U.S. patent application number 10/483416 was filed with the patent office on 2005-08-04 for process for the preparation of l-amino acids using strains of the enterobacteriaceae family which contain an enhanced soda gene.
This patent application is currently assigned to Degussa AG. Invention is credited to Rieping, Mechthild.
Application Number | 20050170472 10/483416 |
Document ID | / |
Family ID | 26009728 |
Filed Date | 2005-08-04 |
United States Patent
Application |
20050170472 |
Kind Code |
A1 |
Rieping, Mechthild |
August 4, 2005 |
Process for the preparation of l-amino acids using strains of the
enterobacteriaceae family which contain an enhanced soda gene
Abstract
The invention relates to a process for the preparation of
L-amino acids, in particular L-threonine, in which the following
steps are carried out: a) fermentation of microorganisms of the
Enterobacteriaceae family which produce the desired L-amino acid
and in which at least the sodA gene, or the nucleotide sequence
which codes for this, is enhanced, in particular over-expressed, b)
concentration of the desired L-amino acid in the medium or in the
cells of the bacteria, and c) isolation of the desired L-amino
acid.
Inventors: |
Rieping, Mechthild;
(Bielefeld, DE) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND, MAIER & NEUSTADT, P.C.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
Degussa AG
|
Family ID: |
26009728 |
Appl. No.: |
10/483416 |
Filed: |
January 20, 2004 |
PCT Filed: |
July 3, 2002 |
PCT NO: |
PCT/EP02/07373 |
Current U.S.
Class: |
435/106 ;
435/252.33; 435/488 |
Current CPC
Class: |
C07K 14/24 20130101;
C07K 14/245 20130101; C12P 13/08 20130101 |
Class at
Publication: |
435/106 ;
435/252.33; 435/488 |
International
Class: |
C12P 013/04; C12N
015/74; C12N 001/21 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 18, 2001 |
DE |
10135053.8 |
Jul 23, 2001 |
US |
60/306869 |
Claims
What is claimed is:
1. A process for the preparation of L-amino acids, in particular
L-threonine, which comprises carrying out the following steps: a)
fermentation of microorganisms of the Enterobacteriaceae family
which produce the desired L-amino acid and in which at least the
sodA gene, or the nucleotide sequence which codes for this, is
enhanced, in-particular over-expressed, b) concentration of the
desired L-amino acid in the medium or in the cells of the
microorganisms, and c) isolation of the desired L-amino acid,
constituents of the fermentation broth and/or the biomass in its
entirety or portions (>0 to 100%) thereof optionally remaining
in the product.
2. A process as claimed in claim 1, wherein microorganisms in which
further genes of the biosynthesis pathway of the desired L-amino
acid are additionally enhanced are employed.
3. A process as claimed in claim 1, wherein microorganisms in which
the metabolic pathways which reduce the formation of the desired
L-amino acid are at least partly eliminated are employed.
4. A process as claimed in claim 1, wherein the expression of the
polynucleotide which codes for the sodA gene is increased.
5. A process as claimed in claim 1, wherein the regulatory and/or
catalytic properties of the polypeptide (protein) for which the
polynucleotide sodA codes are improved or increased.
6. A process as claimed in claim 1, wherein, for the preparation of
L-amino acids, microorganisms of the Enterobacteriaceae family in
which in addition at the same time one or more of the genes chosen
from the group consisting of: 6.1 the thrABC operon which codes for
aspartate kinase, homoserine dehydrogenase, homoserine kinase and
threonine synthase, 6.2 the pyc gene which codes for pyruvate
carboxylase, 6.3 the pps gene which codes for phosphoenol pyruvate
synthase, 6.4 the ppc gene which codes for phosphoenol pyruvate
carboxylase, 6.5 the pntA and pntB genes which code for
transhydrogenase, 6.6 the rhtb gene which imparts homoserine
resistance, 6.7 the mqo gene which codes for malate:quinone
oxidoreductase, 6.8 the rhtC gene which imparts threonine
resistance, 6.9 the thrE gene which codes for the threonine export
protein, 6.10 the gdhA gene which codes for glutamate
dehydrogenase, 6.11 the hns gene which codes for the DNA-binding
protein HLP-II, 6.12 the pgm gene which codes for
phosphoglucomutase, 6.13 the fba gene which codes for fructose
biphosphate aldolase, 6.14 the ptsH gene which codes for the
phosphohistidine protein hexose phosphotransferase, 6.15 the ptsI
gene which codes for enzyme I of the phosphotransferase system,
6.16 the crr gene which codes for the glucose-specific IIA
component, 6.17 the ptsG gene which codes for the glucose-specific
IIBC component, 6.18 the lrp gene which codes for the regulator of
the leucine regulon, 6.19 the mopB gene which codes for 10 Kd
chaperone, 6.20 the ahpc gene which codes for the small sub-unit of
alkyl hydroperoxide reductase, 6.21 the ahpF gene which codes for
the large sub-unit of alkyl hydroperoxide reductase, 6.22 the cysk
gene which codes for cysteine synthase A, 6.23 the cysB gene which
