U.S. patent application number 11/053551 was filed with the patent office on 2005-08-04 for transgenic microbial polyhydroxyalkanoate producers.
This patent application is currently assigned to Metabolix, Inc.. Invention is credited to Huisman, Gjalt W., Peoples, Oliver P., Skraly, Frank A..
Application Number | 20050170480 11/053551 |
Document ID | / |
Family ID | 22259400 |
Filed Date | 2005-08-04 |
United States Patent
Application |
20050170480 |
Kind Code |
A1 |
Huisman, Gjalt W. ; et
al. |
August 4, 2005 |
Transgenic microbial polyhydroxyalkanoate producers
Abstract
Transgenic microbial strains are provided which contain the
genes required for PHA formation integrated on the chromosome. The
strains are advantageous in PHA production processes, because (1)
no plasmids need to be maintained, generally obviating the required
use of antibiotics or other stabilizing pressures, and (2) no
plasmid loss occurs, thereby stabilizing the number of gene copies
per cell throughout the fermentation process, resulting in
homogeneous PHA product formation throughout the production
process. Genes are integrated using standard techniques, preferably
transposon mutagenesis. In a preferred embodiment wherein mutiple
genes are incorporated, these are incorporated as an operon.
Sequences are used to stabilize mRNA, to induce expression as a
function of culture conditions (such as phosphate concentration),
temperature, and stress, and to aid in selection, through the
incorporation of selection markers such as markers conferring
antibiotic resistance.
Inventors: |
Huisman, Gjalt W.; (San
Carlos, CA) ; Peoples, Oliver P.; (Arlington, MA)
; Skraly, Frank A.; (Somerville, MA) |
Correspondence
Address: |
PATREA L. PABST
PABST PATENT GROUP LLP
400 COLONY SQUARE
SUITE 1200
ATLANTA
GA
30361
US
|
Assignee: |
Metabolix, Inc.
|
Family ID: |
22259400 |
Appl. No.: |
11/053551 |
Filed: |
February 8, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11053551 |
Feb 8, 2005 |
|
|
|
10461069 |
Jun 13, 2003 |
|
|
|
10461069 |
Jun 13, 2003 |
|
|
|
09375975 |
Aug 17, 1999 |
|
|
|
6593116 |
|
|
|
|
60096852 |
Aug 18, 1998 |
|
|
|
Current U.S.
Class: |
435/135 ;
435/252.3; 435/252.33; 435/471 |
Current CPC
Class: |
C12N 9/1025 20130101;
C12N 15/90 20130101; Y10S 435/829 20130101; C12N 9/0006 20130101;
C12N 9/88 20130101; C12N 9/1029 20130101; C12N 9/0004 20130101;
C12N 9/13 20130101; C12P 7/625 20130101; C12N 9/00 20130101; Y10S
435/831 20130101; Y10S 435/877 20130101 |
Class at
Publication: |
435/135 ;
435/252.3; 435/252.33; 435/471 |
International
Class: |
C12P 007/62; C12N
001/21; C12N 015/74 |
Claims
We claim:
1. A genetically engineered microorganism having at least one gene
involved in synthesis of polyhydroxyalkanoates selected from the
group consisting of thiolase, reductase, PHB synthase, PHA
synthase, acyl-CoA transferase, enoyl-CoA hydratase, integrated
into the chromosome, which produce polyhydroxyalkanoate.
2. The microorganism of claim 1 selected from the group consisting
of E. coli, Alcaligenes latus, Alcaligenese eutrophus, Azotobacter,
Pseudomonas putida, and Ralstonia eutropha.
3. The microorganism of claim 1 wherein the gene is inserted using
transposan mutagenesis.
4. The microorganism of claim 1 comprising multiple genes involved
in synthesis of polyhydroxyalkanoate wherein the genes are
integrated operably linked as an operon.
5. The microorganism of claim 1 wherein the gene is integrated
operably linked under the control of a promoter.
6. The microorganism of claim 1 wherein the gene is integrated
operably linked with upstream activating sequences
7. The microorganism of claim 1 wherein the gene is integrated
operably linked with mRNA stabilizing sequences.
8. The microorganism of claim 5 wherein the gene is operably linked
with promoter including a consensus E. coli pho box and -35
promoter region that is regulated by the phosphate concentration in
the medium.
9. The microorganism of claim 5 wherein the promoter is selected
from the group consisting of promoter that induces expression under
general stress conditions such as nutrient limitation, pH or heat
shock, and administration of toxic chemicals.
10. The microorganism of claim 1 wherein the gene is integrated
operably linked with a selection marker.
11. The microorganism of claim 1 wherein the gene is isolated or
derived from a microorganism selected from the group consisting of
A. eutrophus, Aeromonas caviae, Zoogloea ramigera, Nocardia,
Rhodococcus, Pseudomonas Sp. 61-3, Pseudomonas acidophila,
Pseudomonas oleovarans, Chromobacterium violaceum, and Alcaligenes
latus.
12. The microorganism of claim 1 wherein the gene is selected from
the group consisting of PHB polymerase from R. eutropha (C1), PHA
polymerase from P. oleovorans (C3), PHB polymerase from A. caviae
(C12), ACP::CoA transacylase from P. putida (G3), (R)-specific
enouyl-CoA hydratase from A. caviae (J12), a broad substrate
specific 3-ketoacyl-CoA thiolase from R. eutropha (A1-II), and
phasins from R. eutropha (P1-I and P1-II).
13. The microorganism of claim 1 wherein the gene is integrated as
a single copy on the chromosome of the microorganism.
14. A method for screening for a gene involved in synthesis of
polyhydroxyalkanoates that enhances production comprising mutating
a genetically engineered microorganism having at least one gene
involved in synthesis of polyhydroxyalkanoates selected from the
group consisting of thiolase, reductase, PHB synthase, PHA
synthase, acyl-CoA transferase, enoyl-CoA hydratase, integrated
into the chromosome, which produces polyhydroxyalkanoate, and
screening for enhanced production of polyhydroxyalkanoates.
15. The method of claim 14 wherein the gene is isolated or derived
from a microorganism selected from the group consisting of A.
eutrophus, Aeromonas caviae, Zoogloea ramigera, Nocardia,
Rhodococcus, Pseudomonas Sp. 61-3, Pseudomonas acidophila,
Pseudomonas oleovarans, Chromobacterium violaceum, and Alcaligenes
latus.
16. The method of claim 14 wherein the microorganisms are missing
one or more genes required for production of
polyhydroxyalkanoates.
17. The method of claim 14 wherein the microorganims produce
polyhydroxyalkanoates, further comprising selecting genes which
result in increased polyhydroxyalkanoate production.
18. A method for producing polyhydroxyalkanoates comprising
culturing genetically engineered microorganisms having at least one
gene involved in synthesis of polyhydroxyalkanoates selected from
the group consisting of thiolase, reductase, PHB synthase, PHA
synthase, acyl-CoA transferase, enoyl-CoA hydratase, integrated
into the chromosome, with appropriate substrate under conditions
wherein the microorganisms produce polyhydroxyalkanoate.
19. The method of claim 18 wherein the microorganisms comprise
multiple genes involved in synthesis of polyhydroxyalkanoate
wherein the genes are integrated operably linked as an operon.
20. The method of claim 18 wherein the microorganisms comprise
genes selected from the group consisting of genes integrated
operably linked under the control of a promoter, genes integrated
operably linked with upstream activating sequences, genes
integrated operably linked with mRNA stabilizing sequences, genes
operably linked with a promoter including a consensus E. coli pho
box and -35 promoter region that is regulated by the phosphate
concentration in the medium, and genes integrated operably linked
with a selection marker.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] Priority is claimed to U.S. provisional application Ser. No.
60/096,852, filed Aug. 18, 1998, the teachings of which are
incorporated herein.
BACKGROUND OF THE INVENTION
[0002] The present invention is generally in the field of
biosynthesis of poly(3-hydroxyalkanoates), and more particularly to
improved microbial strains useful in commercial production of
polyhydroxyalkanoates.
[0003] Poly(3-hydroxyalkanoates) (PHAs) are biological polyesters
synthesized by a broad range of bacteria. These polymers are
biodegradable and biocompatible thermoplastic materials, produced
from renewable resources, with a broad range of industrial and
biomedical applications (Williams & Peoples, CHEMTECH 26:38-44
(1996)). PHA biopolymers have emerged from what was originally
considered to be a single homopolymer, poly-3-hydroxybutyrate (PHB)
into a broad class of polyesters with different monomer
compositions and a wide range of physical properties. About 100
different monomers have been incorporated into the PHA polymers
(Steinbuchel & Valentin, FEMS Microbiol. Lett. 128:219-28
(1995)).
[0004] It has been useful to divide the PHAs into two groups
according to the length of their side chains and their biosynthetic
pathways. Those with short side chains, such as PHB, a homopolymer
of R-3-hydroxybutyric acid units, are crystalline thermoplastics,
whereas PHAs with long side chains are more elastomeric. The former
have been known for about seventy years (Lemoigne & Roukhelman,
1925), whereas the latter materials were discovered relatively
recently (deSmet et al., J. Bacteriol. 154:870-78 (1983)). Before
this designation, however, PHAs of microbial origin containing both
(R)-3-hydroxybutyric acid units and longer side chain
(R)-3-hydroxyacid units from C.sub.5 to C.sub.16 had been
identified (Wallen & Rohweder, Environ. Sci. Technol. 8:576-79
(1974)). A number of bacteria which produce copolymers of
(R)-3-hydroxybutyric acid and one or more long side chain
hydroxyacid units containing from five to sixteen carbon atoms have
been identified (Steinbuchel & Wiese, Appl. Microbiol.
Biotechnol. 37:691-97 (1992); Valentin et al., Appl. Microbiol.
Biotechnol. 36:507-14 (1992); Valentin et al., Appl. Microbiol.
Biotechnol. 40:710-16 (1994); Abe et al., Int. J. Biol. Macromol.
16:115-19 (1994); Lee et al., Appl. Microbiol. Biotechnol.
42:901-09 (1995); Kato et al., Appl. Microbiol. Biotechnol.
45:363-70 (1996); Valentin et al., Appl. Microbiol. Biotechnol.
46:261-67 (1996); U.S. Pat. No. 4,876,331 to Doi). A combination of
the two biosynthetic pathways outlined described above provide the
hydroxyacid monomers. These copolymers can be referred to as
PHB-co-HX (where X is a 3-hydroxyalkanoate or alkanoate or
alkenoate of 6 or more carbons). A useful example of specific
two-component copolymers is PHB-co-3-hydroxyhexanoate (PHB-co-3HH)
(Brandl et al., Int. J. Biol. Macromol. 11:49-55 (1989); Amos &
McInerey, Arch. Microbiol. 155:103-06 (1991); U.S. Pat. No.
5,292,860 to Shiotani et al.).
[0005] PHA production by many of the microorganisms in these
references is not commercially useful because of the complexity of
the growth medium, the lengthy fermentation processes, or the
difficulty of down-stream processing of the particular bacterial
strain. Genetically engineered PHA production systems with fast
growing organisms such as Escherichia coli have been developed.
Genetic engineering also allows for the improvement of wild type
PHA production microbes to improve the production of specific
copolymers or to introduce the capability to produce different PHA
polymers by adding PHA biosynthetic enzymes having different
substrate-specificity or even kinetic properties to the natural
system. Examples of these types of systems are described in
Steinbuchel & Valentin, FEMS Microbiol. Lett. 128:219-28
(1995). PCT WO 98/04713 describes methods for controlling the
molecular weight using genetic engineering to control the level of
the PHA synthase enzyme. Commercially useful strains, including
Alcaligenes eutrophus (renamed as Ralstonia eutropha), Alcaligenes
latus, Azotobacter vinlandii, and Pseudomonads, for producing PHAs
are disclosed in Lee, Biotechnology & Bioengineering 49:1-14
(1996) and Braunegg et al., (1998), J. Biotechnology 65:
127-161.
