U.S. patent application number 11/054211 was filed with the patent office on 2005-08-04 for polypeptides, their production and use.
Invention is credited to Fujii, Ryo, Fukusumi, Shoji, Habata, Yugo, Hinuma, Shuji, Hosoya, Masaki, Kawamata, Yuji, Kitada, Chieko.
Application Number | 20050170461 11/054211 |
Document ID | / |
Family ID | 27463762 |
Filed Date | 2005-08-04 |
United States Patent
Application |
20050170461 |
Kind Code |
A1 |
Hinuma, Shuji ; et
al. |
August 4, 2005 |
Polypeptides, their production and use
Abstract
The present invention relates to the ligand polypeptide for the
human pituitary- and mouse pancreas-derived G protein-coupled
receptor proteins. The ligand polypeptide or the DNA which codes
for the ligand polypeptide can be used for (1) development of
medicines such as pituitary function modulators, central nervious
system function modulators, and pancreatic function modulators, and
(2) development of receptor binding assay systems using the
expression of recombinant receptor proteins and screening of
pharmaceutical candidate compounds. In particular, by the receptor
binding assay systems utilizing the expression of recombinant G
protein-coupled receptor proteins in accordance with the invention,
agonists and antagonists of G protein-coupled receptors which are
specific to human and other warm-blooded animals can be screened
and the agonists or antagonists obtained can be used as therapeutic
and prophylactic agents for various diseases.
Inventors: |
Hinuma, Shuji; (Tsukuba-shi,
JP) ; Habata, Yugo; (Tsukuba-shi, JP) ;
Kawamata, Yuji; (Tsukuba-shi, JP) ; Hosoya,
Masaki; (Tsuchiura-shi, JP) ; Fujii, Ryo;
(Tsukuba-shi, JP) ; Fukusumi, Shoji; (Tsukuba-shi,
JP) ; Kitada, Chieko; (Sakai-shi, JP) |
Correspondence
Address: |
EDWARDS & ANGELL, LLP
P.O. BOX 55874
BOSTON
MA
02205
US
|
Family ID: |
27463762 |
Appl. No.: |
11/054211 |
Filed: |
February 8, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11054211 |
Feb 8, 2005 |
|
|
|
09716147 |
Nov 17, 2000 |
|
|
|
6881545 |
|
|
|
|
09716147 |
Nov 17, 2000 |
|
|
|
08776971 |
Feb 7, 1997 |
|
|
|
6228984 |
|
|
|
|
08776971 |
Feb 7, 1997 |
|
|
|
PCT/JP96/03821 |
Dec 26, 1996 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 530/350; 530/388.22; 536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 16/28 20130101; C07H 21/04 20130101; C07K 14/575 20130101;
C07K 14/705 20130101; C07K 14/72 20130101 |
Class at
Publication: |
435/069.1 ;
530/350; 530/388.22; 536/023.5; 435/320.1; 435/325 |
International
Class: |
C07K 014/72; C07K
016/28; C07H 021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 28, 1995 |
JP |
7-343371 |
Mar 15, 1996 |
JP |
8-59419 |
Aug 12, 1996 |
JP |
8-211805 |
Sep 18, 1996 |
JP |
8-246573 |
Claims
1-16. (canceled)
17. A screening method for a compound capable of changing the
binding activity of a ligand polypeptide comprising the amino acid
sequence of SEQ ID NO:73, or its amide or ester, or a salt thereof,
or a partial peptide thereof, with a receptor protein comprising an
amino acid sequence represented by SEQ ID NO: 22, or a salt
thereof, or a partial peptide of said receptor protein, or a salt
thereof, the method comprising making a comparison of said binding
activity between: (i) at least one case where said polypeptide, or
its amide or ester, a partial peptide of said ligand polypeptide,
or its amide or ester, or a salt thereof is contacted with said
receptor protein or a salt thereof or a partial peptide of said
receptor protein, or a salt thereof, and (ii) at least one case
where said ligand polypeptide or its amide or ester, or a salt
thereof, or the partial peptide of said ligand polypeptide, or its
amide or ester, or a salt thereof, together with a sample
containing the compound to be tested is contacted with the receptor
protein or a salt thereof or a partial peptide of said receptor
protein, or a salt thereof.
18-20. (canceled)
21. The method as claimed in claim 17, wherein the ligand
polypeptide comprises the amino acid sequence of SEQ ID NO:3, SEQ
ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ
ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO: 61, SEQ ID NO:62,
SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, or SEQ ID NO:66.
22. The method as claimed in claim 17, wherein the ligand
polypeptide comprises the amino acid seqeunece of SEQ ID NO:1, SEQ
ID NO:44, SEQ ID NO:45, or SEQ ID NO:59.
Description
TECHNICAL FIELD
[0001] The present invention relates to a novel ligand polypeptide
for the G protein-coupled receptor protein and a DNA comprising a
DNA encoding the ligand polypeptide.
BACKGROUND ART
[0002] Many hormones and neurotransmitters mediate biological
functions through specific receptors present on the cell membrane.
Many of these receptors engage themselves in the intracellular
transduction of signals through activation of the coupled guanine
nucleotide-binding protein (hereinafter sometimes referred to
briefly as G protein) and have the common structure comprising 7
transmembrane domains. Therefore, these receptors are collectively
referred to as G protein-coupled receptor or 7-transmembrane
receptor.
[0003] One of the pathways to modulate biological functions
mediated by such hormones or neurotransmitters through G
protein-coupled receptors is the hypothalamo-pituitary system.
Thus, the secretion of pituitary hormone from the hypophysis is
controlled by hypothalamic hormones (pituitatropic releasing
factor) and the functions of the target cells or organs are
regulated through the pituitary hormones released into the
circulation. This pathway carries out functional modulations of
importance to the living body, such as homeostasis and regulation
of the reproduction, development, metabolism and growth of
individuals. The secretion of pituitary hormones is controlled by a
positive feedback or a negative feedback mechanism involving
hypothalamic hormone and the peripheral hormone secreted from the
target endocrine gland. The various receptor proteins present in
the hypophysis are playing a central role in the regulation of the
hypothalamus-pituitary system.
[0004] Meanwhile, it is known that these hormones and factors as
well as their receptors are not localized in the
hypothalamus-pituitary system but are broadly distributed in the
brain. Therefore, it is suspected that, in the central nervous
system, this substance called hypothalamus hormone is functioning
as a neurotransmitter or a neuromodulator. Moreover, the substance
is distributed in peripheral tissues as well and thought to be
playing important roles in the respective tissue.
[0005] The pancreas is playing a crucial role in the carbohydrate
metabolism by secreting glucagon and insulin as well as digestive
juice. While insulin is secreted from the pancreatic .beta. cells,
its secretion is mainly stimulated by glucose. However, it is known
that .beta. cells have a variety of receptors and the secretion of
insulin is controlled by a number of factors in addition to glucose
as well as peptide hormones, e.g. galanine, somatostatin, gastric
inhibitory polypeptide, glucagon, amyrin, etc.; sugars, e.g.
mannose etc.; amino acids, and neurotransmitters, among others.
[0006] The means only heretofore available for identifying ligands
for said G protein-coupled receptor proteins is estimation from the
homology in primary structure of G protein-coupled receptor
proteins.
[0007] Recently, investigation for novel opioid peptides by
introducing a cDNA coding for a receptor protein which a ligand is
unknown, i.e. an orphan G protein-coupled receptor protein, into
animal cells have been reported (Reinsheid, R. K. et al., Science,
270, 792-794, 1995, Menular, J.-C., et al., Nature 377, 532-535,
1995). However, in view of similarities to known G protein-coupled
receptor proteins and tissue distributions, it could be easily
anticipated in these cases that the ligand would be belonging to
the family of opioid peptides. The history of research and
development in the realm of substances acting on the living body
through the opioid receptor dates back to many years ago and
various antagonists and agonists had been developed. Therefore,
among the compounds artificially synthesized, an agonist of the
receptor was picked out and, using it as a probe, expression of the
receptor in the receptor cDNA-transfected cells was verified. Then,
a search was made for an activator of the intracellular signal
transduction which was similar to the agonist, the activator so
found was purified, and the structure of the ligand was determined.
However, when the homology of an orphan receptor to known G
protein-coupled receptor proteins is low, it was very difficult to
predict its ligand.
[0008] Ligands for orphan G protein-coupled receptors expressed in
the hypophysis, central nervous system, and pancreatic .beta. cells
are considered to be useful for developing medicines, but their
structures and functions have not been elucidated as yet.
DISCLOSURE OF INVENSION
[0009] Employing a cell in which a cDNA coding for orphan G
protein-coupled receptor protein has been expressed by a suitable
means and using measurement of a specific cell stimulation activity
exemplified by a signal transduction activity as an indicator, the
inventors of the present invention succeeded in screening a
polypeptide which said receptor protein recognizes as a ligand.
[0010] Furthermore, the inventors found that a compound can be
screened which is capable of changing the binding activity of this
ligand which is an activating factor to said receptor protein.
[0011] The present invention, therefore, relates to
[0012] (1) A polypeptide which comprises an amino acid sequence
represented by SEQ ID NO:73 or its substantial equivalent thereto,
or its amide or ester, or a salt thereof.
[0013] (2) The polypeptide as described in (1) above, which
comprises the amino acid sequence represented by SEQ ID NO:3, SEC
ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID
NO:9, SEQ ID NO:10, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ
ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:62,
SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, or SEQ ID NO:66.
[0014] (3) The polypeptide as described in (1) above, which
comprises the amino acid sequence represented by SEQ ID NO:1, SEQ
ID NO:44, SEQ ID NO:45, or SEQ ID NO:59.
[0015] (4) A partial peptide of the polypeptide as described in (1)
above its amide or ester, or a salt thereof.
[0016] (5) A DNA which comprises a DNA having a nucleotide sequence
coding for the polypeptide as described in (1) above or the partial
peptide as described in (4) above.
[0017] (6) The DNA as described in (5) above which comprises a
nucleotide sequence represented by SEQ ID NO:2, SEQ ID NO:11, SEQ
ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16,
SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:18, SEQ ID NO:46, SEQ ID
NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ
ID NO:58, SEQ ID NO:60, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69,
SEQ ID NO:70, SEQ ID NO:71, or SEQ ID NO:72.
[0018] (7) A recombinant vector comprising the DNA as described in
(5) above.
[0019] (8) A transformant carrying the DNA as described in (5)
above or the recombinant vector as described (7) above.
[0020] (9) A method for producing the polypeptide as described in
(1) above or the partial peptide as described in (4) above, which
comprises culturing the transformant as described in (8) above.
[0021] (10) A pharmaceutical composition containing the
polypeptide, its amide or ester as described in (1) above, or a
pharmaceutically acceptable salt thereof.
[0022] (11) A pharmaceutical composition containing the partial
peptide peptide, its amide or ester as described in (4) above, or a
pharmaceutically acceptable salt thereof.
[0023] (12) A pharmaceutical composition containing the DNA as
described in (5) above.
[0024] (13) The pharmaceutical composition as described in (10),
(11), or (12) above, which is a pituitary function modulator.
[0025] (14) The pharmaceutical composition as described in (10),
(11), or (12) above, which is a central nervous system function
modulator.
[0026] (15) The pharmaceutical composition as described in (10),
(11), or (12) above, which is a pancreatic function modulator.
[0027] (16) An antibody against the polypeptide as described in (1)
above or against the partial peptide as described in (4) above.
[0028] (17) A screening method for a compound capable of changing
the binding activity of the polypeptide as described in (1) above
or the partial peptide as described in (4) above, with a receptor
protein comprising an amino acid sequence represented by SEQ ID
NO:21 or its partial peptide or its substantial equivalent thereto,
or a salt thereof, which comprises making a comparison between: (i)
at lease one case where said polypeptide as described in (1) above
or the partial peptide as described in (4) above is contacted with
a receptor protein comprising an amino acid sequence represented by
SEQ ID:21 or its partial peptide or its substantial equivalent
thereto, or a salt thereof, and (ii) at least one case where said
polypeptide as described in (1) above or the partial peptide as
described in (4) above together with a sample to be tested in
contacted with protein comprising an amino acid sequence
represented by SEQ ID NO:21 or its partial peptide or its
substantial equivalent thereto, or a salt thereof.
[0029] (18) A kit for screening for a compound capable of changing
the binding activity of the polypeptide as described in (1) above
or the partial peptide as described in (4) above with a receptor
protein comprising an amino acid sequence represented by SEQ ID
NO:21 or its partial peptide or its substantial equivalent thereto,
or a salt thereof.
[0030] (19) A compound capable of changing the binding activity of
the polypeptide as described in (1) or the partial peptide as
described in (4) with a receptor protein comprising an amino acid
sequence represented by SEQ ID NO:21 or its partial peptide or its
substantial equivalent thereto, or a salt thereof.
[0031] (20) A G protein-coupled receptor protein which recognizes
the polypeptide as described in (1) above or the partial peptide as
described in (4) above as a ligand, or a salt thereof.
[0032] The present invention further provides:
[0033] (21) the polypeptide as described in (1) above, or its amide
or ester, or a salt thereof, which comprises an amino acid sequence
selected from the group consisting of an amino acid sequence of SEQ
ID NO:73, amino acid sequences wherein 1 to 15 amino acid residues,
preferably 1 to 10 amino acid residues, more preferably 1 to 5
amino acid residues are deleted from the amino acid sequence of SEQ
ID NO:73, amino acid sequences wherein 1 to 80 amino acid residues,
preferably 1 to 50 amino acid residues, more preferably 1 to 10
amino acid residues are added to the amino acid sequence of SEQ ID
NO:73, and amino acid sequences wherein 1 to 15 amino acid
residues, preferably 1 to 10 amino acid residues, more preferably 1
to 5 amino acid resides in the amino acid sequence of SEQ ID NO:73
are substituted with one or more other amino acid residues;
[0034] (22) the polypeptide as described in (1) above, which
comprises an amino acid sequence wherein the peptide of SEQ ID
NO:74 is added to the N-terminus of the polypeptide comprising the
amino acid sequence of SEQ ID NO:73;
[0035] (23) the polypeptide as described in (1) above, which in
derived from bovine, rat or human; and
[0036] (24) the pharmaceutical composition described in (10), (11)
or (12) above, which is a therapeutic and/or prophylactic agent for
dementia, depression (melancholia), hyperkinetic
(microencephalo-pathy) syndrome, disturbance of consciousness,
anxiety syndrome, schizophrenia, horror, growth hormone secretory
disease, hyperphagia, polyphagia, hypercholesterolemia,
hyperglyceridemia, hyperlipemia, hyperprolactinemia, diabetes,
cancer, pancreatitis, renal disease, Turner's syndrome, neurosis,
rheumatoid arthritis, spinal injury, transient brain ischemia,
amyotrophic lateral sclerosis, acute myocardial infarction,
spinocerebellar degeneration, bone fracture, trauma, atopic
dermatitis, osteoporosis, asthma, epilepsy, infertility and/or
oligogalactia.
[0037] Referring to the G protein-coupled receptor protein for the
ligand polypeptide in accordance with the present invention, the
invention specifically provides:
[0038] (25) the G protein-coupled receptor protein described in
(20) or a salt thereof, which comprises an amino acid sequence
represented by SEQ ID NO:19 or its substantial equivalent thereto
or/and an amino acid sequence represented by SEQ ID NO:20 or its
substantial equivalene thereto;
[0039] (26) the G protein-coupled receptor protein described in
(25) above or a salt thereof, which comprises an amino acid
sequence represented by SEQ ID NO:21 or its substantial equivalent
thereto;
[0040] (27) the G protein-coupled receptor protein described in
(25) above or a salt thereof, which comprises an amino acid
sequence represented by SEQ ID NO:22 or its substantial equivalent
thereto;
[0041] (28) the G protein-coupled receptor protein described in
(25) above or a salt thereof, which comprises an amino acid
sequence represented by SEQ ID NO:23 or its substantial equivalent
thereto;
[0042] (29) a partial peptide of any of the G protein-coupled
receptor proteins described in (25)-(28) above or a salt
thereof;
[0043] (30) a DNA which comprises a DNA having a nucleotide
sequence coding for the G protein-coupled receptor protein
described in (25) above;
[0044] (31) a DNA which comprises a DNA having a nucleotide
sequence coding for the G protein-coupled receptor protein
described in (26) above;
[0045] (32) a DNA which comprises a DNA having a nucleotide
sequence coding for the G protein-coupled receptor protein
described in (27) above;
[0046] (33) a DNA which comprises a DNA having a nucleotide
sequence coding for the G protein-coupled receptor protein
described in (28) above;
[0047] (34) the DNA described in (30) above, which comprises the
nucleotide sequence of SEQ ID NO:24 or the nucleotide sequence of
SEQ ID NO:25;
[0048] (35) the DNA described in (31) above, which comprises the
nucleotide sequence of SEQ ID NO:26;
[0049] (36) the DNA described in (32) above, which comprises the
nucleotide sequence of SEQ ID NO:27;
[0050] (37) the DNA described in (33) above, which comprises the
nucleotide sequence of SEQ ID NO:28;
[0051] (38) a recombinant vector comprising any of the DNAs
described in (30)-(33) above;
[0052] (39) a transformant carrying the recombinant vector
described in (38) above;
[0053] (40) a method for producing the G protein-coupled receptor
protein described in (28) above or a salt thereof, which comprises
culturing the transformant of (39) to produce said G
protein-coupled receptor protein on the cell membrane of the
transformant;
[0054] (41) an antibody to any of the G protein-coupled receptor
protein described in (25)-(28) above or a salt thereof, or the
partial peptide described in (29) above or a salt thereof.