codes for the regulator of the cys regulon, 6.24 the cysJ gene
which codes for the flavoprotein of NADPH sulfite reductase, 6.25
the cysI gene which codes for the haemoprotein of NADPH sulfite
reductase, 6.26 the cysH gene which codes for adenylyl sulfate
reductase, 6.27 the phoB gene which codes for the positive
regulator PhoB of the pho regulon, 6.28 the phoR gene which codes
for the sensor protein of the pho regulon, 6.29 the phoE gene which
codes for protein E of outer cell membrane, 6.30 the malE gene
which codes for the periplasmic binding protein of maltose
transport 6.31 the pykF gene which codes for fructose-stimulated
pyruvate kinase I, 6.32 the talB gene which codes for transaldolase
B, 6.33 the rseA gene which codes for a membrane protein which acts
as a negative regulator on sigmaE activity, 6.34 the rseC gene
which codes for a global regulator of the sigmaE factor, 6.35 the
pfkB gene which codes for 6-phosphofructokinase II, 6.36 the sucA
gene which codes for the decarboxylase sub-unit of 2-ketoglutarate
dehydrogenase, 6.37 the sucB gene which codes for the
dihydrolipoyltranssuccinase E2 sub-unit of 2-ketoglutarate
dehydrogenase, 6.38 the sucC gene which codes for the
.beta.-sub-unit of succinyl-CoA synthetase, 6.39 the sucD gene
which codes for the .alpha.-sub-unit of succinyl-CoA synthetase, is
or are enhanced, in particular over-expressed, are fermented.
7. A process as claimed in claim 1, wherein, for the preparation of
L-amino acids, microorganisms of the Enterobacteriaceae family in
which in addition at the same time one or more of the genes chosen
from the group consisting of: 7.1 the tdh gene which codes for
threonine dehydrogenase, 7.2 the mdh gene which codes for malate
dehydrogenase, 7.3 the gene product of the open reading frame (orf)
yjfA, 7.4 the gene product of the open reading frame (orf) ytfP,
7.5 the pckA gene which codes for phosphoenol pyruvate
carboxykinase, 7.6 the poxB gene which codes for pyruvate oxidase,
7.7 the aceA gene which codes for isocitrate lyase, 7.8 the dgsA
gene which codes for the DgsA regulator of the phosphotransferase
system, 7.9 the fruR gene which codes for the fructose repressor,
7.10 the rpoS gene which codes for the sigma.sup.38 factor is or
are attenuated, in particular eliminated or reduced in expression,
are fermented.
Description
FIELD OF THE INVENTION
[0001] This invention relates to a process for the fermentative
preparation of L-amino acids, in particular L-threonine, using
strains of the Enterobacteriaceae family in which at least the sodA
gene is enhanced.
PRIOR ART
[0002] L-Amino acids, in particular L-threonine, are used in human
medicine and in the pharmaceuticals industry, in the foodstuffs
industry and very particularly in animal nutrition.
[0003] It is known to prepare L-amino acids by fermentation of
strains of Enterobacteriaceae, in particular Escherichia coli (E.
coli) and Serratia marcescens. Because of their great importance,
work is constantly being undertaken to improve the preparation
processes. Improvements to the process can relate to fermentation
measures, such as e.g. stirring and supply of oxygen, or the
composition of the nutrient media, such as e.g. the sugar
concentration during the fermentation, or the working up to the
product form, by e.g. ion exchange chromatography, or the intrinsic
output properties of the microorganism itself.
[0004] Methods of mutagenesis, selection and mutant selection are
used to improve the output properties of these microorganisms.
Strains which are resistant to antimetabolites, such as e.g. the
threonine analogue .alpha.-amino-.beta.-hydroxyvaleric acid (AHV),
or are auxotrophic for metabolites of regulatory importance and
produce L-amino acid, such as e.g. L-threonine, are obtained in
this manner.
[0005] Methods of the recombinant DNA technique have also been
employed for some years for improving the strain of strains of the
Enterobacteriaceae family which produce L-amino acids, by
amplifying individual amino acid biosynthesis genes and
investigating the effect on the production.
OBJECT OF THE INVENTION
[0006] The object of the invention is to provide new measures for
improved fermentative preparation of L-amino acids, in particular
L-threonine.
SUMMARY OF THE INVENTION
[0007] The invention provides a process for the fermentative
preparation of L-amino acids, in particular L-threonine, using
microorganisms of the Enterobacteriaceae family which in particular
already produce L-amino acids and in which at least the nucleotide
sequence which codes for the sodA gene is enhanced.
DETAILED DESCRIPTION OF THE INVENTION
[0008] Where L-amino acids or amino acids are mentioned in the
following, this means one or more amino acids, including their
salts, chosen from the group consisting of L-asparagine,
L-threonine, L-serine, L-glutamate, L-glycine, L-alanine,
L-cysteine, L-valine, L-methionine, L-isoleucine, L-leucine,
L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan
and L-arginine. L-Threonine is particularly preferred.