[0006] The development of recombinant PHA production strains has
followed two parallel paths. In one case, the strains have been
developed to produce copolymers, a number of which have been
produced in recombinant E. coli. These copolymers include
poly(3-hydroxybutyrate-co-3-hydroxyvale- rate) (PHBV),
poly(3-hydroxybutyrate-co-4-hydroxybutyrate) (P3HB-co-4HB),
poly(4-hydroxybutyrate) (P4HB) and long side chain PHAs comprising
3-hydroxyoctanoate units (Madison and Huisman, 1999. Strains of E.
coli containing the phb genes on a plasmid have been developed to
produce P(3HB-3HV) (Slater, et al., Appl. Environ. Microbiol.
58:1089-94 (1992); Fidler & Dennis, FEMS Microbiol. Rev.
103:231-36 (1992); Rhie & Dennis, Appl. Environ. Micobiol.
61:2487-92 (1995); Zhang, H. et al., Appl. Environ. Microbiol.
60:1198-205 (1994)). The production of P(4HB) and P(3HB-4HB) in E.
coli is achieved by introducing genes from a metabolically
unrelated pathway into a P(3HB) producer (Hein, et al., FEMS
Microbiol. Lett. 153:411-18 (1997); Valentin & Dennis, J.
Biotechnol. 58:33-38 (1997)). E. coli also has been engineered to
produce medium short chain polyhydroxyalkanoates (msc-PHAs) by
introducing the phaC1 and phaC2 gene of P. aeruginosa in a
fadB::kan mutant (Langenbach, et al., FEMS Microbiol. Lett.
150:303-09 (1997); Qi, et al., FEMS Microbiol. Lett. 157:155-62
(1997)).
[0007] Although studies demonstrated that expression of the A.
eutrophus PHB biosynthetic genes encoding PHB polymerase,
-ketothiolase, and acetoacetyl-CoA reductase in E. coli resulted in
the production of PHB (Slater, et al., J. Bacteriol. 170:4431-36
(1988); Peoples & Sinskey, J. Biol. Chem. 264:15298-303 (1989);
Schubert, et al., J. Bacteriol. 170:5837-47 (1988)), these results
were obtained using basic cloning plasmid vectors and the systems
are unsuitable for commercial production since these strains lacked
the ability to accumulate levels equivalent to the natural
producers in industrial media.
[0008] For commercial production, these strains have to be made
suitable for large scale fermentation in low cost industrial
medium. The first report of recombinant P(3HB) production
experiments in fed-batch cultures used an expensive complex medium,
producing P(3HB) to 90 g/L in 42 hours using a pH-stat controlled
system (Kim, et al., Biotechnol. Lett. 14:811-16 (1992)). Using
stabilized plasmids derived from either medium- or high-copy-number
plasmids, it was shown that E. coli XL1-Blue with the latter type
plasmid is required for substantial P(3HB) accumulation (Lee, et
al., Ann. N.Y. Acad. Sci. 721:43-53 (1994)). In a fed-batch
fermentation on 2% glucose/LB. medium, this strain produced 81%
P(3HB) at a productivity of 2.1 g/L-hr (Lee, et al., J. Biotechnol.
32:203-11 (1994)). The P(3HB) productivity was reduced to 0.46
g/L-hr in minimal medium, but could be recovered by the addition of
complex nitrogen sources such as yeast extract, tryptone, casamino
acids, and collagen hydrolysate (Lee & Chang, Adv. Biochem.
Eng. Biotechnol. 52:27-58 (1995); Lee, et al., J. Ferment. Bioeng.
79:177-80 (1995)).
[0009] Although recombinant E. coli XL1-blue is able to synthesize
substantial levels of P(3HB), growth is impaired by dramatic
filamentation of the cells, especially in defined medium (Lee, et
al., Biotechnol. Bioeng. 44:1337-47 (1994); Lee, Biotechnol. Lett.
16:1247-52 (1994); Wang & Lee, Appl. Environ. Microbiol.
63:4765-69 (1997)). By overexpression of FtsZ in this strain,
biomass production was improved by 20% and P(3HB) levels were
doubled (Lee & Lee, J. Environ. Polymer Degrad. 4:131-34
(1996)). This recombinant strain produced 104 g/L P(3HB) in defined
medium corresponding to 70% of the cell dry weight. The volumetric
productivity of 2 g/L-hr, however, is lower than achievable with R.
eutropha. Furthermore, about 15% of the cells lost their ability to
produce PHB by the end of the fermentation (Wang & Lee,
Biotechnol. Bioeng. 58:325-28 (1998)).
[0010] Recombinant E. coli P(3HB-3HV) producers reportedly are
unable to grow to a high density and therefore are unsuited for
commercial processes (Yim, et al., Biotechnol. Bioeng. 49:495-503
(1996)). In an attempt to improve P(3HB-3HV) production in a
recombinant strain, four E. coli strains (XL1-Blue, JM109, HB101,
and DH5.alpha.) were tested by Yim et al. All four recombinant E.
coli strains synthesized P(3HB-3HV) when grown on glucose and
propionate with HV fractions of 7% (Yim, et al., Biotechnol.
Bioeng. 49:495-503 (1996)). Unlike other strains studied (Slater,
et al., Appl. Environ. Microbiol. 58:1089-94 (1992)), recombinant
XL1-Blue incorporates less than 10% HV when the propionic acid
concentration is varied between 0 and 80 mM. HV incorporation and
PHA formation were increased by pre-growing cells on acetate
followed by glucose/propionate addition at a cell density of around
10.sup.8 cells per ml. Oleate supplementation also stimulated HV
incorporation. This recombinant XL1-Blue when pregrown on acetate
and with oleate supplementation reached a cell density of 8 g/L,
75% of which was P(3HB-3HV) with an HV fraction of 0.16 (Yim, et
al., Biotechnol. Bioeng. 49:495-503 (1996)).
[0011] One of the challenges of producing P(3HB) in recombinant
organisms is the stable and constant expression of the phb genes
during fermentation. Often P(3HB) production by recombinant
organisms is hampered by the loss of plasmid from the majority of
the bacterial population. Such stability problems may be attributed
to the metabolic load exerted by the need to replicate the plasmid
and synthesize P(3HB), which diverts acetyl-CoA to P(3HB) rather
than to biomass. In addition, plasmid copy numbers often decrease
upon continued fermentation because only a few copies provide the
required antibiotic resistance or prevent cell death by maintaining
parB. For these reasons, a runaway plasmid was designed to suppress
the copy number of the plasmid at 30 C and induce plasmid
replication by shifting the temperature to 38 C (Kidwell, et al.,
Appl. Environ. Microbiol. 61:1391-98 (1995)). Using this system,
P(3HB) was produced to about 43% of the cell dry weight within 15
hours after induction with a volumetric production of 1 gram P(3HB)
per liter per hour. Although this productivity is of the same order
of magnitude as natural P(3HB) producers, strains harboring these
parB-stabilized runaway replicons still lost the capacity to
accumulate P(3HB) during prolonged fermentations.
[0012] While the instability of the phb genes in high cell-density
fermentations affects the PHA cost by decreasing the cellular
P(3HB) yields, the cost of the feedstock also contributes to the
comparatively high price of PHAs. The most common substrate used
for P(3HB) production is glucose. Consequently, E. coli and
Klebsiella strains have been examined for P(3HB) formation on
molasses, which cost 33-50% less than glucose (Zhang, et al., Appl.
Environ. Microbiol. 60:1198-1205 (1994)). The main carbon source in
molasses is sucrose. Recombinant E. coli and K. aerogenes strains
carrying the phb locus on a plasmid grown in minimal medium with 6%
sugarcane molasses accumulated P(3HB) to approximately 3 g/L
corresponding to 45% of the cell dry weight. When the K. aerogenes
was grown fed-batch in a 10 L fermenter on molasses as the sole
carbon source, P(3HB) was accumulated to 70% its cell dry weight,
which corresponded to 24 g/L. Although the phb plasmid in K.
aerogenes was unstable, this strain shows promise as a P(3HB)
producer on molasses, especially since fadR mutants incorporate 3HV
up to 55% in the presence of propionate (Zhang, et al., Appl.
Environ. Microbiol. 60:1198-1205 (1994)).
[0013] U.S. Pat. No. 5,334,520 to Dennis discloses the production
of PHB in E. coli transformed with a plasmid containing the phbCAB
genes. A rec.sup.-, lac.sup.+ E. coli strain was grown on whey and
reportedly accumulates PHB to 85% of its cell dry weight. U.S. Pat.
No. 5,371,002 to Dennis et al. discloses methods to produce PHA in
recombinant E. coli using a high copy number plasmid vector with
phb genes in a host that expresses the acetate genes either by
induction, constitutively, or from a plasmid. U.S. Pat. No.
5,512,456 to Dennis discloses a method for production and recovery
of PHB from transformed E. coli strains. These E. coli strains are
equipped with a vector containing the phb genes and a vector
containing a lysozyme gene. High copy number plasmids or runaway
replicons are used to improve productivity. The vectors are
stabilized by parB or by supF/dnaB(am). Using such strains, a
productivity of 1.7 g/L-hr was obtained corresponding to 46 g/L PHB
in 25 hrs, after which the plasmid was increasingly lost by the
microbial population. PCT WO094/21810 discloses the production of
PHB in recombinant strains of E. coli and Klebsiella aerogenes with
sucrose as a carbon source. PCT WO 95/21257 discloses the improved
production of PHB in transformed prokaryotic hosts. Improvements in
the transcription regulating sequences and ribosome binding site
improve PHB formation by the plasmid based phb genes. The plasmid
is stabilized by the parB locus. PHB production by this construct
is doubled by including the 361 nucleotides that are found upstream
of phbC in R. eutropha instead of only 78 nucleotides. It is
generally believed that PHB production by recombinant
microorganisms requires high levels of expression using stabilized
plasmids. Since plasmids are available in the cell in multiple
copies, ranging from one to several hundreds, the use of plasmids
ensured the presence of multiple copies of the genes of interest.
Since plasmids may be lost, stabilization functions are introduced.
Such systems, which are described above, have been tested for PHB
production, and the utility of these systems in industrial
fermentation processes has been investigated. However, overall PHB
yield is still affected by loss of phb genes.
[0014] It is therefore an object of the present invention to
provide recombinant microorganisms strains useful in industrial
fermentation processes which can accumulate commercially
significant levels of PHB while providing stable and constant
expression of the phb genes during fermentation.
[0015] It is another object of the present invention to provide
transgenic microbial strains for enhanced production of
poly(3-hydroxyalkanoates).
[0016] It is another object of the present invention to provide
transgenic microbial strains which yield stable and constant
expression of the phb genes during fermentation and accumulate
commercially significant levels of PHB, and methods of use
thereof.
SUMMARY OF THE INVENTION
[0017] Transgenic microbial strains are provided which contain the
genes required for PHA formation integrated on the chromosome. The
strains are advantageous in PHA production processes, because (1)
no plasmids need to be maintained, generally obviating the required
use of antibiotics or other stabilizing pressures, and (2) no
plasmid loss occurs, thereby stabilizing the number of gene copies
per cell throughout the fermentation process, resulting in
homogeneous PHA product formation throughout the production
process. Genes are integrated using standard techniques, preferably
transposon mutagenesis. In a preferred embodiment wherein mutiple
genes are incorporated, these are incorporated as an operon.
Sequences are used to stabilize mRNA, to induce expression as a
function of culture conditions (such as phosphate concentration),
temperature, and stress, and to aid in selection, through the
incorporation of selection markers such as markers conferring
antibiotic resistance.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 is a diagram showing the construction of
pMNXTp.sub.1kan, pMNXTp.sub.1cat, pMSXTp.sub.1kan, and
pMSXTp.sub.1cat.
[0019] FIG. 2 is a diagram showing the construction of
pMUXC.sub.5cat.
[0020] FIG. 3 is a diagram showing the construction of
pMUXAB.sub.5cat, pMUXTp.sub.1AB.sub.5kan, pMUXTp.sub.11AB.sub.5kan,
pMUXTp.sub.12AB.sub.5kan, and pMUXTp.sub.13AB.sub.5kan.
