U.S. patent application number 10/500184 was filed with the patent office on 2005-08-04 for method of stabilizing protein.
Invention is credited to Sugo, Izumi, Tomonou, Kikuo.
Application Number | 20050171339 10/500184 |
Document ID | / |
Family ID | 19189694 |
Filed Date | 2005-08-04 |
United States Patent
Application |
20050171339 |
Kind Code |
A1 |
Sugo, Izumi ; et
al. |
August 4, 2005 |
Method of stabilizing protein
Abstract
The present inventors revealed that deamidation of an antibody
can be suppressed without influencing its activity by substituting
a glycine that is located adjacent to an asparagine with another
amino acid.
Inventors: |
Sugo, Izumi; (Shizuoka,
JP) ; Tomonou, Kikuo; (Shizuoka, JP) |
Correspondence
Address: |
FISH & RICHARDSON PC
225 FRANKLIN ST
BOSTON
MA
02110
US
|
Family ID: |
19189694 |
Appl. No.: |
10/500184 |
Filed: |
February 28, 2005 |
PCT Filed: |
December 27, 2002 |
PCT NO: |
PCT/JP02/13804 |
Current U.S.
Class: |
530/388.15 |
Current CPC
Class: |
C07K 14/70503 20130101;
A61P 43/00 20180101; C07K 16/36 20130101; C07K 2317/41 20130101;
C07K 1/107 20130101; A61P 7/02 20180101; C07K 16/00 20130101 |
Class at
Publication: |
530/388.15 |
International
Class: |
C07K 016/44 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 28, 2001 |
JP |
2001-400895 |
Claims
1. A method for stabilizing a protein, which comprises the step of
substituting an amino acid that is located adjacent to an amino
acid being deamidated with another amino acid.
2. The method for stabilizing a protein of claim 1, wherein the
amino acid being deamidated is asparagine.
3. The method for stabilizing a protein of claim 1, wherein the
amino acid that is located adjacent to the C-terminal side of the
amino acid being deamidated is glycine.
4. The method for stabilizing a protein of any one of claims 1 to
3, wherein the protein is an antibody.
5. The method for stabilizing a protein of claim 4, wherein the
antibody is humanized antibody.
6. The method for stabilizing a protein of claim 4 or 5, wherein
the amino acid being deamidated exists in the complementary
determining region (CDR).
7. The method for stabilizing a protein of claim 6, wherein the
complementary determining region (CDR) is CDR2.
8. The method for stabilizing a protein of any one of claims 1 to
3, wherein the protein is an antigen binding protein.
9. The method for stabilizing a protein of any one of claims 1 to
3, wherein the protein belongs to the immunoglobulin
superfamily.
10. The method for stabilizing a protein of any one of claims 1 to
3, wherein the protein is a pharmaceutical agent.
11. A protein stabilized by the method of any one of claims 1 to
10.
12. The stabilized protein of claim 11 whose antigen binding
activity is 70% or more of the activity before the amino acid
substitution.
Description
TECHNICAL FIELD
[0001] The present invention relates to a method for improving
protein stability. Specifically, the present invention relates to a
method for stabilizing proteins comprising the step of substituting
the amino acid that is located adjacent to the amino acid being
deamidated in a protein with another amino acid.
BACKGROUND ART
[0002] Gradual deamidation of amino acids, such as asparagine, in
proteins over time is mentioned as a cause of the reduction in
protein stability. When proteins, particularly antibodies, are used
as pharmaceutical agents for various diseases, they are required to
be stable over a long period. However, the activity of antibody
decreases with time. The cause for reduction in activity varies in
antibodies, and deamidation of amino acids, such as asparagine,
comprised in the antibody is also mentioned as one of the
causes.
[0003] Therefore, proteins can be stabilized by suppressing
deamidation of asparagines. Thus, research on suppressing
deamidation of asparagine has been conducted. The substitution of
asparagine with another amino acid by site-directed mutagenesis is
considered the most certain method to prevent deamidation of
proteins. However, this substitution has the potential to influence
protein activity. For example, when the asparagine is located in
the complementary determining region (CDR) of an antibody, such
substitution is reported to affect the antibody binding affinity
(Presta L. et al., Thromb. Haemost. 85: 379-389, 2001). An
anti-human tissue factor (TF) antibody that is expected to inhibit
thrombus formation without inhibiting the extrinsic blood
coagulation reaction via the inhibition of Factor X activation
mediated by TF in the intrinsic blood coagulation reaction is known
in the art (WO 99/51743). However, this antibody has not been
formulated as a pharmaceutical preparation and its activity reduces
over time under antibody destabilizing conditions. The deamidation
of anti-human TF antibody is supposed to be a factor of such
reduction.
[0004] Thus, a method to suppress deamidation of asparagine without
influencing antibody activity has been desired in the art.
DISCLOSURE OF THE INVENTION
[0005] Reduction in protein activity is a very important problem
from the medical and pharmaceutical perspectives. Particularly,
antibodies that are stable for a long time and which can be used as
pharmaceutical agents are clinically desired. To stabilize
antibodies, it is particularly required to suppress deamidation
over time of amino acids such as asparagine, mainly, those readily
deamidated in Asn-Gly sequences.
[0006] Conventionally, methods to suppress deamidation by altering
amino acids in proteins is a useful technique to improve the value,
quality and such of pharmaceuticals. Such methods increase the
option in the formulation of pharmaceutical preparations, and thus
facilitate application of the proteins to various drug forms and
administration routes. Therefore, the purpose of the present
invention is to provide a method to suppress deamidation of
asparagine without influencing the activity of proteins,
particularly antibodies.
[0007] The present inventors diligently conducted research focusing
on anti-human TF antibody, which use as a pharmaceutical is
expected in the art. The antibody was used as an example of a
protein for developing a method to suppress deamidation of
asparagine without affecting the protein activity. First, a mutated
anti-human TF antibody was expressed as a recombinant wherein
asparagine that may be deamidated yet existing in the CDR, is
substituted with aspartic acid. The TF binding activity of
anti-human TF antibody was suggested to decrease significantly due
to the deamidation of Asn54 existing in the CDR2 region of the
anti-human TF antibody heavy chain (H chain). The amino acid
adjacent to Asn54 in the CDR2 region of anti-human TF antibody
heavy chain is Gly55. These two amino acids form a primary sequence
Asn-Gly that is easily deamidated. Therefore, the possibility to
suppress deamidation of Asn54 by substituting this Gly55 with
another amino acid was considered. Thus, the present inventors
prepared mutants wherein the glycine adjacent to the asparagine was
substituted with other amino acids to measure their binding
activities. As a result, it was discovered that the substitution of
glycine that is located adjacent to asparagine with other amino
acids did not reduce the activity, and also suppressed the known
instability due to deamidation.
[0008] Thus, the present inventors found that antibody activity is
uninfluenced by the substitution of glycine that is located
adjacent to asparagine with other amino acids, instead of the
substitution of the asparagine itself, and thereby completed the
present invention.
[0009] Specifically, the present invention provides the
following:
[0010] (1) a method for stabilizing a protein, which comprises the
step of substituting an amino acid that is located adjacent to an
amino acid being deamidated with another amino acid;
[0011] (2) the method for stabilizing a protein of (1), wherein the
amino acid being deamidated is asparagine;
[0012] (3) the method for stabilizing a protein of (1), wherein the
amino acid that is located adjacent to the C-terminal side of the
amino acid being deamidated is glycine;
[0013] (4) the method for stabilizing a protein of any one of (1)
to (3), wherein the protein is an antibody;
[0014] (5) the method for stabilizing a protein of (4), wherein the
antibody is humanized antibody;
[0015] (6) the method for stabilizing a protein of (4) or (5),
wherein the amino acid being deamidated exists in the complementary
determining region (CDR);
[0016] (7) the method for stabilizing a protein of (6), wherein the
complementary determining region (CDR) is CDR2;
[0017] (8) the method for stabilizing a protein of any one of (1)
to (3), wherein the protein is an antigen binding protein;
[0018] (9) the method for stabilizing a protein of any one of (1)
to (3), wherein the protein belongs to the immunoglobulin
superfamily;
[0019] (10) the method for stabilizing a protein of any one of (1)
to (3), wherein the protein is a pharmaceutical agent;
[0020] (11) a protein stabilized by the method of any one of (1) to
(10); and
[0021] (12) the stabilized protein of (11) whose antigen binding
activity is 70% or more of the activity before the amino acid
substitution.
[0022] The terms described in the specification are defined as
follows. However, it should be understood that the definitions are
provided to facilitate understanding of the terms used herein and
are not to be construed as limiting the present invention.
[0023] The term "protein" herein refers to recombinant proteins,
natural proteins and synthetic peptides prepared by artificially
combining amino acids, which proteins and peptides consist of five
amino acids or more. Proteins consist of amino acid sequences
having preferably 14 residues or more, more preferably 30 residues
or more, and much more preferably 50 residues or more.
[0024] The term "antibody" used in the stabilization method of the
present invention is used in the broadest sense, and includes
monoclonal antibodies (including full-length monoclonal
antibodies), polyclonal antibodies, mutant antibodies, antibody
fragments (for example, Fab, F(ab').sub.2 and Fv) and multispecific
antibodies (for example, bispecific antibodies) as long as they
have the desired biological activity. Antibodies (Ab) and
immunoglobulins (Ig) are glycoproteins that share the same
structural features. Antibodies show a specific binding ability to
a certain antigen, while immunoglobulins include antibodies and
other antibody-like molecules that lack antigen specificity.
Natural antibodies and immunoglobulins are generally
heterotetramers of about 150,000 Daltons consisting of 2 identical
light chains (L chains) and 2 identical heavy chains (H chains).
Each of the light chain is connected to a heavy chain through a
single covalent disulfide bond. However, the number of disulfide
bonds between the heavy chains varies depending on the isotype of
the immunoglobulin. Both of the heavy and light chains further have
intramolecular disulfide bridges at constant distance. Each of the
heavy chain has a variable region (V.sub.H) at one end and many
constant regions connected thereto. Each of the light chain has a
variable region (V.sub.L) at one end and a constant region at the
other end. The constant region and the variable region of the light
chain are placed side-by-side to the first constant region and the
variable region of the heavy chain, respectively. Specific amino
acid residues are considered to form the interface of the variable
region of the light and heavy chains (Chothia C. et al. J. Mol.
Biol. 186: 651-663, 1985; Novotny J., Haber E., Proc. Natl. Acad.
Sci. USA 82: 4592-4596, 1985).
[0025] The light chains of antibodies (immunoglobulins) derived
from vertebrate species can be divided into two clearly distinct
types called kappa (.kappa.) and lambda (.lambda.), based on the
amino acid sequence of the constant region. In addition, an
"immunoglobulin" can be classified into different classes based on
the amino acid sequence of the constant region of the heavy chain.
At least five major classes exist for immunoglobulins: IgA, IgD,
IgE, IgG and IgM. Furthermore, some of them can be further
classified into subclasses (isotypes), for example, IgG-1, IgG-2,
IgG-3 and IgG-4, and IgA-1 and IgA-2. The heavy chain constant
regions of the different classes are called .alpha., .delta.,
.epsilon., .gamma. and .mu., respectively. The subunit structures
and three-dimensional structures of immunoglobulins of each class
are well known.
[0026] Herein, the phrase "monoclonal antibody" refers to an
antibody obtained from a group of substantially homogeneous
antibodies, i.e., an antibody group wherein the antibodies
constituting the group are homogeneous except for naturally
occurring mutants that exist in a small amount. A monoclonal
antibody is highly specific and interacts with a single antigenic
site. Furthermore, each monoclonal antibody targets a single
antigenic determinant (epitope) on an antigen, as compared to
common (polyclonal) antibody preparations that typically contain
various antibodies against diverse antigenic determinants. In
addition to their specificity, monoclonal antibodies are
advantageous in that they are produced from hybridoma cultures not
contaminated with other immunoglobulins.
[0027] The qualifier "monoclonal" indicates the characteristics of
antibodies obtained from a substantially homogeneous group of
antibodies, and does not require that the antibodies be produced by
a particular method. For example, the monoclonal antibody used in
the present invention can be produced by, for example, the
hybridoma method (Kohler G. and Milstein C., Nature 256: 495-497,
1975) or the recombination method (U.S. Pat. No. 4,816,567). The
monoclonal antibodies used in the present invention can be also
isolated from a phage antibody library (Clackson T. et al., Nature
352: 624-628, 1991; Marks J. D. et al., J. Mol. Biol. 222:581-597,
1991). The monoclonal antibodies in the present specification
particularly include "chimeric" antibodies (immunoglobulins)
wherein a part of the heavy chain and/or light chain is derived
from a specific species, or a specific antibody class or subclass
and the remaining portion of the chain from another species, or
another antibody class or subclass. Furthermore, as long as they
have the desired biological activity, antibody fragments thereof
are also included in the present invention (U.S. Pat. No.
4,816,567; Morrison S. L. et al., Proc. Natl. Acad. Sci. USA 81:
6851-6855, 1984).