[0009] The term "enhancement" in this connection describes the
increase in the intracellular activity of one or more enzymes or
proteins in a microorganism which are coded by the corresponding
DNA, for example by increasing the number of copies of the gene or
genes, using a potent promoter or a gene or allele which codes for
a corresponding enzyme or protein with a high activity, and
optionally combining these measures.
[0010] By enhancement measures, in particular over-expression, the
activity or concentration of the corresponding protein is in
general increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%,
300%, 400% or 500%, up to a maximum of 1000% or 2000%, based on
that of the wild-type protein or the activity or concentration of
the protein in the starting microorganism.
[0011] The process comprises carrying out the following steps:
[0012] a) fermentation of microorganisms of the Enterobacteriaceae
family in which at least the sodA gene is enhanced,
[0013] b) concentration of the corresponding L-amino acid in the
medium or in the cells of the microorganisms of the
Enterobacteriaceae family, and
[0014] c) isolation of the desired L-amino acid, constituents of
the fermentation broth and/or the biomass in its entirety or
portions (>0 to 100%) thereof optionally remaining in the
product.
[0015] The microorganisms which the present invention provides can
produce L-amino acids from glucose, sucrose, lactose, fructose,
maltose, molasses, optionally starch, optionally cellulose or from
glycerol and ethanol. They are representatives of the
Enterobacteriaceae family chosen from the genera Escherichia,
Erwinia, Providencia and Serratia. The genera Escherichia and
Serratia are preferred. Of the genus Escherichia the species
Escherichia coli and of the genus Serratia the species Serratia
marcescens are to be mentioned in particular.
[0016] Suitable strains, which produce L-threonine in particular,
of the genus Escherichia, in particular of the species Escherichia
coli, are, for example
[0017] Escherichia coli TF427
[0018] Escherichia coli H4578
[0019] Escherichia coli KY10935
[0020] Escherichia coli VNIIgenetika MG442
[0021] Escherichia coli VNIIgenetika M1
[0022] Escherichia coli VNIIgenetika 472T23
[0023] Escherichia coli BKIIM B-3996
[0024] Escherichia coli kat 13
[0025] Escherichia coli KCCM-10132.
[0026] Suitable L-threonine-producing strains of the genus
Serratia, in particular of the species Serratia marcescens, are,
for example
[0027] Serratia marcescens HNr21
[0028] Serratia marcescens TLr156
[0029] Serratia marcescens T2000.
[0030] Strains from the Enterobacteriaceae family which produce
L-threonine preferably have, inter alia, one or more genetic or
phenotypic features chosen from the group consisting of: resistance
to .alpha.-amino-.beta.-hydroxyvaleric acid, resistance to
thialysine, resistance to ethionine, resistance to
.alpha.-methylserine, resistance to diaminosuccinic acid,
resistance to .alpha.-aminobutyric acid, resistance to borrelidin,
resistance to rifampicin, resistance to valine analogues, such as,
for example, valine hydroxamate, resistance to purine analogues,
such as, for example, .alpha.-dimethylaminopurine, a need for
L-methionine, optionally a partial and compensatable need for
L-isoleucine, a need for meso-diaminopimelic acid, auxotrophy in
respect of threonine-containing dipeptides, resistance to
L-threonine, resistance to L-homoserine, resistance to L-lysine,
resistance to L-methionine, resistance to L-glutamic acid,
resistance to L-aspartate, resistance to L-leucine, resistance to
L-phenylalanine, resistance to L-serine, resistance to L-cysteine,
resistance to L-valine, sensitivity to fluoropyruvate, defective
threonine dehydrogenase, optionally an ability for sucrose
utilization, enhancement of the threonine operon, enhancement of
homoserine dehydrogenase I-aspartate kinase I, preferably of the
feed back resistant form, enhancement of homoserine kinase,
enhancement of threonine synthase, enhancement of aspartate kinase,
optionally of the feed back resistant form, enhancement of
aspartate semialdehyde dehydrogenase, enhancement of phosphoenol
pyruvate carboxylase, optionally of the feed back resistant form,
enhancement of phosphoenol pyruvate synthase, enhancement of
transhydrogenase, enhancement of the RhtB gene product, enhancement
of the RhtC gene product, enhancement of the YfiK gene product,
enhancement of a pyruvate carboxylase, and attenuation of acetic
acid formation.
[0031] It has been found that microorganisms of the
Enterobacteriaceae family produce L-amino acids, in particular
L-threonine, in an improved manner after enhancement, in particular
over-expression, of the sodA gene.
[0032] The nucleotide sequences of the genes of Escherichia coli
belong to the prior art and can also be found in the genome
sequence of Escherichia coli published by Blattner et al. (Science
277: 1453-1462 (1997)).