[0055] To be further specific, the G protein-coupled receptor
protein relates to:
[0056] (42) the G protein-coupled receptor protein described in
(25) above or a salt thereof, wherein the protein comprises (i) an
amino acid sequence selected from the group consisting of an amino
acid sequence of SEQ ID NO:19, amino acid sequences wherein 1 to 30
amino acid residues, preferably 1 to 10 amino acid residues are
deleted from the amino acid sequence of SEQ ID NO:19, amino acid
sequences wherein 1 to 30 amino acid residues, preferably 1 to 10
amino acid residues are added to the amino acid sequence of SEQ ID
NO:19, and amino acid sequences wherein 1 to 0.30 amino acid
residues, preferably 1 to 10 amino acid residues in the amino acid
sequence of SEQ ID NO:19 are substituted with one or more than
amino acid residues and/or (ii) an amino acid sequence selected
from the group consisting of an amino acid sequence of SEQ ID
NO:20, amino acid sequences wherein 1 to 30 amino acid residues,
preferably 1 to 10 amino acid residues are deleted from the amino
acid sequence of SEQ ID NO:20, amino acid sequences wherein 1 to 30
amino acid residues, preferably 1 to 10 amino acid residues are
added to the amino acid sequence of SEQ ID NO:20, and amino acid
sequences wherein 1 to 30 amino acid residues, preferably 1 to 10
amino acid residues in the amino acid sequence of SEQ ID NO:20 are
substituted with one or more other amino acid residues;
[0057] (43) the G protein-coupled receptor protein described in
(26) above or a salt thereof, wherein the protein comprises an
amino acid sequence selected from the group consisting of an amino
acid sequence of SEQ ID NO:21, amino acid sequences wherein 1 to 30
amino acid residues, preferably 1 to 10 amino acid residues are
deleted from the amino acid sequence of SEQ ID NO:21, amino acid
sequences wherein 1 to 30 amino acid residues, preferably 1 to 10
amino acid residues are added to the amino acid sequence of SEQ ID
NO:21, and amino acid sequences wherein 1 to 30 amino acid
residues, preferably 1 to 10 amino acid residues in the amino acid
sequence of SEQ ID NO:21 are substituted with one or more other
amino acid residues;
[0058] (44) the G protein-coupled receptor protein described in
(27) above or a salt thereof wherein the protein comprises an amino
acid sequence selected from the group consisting of an amino acid
sequence of SEQ ID NO:22, amino acid sequences wherein 1 to 30
amino acid residues, preferably 1 to 10 amino acid residues are
deleted from the amino acid sequence of SEQ ID NO:22, amino acid
sequences wherein 1 to 30 amino acid residues, preferably 1 to 10
amino acid residues are added to the amino acid sequence of SEQ ID
NO:22, and amino acid sequences wherein 1 to 30 amino acid
residues, preferably 1 to 10 amino acid residues in the amino acid
sequence of SEQ ID NO:22 are substituted with one or more other
amino acid residues;
[0059] (45) the G protein-coupled receptor protein described in
(28) above or a salt thereof, wherein the protein comprises an
amino acid sequence selected from the group consisting of an amino
acid sequence of SEQ ID NO:23, amino acid sequences wherein 1 to 30
amino acid residues, preferably 1 to 10 amino acid residues are
deleted from the amino acid sequence of SEQ ID NO:23, amino acid
sequences wherein 1 to 30 amino acid residues, preferably 1 to 10
amino acid residues are added to the amino acid sequence of SEQ ID
NO:23, and amino acid sequences wherein 1 to 30 amino acid
residues, preferably 1 to 10 amino acid residues in the amino acid
sequence of SEQ ID NO:23 are substituted with one or more other
amino acid residues.
[0060] As used herein the term "substantial equivalent(s)" means
that the activity of the protein, e.g., nature of the binding
activity of the ligand and the receptor and physical
characteristics are substantially the same. Substitutions,
deletions or insertions of amino acids often do not produce radical
changes in the physical and chemical characteristics of a
polypeptide, in which case polypeptides containing the
substitution, deletion, or insertion would be considered to be
substantially equivalent to polypeptides lacking the substitution,
deletion, or insertion. Substantially equivalent substitutes for an
amino acid within the sequence may be selected from other members
of the class to which the amino acid belongs. The non-polar
(hydrophobic) amino acids include alanine, leucine, isoleucine,
valine, proline, phenylalanine, tryptophan and methionine. The
polar neutral amino acids include glycine, serine, threonine,
cysteine, tyrosine, asparagine, and glutamine. The positively
charged (basic) amino acids include arginine, lysine and histidine.
The negatively charged (acidic) amino acids include aspartic acid
and glutamic acid.
BRIEF DESCRIPTION OF THE DRAWINGS
[0061] FIG. 1 shows the nucleotide sequence of the human
pituitary-derived G protein-coupled receptor protein cDNA fragment
harbored in cDNA clone p19P2 isolated by PCR using human
pituitary-derived cDNA and the amino acid encoded by the nucleotide
sequence. The primer used for sequencing was -21M13. The
underscored region correspond to the synthetic primer.
[0062] FIG. 2 shows the nucleotide sequence of the human
pituitary-derived G protein-coupled receptor protein cDNA fragment
harbored in cDNA clone p19P2 isolated by PCR using human
pituitary-derived cDNA and the amino acid sequence encoded thereby.
The primer used for sequencing was M13RV-N (Takara). The
underscored region correspond to the synthetic primer.
[0063] FIG. 3 shows a partial hydrophobic plot of the protein
encoded by the human pituitary-derived G protein-coupled receptor
protein cDNA fragment harbored in p19P2 constructed according to
the amino acid sequence shown in FIG. 1.
[0064] FIG. 4 shows a partial hydrophobic plot of the protein
encoded by the human pituitary-derived G protein-coupled receptor
protein cDNA fragment harbored in p19P2 constructed according to
the amino acid sequence shown in FIG. 2.
[0065] FIG. 5 is a diagram comparing the partial amino acid
sequence of the protein encoded by the human pituitary-derived G
protein-coupled receptor protein cDNA fragment harbored in p19P2 as
shown in FIGS. 1 and 2 with the known G protein-coupled receptor
protein S12863. The shadowed region represents the region of
agreement. The 1 to 9 amino acid sequence of p19P2 corresponds to
the 1 to 99 amino acid sequence of FIG. 1 and the 156 to 230 amino
acid sequence corresponds to the 1 to 68 amino acid sequence of
FIG. 2.
[0066] FIG. 6 shows the nucleotide sequence of the MIN6-derived G
protein-coupled receptor protein cDNA fragment based on the
nucleotide sequences of the MIN6-derived G protein-coupled receptor
protein cDNA fragments harbored in the cDNA clones pG3-2 and pG1-10
isolated by PCR using MIN6-derived cDNA and the amino acid sequence
encoded by the nucleotide sequence. The underscored region
correspond to the synthetic primer.
[0067] FIG. 7 is a diagram comparing the partial amino acid
sequence encoded by pG3-2/pG1-10 of the MIN6-derived G
protein-coupled receptor protein shown in FIG. 6 with the partial
amino acid sequence of the protein encoded by p19P2 shown in FIGS.
1 and 2. The shadowed region corresponds to the region of
agreement. The 1 to 99 amino acid sequence of the protein encoded
by p19P2 corresponds to the 1 to 99 amino acid sequence of FIG. 1
and the 156 to 223 amino acid sequence corresponds to the 1 to 68
amino acid sequence of FIG. 2. The 1 to 223 amino acid sequence of
the protein encoded by pG3-2/pG1-10 corresponds to the 1 to 223
amino acid sequence of FIG. 6.
[0068] FIG. 8 is a partial hydrophobic plot of the MIN6-derived G
protein-coupled receptor protein constructed according to the
partial amino acid sequence shown in FIG. 6.
[0069] FIG. 9 shows the entire nucleotide sequence of the human
pituitary-derived G protein-coupled receptor protein cDNA harbored
in the cDNA clone phGR3 isolated from a human pituitary-derived
cDNA library by the plaque hybridization method using the DNA
fragment inserted in p19P2 as a probe and the amino acid sequence
encorded by the nucleotide sequence.
[0070] FIG. 10 shows the result of Northern blotting of human
pituitary mRNA hybridized with radioisotope-labeled human pituitary
cDNA clone phGR3.
[0071] FIG. 11 shows a hydrophobic plot of the protein encoded by
the human pituitary-derived G protein-coupled receptor protein cDNA
harbored in the phGR3 as constructed according to the amino acid
sequence shown in FIG. 9.
[0072] FIG. 12 shows the nucleotide sequence of the MIN6-derived G
protein-coupled receptor protein cDNA fragment harbored in the cDNA
clone p5S38 isolated by PCR using MIN6-derived cDNA and the amino
acid sequence encoded by the nucleotide sequence. The underscored
region correspond to the synthetic primer.
[0073] FIG. 13 shows a diagram comparing the partial amino acid
sequence of MIN6-derived G protein-coupled receptor protein encoded
by p5S38 shown in FIG. 12 with the partial amino acid sequence of G
protein-coupled receptor protein encoded by the cDNA fragment
harbored in p19P2 as shown in FIGS. 1 and 2 and the partial amino
acid sequence of G protein-coupled receptor protein encoded by the
nucleotide sequence generated from the nucleotide sequences of cDNA
fragments contained in pG3-2 and pG1-10 shown in FIG. 6. The
shadowed region represents the sequence region of agreement. The 1
to 144 amino acid sequence of the protein encoded by p5S38
corresponds to the 1 to 144 amino acid sequence of FIG. 12, the 1
to 99 amino acid sequence of the protein encoded by p19P2
corresponds to the 1 to 99 amino acid sequence of FIG. 1 and the
156 to 223 amino acid sequence corresponds to 1 to 68 amino acid
sequence of FIG. 2. The 1 to 223 amino acid sequence of the protein
encoded by pG3-2/pG1-10 corresponds to the 1 to 223 amino acid
sequence of FIG. 6.
[0074] FIG. 14 shows a partial hydrophobic plot of the protein
encoded by the MIN6-derived G protein-coupled receptor protein cDNA
harbored in p5S38 as constructed according to the partial amino
acid sequence shown in FIG. 12.
[0075] FIG. 15 shows the results of the following analysis. Thus,
RT-PCR was carried out to confirm the expression of mRNA in CHO
cells transfected by pAKKO-19P2. Lanes 1-7 represent the results
obtained by performing PCRs using serial dilutions of pAKKO-19P2
for comparison, i.e. the 10 .mu.l/ml stock solution (lane 1), 1/2
dilution (lane 2), 1/4 dilution (lane 3), 1/64 dilution (Lane 4),
1/256 dilution (lane 5), 1/1024 dilution (lane 6), and 1/4096
dilution (lane 7) of the plasmid as templates, and analyzing the
reaction mixtures by 1.2% agarose gel electrophoresis. Lanes 8
through 11 are the results obtained by performing PCRs using a 1/10
dilution (lane 8), a 1/100 dilution (lane 9), and a 1/1000 dilution
(lane 10) of the cDNA prepared from the CHO-19P2 cell line as
templates and subjecting the respective reaction mixtures to
electrophoresis. Lane 11 was obtained by performing PCR using a
template obtained by carrying out cDNA synthesis without reverse
transcriptase and subjecting the PCR reaction product to
electrophoresis. Lanes 12 and 13 were obtained by performing PCR
using cDNAs prepared from mock CHO cells with and without addition
of reverse transcriptase, respectively, as templates and subjecting
the respective reaction products to electrophoresis. M represents
the DNA size marker. The lanes at both ends were obtained by
electrophoresing 1 .mu.l of .lambda./Sty I digest (Nippon Gene) and
the second lane from right was obtained with 1 .mu.l of
.phi./.chi.174/Hinc II digest (Nippon Gene). The arrowmark
indicates the position of the band amplified by PCR of about 400
bp.
[0076] FIG. 16 shows the activity of the crude ligand peptide
fraction extracted from rat whole brain to promote release of
arachidonic acid metabolites from CHO-19P2 cells. The arachidonic
acid metabolite releasing activity was expressed as % of the amount
of [.sup.3H] arachidonic acid metabolites released in the presence
of the crude ligand polypeptide fraction with the amount of
[.sup.3H] arachidonic acid metabolites released in the presence of
0.05% BAS-HABB being taken as 100%. The activity to promote release
of arachidonic acid metabolites from the CHO-19P2 cell line was
detected in a 30% CH.sub.3CN fraction.
[0077] FIG. 17 shows the activity of the crude ligand polypeptide
fraction extracted from bovine hypothalamus to promote release of
arachidonic acid metabolites from CHO-19P2 cells. The arachidonic
acid metabolite release-promoting activity was expressed as % of
the amount of [.sup.3H] arachidonic acid metabolites released in
the presence of the crude ligand polypeptide fraction with the
amount of [.sup.3H] arachidonic acid metabolites released in the
presence of 0.05% BAS-HABB being taken as 100%. The activity to
promote release of arachidonic acid metabolites from the CHO-19P2
cell line was detected in a 30% CH.sub.3CN fraction just as in the
crude ligand polypeptide fraction from rat whole brain.
[0078] FIG. 18 shows the activity of the fraction purified with the
reversed-phase column C18 218TP5415 to specifically promote release
of arachidonic acid metabolites from CHO-19P2 cells. The active
fraction from RESOURCE S was fractionated on C18 218TP5415. Thus,
chromatography was carried out at a flow rate of 1 ml/min. on a
concentration gradient of 20%-30% CH.sub.3CN/0.1% TFA/H.sub.2O, the
eluate was collected in 1 ml fractions, and each fraction was
lyophilized. Then, the activity of each fraction to specifically
promote release of arachidonic acid metabolites from the CHO-19P2
cell line was determined. As a result, the activity was
fractionated into 3 fractions (designated, in the order of elution,
as P-1, P-2, and P-3).
[0079] FIG. 19 shows the activity of the fraction purified with the
reversed-phase column diphenyl 219TP5415 to specifically promote
arachidonic acid metabolite release from CHO-19P2 cells. The P-3
active fraction from C18 218TP5415 was fractionated on diphenyl
219TP5415. The chromatography was carried out at a flow rate of 1
ml/min. on a concentration gradient of 22%-25% CH.sub.3CN/0.1%
TFA/H.sub.2O, the eluate was collected in 1 ml fractions, and each
fraction was lyophilized. Then, the activity to specifically
promote release of arachidonic acid metabolites from CHO-19P2 cells
in each fraction was determined. As a result, the activity
converged in a single peak.
[0080] FIG. 20 shows the activity of the fraction purified by
reversed-phase column .mu.RPC C2/C18 SC 2.1/10 to specifically
promote release of arachidonic acid metabolites from CHO-19P2
cells. The peak active fraction from diphenyl 219TP5415 was
fractionated on .mu.RPC C2/C18 SC 2.1/10. The chromatography was
carried out at a flow rate of 100 .mu.l/min. on a concentration
gradient of 22%-23.5% CH.sub.3CN/0.1% TFA/H.sub.2O, the eluate was
collected in 100 .mu.l fractions, and each fraction was
lyophilized. Then, the activity to specifically promote release of
arachidonic acid metabolites from CHO-19P2 cells in each fraction
was determined. As a result, the activity was found as two peaks of
apparently a single substance (peptide).
[0081] FIG. 21 shows the activity of the P-2 fraction purified by
reversed-phase column .mu.RPC C2/C18 SC 2.1/10 to specifically
promote release of arachidonic acid metabolites from CHO-19P2
cells. The chromatography was carried out at a flow rate of 100
.mu.l/min. on a concentration gradient of 21.5%-23.0%
CH.sub.3CN/0.1% TFA/dH.sub.2O, the eluate was collected in 100
.mu.l fractions, and each fraction was lyophilized. Then, the
activity to specifically promote release of arachidonic acid
metabolites from CHO-19P2 cells in each fraction was determined. As
a result, the activity was found as a peak of apparently a single
substance.
[0082] FIG. 22 shows the nucleotide sequence of bovine hypothalamus
ligand polypeptide cDNA fragment as derived from the nucleotide
sequence of the bovine hypothalamus-derived ligand polypeptide cDNA
fragment which specifically promotes release of arachidonic acid
metabolites from CHO-19P2 cells as harbored in a cDNA clone
isolated by PCR using bovine hypothalamus-derived cDNA and the
amino acid sequence encoded by said nucleotide sequence. The region
indicated by the arrowmark corresponds to the synthetic primer.
[0083] FIG. 23 shows the nucleotide sequence of the bovine
hypothalamus-derived ligand polypeptide cDNA fragment generated
according to the nucleotide sequence of the bovine
hypothalamus-derived ligand polypeptide cDNA fragment which
specifically promotes release of arachidonic acid metabolites from
CHO-19P2 cells as harbored in a cDNA clone isolated by PCR using
bovine hypothalamus-derived cDNA and the amino acid sequence
encoded by said nucleotide sequence. The region indicated by the
arrowmark corresponds to the synthetic primer.
[0084] FIG. 24 shows the amino acid sequences (a) and (b) of the
bovine hypothalamus-derived ligand polypeptides which specifically
promote release of arachidonic acid metabolites from CHO-19P2 cells
and the cDNA sequence coding for the full coding region of the
ligand polypeptides defined by SEQ ID NO:1 and SEQ ID NO:44.
[0085] FIG. 25 shows the concentration-dependent activity of
synthetic ligand polypeptide (19P2-L31) to specifically promote
release of arachidonic acid metabolites from CHO-19P2 cells. The
synthetic peptide was dissolved in degassed dH.sub.2O at a final
concentration of 10.sup.-3M and diluted with 0.05% BSA-HBSS to
concentrations of 10.sup.-12M-10.sup.-6M. The arachidonic acid
metabolite releasing activity was expressed in the measured
radioactivity of [.sup.3H] arachidonic acid metabolites released in
the supernatant when the dilution was added to the cells. As a
result, the activity of 19P2-31 to specifically promote release of
arachidonic acid metabolites from CHO-19P2 cells was found in a
concentration-dependent manner.