[0028] The phrase "mutant antibody" refers to amino acid sequence
variants of antibodies wherein one or more amino acid residues are
altered. The "mutant antibody" herein includes variously altered
amino acid variants as long as they have the same binding
specificity as the original antibody. Such mutants have less than
100% homology or similarity to the amino acid sequence that has at
least 75%, more preferably at least 80%, even more preferably at
least 85%, still more preferably at least 90%, and most preferably
at least 95% amino acid sequence homology or similarity to the
amino acid sequence of the variable region of the heavy chain or
light chain of an antibody. The method of the present invention is
equally applicable to both polypeptides, antibodies and antibody
fragments; therefore, these terms are often used
interchangeably.
[0029] The phrase "antibody fragment" refers to a part of a
full-length antibody and generally indicates an antigen-binding
region or a variable region. For example, antibody fragments
include Fab, Fab', F(ab').sub.2 and Fv fragments. Papain digestion
of an antibody produces two identical antigen-binding fragments
called Fab fragments each having an antigen-binding region, and a
remaining fragment called "Fc" since it crystallizes easily. On the
other hand, by the digestion with pepsin, a F(ab').sub.2 fragment
(which has two antigen-binding sites and can cross bind antigens)
and the remaining other fragment (called pFc') are obtained. Other
fragments include diabody (diabodies), linear antibodies,
single-chain antibodies, and multispecific antibodies formed from
antibody fragments. In this specification, "functional fragment" of
an antibody indicates Fv, F(ab) and F(ab').sub.2 fragments.
[0030] Herein, an "Fv" fragment is the smallest antibody fragment
and contains a complete antigen recognition site and a binding
site. This region is a dimmer (V.sub.H-V.sub.L dimmer) wherein the
variable regions of each of the heavy chain and light chain are
strongly connected by a noncovalent bond. The three CDRs of each of
the variable regions interact with each other to form an
antigen-binding site on the surface of the V.sub.H-V.sub.L dimmer.
Six CDRs confer the antigen-binding site of an antibody. However, a
variable region (or a half of Fv which contains only three CDRs
specific to an antigen) alone has also the ability to recognize and
bind an antigen although its affinity is lower than the affinity of
the entire binding site.
[0031] Moreover, a Fab fragment (also referred to as F(ab)) further
includes the constant region of the light chain and a constant
region (C.sub.H1) of the heavy chain. An Fab' fragment differs from
the Fab fragment in that it additionally has several residues
derived from the carboxyl end of the heavy chain C.sub.H1 region
which contains one or more cysteines from the hinge domain of the
antibody. Fab'-SH indicates an Fab' wherein one or more cysteine
residues of the constant region has a free thiol-group. The F(ab')
fragment is produced by the cleavage of disulfide bonds between the
cystines in the hinge region of the F(ab').sub.2 pepsin digest.
Other chemically bound antibody fragments are also known by those
skilled in art.
[0032] The term "diabody (diabodies)" refers to a small antibody
fragment having two antigen-binding sites, and the fragment
contains V.sub.H-V.sub.L wherein the heavy chain variable region
(V.sub.H) is connected to the light chain variable region (V.sub.L)
in the same polypeptide chain. When a short linker is used between
the two regions so that the two regions cannot be connected
together in the same chain, these two regions form pairs with the
constant regions in another chain to create two antigen-binding
sites. The diabody is described in detail in, for example, European
patent No. 404,097, WO 93/11.161 and Holliger P. et al. (Proc.
Natl. Acad. Sci. USA 90: 6444-6448, 1993).
[0033] A single-chain antibody (hereafter also referred to as
single-chain Fv or sFv) or sFv antibody fragment contains the
V.sub.H and V.sub.L regions of an antibody, and these regions exist
on a single polypeptide chain. Generally, an Fv polypeptide further
contains a polypeptide linker between the V.sub.H and V.sub.L
regions, and therefore an sFv can form a structure necessary for
antigen binding. See, Pluckthun "The Pharmacology of Monoclonal
Antibodies" Vol. 113 (Rosenburg and Moore eds. (Springer Verlag,
New York) pp. 269-315, 1994) for the review of sFv.
[0034] A multispecific antibody is an antibody that has specificity
to at least two different kinds of antigens. Although such a
molecule usually binds to two antigens (i.e., a bispecific
antibody), the "multispecific antibody" herein encompasses
antibodies that has specificity to more than two antigens (for
example, three antigens). The multispecific antibody can be a
full-length antibody or fragments thereof (for example,
F(ab').sub.2 bispecific antibody).
[0035] The phrase "humanized antibody" in the present invention is
an antibody produced by genetic engineering. Specifically, it
refers to an antibody characterized by a structure wherein a part
of or the entire CDR of the hypervariable region is derived from
that of a monoclonal antibody of a non-human mammal (mouse, rat,
hamster, etc.), and the framework region of the variable region and
constant region are those derived from human immunoglobulin.
Herein, the CDR of a hypervariable region refers to the three
regions (CDR1, CDR2 and CDR3) directly binding to an antigen in a
complementary manner and that exist in the hypervariable region of
the variable region of an antibody. Whereas, the framework region
of a variable region refers to the relatively conserved four
regions (framework regions; FR1, FR2, FR3 and FR4) which intervene
between the three above-mentioned CDR regions. Specifically, the
"humanized antibody" in the present invention refers to antibodies
wherein all regions except a part or the entire CDR of the
hypervariable region of a monoclonal antibody derived from a
non-human mammal is replaced with a corresponding region of a human
immunoglobulin.
[0036] Furthermore, a humanized antibody may contain residues that
do not exist in either the recipient antibody or the introduced CDR
or the framework sequence. Such alterations are performed to
precisely optimize the capability of the antibody. Generally, all
humanized antibodies essentially contain at least one, typically
two variable regions. In the antibody, all or essentially all of
the CDR regions correspond to the CDR of a non-human
immunoglobulin, and all or essentially all of the FRs are derived
from a human immunoglobulin variable region. Optimally, the
humanized antibody further may contain typically at least a part of
the constant region of a human immunoglobulin. More details can be
found in Jones P. T. et al. (Nature 321: 522-525, 1986), Riechmann
L. et al. (Nature 332: 323-327, 1988) and Presta et al. (Curr. Op.
Struct. Biol. 2: 593-596, 1992).
[0037] The term "variable" in the antibody variable region
indicates that a certain region in the variable region highly
varies among antibodies, and that the region is responsible for the
binding and specificity of respective antibodies to their specific
antigens. The variable regions are concentrated in three areas
called CDR or hypervariable region within the variable regions of
light and heavy chains. There are at least two methods to determine
the CDR: (1) a technique based on sequence variation among species
(i.e., Kabat et al., "Sequence of Proteins of Immunological
Interest" (National Institute of Health, Bethesda) 1987); and (2) a
technique based on crystallographic research of antigen-antibody
complex (Chothia C. et al., Nature 342: 877-883, 1989). The area
more highly conserved in the variable region is called FR. The
variable regions of natural heavy and light chains mainly have
.beta.-sheet structures and form three loop-like connections, and
in some cases, contain four FRs connected by CDRs that form a
.beta.-sheet structure. The CDRs in each chain is maintained very
closely to the CDRs on the other chain by FRs and plays a role in
the formation of the antigen-binding site of an antibody (see,
Kabat et al.). The constant region does not directly participate in
the binding of the antibody to the antigen. However, it shows
various effector functions, such as participation of the antibody
in antibody dependent cytotoxicity.
[0038] The constant region of a human immunoglobulin has a unique
amino acid sequences for each isotype, such as IgG (IgG1, IgG2,
IgG3 and IgG4), IgM, IgA, IgD and IgE. In the present invention,
the constant region of the above-mentioned humanized antibody may
be of any isotype. Preferably, the constant region of human IgG is
used. Moreover, there is no limitation on the FR of the variable
region derived from a human immunoglobulin.
[0039] The term "antigen" in the present specification encompasses
both complete antigens having immunogenicity and incomplete
antigens (including haptens) without immunogenicity. Antigens
include substances such as proteins, polypeptides, polysaccharides,
nucleic acids and lipids; however, they are not limited thereto. As
immunogens for antibody production, soluble antigens or fragments
thereof connected to other molecules may be used. In the interest
of transmembrane molecules, such as receptors, fragments thereof
(for example, extracellular regions of receptors) may be used as
immunogens. Alternatively, cells expressing transmembrane molecules
may be used as immunogens. Such cells may be natural cells (for
example, tumor cell lines) or cells transfected by recombinant
techniques to express the transmembrane molecules. Any form of
antigen known to those skilled in the art can be used to produce
antibodies.
[0040] Herein, the phrase "antigen-binding protein" refers to
proteins that have the ability to bind to an antigen.
[0041] The phrase "immunoglobulin superfamily" in the present
specification refers to proteins that have the structural
characteristic wherein one or multiple domains homologous to the
constant or variable domain of an immunoglobulin are contained. The
immunoglobulin superfamily includes the immunoglobulin (H chain and
L chain), T cell receptor (.alpha. chain, .beta. chain, .gamma.
chain and .delta. chain), MHC class I molecule (.alpha. chain),
.beta..sub.2 microglobulin, MHC class II molecule (.alpha. chain
and .beta. chain), CD3 (.gamma. chain, .delta. chain and .epsilon.
chain), CD4, CD8 (.alpha. chain and .beta. chain), CD2, CD28,
LFA-3, ICAM-1, ICAM-2, VCAM-1, PECAM-1, F.sub.c receptor II, poly
Ig receptor, Thy-1, NCAM, myelin-associated glycoprotein (MAG), Po,
carcinoembryonic antigen (CEA), PDGF receptor and so on.
[0042] The phrase "pharmaceutical agent" in the present
specification refers to substances that are administered to animals
for purposes such as treatment or prevention of diseases, injuries
and such, or improvement of health conditions.
[0043] 1. Amino Acid Alternation for Protein Stabilization
[0044] The present invention provides a method for stabilizing a
protein wherein an amino acid adjacent to an amino acid being
deamidated in the protein is substituted with another amino acid.
The protein to be stabilized according to the present invention is
not restricted in any way. A suitable example of the protein
includes antibodies. Humanized antibodies or human antibodies are
preferred as the antibody from the aspect of medical use.
[0045] In addition to asparagine, glutamine is also known as an
amino acid that is deamidated (Scotchler J. W. and Robinson A. B.,
Anal. Biochem. 59: 319-322, 1974). When comparing peptides of 5
amino acids, the half-life of glutamine is 96 to 3409 days compared
to the half-life of asparagine being 6 to 507 days. Namely, the
reaction rate of deamidation of glutamine is very slow compared
with that of asparagine (Bischoff R. and Kolbe H. V. J., J.
Chromatogr. B. 662: 261-278, 1994). Deamidation of glutamine has
not been detected in antibody preparations (Harris R. J., Kabakoff
B., Macchi F. D., Shen F. J., Kwong M., Andya J. D. et al., J.
Chromatogr. B. 752: 233-245, 2001). However, the deamidation
reaction is supposed to be enhanced in vivo than in pharmaceutical
preparations (Robinson N. E. and Robinson A. B., Proc. Natl. Acad.
Sci. USA 98: 12409-12413, 2001). Therefore, to develop an antibody
preparation with a long in vivo half-life, suppression of
deamidation of glutamine, in addition to asparagine is considered
to be necessary. The amino acid to be deamidated preferably is
asparagine.
[0046] Amino acids other than glycine can be also considered as the
amino acid adjacent to an deamidated amino acid and that can be
substituted in a protein (Robinson N. E. and Robinson A. B., Proc.
Natl. Acad. Sci. USA 98: 4367-4372, 2001). However, glycine is
particularly known to cause deamidation of asparagine. Thus, the
amino acid that is located adjacent to an amino acid that is
deamidated preferably is glycine.
[0047] Generally, an antibody is inactivated by amino acid
substitution in the CDR. However, the present inventors revealed
that the activity of an antibody is retained even after the
substitution of an amino acid adjacent to asparagine in the CDR,
and hence the stability of the antibody can be improved. Therefore,
according to the present invention, an amino acid adjacent to an
asparagine in the CDR is effectively substituted with another amino
acid. Glycine is a suitable target as the amino acid adjacent to
the asparagine. Particularly, glycine contained in the "Asn-Gly"
sequence that is particularly easily deamidated is the most
suitable target.
[0048] According to the present invention, in addition to the amino
acid adjacent to the above-mentioned deamidated amino acid, one or
more of other amino acids can also be altered unless the stability
and biological activity of the protein is reduced. When the protein
is an antibody, biological activity indicates its activity to
specifically bind to antigen. A preferred amino acid alternation is
a conservative substitution from the viewpoint to maintain the
property of the protein.
[0049] The alteration of an amino acid of a protein can be
performed by methods to recombine the gene sequence encoding the
protein. Techniques generally known in the art can be used for gene
recombination.