[0033] The following information, inter alia, on the sodA gene is
known from the prior art:
1 Description: Superoxide dismutase EC No. 1.15.1.1 Reference:
Touati; Journal of Bacteriology 155(3): 1078-1087 (1983); Schrum
and Hassan; Free Radical Biology and Medicine 17(3): 209-213
(1994); Benov and Fridovich; Archieves of Biochemistry and
Biophysics 322(1): 291-294 (1995) Accession No.: AE000465
[0034] The nucleic acid sequences can be found in the databanks of
the National Center for Biotechnology Information (NCBI) of the
National Library of Medicine (Bethesda, Md., USA), the nucleotide
sequence databank of the European Molecular Biologies Laboratories
(EMBL, Heidelberg, Germany or Cambridge, UK) or the DNA databank of
Japan (DDBJ, Mishima, Japan).
[0035] The genes described in the text references mentioned can be
used according to the invention. Alleles of the genes which result
from the degeneracy of the genetic code or due to "sense mutations"
of neutral function can furthermore be used.
[0036] To achieve an enhancement, for example, expression of the
genes or the catalytic properties of the proteins can be increased.
The two measures can optionally be combined.
[0037] To achieve an over-expression, the number of copies of the
corresponding genes can be increased, or the promoter and
regulation region or the ribosome binding site upstream of the
structural gene can be mutated. Expression cassettes which are
incorporated upstream of the structural gene act in the same way.
By inducible promoters, it is additionally possible to increase the
expression in the course of fermentative L-threonine production.
The expression is likewise improved by measures to prolong the life
of the m-RNA. Furthermore, the enzyme activity is also increased by
preventing the degradation of the enzyme protein. The genes or gene
constructs can either be present in plasmids with a varying number
of copies, or can be integrated and amplified in the chromosome.
Alternatively, an over-expression of the genes in question can
furthermore be achieved by changing the composition of the media
and the culture procedure.
[0038] Instructions in this context can be found by the expert,
inter alia, in Chang and Cohen (Journal of Bacteriology 134:
1141-1156 (1978)), in Hartley and Gregori (Gene 13:347-353 (1981)),
in Amann and Brosius (Gene 40: 183-190 (1985)), in de Broer et al.
(Proceedings of the National Academy of Sciences of the United
States of America 80: 21-25 (1983)), in LaVallie et al.
(BIO/TECHNOLOGY 11: 187-193 (1993)), in PCT/US97/13359, in Llosa et
al. (Plasmid 26:222-224 (1991)), in Quandt and Klipp (Gene 80:
161-169 (1989)), in Hamilton et al. (Journal of Bacteriology 171:
4617-4622 (1989)), in Jensen and Hammer (Biotechnology and
Bioengineering 58: 191-195 (1998)) and in known textbooks of
genetics and molecular biology.
[0039] Plasmid vectors which are capable of replication in
Enterobacteriaceae, such as e.g. cloning vectors derived from
pACYC184 (Bartolom et al.; Gene 102: 75-78 (1991)), pTrc99A (Amann
et al.; (Gene 69: 301-315 (1988)) or pSC101 derivatives (Vocke and
Bastia; Proceedings of the National Academy of Sciences of the
United States of America 80 (21): 6557-6561 (1983)) can be used. A
strain transformed with a plasmid vector, where the plasmid vector
carries at least the sodA gene, or the nucleotide sequence which
codes for this, can be employed in a process according to the
invention.
[0040] It is also possible to transfer mutations which affect the
expression of the particular gene into various strains by sequence
exchange (Hamilton et al.; Journal of Bacteriology 171: 4617-4622
(1989)), conjugation or transduction.
[0041] It may furthermore be advantageous for the production of
L-amino acids, in particular L-threonine, with strains of the
Enterobacteriaceae family, in addition to enhancement of the sodA
gene, for one or more enzymes of the known threonine biosynthesis
pathway or enzymes of anaplerotic metabolism or enzymes for the
production of reduced nicotinamide adenine dinucleotide phosphate
or enzymes of glycolysis or PTS enzymes or enzymes of sulfur
metabolism to be enhanced.