[0086] FIG. 26 shows the concentration-dependent activity of
synthetic ligand polypeptide (19P2-L31(O)) to specifically promote
release of arachidonic acid metabolites from CHO-19P2 cells. The
synthetic ligand peptide was dissolved in degassed dH.sub.2O at a
final concentration of 10.sup.-3 M and diluted with 0.05% BSA-HBSS
to concentrations of 10.sup.-12M-10.sup.-6M. The arachidonic acid
metabolite releasing activity was expressed in the measured
radioactivity of [.sup.3H] arachidonic acid metabolites released in
the supernatant when the dilution was added to the cells. As a
result, the activity of 19P2-L31(O) to specifically promote release
of arachidonic acid metabolites from CHO-19P2 cells was found in a
dose-dependent manner.
[0087] FIG. 27 shows the activity of synthetic ligand polypeptide
19P2-L20 to specifically promote release of arachidonic acid
metabolites from CHO-19P2 cells. The synthetic peptide was
dissolved in degassed dH.sub.2O at a final concentration of
10.sup.-3M and diluted with 0.05% BSA-HBSS to concentrations of 10
.sup.12M-10.sup.-6M. The arachidonic acid metabolite releasing
activity was expressed in the measured radioactivity of [.sup.3H]
arachidonic acid metabolites released in the supernatant when the
dilution was added to the cells. As a result, the activity of
19P2-L20 to specifically promote release of arachidonic acid
metabolites from CHO-19P2 cells was found in a dose-dependent
manner.
[0088] FIG. 28 shows the 1.2% agarose gel electrophoregram of the
DNA fragments of the phages cloned from a bovine genomic library as
digested with restriction enzymes BamHI(B) and SalI(S). As the DNA
size marker (M), StyI digests of .lambda. phage DNA were used. In
lane B, two bands derived from the vector were detected in
positions between the first (19,329 bp) and second (7.743 bp)
marker bands, as well as 3 bands derived from the inserted fragment
between the third (6,223 bp) and 5th (3,472 bp) bands. In lane S,
two bands derived from the vector were similarly detected but due
to the overlap of the band of the inserted fragment, the upper band
is thicker than the band in lane B.
[0089] FIG. 29 shows the nucleotide sequence around the coding
region as decoded from bovine genomic DNA. The 1st to 3rd bases
(ATG) correspond to the translation start codon and the 767th to
769th bases (TAA) correspond to the translation end codon.
[0090] FIG. 30 shows a comparison between the nucleotide sequence
(genome) around the coding region as deduced from bovine genomic
DNA and the nucleotide sequence (cDNA) of bovine cDNA cloned by
PCR. The sequence region of agreement is indicated by shading. As
to the 101st to 572nd region, there is no corresponding region in
the nucleotide sequence of cDNA, indicating that it is an
intron.
[0091] FIG. 31 shows the translation of the amino acid sequence
encoded after elimination of the intron from the nucleotide
sequence around the coding region as decoded from bovine genomic
DNA.
[0092] FIG. 32 shows the full-length amino acid sequence and the
cDNA sequence coding for the full coding region of rat ligand
polypeptide.
[0093] FIG. 33 shows amino acid sequence of bovine ligand
polypeptide and the nucleotide sequences of DNAs coding for bovine
polypeptide and rat polypeptide. The arrowmark indicates the region
corresponding to the synthetic primer.
[0094] FIG. 34 shows the full-length amino acid sequence and the
sequence of cDNA coding for the full coding region of human ligand
polypeptide.
[0095] FIG. 35 shows a comparison of the amino acid sequences in
the translation region of bovine ligand polypeptide, rat ligand
polypeptide, and human ligand polypeptide.
[0096] FIG. 36 shows the results of receptor binding experiments on
living cells wherein radioiodinated ligand polypeptide is used in
the experiments.
[0097] FIG. 37 shows the results of measurements of release of
arachidonic acid metabolites from CHO-19P2-9 and CHO-UHR1 by ligand
polypeptide.
[0098] FIG. 38 shows the results of quantification of UHR-1 mRNA by
RT-PCR in discrete regions of the brain and tissues in rats.
[0099] FIG. 39 shows the results of quantification of ligand
polypeptide mRNA by RT-PCR in discrete regions of the brain and
tissues in rats.
[0100] FIG. 40 shows effects of ligand polypeptide on
glucose-induced increase in plasma insulin concentration, which is
measured by radioimmunoassay.
[0101] FIG. 41 shows the results of measurements of motor activity
by administration of 10 nmol of ligand polypeptide to mouse.
[0102] (a) relates to spontaneous motor activity and (b) relates to
rearing.
[0103] FIG. 42 shows the results of measurements of motor activity
by administration of 1 nmol of ligand polypeptide to mouse.
[0104] (a) relates to spontaneous motor activity and (b) relates to
rearing.
[0105] FIG. 43 shows the results of measurements of motor activity
by administration of 0.1 nmol of ligand polypeptide to mouse.
[0106] (a) relates to spontaneous motor activity and (b) relates to
rearing.
[0107] FIG. 44 shows the results of measurements of motor activity
by administration of 0.01 mmol of ligand polypeptide to mouse.
[0108] (a) relates to spontaneous motor activity and (b) relates to
rearing.
[0109] FIG. 45 shows the results of measurements of body
temperature which is measured at the time when the ligand
polypeptide is administered to the lateral ventricle of mice. The
administration of ligand polypeptide is carried out after 15 hours
from administration of reserpine at a dose of 3 mg/kg, S.C.
[0110] In FIG. 45, the single star mark asterisk shows p<0.05
and the double star marks asterisks shows p<0.01.
[0111] FIG. 46 illustrates the drawing in which the micro-injection
cannula is inserted into the area postrema at an angle of
20.degree..
[0112] FIG. 47 shows the typical example of direct and average
blood pressure which is measured after the injection of ligand
polypeptide into the area postrema of rat. It is measured after the
injection of 10 nmol of ligand polypeptide at the rate of 1
.mu.l/min, and under the condition of non-anesthesia.
[0113] FIG. 48 shows the results of measurements of growth hormone
(GH) in plasma when 50 nmol of ligand polypeptide is administered
into the third ventricle of rat after anesthesia by
pentobarbital.
[0114] FIG. 49 shows the changes of secretion of GH in plasma by
administration of 50 nmol of ligand polypeptide into the third
ventricle in freely moving rats.
[0115] The ligand polypeptide or PBS was administered into the
third ventricle. At 10 min later, 5 .mu.g/kg of GHRH was
administered intravenously to the rat conscious. GH levels were
measured just prior to intraventricular administration (time 0) and
10, 20, 30, 40, and 60 min after the intravenous injection of
GHRH.
[0116] In FIG. 49, the single star mark asterisk shows p<0.05
and the double star marks asterisks show p<0.01.
[0117] FIG. 50 shows the relationship between the ligand
polypeptide serum and the absorbance.
[0118] FIG. 51 shows the inhibition of the release of archidonic
acid metabolites by anti-ligand polypeptide polyclonal
antibody.
[0119] FIG. 52 shows the sequence of cDNA coding for UHR-1, which
is constructed on pAKKO-UHR1-7.
BEST MODE FOR CARRYING OUT THE INVENTION
[0120] The ligand polypeptide according to the present invention is
a polypeptide which is capable of binding to G protein-coupled
receptor protein and comprising an amino acid sequence represented
by SEQ ID NO:73 or its substantial equivalent thereto or a partial
peptide thereof, or its amide or ester, or a salt thereof. In SEQ
ID NO:73, Xaa at 10th position is Ala or Thr; Xaa at 11th position
is Gly or Ser; and Xaa at 21th position is H, Gly, or GlyArg.
[0121] The above ligand polypeptide, its amide or ester, or a salt
thereof (hereinafter sometimes referred to briefly as the ligand
polypeptide or the polypeptide), processes for their production,
and uses for the polypeptide are now described in detail.
[0122] The above ligand polypeptide of the present invention
includes any polypeptides derived from any tissues, e.g. pituitary
gland, pancreas, brain, kidney, liver, gonad, thyroid gland, gall
bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive
canal, blood vessel, heart, etc.; or cells of man and other
warm-blooded animals, e.g. guinea pig, rat, mouse, swine, sheep,
bovine, monkey, etc. and comprising an amino acid sequence
represented by SEQ ID NO:73 or its substantial equivalent thereto.
For example, in addition to the protein comprising the amino acid
sequence of SEQ ID NO:73, the ligand polypeptide of the present
invention includes the protein comprising an amino acid sequence
having a homology of about 50-99.9%, preferably 70-99.9%, more
preferably 80-99.9% and especially preferably 90-99.9% to the amino
acid sequence of SEQ ID NO:73 and having qualitatively
substantially equivalent activity to the protein comprising the
amino acid sequence of SEQ ID NO:73. The term "substantially
equivalent" means the nature of the receptor-binding activity,
signal transduction activity and the like is equivalent. Thus, it
is allowable that even differences among grades such as the
strength of receptor binding activity and the molecular weight of
the polypeptide are present.
[0123] To be more specific, the ligand polypeptide of the present
invention includes the polypeptide derived from the rat whole
brain, bovine hypothalamus, or human whole brain and comprising the
amino acid sequence of SEQ ID NO:73. In addition, the ligand
polypeptide of the present invention includes the polypeptides
which comprises substantial equivalent polypeptides such as
polypeptides wherein 1 to 15, preferably 1 to 10, and more
preferably 1 to 5 amino acid residues are deleted from the amino
acid sequence of SEQ ID NO:73, polypeptides wherein 1 to 80,
preferably 1 to 50, more preferably 1 to 10 amino acid residues are
added to the amino acid sequence of SEQ ID NO:73, or polypeptides
wherein 1 to 15, preferably 1 to 10, more preferably 1 to 5 amino
acid residues are substituted with one or more other amino acid
residues.
[0124] The amino acid sequence of SEQ ID NO:73 comprises SEQ ID
NO:8, 9, 10, 50, 51, 52, 64, 65 or 66. The substantial equivalent
polypeptides to the polypeptide comprising the amino acid sequence
of SEQ ID NO: 73 are polypeptides comprising the amino acid
sequences of SEQ ID NO:1, 3, 4, 5, 6, 7, 44, 45, 47, 48, 49, 59,
61, 62, or 63.
[0125] Among them, preferred is the polypeptide comprising the
amino acid sequence of SEQ ID NO:73 and the polypeptide comprising
the amino acid sequence which a peptide of SEQ ID NO:74 is added to
the N-terminus of the polypeptide comprising the amino acid
sequence of SEQ ID NO:73.
[0126] Furthermore, the polypeptide or partial peptide of the
present invention includes those wherein the N-terminal side of Gln
is cleaved in vivo to form pyroglutamyl peptide.
[0127] The peptides described in this specification, the left ends
are the N-terminus (amino terminus) and the right end is the
C-terminus (carboxyl terminus) according to the convention of the
peptide indication. While the C-terminus of the polypeptide of SEQ
ID NO:73 is usually carboxyl (--COOH) or carboxylate (--COO.sup.-),
it may be amide (--CONH.sub.2) or ester (--COOR) form. The ester
residue R includes a C.sub.1-6 alkyl group such as methyl, ethyl,
n-propyl, isopropyl, n-butyl, etc., a C.sub.3-8 cycloalkyl group
such as cyclopentyl, cyclohexyl, etc., a C.sub.6-12 aryl group such
as phenyl, .alpha.-naphthyl, etc., and a C.sub.7-14 aralkyl group
such as a phenyl-C.sub.1-2 alkyl group, e.g. benzyl, phenethyl,
benzhydryl, etc. or an .alpha.-naphthyl-C.sub.1-2 alkyl, e.g.
.alpha.-naphthylmethyl etc. In addition, the ester may be a
pivaloyloxymethyl ester which is broadly used for oral
administration. When the polypeptide of SEQ ID NO:73 has a carboxyl
or carboxylate group in any position other than the C-terminus, the
corresponding amide or ester are also included in the concept of
the polypeptide of the present invention. The ester mentioned just
above includes the esters mentioned for the C-terminus.
[0128] The preferred ligand polypeptide of the present invention is
a peptide which the C-terminus is amidated. Especially preferred is
a polypeptide comprising the amino acid sequence of SEQ ID NO:5, 8,
47, 50, 61 or 64 which the C-terminus is amidated.
[0129] The salt of polypeptide of the present invention includes
salts with physiologically acceptable bases, e.g. alkali metals or
acids such as organic or inorganic acids, and is preferably a
physiologically acceptable acid addition salt. Examples of such
salts are salts thereof with inorganic acids, e.g. hydrochloric
acid, phosphoric acid, hydrobromic acid or sulfuric acid, etc. and
salts thereof with organic acids, e.g. acetic acid, formic acid,
propionic acid, fumaric acid, maleic acid, succinic acid, tartaric
acid, citric acid, malic acid, oxalic acid, benzoic acid,
methanesulfonic acid or benzenesulfonic acid, etc.
[0130] The ligand polypeptide or amide or ester, or a salt thereof
of the present invention may be manufactured from the tissues or
cells of warm-blooded animals inclusive of human by purifying
techniques or manufactured by the peptide synthesis as described
hereinafter. Moreover, it can be manufactured by culturing a
transformant carrying a DNA coding for the polypeptide as described
hereinafter.
[0131] In the production from the tissues or cells of human or
other warm-blooded animals, the ligand polypeptide can be purified
and isolated by a process which comprises homogenizing the tissue
or cells of human or other warm-blooded animal, extracting the
homogenate with an acid, for instance, and subjecting the extract
to a combination of chromatographic procedures such as
reversed-phase chromatography, ion-exchange chromatography,
affinity chromatography, etc.
[0132] As mentioned above, the ligand polypeptide in the present
invention can be produced by the per se known procedures for
peptide synthesis. The methods for peptide synthesis may be any of
a solid-phase synthesis and a liquid-phase synthesis. Thus, the
objective peptide can be produced by condensing a partial peptide
or amino acid capable of constituting the protein with the residual
part thereof and, when the product has a protective group, the
protective group is detached whereupon a desired peptide can be
manufactured. The known methods for condensation and deprotection
includes the procedures described in the following literature
(1)-(5).
[0133] (1) M. Bodanszky and M. A. Ondetti, Peptide Synthesis,
Interscience Publishers, New York, 1966
[0134] (2) Schroeder and Luebke, The Peptide, Academic Press, New
York, 1965
[0135] (3) Nobuo Izumiya et al., Fundamentals and Experiments in
Peptide Synthesis, Maruzen, 1975
[0136] (4) Haruaki Yajima and Shumpei Sakakibara, Biochemical
Experiment Series 1, Protein Chemistry IV, 205, 1977
[0137] (5) Haruaki Yajima (ed.), Development of Drugs-Continued,
14, Peptide Synthesis, Hirokawa Shoten
[0138] After the reaction, the protein can be purified and isolated
by a combination of conventional purification techniques such as
solvent extraction, column chromatography, liquid chromatography,
and recrystallization. Where the protein isolated as above is a
free compound, it can be converted to a suitable salt by the known
method. Conversely where the isolated product is a salt, it can be
converted to the free peptide by the known method.
[0139] The amide of polypeptide can be obtained by using a resin
for peptide synthesis which is suited for amidation. The resin
includes chloromethyl resin, hydroxymethyl resin, benzhydrylamine
resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin,
4-methylbenzhydrylamine resin, PAM resin,
4-hydroxymethylmethylphenylacet- amidomethyl resin, polyacrylamide
resin, 4-(2',4'-dimethoxyphenylhydroxyme- thyl)phenoxy resin,
4-(2',4'-dimethoxyphenylFmoc aminoethyl)phenoxy resin, and so on.
Using such a resin, amino acids whose .alpha.-amino groups and
functional groups of side-chain have been suitably protected are
condensed on the resin according to the sequence of the objective
peptide by various condensation techniques which are known per se.
At the end of the series of reactions, the peptide or the protected
peptide is removed from the resin and the protective groups are
removed to obtain the objective polypeptide.
[0140] For the condensation of the above-mentioned protected amino
acids, a variety of activating reagents for peptide synthesis can
be used but a carbodiimide compound is particularly suitable. The
carbodiimide includes DCC, N,N'-diisopropylcarbodiimide, and
N-ethyl-N'-(3-dimethylaminoprolyl)- carbodiimide. For activation
with such a reagent, a racemization inhibitor additive, e.g. HOBt
and the protected amino acid are directly added to the resin or the
protected amino acid pre-activated as symmetric acid anhydride,
HOBt ester, or HOOBt ester is added to the resin. The solvent for
the activation of protected amino acids or condensation with the
resin can be properly selected from among those solvents which are
known to be useful for peptide condensation reactions. For example,
N,N-dimethylformamide, N-methylpyrrolidone, chloroform,
trifluoroethanol, dimethyl sulfoxide, DMF, pyridine, dioxane,
methylene chloride, tetrahydrofuran, acetonitrile, ethyl acetate,
or suitable mixtures of them can be mentioned. The reaction
temperature can be selected from the range hitherto-known to be
useful for peptide bond formation and is usually selected from the
range of about -20.degree. C.-50.degree. C. The activated amino
acid derivative is generally used in a proportion of 1.5-4 fold
excess. If the condensation is found to be insufficient by a test
utilizing the ninhydrin reaction, the condensation reaction can be
repeated to achieve a sufficient condensation without removing the
protective group. If repeated condensation still fails to provide a
sufficient degree of condensation, the unreacted amino group can be
acetylated with acetic anhydride or acetylimidazole.