[0050] When the protein is an antibody, the alteration of amino
acids can be performed as follows. For example, variant antibodies
or mutants wherein one or more amino acid residues are altered in
one or more of the hypervariable regions of the antibody can be
prepared. In addition, one or more mutations (for example,
substitution) can be introduced into the framework residues of the
mammalian antibody to improve the binding affinity of the mutant
antibody to its antigen. Exemplary framework residues that can be
altered include portions that directly bind to antigens by
noncovalent bonds (Amit A. G. et al., Science 233: 747-753, 1986),
portions that affect and/or influence the structure of the CDR
(Chothia C. and Lesk A. M., J. Mol. Biol. 196: 901-917, 1987)
and/or portions that are involved in the VL-VH interaction
(European patent No. 239,400, B1). According to an embodiment, the
binding affinity of an antibody to an antigen is enhanced by
altering one or more of such framework residues.
[0051] One useful method for producing mutant antibodiesis
"Alanine-Scanning Mutagenesis" (Cunningham B. C. and Wells J. A.,
Science 244: 1081-1085, 1989; Cunningham B. C. and Wells J. A.,
Proc. Natl. Acad. Sci. USA 84: 6434-6437, 1991). According to this
method, one or more residues of the hypervariable region are
substituted with alanine or polyalanine residues to change the
interaction between the antigen and the corresponding amino acids.
The residues of the hypervariable region that showed functional
sensitivity to the substitution are further distinguished in more
detail by introducing further or other mutation to the substitution
site. Therefore, although the site to introduce an amino acid
sequence mutation is determined beforehand, the type of mutation
does not have to be determined beforehand.
[0052] The ala mutant produced by this method is screened for its
biological activity. Depending on the desired characteristics
obtained by the scanned residues, a similar substitution of other
amino acids may also be performed. Alternatively, there is also a
method wherein the altered amino acid residue is more
systematically identified. According to this method, the
hypervariable region residues within a species-specific antibody
involved in the binding of a first mammalian species antigen and
the hypervariable region residues involved in the binding of a
homologous antigen of a second mammalian species can be identified.
In order to achieve this, Alanine-scanning is performed for the
hypervariable region residues of the species-specific antibody. In
the scanning, the binding of each ala mutant to the first and
second mammalian species antigen is tested in order to identify (1)
the hypervariable region residues involved in the binding of the
first mammalian species (for example, human) antigen and (2) the
site involved in the binding of the second mammalian species (for
example, non-human) antigen homolog. Preferably, residues that are
apparently involved in the binding of the second mammalian species
(for example, non-human mammalian) derived-antigen but not in the
binding of the first mammalian species (for example, human)
derived-antigen are candidates for alteration. In another
embodiment, residues that are clearly involved in the binding of
the first and second mammalian species derived-antigens are
selected for alteration. The alteration includes deletion of the
residues and insertion wherein one or more residues are linked to
the target residues; however, generally, alteration refers to
substitution of the residues with other amino acids.
[0053] A nucleic acid molecule encoding an amino acid sequence
mutant may be prepared by various methods known in the art. Such
methods include, but are not limited to, oligo nucleotide mediated
mutation (or site-specific mutation), PCR mutation or cassette
mutation of a previously produced mutated or a non-mutated version
of a species-specific antibody. Suitable methods for producing
mutants include site-specific mutation (see Kunkel T. A., Proc.
Natl. Acad. Sci. USA 82: 488-492, 1985) and such. Generally, mutant
antibodies having improved biological characteristics have at least
75%, preferably at least 80%, more preferably at least 85%, further
more preferably at least 90% and most preferably at least 95% amino
acid sequence homology or similarity with the amino acid sequence
of the variable region of the heavy or light chain of the original
antibody. Sequence homology or similarity in the present
specification is defined as the rate of the amino acid residues
which are homologous (i.e., the same residues) or similar (i.e.,
the amino acid residues of the same group based on the
above-mentioned general side chain characteristic) to the residues
in the species specific antibody of the candidate sequence after
alignment of the sequence and introducing a gap as needed in order
to obtain the maximum sequence homology.
[0054] Alternatively, a mutant antibody can be constructed by
systematic mutations of the CDR in the heavy and light chains of an
antibody. Preferable methods for constructing such a mutant
antibody include methods utilizing affinity maturation using phage
display (Hawkins R. E. et al, J. Mol. Biol. 226: 889-896, 1992;
Lowman H. B. et al, Biochemistry 30: 10832-10838, 1991).
Bacteriophage coat protein fusion (Smith G. P., Science
228:1315-1317, 1985; Scott J. K. and Smith G. P., Science 249:
386-390, 1990; Cwirla S. E. et al., Proc. Natl. Acad. Sci. USA 87:
6378-6382, 1990; Devlin J. J. et al., Science 249: 404-406, 1990;
review by Wells and Lowman, Curr. Opin. Struct. Biol. 2:597, 1992;
U.S. Pat. No. 5,223,409) is known as a useful method to relate a
displayed phenotype protein or peptide with the genotype of the
bacteriophage particle encoding it. Moreover, a method to display
the F(ab) region of an antibody on the surface of a phage is also
known in the art (McCafferty et al., Nature 348:552, 1990; Barbas
et al., Proc. Natl. Acad. Sci. USA 88:7978, 1991; Garrard et al.,
Biotechnology 9:1373, 1991). Monovalent phage display comprises the
step of displaying a group of protein variants as fusions with a
coat protein of the bacteriophage yet that only one copy of the
variant is displayed on a few phage particles (Bass et al, Proteins
8:309, 1990).
[0055] Affinity maturation or improvement of equilibrium of the
binding affinity of various proteins has been performed hitherto by
mutagenesis, monovalent phage display, functional analysis and
addition of desirable mutations of, for example, human growth
hormone (Lowman and Wells, J. Mol. Biol. 234: 564-578, 1993; U.S.
Pat. No. 5,534,617) and antibody F(ab) region (Barbas et al., Proc.
Natl. Acad. Sci. USA 91:3809, 1994; Yang et al., J. Mol. Biol.
254:392, 1995). A library of many protein variants (10.sup.6
molecules) different at specific sequence sites can be prepared on
the surface of bacteriophage particles that contain DNAs encoding
specific protein variants. The displayed amino acid sequence can be
predicted from DNA by several cycles of affinity purification using
immobilized antigen followed by isolation of respective
bacteriophage clones.
[0056] 2. Production of Polyclonal Antibodies
[0057] Polyclonal antibodies are preferably produced in non-human
mammals by multiple subcutaneous (sc) or intraperitoneal (ip)
injections of related antigen and adjuvant. The related antigen may
be bound to a protein that is immunogenic to the immunized species,
for example, keyhole limpet hemocyanin, serum albumin, bovine
thyroglobulin or soybean trypsin inhibitor, using bifunctional
agents or inducers, for example, maleimidebenzoylsulfosuccinimide
ester (binding via a cysteine residue), N-hydroxysuccinimide (via a
lysine residue), glutaraldehyde, succinic anhydride,
thionylchloride or R.sup.1N.dbd.C.dbd.CR (wherein, R and R.sup.1
are different alkyl groups).
[0058] For example, an animal is immunized against an antigen, an
immunogenic conjugate or a derivative through multiple endermic
injections of solution containing 100 .mu.g or 5 .mu.g of protein
or conjugate (amount for a rabbit or a mouse, respectively) with 3
volumes of Freund's complete adjuvant. One month later, a booster
is applied to the animal through subcutaneous injections of 1/5 to
{fraction (1/10)} volume of the original peptide or conjugate in
Freund's complete adjuvant at several sites. Blood is collected
from the animal after 7 to 14 days and serum is analyzed for
antibody titer. Preferably, a conjugate of the same antigen but
that is bound to a different protein and/or bound via a different
cross-linking reagent is used as the booster. A conjugate can be
also produced by protein fusion through recombinant cell culture.
Moreover, in order to enhance immune response, agglutinins, such as
alum, are preferably used. The selected mammalian antibody usually
has a binding affinity strong enough to the antigen. The affinity
of an antibody can be determined by saturation bonding,
enzyme-linked immunosorbent assay (ELISA) and competitive analysis
(for example, radioimmunoassay).
[0059] As a method of screening for desirable polyclonal
antibodies, conventional cross-linking analysis described in
"Antibodies, A Laboratory Manual" (Harlow and David Lane eds., Cold
Spring Harbor Laboratory, 1988) can be performed. Alternatively,
for example, epitope mapping (Champe et al., J. Biol. Chem. 270:
1388-1394, 1995) may be performed. Preferred methods for measuring
the efficacy of a polypeptide or antibody include a method using
the quantitation of the antibody binding affinity. Other
embodiments include methods wherein one or more of the biological
properties of an antibody are evaluated instead of the antibody
binding affinity. These analytical methods are particularly useful
in that they indicate the therapeutic efficacy of an antibody.
Antibodies that show improved properties through such analysis have
also generally, but not always, enhanced binding affinity.
[0060] 3. Production of Monoclonal Antibodies
[0061] A monoclonal antibody is an antibody that recognizes a
single antigen site. Due to its uniform specificity, a monoclonal
antibody is generally useful than a polyclonal antibody which
contains antibodies recognizing many different antigen sites. A
monoclonal antibody can be produced by the hybridoma method (Kohler
et al., Nature 256:495, 1975), the recombinant DNA method (U.S.
Pat. No. 4,816,567), and so on.
[0062] According to the hybridoma method, a suitable host animal,
such as mouse, hamster or rhesus monkey, is immunized similar as
described above to produce antibodies that specifically bind to a
protein used for immunization or to induce lymphocytes producing
the antibodies. Alternatively, a lymphocyte may be immunized in
vitro. Then, the lymphocyte is fused with a myeloma cell using
suitable fusion agents, such as polyethylene glycol, to generate a
hybridoma cell (Goding, "Monoclonal Antibodies: Principals and
Practice", Academic Press, pp. 59-103, 1986). Preferably, the
produced hybridoma cell is seeded and cultured on a proper culture
media containing one or more substances that inhibit proliferation
or growth of unfused parental myeloma cells. For example, when the
parental myeloma cell lacks the hypoxantin guanine phosphoribosyl
transferase enzyme (HGPRT or HPRT), the culture media for the
hybridoma typically contains substances that inhibit the growth of
HGRPT deficient cells, i.e., hypoxantin, aminopterin and thymidine
(HAT culture media).
[0063] Preferred myeloma cells include those that can efficiently
fuse, produce antibodies at a stable high level in selected
antibody producing cells, and are sensitive to media such as HAT
media. Among the myeloma cell lines, preferred myeloma cell lines
include mouse myeloma cell lines, such as mouse tumor derived cells
MOPC-21 and MPC-11 (obtained from Salk Institute Cell Distribution
Center, San Diego, USA), and SP-2 and X63-Ag8-653 cells (obtained
from the American Type Culture Collection, Rockville, USA). Human
myeloma and mouse-human heteromycloma cell lines have also been
used for the production of human monoclonal antibodies (Kozbar, J.
Immunol. 133:3001, 1984; Brodeur et al., "Monoclonal Antibody
Production Techniques and Application", Marcel Dekker Inc, New
York, pp. 51-63, 1987).
[0064] Next, the production of monoclonal antibodies against an
antigen in the culture media wherein the hybridoma cells had been
cultured is analyzed. Preferably, the binding specificity of the
monoclonal antibody produced from the hybridoma cells is measured
by in vitro binding assay, such as immunoprecipitation,
radioimmunoassay (RIA) or enzyme-linked immunosorbent assay
(ELISA). After identifying the hybridoma cells that produce
antibodies having the desired specificity, affinity and/or
activity, clones are subcloned by limiting dilution method and
cultured by standard protocols (Goding, "Monoclonal Antibodies:
Principals an Practice", Academic Press, pp. 59-103, 1986). Culture
media suitable for this purpose include, for example, DMEM and
RPMI-1640. Furthermore, a hybridoma cell can also be grown as
ascites tumor in an animal in vivo. Monoclonal antibodies secreted
from a subclone are preferably purified from culture media, ascites
or serum via conventional immunoglobulin purification methods, such
as protein A-Sepharose, hydroxyapatite chromatography, gel
electrophoresis, dialysis or affinity chromatography.
[0065] DNA encoding a monoclonal antibody can be easily isolated
and sequenced by conventional methods, for example, using an oligo
nucleotide probe specifically binding to genes encoding the heavy
and light chains of the monoclonal antibody. Hybridoma cells are
preferred starting materials for obtaining such DNAs. Once the DNA
is isolated, it is inserted into an expression vector and
transformed into a host cell, such as E. coli cell, simian COS
cell, Chinese hamster ovary (CHO) cell or myeloma cell, that
produce no immunoglobulin protein unless being transformed, and
monoclonal antibody is produced from the recombinant host cell. In
another embodiment, an antibody or an antibody fragment can be
isolated from an antibody phage library prepared by the method
described by McCafferty et al. (Nature 348: 552-554, 1990).
Clackson et al. (Nature 352: 624-628, 1991) and Marks et al. (J.