[0042] Thus, for example, at the same time one or more of the genes
chosen from the group consisting of
[0043] the thrABC operon which codes for aspartate kinase,
homoserine dehydrogenase, homoserine kinase and threonine synthase
(U.S. Pat. No. 4,278,765),
[0044] the pyc gene of Corynebacterium glutamicum which codes for
pyruvate carboxylase (WO 99/18228),
[0045] the pps gene which codes for phosphoenol pyruvate synthase
(Molecular and General Genetics 231(2): 332-336 (1992)),
[0046] the ppc gene which codes for phosphoenol pyruvate
carboxylase (Gene 31: 279-283 (1984)),
[0047] the pntA and pntB genes which code for transhydrogenase
(European Journal of Biochemistry 158: 647-653 (1986)),
[0048] the rhtB gene which imparts homoserine resistance (EP-A-0
994 190),
[0049] the mqo gene which codes for malate:quinone oxidoreductase
(WO 02/06459),
[0050] the rhtC gene which imparts threonine resistance (EP-A-1 013
765),
[0051] the thrE gene of Corynebacterium glutamicum which codes for
the threonine export protein (WO 01/92545),
[0052] the gdhA gene which codes for glutamate dehydrogenase
(Nucleic Acids Research 11: 5257-5266 (1983); Gene 23:199-209
(1983)),
[0053] the hns gene which codes for the DNA-binding protein HLP-II
(Molecular and General Genetics 212: 199-202 (1988)),
[0054] the pgm gene which codes for phosphoglucomutase (Journal of
Bacteriology 176: 5847-5851 (1994)),
[0055] the fba gene which codes for fructose biphosphate aldolase
(Biochemical Journal 257: 529-534 (1989)),
[0056] the ptsH gene of the ptsHIcrr operon which codes for the
phosphohistidine protein hexose phosphotransferase of the
phosphotransferase system PTS (Journal of Biological Chemistry 262:
16241-16253 (1987)),
[0057] the ptsI gene of the ptsHIcrr operon which codes for enzyme
I of the phosphotransferase system PTS (Journal of Biological
Chemistry 262: 16241-16253 (1987)),
[0058] the crr gene of the ptsHIcrr operon which codes for the
glucose-specific IIA component of the phosphotransferase system PTS
(Journal of Biological Chemistry 262: 16241-16253 (1987)),
[0059] the ptsG gene which codes for the glucose-specific IIBC
component (Journal of Biological Chemistry 261: 16398-16403
(1986)),
[0060] the lrp gene which codes for the regulator of the leucine
regulon (Journal of Biological Chemistry 266: 10768-10774
(1991)),
[0061] the mopB gene which codes for 10 Kd chaperone (Journal of
Biological Chemistry 261: 12414-12419 (1986)) and is also known by
the name groES,
[0062] the ahpC gene of the ahpCF operon which codes for the small
sub-unit of alkyl hydroperoxide reductase (Proceedings of the
National Academy of Sciences of the United States of America 92:
7617-7621 (1995)),
[0063] the ahpF gene of the ahpCF operon which codes for the large
sub-unit of alkyl hydroperoxide reductase (Proceedings of the
National Academy of Sciences of the United States of America 92:
7617-7621 (1995)),
[0064] the cysK gene which codes for cysteine synthase A (Journal
of Bacteriology 170: 3150-3157 (1988)),
[0065] the cysB gene which codes for the regulator of the cys
regulon (Journal of Biological Chemistry 262: 5999-6005
(1987)),
[0066] the cysJ gene of the cysJIH operon which codes for the
flavoprotein of NADPH sulfite reductase (Journal of Biological
Chemistry 264: 15796-15808 (1989), Journal of Biological Chemistry
264: 15726-15737 (1989)),
[0067] the cysI gene of the cysJIH operon which codes for the
haemoprotein of NADPH sulfite reductase (Journal of Biological
Chemistry 264: 15796-15808 (1989), Journal of Biological Chemistry
264: 15726-15737 (1989)),
[0068] the cysH gene of the cysJIH operon which codes for adenylyl
sulfate reductase (Journal of Biological Chemistry 264: 15796-15808
(1989), Journal of Biological Chemistry 264: 15726-15737
(1989)),
[0069] the phoB gene of the phoBR operon which codes for the
positive regulator PhoB of the pho regulon (Journal of Molecular
Biology 190 (1): 37-44 (1986)),
[0070] the phoR gene of the phoBR operon which codes for the sensor
protein of the pho regulon (Journal of Molecular Biology 192 (3):
549-556 (1986)),
[0071] the phoE gene which codes for protein E of the outer cell
membrane (Journal of Molecular Biology 163 (4): 513-532
(1983)),
[0072] the malE gene which codes for the periplasmic binding
protein of maltose transport (Journal of Biological Chemistry 259
(16): 10606-10613 (1984)),
[0073] the pykF gene which codes for fructose-stimulated pyruvate
kinase I (Journal of Bacteriology 177 (19): 5719-5722 (1995)),
[0074] the talB gene which codes for transaldolase B (Journal of
Bacteriology 177 (20): 5930-5936 (1995)),
[0075] the rseA gene of the rseABC operon which codes for a
membrane protein with anti-sigmaE activity (Molecular Microbiology
24 (2): 355-371 (1997)),
[0076] the rseC gene of the rseABC operon which codes for a global
regulator of the sigmaE factor (Molecular Microbiology 24 (2):
355-371 (1997)),
[0077] the pfkB gene which codes for 6-phosphofructokinase II (Gene
28 (3): 337-342 (1984)),
[0078] the sucA gene of the sucABCD operon which codes for the
decarboxylase sub-unit of 2-ketoglutarate dehydrogenase (European
Journal of Biochemistry 141 (2): 351-359 (1984)),
[0079] the sucB gene of the sucABCD operon which codes for the
dihydrolipoyltranssuccinase E2 sub-unit of 2-ketoglutarate
dehydrogenase (European Journal of Biochemistry 141 (2): 361-374
(1984)),
[0080] the sucC gene of the sucABCD operon which codes for the
.beta.-sub-unit of succinyl-CoA synthetase (Biochemistry 24 (22):
6245-6252 (1985)) and
[0081] the sucD gene of the sucABCD operon which codes for the
.alpha.-sub-unit of succinyl-CoA synthetase (Biochemistry 24 (22):
6245-6252 (1985)),
[0082] can be enhanced, in particular over-expressed.