DETAILED DESCRIPTION OF THE INVENTION
[0021] By randomly inserting genes that encode PHA biosynthetic
enzymes into the chromosome of E. coli, means have been identified
to directly achieve high levels of expression from strong
endogenous promoters at sites that are non-essential for growth of
the host in industrial medium based fermentations. As demonstratd
by the examples, E. coli strains have been obtained using these
techniques that produce PHAs in levels exceeding 85% of the cell
dry weight from single copy genes on the chromosome. Expression of
the phb genes in these strains is not dependent on the upstream
sequences of phbC in R. eutropha nor on a high copy number
construct. Maintenance of the phb genes by these strains is
independent of the supplementation of antibiotics, the presence of
stabilizing loci such as parB or hok/sok or any other selective
pressure. The ultra-high level of expression required in the
plasmid-based systems has been found to be completely unnecessary.
Furthermore, unlike the most successful fermentations reported to
date (Wang & Lee, Biotechnol. Bioeng. 58:325-28 (1998)) for
recombinant plasmid-based E. coli, fermentation with these strains
provides that virtually all of the cells contain PHB at the end of
the fermentation.
[0022] Despite the low copy number, these transgenic bacteria
accumulate PHB to levels observed for wild-type organisms. The host
used for recombinant PHB production also is an important parameter
in designing a plasmid-based E. coli system. For example, although
W3110 strains were poor PHB producers when using a plasmid-based
system, it was found that by integrating the phb genes into the
chromosome of this same host, the host retained excellent growth
characteristics while accumulating commercially significant levels
of PHB.
[0023] Methods and Materials for Producing the Microbial
Strains
[0024] Bacterial Strains to be Modified
[0025] A number of bacteria can be genetically engineered to
produce polyhydroxyalkanoates. These include organisms that already
produce polyhydroxyalkanoates, modified to utilize alternative
substrates or incorporate additional monomers, or to increase
production, and organisms that do not produce
polyhydroxyalkanoates, but which expresses none to some of the
enzymes required for production of polyhydroxylkanoates. Examples
include E. coli, Alcaligenes latus, Alcaligenese eutrophus,
Azotobacter, Pseudomonas putida, and Raistonia eutropha.
[0026] Methods for Generating Transgenic PHB Producers
[0027] Methods for incorporating engineered gene constructs into
the chromosomal DNA of bacterial cells are well known to those
skilled in the art. Typical integration mechanisms include
homologous recombination using linearized DNA in recBC or recD
strains followed by P1 transduction (Miller 1992, A Short Course in
Bacterial Genetics: A laboratory manual & Handbook for
Escherichia coli and Related Bacteria. Cold Spring Harbor
laboratory Press, Cold Spring Harbor, N.Y.) special plasmids
(Hamilton et al., J. Bacteriol. 171:4617 (1989); Metcalf et al.,
Plasmid 35:1 (1996); U.S. Pat. No. 5,470,727 to Mascarenhas et
al.), or by random insertion using transposon based systems
(Herrero et al. J. Bacteriol. 172:6557 (1990); Peredelchuk &
Bennett, Gene 187:231 (199.7); U.S. Pat. No. 5,595,889 to Richaud
et al.; U.S. Pat. No. 5,102,797 to Tucker et al.). In general, the
microbial strains containing an insertion are selected on the basis
of an acquired antibiotic resistance gene that is supplied by the
integrated construct. However, complementation of auxotrophic
mutants can also be used.
[0028] Expression of the genes of interest for chromosomal
integration can be achieved by including a transcription activating
sequence (promoter) in the DNA construct to be integrated.
Site-directed, homologous recombination can be combined with
amplification of expression of the genes of interest, as described
by U.S. Pat. No. 5,00,000 to Ingram et al. Although mini-transposon
systems have been used for a number of years, they have been
designed such that the expression level of the integrated gene of
interest is not modulated. Ingram, et al. selected for increased
expression of a foreign gene inserted into the E. coli chromosome
by homologous recombination. This was achieved by inserting a
promoter-less chloroamphenicol (Cm) resistance gene downstream of
the gene of interest to create a transcriptional fusion. After a
transcriptional fusion of the alcohol dehydrogenase gene with a
promoterless chloramphenicol acetyl transferase genes is integrated
in the pfl gene, increased expression is achieved by selecting
mutants on increasing concentrations of chloramphenicol. However,
in chemostat studies these stabilzed strains still lost the
capacity to produce ethanol (Lawford & Rousseau, Appl. Biochem.
Biotechnol. 57-58:293-305 (1996)). Also, strains that contained the
ethanologenic genes on the chromosome demonstrated a decreased
growth rate in glucose minimal medium (Lawford & Rousseau,
Appl. Biochem. Biotechnol., 57-58:277-92 (1996)).
[0029] These approaches have been combined and modified to randomly
integrate a mini-transposon into the chromosome to select for
healthy, fast growing transgenic strains coupled with a screening
system for modulating expression of the integrated genes. A series
of expression cassettes have been developed for inserting
heterologous genes into bacterial chromosomes. These cassettes are
based on the transposon delivery systems described by Herrero et
al., J. Bacteriol. 172:6557-67 (1990); de Lorenzo et al., J.
Bacteriol. 172:6568 (1990). Although these systems specify
RP4-mediated conjugal transfer and use only transposon Tn10 and
Tn5, any combination of transposon ends and delivery system could
be adapted for the technology described, resulting in sustained and
homogeneous PHA production.
[0030] The following general approach is used for generating
transgenic E. coli PHB producers: (1) a promoterless antibiotic
resistance (abr) gene is cloned in the polylinker of a suitable
plasmid such as pUC18NotI or pUC18SfiI so that the major part of
the polylinker is upstream of abr; (2) phb genes are subsequently
cloned upstream of and in the same orientation as the abr gene; (3)
the phb-abr cassette is excised as a NotI or AvrII fragment (AvrII
recognizes the SfiI site in pUC18SfiI) and cloned in the
corresponding sites of any plasmid like those from the pUT- or
pLOF-series; (4) the resulting plasmids are maintained in E. coli
.lambda.pir strains and electroporated or conjugated into the E.
coli strain of choice in which these plasmids do not replicate; and
(5) new strains in which the phb-abr cassette has successfully
integrated in the chromosome are selected on selective medium for
the host (e.g., naladixic acid when the host is naladixic acid
resistant) and for the cassette (e.g., chloramphenicol, kanamycin,
tetracyclin, mercury chloride, bialaphos). The resulting phb
integrants are screened on minimal medium in the presence of
glucose for growth and PHB formation.
[0031] Several modifications of this procedure can be made. If the
promotorless antibiotic resistance marker is not used, the
insertion of the PHA genes is selected based on a marker present in
the vector and integrated strains producing the desired level of
PHA are detected by screening for PHA production. The phb genes may
have, but do not need, endogeneous transcription sequences, such as
upstream activating sequences, RNA polymerase binding site, and/or
operator sequences. If the phb genes do not have such sequences,
the described approach is limited to the use of vectors like the
pUT series in which transcription can proceed through the insertion
sequences. This limitation is due to the inability of RNA
polymerase to read through the Tn10 flanking regions of the pLOF
plasmids. The abr gene may carry its own expression sequences if so
desired. Instead of an abr gene, the construct may be designed such
that an essential gene serves as selective marker when the host
strain has a mutation in the corresponding wild-type gene. Examples
of genes useful for this purpose are generally known in the art.
Different constructs can be integrated into one host, either
subsequently or simultaneously, as long as both constructs carry
different marker genes. Using multiple integration events, phb
genes can be integrated separately, e.g., the PHB polymerase gene
is integrated first as a phbC-cat cassette, followed by integration
of the thiolase and reductase genes as aphbAB-kan cassette.
Alternatively, one cassette may contain all phb genes whereas
another cassette contains only some phb genes required to produce a
desired PHA polymer.
[0032] In some cases a transposon integration vector such as pJMS11
(Panke et al. Appl. Enviro. Microbiol. 64: 748-751) may be used
such that the selectable marker can be excised from the chromosome
of the integrated strain. This is useful for a number of reasons
including providing a mechanism to insert multiple transposon
constructs using the same marker gene by excising the marker
following each insertion event.
[0033] Sources of phb and Other Genes Involved in PHA Formation
[0034] A general reference is Madison and Huisman, 1999,
Microbiology and Molecular Biology Reviews 63: 21-53. The phb genes
may be derived from different sources and combined in a single
organism, or from the same source.
[0035] Thiolase Encoding Genes
[0036] Thiolase encoding genes have been isolated from Alcaligenes
latus, Ralstonia eutropha (Peoples & Sinskey, J. Biol. Chem.
264(26):15298-303 (1989); Acinetobacter sp. (Schembri, et al., J.
Bacteriol. 177(15):4501-7 (1995)), Chromotium vinosum (Liebergesell
& Steinbuchel, Eur. J. Biochem. 209(1):135-50 (1992)),
Pseudomonas acidophila, Pseudomonas denitrificans (Yabutani, et
al., FEMS Microbiol. Lett. 133 (1-2):85-90 (1995)), Rhizobium
meliloti (Tombolini, et al., Microbiology 141:2553-59 (1995)),
Thiocystis violacea (Liebergesell & Steinbuchel, Appl.
Microbiol. Biotechnol. 38(4):493-501 (1993)), and Zoogloea ramigera
(Peoples, et al., J. Biol. Chem. 262(1):97-102 (1987)).
[0037] Other genes that have not been implicated in PHA formation
but which share significant homology with the phb genes and/or the
corresponding gene products may be used as well. Genes encoding
thiolase- and reductase- like enzymes have been identified in a
broad range of non-PHB producing bacteria. E. coli (U29581, D90851,
D90777), Haemophilus influenzae (U32761), Pseudomonas fragi
(D10390), Pseudomonas aeruginosa (U88653), Clostridium
acetobutylicum (U08465), Mycobacterium leprae (U00014),
Mycobacterium tuberculosis (Z73902), Helicobacter pylori
(AE000582), Thermoanaerobacterium thermosaccharolyticum (Z92974),
Archaeoglobus fulgidus (AE001021), Fusobacterium nucleatum
(U37723), Acinetobacter calcoaceticus (L05770), Bacillus subtilis
(D84432, Z99120, U29084), and Synechocystis sp. (D90910) all encode
one or more thiolases from their chromosome. Eukaryotic organisms
such as Saccharomyces cerevisiae (L20428), Schizosaccharomyces
pombe (D89184), Candida tropicalis (D13470), Caenorhabditis elegans
(U41105), human (S70154), rat (D13921), mouse (M35797), radish
(X78116), pumpkin (D70895), and cucumber (X67696) also express
proteins with significant homology to the 3-ketothiolase from R.
eutropha.
[0038] Reductase Encoding Genes
[0039] Reductase encoding genes have been isolated from A. latus,
R. eutropha (Peoples & Sinskey, J. Biol. Chem.
264(26):15298-303 (1989); Acinetobacter sp. (Schembri, et al., J.
Bacteriol. 177(15):4501-7 (1995)), C. vinosum (Liebergesell &
Steinbuchel, Eur. J. Biochem. 209(1):135-50 (1992)), P. acidophila,
P. denitrificans (Yabutani, et al., FEMS Microbiol. Lett. 133
(1-2):85-90 (1995)), R. meliloti (Tombolini, et al., Microbiology
141:2553-59 (1995)), and Z. ramigera (Peoples, et al., J. Biol.
Chem. 262(1):97-102 (1987)).
[0040] Other genes that have not been implicated in PHA formation
but which share significant homology with the phb genes and/or the
corresponding gene products may be used as well. Genes with
significant homology to the phbB gene encoding acetoacetyl CoA
reductase have been isolated from several organisms, including
Azospirillum brasiliense (X64772, X52913) Rhizobium sp. (U53327,
Y00604), E. coli (D90745), Vibrio harveyi (U39441), H. influenzae
(U32701), B. subtilis (U59433), P. aeruginosa (U91631),
Synechocystis sp. (D90907), H. pylori (AE000570), Arabidopsis
thaliana (X64464), Cuphea lanceolata (X64566) and Mycobacterium
smegmatis (U66800).