Mol. Biol. 222: 581-597, 1991) describe the isolation of mouse and
human antibodies using phage libraries, respectively. The following
references describe the production of high affinity (nM range)
human antibody by chain shuffling (Marks et al, Bio/Technology 10:
779-783, 1992), and combinatorial infection and in vivo
recombination for producing large phage libraries (Waterhouse et
al, Nucl. Acids Res. 21: 2265-2266, 1993). These techniques can
also be used to isolate monoclonal antibodies in place of
conventional monoclonal antibody hybridoma techniques.
[0066] DNA can be also altered by, for example, substitution of
corresponding mouse sequences with the coding sequences of the
constant regions of human heavy and light chains (U.S. Pat. No.
4,816,567; Morrison et al, Proc. Natl. Acad. Sci. USA 81:6851,
1984), or by binding immunoglobulin polypeptides through covalent
bonds. Typically, these non-immunoglobulin polypeptides are
substituted with the constant region of an antibody or the variable
region of the antibody antigen-binding site is substituted to
construct a chimeric bispecific antibody that has an
antigen-binding site specific for an antigen and another
antigen-binding site specific for another antigen.
[0067] 4. Production of Antibody Fragments
[0068] Hitherto, antibody fragments have been produced by digesting
natural antibody with proteases (Morimoto et al., J. Biochem.
Biophys. Methods 24: 107-117, 1992; Brennan et al., Science 229:81,
1985). However, today, they can also be produced by recombinant
techniques. For example, antibody fragments can also be isolated
from the above-mentioned antibody phage library. Furthermore,
F(ab').sub.2-SH fragments can be directly collected from a host
cell such as E. coli, and chemically bound in the form of
F(ab').sub.2 fragment (Carter, et al., Bio/Technology 10: 163-167,
1992). Moreover, in another method, F(ab').sub.2 fragment can also
be directly isolated from recombinant host cell culture. The method
for constructing single chain antibodies, fragments of single chain
antibodies and such are well known in the art (for example, see,
U.S. Pat. No. 4,946,778; U.S. Pat. No. 5,260,203; U.S. Pat. No.
5,091,513; U.S. Pat. No. 5,455,030; etc.).
[0069] 5. Production of Multispecific Antibodies
[0070] Methods for producing multispecific antibodies are known in
the art. The production of a full-length bispecific antibody
includes the step of co-expression of two immunoglobulin
heavy-light chains having different specificity (Millstein et al.,
Nature 305: 537-539, 1983). The heavy and light chains of
immunoglobulins are randomly combined, and therefore, the obtained
multiple co-expressing hybridomas (quadroma) are a mixture of
hybridomas each expressing a different antibody molecule. Thus, the
hybridoma producing the correct bispecificity antibody has to be
selected among them. The selection can be performed by methods such
as affinity chromatography. Furthermore, according to another
method, the variable region of an antibody having the desired
binding specificity is fused to the constant region sequence of an
immunoglobulin. The above-mentioned constant region sequence
preferably contains at least a part of the hinge, CH2 and the CH3
regions of the heavy chain constant region of the immunoglobulin.
Preferably, the CH1 region of the heavy chain required for the
binding with the light chain is further included. DNA encoding the
immunoglobulin heavy chain fusion is inserted into an expression
vector to transform a proper host organism. If needed, DNA encoding
the immunoglobulin light chain is also inserted into an expression
vector different to that of the immunoglobulin heavy chain fusion
to transform the host organism. There are cases where the antibody
yield increases when the ratio of the chains is not identical. In
such cases, it is more convenient to insert each of the genes into
separate vectors since the expression ratio of each of the chains
can be controlled. However, genes encoding plural chains can also
be inserted into a vector.
[0071] According to a preferred embodiment, a bispecific antibody
is desired wherein a heavy chain having a first binding specificity
exists as an arm of the hybrid immunoglobulin and a heavy
chain-light chain complex having another binding specificity exists
as the other arm. Due to the existence of the light chain only on
one of the arms, the bispecific antibody can be readily isolated
from other immunoglobulins. Such a separation method is referred to
in WO 94/04690. See, Suresh et al. (Methods in Enzymology 121:210,
1986) for further reference of methods for producing bispecific
antibodies. A method wherein a pocket corresponding to a bulky side
chain of a first antibody molecule is created in a multispecific
antibody that comprises the antibody constant region CH3 (WO
96/27011) is also known as a method for decreasing homodimers to
increase the ratio of heterodimers in the final product obtained
from recombinant cell culture. According to the method, one of the
antibody molecules is altered at one or more amino acids on the
surface that binds to the other molecule to amino acids having a
bulky side chain (e.g., tyrosine or tryptophan). Furthermore, amino
acids with a bulky side chain in the corresponding portion of the
other antibody molecule is altered to amino acids with a small side
chain (e.g., alanine or threonine).
[0072] Bispecific antibodies include, for example, heteroconjugated
antibodies wherein one antibody is bound to avidin and the other to
biotin and such (U.S. Pat. No. 4,676,980, WO 91/00360, WO 92/00373,
European patent No. 03089). Cross-linkers used for the production
of such heteroconjugated antibodies are well known, and are
mentioned, for example in U.S. Pat. No. 4,676,980.
[0073] Additionally, methods for producing bispecific antibodies
from antibody fragments have been also reported. For example,
bispecific antibodies can be produced utilizing chemical bonds. For
example, first, F(ab').sub.2 fragments are produced and the
fragments are reduced in the presence of dithiol complexing agent,
sodium arsanilate, to prevent intramolecular disulfide formation.
Next, the F(ab').sub.2 fragments are converted to thionitrobenzoate
(TNB) derivatives. After re-reducing one of the F(ab').sub.2-TNB
derivatives to a Fab'-thiol using mercaptoethanolamine, equivalent
amounts of the F(ab').sub.2-TNB derivative and Fab'-thiol are mixed
to produce a bispecific antibody.
[0074] Various methods have been reported to directly produce and
isolate bispecific antibodies from recombinant cell culture. For
example, a production method for bispecific antibodies using a
leucine zipper has been reported (Kostelny et al., J. Immunol.
148:1547-1553, 1992). First, leucine zipper peptides of Fos and Jun
proteins are connected to the Fab' sites of different antibodies by
gene fusion, the homodimer antibodies are reduced at the hinge
region to form monomers, followed by reoxidation to form a
heterodimer antibody. Alternatively, a method to form two
antigen-binding sites wherein pairs are formed between different
complementary light chain variable regions (VL) and heavy chain
variable regions (VH) by linking the VL and VH through a linker
that is short enough to prevent binding between these two regions
(Hollinger et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448, 1993).
Furthermore, dimers utilizing single chain Fv (sFV) have also been
reported (Gruger et al., J. Immunol. 152:5368, 1994). Moreover,
trispecific (rather than bispecific) antibodies have also been
reported (Tutt et al., J. Immunol. 147:60, 1991).
[0075] 6. Production of Humanized Antibodies
[0076] Humanized antibodies can be obtained via established general
antibody production methods by immunizing a human antibody
producing transgenic non-human mammal with an immunogen (antigen).
Methods for producing human antibody producing non-human mammals,
particularly human antibody producing transgenic mice, are known in
the art (Nature Genetics 7: 13-21, 1994; Nature Genetics 15:
146-156, 1997; Published Japanese Translation of International
Publication No. Hei 4-504365; Published Japanese Translation of
International Publication No. Hei 7-509137; Nikkei Science 6:
40-50, 1995; WO 94/25585; Nature 368: 856-859, 1994; Published
Japanese Translation of International Publication No. Hei 6-500233;
etc.). Specifically, the human antibody producing transgenic
non-human mammal can be produced by the following steps:
[0077] (1) producing a knockout non-human mammal wherein the
endogenous immunoglobulin heavy chain gene of the animal is
functionally inactivated via the substitution of at least a part of
the endogenous immunoglobulin heavy chain locus of the non-human
mammal with a drug resistance marker gene (for example, neomycin
resistance gene) by homologous recombination;
[0078] (2) producing a knockout non-human mammal wherein the
endogenous immunoglobulin light chain gene (particularly, the
.kappa. chain gene) of the animal is functionally inactivated via
the substitution of at least a part of the endogenous
immunoglobulin light chain locus of the non-human mammal with a
drug resistance marker gene (for example, neomycin resistance gene)
by homologous recombination;
[0079] (3) producing a transgenic non-human mammal wherein a
desired region of the human immunoglobulin heavy chain locus has
been integrated into the mouse chromosome using a vector
represented by yeast artificial chromosome (YAC) vector and such
that can transfer large genes;
[0080] (4) producing a transgenic non-human mammal wherein a
desired region of the human immunoglobulin light chain
(particularly, the .kappa. chain) locus has been integrated into
the mouse chromosome using a vector represented by YAC vector and
such that can transfer large genes; and
[0081] (5) producing a transgenic non-human mammal wherein both the
endogenous immunoglobulin heavy chain and light chain loci of the
non-human mammal are functionally inactivated, yet desired regions
of both the human immunoglobulin heavy chain and light chain are
integrated into the non-mammalian chromosome by crossing the
knockout non-human mammals and transgenic non-human mammals of
above-mentioned (1) to (4) in an arbitrary order.
[0082] As mentioned above, an endogenous immunoglobulin locus of
non-human mammals can be inactivated so that it inhibits
reconstitution of the locus via the substitution of a proper region
of the locus with an exogenous marker gene (for example, neomycin
resistance gene, etc.) via homologous recombination. For
inactivation using the homologous recombination, for example, a
method called positive negative selection (PNS) can be used (Nikkei
Science 5: 52-62, 1994). The functional inactivation of an
immunoglobulin heavy chain locus can be attained by, for example,
introducing a deficit into a part of the J or C region (for
example, the C.mu. region). On the other hand, the functional
inactivation of an immunoglobulin light chain (for example, the
.kappa. chain) can be attained by, for example, introducing a
deficit into a part of the J or C region, or a region comprising
the area that spans over both the J and C regions.
[0083] A transgenic animal can be produced by standard methods (for
example, "Saishin-Dobutsusaibou-Jikken manual (The latest animal
cell experiment manual)", Chapter 7, LIC, pp. 361-408, 1990).
Specifically, a hypoxantin-guanine phosphoribosyltransferase (HRPT)
negative embryonic stem (ES) cell derived from normal non-human
animal blastocyst is fused by the spheroplast fusion method with
yeast that comprises a YAC vector inserted with a gene or a part
thereof encoding the human immunoglobulin heavy chain or light
chain locus and the HRPT gene. The ES cell wherein the exogenous
gene has been integrated into the mouse endogenous gene is selected
by HAT selection. Subsequently, the selected ES cell is
microinjected into a fertilized egg (blastocyst) obtained from
another normal non-human mammal (Proc. Natl. Acad. Sci. USA 77:
7380-7384, 1980; U.S. Pat. No. 4,873,191). A chimeric transgenic
non-human mammal is born by transplanting the blastocyst into the
uterus of another non-human mammal that acts as the surrogate
mother. Heterotransgenic non-human mammals are obtained by crossing
the chimeric animal with a normal non-human mammal. By crossing the
heteroanimals among themselves, homotransgenic non-human mammals
can be obtained according to Mendel's law.
[0084] A humanized antibody can also be obtained from the culture
supernatant by culturing a recombinant human monoclonal antibody
producing host that can be obtained via the transformation of the
host with cDNAs encoding each of the heavy and light chains of such
humanized antibody or preferably a vector containing the cDNAs by
recombinant technique. Herein, such a host is a eukaryotic cell
other than fertilized egg, preferably a mammalian cell, such as CHO
cell, lymphocyte and myeloma cell.
[0085] The antigen-binding activity of an antibody stabilized by
the method of the present invention is not particularly limited;
however, it is preferred to have 70% or more, more preferably 80%
or more and further preferably 90% or more of the activity
possessed by the antibody before the amino acid substitution.
BRIEF DESCRIPTION OF THE DRAWINGS
[0086] FIG. 1 depicts the amino acid sequences of humanized heavy
chain version i and humanized light chain version b2 contained in
the anti-human TF antibody described in WO 99/51743. A few
asparagine residues (Asn28, Asn51 and Asn55) that may be deamidated
are boxed.
[0087] FIG. 2 depicts the cloning vector pCVIDEC-AHi integrated
with the heavy chain variable region (AHi) of the anti-human TF
antibody. A: the entire pCVIDEC-AHi vector; and B: the NheI-SalI
fragment of the heavy chain variable region.
[0088] FIG. 3 depicts the anion exchange chromatogram of each of
the anti-human TF mutant antibodies and the original anti-human TF
antibody. A: 99D01; and B: original (native).
[0089] FIG. 4 depicts the anion exchange chromatogram of each of
the anti-human TF mutant antibodies and the original anti-human TF
antibody. C: N28D; and D: N51D.
[0090] FIG. 5 depicts the anion exchange chromatogram of each of
the anti-human TF mutant antibodies and the original anti-human TF
antibody. E: N54D; and F: N51D/N54D.
[0091] FIG. 6 depicts the superposed anion exchange chromatograms
of each of the anti-human TF mutant antibodies and the original
anti-human TF antibody.