[0141] The protecting group of amino group for the starting
material amino acid includes Z, Boc, tertiaryamyloxycarbonyl,
isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z,
adamantyloxycarbonyl, trifluoroacetyl, phthalyl, formyl,
2-nitrophenylsulfenyl, diphenylphosphinothioyl, or Fmoc. The
carboxy-protecting group that can be used includes but is not
limited to the above-mentioned C.sub.1-6 alkyl, C.sub.3-8
cycloalkyl and C.sub.7-14 aralkyl as well as 2-adamantyl,
4-nitrobenzyl, 4-methoxybenzyl, 4-chlorobenzyl, phenacyl,
benzyloxycarbonylhydrazido, tertiary-butoxycarbonylhydrazido, and
tritylhydrazido.
[0142] The hydroxy group of serine and threonine can be protected
by esterification or etherification. The group suited for said
esterification includes carbon-derived groups such as lower
alkanoyl groups, e.g. acetyl etc., aroyl groups, e.g. benzoyl etc.,
benzyloxycarbonyl, and ethoxycarbonyl. The group suited for said
etherification includes benzyl, tetrahydropyranyl, and
tertiary-butyl.
[0143] The protective group for the phenolic hydroxyl group of
tyrosine includes Bzl, Cl.sub.2-Bzl, 2-nitrobenzyl, Br-Z, and
tertiary-butyl.
[0144] The protecting group of imidazole for histidine includes
Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP,
benzyloxymethyl, Bum, Boc, Trt, and Fmoc.
[0145] The activated carboxyl group of the starting amino acid
includes the corresponding acid anhydride, azide, and active
esters, e.g. esters with alcohols such as pentachlorophenol,
2,4,5-trichlorophenol, 2,4-dinitrophenol, cyanomethyl alcohol,
p-nitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide,
HOBt, etc. The activated amino group of the starting amino acid
includes the corresponding phosphoramide.
[0146] The method for elimination of protective groups includes
catalytic reduction using hydrogen gas in the presence of a
catalyst such as palladium black or palladium-on-carbon, acid
treatment with anhydrous hydrogen fluoride, methanesulfonic acid,
trifluoromethanesulfonic acid, trifluoroacetic acid, or a mixture
of such acids, base treatment with diisopropylethylamine,
triethylamine, piperidine, piperazine, reduction with sodium metal
in liquid ammonia. The elimination reaction by the above-mentioned
acid treatment is generally carried out at a temperature of
-20.degree. C.-40.degree. C. and can be conducted advantageously
with addition of a cation acceptor such as anisole, phenol,
thioanisole, m-cresol, p-cresol, dimethyl sulfide,
1,4-butanedithiol, 1,2-ethanedithiol. The 2,4-dinitrophenyl group
used for protecting the imidazole group of histidine can be
eliminated by treatment with thiophenol, while the formyl group
used for protecting the indole group of tryptophan can be
eliminated by alkali treatment with dilute sodium hydroxide
solution or dilute aqueous ammonia as well as the above-mentioned
acid treatment in the presence of 1,2-ethanedithiol,
1,4-butanedithiol.
[0147] The method for protecting functional groups which should not
take part in the reaction of the starting material, the protective
groups that can be used, the method of removing the protective
groups, and the method of activating the functional groups that are
to take part in the reaction can all be selected judicially from
among the known groups and methods.
[0148] An another method for obtaining the amide form of the
polypeptide comprises amidating the .alpha.-carboxyl group of the
C-terminal amino acid at first, then extending the peptide chain to
the N-side until the desired chain length, and then selectively
deprotecting the .alpha.-amino group of the C-terminal peptide and
the .alpha.-carboxy group of the amino acid or peptide that is to
form the remainder of the objective polypeptide and condensing the
two fragments whose .alpha.-amino group and side-chain functional
groups have been protected with suitable protective groups
mentioned above in a mixed solvent such as that mentioned
hereinbefore. The parameters of this condensation reaction can be
the same as described hereinbefore. From the protected peptide
obtained by condensation, all the protective groups are removed by
the above-described method to thereby provide the desired crude
peptide. This crude peptide can be purified by known purification
procedures and the main fraction be lyophilized to provide the
objective amidated polypeptide.
[0149] To obtain an ester of the polypeptide, the .alpha.-carboxyl
group of the C-terminal amino acid is condensed with a desired
alcohol to give an amino acid ester and then, the procedure
described above for production of the amide is followed.
[0150] The partial peptide of the ligand polypeptide of the present
invention, its amide or ester, or a salt thereof can be any peptide
that has the same activities, e.g. pituitary function modulating
activity, central nervous system function modulating activity, or
pancreatic function modulating activity as the polypeptide which
has an amino acid sequence of SEQ ID NO:73 or its substantial
equivalent thereto. As such peptides, there can be mentioned
peptides wherein 1 to 15 amino acids residues are deleted from the
above-mentioned amino acid sequence of SEQ ID NO:73. To be
specific, the peptide having an amino acid sequence corresponding
to the 2nd to 21st positions of the amino acid sequence of SEQ ID
NO:73, the peptide corresponding to the 3rd to 21st positions of
the amino acid sequence of SEQ ID NO:73, the peptide corresponding
to the 4th to 21st positions of the amino acid sequence of SEQ ID
NO:73, the peptide corresponding to the 5th to 21st positions of
the amino acid sequence of SEQ ID NO:73, the peptide corresponding
to the 6th to 21st positions of the amino acid sequence of SEQ ID
NO:73, the peptide corresponding to the 7th to 21st positions of
the amino acid sequence of SEQ ID NO:73, the peptide corresponding
to the 8th to 21st positions of the amino acid sequence of SEQ ID
NO:73, the peptide corresponding to the 9th to 21st positions of
the amino acid sequence of SEQ ID NO:73, the peptide corresponding
to the 10th to 21st positions of the amino acid sequence of SEQ ID
NO:73, the peptide corresponding to the 11th to 21st positions of
the amino acid sequence of SEQ ID NO:73, the peptide corresponding
to the 12th to 21st positions of the amino acid sequence of SEQ ID
NO:73, the peptide corresponding to the 13th to 21st positions of
the amino acid sequence of SEQ ID NO:73, the peptide corresponding
to the 14th to 21st positions of the amino acid sequence of SEQ ID
NO:73, and the peptide corresponding to the 15th to 21st positions
of the amino acid sequence of SEQ ID NO:73, can be mentioned as
preferred examples. Moreover, the peptide having the amino acid
sequence of SEQ ID NO:74 is also preferred.
[0151] The ligand polypeptide or partial peptide thereof can be
used as antigen for preparation of anti-ligand polypeptide
antibody. The polypeptide as antigen includes N-terminus peptides,
C-terminus peptides or peptides of central portions other than
above-mentioned ligand polypeptides or partial peptides thereof. To
be more specifically includes the partial peptide of SEQ ID NO: 92,
93 or 94.
[0152] The partial peptide may be a peptide containing each of the
domains or a peptide containing a plurality of the domains within
the molecule.
[0153] The partial peptide mentioned in this specification may be
one ending with an amide bond (--CONH.sub.2) or an ester bond
(--COOR) at the C-terminus. The ester here includes the same one of
the above polypeptide. When the partial peptide has a carboxyl or
carboxylate group in any position other than the C-terminus, the
case in which such group or moiety has been amidated or esterified
also falls within the scope of the partial peptide in the present
invention. The ester here may be of the same one as the
above-mentioned ester at the C-terminus.
[0154] The ligand polypeptide or its partial peptide of the present
invention may be in the form of a fused protein which fused with a
protein whose functions or properties are already known.
[0155] The salt of such partial peptide of the ligand polypeptide
of present invention may be of the same one as the above-mentioned
salt of the polypeptide.
[0156] The partial peptide of the ligand polypeptide of the
invention, its amide or ester, or a salt thereof can be produced by
the same synthetic processes as mentioned for the polypeptide or by
cleaving the polypeptide of the present invention with a suitable
peptidase.
[0157] The DNA coding for the ligand polypeptide or a partial
peptide thereof of the present invention may be any DNA comprising
the nucleotide sequence encoding a polypeptide having an amino acid
sequence of SEQ ID NO:73 or its substantial equivalent thereto.
Furthermore, the DNA may be any of genomic DNA, genomic DNA
library, tissue- or cell-derived cDNA, tissue- or cell-derived cDNA
library, and synthetic DNA. The vector for such as library may be
any of bacteriophage, plasmide, cosmide, and phagimide. Moreover,
it can be directly amplified by the RT-PCR method by using an RNA
fraction may be prepared from a tissue or cells.
[0158] To be more specific, as the DNA coding for a polypeptide
derived from rat whole brain or bovine hypothalmus and comprising
the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:44, the DNA
comprising the nucleotide sequence of SEQ ID NO:2 can be
exemplified. In SEQ ID NO:2, R at 129th position represents G or A,
and Y at 179th and 240th positions represents C or T. When Y at
179th position is C, the amino acid sequence of SEQ ID NO:1 is
encoded, and when Y at 179th position is T, the amino acid sequence
of SEQ ID NO:44 is encoded.
[0159] As the DNA coding for a bovine-derived polypeptide
comprising the amino acid sequence of SEQ ID NO:3, 4, 5, 6, 7, 8, 9
or 10, a DNA comprising the nucleotide sequence of SEQ ID NO:11,
12, 13, 14, 15, 16, 17 or 18 can be exemplified. Here, R at 63th
position of SEQ ID NO:11, 13, 14 or 15 and R at 29th position of
SEQ ID NO:12, 16, 17, or 18 represent G or A.
[0160] As the DNA coding for a rat-derived polypeptide of SEQ ID
NO:45, 47, 48, 49, 50, 51, or 52, a DNA comprising the nucleotide
sequence of SEQ ID NO:46, 53, 54, 55, 56, 57, or 58 can be
exemplified.
[0161] Furthermore, as the DNA coding for a human-derived peptide
of SEQ ID NO:59, 61, 62, 63, 64, 65, or 66, a DNA comprising the
nucleotide sequence of SEQ ID NO:60, 67, 68, 69, 70, 71, or 72 can
be exemplified.
[0162] Among DNAs coding for the bovine-derived polypeptide
comprising the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:44,
the rat-derived polypeptide comprising the amino acid sequence of
SEQ ID NO:45, or the human-derived polypeptide comprising the amino
acid sequence of SEQ ID NO:59, DNA fragments comprising partial
nucleotide sequences of 6 to 90, preferably 6 to 60, more
preferably 9 to 30, and especially preferably 12 to 30 can be
advantageously used as DNA probes as well.
[0163] The DNA coding for the ligand polypeptide or a partial
peptide thereof of the present invention can be produced by the
following genetic engineering procedures.
[0164] The DNA fully encoding the polypeptide or partial peptide of
the present invention can be cloned either by PCR amplification
using synthetic DNA primers having a partial nucleotide sequence of
the polypeptide or partial peptide or by hybridization using the
DNA inserted in a suitable vector and labeled with a DNA fragment
comprising a part or full region of a human-derived polypeptide or
a synthetic DNA. The hybridization can be carried out typically by
the procedure described in Molecular Cloning (2nd ed., J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). When a commercial
library is used, the instructions given in the accompanying manual
can be followed.
[0165] The cloned DNA coding for the polypeptide or partial peptide
can be used directly or after digestion with a restriction enzyme
or addition of a linker depending on purposes. This DNA has ATG as
the translation initiation codon at the 5' end and may have TAA,
TGA, or TAG as the termination codon at the 3' end. The translation
initiation and termination codons can be added by means of suitable
DNA adapters.
[0166] An expression vector for the polypeptide or partial peptide
can be produced by, for example (a) cutting out a target DNA
fragment from the DNA for the polypeptide or partial peptide of the
present invention and (b) ligating the target DNA fragment with the
downstream side of a promoter in a suitable expression vector.
[0167] The vector may include plasmids derived from Escherichia
coli, e.g., pBR322, pBR325, pUC12, pUC13, etc.; plasmids derived
from Bacillus subtilis, e.g., pUB110, pTP5, pC194, etc.; plasmids
derived from yeasts e.g., pSH19, pSH15, etc.; bacteriophages such
as .lambda.-phage, and animal virus such as retrovirus, vaccinia
virus and baculovirus.
[0168] According to the present invention, any promoter can be used
as long as it is compatible with the host cell which is used for
expressing a gene. When the host for the transformation is E. coli,
the promoters are preferably trp promoters, lac promoters, recA
promoters, .lambda..sub.PL promoters, lpp promoters, etc. When the
host for the transformation is Bacillus, the promoters are
preferably SPO1 promoters, SPO2 promoters, penP promoters, etc.
When the host is a yeast, the promoters are preferably PHO5
promoters, PGK promoters, GAP promoters, ADH promoters, etc. When
the host is an animal cell, the promoters include SV40-derived
promoters, retrovirus promoters, metallothionein promoters, heat
shock promoters, cytomegalovirus (CMV) promoters, SR.alpha.
promoters, etc. An enhancer can be effectively utilized for
expression.
[0169] As required, furthermore, a host-compatible signal sequence
is added to the N-terminal side of the polypeptide or partial
peptide thereof. When the host is E. coli, the utilizable signal
sequences may include alkaline phosphatase signal sequences, OmpA
signal sequences, etc. When the host is Bacillus, they may include
.alpha.-amylase signal sequences, subtilisin signal sequences, etc.
When the host is a yeast, they may include mating factor .alpha.
signal sequences, invertase signal sequences, etc. When the host is
an animal cell, they may include insulin signal sequences,
.alpha.-interferon signal sequences, antibody molecule signal
sequences, etc.
[0170] A transformant or transfectant is produced by using the
vector thus constructed, which carries the polypeptide or partial
peptide-encoding DNA of the present invention. The host may be, for
example, Escherichia microorganisms, Bacillus microorganisms,
yeasts, insect cells, animal cells, etc. Examples of the
Escherichia and Bacillus microorganisms include Escherichia coli
K12.cndot.DH1 [Proc. Natl. Acad. Sci. USA, Vol. 60, 160 (1968)],
JM103 [Nucleic Acids Research, Vol. 9, 309 (1981)], JA221 [Journal
of Molecular Biology, Vol. 120, 517 (1978)], HB101 [Journal of
molecular Biology, Vol, 41, 459 (1969)], C600 [Genetics, Vol. 39,
440 (1954)], etc.
[0171] Examples of the Bacillus microorganism are, for example
Bacillus subtilis MI114 [Gene, Vol. 24, 255 (1983)], 207-21
[Journal of Biochemistry, Vol. 95, 76 (1984)], etc.
[0172] The yeast may be, for example, Saccharomyces cerevisiae
AH22, AH22R.sup.-, NA87-11A, DKD-5D, 20B-12, etc. The insect may
include a silkworm (Bombyx mori larva), [Maeda et al, Nature, Vol.
315, 592 (1985)] etc. The host animal cell may be, for example,
monkey-derived cell line, COS-7, Vero, Chinese hamster ovary cell
line (CHO cell), DHFR gene-deficient Chinese hamster cell line
(dhfr.sup.- CHO cell), mouse L cell, mouse myeloma cell, human FL,
etc.
[0173] Depending on the host cell used, transformation is done
using standard techniques appropriate to such cells. Transformation
of Escherichia microorganisms can be carried out in accordance with
methods as disclosed in, for example, Proc. Natl. Acad. Sci. USA,
Vol. 69, 2110 (1972), Gene, Vol. 17, 107 (1982), etc.
Transformation of Bacillus microorganisms can be carried out in
accordance with methods as disclosed in, for example, Molecular
& General Genetics, Vol. 168, 111 (1979), etc. Transformation
of the yeast can be carried out in accordance with methods as
disclosed in, for example, Proc. Natl. Acad. Sci. USA, Vol. 75,
1929 (1978), etc. The insect cells can be transformed in accordance
with methods as disclosed in, for example, Bio/Technology, 6,
47-55, 1988. The animal cells can be transformed by methods as
disclosed in, for example, Virology, Vol. 52, 456, 1973, etc. The
transformants or transfectants wherein the expression vector
carrying a polypeptide or partial peptide thereof encoding DNA
harbors are produced according to the aforementioned
techniques.
[0174] Cultivation of the transformant (transfectant) in which the
host is Escherichia or Bacillus microorganism can be carried out
suitably in a liquid culture medium. The culture medium may
contains carbon sources, nitrogen sources, minerals, etc. necessary
for growing the transformant. The carbon source may include
glucose, dextrin, soluble starch, sucrose, etc. The nitrogen source
may include organic or inorganic substances such as ammonium salts,
nitrates, corn steep liquor, peptone, casein, meat extracts,
bean-cakes, potato extracts, etc. Examples of the minerals may
include calcium chloride, sodium dihydrogen phosphate, magnesium
chloride, etc. It is further allowable to add yeasts, vitamines,
growth-promoting factors, etc. It is desired that the culture
medium is pH from about 5 to about 8.
[0175] The Escherichia microorganism culture medium is preferably
an M9 medium containing, for example, glucose and casamino acid
(Miller, Journal of Experiments in Molecular Genetics), 431-433,
Cold Spring Harbor Laboratory, New York, 1972. Depending on
necessity, the medium may be supplemented with drugs such as
3.beta.-indolyl acrylic acid in order to improve efficiency of the
promoter. In the case of an Escherichia host, the cultivation is
carried out usually at about 15 to 43.degree. C. for about 3 to 24
hours. As required, aeration and stirring may be applied. In the
case of Bacillus host, the cultivation is carried out usually at
about 30 to 40.degree. C. for about 6 to 24 hours. As required,
aeration and stirring may be also applied. In the case of the
transformant in which the host is a yeast, the culture medium used
may include, for example, a Burkholder minimum medium [Bostian, K.