[0041] PHA Polymerase Encoding Genes
[0042] PHA polymerase encoding genes have been isolated from
Aeromonas caviae (Fukui & Doi, J. Bacteriol. 179(15):4821-30
(1997)), A. latus, R. eutropha (Peoples & Sinskey, J. Biol.
Chem. 264(26):15298-303 (1989); Acinetobacter (Schembri, et al., J.
Bacteriol. 177(15):4501-7 (1995)), C. vinosum (Liebergesell &
Steinbuchel, Eur. J. Biochem. 209(1):135-50 (1992)),
Methylobacterium extorquens (Valentin & Steinbuchel, Appl.
Microbiol. Biotechnol. 39(3):309-17 (1993)), Nocardia corallina
(GenBank Ace. No. AF019964), Nocardia salmonicolor, P. acidophila,
P. denitrificans (Ueda, et al., J. Bacteriol. 178(3):774-79
(1996)), Pseudomonas aeruginosa (Timm & Steinbuchel, Eur. J.
Biochem. 209(1):15-30 (1992)), Pseudomonas oleovorans (Huisman, et
al., J. Biol. Chem. 266:2191-98 (1991)), Rhizobium etli (Cevallos,
et al., J. Bacteriol. 178(6):1646-54 (1996)), R. meliloti
(Tombolini, et al., Microbiology 141 (Pt 10):2553-59 (1995)),
Rhodococcus ruber (Pieper & Steinbuchel, FEMS Microbiol. Lett.
96(1):73-80 (1992)), Rhodospirrilum rubrum (Hustede, et al., FEMS
Microbiol. Lett. 93:285-90 (1992)), Rhodobacter sphaeroides
(Steinbuchel, et al., FEMS Microbiol. Rev. 9(2-4):217-30 (1992);
Hustede, et al., Biotechnol. Lett. 15:709-14 (1993)), Synechocystis
sp. (Kaneko, DNA Res. 3(3):109-36 (1996)), T. violaceae
(Liebergesell & Steinbuchel, Appl. Microbiol. Biotechnol.
38(4):493-501 (1993)), and Z. ramigera (GenBank Acc. No.
U66242).
[0043] Vectors for Incorporation of Genes into the Bacterial
Chromosomes
[0044] The pUT and pLOF series of plasmid transposon delivery
vectors useful in the PHA-producing methods described herein use
the characteristics of transposon Tn5 and transposon Tn10,
respectively. The transposase genes encoding the enzymes that
facilitate transposition are positioned outside of the `transposase
recognition sequences` and are consequently lost upon
transposition. Both Tn5 and Tn10 are known to integrate randomly in
the target genome, unlike, for example, the Tn7 transposon.
However, generally any transposon can be modified to facilitate the
insertion of heterologous genes, such as the phb genes, into
bacterial genomes. This methodology thus is not restricted to the
vectors used in the methods described herein.
[0045] Methods and Materials for Screening for Enhanced Polymer
Production
[0046] Screening of Bacterial Strains
[0047] The technology described above allows for the generation of
new PHA producing strains and also provides new bacterial strains
that are useful for screening purposes. Table 1 below shows the
different combinations of chromosomally and plasmid encoded PHB
enzymes and how specific strains can be used to identify new or
improved enzymes.
[0048] Besides a screening tool for genes that express improved
enzymes, E. coli strains with a complete PHA pathway integrated on
the chromosome can be used to screen for heterologous genes that
affect PHA formation. E. coli is a useful host because genes are
easily expressed from a multitude of plasmid vectors: high
copy-number, low copy-number, chemical or heat inducible, etc. and
mutagenesis procedures have been well established for this
bacterium. In addition, the completely determined genomic sequence
of E. coli facilitates the characterization of genes that affect
PHA metabolism.
[0049] Transgenic E. coli strains expressing an incomplete PHA
pathway can be transformed with gene libraries to identify homologs
of the missing gene from other organisms, either prokaryotic or
eukaryotic. Because these screening strains do not have the
complete PHA biosynthetic pathway, the missing functions can be
complemented and identified by the ability of the host strain to
synthesize PHA. Generally PHA synthesizing bacterial colonies are
opaque on agar plates, whereas colonies that do not synthesize PHA
appear translucent. Clones from a gene library that complement the
missing gene confer a white phenotype to the host when grown on
screening media. Generally screening media contains all essential
nutrients with excess carbon source and an antibiotic for which
resistance is specified by the vector used in the library
construction.
[0050] Besides new genes, genes encoding improved PHA biosynthetic
enzymes can also be screened for. A mutagenized collection of
plasmids containing a phb biosynthetic gene into an E. coli host
strain lacking this activity but containing genes encoding the
other PHA biosynthetic enzymes can be screened for increased or
altered activity. For example, PHA polymerases with increased
activity can be screened for in a strain that expresses thiolase
and reductase from the chromosome by identifying PHB-containing
colonies under conditions that support PHB formation poorly.
mcl-PHA polymerases with an increased specificity towards C.sub.4
can similarly be screened for under PHB accumulation promoting
conditions. Altered activities in the phaG encoded ACP::CoA
transferase can be screened for by expressing mutated versions of
this gene in a phbC integrant and screening for PHB formation from
short chain fatty acids. Enzymes that have increased activity under
sub-optimal physical conditions (e.g., temperature, pH, osmolarity,
and oxygen tension) can be screened for by growing the host under
such conditions and supplying a collection of mutated versions of
the desired gene on a plasmid. Reductase enzymes with specificity
to medium side-chain 3-ketoacyl-CoA's, such as 3-ketohexanoyl-CoA,
can be screened for by identifying PHA synthesizing colonies in a
strain that has a msc-PHA polymerase gene integrated on the
chromosome and mutagenized versions of a phbB gene on a plasmid.
The combination of different specificity PHA enzymes allows for the
screening of a multitude of new substrate specificities. Further
permutations of growth conditions allows for screening of enzymes
active under sub-optimal conditions or enzymes that are less
inhibited by cellular cofactors, such as Coenzyme A and
CoA-derivatives, reduced or oxidised nicotinamide adenine
dinucleotide or nicotinamide adenine dinucleotide phosphate (NAD,
NADP, NADH, and NADPH).
[0051] Using the techniques described herein, E. coli strains
expressing the genes encoding enzymes for the medium side-chain PHA
pathway can be constructed. Strains in which either phaC or phaG or
both are integrated on the chromosome of E. coli accumulate a PHA
including medium chain-length 3-hydroxy fatty acids of which
3-hydroxydecanoate is the predominant constituent. When phaC is
integrated by itself, msc-PHAs can be synthesized from fatty acids.
In such strains, it is advantageous to manipulate fatty acid
oxidation such that 3-hydroxy fatty acid precursors accumulate
intracellularly. This manipulation can be achieved by mutagenesis
or by substituting the E. coli fatty acid degradation enzymes FadA
and FadB encoding genes with the corresponding faoAB genes from
Pseudomonas putida or related rRNA homogy group I fluorescent
pseudomonad.
1TABLE 1 Phenotypes of Strains for Screening of New or Improved
Enzymes Gene(s) Genes integrated on Carbon source Screen identifies
on chromosome plasmid for screen genes encoding phbC library
glucose new thiolase/ reductase library fatty acids new reductase,
hydratase, transferase library hydroxy fatty acid, hydroxy fatty
acid e.g. 4- activating enzyme, hydroxybutyrate e.g. 4HB-CoA (4HB)
transferase (acetyl- CoA or succinyl-CoA dependent) or 4HB- CoA
synthase phaG glucose transferase with new substrate specificity
phbAB library glucose new polymerase gene phaC glucose; altered
polymerase with new environmental substrate specificity; conditions
increased activity under sub-optimal conditions phbBC library
glucose new thiolase phbA limiting glucose/less deregulated
thiolase; prefered carbon increased activity sources or rich under
sub-optimal medium; altered conditions environmental conditions
phbAC library glucose new reductase phbB limiting glucose/less
deregulated reductase; prefered carbon increased activity sources
or rich under sub-optimal medium; altered conditions environmental
conditions phbCAB library any enzymes affecting PHB formation under
specific conditions phbCAB, random any enzymes affecting mutations
PHB formation under (chemical or specific conditions transposon)
phaC library hexanoate hydratase with specificity for C6 and longer
substrates phaJ fatty acids hydratase with increased specificity
for C6 and longer substrates phbB fatty acids reductase with new
substrate specificity phaC fadR.sup.+, .DELTA.ato phbAB glucose +
butyrate thiolase/reductase combination specific for C6 monomer
phaJ phaC fatty acids polymerase with wider substrate specificity
phaG phbC glucose polymerase with wider substrate specificity
EXAMPLES
[0052] The methods and compositions described herein will be
further understood by reference to the following non-limiting
examples. These examples use the following general methods and
materials.
[0053] Materials and Methods
[0054] E. coli strains were grown in Luria-Bertani medium
(Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2d ed.
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[1992 at 37.degree. C. or 30.degree. C. or in minimal E2 medium
(Lageveen et al., Appl. Environ. Microbiol. 54: 2924-2932 (1988)).
DNA manipulations were performed on plasmid and chromosomal DNA
purified with the Qiagen plasmid preparation or Qiagen chromosomal
DNA preparation kits according to manufacturers recommendations.
DNA was digested using restriction enzymes (New England Biolabs,
Beverly, Mass.) according to manufacturers recommendations. DNA
fragments were isolated from 0.7% agarose-Tris/acetate/EDTA gels
using a Qiagen kit.
[0055] Plasmid DNA was introduced into E. coli cells by
transformation or electroporation (Sambrook, et al., Molecular
Cloning: A Laboratory Manual, 2d ed. (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.)). Transposition of phb genes from
the pUT vectors was achieved by mating of the plasmid donor strain
and the recipient (Herrero et al., J. Bacteriol. 172:6557 (1990)).
The recipient strains used were spontaneous naladixic acid or
rifampicin resistant mutants of E. coli derived from either LS5218
or MBX23. MBX23 is LJ14 rpoS::Tn10in which the rpoS::Tn10allele was
introduced by P1 transduction from strain 1106 (Eisenstark).
Recipients in which phb genes have been integrated into the
chromosome were selected on naladixic acid or rifampicin plates
supplemented with the antibiotic resistance specified by the
mini-transposon, kanamycin, or chloramphenicol. Oligonucleotides
were purchased from Biosynthesis or Genesys. DNA sequences were
determined by automated sequencing using a Perkin-Elmer ABI 373A
sequencing machine. DNA was amplified using the
polymerase-chain-reaction in 50 microliter volume using PCR-mix
from Gibco-BRL (Gaithersburg, Md.) and an Ericomp DNA amplifying
machine.
[0056] DNA fragments were separated on 0.7% agarose/TAE gels.
Southern blots were performed according to procedures described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2d ed.
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
Detection of DNA fragments containing phb genes was performed using
chemiluminescent labeling and detection kits from USB/Amersham.
Proteins samples were denatured by incubation in a boiling water
bath for 3 minutes in the presence of 2-mercaptoethanol and sodium
dodecylsulphate and subsequently separated on 10%, 15%, or 10-20%
sodium dodecylsulphate-polyacrylamide gels. After transfer of
protein to supported nitrocellulose membranes (Gibco-BRL,
Gaithersburg, Md.), 3-ketoacyl-CoA thiolase, acetoacetyl-CoA
reductase and PHB polymerase was detected using polyclonal
antibodies raised against these enzymes and horseradish peroxidase
labeled secondary antibodies followed by chemiluminescent detection
(USB/Amersham).
[0057] Acetoacetyl-CoA thiolase and acetoacetyl-CoA reductase
activities were determined as described by Peoples and Sinskey, J.
Biol. Chem. 264: 15293-15297 (1989) in cell free extracts from
strains grown for 16 hours in LB-medium at 37 C. The
acetoacetyl-CoA thiolase activity is measured as degradation of a
Mg.sup.2+-acetoacetyl-CoA complex by monitoring the decrease in
absorbance at 304 nm after addition of cell-free extract using a
Hewlett-Packer spectrophotometer. The acetoacetyl-CoA reductase
activity is measured by monitoring the conversion of NADH to NAD at
340 nm using a Hewlett-Packer spectrophotometer.