[0092] FIG. 7 depicts the binding activity of each of the
anti-human TF mutant antibodies and the original anti-human TF
antibody.
[0093] FIG. 8 depicts the neutralizing activity of each of the
anti-human TF mutant antibodies and the original anti-human TF
antibody.
[0094] FIG. 9 depicts the cloning vector pCVIDEC-AHi integrated
with the heavy chain variable region (AHi) of the anti-human TF
antibody. The nucleotide sequences described in FIG. 9 are shown in
SEQ ID NOs: 27 and 28. A: the entire pCVIDEC-AHi vector; B: the
XbaI-BalI fragment of the heavy chain variable region; and C: the
XbaI-ApoI fragment of the heavy chain variable region.
[0095] FIG. 10 depicts a graph comparing the binding activity of
each of the anti-human TF mutant antibodies. The anti-human TF
antibody concentration conversion values calculated based on the
calibration curve plotted using the bulk anti-human TF antibody
(Lot No. 00C01) are shown. Blank: 10% FCS-.alpha.-MEM culture
medium; control: CHO cell culture supernatant; G to P: each of the
anti-human TF antibody heavy chain Gly55 mutants.
[0096] FIG. 11 depicts the binding activity of each of the
anti-human TF mutant antibodies mutants.
[0097] FIG. 12 depicts the elution profiles of each of the
anti-human TF mutant antibodies and the bulk anti-human TF antibody
(99D01).
[0098] FIG. 13 depicts graphs showing the binding activity before
and after the accelerated testing on each of the anti-human TF
mutant antibodies and the bulk anti-human TF antibody (99D01), and
the ratio compared with the initial value.
[0099] FIG. 14 depicts the anion chromatograph and neutralizing
activity before and after the accelerated testing on each of the
anti-human TF mutant antibodies and the bulk anti-human TF antibody
(99D01). A: 99D01 (G55G); B: G55L; C: G55I; D: G55F; E: G55E; and
F: G55K.
[0100] FIG. 15 depicts the anion chromatograph and neutralizing
activity before and after the accelerated testing on each of the
anti-human TF mutant antibodies and the bulk anti-human TF antibody
(99D01). A: 99D01 (G55G); B: G55L; C: G55I; D: G55F; E: G55E; and
F: G55K.
[0101] FIG. 16 depicts the neutralizing activity before and after
the accelerated testing on each of the anti-human TF mutant
antibodies and the bulk anti-human TF antibody (99D01).
[0102] FIG. 17 depicts the neutralizing activity before and after
the accelerated testing on each of the anti-human TF mutant
antibodies and the bulk anti-human TF antibody (99D01).
BEST MODE FOR CARRYING OUT THE INVENTION
[0103] Herein below, the present invention will be specifically
described using Examples; however, it is not to be construed as
being limited thereto:
EXAMPLE 1
Measurement of Binding and Neutralizing Activities of Anti-Human TF
Antibody Asn54 Substitution Mutant with TF
[0104] Humanized antibody against human tissue factor (TF)
described in WO 99/51743 is expected to suppress thrombus formation
without suppressing the extrinsic blood coagulation reaction
through the inhibition of the TF mediated Factor X activation in
the intrinsic blood coagulation reaction. This anti-human TF
antibody contains humanized heavy chain version i (SEQ ID NO: 25,
FIG. 1) and humanized light chain version b2 (SEQ ID NO: 26, FIG.
1). The antibody comprises a few asparagine residues that may be
deamidated: such as Asn51 and Asn54 in CDR2 of the heavy chain
variable region, and Asn28 in FR1 of the heavy chain variable
region. Particularly, Asn54 is contained in an Asn-Gly sequence,
and thus is considered to be easily deamidated.
[0105] Pharmaceutical formulation of the antibody has not been
established. Under destabilizing conditions of the antibody, the
antibody binding activity to TF decreases in a solution
pH-dependent manner and the increase of low pI molecular species
has been observed. Due to the increase of degeneration upon
stronger basification, the decrease in the binding activity and the
increase of low pI molecular species are supposed to result from
the deamidation of amino acids constituting the anti-human TF
antibody. Furthermore, the deamidation is suggested to occur in the
CDR region due to the co-observed decrease in the antigen binding
activity.
[0106] Based on these findings, mutants (4 mutants including N51D
mutant, N54D mutant, N51D/N54D double mutant and N28D mutant)
wherein Asn51 and Asn54 in the CDR2 and Asn28 in the FR1 of the
heavy chain variable region of anti-human TF antibody described in
WO 99/51743 have been substituted with aspartic acid were prepared,
and their binding activity and neutralizing activity to TF were
measured.
[0107] The amino acid sequence of the antibody follows the sequence
described by Kabat et al. (Kabat E. A., Wu T. T., Perry H. M.,
Gottesman K. S. and Foeller C., "Sequences of proteins of
immunological interest. 5th ed.", US Dept. Health and Human
Services, Bethesda, Md., 1991).
[0108] 1. Construction of Anti-Human TF Mutant Antibody Expression
Vector
[0109] Cloning vector pCVIDEC-AHi (FIG. 2A) and anti-human TF
antibody expression vector pN5KG4P-AHi-ALb2 both integrated with
the heavy chain variable region (AHi) of the anti-human TF antibody
were purified from dam.sup.-/dcm.sup.- E. coli SCS110.
[0110] Substitution of the codon encoding Asn with that of Asp was
performed in pCVIDEC-AHi. Specifically, a fragment of about 30 bp
containing the region that encodes each Asn was digested with
restriction enzymes and replaced with a fragment prepared from a
synthetic oligo DNA having base substitution (FIG. 2B). To alter
Asn51 and Asn54, pCVIDE-AHi was digested with XbaI and BalI, and a
fragment designed for one base pair substitution of the codon was
integrated to alter either or both of Asn51 and Asn54 in the heavy
chain variable region CDR2 of the anti-human TF antibody to Asp. To
alter Asn28, pCVIDEC-AHi was digested with MroI and EcoT22I, and a
fragment designed for one base pair substitution of the codon was
integrated to substitute Asn28 to Asp in the heavy chain variable
region FR1 of the anti-human TF antibody.
[0111] The sequence was confirmed at every step while constructing
the expression vector. The target sequence was confirmed on the
cloning vector, and the sequence was reconfirmed after replacing
the fragment obtained by digestion with NheI and SalI with the
heavy chain variable region of the anti-human TF antibody
expression vector digested with NheI and SalI. E. Coli DH5.alpha.
was transformed after confirming that the target sequence was
obtained. Then, the four anti-human TF mutant antibody expression
vectors, i.e., N51D mutant expression vector, N54D mutant
expression vector, N51D/N54D double mutant expression vector and
N28D mutant expression vector, were purified using the QIAGEN Maxi
column.
[0112] 2. Transient Expression of Anti-Human TF Mutant Antibody in
COS-7 Cell
[0113] Five vectors in total, i.e., the constructed expression
vectors for each of the mutants and the original anti-human TF
antibody, were transfected into COS-7 cells by the electroporation
method and were transiently expressed. COS-7 cells were washed with
D-PBS (-) and then resuspended in PBS to be about 0.3 to
1.0.times.10.sup.7 cells/ml. The cell suspension was transferred
into a 0.4 cm cuvette together with 10 .mu.g of anti-human TF
mutant antibody expression vector, and electroporation was
conducted with the conditions of 1.5 kV and 25 .mu.F. After leaving
standing for 10 min, the cells were suspended in 30 ml of 10%
FCS-DMEM. On the next day, dead cells were discarded together with
the media and 50 ml of fresh 10% FCS-DMEM was added. The cells were
cultured for 3 days and then the culture supernatant was
collected.
[0114] 3. Measurement of Expression Level of Anti-Human TF Mutant
Antibody
[0115] 3-1 Measurement of Expression Level by Direct ELISA
[0116] 100 .mu.l each of the culture supernatant of the transfected
COS-7 cells were seeded on a 96-well ELISA plate and immobilized
over night. Similarly, 100.mu. each of anti-human TF antibody (Lot
No. 00C01) serially diluted (1 to 1000 ng/ml) with DMEM was seeded
and immobilized on a 96-well ELISA plate for plotting a calibration
curve. After blocking with ELISA dilution buffer, HRP-labeled
anti-IgG antibody was reacted and color was developed by TMB. The
reaction was quenched with 2 M sulfuric acid and the absorbance at
450 nm was measured with ARVO-SX5. The amount of anti-human TF
antibody in the culture supernatant was calculated from the value
of the anti-human TF antibody (Lot No. 00C01) seeded for the
calibration curve.
[0117] As shown in Table 1, direct ELISA confirmed concentration
and total expression level of anti-TF antibody of about 65 to about
100 ng/ml and about 3 to about 5 .mu.g, respectively.
1 TABLE 1 Total expression Concentration Dosage level (ng/ml) (ml)
(.mu.g) Original 98.710 50 4.9 N28D 84.535 50 4.2 N51D 75.634 50
3.8 N54D 77.956 50 3.9 N51D/N54D 68.387 50 3.4
[0118] 4. Purification of Each Anti-Human TF Mutant Antibody
[0119] Each mutant was purified from 50 ml of the recovered culture
supernatant using affinity chromatography (Protein A) and anion
exchange chromatography (Mono Q).
[0120] 4-1 Affinity Chromatography
[0121] Affinity chromatography was performed under the following
conditions:
[0122] System: SMART System (Amersham Pharmacia Biotech)
[0123] Column: HiTrap Protein A HP (0.7 cm.phi..times.2.5 cm, 1 ml,
Amersham Pharmacia Biotech)
[0124] Equilibrating Buffer: D-PBS (-)
[0125] Washing Buffer: 10 mM Sodium phosphate buffer (pH 7.4)
[0126] Elution Buffer: 50 mM Acetic acid (pH 2 to 3)
[0127] After adjusting the pH to 7.4 with 0.5 M sodium
monophosphate solution, a sample was concentrated 5-fold with
Centriprep-50 and loaded at a flow rate of 1 ml/min onto the column
equilibrated with 10 ml (10 C.V.) equilibrating buffer. The column
was washed with 5 ml (5 C.V.) washing buffer at a flow rate of 0.5
ml/min, eluted with 5 ml (5 C.V.) elution buffer, and then
collected as ten fractions, each containing 0.5 ml solution. Four
fractions containing the antibody were combined and neutralized to
pH 6 to 7 with 0.1 ml of 1 M Tris base.
[0128] 4-2 Anion Exchange Chromatography
[0129] Next, anion exchange chromatography was performed under the
following conditions:
[0130] System: SMART System (Amersham Pharmacia Biotech)
[0131] Column: Mono Q PC 1.6/5 (0.16 cm.phi..times.5 cm, 0.1 ml,
Amersham Pharmacia Biotech)
[0132] Buffer A: 50 mM Tris-HCl (pH 8.0)
[0133] Buffer B: 50 mM Tris-HCl (pH 8.0)/0.5 M NaCl
[0134] Sample was prepared by adding 0.1 ml of 1 M Tris base to the
Protein A elution fraction obtained by affinity chromatography to
adjust the pH to 8 to 9. The sample was loaded onto the column at a
flow rate of 200 .mu.l/min, and then eluted by gradient elution
using a gradient program of 0% B/5 min, 0 to 60% B/30 min, 60 to
100% B/10 min and 100% B/10 min, with a flow rate of 50 .mu.l/min.
The eluate was collected as 50 .mu.l fractions, and 2 to 4
fractions containing the antibody were combined and subjected for
activity measurement.
[0135] The affinity chromatography and anion exchange
chromatography resulted in 0.5 to 1.0 .mu.g of antibody. The anion
exchange chromatogram of each mutant is shown in FIGS. 3 to 5 and
the superposed chromatograms of the mutants are shown in FIG. 6. In
addition, the amount and recovery rate of the proteins are shown in
Table 2. The N54D mutant and N51D/N54D double mutant were obtained
as almost a single peak. However, subpeak was observed for the
original anti-human TF antibody, N51D mutant and N28D mutant.
Particularly, N51D mutant showed 2 subpeaks, and that with high
contents.
2TABLE 2 Initial Total protein protein Peak amount Concentration
Dosage amount Recovery No. (.mu.g) (ng/ml) (ml) (.mu.g) (%)
Original 1 4.9 6969.568 0.10 0.70 16.5 2 734.883 0.15 0.11 N28D 1
4.2 5436.713 0.15 0.82 20.7 2 320.086 0.15 0.05 N51D 1 3.8 2643.388
0.15 0.40 18.2 2 2724.396 0.10 0.27 3 143.479 0.15 0.02 N54D 3.9
2811.046 0.20 0.56 14.4 N51D/ 3.4 5255.977 0.20 1.05 30.9 N54D
[0136] 5. Measurement of TF Binding Activity
[0137] TF binding activity was measured by competitive ELISA using
biotinylated anti-human TF antibody. Each of the anti-human TF
mutant antibodies was expressed in COS-7, and purified using
protein A affinity chromatography and anion exchange chromatography
to be used as samples. The subpeaks observed during anion exchange
chromatography of the original anti-human TF antibody, N28D mutant
and N51D mutant were used for the measurement. Lot No. 00C01 was
used as the anti-human TF antibody standard.