[0083] It may furthermore be advantageous for the production of
L-amino acids, in particular L-threonine, in addition to
enhancement of the sodA gene, for one or more of the genes chosen
from the group consisting of
[0084] the tdh gene which codes for threonine dehydrogenase
(Journal of Bacteriology 169: 4716-4721 (1987)),
[0085] the mdh gene which codes for malate dehydrogenase (E.C.
1.1.1.37) (Archives in Microbiology 149: 36-42 (1987)),
[0086] the gene product of the open reading frame (orf) yjfA
(Accession Number AAC77180 of the National Center for Biotechnology
Information (NCBI, Bethesda, Md., USA)),
[0087] the gene product of the open reading frame (orf) ytfP
(Accession Number AAC77179 of the National Center for Biotechnology
Information (NCBI, Bethesda, Md., USA)),
[0088] the pckA gene which codes for the enzyme phosphoenol
pyruvate carboxykinase (Journal of Bacteriology 172: 7151-7156
(1990)),
[0089] the poxB gene which codes for pyruvate oxidase (Nucleic
Acids Research 14(13): 5449-5460 (1986)),
[0090] the aceA gene which codes for the enzyme isocitrate lyase
(Journal of Bacteriology 170: 4528-4536 (1988)),
[0091] the dgsA gene which codes for the DgsA regulator of the
phosphotransferase system (Bioscience, Biotechnology and
Biochemistry 59: 256-251 (1995)) and is also known under the name
of the mlc gene,
[0092] the fruR gene which codes for the fructose repressor
(Molecular and General Genetics 226: 332-336 (1991)) and is also
known under the name of the cra gene and
[0093] the rpoS gene which codes for the sigma.sup.38 factor (WO
01/05939) and is also known under the name of the katF gene,
[0094] to be attenuated, in particular eliminated or for the
expression thereof to be reduced.
[0095] The term "attenuation" in this connection describes the
reduction or elimination of the intracellular activity of one or
more enzymes (proteins) in a microorganism which are coded by the
corresponding DNA, for example by using a weak promoter or a gene
or allele which codes for a corresponding enzyme with a low
activity or inactivates the corresponding enzyme (protein) or gene,
and optionally combining these measures.
[0096] By attenuation measures, the activity or concentration of
the corresponding protein is in general reduced to 0 to 75%, 0 to
50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or concentration
of the wild-type protein or of the activity or concentration of the
protein in the starting microorganism.
[0097] It may furthermore be advantageous for the production of
L-amino acids, in particular L-threonine, in addition to
enhancement of the sodA gene, to eliminate undesirable side
reactions (Nakayama: "Breeding of Amino Acid Producing
Microorganisms", in: Overproduction of Microbial Products,
Krumphanzl, Sikyta, Vanek (eds.), Academic Press, London, UK,
1982).
[0098] The microorganisms produced according to the invention can
be cultured in the batch process (batch culture), the fed batch
process (feed process) or the repeated fed batch process
(repetitive feed process). A summary of known culture methods is
described in the textbook by Chmiel (Bioprozesstechnik 1.
Einfuhrung in die Bioverfahrenstechnik [Bioprocess Technology 1.
Introduction to Bioprocess Technology (Gustav Fischer Verlag,
Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren und
periphere Einrichtungen [Bioreactors and Peripheral Equipment]
(Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).
[0099] The culture medium to be used must meet the requirements of
the particular strains in a suitable manner. Descriptions of
culture media for various microorganisms are contained in the
handbook "Manual of Methods for General Bacteriology" of the
American Society for Bacteriology (Washington D.C., USA, 1981).
[0100] Sugars and carbohydrates, such as e.g. glucose, sucrose,
lactose, fructose, maltose, molasses, starch and optionally
cellulose, oils and fats, such as e.g. soya oil, sunflower oil,
groundnut oil and coconut fat, fatty acids, such as e.g. palmitic
acid, stearic acid and linoleic acid, alcohols, such as e.g.
glycerol and ethanol, and organic acids, such as e.g. acetic acid,
can be used as the source of carbon. These substances can be used
individually or as a mixture.
[0101] Organic nitrogen-containing compounds, such as peptones,
yeast extract, meat extract, malt extract, corn steep liquor, soya
bean flour and urea, or inorganic compounds, such as ammonium
sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate
and ammonium nitrate, can be used as the source of nitrogen. The
sources of nitrogen can be used individually or as a mixture.