L. et al., Proc. Natl. Acad. Sci. USA, Vol. 77, 4505 (1980)], an SD
medium containing 0.5% casamino acid [Bitter, G. A. et al., Proc.
Natl. Acad. Sci. USA, Vol. 81, 5330 (1984)], etc. It is preferable
that the pH of the culture medium is adjusted to be from about 5 to
about 8. The cultivation is carried out usually at about 20 to
35.degree. C. for about 24 to 72 hours. As required, aeration and
stirring may be applied. In the case of the transformant in which
the host is an insect, the culture medium used may include those
obtained by suitably adding additives such as passivated (or
immobilized) 10% bovine serum and the like to the Grace's insect
medium (Grace, T. C. C., Nature, 195, 788 (1962)). It is preferable
that the pH of the culture medium is adjusted to be about 6.2 to
6.4. The cultivation is usually carried out at about 27.degree. C.
for about 3 to 5 days. As desired, aeration and stirring may be
applied. In the case of the transformant in which the host is an
animal cell, the culture medium used may include MEM medium
[Science, Vol. 122, 501 (1952)], DMEM medium [Virology, Vol. 8, 396
(1959)], RPMI 1640 medium [Journal of the American Medical
Association, Vol. 199, 519 (1967)], 199 medium [Proceedings of the
Society of the Biological Medicine, Vol. 73, 1 (1950)], etc. which
are containing, for example, about 5 to 20% of fetal calf serum. It
is preferable that the pH is from about 6 to about 8. The
cultivation is usually carried out at about 30 to 40.degree. C. for
about 15 to 60 hours. As required, medium exchange, aeration and
stirring may be applied.
[0176] Separation and purification of the polypeptide or partial
peptide from the above-mentioned cultures can be carried out
according to methods described herein below.
[0177] To extract polypeptide or partial peptide from the cultured
microorganisms or cells, the microorganisms or cells are collected
by known methods after the cultivation, suspended in a suitable
buffer solution, disrupted by ultrasonic waves, lysozyme and/or
freezing and thawing, etc. and, then, a crude extract of the
polypeptide or partial peptide is obtained by centrifugation or
filtration. Other conventional extracting or isolating methods can
be applied. The buffer solution may contain a protein-denaturing
agent such as urea or guanidine hydrochloride or a surfactant such
as Triton X-100 (registered trademark, hereinafter often referred
to as "TM").
[0178] In the case where the polypeptide or partial peptide are
secreted into culture media, supernatant liquids are separated from
the microorganisms or cells after the cultivation is finished and
the resulting supernatant liquid is collected by widely known
methods. The culture supernatant liquid and extract containing the
polypeptide or partial peptide can be purified by suitable
combinations of widely known methods for separation, isolation and
purification. The widely known methods of separation, isolation and
purification may include methods which utilizes solubility, such as
salting out or sedimentation with solvents methods which utilizes
chiefly a difference in the molecular size or weight, such as
dialysis, ultrafiltration, gel filtration and SDS-polyacrylamide
gel electrophoresis, methods utilizing a difference in the electric
charge, such as ion-exchange chromatography, methods utilizing
specific affinity such as affinity chromatography, methods
utilizing a difference in the hydrophobic property, such as
reverse-phase high-performance liquid chromatography, and methods
utilizing a difference in the isoelectric point such as isoelectric
electrophoresis, or chromatofocusing, etc.
[0179] In cases where the polypeptide or partial peptide thus
obtained is in a free form, the free protein can be converted into
a salt thereof by known methods or method analogous thereto. In
case where the polypeptide or partial peptide thus obtained is in a
salt form vice versa, the protein salt can be converted into a free
form or into any other salt thereof by known methods or method
analogous thereto.
[0180] The polypeptide or partial peptide produced by the
transformant can be arbitrarily modified or a polypeptide can be
partly removed therefrom, by the action of a suitable
protein-modifying enzyme before or after the purification. The
protein-modifying enzyme may include trypsin, chymotrypsin, arginyl
endopeptidase, protein kinase, glycosidase, etc. The activity of
the polypeptide or partial peptide thus formed can be measured by
experimenting the coupling (or binding) with receptor or by enzyme
immunoassays (enzyme linked immunoassays) using specific
antibodies.
[0181] The DNA coding for the ligand polypeptide of the present
invention, the ligand polypeptide or a partial peptide thereof can
be used for (1) synthesis of a part or the full length of the
ligand for G protein-coupled receptor protein, (2) search for the
physiological activities of the ligand polypeptide or partial
peptide thereof of the present invention, (3) preparation of a
synthetic oligonucleotide probe or a PCR primer, (4) acquisition of
DNAs coding for ligands of G protein-coupled receptor proteins and
precursor proteins, (5) development of receptor-binding assay
systems using the expression of recombinant receptor proteins and
screening of candidate medicinally active compounds, (6)
acquisition of antibodies and antisera, (7) development of
diagnostic agents utilizing said antibodies or antisera, (8)
development of drugs such as pituitary function modulators, central
nervous system function modulators, and pancreatic function
modulators, and (9) gene therapies, among other uses.
[0182] Particularly by using the receptor binding assay system
using the expression of a recombinant G protein-coupled receptor
protein, which is described hereinafter, agonists or antagonists of
G protein-coupled receptors which are specific to warm-blood
animals including humans can be screened and such agonists and
antagonists can be used as prophylactic and therapeutic agents for
various diseases.
[0183] Further, referring to (8) above, the ligand polypeptide, a
partial peptide thereof, or the DNA encording either of them of the
present invention is useful as a safe pharmaceutical composition of
low toxic potential because it is recognized as a ligand by the G
protein-coupled receptor protein expressed in the hypophysis,
central nervous system and pancreatic .beta. cells. The ligand
polypeptide, a partial peptide thereof, or the DNA encording either
of them of the present invention is associated with the modulation
of pituitary function, central nervous system function, and
pancreatic function and, therefore, can be used as a therapeutic
and prophylactic pharmaceutical composition for dementia such as
senile dementia, cerebrovascular dementia (dementia due to
cerebrovascular disorder), dementia associated with
phylodegenerative retroplastic diseases (e.g. Alzheimer's disease,
Parkinson's disease, Pick's disease, Huntington's disease, etc.),
dementia due to infectious diseases (e.g. delayed viral infections
such as Creutzfelt-Jakob disease), dementia associated with
endocrine, metabolic, and toxic diseases (e.g. hypothyroidism,
vitamin B12 deficiency, alcoholism, and poisoning due to various
drugs, metals, or organic compounds), dementia associated with
oncogenous diseases (e.g. brain tumor), dementia due to traumatic
diseases (e.g. chronic subdural hematoma):, depression
(melancholia), hyperkinetic (microencephalo-pathy) syndrome,
disturbance of consciousness, anxiety syndrome, schizophrenia,
horror, growth hormone secretory disease (e.g. gigantism,
acromegalic gigantism etc.), hyperphagia, polyphagia,
hypercholesterolemia, hyperglyceridemia, hyperlipemia,
hyperprolactinemia, diabetes (e.g. diabetic complications, diabetic
nephropathy, diabetic neurophathy, diabetic retinopathy etc.),
cancer (e.g. mammary cancer, lymphatic leukemia, cystic cancer,
ovary cancer, prostatic cancer etc.), pancreatitis, renal disease
(e.g. chromic renal failure, nephritis etc.), Turner's syndrome,
neurosis, rheumatoid arthritis, spinal injury, transient brain
ischemia, amyotrophic lateral sclerosis, acute myocardial
infarction, spinocerebellar degeneration, bone fracture, trauma,
atopic dermatitis, osteoporosis, asthma, epilepsy, infertility or
oligogalactia. Furthermore, they can be also used as the agent for
improvement in postoperative nutritional status and/or
vasopressor.
[0184] When the polypeptide, a partial peptide thereof, or the DNA
encoding either of them of the present invention is used as a
pharmaceutical composition as described above, it can be used by
conventional methods. For example, it can be used orally in the
form of tablets which may be sugar coated as necessary, capsules,
elixirs, microcapsules etc., or non-orally in the form of
injectable preparations such as aseptic solutions and suspensions
in water or other pharmaceutically acceptable liquids. These
preparations can be produced by mixing the polypeptide, a partial
peptide thereof, or the DNA encoding either of them with
physiologically acceptable carriers, flavoring agents, excipients,
vehicles, antiseptics, stabilizers, binders etc. in unit dosage
forms required for generally accepted manners of pharmaceutical
making. Active ingredient contents in these preparations are set so
that an appropriate dose within the specified range is
obtained.
[0185] Additives which can be mixed in tablets, capsules etc.
include binders such as gelation, corn starch, tragacanth and gum
arabic, excipients such as crystalline cellulose, swelling agents
such as corn starch, gelatin and alginic acid, lubricants such as
magnesium stearate, sweetening agents such as sucrose, lactose and
saccharin, and flavoring agents such as peppermint, akamono oil and
cherry. When the unit dosage form is the capsule, the
above-mentioned materials may further incorporate liquid carriers
such as oils and fats. Sterile compositions for injection can be
formulated by ordinary methods of pharmaceutical making such as by
dissolving or suspending active ingredients, naturally occuring
vegetable oils such as sesame oil and coconut oil, etc. in vehicles
such as water for injection.
[0186] Aqueous liquids for injection include physiological saline
and isotonic solutions containing glucose and other auxiliary
agents, e.g., D-sorbitol, D-mannitol and sodium chloride, and may
be used in combination with appropriate dissolution aids such as
alcohols, e.g., ethanol, polyalcohols, e.g., propylene glycol and
polyethylene glycol, nonionic surfactants, e.g., polysorbate 80
(TM) and HCO-50 etc. Oily liquids include sesame oil and soybean
oil, and may be used in combination with dissolution aids such as
benzyl benzoate and benzyl alcohol. Furthermore the above-mentioned
materials may also be formulated with buffers, e.g., phosphate
buffer and sodium acetate buffer; soothing agents, e.g.,
benzalkonium chloride, procaine hydrochloride; stabilizers, e.g.,
human serum albumin, polyethylene glycol; preservatives, e.g.,
benzyl alcohol, phenol; antioxidants etc. The thus-prepared
injectable liquid is normally filled in an appropriate ampule.
Because the thus-obtained preparation is safe and of low toxicity,
it can be administered to humans or warm-blooded mammals, e.g.,
mouse, rats, guinea pig, rabbits, chicken, sheep, pigs, bovines,
cats, dogs, monkeys, baboons, chimpanzees, for instance.
[0187] The dose of said polypeptide, a partial peptide thereof, or
the DNA encoding either of them is normally about 0.1-100 mg,
preferably 1.0-50 mg, and more preferably 1.0-20 mg per day for an
adult (weighing 60 kg) in oral administration, depending on
symptoms etc. In non-oral administration, it is advantageous to
administer the polypeptide, a partial peptide thereof, or the DNA
encoding either of them in the form of injectable preparation at a
daily dose of about 0.01-30 mg, preferably about 0.1-20 mg, and
more preferably about 0.1-10 mg per administration by an
intravenous injection for an adult (weighing 60 kg), depending on
subject of administration, target organ, symptoms, method of
administration etc. For other animal species, corresponding does as
converted per 60 kg weight can be administered.
[0188] The G protein-coupled receptor protein for the above ligand
polypeptide of the present invention may be any of G
protein-coupled receptor proteins derived from various tissues,
e.g. hypophysis, pancreas, brain, kidney, liver, gonad, thyroid
gland, gall bladder, bone marrow, adrenal gland, skin, muscle,
lung, alimentary canal, blood vessel, heart, etc. of human and
other warm-blooded animals, e.g. guinea pig, rat, mouse, swine,
sheep, bovine, monkey, etc.; and comprising an amino acid sequence
of SEQ ID NO:19, 20, 21, 22 or 23, or substantial equivalent
thereto. Thus, the G protein-coupled receptor protein of the
present invention includes, in addition to proteins comprising the
SEQ ID NO:19, 20, 21, 22 or 23, those proteins comprising amino
acid sequences of about 90-99.9% homology to the amino acid
sequence of SEQ ID NO:19, 20, 21, 22 or 23 and having qualitatively
substantially equivalent activity to proteins comprising the amino
acid sequence of SEQ ID NO:19, 20, 21, 22, or 23. The activities
which these proteins are possessed may include ligand binding
activity and signal transduction activity. The term "substantially
equivalent" means that the nature of the ligand binding activity
and the like is equivalent. Therefore, it is allowable that even
differences among grades such as the strength of ligand binding
activity and the molecular weight of receptor protein are
present.
[0189] To be further specific, the G protein-coupled receptor
proteins include human pituitary-derived G protein-coupled receptor
proteins which comprises the amino acid sequence of SEQ ID NO:19
or/and SEQ ID NO:20, mouse pancreas-derived G protein-coupled
receptor proteins which comprises the amino acid sequence of SEQ ID
NO:22, and mouse pancreas-derived G protein-coupled receptor
proteins which comprises the amino acid sequence of SEQ ID NO:23.
As the human pituitary-derived G protein-coupled receptor proteins
which comprises the amino acid sequence of SEQ ID NO:19 and/or SEQ
ID NO:20 include the human pituitary-derived G protein-coupled
receptor protein which comprises the amino acid sequence of SEQ ID
NO:21. The G protein-coupled receptor proteins further include
proteins wherein 1 to 30 amino acid residues, preferably 1 to 10
amino acid residues are deleted from the amino acid sequence of SEQ
ID NO:19, 20, 21, 22 or 23, proteins wherein 1 to 30 amino acid
residues, preferably 1 to 10 amino acid residues are added to the
amino acid sequence of SEQ ID NO:19, 20, 21, 22, or 23, the
proteins wherein 1 to 30 amino acid residues, preferably 1 to 10
amino acid residues in the amino acid sequence of SEQ ID NO:19, 20,
21, 22, or 23 are substituted with one or more other amino acid
residues.
[0190] Here, the protein which comprises an amino acid sequence of
SEQ ID NO:21 or substantial equivalent thereto contains the
full-length of the amino acid sequence for human pituitary-derived
G protein-coupled receptor protein. The protein which comprises an
amino acid sequence of SEQ ID NO:19 or/and SEQ ID NO:20 or
substantial equivalent thereto may be a partial peptide of the
protein which comprises an amino acid sequence of SEQ ID NO:21 or
substantial equivalent thereto. The protein which comprises an
amino acid sequence of SEQ ID NO:22 or SEQ ID NO:23 or substantial
equivalent thereto is a G protein-coupled receptor protein which is
derived from mouse pancreas but since its amino acid sequence is
quite similar to the amino acid sequence of SEQ ID NO:19 or/and SEQ
ID NO:20 (cf. Example 8, FIG. 13 in particular), the protein which
comprises an amino acid sequence of SEQ ID NO:22 or 23 or
substantial equivalent thereto is also subsumed in the category of
said partial peptide of the protein which comprises an amino acid
sequence of SEQ ID NO:21 or substantial equivalent thereto.
[0191] Thus, the above-mentioned protein comprising an amino acid
sequence of SEQ ID NO:21 or substantial equivalent thereto or a
partial peptide of the protein or a salt thereof, which will be
described below, includes the protein comprising an amino acid
sequence of SEQ ID NO:19, 20, 22, or 23 or substantial equivalent
thereto, or a salt thereof.
[0192] Furthermore, the G protein-coupled receptor protein includes
the protein in which the N-terminal Met has been protected with a
protective group, e.g. C.sub.1-6 acyl such as formyl or acetyl, the
protein in which the N-terminal side of Glu has been cleaved in
vivo to form pyroglutamine, the protein in which the side chain of
any relevant constituent amino acid has been protected with a
suitable protective group, e.g. C.sub.1-6 acyl such as formyl or
acetyl, and the complex protein such as glycoproteins available
upon attachment of sugar chains.
[0193] The salt of G protein-coupled receptor protein includes the
same kinds of salts as mentioned for the ligand polypeptide.
[0194] The G protein-coupled receptor protein or a salt thereof or
a partial peptide thereof can be produced from the tissues or cells
of human or other warm-blooded animals by the per se known
purification technology or, as described above, by culturing a
transformant carrying a DNA coding for the G protein-coupled
receptor protein. It can also be produced in accordance with the
procedures for peptide synthesis which are described above.
[0195] A partial peptide of G protein-coupled receptor protein may
include, for example, a fragment containing an extracellular
portion of the G protein-coupled receptor protein, i.e. the site
which is exposed outside the cell membranes. Examples of the
partial peptide are fragments containing a region which is an
extracellular area (hydrophilic region) as analyzed in a
hydrophobic plotting analysis of the G protein-coupled receptor
protein, such as shown in FIG. 3, FIG. 4, FIG. 8, FIG. 11, or FIG.
14. Furthermore, a fragment which partly contains a hydrophobic
region may also be used. While peptides which separately contains
each domain may be used too, peptides which contains multiple
domains at the same time will be used as well.
[0196] The salt of a partial peptide of G protein-coupled receptor
protein may be the same one of salt mentioned for the salt of
ligand polypeptide.
[0197] The DNA coding for the G protein-coupled receptor protein
may be any DNA comprising a nucleotide sequence encoding the G
protein-coupled receptor protein which comprises an amino acid
sequence of SEQ ID NO:19, 20, 21, 22, or 23 or substantial
equivalent thereto. It may also be any one of genomic DNA, genomic
DNA library, tissue- or cell-derived cDNA, tissue- or cell-derived
cDNA library, and synthetic DNA. The vector for such a library may
include bacteriophage, plasmid, cosmid, and phargimide.
Furthermore, using an RNA fraction prepared from a tissue or cells,
a direct amplification can be carried out by the RT-PCR method.