[0138] shTF was adjusted to 20 nM with coating buffer (hereafter,
indicated as CB), dispensed at 100 .mu.l/well into a 96-well plate
and incubated at 4.degree. C. overnight. Each well was washed three
times with rinse buffer (hereafter, indicated as RB), 200 .mu.l
dilution buffer (hereafter, indicated as DB) was added to each
well. The plate was left standing at room temperature for 2 hours
for blocking. After discarding DB, 100 .mu.l sample diluted by
2-fold serial dilution with DB containing 10,000-fold diluted
biotinylated anti-human TF antibody was added to each well, and the
plate was left standing at room temperature for one hour. The plate
was washed three times with RB, 100 .mu.l ALP-streptavidin diluted
5,000-fold with DB was dispensed to each well, and left standing
for 1 hour at room temperature. Each well was washed 5 times with
RB and SIGMA104 adjusted with substrate buffer (hereafter,
indicated as SB) to 1 mg/ml was dispensed to each well. Plates were
left standing for 30 min at room temperature for color development
and measured with a microplate reader at a wavelength of 405 nm and
a control wavelength of 655 nm.
[0139] The assessment of binding activity was performed as follows:
a straight-line as the standard was obtained by linear-regression
of the concentration (logarithmic conversion value)-absorbance of
the original anti-TF human antibody. The absorbance of each sample
within the range of 62.5 to 500 ng/ml was converted to standard
antibody concentration (Cc) using this standard straight-line. The
added antibody concentration was subtracted from Cc (Ca) to obtain
the sample concentration ratio to the standard antibody that shows
the same binding activity as the binding activity.
[0140] The measurement results on the binding activities are shown
in FIG. 7 and Table 3. The binding activity of each mutant was
lower than that of the original anti-human TF antibody. The binding
activity of the mutant (N54D mutant) of Asn54 located in CDR2 yet
mostly expected to undergo deamidation decreased to about 10% of
the original anti-human TF antibody. The binding activity of the
mutant (N54D mutant) of Asn51 located in CDR2 similar to Asn54 was
about 50% of the original anti-human TF antibody, and the degree of
decrease was smaller than the N54D mutant. The N51D/N54D double
mutant, a mutant of both the amino acids Asn51 and Asn 54, had a
further decreased binding activity than the N54D mutant. On the
other hand, the binding activity of the mutant (N28D mutant) of
Asn28 located in FR1 was about 94% of the original anti-human TF
antibody showing only a slight decrease. From these findings,
deamidation of Asn51 and Asn54 located in CDR2, particularly Asn54
was indicated to greatly reduce the binding activity.
[0141] Furthermore, the comparison of the binding activity of the
subpeaks (peak 2) observed in the original anti-human TF antibody,
N28D mutant and N51D mutant to that of the main peak (peak 1)
revealed lower binding activity in all the subpeaks to the
mainpeak.
3 TABLE 3 Binding Activity Peak 1 Peak 2 Native 100% 70.6% N28D
93.9% 46.3% N51D 49.2% 29.0% N54D 9.2% N51D/N54D 7.0%
[0142] 6. Measurement of TF Neutralizing Activity
[0143] TF neutralizing activity was measured using hTF (Thromborel
S), Factor VIIa and Factor X. Similar to the measurement of the
binding activity, each of the anti-human TF mutant antibodies was
expressed in COS-7 cells and purified using Protein A affinity
chromatography and anion exchange column chromatography. Lot No.
00C01 was used for the anti-human TF antibody standard.
[0144] Coagulation factor VIIa and Thromborel S were diluted with
assay buffer (TBS (pH 7.49) containing 5 mM CaCl.sub.2 and 0.1%
BSA; hereafter, indicated as AB) to 0.1 PEU/ml and 120-fold (v/v),
respectively. 60 .mu.l of these mixtures were dispensed to each
well of a plate and left standing for 60 min at room temperature.
ABX wherein Factor X is diluted with AB to 0.25 PEU/ml was used to
dilute the samples and 40 .mu.l of sample diluted to the desired
concentration was dispensed to each well of the plate. The plate
was left standing for 30 min at room temperature, and the reaction
was quenched by adding 10 .mu.l/well of 500 mM EDTA. S-2222 mixture
was prepared by mixing one volume of S-2222, a chromogenic
substrate, solution with one volume of MilliQ H.sub.2O and two
volumes of 0.6 mg/ml hexamethylene bromide solution. Fifty
.mu.l/well of the S-2222 mixture was dispensed into the plate and
left standing at room temperature. After 30 min, measurements were
performed using a micro plate reader at a measurement wavelength of
405 nm and a control wavelength of 655 nm.
[0145] Measurement results on the neutralizing activity are shown
in FIG. 8 and Table 4. The concentration of each of the mutant was
calculated using the anti-human TF antibody standard as a standard,
and the neutralizing activity ratio compared to the anti-human TF
antibody standard was obtained. The neutralizing activity ratio
bases on the concentration of 250 ng/ml, at which concentration all
samples could be measured. The original anti-human TF antibody and
N28D mutant retained a neutralizing activity almost equivalent to
the anti-human TF antibody standard. Thus, the deamidation of Asn28
located in FR was considered not to affect the decrease of
neutralizing activity.
[0146] On the other hand, the neutralizing activity ratios of N51D
and N54D mutants against the anti-human TF antibody standard
decreased to 65.6% and 19.9%, respectively. Therefore, the
deamidation of Asn51 and Asn54 located in CDR of the anti-human TF
antibody was strongly suggested to cause the decrease of
neutralizing activity.
4 TABLE 4 Added Calculated Neutralizing concentration concentration
activity ratio (ng/ml) (ng/ml) (%) N28D 250 253 101 N51D 250 164
65.6 N54D 250 49.8 19.9 N51D/N54D 250 31.3 12.5 Native 250 248
99.1
[0147] From the results described above, the solution pH-dependent
decrease in the binding activity to TF and increase in low pI
molecular species of unformulated anti-human TF antibody under
antibody destabilizing conditions were revealed to mainly result
from the deamidation of Asn54 in the CDR2 region.
EXAMPLE 2
Measurement of TF Binding and Neutralizing Activities of Gly55
Substitution Mutant of Anti-Human TF Antibody
[0148] The anti-human TF antibody described in WO 99/51743 contains
the humanized heavy chain version i (SEQ ID NO: 25, FIG. 1) and the
humanized light chain version b2 (SEQ ID NO: 26, FIG. 1). Based on
its amino acid sequence, mutants were prepared wherein the Gly55 in
the heavy chain CDR2 that is considered as an important amino acid
in the construction of the loop of CDR2 had been substituted with
19 other amino acids. Then, the binding activity of each mutant
with TF was measured. Furthermore, the neutralizing activity and
deamidation was observed for the mutants wherein Gly55 had been
substituted with Ile, Leu, Phe, Glu and Lys.
[0149] The amino acid sequence of the antibody based on the
sequence described by Kabat et al. (Kabat E. A., Wu T. T., Perry H.
M., Gottesman K. S. and Foeller C., "Sequences of proteins of
immunological interest. 5th ed.", US Dept. Health and Human
Services, Bethesda, Md., 1991).
[0150] 1. Construction of Anti-Human TF Mutant Antibody Expression
Vector
[0151] The cloning vector pCVIDEC-AHi (FIG. 9A) and the anti-human
TF antibody expression vector pN5KG4P-AHi-ALb2 carrying the heavy
chain variable region (AHi) of the anti-human TF antibody were
isolated from E. coli SCS110 (dam.sup.-/dcm.sup.-1).
[0152] The substitution of the codon encoding Gly55 with a
different amino acid was performed on the pCVIDEC-AHi. In this
procedure, the substitution to 15 amino acids wherein the third
codon can be fixed to "C" was performed as follows: digesting a
fragment of about 30 bp comprising the coding region of Asn54-Gly55
at the unique sites XbaI and BalI of pCVIDEC-AHi, and integrating a
fragment prepared using a synthetic oligo DNA wherein the 2
nucleotides at the 3'-end of the Gly55-coding codon has been
randomized (FIG. 9B). The XbaI-BalI fragment was prepared by
elongating the 3'-end with two nucleotides using Vent polymerase
(NEB, Inc.) so that the 1st and 2nd nucleotides of the Gly55 codon
in the CDR2 variable of the of the anti-human TF antibody heavy
chain region become random nucleotide sequences, and then digesting
with XbaI. This procedure was believed to enable production of 15
mutants with high codon usage in mammals via one operation.
However, in fact, only 8 kinds of mutants were produced since
optimal reaction conditions could not be found. Therefore, the
remaining mutants were constructed using other restriction enzyme
sites.
[0153] Mutants comprising substitution of an amino acid wherein the
3.sup.rd codon of Gly55 has to be converted, as well as those that
could not be produced by the above-descried method were produced as
follows: a vector wherein the EcoRI site of pCVIDEC-AHi is changed
to HindIII site was constructed, digested at the unique sites ApoI
and XbaI of pCVIDEC-AHi, and a fragment produced using synthetic
oligo DNA was inserted. That is, apart from the XbaI and BalI
sites, ApoI and XbaI sites were the possible sites that can be used
as the restriction enzyme sites. However, ApoI also digests the
ECORI sites in the vector. Therefore, the EcoRI site was first
removed by changing it to a HindIII site. The ApoI-XbaI fragment
was about 55 bp. Thus, a synthetic oligo DNA was prepared so that a
total of about 16 bp overlap upstream and downstream of the
nucleotide sequence of the codon encoding Gly 55 that is changed to
other amino acids. After annealing, the fragment was elongated
using Vent polymerase and digested with ApoI and XbaI (FIG. 9C and
Table 5).
5TABLE 5 EcoRI site deletion adapter Hind III G AATTC
AATTGGAAGCTTGC CTTAA G CCTTCGAACGTTAA H-G56M primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATATGC H-G56M primer-R
GAGAATTTCGGGTCATACATACTATGCATATTCGCAGGAT H-G56M primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATAAGCAT H-G56K primer-R
GAGAATTTCGGGTCATACATACTATGCTTATTCGCAGGAT H-G56W primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATTGGCAT H-G56W primer-R
GAGAATTTCGGGTCATACATACTATGCCAATTCGCAGGAT H-G56Q primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATCAGCAT H-G56Q primer-R
GAGAATTTCGGGTCATACATACTATGCTGATTCGCAGGAT H-G56E primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATGAGCAT H-G56E primer-R
GAGAATTTCGGGTCATACATACTATGCTCATTCGCAGGAT H-G56F primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATTTCCAT H-G56F primer-R
GAGAATTTCGGGTCATACATACTATGGAAATTCGCAGGAT H-G56T primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATACCCAT H-G56T primer-R
GAGAATTTCGGGTCATACATACTATGGGTATTCGCAGGAT H-G56N primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATAACCAT H-G56N primer-R
GAGAATTTCGGGTCATACATACTATGGTTATTCGCAGGAT H-G56D primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAAGACCAT H-G56D primer-R
GAGAATTTCGGGTCATACATACTATGGTCATTCGCAGGAT H-G56P primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATCCCCAT H-G56P primer-R
GAGAATTTCGGGTCATACATACTATGGGGATTCGCAGGAT H-G56C primer-F
GAGTCTAGAATGGATTGGTGGGAATGATCCTGCGAATTGCCAT H-G56C primer-R
GAGAATTTCGGGTCATACATACTATGGCAATTCGCAGGAT
[0154] Primers for the construction of anti-human TF mutant
antibodies using XbaI and ApoI sites are shown.
[0155] In addition, the nucleotide sequences indicated in Table 5
are shown in SEQ ID NOs: 1 to 24.
[0156] The sequences of the constructed 19 different anti-human TF
mutant antibodies were confirmed in the cloning vector by a
sequencer. Furthermore, the sequences were reconfirmed after
constructing mutant expression vectors by replacing the heavy chain
variable region obtained through NheI and SalI digestion with the
heavy chain variable region digested from the anti-human TF
antibody expression vector with NheI and SalI. After confirming
that the target sequence was obtained, the anti-human TF mutant
antibody expression vector was amplified using E. coli DH5.alpha.,
purified using QIAGEN Maxi column and the sequence was confirmed.
As a result, 19 different anti-human TF mutant antibody expression
vectors were obtained.
[0157] 2. Transient Expression of Anti-Human TF Mutant Antibody in
CHO Cells
[0158] A total of 20 expression vectors, i.e., the constructed
anti-human antibody heavy chain Gly55 mutant expression vectors and
Gly55 non-substituted antibody (Gly55Gly) expression vector, were
transfected into CHO cells via the lipofection method for transient
expression. A day before lipofection, the CHO (dhfr-) cells were
cultured on 10% FCS-.alpha.-MEM in an atmosphere of 5% CO.sub.2 at
37.degree. C. The CHO cells were seeded at 1.times.10.sup.5
cells/well on 12-well plates and cultured at 5% CO.sub.2 at
37.degree. C.