[0102] Phosphoric acid, potassium dihydrogen phosphate or
dipotassium hydrogen phosphate or the corresponding
sodium-containing salts can be used as the source of phosphorus.
The culture medium must furthermore comprise salts of metals, such
as e.g. magnesium sulfate or iron sulfate, which are necessary for
growth. Finally, essential growth substances, such as amino acids
and vitamins, can be employed in addition to the abovementioned
substances. Suitable precursors can moreover be added to the
culture medium. The starting substances mentioned can be added to
the culture in the form of a single batch, or can be fed in during
the culture in a suitable manner.
[0103] Basic compounds, such as sodium hydroxide, potassium
hydroxide, ammonia or aqueous ammonia, or acid compounds, such as
phosphoric acid or sulfuric acid, can be employed in a suitable
manner to control the pH of the culture. Antifoams, such as e.g.
fatty acid polyglycol esters, can be employed to control the
development of foam. Suitable substances having a selective action,
e.g. antibiotics, can be added to the medium to maintain the
stability of plasmids. To maintain aerobic conditions, oxygen or
oxygen-containing gas mixtures, such as e.g. air, are introduced
into the culture. The temperature of the culture is usually
25.degree. C. to 45.degree. C., and preferably 30.degree. C. to
40.degree. C. Culturing is continued until a maximum of L-amino
acids or L-threonine has formed. This target is usually reached
within 10 hours to 160 hours. The analysis of L-amino acids can be
carried out by anion exchange chromatography with subsequent
ninhydrin derivation, as described by Spackman et al. (Analytical
Chemistry 30: 1190-1206 (1958)), or it can take place by reversed
phase HPLC as described by Lindroth et al. (Analytical Chemistry
51: 1167-1174 (1979)).
[0104] The process according to the invention is used for the
fermentative preparation of L-amino acids, such as, for example,
L-threonine, L-isoleucine, L-valine, L-methionine, L-homoserine and
L-lysine, in particular L-threonine.
[0105] The present invention is explained in more detail in the
following with the aid of embodiment examples.
[0106] The minimal (M9) and complete media (LB) for Escherichia
coli used are described by J. H. Miller (A Short Course in
Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press).
The isolation of plasmid DNA from Escherichia coli and all
techniques of restriction, ligation, Klenow and alkaline
phosphatase treatment are carried out by the method of Sambrook et
al. (Molecular Cloning--A Laboratory Manual (1989) Cold Spring
Harbor Laboratory Press). Unless described otherwise, the
transformation of Escherichia coli is carried out by the method of
Chung et al. (Proceedings of the National Academy of Sciences of
the United States of America 86: 2172-2175 (1989)).
[0107] The incubation temperature for the preparation of strains
and transformants is 37.degree. C.
EXAMPLE 1
[0108] Construction of the Expression Plasmid pTrc99AsodA
[0109] The sodA gene from E. coli K12 is amplified using the
polymerase chain reaction (PCR) and synthetic oligonucleotides.
Starting from the nucleotide sequence of the sodA gene in E. coli
K12 MG1655 (Accession Number AE000465, Blattner et al. (Science
277: 1453-1462 (1997)), PCR primers are synthesized (MWG Biotech,
Ebersberg, Germany). The sequences of the primers are modified such
that recognition sites for restriction enzymes are formed. The
recognition sequence for XbaI is chosen for the sodA1 primer and
the recognition sequence for HindIII for the sodA2 primer, which
are marked by underlining in the nucleotide sequence shown
below:
2 sodA1: (SEQ ID No. 1) 5' - CGCGGCATCTAGAATCTGACGCCCGACAATAC - 3'
sodA2: (SEQ ID No. 2) 5' - CGCCTCATTGAAGCTTGCGGCAAATG - 3'
[0110] The chromosomal E. coli K12 MG1655 DNA employed for the PCR
is isolated according to the manufacturer's instructions with
"Qiagen Genomic-tips 100/G" (QIAGEN, Hilden, Germany). A DNA
fragment approx. 700 bp in size can be amplified with the specific
primers under standard PCR conditions (Innis et al. (1990) PCR
Protocols. A Guide to Methods and Applications, Academic Press)
with Pfu-DNA polymerase (Promega Corporation, Madison, USA).
[0111] The PCR product is ligated according to the manufacturer's
instructions with the vector pCR-Blunt II-TOPO (Zero Blunt TOPO PCR
Cloning Kit, Invitrogen, Groningen, The Netherlands) and
transformed into the E. coli strain TOP10. Selection of
plasmid-carrying cells takes place on LB agar, to which 50 .mu.g/ml
kanamycin are added. After isolation of the plasmid DNA, the vector
pCR-Blunt II-TOPO-sodA is cleaved with the restriction enzymes
HindIII and XbaI and, after separation in 0.8% agarose gel, the
sodA fragment is isolated with the aid of the QIAquick Gel
Extraction Kit (QIAGEN, Hilden, Germany). The vector pTrc99A
(Pharmacia Biotech, Uppsala, Sweden) is cleaved with the enzymes
HindIII and XbaI and ligation is carried out with the sodA fragment
isolated.