[0198] To be specific, the DNA encoding the human pituitary-derived
G protein-coupled receptor protein which comprises the amino acid
sequence of SEQ ID NO:19 include a DNA which comprises the
nucleotide sequence of SEQ ID NO:24. The DNA encoding the human
pituitary-derived G protein-coupled receptor protein which
comprises the amino acid sequence of SEQ ID NO:20 include a DNA
which comprises the nucleotide sequence of SEQ ID NO:25. The DNA
encoding the human pituitary-derived G protein-coupled receptor
protein which comprises the amino acid sequence of SEQ ID NO:21
include a DNA which comprises the nucleotide sequence of SEQ ID
NO:26. The DNA encoding the mouse pancreas-derived G
protein-coupled receptor protein which comprises the amino acid
sequence of SEQ ID NO:22 include a DNA which comprises the
nucleotide sequence of SEQ ID NO:27. The DNA encoding the mouse
pancreas-derived G protein-coupled receptor protein which comprises
the amino acid sequence of SEQ ID NO:23 include a DNA comprising
the nucleotide sequence of SEQ ID NO:28.
[0199] A method for cloning the DNA completely coding for the G
protein-coupled receptor protein, vector, promoter, host cell, a
method for transformation, a method for culturing the transformant
or a method for separation and purification of the G
protein-coupled receptor protein may include the same one as
mentioned for the ligand polypeptide.
[0200] To be specific, the plasmid phGR3 obtained in Example 5,
described hereinafter, is digested with the restriction enzyme SalI
and the translation frame for the full-length cDNA encoding hGR3 is
isolated. This frame is subjected to ligation to, for example, the
expression vector pAKKO-111 for animal cell use which has been
treated with BAP (bacterial alkaline phosphatase) after SalI
digestion for inhibition of autocyclization. After completion of
the ligation reaction, a portion of the reaction mixture is used
for transfection of, for example, Escherichia coli DH5. Among the
transformants obtained, a transformant in which the cDNA coding for
hGR3 has been inserted in the forward direction with respect to a
promoter, such as SR.alpha., which has been inserted into the
expression vector beforehand is selected by mapping after cleavage
with restriction enzymes or by nucleotide sequencing and the
plasmid DNA is prepared on a production scale.
[0201] The thus-constructed DNA of the expression vector is
introduced into CHO dhfr.sup.- cells using a kit for introducing a
gene into animal cells by the calcium phosphate method, the
liposome method or the like to provide a high G protein-coupled
receptor protein (hGR3) expression CHO cell line.
[0202] The resulting CHO cells are cultured in a nucleic acid-free
screening medium in a CO.sub.2 incubator at 37.degree. C. using 5%
CO.sub.2 for 1-4 days so as to give the G protein-coupled receptor
protein (hGR3).
[0203] The G protein-coupled receptor protein is purified from the
above CHO cells using an affinity column prepared by conjugating an
antibody to the G protein-coupled receptor protein or a partial
peptide thereof to a support or an affinity column prepared by
conjugating a ligand for the G protein-coupled receptor
protein.
[0204] The activity of the G protein-coupled receptor protein thus
formed can be measured by experimenting the binding with a ligand
or by enzyme immunoassays using specific antibodies.
[0205] The G protein-coupled receptor protein, the partial peptide
thereof and the G protein-coupled receptor protein-encoding DNA can
be used for:
[0206] 1) determining a ligand to the G protein-coupled receptor
protein,
[0207] 2) obtaining an antibody and an antiserum,
[0208] 3) constructing a system for expressing a recombinant
receptor protein,
[0209] 4) developing a receptor-binding assay system using the
above developing system and screening pharmaceutical candidate
compounds,
[0210] 5) designing drugs based upon comparison with ligands and
receptors which have a similar or analogous structure,
[0211] 6) preparing a probe for the analysis of genes and preparing
a PCR primer,
[0212] 7) gene manipulation therapy,
[0213] In particular, it is possible to screen a G protein-coupled
receptor agonist or antagonist specific to a warm-blooded animal
such as human being by a receptor-binding assay system which uses a
system for expressing a recombinant G protein-coupled receptor
protein. The agonist or antagonist thus screened or characterized
permits various applications including prevention and/or therapy of
a variety of diseases.
[0214] Described below are uses of ligand polypeptide of the
present invention, G protein-coupled receptor proteins to the
ligand polypeptide, ligand polypeptide-encoding DNAs, G
protein-coupled receptor protein-encoding DNAs and their
antibodies.
[0215] (1) Method for Determing a Ligand to the G Protein-Coupled
receptor Protein
[0216] The G protein-coupled receptor protein, the partial peptide
thereof or a salt thereof is useful as a reagent for investigating
or determining a ligand to said G protein-coupled receptor
protein.
[0217] According to the present invention, methods for determining
a ligand to the G protein-coupled receptor protein which comprises
contacting the G protein-coupled receptor protein or the partial
peptide thereof with the compound to be tested, and measuring the
binding amount, the cell stimulating activity, etc. of the test
compound to the G protein-coupled receptor protein or the partial
peptide thereof are provided.
[0218] The compound to be tested may include not only known ligands
such as angiotensins, bombesins, canavinoids, cholecystokinins,
glutamine, serotonin, melatonins, neuropeptides Y, opioids, purine,
vasopressins, oxytocins, VIP (vasoactive intestinal and related
peptides), somatostatins, dopamine, motilins, amylins, bradykinins,
CGRP (calcitonin gene related peptides), leukotrienes,
pancreastatins, prostaglandins, thromboxanes, adenosine,
adrenaline, .alpha.- and .beta.-chemokines such as IL-8,
GRO.alpha., GRO.beta., GRO.gamma., NAP-2, ENA-78, PF4, IP10, GCP-2,
MCP-1, HC14, MCP-3, I-309, MIP1.alpha., MIP-1.beta., RANTES, etc.;
endothelins, enterogastrins, histamine, neurotensins, TRH,
pancreatic polypeptides, galanin, modified derivatives thereof,
analogues thereof, family members thereof and the like but also
tissue extracts, cell culture supernatants, etc. of human or
warm-blooded aminals such as mice, rats, swines, cattle, sheep and
monkeys, etc. For example, said tissue extract, said cell culture
supernatant, etc. is added to the G protein-coupled receptor
protein for measurement of the cell stimulating activity, etc. and
fractionated by relying on the measurements whereupon a single
ligand can be finally determined and obtained.
[0219] In one specific embodiment of the present invention, said
method for determining the ligand includes a method for determining
whether a sample (including a compound or a salt thereof) is
capable of stimulating a target cell which comprises binding said
compound with the G protein-coupled receptor protein either in the
presence of the G protein-coupled receptor protein, the partial
peptide thereof or a salt thereof, or in a receptor binding assay
system in which the expression system for the recombinant receptor
protein is constructed and used; and measuring the
receptor-mediated cell stimulating activity, etc. Examples of said
cell stimulating activities that can be measured include promoting
or inhibiting biological responses, e.g. liberation of arachidonic
acid, liberation of acetylcholine, liberation of endocellular
Ca.sup.2+, production of endocellular cAMP, production of
endocellular cGMP, production of inositol phosphate, changes in the
cell membrane potential, phosphorylation of endocellular protein,
activation of c-fos, decrease in pH, etc, and preferably liberation
of arachidonic acid. Examples of said compound or a salt thereof
capable of stimulating the cell via binding with the G
protein-coupled receptor protein include peptides, proteins,
nonpeptidic compounds, synthetic compounds, fermented products,
etc.
[0220] In more specific embodiments of the present invention, said
methods for screening and identifying a ligand includes:
[0221] 1) a method of screening for a ligand to a G protein-coupled
receptor protein, which comprises contacting a labeled test
compound with a G protein-coupled receptor protein or a salt
thereof or its partial peptide or a salt thereof, and measuring the
amount of the labeled test compound binding with said protein or
salt thereof or with said partial peptide or salt thereof;
[0222] 2) a method of screening for a ligand to a G protein-coupled
receptor protein, which comprises contacting a labeled test
compound with cells containing the G protein-coupled receptor
protein or the membrane fraction of said cell, and measuring the
amount of the labeled test compound binding with said cells or said
membrane fraction;
[0223] 3) a method of screening for a ligand to a G protein-coupled
receptor protein, which comprises contacting a labeled test
compound with the G protein-coupled receptor protein expressed on
cell membranes by culturing transformants carrying the G
protein-coupled receptor protein-encoding DNA and measuring the
amount of the labeled test compound binding with said G
protein-coupled receptor protein;
[0224] 4) a method of screening for a ligan to a G protein-coupled
receptor protein, which comprises contacting a test compound with
cells containing the G protein-coupled receptor protein, and
measuring the cell stimulating activity, e.g. promoting or
inhibiting activity on biological responses such as liberation of
arachidonic acid, liberation of acetylcholine, liberation of
endocellular Ca.sup.2+, production of endocullular cAMP, production
of endocellular cGMP, production of inositol phosphate, changes in
the cell membrane potential, phosphorylation of endocellular
protein, activation of c-fos, lowering in pH, etc. via the G
protein-coupled receptor protein; and
[0225] 5) a method of screening for a ligand to the G
protein-coupled receptor protein, which comprises contacting a test
compound with the G protein-coupled receptor protein expressed on
the cell membrane by culturing transformants carrying the G
protein-coupled receptor protein-encoding DNA, and measuring at
least one cell stimulating activity, e.g., an activity for
promoting or inhibiting physiological responses such as liberation
of arachidonic acid, liberation of 2+acetylcholine, liberation of
endocellular Ca production of endocellular cAMP, production of
endocellular cGMP, production of inositol phosphate, changes in the
cell membrane potential, phosphorylation of endocellular protein,
activation of c-fos, lowering in pH etc. via the G protein-coupled
receptor protein.
[0226] Described below are specific illustrations of the method for
screening and identifying ligands.
[0227] First, the G protein-coupled receptor protein used for the
method for determining the ligand may include any material so far
as it contains a G protein-coupled receptor protein, a partial
peptide thereof or a salt thereof although it is preferable to
express large amounts of the G protein-coupled receptor proteins in
animal cells.
[0228] In the manufacture of the G protein-coupled receptor
protein, the above-mentioned method can be used and carried out by
expressing said protein encoding DNA in mammalian cells or in
insect cells. With respect to the DNA fragment coding for a
particular region such as an extracellular epitope, the
extracellular domains, etc., complementary DNA may be used although
the method of expression is not limited thereto. For example, gene
fragments or synthetic DNA may be used as well.
[0229] In order to introduce the G protein-coupled receptor
protein-encoding DNA fragment into host animal cells and to express
it efficiently, it is preferred that said DNA fragment is
incorporated into the downstream side of polyhedron promoters
derived from nuclear polyhedrosis virus belonging to baculovirus,
promoters derived from SV40, promoters derived from retrovirus,
metallothionein promoters, human heat shock promoters,
cytomegalovirus promoters, SR.alpha. promoters, etc. Examinations
of the quantity and the quality of the expressed receptor can be
carried out by methods per se known to those of skill in the art or
methods similar thereto based upon the present disclosure. For
example, they may be conducted by methods described in publications
such as Nambi, P. et al: The Journal of Biochemical Society, vol.
267, pages 19555-19559 (1992).
[0230] Accordingly, with respect to the determination of the
ligand, the material containing a G protein-coupled receptor
protein or partial peptide thereof may include products containing
G protein-coupled receptor proteins which are purified by methods
per se known to those of skill in the art or methods similar
thereto, peptide fragments of said G protein-coupled receptor
protein, cells containing said G protein-coupled receptor protein,
membrane fractions of the cell containing said protein, etc.
[0231] When the G protein-coupled receptor protein-containing cell
is used in the determining method of the ligand, said cell may be
immobilized with binding agents including glutaraldehyde, formalin,
etc. The immobilization may be carried out by methods per se known
to those of skill in the art or methods similar thereto.
[0232] The G protein-coupled receptor protein-containing cells are
host cells which express the G protein-coupled receptor protein.
Examples of said host cells are microorganisms such as Escherichia
coli, Bacillus subtilis, yeasts, insect cells, animal cells,
etc.
[0233] The cell membrane fraction is a cell membrane-rich fraction
which is prepared by methods per se known to those of skill in the
art or methods similar thereto after disruption of cells. Examples
of cell disruption may include a method for squeezing cells using a
Potter-Elvehjem homogenizer, a disruption by a Waring blender or a
Polytron manufactured by Kinematica, a disruption by ultrasonic
waves, a disruption via blowing out cells from small nozzles
together with applying a pressure using a French press or the like,
etc. In the fractionation of the cell membrane, a fractionation
method by means of centrifugal force such as a fractional
centrifugal separation and a density gradient centrifugal
separation is mainly used. For example, disrupted cellular liquid
is centrifuged at a low speed (500 rpm to 3,000 rom) for a short
period (usually, from about one to ten minutes), the supernatant
liquid is further centrifuged at a high speed (15,000 rpm to 30,000
rom) usually for 30 minutes to two hours and the resulting
precipitate is used as a membrane fraction. Said membrane fraction
contains a lot of the expressed G protein-coupled receptor protein
and a lot of membrane components such as phospholipids and membrane
proteins derived from the cells.
[0234] The amount of the G protein-coupled receptor protein in the
membrane fraction cell containing said G protein-coupled receptor
protein is preferably 10.sup.3 to 10.sup.8 molecules per cell or,
more preferably, 10.sup.5 to 10.sup.7 molecules per cell.
Incidentally, the greater the expressed amount, the higher the
ligand binding activity (specific activity) per membrane fraction
whereby the construction of a highly sensitive screening system
becomes possible and, moreover, it permits measurement of a large
amount of samples within the same lot.
[0235] In conducting the above-mentioned methods 1) to 3) wherein
ligands capable of binding with the G protein-coupled receptor
protein are determined, a suitable G protein-coupled receptor
fraction and a labeled test compound are necessary. The G
protein-coupled receptor fraction is preferably a naturally
occurring (natural type) G protein-coupled receptor, a recombinant
G protein-coupled receptor having the activity equivalent to that
of the natural type. Here, the term "activity equivalent to" means
the equivalent ligand binding activity, etc. as discussed
above.
[0236] Suitable examples of the labeled test compound include
above-mentioned compound to be tested which are labeled with
[.sup.3H], [.sup.125I], [.sup.14C], [.sup.35S], etc.
[0237] Specifically, the determination of ligands capable of
binding with G protein-coupled receptor proteins is carried out as
follows:
[0238] First, cells or cell membrane fractions containing the G
protein-coupled receptor protein are suspended in a buffer suitable
for the assay to prepare the receptor sample for conducting the
method of determining the ligand binding with the G protein-coupled
receptor protein. The buffer may include any buffer such as
Tris-HCL buffer or phosphate buffer with pH 4-10, preferably, pH
6-8, etc., as long as it does not inhibit the binding of the ligand
with the receptor. In addition, surface-active agents such as
CHAPS, Tween 80.TM. (Kao-Atlas, Japan), digitonin, deoxycholate,
etc. and various proteins such as bovine serum albumin (BSA),
gelatin, milk derivatives, etc. may be added to the buffer with an
object of descreasing the non-specific binding. Further, a protease
inhibitor such as PMSF, leupeptin, E-64 (manufactured by Peptide
Laboratory), pepstatin, etc. may be added with an object of
inhibiting the decomposition of the receptor and the ligand by
protease. A test compound labeled with a predetermined (or certain)
amount (5,000 cpm to 500,000 cpm) of [.sup.3H], [.sup.125I].
[.sup.14C], [.sup.35S], etc. coexists in 0.01 ml to 10 ml of said
receptor solution. In order to know the non-specific binding amount
(NSB), a reaction tube to which a great excessive amount of the
unlabeled test compound is added is prepared as well. The reaction
is carried out at 0-50.degree. C., preferably at 4-37.degree. C.
for 20 minutes to 24 hours, preferably 30 minutes to three hours.
After the reaction, it is filtered through a glass fiber filter or
the like, washed with a suitable amount of the same buffer and the
radioactivity remaining in the glass fiber filter is measured by
means of a liquid scintillation counter or a gamma-counter. The
test compound in which the cound (B-NSB) obtained by subtracting
the non-specific binding amount (NSB) from the total binding amount
(B) is more than 0 cpm is identified as a ligand to the G
protein-coupled receptor protein.
[0239] In conducting the above-mentioned methods 4) to 5) wherein
ligands capable of binding with the G protein-coupled receptor
protein are determined, the cell stimulating activity, e.g. the
liberation of arachidonic acid, the liberation of acetylcholine,
endocellular Ca.sup.2+ liberation, endocellular cAMP production,
the production of inositol phosphate, changes in the cell membrane
potential, the phosphorylation of endocellular protein, the
activation of c-fos, lowering of pH, the activation of G protein,
cell promulgation, etc.; mediated by the G protein-coupled receptor
protein may be measured by known methods or by the use of
commercially available measuring kits. To be more specific, G
protein-coupled receptor protein-containing cells are at first
cultured in a multi-well plate or the like.
[0240] In conducting the determination of ligand, it is substituted
with a fresh medium or a suitable buffer which does not show
toxicity to the cells in advance of the experiment, and incubated
under appropriate conditions and for sufficient time after adding a
test compound, etc. thereto. Then, the cells are extracted or the
supernatant liquid is recovered and the resulting product is
determined by each of the methods. When it is difficult to identify
the production of the substance, e.g. arachidonic acid, etc. which
is to be an index for the cell stimulating activity due to the
decomposing enzyme contained in the cell, an assay may be carried
out by adding an inhibitor against said decomposing enzyme. With
respect to an activity such as an inhibitory action against cAMP
production, it may be detected as an inhibitory action against the
production of the cells whose fundamental production is increased
by forskolin or the like.