[0159] After adding 6 .mu.l of FuGENE6 Transfection Reagent
(Boehringer Mannheim GmbH) to 100 .mu.l of Opti-MEM (GIBCO BRL) and
leaving standing for 5 min, the mixture was added to a tube
containing 1 .mu.g of each of the anti-human TF antibody heavy
chain Gly55 mutant expression vectors pN5KG4P-AHi-Alb2-G55X (X: 20
kinds of each amino acid). The tube was left standing for 20 min to
form a FuGENE6/DNA complex. After discarding the media of the CHO
cell seeded on the previous day, 2 ml/well of 10% FCS-.alpha.-MEM
was newly added followed by the addition of each FuGENE6/DNA
complex in triplicate.
[0160] The cells were cultured at 37.degree. C. at 5% CO.sub.2 for
one day and then washed with PBS. Media were replaced by adding 3
ml/well of 10% FCS-.alpha.-MEM. After 7-day incubation at 5%
CO.sub.2 at 37.degree. C., about 9 ml of culture supernatant
containing each of the anti-human TF mutant antibody was
transferred into a 15 ml tube, centrifuged at 1000 rpm for 5 min,
and concentrated to 10-fold through ultrafiltration. The obtained
culture supernatant was used as the anti-human TF antibody heavy
chain Gly55Xaa mutant sample.
[0161] 3. Measurement of TF Binding Activity
[0162] Human IgG content in the anti-human TF antibody heavy chain
Gly55Xaa mutant sample of was measured to adjust the IgG
concentration of each sample to 100 ng/ml.
[0163] TF binding activity was measured by competitive ELISA using
biotinylated anti-human TF antibody. shTF was adjusted to 20 nM
with CB, dispensed at 100 .mu.l/well into a 96-well plate, and was
left standing at 4.degree. C. overnight. The plate was washed three
times with RB, 200 .mu.l/well of DB was dispensed thereto, and then
left standing for blocking at room temperature for 2 hours. After
removing DB, 100 .mu.l/well of standard and samples diluted by
2-fold serial dilution with DB containing biotinylated anti-human
TF antibody (diluted 10,000-fold at final concentration) were
added. The plates were left standing at room temperature for 0.1
hour. After washing 3 times with RB, 100 .mu.l/well of
ALP-streptavidin, diluted 8,000-fold with DB, was added and left
standing at room temperature for one hour. SIGMA104 adjusted to 1
mg/ml with SB was added after washing 3 times with RB, and left
standing for about 20 min at room temperature to develop colors and
measure with a microplate reader at a wavelength of 405 nm and a
control wavelength of 655 nm.
[0164] The binding activity was compared by determining the
concentration that showed 50% activity according to the following
procedure: the absorbance at each measured point was converted to
percentage (%) by taking the absorbance of sample (-) and
biotinylated antibody (+) as 100%. A linear regression equation of
"concentration (logarithmic conversion value)-absorbance (%)" was
obtained based on two points which sandwich the 50% value of each
sample. Then, the concentration giving 50% absorbance was
calculated to calculate the binding activity of each sample from
Equation 1.
binding activity=(50% activity concentration of the standard
antibody)/(50% activity concentration of sample).times.100.
Equation 1
[0165] The anti-human TF antibody concentration conversion value
that was calculated based on the calibration curve produced using
bulk anti-human TF antibody (Lot No. 00C01) is shown in FIG. 10.
The Gly55 non-substituted antibody (Gly55Gly) expressed in CHO
cells retained a TF binding activity almost equivalent to the bulk
anti-human TF antibody. Decrease in the binding activity was
observed in the Gly55 mutants, Gly55Val, Gly55Ile and Gly55Pro.
[0166] The following assay was performed to examine the TF binding
activity of the anti-human TF antibody heavy chain Gly55 mutants in
detail. Specifically, the TF binding activity was measured by
competitive ELISA method using the anti-human TF mutant antibodies
by changing the amount of added sample within the range of 25 to
200 ng/ml. Measurements on Gly55Asn and Gly55Asp were not performed
due to the lack of sample amount.
[0167] The measurement results are shown in FIG. 11. Among the
examined 18 anti-human TF antibody heavy chain Gly55 mutants, the
TF binding activity of Gly55Val, Gly55Ile and Gly55Pro were
significantly decreased compared with the bulk anti-human TF
antibody (Lot No. 00C01) and Gly55 non-substituted antibody
(Gly55Gly). However, no significant difference in the TF binding
activity could be observed for the other 15 mutants. Thus, the TF
binding activity was supposed to be maintained even after changing
the Gly55 with another amino acid.
[0168] 4. Measurement of TF Neutralizing Activity
[0169] Coagulation factor VIIa and Thromborel S were diluted with
AB to 0.1 PEU/ml and 120-fold (v/v), respectively. Sixty .mu.l/well
of a mixture thereof was dispensed to a plate and left standing at
room temperature for 60 min. Twenty .mu.l/well of sample diluted by
2-fold serial dilution with 10 mM phosphate buffer was dispensed
followed by 20 .mu.l/well coagulation factor (Factor X) solution
diluted to 0.5 PEU/ml with AB (supplemented with CaCl.sub.2
solution to a CaCl.sub.2 concentration of 10 mM). The plate was
left standing at room temperature for 30 min and then the reaction
was quenched by adding 10 .mu.l/well of 500 mM EDTA. Fifty
.mu.l/well of a solution of test-team chromogenic substrate S-2222
solution and polybrene solution mixed at 1:1 was dispensed and left
standing at room temperature. After 30 min, measurements were taken
by a microplate reader at a measurement wavelength of 405 nm and a
control wavelength of 655 nm.
[0170] The neutralizing activity was compared by determining the
concentration showing 50% activity according to the following
procedure: the absorbance at each measured point was converted to
percentage (%) by taking the absorbance of sample (-) and
coagulation factor X (+) as 100%, and sample (-) and coagulation
factor X (-) as 0%. A linear regression equation of "concentration
(logarithmic conversion value)-absorbance (%)" was obtained based
on two points that sandwich the 50% value of each sample. Then, the
concentration giving 50% absorbance was calculated to calculate the
neutralizing activity of each sample from Equation 2.
Neutralizing activity (IC50)=(50% activity concentration of the
standard antibody)/(50% activity concentration of
sample).times.100. Equation 2
[0171] 5. Construction of Stable Expression System of Anti-Human TF
Mutant Antibodies Using CHO Cells
[0172] Five kinds of mutants, Gly55Leu, Gly55Phe, Gly55Glu,
Gly55Lys and Gly55Ile, wherein the Gly55 is substituted to Leu
(aliphatic amino acid), Phe (aromatic amino acid), Glu (acidic
amino acid), Lys (basic amino acid) and Ile (branched-chain
aliphatic amino acid), respectively, were produced in sufficient
quantity to compare the activity of the anti-human TF mutant
antibodies by constructing stable expression cell lines.
[0173] 5-1 Gene Transfer into CHO Cells
[0174] CHO (dhfr-) cells were washed with PBS and then resuspended
in PBS to about 1.times.10.sup.7 cells/ml. The cells were
transferred into a 0.4 cm cuvette together with 10 .mu.g of the
expression vector of the anti-human TF antibody heavy chain Gly55
mutant, pN5KG4P-AHi-Alb2-G55X. Electroporation was performed at 1.5
kV with 25 .mu.F. After leaving standing for 10 min, the cells were
suspended in 200 ml of 10% FCS-.alpha.-MEM nucleic acid (-) media.
Two hundred .mu.l/well of the suspension was seeded and cultured on
ten 96-well plates.
[0175] 5-2 Selection of Transfected Cells
[0176] The amount of expressed antibody in wells wherein cell
growth could be observed during the 96-well plate culture was
compared by hIgG ELISA. Cells that showed high hIgG expression were
subcultured from 10 wells each at a total of 70 wells into 12 well
plates and cultured in 10% FCS-.alpha.-MEM nucleic acid (-) media.
The expression amount of anti-human TF mutant antibody was measured
by hIgG ELISA at the time when the cells had acclimatized to the
10% FCS-.alpha.-MEM nucleic acid (-) media and showed satisfactory
growth. Four wells were selected for each mutant and subcultured
into a 50 ml flask. Antibody production was enhanced by replacing
the media with 10% FCS-.alpha.-MEM nucleic acid (-) containing 10
nM MTX.
[0177] 5-3 Production of Anti-Human TF Mutant Antibody by
Large-Scale Culture Using Serum Free Media
[0178] Among the anti-human TF mutant antibody clones, one clone
each for each mutant having a high hIgG expression level was
selected and cultured in six 175 cm.sup.2 flasks using media
containing 10 nM MTX. The media were replaced with 150 ml CHO-S-SFM
II serum free media after reaching subconfluence and incubated for
7 days. The culture supernatant was collected, treated with 0.22
.mu.m filter, and stored at -80.degree. C. until purification.
[0179] 5-4 Measurement of Expression Level of Anti-Human TF Mutant
Antibody by Sandwich ELISA
[0180] One hundred .mu.l/well of anti-human IgG (.gamma.) antibody
was dispensed into a 96-well plate and left standing at 4.degree.
C. overnight. After washing 3 times with RB, 200 .mu.l/well of DB
was dispensed and left standing at room temperature for 2 hours for
blocking.
[0181] After discarding DB, 100 .mu.l/well of the standard and
sample that was properly diluted with DB or media used to recover
the antibody from the anti-human TF mutant antibody producing cells
was added, and left standing at room temperature for 2 hours. After
washing three times with RB, 100 .mu.l/well of HRP-labeled
anti-human IgG antibody diluted 10,000-fold with DB was dispensed
and left standing at room temperature for 1 hour. After washing 10
times with RB, 100 .mu.l/well of chromogenic reagent was dispensed
and left standing at room temperature for about 10 min. Color
reaction was quenched by the addition of 50 .mu.l/well of 2 N
sulfuric acid to measure the absorbance with a microplate reader at
a measurement wavelength of 450 nm and a control wavelength of 655
nm.
[0182] Consequently, several milligrams of each of the anti-human
TF mutant antibodies, except Gly55Gly, were obtained (Table 6).
6TABLE 6 Version G55G G55F G55L G55E G55K G55I 99D01 Clone No. 196
41 96 23 237 127 .alpha.-MEM N (-) (ng/ml) 29 64 9 59 600 110
.alpha.-MEM 10 nM 50 836 3451 6143 423 369 MTX (ng/ml) CHO-SFM-II
(large-Scale: 0.24 15.4 41.7 50 11.5 5.8 900 ml) (.mu.g/ml)
Purified -- 319 379 624 180 153 1556 (after buffer exchange: (4 ml)
.mu.g/ml, total 7 ml)
[0183] 6. Purification of Each Anti-Human TF Antibody Mutant
[0184] Each mutant was purified from the supernatant of the large
scale culture containing each of the mutants using a HiTrap
rProtein A FF column and a HiTrap Q Sepharose HP column.
[0185] 6-1 Affinity Chromatography for Purification
[0186] Affinity chromatography was performed in a refrigerated room
under the following conditions:
[0187] System: FPLC System
[0188] Column: HiTrap rProtein A FF (1.6 cm.phi..times.2.5 cm, 5
ml)
[0189] Equilibrating buffer: D-PBS (-)
[0190] Washing buffer: 10 mM Sodium phosphate buffer (pH 7.4)
[0191] Elution buffer: 50 mM Acetic acid (pH 2 to 3)
[0192] Samples were loaded onto the column after adjusting the pH
to 7.4 with 0.5 M disodium phosphate solution. Fifty ml of washing
buffer was used to dilute 1.5 ml (16.5 mg) of the anti-human TF
antibody standard. Elution was performed with 25 ml (5 C.V.)
elution buffer at a flow rate of 5 ml/min and the pH was
neutralized to 6 to 7 with 1.25 ml of 1 M Tris base.
[0193] 6-2 Anion Exchange Chromatography for Purification
[0194] Next, anion exchange chromatography was conducted in a
refrigerated room under the following conditions:
[0195] System: FPLC System
[0196] Column: HiTrap Q Sepharose HP (0.7 cm.phi..times.2.5 cm, 1
ml)
[0197] Buffer A: 50 mM Tris-HCl (pH 8.0, 4.degree. C.)
[0198] Buffer B: 50 mM Tris-HCl (pH 8.0, 4.degree. C.)/1 M NaCl
[0199] Sample was prepared by adjusting the pH of the Protein A
elution fraction obtained via affinity chromatography to 8 to 9
through the addition of 1.25 ml of 1 M Tris base. Elution steps of
0 mm NaCl (5 C.V.), 250 mM NaCl (5+5 C.V.) and 1 M NaCl (100 C.V.)
at a flow rate of 1 ml/min were performed and the first half 5 C.V.
(5 ml) of the 250 mM NaCl step was collected.