[0058] Accumulated PHA was determined by gas chromatographic (GC)
analysis as follows. About 20 mg of lyophilized cell mass was
subjected to simultaneous extraction and butanolysis at 110 C for 3
hours in 2 mL of a mixture containing, by volume, 90% 1-butanol and
10% concentrated hydrochloric acid, with 2 mg/mL benzoic acid added
as an internal standard. The water-soluble components of the
resulting mixture were removed by extraction with 3 mL water. The
organic phase (1 .mu.L at a split ratio of 1:50 at an overall flow
rate of 2 L/min) was analyzed on an HP 5890 GC with FID detector
(Hewlett-Packard Co, Palo Alto, Calif.) using an SPB-1 fused silica
capillary GC column (30 m; 0.32 mm ID; 0.25 .mu.m film; Supelco;
Bellefonte, Pa.) with the following temperature profile: 80.degree.
C., 2 min.; 10.degree. C. per min. to 250.degree. C.; 250.degree.
C., 2 min. The standard used to test for the presence of
4-hydroxybutyrate units in the polymer was .gamma.-butyrolactone,
which, like poly(4-hydroxybutyrate), forms n-butyl
4-hydroxybutyrate upon butanolysis. The standard used to test for
3-hydroxybutyrate units in the polymer was purified PHB.
[0059] The molecular weights of the polymers were determined
following chloroform extraction by gel permeation chromatography
(GPC) using a Waters Styragel HT6E column (Millipore Corp., Waters
Chromatography Division, Milford, Mass.) calibrated versus
polystyrene samples of narrow polydispersity. Samples were
dissolved in chloroform at 1 mg/mL, and 50 .mu.L samples were
injected and eluted at 1 mL/min. Detection was performed using a
differential refractometer.
[0060] 1-Methyl-3-nitro-1-nitroso-guanidine (NTG) mutagenesis was
performed as described by Miller, A Short Course in Bacterial
Genetics (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.) using a 90 minute treatment with 1 mg/ml NTG corresponding to
99% killing.
Example 1
Host Strains and Plasmid Tools for Gene Integration
[0061] Strains and plasmids from which transposon vectors and
transposon derivatives were developed are listed in Tables 2 and 3
below. MBX245 and MBX247 were selected by growing MBX23 and LS5218
respectively on LB plates containing approximately 30 g/ml
naladixic acid. MBX246 and MBX248 were selected by growing MBX23
and LS5218, respectively, on LB plates containing 50 g/ml
rifampicin. Colonies that appeared on these selective media within
24 hours were replica plated on the same medium and after growth
stored in 15% glycerol/nutrient broth at -80.degree. C.
[0062] MBX245 and MBX247 were selected by growing MBX23 and LS5218
respectively on LB plates containing 30 .mu.g/ml naladixic acid.
MBX246 and MBX248 were selected by growing MBX23 and LS5218
respectively on LB plates containing 50 .mu.g/ml rifampicin.
Colonies that appeared on these selective media within 24 hours
were replica plated on the same medium and after growth stored in
15% glycerol/nutrient broth at -80.degree. C.
2TABLE 2 Host Strains Used For Gene Integration strain genotype
source DH5.alpha. recA1 endA1 gyrA96 thi 1 hsdR17 supE44 relA1
.DELTA.(lac- proAB) (.PHI.80dlac.DELTA.(lacZ)M15) S17-1 .lambda.pir
recA thi pro hsdR.sup.-M.sup.+ RP4: 2- 2 Tc::Mu::Km Tn7 .lambda.pir
lysogen CC118 .lambda.pir .DELTA.(ara-leu) araD .DELTA.lacX74 galE
2 galK phoA20 thi-1 rpsE rpoB argE(Am) recA1, .lambda. pir lysogen
XL1-Blue F'::Tn10 lacI.sup.q .DELTA.(lacZ) M15 3 proAB/recA1 endA1
gyrA96 thi hsdR17 supE44 relA1 .DELTA.(lac- proAB) LS5218 fadR601
atoC512.sup.c Spratt et al, 1981 J. Bacteriol. 146: 1166-1169 LJ14
LS5218 atoC2.sup.c atoA14 Spratt et al, 1981 J. Bacteriol 146:
1166-1169 MBX23 LJ14 rpoS Metabolix, Inc. MBX245 MBX23 Nl.sup.r
Metabolix, Inc. MBX246 MBX23 Rf.sup.r Metabolix, Inc. MBX247 LS5218
Nl.sup.r Metabolix, Inc. MBX248 LS5218 Rf.sup.r Metabolix, Inc. 1.
New England Biolabs (Beverly, MA) 2. Herrero et al., J. Bacteriol.
172: 6557-67 (1990) 3. Stratagene (San Diego, CA)
[0063]
3TABLE 3 Plasmids Used For Gene Integration plasmid characteristics
source pUC18Not Ap.sup.r, NotI sites flanking polylinker 2 pUC18Sfi
Ap.sup.r, SfiI sites flanking polylinker 2 pUTkan Ap.sup.r,
Km.sup.r, oriR6K, mobRP4 depends 2 on .lambda.pir for replication
pUTHg Ap.sup.r, Hg.sup.r, oriR6K, mobRP4 depends 2 on .lambda.pir
for replication pKPS4 Ap.sup.r, phaC1 from Pseudomonas oleovorans
pUCDBK1 Ap.sup.r, phbA and phbB from Zoogloea Peoples and Sinskey
ramigera 1989, Molecular Microbiol. 3: 349-357 pZS Ap.sup.r, phbC
from Zoogloea ramigera WO 99/14313
Example 2
Construction of Cloning Vectors to Facilitate Integration of phb
Genes
[0064] The plasmids pMNXTp1kan and pMNXTp1cat were based on the
plasmids pUC18Not and pUC18Sfi and developed as shown in FIG.
1.
[0065] The Tn903 kanamycin (Km) resistance gene from plasmid pBGS18
was amplified by PCR using the oligonucleotide primers
4 linkK1, 5' TGCATGCGATATCAATTGTCCA GCCAGAAAGTGAGG, and linkK2, 5'
ATTTATTCAACAAAGCCGCC.
[0066] Prior to PCR amplification, the primers were phosphorylated
using T4 polynucleotide kinase using standard procedures. The DNa
was amplified using the following program: 1 cycle of 3 min at
95.degree. C., 40 s at 42.degree. C., 2 min at 72.degree. C.,
followed by 30 cycles of 40 s at 95.degree. C., 40 s at 42.degree.
C. and 90 s at 72.degree. C. The DNA then was phenol extracted and
treated with T4 DNA polymerase prior to gel purification. The blunt
ended 0.8 kb DNA fragment was then inserted into the Ecl136II site
in the polylinker of pUC18Not to obtain pMNXkan.
[0067] The cat gene was obtained as an HindIII cassette from
Pharmacia (Pharmacia Inc. N.J.), blunt ended using Klenow fragment
of DNA polymerase, and inserted into the Ecl136II site of pUC18Not
to obtain pMNXcat.
[0068] The trp terminator sequence was constructed by annealing the
two synthetic oligonucleotides
5 TERM1 (5' CCCAGCCCGCTAATGAGCGGGCTTTTTTTTGAACAA AA 3') and TERM2
(5' TACGTATTTTGTTCAAAAAAAAGCCCGCTCATT- AGCGGG CTGGG 3').
[0069] The terminator was then inserted into the HindIII-SphI site
of pMNXkan and pMNXcat to obtain pMNXTkan and pMNXTcat,
respectively. These vectors were constructed such that any promoter
fragment can be added between the SphI and SacI sites. Promoter
p.sub.1 was constructed by annealing of the synthetic
oligonucleotides
6 PHBB1 (5' TACGTACCCCAGGCTTTACATTTATGCTTCCGGCTCGTATGTTGT GTGGAATTG
TGAGCGGTT 3') and PHBB2 (5'
TTCGAACCGCTCACAATTCCACACAACATACGAGCCGGAAGC ATAAATGTAAAGCCTGGGG
3')
[0070] followed by filling in the ends with Klenow fragment of DNA
polymerase. The blunt-ended promoter fragment p.sub.1 was then
inserted into the HincII site of pMNXTkan and pMNXTcat to obtain
pMNXTp.sub.1kan and pMNXTp.sub.1cat, respectively.
[0071] Plasmid pMSXTp.sub.1cat was constructed by transferring the
Tp.sub.1cat cassette from pMNXTp.sub.1cat as an EcoRI-HindIII
fragment into the EcoRI-HindIII site of pUC18Sfi. Similarly,
pMSXTp.sub.1kan was constructed by transferring the EcoRI-HindIII
fragment containing Tp.sub.1kan into the EcoRI-HindIII site of
pUC18Sfi.
Example 3
Construction of Plasmids for Chromosomal Integration of phbC,
Encoding PHB Polymerase
[0072] Plasmid pMUXC.sub.5cat contains the phbC gene from Z.
ramigera on a transposable element for integration of this gene on
the chromosome of a recipient strain, as shown in FIG. 2. Strong
translational sequences were obtained from pKPS4 which includes
phaC1 encoding PHA polymerase from P. oleovorans in the pTrc vector
(Pharmacia). In this construct, phaC1 is preceded by a strong
ribosome binding site: AGGAGGTTTTT(-ATG). The phaC1 gene including
the upstream sequences, was cloned as a blunt ended EcoRI-HindIII
fragment in the SmaI site of pUC18Sfi to give pMSXC.sub.3. A blunt
ended cat gene cassette was subsequently cloned in the blunt-ended
Sse8387II site, resulting in pMSXC.sub.3cat. At this point, all of
the phaC1 coding region except the 5' 27 base pairs were removed as
a PstI-BamHI fragment and replaced by the corresponding fragment
from the phbC gene from Z. ramigera. The resulting plasmid
pMSXC.sub.5cat encodes a hybrid PHB polymerase enzyme with the 9
amino terminal residues derived from the P. oleovorans PHA
polymerase and the remainder from Z. ramigera. The C.sub.5cat
cassette was then excised as an AvrII fragment and cloned in the
corresponding sites of pUTHg, thereby deleting the mercury
resistance marker from this vector. The resulting plasmid,
pMUXC.sub.5cat, contains a C.sub.5cat mini-transposon in which phbC
is not preceded by a promoter sequence. Expression of the cassette
upon integration is therefore dependent on transcriptional
sequences that are provided by the DNA adjacent to the integration
site.
Example 4
Construction of Plasmids for Chromosomal Integration of phbAB,
Encoding Thiolase and Reductase
[0073] pMSXTp.sub.1AB.sub.5kan2 was constructed from
pMSXTp.sub.1kan as partially shown in FIG. 3. First pMSXTp.sub.1kan
was digested with NdeI, filled in with Klenow and religated to
obtain pMSXTp.sub.1kan2 in which the NdeI site is deleted. This
deletion results in a unique NdeI site just upstream of phbA of Z.
ramigera during later stages of the cloning procedure.
[0074] B.sub.5 was cloned as a NarI fragment from pUCDBK1 (Peoples
and Sinskey 1989, Molecular Microbiol. 3: 349-357) and cloned in
the HincII site of pUC18Sfi to generate pMSXB.sub.5. A.sub.5 was
inserted as an FseI/blunt-SalI fragment in the Ecl136II-SalI sites
resulting in pMSXAB.sub.5 and regenerating the Z. ramigera AB.sub.5
intergenic region. pMSXAB.sub.5cat was created by inserting a
promoterless cat cassette in the HindIII site of pMSXAB.sub.5. The
AB.sub.5 fragment from pMSXAB.sub.5cat was cloned as a EcoRI-PstlI
fragment into the SmaI site of pMSXTp.sub.1kan2 giving
pMSXTp.sub.1AB.sub.5kan2.
[0075] The expression cassette AB.sub.5cat was then excised as a
2.8 kb AvrII fragment and ligated into the AvrII site of pUTHg and
transformed into E. coli strain CC118 .lambda.pir to obtain plasmid
pMUXAB.sub.5cat. This plasmid was then transformed into E. coli
S17-1.lambda.pir and used to insert the AB5cat expression cassette
into the chromosome of E. coli MBX247 by conjugation. The resulting
Ap.sup.s/Cm.sup.r transconjugants were characterized for
integration and expression of the thiolase and reductase genes
encoded by the phbAB genes.