[0241] The kit used for the method of determining the ligand
binding with the G protein-coupled receptor protein includes a G
protein-coupled receptor protein or a partial peptide thereof,
cells containing the G protein-coupled receptor protein, a membrane
fraction from the cells containing the G protein-coupled receptor
protein, etc.
[0242] Examples of the kit for determining the ligand are as
follows:
[0243] 1. Reagent for Determing the Ligand.
[0244] 1) Buffer for Measurement and Buffer for Washing.
[0245] The buffering product wherein 0.05% of bovine serum albumin
(manufactured by Sigma) is added to Hanks' Balanced Salt Solution
(manufactured by Gibco).
[0246] This product may be sterilized by filtration through a
membrane filter with a 0.45 .mu.m pore size, and stored at
4.degree. C. or may be formulated upon use.
[0247] 2) G Protein-Coupled Receptor Protein Sample.
[0248] CHO cells in which G protein-coupled receptor proteins are
expressed are subcultured at the rate of 5.times.10.sup.5
cells/well in a 12-well plate and cultured at 37.degree. C. in a
humidified 5% CO.sub.2/95% air atmosphere for two days to prepare
the sample.
[0249] 3) Labeled Test Compound.
[0250] The compound which is labeled with commercially available
[.sup.3H], [.sup.125I], [.sup.14C], [.sup.35S], etc. or labeled
with a suitable method.
[0251] The product in a state of an aqueous solution is stored at
4.degree. C. or at -20.degree. C. and, upon use, diluted to 1 .mu.M
with a buffer for the measurement. In the case of a test compound
which is barely soluble in water, it may be dissolved in an organic
solvent such as dimethylformamide, DMSO, methanol and the like.
[0252] 4) Unlabeled Test Compound.
[0253] The same compound as the labeled one is prepared in a
concentration of 100 to 1,000-fold concentrated state.
[0254] 2. Method of Measurement
[0255] 1) G protein-coupled receptor protein-expressing CHO cells
cultured in a 12-well tissue culture plate are washed twice with 1
ml of buffer for the measurement and then 490 .mu.l of buffer for
the measurement is added to each well.
[0256] 2) Five .mu.l of the labeled test compound is added and the
mixture is made to react at room temperature for one hour. For
measuring the nonspecific binding amount, 5 .mu.l of the unlabeled
test compound is added.
[0257] 3) The reaction solution is removed from each well, which is
washed with 1 ml of a buffer for the measurement three times. The
labeled test compound which is binding with the cells is dissolved
in 0.2N NaOH-1% SDS and mixed with 4 ml of a liquid scintillator A
manufactured by WAKO Pure Chemical, Japan.
[0258] 4) Radioactivity is measured using a liquid scintillation
counter such as one manufactured by Beckmann.
[0259] (2) Prophylactic and Therapeutic Agent for G Protein-Coupled
Receptor Protein or Ligand Polypeptide Deficiency Diseases
[0260] If a ligand to the G protein-coupled receptor protein is
revealed via the aforementioned method (1), the ligand or the G
protein-coupled receptor protein-encoding DNA can be used as a
prophylactic and/or therapeutic agent for treating said G
protein-coupled receptor protein or ligand polypeptide deficiency
diseases depending upon the action that said ligand exerts.
[0261] For example, when there is a patient for whom the
physiological action of the ligand, e.g. pituitary function
modulating action, central nervious system function modulating
action or pancreatic function modulating action; cannot be expected
because of a descrease in the G protein-coupled receptor protein or
ligand polypeptide in vivo, the amount of the G protein-coupled
receptor protein or ligand polypeptide in the brain cells of said
patient can be increased whereby the action of the ligand can be
fully achieved by:
[0262] (a) administering the G protein-coupled receptor
protein-encoding DNA to the patient to express it; or
[0263] (b) inserting the G protein-coupled receptor protein or
ligand polypeptide-encoding DNA into brain cells or the like to
said patient. Accordingly, the G protein-coupled receptor protein-
or ligand polypeptide-encoding DNA can be used as a safe and less
toxic preventive and therapeutic agent for the G protein-coupled
receptor protein or ligand polypeptide deficiency diseases.
[0264] When the above-mentioned DNA is used as the above-mentioned
agent, said DNA may be used alone or after inserting it into a
suitable vector such as retrovirus vector, adenovirus vector,
adenovirus-associated virus vector, etc. followed by subjecting the
product vector to a conventional means which is the same means as
using the DNA coding for the ligand polypeptide or partial peptide
thereof as the pharmaceutical composition.
[0265] (3) Quantitative Determination of the G Protein-Coupled
Receptor Protein to the Ligand Polypeptide
[0266] The ligand polypeptide that has a binding property for a G
protein-coupled receptor protein or a partial peptide thereof, or a
salt thereof are capable of determining quantitatively an amount of
a G protein-coupled receptor protein or a partial peptide thereof,
or a salt thereof in vivo with good sensitivity.
[0267] This quantitative determination may be carried out by, for
example, combining with a competitive analysis. Thus, a sample to
be determined is contacted with the ligand polypeptide so that the
concentration of a G protein-coupled receptor protein or a partial
peptide thereof in said sample can be determined. In one embodiment
of the quantitative determination, the protocols described in the
following 1) and 2) or methods similar thereto may be used:
[0268] 1) Hiroshi Irie (ed): "Radioimmunoassay" (Kodansha, Japan,
1974); and
[0269] 2) Hiroshi Irie (ed): "Radioimmunoassay, Second Series"
(Kodansha, Japan, 1979).
[0270] (4) Screening of Compound Changing the Binding Activity of
Ligand Polypeptide, Partial Peptide Thereof or Salt Thereof
(Hereinafter Sometimes Referred to Briefly as Ligand or Ligand
Polypeptide) with the G Protein-Coupled Receptor Protein
[0271] G protein-coupled receptor proteins or partial peptide or
salt thereof can be used. Alternatively, expression systems for
recombinant G protein-coupled receptor proteins are constructed and
receptor binding assay systems using said expression system are
used. In these assay systems, it is possible to screen compounds,
e.g. peptides, proteins, nonpeptidic compounds, synthetic
compounds, formented products, cell extracts, animal tissue
extracts, etc.; or salts thereof which changes the binding activity
of a ligand polypeptide with the G protein-coupled receptor
protein. Such a compound includes a compound exhibiting a G
protein-coupled receptor-mediated cell stimulating activity, e.g.
activity of promoting or activity of inhibiting physiological
reactions including liberation of arachidonic acid, liberation of
acetylchloline, endocellular Ca.sup.2+ liberation, endocellular
cAMP production, endocellular cGMP production, production of
inositol phosphate, changes in cell membrane potential,
phosphorylation of endocellular protein's activation of c-fos,
lowering of pH, activation of G protein, cell promulgation, etc.;
so-called "G protein-coupled receptor-agonist", a compound free
from such a cell stimulating activity, so-called "G protein coupled
receotor-antagonist", etc. The term of "change the binding activity
of a ligand polypeptide" includes the both concept of the case in
which the binding of ligand is inhibited and the case in which the
binding of ligand is promoted.
[0272] Thus, the present invention provides a method of screening
for a compound which changes the binding activity of a ligand with
a G protein-coupled receptor protein or a salt thereof,
characterized by comparing the following two cases:
[0273] (i) the case wherein the ligand is contacted with the G
protein-coupled receptor protein or salt thereof, or a partial
peptide thereof or a salt thereof; and
[0274] (ii) the case wherein the ligand is contacted with a mixture
of the G protein-coupled receptor protein or salt thereof or the
partial peptide or salt thereof and said test compound.
[0275] In said screening method, one characteristic feature of the
present invention resides in that the amount of the ligand bonded
with said G protein-coupled receptor protein or the partial peptide
thereof, the cell stimulating activity of the ligand, etc. are
measured in both the case where (i) the ligand polypeptide is
contacted with G protein-coupled receptor proteins or partial
peptide thereof and in the case where (ii) the ligand polypeptide
and the test compound are contacted with the G protein-coupled
receptor protein or the partial peptide thereof, respectively and
then compared therebetween.
[0276] In one more specific embodiment of the present invention,
the following is provided:
[0277] 1) a method of screening for a compound or a salt thereof
which changes the binding activity of a ligand polypeptide with a G
protein-coupled receptor protein, characterized in that, when a
labeled ligand polypeptide is contacted with a G protein-coupled
receptor protein or a partial peptide thereof and when a labeled
ligand polypeptide and a test compound are contacted with a G
protein-coupled receptor protein or a partial peptide thereof, the
amounts of the labeled ligand polypeptide bonded with said protein
or a partial peptide thereof or a salt thereof are measured and
compared;
[0278] 2) a method of screening for a compound or a salt thereof
which changes the binding activity of a ligand polypeptide with a G
protein-coupled receptor protein, characterized in that, when a
labeled ligand polypeptide is contacted with cells containing G
protein-coupled receptor proteins or a membrane fraction of said
cells and when a labeled ligand polypeptide and a test compound are
contacted with cells containing G protein-coupled receptor proteins
or a membrane fraction of said cells, the amounts of the labeled
ligand polypeptide binding with said protein or a partial peptide
thereof or a salt thereof are measued and compared;
[0279] 3) a method of screening for a compound or a salt thereof
which changes the binding activity of a ligand polypeptide with a G
protein-coupled receptor protein, characterized in that, when a
labeled ligand polypeptide is contacted with G protein-coupled
receptor proteins expressed on the cell memberane by culturing a
transformant carrying a G protein-coupled receptor protein-encoding
DNA and when a labeled ligand polypeptide and a test compound are
contacted with G protein-coupled receptor proteins expressed on the
cell membrane by culturing a transformant carrying a G
protein-coupled receptor protein-encoding DNA, the amounts of the
labeled ligand polypeptide binding with said G protein-coupled
receptor protein are measured and compared;
[0280] 4) a method of screening for a compound or a salt thereof
which changes the binding of a ligand polypeptide with a G
protein-coupled receptor protein, characterized in that, when a G
protein-coupled receptor protein-activating compound, e.g. a ligand
polypeptide of the present invention, etc. is contacted with cells
containing G protein-coupled receptor proteins and when the G
protein-coupled receptor protein-activating compound and a test
compound are contacted with cells containing G protein-coupled
receptor proteins, the resulting G protein-coupled receptor
protein-mediated cell stimulting activities, e.g. activities of
promoting or activities of inhibiting physiological responses
including liberation of arachidonic acid, liberation of
acetylcholine, endocellular Ca.sup.2+ liberation, endocellular cAMP
production, endocellular cGMP production, production of inositol
phosphate, changes in cell membrane potential, phosphorylation of
endocellular proteins, activation of c-fos, lowering of pH,
activation of G protein, cell promulgation, etc.; are measured and
compared; and
[0281] 5) a method of screening for a compound or a salt thereof
which changes the binding activity of a ligand polypeptide with a G
protein-coupled receptor protein, characterized in that, when a G
protein-coupled receptor protein-activating compound, e.g. a ligand
polypeptide of the present invention, etc. is contacted with G
protein-coupled receptor proteins expressed on cell membranes by
culturing transformants carrying G protein-coupled receptor
protein-encoding DNA and when a G protein-coupled receptor
protein-activating compound and a test compound are contacted with
the G protein-coupled receptor protein expressed on the cell
membrane by culturing the transformant carrying the G
protein-coupled receptor protein-encoding DNA, the resulting G
protein-coupled receptor protein-mediated cell stimulating
activities, e.g. activities of promoting or activities of
inhibiting physiological responses such as liberation of
arachidonic acid, liberation of acetylcholine, endocellular
Ca.sup.2+ liberation, endocellular cAMP production, endocellular
cGMP production, production of inositol phosphate, changes in cell
membrane potential, phosphorylation of endocellular proteins,
activation of c-fos, lowering of pH, activation of G protein, and
cell promulgation, etc.; are measured and compared.
[0282] The G protein-coupled receptor agonist or antagonist have to
be screened by, first, obtaining a candidate compound by using G
protein-coupled receptor protein-containing cells, tissues or cell
membrane fractions derived from rat or the like (primary
screening), then, making sure whether the candidate compound really
inhibitis the binding between human G protein-coupled receptor
proteins and ligands (secondary screening). Other receptor proteins
inevitably exist and when the cells, the tissues or the cell
membrane fractions were used, they intrinsically make it difficult
to screen agonists or antagonists to the desired receptor proteins.
By using the human-derived G protein-coupled receptor protein,
however, there is no need of effecting the primary screening,
whereby it is possible to efficiently screen a compound that
changes the binding activity between a ligand and a G
protein-coupled receptor Additionally, it is possible to evaluate
whether the compound that is screened is a G protein-coupled
receptor agonist or a G protein-coupled receptor antagonist.
[0283] Specific explanations of the screening method will be given
as hereunder.
[0284] First, with respect to the G protein-coupled receptor
protein used for the screening method of the present invention, any
product may be used so far as it contains G protein-coupled
receptor proteins or partial peptides thereof although the use of a
membrane fraction of mammalian organs is preferable. However, human
organs can be extremely scarce and, accordingly, G protein-coupled
receptor proteins which are expressed in a large amount using a
recombinant technique are suitable for the screening.
[0285] In the manufacture of the G protein-coupled receptor
protein, the above-mentioned method can be used.
[0286] When the G protein-coupled receptor protein-containing cells
or cell membrane fractions are used in the screening method, the
above-mentioned method can be used.
[0287] In conducting the above-mentioned methods 1) to 3) for
screening the compound capable of changing the binding activity of
the ligand with the G protein-coupled receptor protein, a suitable
G protein-coupled receptor fraction and a labeled ligand
polypeptide are necessary. With respect to the G protein-coupled
receptor fraction, it is preferred to use naturally occurring G
protein-coupled receptors (natural type G protein-coupled
receptors) or recombinant type G protein-coupled receptor fractions
with the activity equivalent to that of the natural type G protein
coupled. Here the term "activity equivalent to" means the same
ligand binding activity, or the substantially equivalent ligand
binding activity.
[0288] With respect to the labeled ligand, it is possible to use
labeled ligands, labeled ligand amalogized compounds, etc. For
example, ligands labeled with [.sup.3H], [.sup.125I], [.sup.14C],
[.sup.35S], etc. and other labeled substances may be utilized.
[0289] Specifically, G protein-coupled receptor protein-containing
cells or cell membrane fractions are first suspended in a buffer
which is suitable for the determining method to prepare the
receptor sample in conducting the screening for a compound which
changes the binding activity of the ligand with the G
protein-coupled receptor protein. With respect to the buffer, any
buffer such as Tris-HCl buffer or phosphate buffer of pH 4-10,
preferably, pH 6-8 which does not inhibit the binding of the ligand
with the receptor may be used.
[0290] In addition, a surface-active agent such as CHAPS, Tween
80.TM. (Kao-Atlas, Japan), digitonin, deoxycholate, etc. and/or
various proteins such as bovine serum albumin (BSA), gelatine, etc.
may be added to the buffer with an object of decreasing the
nonspecific binding. Further, a protease inhibitor such as PMSF,
leupeptin, E-64 manufactured by Peptide Laboratory, Japan,
pepstatin, etc. may be added with an object of inhibiting the
decomposition of the receptor and the ligand by protease. A labeled
ligand in a certain amount (5,000 cpm to 500,000 cpm) is added to
0.01 ml to 10 ml of said receptor solution and, at the same time,
10.sup.-4M to 10.sup.-10M of a test compound coexists. In order to
determine the nonspecific binding amount (NSB), a reaction tube to
which a great excessive amount of unlabeled test compounds is added
is prepared as well.
[0291] The reaction is carried out at 0-50.degree. C., preferably
at 4-37.degree. C. for 20 minutes to 24 hours, preferably 30
minutes to three hours. After the reaction, it is filtered through
a glass fiber filter, a filter paper, or the like, washed with a
suitable amount of the same buffer and the radioactivity retained
in the glass fiber filter, etc. is measured by means of a liquid
scintillation counter of a gamma-counter. Supposing that the count
(B.sub.0-NSB) obtained by subtracting the nonspecific binding
amount (NSB) from the total binding amount (B.sub.0) wherein an
antagonizing substance is not present is set at 100%, a test
compound in which the specific binding amount (B-NSB) obtained by
subtracting the nonspecific binding amount (NSB) from the total
binding amount (B) is, for example, less than 50% may be selected
as a candidate ligand to the G protein-coupled receptor protein of
the present invention.
[0292] In conducting the above-mentioned methods 4) to 5) for
screening the compound which changes the binding activity of the
ligand with the G protein-coupled receptor protein, the G
protein-coupled receptor protein-mediated cell stimulating
activity, e.g. activities of promoting or activities of inhibiting
physiological responses such as release of arachidonic acid,
release of acetylcholine, intracellular Ca.sup.2+ increase,
intracellular cAMP production, production of inositol phosphate,
changes in the cell membrane potential, phosphorylation of
intracullular proteins, activation of c-fos, lowering of pH,
activation of G protein and cell proliferation, etc.; may be
measured by known methods or by the use of commercially available
measuring kits. To be more specific, G protein-coupled receptor
protein-containing cells are at first cultured in a multiwell plate
or the like.
[0293] In conducting the screening, it is substituted with a
suitable buffer which does not show toxicity to fresh media or
cells in advance, incubated under appropriate conditions and for a
specified time after additing a test compound, etc. thereto. The
resultant cells are extracted or the supernatant liquid is
recovered and the resulting product is determined, preferably
quantitatively, by each of the methods. When it is difficult to
identify the production of the indicative substance, e.g.
arachidonic acid, etc. which is to be an indication for the cell
stimulating activity due to the presence of decomposing enzymes
contained in the cell, an assay may be carried out by adding an
inhibitor against said decomposing enzyme. With respect to the
activities such as an inhibitory action against cAMP production, it
may be detected as an inhibitory action against the cAMP production
in the cells whose fundamental production has been increased by
forskolin or the like.