[0112] The E. coli strain XL1-Blue MRF' (Stratagene, La Jolla, USA)
is transformed with the ligation batch and plasmid-carrying cells
are selected on LB agar, to which 50 .mu.g/ml ampicillin are added.
Successful cloning can be demonstrated after plasmid DNA isolation
by control cleavage with the enzymes BglI, Eco91I and PvuII. The
plasmid is called pTrc99AsodA (FIG. 1).
EXAMPLE 2
[0113] Preparation of L-Threonine With the Strain
MG442/pTrc99AsodA
[0114] The L-threonine-producing E. coli strain MG442 is described
in the patent specification U.S. Pat. No. 4,278,765 and deposited
as CMIM B-1628 at the Russian National Collection for Industrial
Microorganisms (VKPM, Moscow, Russia).
[0115] The strain MG442 is transformed with the expression plasmid
pTrc99AsodA described in example 1 and with the vector pTrc99A and
plasmid-carrying cells are selected on LB agar with 50 .mu.g/ml
ampicillin. The strains MG442/pTrc99AsodA and MG442/pTrc99A are
formed in this manner. Selected individual colonies are then
multiplied further on minimal medium with the following
composition: 3.5 g/l Na.sub.2HPO.sub.4*2H.sub.2O, 1.5 g/l
KH.sub.2PO.sub.4, 1 g/l NH.sub.4Cl, 0.1 g/l MgSO.sub.4*7H.sub.2O, 2
g/l glucose, 20 g/l agar, 50 mg/l ampicillin. The formation of
L-threonine is checked in batch cultures of 10 ml contained in 100
ml conical flasks. For this, 10 ml of preculture medium of the
following composition: 2 g/l yeast extract, 10 g/l
(NH.sub.4).sub.2SO.sub.4, 1 g/l KH.sub.2PO.sub.4, 0.5 g/l
MgSO.sub.4*7H.sub.2O, 15 g/l CaCO.sub.3, 20 g/l glucose, 50 mg/l
ampicillin are inoculated and the batch is incubated for 16 hours
at 37.degree. C. and 180 rpm on an ESR incubator from Kuhner AG
(Birsfelden, Switzerland).
[0116] 250 .mu.l portions of this preculture are transinoculated
into 10 ml of production medium (25 g/l (NH.sub.4).sub.2SO.sub.4, 2
g/l KH.sub.2PO.sub.4, 1 g/l MgSO.sub.4*7H.sub.2O, 0.03 g/l
FeSO.sub.4*7H.sub.2O, 0.018 g/l MnSO.sub.4*1H.sub.2O, 30 g/l
CaCO.sub.3, 20 g/l glucose, 50 mg/l ampicillin) and the batch is
incubated for 48 hours at 37.degree. C. The formation of
L-threonine by the starting strain MG442 is investigated in the
same manner, but no addition of ampicillin to the medium takes
place. After the incubation the optical density (OD) of the culture
suspension is determined with an LP2W photometer from Dr. Lange
(Dusseldorf, Germany) at a measurement wavelength of 660 nm.
[0117] The concentration of L-threonine formed is then determined
in the sterile-filtered culture supernatant with an amino acid
analyzer from Eppendorf-BioTronik (Hamburg, Germany) by ion
exchange chromatography and post-column reaction with ninhydrin
detection.
[0118] The result of the experiment is shown in Table 1.
3 TABLE 1 OD Strain (660 nm) L-Threonine g/l MG442 5.6 1.4
MG442/pTrc99A 3.8 1.3 MG442/pTrc99AsodA 3.9 2.3
BRIEF DESCRIPTION OF THE FIGURE
[0119] FIG. 1: Map of the plasmid pTrc99AsodA containing the sodA
gene.
[0120] The length data are to be understood as approx. data. The
abbreviations and designations used have the following meaning:
[0121] Amp: Ampicillin resistance gene
[0122] lacI: Gene for the repressor protein of the trc promoter
[0123] Ptrc: trc promoter region, IPTG-inducible
[0124] sodA: Coding region of the sodA gene
[0125] 5S: 5S rRNA region
[0126] rrnBT: rRNA terminator region
[0127] The abbreviations for the restriction enzymes have the
following meaning
[0128] BglI: Restriction endonuclease from Bacillus globigii (ATCC
49760)
[0129] Eco91I: Restriction endonuclease from Escherichia coli RFL
91
[0130] HindIII: Restriction endonuclease from Haemophilus
influenzae
[0131] PvuII: Restriction endonuclease from Proteus vulgaris (ATCC
13315)
[0132] XbaI: Restriction endonuclease from Xanthomonas campestris
Sequence CWU 1
1
2 1 32 DNA Artificial Sequence Synthetic DNA 1 cgcggcatct
agaatctgac gcccgacaat ac 32 2 26 DNA Artificial Sequence Synthetic
DNA 2 cgcctcattg aagcttgcgg caaatg 26
* * * * *