Example 5
Construction of Plasmids with Improved Promoters for Integration of
phbAB into the Chromosome of E. coli
[0076] Expression of phbAB5 was improved by introduction of strong
promoters upstream of these genes, as shown in FIG. 3. These
promoters were generated with sets of oligonucleotides that provide
upstream activating sequences, a -35 promoter region, a -10
promoter region with transcriptional start site(s), and mRNA
sequences with possible stabilizing functions. Plasmid
pMSXTp.sub.1AB.sub.5kan2 was digested with PstI/XbaI, and a
fragment containing the -10 region of the lac promoter was inserted
as a fragment obtained after annealing oligonucleotides
7 3A (5' GGCTCGTATAATGTGTGGAGGGAGAACCGCCGGGCTCGCGCCGTT) and 3B (5'
CTAGAACGGCGCGAGCCCGGCGGTTCTCCCTCCACA- CATTATAC GAGCCTGCA).
[0077] Next, a fragment containing the lac -35 region and the rrnB
region were inserted into the PstI site as a fragment obtained
after annealing the oligonucleotides:
8 1A (5' TTCAGAAAATTATTTTAAATITCCTCTTGACATTTATGCT GCA) and 1B (5'
GCATAAATGTCAAGAGGAAATTTAAAATAATTTTCTG- AATGCA).
[0078] Next, the messenger stabilizing sequence including the
transcriptional start site from AB.sub.5 was inserted into the
XbaI-NdeI sites as a fragment obtained after annealing the
oligonucleotides:
9 4A (5' CTAGTGCCGGACCCGGTTCCAAGGCCGGCCGCAAGGCTGCCAG
AACTGAGGAAGCACA) and 4B (5'
TATGTGCTTCCTCAGTTCTGGCAGCCTTGCGGCCGGCCTTGGAA CCGGGTCCGGCA).
[0079] The resulting plasmid is pMSXp.sub.11AB.sub.5kan2. The AvrII
fragment, containing Tp.sub.11AB.sub.5kan2 was cloned into pUTHg
cut with AvrII and used for integration into the genome of MBX379
and MBX245.
[0080] Plasmid pMSXTp.sub.12AB.sub.5kan2 was constructed as
pMSXTP.sub.11AB.sub.5kan2 with the distinction that the following
oligonucleotides were used instead of oligonucleotides 1A and
1B:
10 2A: (5' TCCCCTGTCATAAAGTTGTCACTGCA) and 2B (5'
GTGACAACTTTATGACAG GGGATGCA).
[0081] These oligonucleotides provide a consensus E. coli pho box
and -35 promoter region to generate a promoter that is potentially
regulated by the phosphate concentration in the medium.
[0082] pMSXTp.sub.13AB.sub.5kan2 was constructed to provide
expression of AB.sub.5 from a promoter that has been shown to be
expressed under general stress conditions such as nutrient
limitation, pH or heat shock, and administration of toxic
chemicals. The promoter region of uspA was amplified using
oligonucleotides
11 UspUp (5' TGACCAACATACGA GCGGC) and UspDwn (5'
CTACCAGAACTTTGCTTTCC)
[0083] in a PCR reaction consisting of an incubation at 95 C for 3
min. followed by 30 cycles of 40 s at 95.degree. C., 40 s at
42.degree. C., an incubation for 7 min. at 68.degree. C., and final
storage at 4.degree. C. The approximately 350 bp PCR product was
cloned into pCR2.1 (Invitrogen Corp., USA) to generate
pMBXp.sub.13. An approximately 190 bp HincII-MscI fragment
containing the promoter and transcriptional start site for uspA and
the first 93 bp of the uspA mRNA was cloned into blunt ended
BamHI-Sse83871pMSXTp.sub.1kan2 to give pMSXTp.sub.13kan2. Plasmid
pMSXTp.sub.13kan2 was then KpnI digested, blunt ended with T4
polymerase and dephosphorylated using calf intestinal phosphatase.
The AB.sub.5 genes were isolated as a 2.0 kb EcoRI/Sse8387I
fragment from pMSXAB.sub.5, blunt ended using Klenow and T4
polymerase and ligated into the KpnI site of pMSXTp.sub.13kan2. In
the resulting plasmid pMSXTp.sub.13AB.sub.5kan2, the phbAB and kan
genes are expressed from the uspA (p.sub.13) promoter.
[0084] The p.sub.nAB.sub.5kan (n=11, 12, 13) expression cassettes
were then excised as 2.8 kb AvrII fragments and ligated into the
AvrII site of pUTHg and transformed into E. coli strain CC118
.lambda.pir to obtain plasmid pMUXp.sub.nAB.sub.5kan. This plasmid
was then transformed into E. coli S17-1.lambda.pir and used to
insert p.sub.11AB.sub.5kan, p.sub.12AB.sub.5kan, and
p.sub.13AB.sub.5kan expression cassettes into the chromosome of E.
coli strains by conjugation.
Example 6
Integration of C.sub.5cat into the Chromosome of E. coli
[0085] C.sub.5cat was introduced into the chromosome of MBX23 by
conjugation using S17-1.lambda.pir (pMUXC.sub.5cat) as the donor
strain. The conjugation mixture was spread on LB/N1/Cm plates and
integrants were obtained, 40% of which were sensitive to
ampicillin, indicating that no plasmid was present in these
strains. Five integrants were transformed with pMSXAB.sub.5cat
(Ap.sup.r) and grown on LB/Ap/Cm/2% glucose to examine biosynthetic
activity of PHB polymerase (Table 4).
12TABLE 4 Integrated Strains strain containing strain after strain
pMSXAB5cat PHB phenotype plasmid curing MBX300 MBX305 ++++ MBX325
MBX301 MBX308 +++ MBX331 MBX302 MBX310 ++++ MBX326 MBX303 MBX315
++++ MBX327 MBX304 MBX316 + MBX337
Example 7
Amplification of C5 Expression in Integrated Strains
[0086] Expression of PHB polymerase was increased by restreaking
MBX326 successively on LB plates containing 100, 200, 500, and 1000
.mu.g/ml chloroamphenicol. Strain MBX379 was derived from MBX326
and exhibited chloramphenicol resistance up to 1000 .mu.g/ml. In
Southern blot analysis of chromosomal DNA isolated from MBX379 and
its predecessors, the phbC5 copy-number had not increased. Western
blot analysis indicated a strong increase in PHB polymerase levels
in cell free extracts of these strains when the phbAB genes were
present on a plasmid.
Example 8
Integration of p.sub.11AB.sub.5kan, p.sub.12AB.sub.5kan and
p.sub.13AB.sub.5kan into MBX379
[0087] S17-1 .lambda.pir strains with either
pMUXp.sub.11AB.sub.5kan, pMUXp.sub.12AB.sub.5kan, or
pMUXp.sub.13AB.sub.5kan were mated with MBX379. Transgenic strains
in which phbAB.sub.5kan had integrated on the chromosome were
selected on LB/N1/Km plates. Among the integrants, PHB producers
were identified on LB/glucose plates. Representatives of the
individual constructs were MBX612 (MBX379::p.sub.11AB.sub.5kan),
MBX677 (MBX379::p.sub.12AB.sub.5kan), and MBX680
(MBX379::p.sub.13AB.sub.5kan). Southern blots and Western blots
showed that the phbAB genes had integrated in the chromosome and
were expressed in these strains as well. Table 5 shows the PHB
accumulation levels of transgenic E. coli PHB producers grown in
Luria-Bertani medium with 2% glucose or minimal E2 medium with 2%
glucose and 0.5% corn steep liquor.
13TABLE 5 PHB Accumulation Levels for Transgenic E. coli PHB
Producers % PHB of cell dry weight strain LB/glucose E2 glucose
MBX612 56 35 MBX677 58 38 MBX680 39 50
Example 9
Selection and Bacteriophage P1 Transduction to Yield Improved
Strains
[0088] The growth characteristics of MBX612, 677, and 680 were
improved by bacteriophage P1 transduction. A single transduction
step was required to transduce the C.sub.5cat and AB.sub.5kan
alleles from the different strains into LS5218, indicating that the
two separate integration cassettes were located close to each other
on the chromosome. The resulting strains are MBX690 (from MBX681),
MBX691 (from MBX677), and MBX698 (from MBX680). Repeated
inoculation of MBX612 on minimal E2 medium with limiting nitrogen
resulted in MBX681. Unlike the strains generated by P1
transduction, MBX681 did not exhibit improved growth
characteristics. Southern blots and Western blots show that phbC
and the phbAB genes were successfully transduced and were expressed
in these strains as well. Table 6 below shows PHB accumulation
levels for these transgenic E. coli PHB producers grown in
Luria-Bertani medium with 2% glucose or minimal E2 medium with 2%
glucose and 0.5% corn steep liquor.
14TABLE 6 PHB Accumulation Levels for Transgenic E. coil PHB
Producers % PHB of cell dry weight strain LB/glucose E2 glucose
MBX681 54 22 MBX690 52 44 MBX691 54 28 MBX698 37 15
Example 10
Further Improvements of Transgenic E. coli Strains for PHB
Production
[0089] Mutagenesis using NTG or EMS was used to further improve PHB
production in MBX680. Strains MBX769 and MBX777 were selected after
treatment of MBX680 with EMS and NTG, respectively. These strains
were found to be able to grow on R2-medium supplied with 1%
glucose, 0.5% corn steep liquor, and 1 mg/ml chloroamphenicol.
MBX769 was grown in 50 ml R-medium/0.5% CSL with 2 or 3% glucose at
37.degree. C. for 20 to 26 hours. PHB was accumulated to 71% of the
cell dry weight. Similarly, MBX769 was grown in 50 ml LB with or
without 0.375 g/L KH.sub.2PO.sub.4, 0.875 K.sub.2HPO.sub.4, 0.25
(NH.sub.4).sub.2SO.sub.4, and a total of 50 g/L glucose (five
aliquots were added over the course of the incubation). After 63
hours of incubation, PHB had accumulated up to 96% of the cell dry
weight.
[0090] The phbC and phbAB alleles from MBX777 were subsequently
transduced into LS5218, resulting in MBX820. Southern blots and
Western blots show that phbC and the phbAB genes were successfully
transduced and were expressed in these strains as well. Table 7
shows the PHB accumulation levels of these transgenic E. coli PHB
producers grown in Luria-Bertani medium with 2% glucose or minimal
E2 medium with 2% glucose and 0.5% corn steep liquor.
15TABLE 7 PHB Accumulation Levels for Transgenic E. coli PHB
Producers % PHB of cell dry weight strain LB/glucose E2 glucose
MBX680 39 50 MBX777 67 57 MBX820 53 50
Example 11
Growth Characteristics of Transgenic E. coli PHB Producers
[0091] The introduction of phb genes into MBX245 (t.sub.d=47 min.)
was accompanied by a reduction in growth rate (MBX680, t.sub.d=71
min.). Improved PHB production was achieved by EMS mutagenesis, but
did not improve the growth rate (MBX777, t.sub.d=72 min.). P1
transduction of the PHB genes into a wild-type strain (MBX184)
resulted in the same high growth rate as exhibited by MBX245 and
PHB accumulation up to 50% of the cell dry weight in less than 24
hours (MBX820, t.sub.d=45 min.).