[0200] Five hundred .mu.g or more of each of the anti-human TF
mutant antibodies, except Gly55Gly, was obtained (Table 5).
Gly55Gly was not obtained. Therefore, bulk anti-human TF antibody
(Lot No. 99D01) was purified according to a similar procedure to
use it for comparison with anti-human TF antibody (Table 5).
[0201] 7. Anion Exchange Chromatography for Analysis
[0202] Sample was analyzed by anion exchange chromatography at room
temperature under the following conditions:
[0203] System: SMART System
[0204] Column: MonoQ PC 1.6/5 (0.16 cm.phi..times.5 cm, 0.1 ml)
[0205] Buffer A: 50 mM Tris-HCl (pH 8.0, 20.degree. C.)
[0206] Buffer B: 50 mM Tris-HCl (pH 8.0, 20.degree. C.)/500 mM
NaCl
[0207] Gradient elution with a gradient program of 0% B/5 min,
0-60% B/30 min, 60 to 100% B/10 min and 100% B/10 min at a flow
rate of 50 .mu.l/min was performed. Two .mu.g of sample (calculated
by UV conversion) was diluted 3 to 50 times with 50 .mu.l of buffer
A and 25 .mu.l thereof was analyzed.
[0208] The analysis by anion exchange chromatography of purified
bulk anti-human TF antibody (99D01) and each of the anti-human TF
mutant antibody revealed almost a single peak, although with a
change in elution time depending on the introduced amino acid
mutation (FIG. 12).
[0209] 8. Suppression of Anti-Human TF Antibody Deamidation by
Amino Acid Mutation
[0210] In order to examine the deamidation reaction, accelerated
testing was performed under heated condition using a neutral pH
buffer wherein deamidation easily occurs.
[0211] 8-1 Replacement of Buffer
[0212] Replacement of sample buffer with 20 mM sodium phosphate
buffer/150 mM sodium chloride (pH 7.5) buffer using a PD-10
desalting column was performed. After equilibrating the column, 2.5
ml sample was loaded onto two columns and eluted with 3.5 ml
buffer.
[0213] 8-2 Sample Preparation for Accelerated Testing
[0214] Each sample of the anti-human TF mutant antibodies was
diluted to 100 .mu.g/ml based on the value quantitated by hIgG
ELISA. Buffer containing 20 mM sodium phosphate buffer/150 mM NaCl
(pH 7.5) was used. After passing through a 0.22 .mu.m filter, 1 ml
of each sample was dispensed into a 5 ml vial.
[0215] 8-3 Accelerated Testing
[0216] Accelerated testing on the purified bulk anti-human TF
antibody (99D01) and anti-human TF mutant antibodies was performed
for four weeks at 40.degree. C. in 20 mM sodium phosphate
buffer/150 mM NaCl (pH 7.5) solution. A portion was sampled at each
point of 0, 1, 2 and 4 weeks, and its activity was analyzed through
the comparison of TF binding activity and TF neutralizing activity.
Deamidation at each point was analyzed using analytical anion
exchange chromatography.
[0217] The value (Table 7) obtained by requantitation using the
monomer fraction of GPC as an indicator was used for the comparison
of activity. Specifically, quantitation of antibody was performed
at room temperature under following conditions:
[0218] System: Waters (600S Controller, 616 Pump, 486 Tunable
absorbance detector, 717 Plus Autosampler)
[0219] Column: TSK gel G3000SWXL (0.78 cm.phi..times.30 cm, guard
column 0.6 cm.phi..times.4 cm)
[0220] Buffer: 50 mM Sodium phosphate/300 mM NaCl (pH 7.0)
[0221] Analysis was performed at a flow rate of 0.5 ml/min using
100 .mu.l (equivalent to 10 .mu.g) of accelerated material as a
sample.
7 TABLE 7 Initial value 1 week 2 weeks 4 weeks 99D01 116.1 115.2
116.5 112.4 G55L 116.5 113.8 115.6 113.7 G55I 102.7 99.6 98.4 94.5
G55F 118.3 115.3 114.8 111.8 G55E 110.8 110.2 110.7 109.8 G55K
135.2 134.9 136.0 130.9
[0222] Similar to transiently expressed anti-human TF mutant
antibodies, the result showed that the TF binding activity of
Gly55Ile before the accelerated testing was about 26% of the bulk
anti-human TF antibody (Lot No. 00C01). Namely, the activity was
low and significantly reduced compared with 99D01 (FIG. 13A).
Almost an equivalent activity to 99D01 was retained by Gly55Leu,
Gly55Glu, Gly55Phe and Gly55Lys (FIG. 13A). After 4 weeks of
accelerated testing, the anti-human TF mutant antibodies retained
80% or more of its activity before the accelerated testing, whereas
the activity of 99D01 decreased to about 60% of its activity before
the accelerated testing (FIG. 13B).
[0223] The analysis of deamidation using analytical anion exchange
chromatography indicated significant increase in a peak considered
to correspond to the deamidated molecule in 99D01 but almost none
in the anti-human TF mutant antibodies (FIG. 14). In the interest
of the changes in the TF neutralizing activity over time, 99D01
showed a relatively large reduction in activity (FIG. 15).
[0224] From these results, deamidation of Asn55 was determined to
be suppressed by the substitution of Gly55, and amino acid
substitution Gly55Leu and Gly55Phe were suggested suitable for
suppressing deamidation.
[0225] 9. TF Neutralizing Activity Before and After Accelerated
Testing
[0226] TF neutralizing activities of 99D01 and each of the
anti-human TF mutant antibodies are shown in FIG. 16. Although
Gly55Glu and Gly55Ile showed low activities of about 41% and about
13%, respectively, the other 3 anti-human TF mutant antibodies had
activities between 56 to 74%, i.e., nearly the same as 99D01
(66%).
[0227] The IC50 value compared to the initial value of each sample
was calculated from FIG. 15 in order to examine the amount of
activity decrease over time of 99D01 and each of the anti-human TF
mutant antibodies in the accelerated testing (FIG. 17). Since the
IC50 value after the accelerated testing at 40.degree. C. for 4
weeks could not be calculated for the Gly55Ile sample, the results
up to 2 weeks are indicated for this sample. The TF neutralizing
activity of 99D01 after the accelerated testing at 40.degree. C.
for 4 weeks decreased to about 40% of the initial value. On the
other hand, each of the mutants wherein Gly55 was substituted with
another amino acid maintained a TF neutralizing activity of 50 to
70% of the initial value even after the accelerated testing at
40.degree. C. for 4 weeks.
[0228] These results indicate that substitution of a glycine that
is located adjacent to an asparagine in an antibody with another
amino acid does not decrease the antibody activity, yet it
suppresses instability due to deamidation.
Industrial Applicability
[0229] The present inventors found that substitution of glycine
that is located adjacent to asparagine with another amino acid does
not influence the antibody activity. The present invention can be
applied to produce antibodies showing low activity decrease, and
thus, to obtain antibodies that can be used as pharmaceutical
agents that are required to be stable for a long time. Furthermore,
the present invention can also be applied to proteins other than
antibodies, and are expected to achieve suppression of deamidation
without affecting the protein activity.
Sequence CWU 1
1
28 1 14 DNA Artificial Sequence Description of Artificial
Sequencean artificially synthesized primer sequence 1 aattggaagc
ttgc 14 2 14 DNA Artificial Sequence Description of Artificial
Sequencean artificially synthesized primer sequence 2 ccttcgaacg
ttaa 14 3 41 DNA Artificial Sequence Description of Artificial
Sequencean artificially synthesized primer sequence 3 gagtctagaa
tggattggtg ggaatgatcc tgcgaatatg c 41 4 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 4 gagaatttcg ggtcatacat actatgcata ttcgcaggat 40 5
43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 5 gagtctagaa tggattggtg
ggaatgatcc tgcgaataag cat 43 6 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 6 gagaatttcg ggtcatacat actatgctta ttcgcaggat 40 7
43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 7 gagtctagaa tggattggtg
ggaatgatcc tgcgaattgg cat 43 8 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 8 gagaatttcg ggtcatacat actatgccaa ttcgcaggat 40 9
43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 9 gagtctagaa tggattggtg
ggaatgatcc tgcgaatcag cat 43 10 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 10 gagaatttcg ggtcatacat actatgctga ttcgcaggat 40
11 43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 11 gagtctagaa tggattggtg
ggaatgatcc tgcgaatgag cat 43 12 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 12 gagaatttcg ggtcatacat actatgctca ttcgcaggat 40
13 43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 13 gagtctagaa tggattggtg
ggaatgatcc tgcgaatttc cat 43 14 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 14 gagaatttcg ggtcatacat actatggaaa ttcgcaggat 40
15 43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 15 gagtctagaa tggattggtg
ggaatgatcc tgcgaatacc cat 43 16 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 16 gagaatttcg ggtcatacat actatgggta ttcgcaggat 40
17 43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 17 gagtctagaa tggattggtg
ggaatgatcc tgcgaataac cat 43 18 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 18 gagaatttcg ggtcatacat actatggtta ttcgcaggat 40
19 43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 19 gagtctagaa tggattggtg
ggaatgatcc tgcgaatgac cat 43 20 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 20 gagaatttcg ggtcatacat actatggtca ttcgcaggat 40
21 43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 21 gagtctagaa tggattggtg
ggaatgatcc tgcgaatccc cat 43 22 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 22 gagaatttcg ggtcatacat actatgggga ttcgcaggat 40
23 43 DNA Artificial Sequence Description of Artificial Sequencean
artificially synthesized primer sequence 23 gagtctagaa tggattggtg
ggaatgatcc tgcgaattgc cat 43 24 40 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
primer sequence 24 gagaatttcg ggtcatacat actatggcaa ttcgcaggat 40
25 444 PRT Homo sapiens 25 Gln Val Gln Leu Leu Glu Ser Gly Ala Val
Leu Ala Arg Pro Gly Thr 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala
Ser Gly Phe Asn Ile Lys Asp Tyr 20 25 30 Tyr Met His Trp Val Lys
Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Gly Asn Asp
Pro Ala Asn Gly His Ser Met Tyr Asp Pro Lys Phe 50 55 60 Gln Gly
Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Ser Thr Val Phe 65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85
90 95 Ala Arg Asp Ser Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr
Leu 100 105 110 Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val
Phe Pro Leu 115 120 125 Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr
Ala Ala Leu Gly Cys 130 135 140 Leu Val Lys Asp Tyr Phe Pro Glu Pro
Val Thr Val Ser Trp Asn Ser 145 150 155 160 Gly Ala Leu Thr Ser Gly
Val His Thr Phe Pro Ala Val Leu Gln Ser 165 170 175 Ser Gly Leu Tyr
Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser 180 185 190 Leu Gly
Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn 195 200 205
Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro 210
215 220 Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu
Phe 225 230 235 240 Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg
Thr Pro Glu Val 245 250 255 Thr Cys Val Val Val Asp Val Ser Gln Glu
Asp Pro Glu Val Gln Phe 260 265 270 Asn Trp Tyr Val Asp Gly Val Glu
Val His Asn Ala Lys Thr Lys Pro 275 280 285 Arg Glu Glu Gln Phe Asn
Ser Thr Tyr Arg Val Val Ser Val Leu Thr 290 295 300 Val Leu His Gln
Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val 305 310 315 320 Ser
Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala 325 330
335 Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln
340 345 350 Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val
Lys Gly 355 360 365 Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser
Asn Gly Gln Pro 370 375 380 Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val
Leu Asp Ser Asp Gly Ser 385 390 395 400 Phe Phe Leu Tyr Ser Arg Leu
Thr Val Asp Lys Ser Arg Trp Gln Glu 405 410 415 Gly Asn Val Phe Ser
Cys Ser Val Met His Glu Ala Leu His Asn His 420 425 430 Tyr Thr Gln
Lys Ser Leu Ser Leu Ser Leu Gly Lys 435 440 26 214 PRT Homo sapiens
26 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15 Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Ile Lys
Ser Phe 20 25 30 Leu Ser Trp Tyr Gln Gln Lys Pro Glu Lys Ala Pro
Lys Ser Leu Ile 35 40 45 Tyr Tyr Ala Thr Ser Leu Ala Asp Gly Val
Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Thr
Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr
Tyr Cys Leu Gln His Gly Glu Ser Pro Tyr 85 90 95 Thr Phe Gly Gly
Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala 100 105 110 Pro Ser
Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125
Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala 130
135 140 Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser
Gln 145 150 155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr
Tyr Ser Leu Ser 165 170 175 Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr
Glu Lys His Lys Val Tyr 180 185 190 Ala Cys Glu Val Thr His Gln Gly
Leu Ser Ser Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys
210 27 37 DNA Artificial Sequence Description of Artificial
Sequencean artificially synthesized sequence 27 gagtctagaa
tggattggtg ggaatgatcc tgcgaat 37 28 39 DNA Artificial Sequence
Description of Artificial Sequencean artificially synthesized
sequence 28 nnattcgcag gatcattccc accaatccat tctagactc 39
* * * * *