Example 12
Plasmids for Chromosomal Integration of Other pha Genes
[0092] The integration of phbC, phbA, and phbB from Z. ramigera
described herein also is applicable to other pha genes, such as
genes encoding PHB polymerase from R. eutropha (C1), PHA polymerase
from P. oleovorans (C3), PHB polymerase from A. caviae (C12),
ACP::CoA transacylase from P. putida (G3), (R)-specific enouyl-CoA
hydratase from A. caviae (J12), a broad substrate specific
3-ketoacyl-CoA thiolase from R. eutropha (A1-II), or a phasin from
R. eutropha (P1-I and P1-II). These genes were obtained by
polymerase chain reaction amplification using the following
primers:
16 C1 up 5' g-GAATTC-aggaggtttt-ATGGCGACCGGCAAAGGCGCGGCAG 3' C1 dw
5' GC-TCTAGA-AGCTT-tcatgccttggcttt- gacgtatcgc 3' C3 up 5'
g-GAATTC-aggaggtttt-ATGAGTAA- CAAGAACAACGATGAGC 3' C3 dw 5'
GC-TCTAGA-AGCTT-tcaacgctcgtgaacgtaggtgccc 3'. C12 up 5'
g-GAATTC-aggaggtttt-ATGAGCCAACCATCTTATGGCCCGC 3' C12 dw 5'
GC-TCTAGA-AGCTT-TCATGCGGCGTCCTCCTCTGTTGGG 3' G3 up 5'
g-GAATTC-aggaggtttt-ATGAGGCCAGAAATCGCTGTACTTG 3' G3 dw 5'
GC-TCTAGA-AGCTT-tcagatggcaaatgca- tgctgcccc 3' J12 up 5'
ag-GAGCTC-aggaggtttt-ATGAGCG- CACAATCCCTGGAAGTAG 3' J12 dw 5'
GC-TCTAGA-AGCTT-ttaaggcagcttgaccacggcttcc 3' A1-II up 5'
g-GAATTC-aggaggtttt-ATGACGCGTGAAGTGGTAGTGGTAAG 3' A1-II dw 5'
GC-TCTAGA-AGCTT-tcagatacgctcgaagatggcggc 3'. P1-I up 5'
g-GAATTC-aggaggtttt-ATGATCCTCACCCCGGAACAA- GTTG 3' P1-I dw 5'
GC-TCTAGA-AGCTT-tcagggc- actaccttcatcgttggc 3' P1-II up 5'
g-GAATTC-aggaggtttt-ATGATCCTCACCCCGGAACAAGTTG 3' P1-II dw 5'
GC-TCTAGA-AGCTT-tcaggcagccgtcgtcttctttgcc 3'
[0093] PCR reactions included 10 pmol of each primer, 1to 5 .mu.l
of chromosomal DNA or boiled cells, and 45 .mu.l PCR mix from Gibco
BRL (Gaithersburg, Md.). Amplification was by 30 cycles of 60 s
incubation at 94 C, 60 s incubation at a temperature between 45 C
and 68 C and 1 to 3 minutes incubation at 72 C. PCR products were
purified, digested with EcoRI and HindIII, blunt ended with the
Klenow fragment of DNA polymerase, and cloned in the Smal site of
pMSXcat, pMSXkan, pMNXcat, or pMNXkan according to the schemes
shown in FIGS. 1 and 2. pMUXpha was derived from pUTHg or pUTkan;
and pMLXpha was derived from pLOFHg, where pha stands for the pha
gene of choice. These plasmids were used for integration of the
desired pha gene into the chromosome of E. coli or any other
Gram-negative microbial strain suitable for PHA production
Example 13
PHBV Copolymer Producing Transgenic E. coli Strains
[0094] E. coli strains with chromosomally integrated phb genes such
as described above also can be used to produce PHBV copolymers.
PHBV is generally synthesized in fermentation systems where
propionic acid is co-fed with glucose or other carbohydrate. After
uptake, propionate is converted to propionyl-CoA, which by the
action of acyl-CoA thiolase and 3-ketoacyl-CoA reductase is
converted to 3-hydroxyvaleryl-CoA (3HV-CoA). 3HV-CoA is
subsequently polymerized by PHA polymerase.
[0095] The capacity to accumulate PHBV can be increased by
increasing levels of enzymes that specifically synthesize HV
monomers. Such enzymes may be involved in the uptake of propionic
acid, in the activation of propionic acid to propionyl-CoA or in
any of the PHB biosynthetic enzymes. Additionally, alternative
enzymes can be isolated from other sources, or propionyl-CoA can be
obtained from alternative pathways, e.g. from the methylmalonyl-CoA
pathway. In this pathway, succinyl-CoA is converted to
methylmalonyl-CoA which is then decarboxylated to yield
propionyl-CoA.
Example 14
PHB4HB Copolymer Producing Transgenic E. coil Strains
[0096] Homopolymers and copolymers containing 4HB monomers can be
produced by transgenic E. coli strains. Incorporation of 4HB from
4HB-CoA can be achieved by feeding 4-hydroxybutyrate to the PHA
producing organisms. 4HB is activated to 4HB-CoA either through a
4-hydroxybutyryl-CoA transferase such as hbcT (OrfZ) from
Clostridium kluyveri or by an endogenous E. coli enzyme or by any
other enzyme with this capability. A P4HB homopolymer is produced
when the transgenic E. coli strain contains only the phbC gene. 4HB
containing copolymers can be synthesized when the transgenic E.
coli strain contains genes encoding the complete PHB biosynthetic
pathway.
[0097] E. coli MBX821 (LS5218::C.sub.5-cat.sup.379, atoC.sup.c) was
grown in Luria-Bertani medium and resuspended in 100 ml 10% LB with
5 g/l. 4HB and 2 g/L glucose. After incubation of this culture for
24 hours, PHA was characterized and identified as containing only
4HB monomers. Similarly, E. coli MBX777 with a plasmid containing
hbcT such as pFS16, was grown in LB/4HB (5 g/L) and the resuting
polymer was identified as PHB4HB with 35.5% 4HB monomers.
Example 15
Production of poly(4-hydroxybutyrate) from 4-hydroxybutyrate in
Recombinant E. coli with No Extrachromosomal DNA
[0098] Poly(4-hydroxybutyrate) can be synthesized from
4-hydroxybutyrate by E. coli expressing 4-hydroxybutyryl-CoA
transferase (hbcT) and PHA synthase (phaC) genes from a plasmid. If
these genes are integrated into the E. coli chromosome and
expressed at high levels, the recombinant E. coli should be able to
synthesize poly(4-hydroxybutyrate) from 4-hydroxybutyrate. The hbcT
and phbC genes were inserted into pUTHg (Herrero, et al., J.
Bacteriol. 172:6557-67, 1990) as follows. pMSXC.sub.5cat and pFS16
were both digested with BamHI and SalI. The large fragment of
pMSXC.sub.5cat and the fragment of pFS16 containing the hbcT gene
thus obtained were ligated together using T4 DNA ligase to form
pMSXC.sub.5hbcT-cat. The fragment containing the phaC, hbcT, and
cat genes was removed from pMSXC.sub.5hbcT-cat by digestion with
AvrII, and it was inserted using T4 DNA ligase into pUTHg that had
been digested with AvrII and treated with calf intestinal alkaline
phosphatase to prevent self-ligation. The plasmid thus obtained was
denoted pMUXC.sub.5hbcT-cat. The plasmid pMUXC.sub.5hbcT-cat was
replicated in MBX129 and conjugated into MBX1177. The strain
MBX1177 is a spontaneous mutant of E. coli strain DH5.alpha. that
was selected for its ability to grow on minimal 4-hydroxybutyrate
agar plates. MBX1177 is also naturally resistant to nalidixic acid.
The recipient cells were separated from the donor cells by plating
on LB-agar supplemented with 25 .mu.g/mL chloramphenicol and 30
.mu.g/mL nalidixic acid. Survivors from this plate were restreaked
on minimal medium, containing, per liter: 15 g agar, 2.5 g/L LB
powder (Difco; Detroit, Mich.); 5 g glucose; 10 g
4-hydroxybutyrate; 1 mmol MgSO.sub.4; 10 mg thiamine; 0.23 g
proline; 25.5 mmol N.sub.2HPO.sub.4; 33.3 mmol K.sub.2HPO.sub.4;
27.2 mmol KH.sub.2PO.sub.4; 2.78 mg FeSO.sub.4.7H.sub.2O; 1.98 mg
MnCl.sub.2.4H.sub.2O; 2.81 mg CoSO.sub.4.7H.sub.2O; 0.17 mg
CuCl.sub.2.2H.sub.2O; 1.67 mg CaCl.sub.2.2H.sub.2O; 0.29 mg
ZnSO.sub.4.7H.sub.2O; and 0.5 mg chloramphenicol. Colonies from
this plate that appeared to be especially white and opaque were
evaluated in shake flasks containing the same medium as above
except without agar. The individual colonies were first grown in 3
mL of LB medium for 8 hours, and 0.5 mL of each culture was used to
inoculate 50 mL of the medium described above. These flasks were
incubated at 30.degree. C. for 96 hours. One isolate was found by
GC analysis (for which the cells were removed from the medium by
centrifugation for 10 minutes at 2000.times.g, washed once with
water and centrifuged again, then lyophilized) to contain 4.9%
poly(4-hydroxybutate) by weight. This strain was denoted MBX1462
and selected for further manipulations. MBX1462 was treated with
the mutagen 1-methyl-3-nitro-1-nitrosoguanidine (MNNG), a chemical
mutagen, by exposing a liquid culture of MBX1462 to 0.1 mg/mL MNNG
for 90 minutes. It was found that 99.8% of the cells were killed by
this treatment. The plating and shake flask experiment described
above was repeated, and one isolate was found by GC analysis to
contain 11% poly(4-hydroxybutate) by weight. This strain was
denoted MBX1476 and selected for further manipulations. The NTG
treatment was repeated and killed 96.3% of the cells. The plating
and shake flask experiment described above was repeated once again,
and one isolate was found by GC analysis to contain 19%
poly(4-hydroxybutate) by weight. This strain was denoted
MBX1509.
Example 15
PHBH Copolymer Producing Transgenic E. coli Strains
[0099] E. coli MBX240 is an XL1-blue (Stratagene, San Diego,
Calif.) derivative with a chromosomally integrated copy of the PHB
polymerase encoding phbC gene from Ralstonia eutropha. This strain
does not form PHAs from carbon sources such as glucose or fatty
acids, because of the absence of enzymes converting acetyl-CoA
(generated from carbohydrates such as glucose) or fatty acid
oxidation intermediates, into (R)-3-hydroxyacyl-CoA monomers for
polymerization. pMSXJ12 was constructed by inserting the phaJ gene
from A. caviae digested with EcoRI and PstI into the corresponding
sites of pUC18Sfi. The phaJ gene was obtained by polymerase chain
reaction using the primers
17 Ac3-5': 5' AGAATTCAGGAGGACGCCGCATGAGCGCACAATCCCTGG and Ac3-3':
5' TTCCTGCAGCTCAAGGCAGCTTGACCA- CG
[0100] using a PCR program including 30 cycles of 45 s at 95 C, 45
s at 55 C and 2.5 minutes at 72 C. Transformants of E. coli MBX240
with plasmid pMTXJI2 containing the (R)-specific enoyl-CoA
hydratase encoded by the phaJ gene from Aeromonas caviae were grown
on Luria-Bertani medium with 10 mM octanoate and 1 mM oleate. After
48 hours of growth, cells were harvested from a 50 ml culture by
centrifugation and the cell pellet lyophilized. Lyophilized cells
were extracted with chloroform (8 ml) for 16 hours and PHA was
specifically precipitated from the chloroform solution by adding
the chloroform layer to a 10-fold excess ethanol. Precipitation was
allowed to occur at 4 C and the solid polymer was air dried and
analyzed for composition by acidic butanolysis. Butylated PHA
monomers were separated by gas chromatography and identified the
PHA as a poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) copolymer
with 2.6% 3-hydroxyhexanoate monomers.
Example 16
Construction of Transgenic E. coli Strains for Screening of New
and/or Improved Genes for PHA Production
[0101] The phbC gene was introduced into an E. coli cloning strain
by bacteriophage P1 transduction. In a procedure similar to that
followed for phbC.sub.5 integration, the phbC gene from R. eutropha
was integrated into the chromosome of MBX23, resulting in MBX143.
After chloramphenicol amplification, MBX150, which is resistant to
500 .mu.g/ml chloramphenicol, was isolated. A bacteriophage P1
lysate grown on MBX150 was used to transduce the phbC-cat allele
into XL1-Blue [pT7-RecA]. Plasmid pT7RecA expresses a functional
RecA protein which is required for successful P1 transduction. The
resulting strain MBX240 is an XL1-Blue derivative with a functional
PHB polymerase expressed from the chromosome. MBX613 and MBX683
were developed using the same procedures. These strains were
derived from MBX245 and XL1-Blue, respectively, and contain
integrated AB.sub.5cat (MBX613) or p.sub.13AB.sub.5kan (MBX683)
operons.
Example 17
Identification of Genes Encoding New, Improved, or Ancillary PHA
Biosynthetic Enzymes
[0102] MBX240, 613, and 683 are three strains that can be used in
screening procedures for new or improved PHA genes. Using these
strains, the following genes have been identified: phbCABFA2 from
P. acidophila and phbCAB from A. latus. In addition, the phaJ gene
from A. caviae was functionally expressed in MBX240 to produce PHA
from fatty acids. Besides PHA biosynthetic genes specific for
C.sub.3 to C.sub.6 monomers, PHA biosynthetic enzymes for PHAs
consisting of medium side-chain 3-hydroxy acids can also be
expressed in E. coli. Such strains are useful in identifying
additional PHA biosynthetic enzymes.
Example 18
Integration of pha Genes in R. eutropha
[0103] The plasmids described in the previous examples were used to
integrate pha genes in R. eutropha. Using a PHA-negative mutant of
R. eutropha such as #2 (Peoples & Sinskey, J. Biol. Chem.
264:15298-303 (1989)) or PHB-4 (Schubert, et al., J. Bacteriol.
170:5837-47 (1988)), PHA formation was restored by integration of
phaC from A. caviae in combination with phbAB from Z. ramigera or
phaJ from A. caviae. The resulting strains produced PHAs to
variable levels, with a molecular weight in the range of 400,000 to
10,000,000 Da and with a composition that includes monomers such as
3-hydroxyhexanoate and 3-hydroxyoctanoate.
Example 19
Integration of pha Genes in P. putida
[0104] The plasmids described in the previous examples were used to
integrate pha genes into Pseudomonas putida. The PHA-negative
phenotype of P. putida GPp104 (Huisman et al., J. Biol. Chem.
266:2191-98 (1991)) was restored by integration of a phaC3kan
cassette where phaC3 encodes the PHA polymerase from P. oleovorans.
Integration of phaC3kan using pMUXC3kan was also applied to
generate mutants of P. putida with mutations in genes encoding
enzymes that affect PHA metabolism other than phaC. The PHA
polymerase gene from A. caviae was also introduced in to the
chromosome to result in a strain that produces PHAs including
3-hydroxy fatty acids in the C.sub.3 to C.sub.9 range.
Example 20
Chromosomal Integration of phaC Genes to Control Molecular Weight
of the Resulting PHA
[0105] It is well known that the concentration of PHA polymerase
determines the molecular weight of the produced PHA when substrate
is available in excess. Variation of the molecular weight is
desirable as polymer properties are dependent on molecular weight.
Chromosomal integration of phb genes results in variable levels of
expression of the pha gene as determined by the chromosomal
integration site. It is therefore possible to obtain different
transgenic bacteria that have variable levels of phaC expression
and hence produce PHAs of variable molecular weight. With this
system, it is possible to produce PHAs with molecular weights of
greater than 400,000 Da and frequently even in excess of 1,000,000
Da. This procedure is applicable to any gram-negative bacterium in
which the pUT or pLOF derived plasmids can be introduced, such as
E. coli, R. eutropha, P. putida, Klebsiella pneumoniae, Alcaligenes
latus, Azotobacter vinelandii, Burkholderia cepacia, Paracoccus
denitrificans and in general in species of the Escherichia,
Pseudomonas, Ralstonia, Burkholderia, Alcaligenes, Klebsiella,
Azotobacter genera.
Example 21
Integration of the PHB Genes as a Single Operon
[0106] A plasmid, pMSXABC.sub.5kan, was constructed such that the
thiolase (phbA), reductase (phbB), and PHB synthase (phbC) genes
from Zoogloea ramigera and the kanamycin resistance gene (kan) were
linked as an operon in the vector pUC18Sfi. This expression
cassette was then excised as an AvrII fragment and inserted into
the AvrII site of pUT to obtain pMUXABC.sub.5kan.
[0107] S17-1 .lambda.pir strains with pMUXABC.sub.5kan were mated
with MBX247. Transgenic strains in which phbABC.sub.5kan had
integrated into the chromosome were selected on LB/N1/Km plates.
Among the integrants, PHB producers were identified on LB/glucose
plates. One strain thus constructed, MBX1164, was selected for
further study.
[0108] Thiolase (Nishimura et al., 1978, Arch. Microbiol.
116:21-24) and reductase (Saito et al., 1977, Arch. Microbiol.
114:211-217) assays were conducted on MBX1164 crude extracts. The
cultures were grown in 50 mL of 0.5.times.E2 medium supplemented
with 20 g/L glucose. One unit (U) was defined as the amount of
enzyme that converted 1 mol of substrate to product per min.
3-Ketothiolase activity was determined to be 2.23.+-.0.38 and
2.48.+-.0.50 U/mg in two independent trials, and
3-hydroxybutyryl-CoA reductase activity was determined to be
4.10.+-.1.51 and 3.87.+-.0.15 U/mg in two independent trials.
[0109] Strain MBX1164 was evaluated for its PHB-producing ability
in square shake bottles. The cells were grown in 2 mL of LB, and
0.1 mL of this was used as an inoculum for the 50-mL shake bottle
culture. The shake bottle contained E2 medium supplemented with
0.25% corn steep liquor (Sigma, St. Louis, Mo.) and 20 g/L glucose.
After incubation at 30.degree. C. for 48 hours with shaking at 200
rpm, the biomass concentration had reached 2.6 g/L, and the PHB
concentration had reached 11.7 g/L; thus the cells contained 82%
PHB by weight.
Example 22
Integration of the Pseudomonas oleovorans PHA Synthase into the E.
coli Chromosome
[0110] A PHA synthase (phaC) cassette from the P. oleovorans
chromosome and a promoterless chloramphenicol resistance gene were
inserted into pUC118 such that an operon of the two genes was
formed; i.e., they were oriented in the same direction and could be
transcribed on the same mRNA. The sequence of the P.oleovorans phaC
gene is shown below. The phaC-cat operon was excised from this
plasmid by digestion with KpnI and HindIII and ligated to pUC18SfiI
that had been digested with the same two enzymes to form
pMSXC.sub.3cat. This allowed the phaC-cat operon to be flanked by
AvrII sites. The phaC-cat operon was removed from pMSXC.sub.3cat by
digestion with AvrII and FspI. Because the two AvrII fragments of
pMSXC.sub.3cat were nearly the same size, FspI was used to
facilitate isolation of the phaC-cat operon by cutting the rest of
the vector into two pieces. The AvrII fragment was ligated to
pUTkan which had been digested with AvrII and treated with alkaline
phosphatase to prevent self-ligation. The plasmid thus produced was
denoted pMUXC.sub.3cat. The operon on this plasmid actually
consisted of phaC-cat-kan. Strain CC118 .lambda.pir (a .lambda.pir
lysogenic strain) was transformed with pMUXC.sub.3cat to produce
strain MBX130. Equal amounts of strains MBX130 and MBX245 were
mixed on an LB agar plate and incubated for 8 hours at 37.degree.
C. The mixed cells were then used as an inoculum for an overnight
37.degree. C. culture of LB-chloramphenicol (25 .mu.g/mL)-nalidixic
acid (30 .mu.g/mL). Single colonies were isolated from this culture
by plating on LB-chloramphenicol (25 .mu.g/mL)-nalidixic acid (30
.mu.g/mL)-kanamycin (25 .mu.g/mL). The colonies thus isolated have
a transducible phaC-cat-kan cassette on the chromosome, as shown by
the ability to use P1 transduction to introduce the cassette into
the chromosome of other strains and select for resistance to both
chloramphenicol and kanamycin.
18 Pseudomonas oleovorans PHA synthase (phaC).
ATGAGTAACAAGAACAACGATGAGCTGCAGCGGCAGGCCTCGGAAAACACCCTGGGGCTGAACCCGGTCATC
GGTATCCGCCGCAAAGACCTGTTGAGCTCGGCACGCACCGTGCTGCGCCAGGCCGTGCGCCAACCG-
CTGCAC
AGCGCCAAGCATGTGGCCCACTTTGGCCTGGAGCTGAAGAACGTGCTGCTGGGCAAGTCC-
AGCCTTGCCCCG
GAAAGCGACGACCGTCGCTTCAATGACCCGGCATGGAGCAACAACCCACTTTAC-
CGCCGCTACCTGCAAACC
TATCTGGCCTGGCGCAAGGAGCTGCAGGACTGGATCGGCAACAGCGAC-
CTGTCGCCCCAGGACATCAGCCGC
GGCCAGTTCGTCATCAACCTGATGACCGAAGCCATGGCTCCG-
ACCAACACCCTGTCCAACCCGGCAGCAGTC
AAACGCTTCTTCGAAACCGGCGGCAAGAGCCTGCTC-
GATGGCCTGTCCAACCTGGCCAAGGACCTGGTCAAC
AACGGTGGCATGCCCAGCCAGGTGAACATG-
GACGCCTTCGAGGTGGGCAAGAACCTGGGCACCAGTGAAGGC
GCCGTGGTGTACCGCAACGATGTG-
CTGGAGCTGATCCAGTACAACCCCATCACCGAGCAGGTGCATGCCCGC
CCGCTGCTGGTGGTGCCGCCGCAGATCAACAAGTTCTACGTATTCGACCTGAGCCCGGAAAAGAGCCTGGCA
CGCTACTGCCTGCGCTCGCAGCAGCAGACCTTCATCATCAGCTGGCGCAACCCGACCAAAGCCCAG-
CGCGAA
TGGGGCCTGTCCACCTACATCGACGCGCTCAAGGAGGCGGTCGACGCGGTGCTGGCGATT-
ACCGGCAGCAAG
GACCTGAACATGGTCGGTGCCTGCTCCGGCGGCATCACCTGCACGGCATTGGTC-
GGCCACTATGCCGCCCTC
GCCGAAAACAAGGTCAATGCCCTGACCCTGCTGGTCAGCGTGCTGGAC-
ACCACCATGGACAACCAGGTCGCC
CTGTTCGTCGACGAGCAGACTTTGGAGGCCGCCAAGCGCCAC-
TCCTACCAGGCCGGTGTGCTCGAAGGCAGC
GAGATGGCCAAGGTGTTCGCCTGGATGCGCCCCAAC-
GACCTGATCTGGAACTACTGGGTCAACAACTACCTG
CTCGGCAACGAGCCGCCGGTGTTCGACATC-
CTGTTCTGGAACAACGACACCACGCGCCTGCCGGCCGCCTTC
CACGGCGACCTGATCGAAATGTTC-
AAGAGCAACCCGCTGACCCGCCCGGACGCCCTGGAGGTTTGCGGCACT
CCGATCGACCTGAAACAGGTCAAATGCGACATCTACAGCCTTGCCGGCACCAACGACCACATCACCCCGTGG
CAGTCATGCTACCGCTCGGCGCACCTGTTCGGCGGCAAGATCGAGTFCGTGCTGTCCAACAGCGGC-
CACATC
CAGAGCATCCTCAACCCGCCAGGCAACCCCAAGGCGCGCTTCATGACCGGTGCCGATCGC-
CCGGGTGACCCG
GTGGCCTGGCAGGAAAACGCCACCAAGCATGCCGACTCCTGGTGGCTGCACTGG-
CAAAGCTGGCTGGGCGAG
CGTGCCGGCGAGCTGAAAAAGGCGCCGACCCGCCTCGGCAACCGTGCC-
TATGCCGCTGGCGAGGCATCCCCG GGCACCTACGTTCACGAGCGTTGA
[0111] Modifications and variations of the present invention will
be obvious to those of skill in the art from the foregoing detailed
description. Such modifications and variations are intended to come
within the scope of the following claims.
* * * * *