[0294] In conducting a screening by measuring the cell stimulating
activity, cells in which a suitable G protein-coupled receptor
protein is expressed are necessary. Preferred G protein-coupled
receptor protein-expressing cells are naturally occurring G
protein-coupled receptor protein (natural type G protein-coupled
receptor protein)-containing cell lines or strains, e.g. mouse
pancreatic .beta. cell line, MIN6, etc., the above-mentioned
recombinant type G protein-coupled receptor protein-expressing cell
lines or strains, etc.
[0295] Examples of the test compound includes peptide, proteins,
non-peptidic compounds, synthesized compounds, fermented products,
cell extracts, plant extracts, animal tissue extracts, serum,
blood, body fluid, etc. Those compounds may be novel or known.
[0296] A kit for screening the compound which changes the binding
activity of the ligand with the G protein-coupled receptor protein
or a salt thereof comprises a G protein-coupled receptor protein or
a partial peptide thereof, or G protein-coupled receptor
protein-containing cells or cell membrane fraction thereof.
[0297] Examples of the screening kit include as follows:
[0298] 1. Reagent for Determining Ligand.
[0299] 1) Buffer for Measurement and Buffer for Washing.
[0300] The product wherein 0.05% of bovine serum albumin
(manufactured by Sigma) is added to Hanks' Balanced Salt Solution
(manufactured by Gibco).
[0301] This may be sterilized by filtration through a membrane
filter with a 0.45 .mu.m pore size, and stored at 4.degree. C. or
may be prepared upon use.
[0302] 2) Sample of G Protein-Coupled Receptor Protein.
[0303] CHO cells in which a G protein-coupled receptor protein is
expressed are subcultured at the rate of 5.times.10.sup.5
cells/well in a 12-well plate and cultured at 37.degree. C. with a
5% CO.sub.2 and 95% air atmosphere for two days to prepare the
sample.
[0304] 3) Labeled Ligand.
[0305] The ligand which is labeled with commercially available
[.sup.3H], [.sup.125I], [.sup.14C], [.sup.35S], etc.
[0306] The product in a state of an aqueous solution is stored at
4.degree. C. or at -20.degree. C. and, upon use, diluted to 1 .mu.M
with a buffer for the measurement.
[0307] 4) Standard Ligand Solution.
[0308] Ligand is dissolved in PBS containing 0.1% of bovine serum
albumin (manufactured by Sigma) to make 1 mM and stored at
-20.degree. C.
[0309] 2. Method of the Measurement.
[0310] 1) CHO cells are cultured in a 12-well tissue culture plate
to express G protein-coupled receptor proteins. The G
protein-coupled receptor protein-expressing CHO cells are washed
with 1 ml of buffer for the measurement twice. Then 490 .mu.l of
buffer for the measurement is added to each well.
[0311] 2) Five .mu.l of a test compound solution of 10.sup.-3 to
10.sup.-10 M is added, then 5 .mu.l of a labeled ligand is added
and is made to react at room temperature for one hour. For knowing
the non-specific binding amount, 5 .mu.l of the ligand of 10.sup.-3
M is added instead of the test compound.
[0312] 3) The reaction solution is removed from the well, which is
washed with 1 ml of buffer for the measurement three times. The
labeled ligand binding with the cells is dissolved in 0.2N NaOH-1%
SDS and mixed with 4 ml of a liquid scintillator A (such as
manufactured by Wako Pure Chemical, Japan).
[0313] 4) Radioactivity is measured using a liquid scintillation
counter (e.g., one manufactured by Beckmann) and PMB (percent
maximum binding) is calculated by the following equation:
PMB=[(B-NSB)/(B.sub.0-NSB)].times.100
[0314] PMB: Percent maximum binding
[0315] B: Value when a sample is added
[0316] NSB: Nonspecific binding
[0317] B.sub.0: Maximum binding
[0318] The compound or a salt thereof obtained by the screening
method or by the screening kit is a compound which changes the
binding activity of a ligand polypeptide with a G protein-coupled
receptor protein, wherein the compound inhibits or promotes the
bonding, and, more particularly, it is a compound having a cell
stimulating activity mediated via a G protein-coupled receptor or a
salt thereof, so-called "G protein-coupled receptor agonist" or a
compound having no said stimulating activity, so-called "G
protein-coupled receptor antagonist". Examples of said compound are
peptides, proteins, non-peptidic compounds, synthesized compounds,
fermented products, etc. and the compound may be novel or
known.
[0319] Said G protein coupled eceptor agonist has the same
physiological action as the ligand to the G protein-coupled
receptor protein has and, therefore, it is useful as a safe and
less toxic pharmaceutical composition depending upon said ligand
activity.
[0320] On the other hand, said G protein-coupled receptor
antagonist is capable of inhibiting the physiological activity of
the ligand to the G protein-coupled receptor protein and,
therefore, it is useful as a safe and less toxic pharmaceutical
composition for inhibiting said ligand activity.
[0321] The ligand polypeptide of the present invention relates to
the pituitary function modulating action, central nervous system
function modulating action or pancreatic function modulating
action. Therefore, the above-mentioned agonist or antagonist can be
used as a therapeutic and/or prophylactic agent for dementia such
as senile dementia, cerebrovascular dementia (dementia due to
cerebrovascular disorder), dementia associated with
phylodegenerative retroplastic diseases (e.g. Alzheimer's disease,
Parkinson's disease, Pick's disease, Huntington's disease, etc.),
dementia due to infectious diseases (e.g. delayed viral infections
such as Creutzfelt-Jakob disease), dementia associated with
endocrine, metabolic, and toxic diseases (e.g. hypothyroidism,
vitamin B12 deficiency, alcoholism, and poisoning due to various
drugs, metals, or organic compounds), dementia associated with
oncogenous diseases (e.g. brain tumor), dementia due to traumatic
diseases (e.g. chronic subdural hematoma):, depression
(melancholia), hyperkinetic (microencephalo-pathy) syndrome,
disturbance of consciousness, anxiety syndrome, schizophrenia,
horror, growth hormone secretory disease (e.g. gigantism,
acromegalic gigantism etc.), hyperphagia, polyphagia,
hypercholesterolemia, hyperglyceridemia, hyperlipemia,
hyperprolactinemia, hypoglycemia, pituitarism, pituitary drawfism,
diabetes (e.g. diabetic complications, diabetic nephropathy,
diabetic neurophathy, diabetic retinopathy etc.), cancer (e.g.
mammary cancer, lymphatic leukemia, cystic cancer, ovary cancer,
prostatic cancer etc.), pancreatitis, renal disease (e.g. chromic
renal failure, nephritis etc.), Turner's syndrome, neurosis,
rheumatoid arthritis, spinal injury, transient brain ischemia,
amyotrophic lateral sclerosis, acute myocardial infarction,
spinocerebellar degeneration, bone fracture, trauma, atopic
dermatitis, osteoporosis, asthma, epilepsy, infertility or
oligogalactia. Furthermore, the agonist or antagonist can be also
used as hypnotic-sedative, agent for improvement in postoperative
nutritional status, vasopressor or depressor.
[0322] When the compound or the salt thereof obtained by the
screening method or by the screening kit is used as the
pharmaceutical composition, a conventional means which is the same
means as using above-mentioned ligand polypeptide as the
pharmaceutical compoisiton may be applied therefor.
[0323] (5) Manufacture of Antibody or Antiserum Against the Ligand
Polypeptide or the G Protein-Coupled Receptor Protein.
[0324] Antibodies, e.g. polyclonal antibody, monoclonal antibody,
and antisera against the ligand polypeptide or the G
protein-coupled receptor protein may be manufactured by antibody-
or antiserum-manufacturing methods per se known to those of skill
in the art or methods similar thereto, using the ligand polypeptide
or the G protein-coupled receptor protein as antigen. For example,
polyclonal antibodies can be manufactured by the method as given
below.
[0325] [Preparation of a Polyclonal Antibody]
[0326] The above-mentioned polypeptide or protein as the antigen is
coupled to a carrier protein. The carrier protein may for example
be bovine thyroglobulin, bovine serum albumin, bovine
gamma-globulin, hemocyanine, or Freund's complete adjuvant
(Difco).
[0327] The coupling reaction between the antigen protein and the
carrier protein can be carried out by the known procedure. The
reagent for use in the coupling reaction includes but is not
limited to glutaraldehyde and water-soluble carbodiimide. The
suitable ratio of the antigen protein to the carrier protein is
about 1:1 through about 1:10 and as to the reaction pH,
satisfactory results are obtained in many cases when the reaction
is carried out around neutral, particularly in the range of pH
about 6-8. The reaction time is preferably about 1 to 12 hours in
many cases and more preferably about 2 to 6 hours. The conjugate
thus obtained is dialyzed against water at about 0 to 18.degree. C.
in the routine manner and stored frozen or optionally lyophilized
and stored.
[0328] For the production of a polyclonal antibody, a warm-blooded
animal is inoculated with the immunogen produced in the manner
described hereinbefore. The warm-blooded animal that can be used
for this purpose includes mammalian warm-blooded animals, e.g.
rabbit, sheep, goat, rat, mouse, guinea pig, bovine, equine, swine,
etc.; and avian species, e.g. chicken, dove, duck, goose, quail,
etc. Regarding the methodology for inoculating a warm-blooded
animal with the immunogen, the inoculum size of the immunogen may
be just sufficient for antibody production. For example, the
desired antibody can be produced in many instances by emulsifying 1
mg of the immunogen in 1 ml of saline with Freund's complete
adjuvant and injecting the emulsion subcutaneously at the back and
hind-limb footpad of rabbits 5 times at 4-week intervals. For
harvesting the antibody produced in the warm-blooded animal, for
example a rabbit, the blood is withdrawn from the auricular vein
usually during day 7 through day 12 after the last inoculation dose
and centrifuged to recover an antiserum. For purification, the
antiserum is generally subjected to affinity chromatography using a
carrier to which each antigen peptide has been conjugated and the
adsorbed fraction is recovered to provide a polyclonal
antibody.
[0329] The monoclonal antibody can be produced by the following
method.
[0330] [Preparation of Monoclonal Antibody]
[0331] (a) Preparation of Monoclonal Antibody-Producing Cells.
[0332] The ligand polypeptide or G protein-coupled receptor protein
is aministered to warm-blooded animals either solely or together
with carriers or diluents to the site where the production of
antibody is possible by the administration. In order to potentiate
the antibody productivity upon the administration, complete
Freund's adjuvants or incomplete Freund's adjuvants may be
administered. The administration is usually carried out once every
two to six weeks and two to ten times in total. Examples of the
applicable warm-blooded animals are monkeys, rabbits, dogs, guinea
pigs, mice, rats, sheep, goats and chickens and the use of mice and
rats is preferred.
[0333] In the preparation of the cells which produce monoclonal
antibodies, an animal wherein the antibody titer is noted is
selected from warm-blooded animals (e.g. mice) immunized with
antigens, then spleen or lymph node is collected after two to five
days from the final immunization and antibody-producing cells
contained therein are fused with myeloma cells to give monoclonal
antibody-producing hybridomas. Measurement of the antibody titer in
antisera may, for example, be carried out by reacting a labeled
ligand polypeptide or a labeled G protein-coupled receptor protein
(which will be mentioned later) with the antiserum followed by
measuring the binding activity of the labeling agent with the
antibody. The operation for fusing may be carried out, for example,
by a method of Koehler and Milstein (Nature, 256, 495, 1975),
Examples of the fusion accelerator are polyethylene glycol (PEG),
Sendai virus, etc. and the use of PEG is preferred.
[0334] Examples of the myeloma cells are NS-1, P3U1, SP2/0, AP-1,
etc. and the use of P3U1 is preferred. The preferred fusion ratio
of the numbers of antibody-producing cells used (spleen cells) to
the numbers of myeloma cells is within a range of about 1:1 to
20:1. When PEG (preferably, PEG 1000 to PEG 6000) is added in a
concentration of about 10-80% followed by incubating at
20-40.degree. C. (preferably, at 30-37.degree. C.) for one to ten
minutes, an efficient cell fusion can be carried out.
[0335] Various methods may be applied for screening a hybridoma
which produces anti-ligand polypeptide antibody or anti-G
protein-coupled receptor antibody. For example, a supernatant
liquid of hybridoma culture is added to a solid phase (e.g.
microplate) to which the ligand polypeptide antigen or the G
protein-coupled receptor protein antigen is adsorbed either
directly or with a carrier, then anti-immunoglobulin antibody
(anti-mouse immunoglobulin antibody is used when the cells used for
the cell fusion are those of mouse) which is labeled with a
radioactive substance, an enzyme or the like, or protein A is added
thereto and then anti-ligand polypeptide monoclonal antibodies or
anti-G protein-coupled receptor monoclonal antibodies bound on the
solid phase are detected; or a supernatant liquid of the hybridoma
culture is added to the solid phase to which anti-immunoglobulin or
protein A is adsorbed, then the ligand polypeptide or the G
protein-coupled receptor labeled with a radioactive substance or an
enzyme is added and anti-ligand polypeptide or anti-G
protein-coupled receptor monoclonal antibodies bonded with the
solid phase is detected.
[0336] Selection and cloning of the anti-ligand polypeptide
monoclonal antibody- or the anti-G protein-coupled receptor
monoclonal antibody-producing hybridoma may be carried out by
methods per se known to those of skill in the art or methods
similar thereto. Usually, it is carried out in a medium for animal
cells, containing HAT (hypoxanthine, aminopterin and thymidine).
With respect to a medium for the selection, for the cloning and for
the growth, any medium may be used so far as hybridoma is able to
grow therein. Examples of the medium are an RPMI 1640 medium
(Dainippon Pharmaceutical Co., Ltd., Japan) containing 1-20%
(preferably 10-20%) of fetal calf serum (FCS), a GIT medium (Wako
Pure Chemical, Japan) containing 1-20% of fetal calf serum and a
serum-free medium for hybridoma culturing (SFM-101; Nissui Seiyaku,
Japan). The culturing temperature is usually 20-40.degree. C. and,
preferably, about 37.degree. C. The culturing time is usually from
five days to three weeks and, preferably, one to two weeks. The
culturing is usually carried out in 5% carbon dioxide gas. The
antibody titer of the supernatant liquid of the hybridoma culture
may be measured by the same manner as in the above-mentioned
measurement of the antibody titer of the anti-ligand polypeptide or
the anti-G protein-coupled receptor in the antiserum.
[0337] (b) Purification of the Monoclonal Antibody.
[0338] Like in the separation/purification of conventional
polyclonal antibodies, the separation/purification of the
anti-ligand polypeptide monoclonal antibody or the anti-G
protein-coupled receptor monoclonal antibody may be carried out by
methods for separating/purifying immunoglobulin such as
salting-out, precipitation with an alcohol, isoelectric
precipitation, electrophoresis, adsorption/deadsorption using ion
exchangers such as DEAE, ultracentrifugation, gel filtration,
specific purifying methods in which only an antibody is collected
by treatment with an active adsorbent such as an antigen-binding
solid phase, protein A or protein G and the bond is dissociated
whereupon the antibody is obtained.
[0339] The ligand polypeptide antibody or the G protein-coupled
receptor antibody which is manufactured by the aforementioned
method (a) or (b) is capable of specifically recognizing ligand
polypeptide or G protein-coupled receptors and, accordingly, it can
be used for a quantitative determination of the ligand polypeptide
or the G protein-coupled receptor in test liquid samples and
particularly for a quantitative determination by sandwich
immunoassays.
[0340] Thus, the present invention provides, for example, the
following methods:
[0341] (i) a quantitative determination of a ligand polypeptide or
a G protein-coupled receptor in a test liquid sample, which
comprises
[0342] (a) competitively reacting the test liquid sample and a
labeled ligand polypeptide or a labeled G protein-coupled receptor
with an antibody which reacts with the ligand polypeptide or the G
protein-coupled receptor, and
[0343] (b) measuring the ratio of the labeled ligand polypeptide or
the labeled G protein-coupled receptor binding with said antibody;
and
[0344] (ii) a quantitative determination of a ligand polypeptide or
a G protein-coupled receptor in a test liquid sample, which
comprises
[0345] (a) reacting the test liquid sample with an antibody
immobilized on an insoluble carrier and a labeled antibody
simultaneously or continuously, and
[0346] (b) measuring the activity of the labeling agent on the
insoluble carrier
[0347] wherein one antibody is capable of recognizing the
N-terminal region of the ligand polypeptide or the G
protein-coupled receptor while another antibody is capable of
recognizing the C-terminal region of the ligand polypeptide or the
G protein-coupled receptor.
[0348] When the monoclonal antibody of the present invention
recognizing a ligand polypeptide or G protein-coupled receptor
(hereinafter, may be reffered to as "anti-ligand polypeptide or
anti-G protein-coupled receptor antibody") is used, ligand
polypeptide or G protein-coupled receptors can be measued and,
moreover, can be detected by means of a tissue staining, etc. as
well. For such an object, antibody molecules per se may be used or
F(ab').sub.2 Fab' or Fab fractions of the antibody molecule may be
used too. There is no particular limitation for the measuring
method using the antibody of the present invention and any
measuring method may be used so far as it relates to a method in
which the amount of antibody, antigen or antibody-antigen complex,
depending on or corresponding to the amount of antigen, e.g. the
amount of ligand polypeptide or G protein-coupled receptor, etc. in
the liquid sample to be measured, is detected by a chemical or a
physical means and then calculated using a standard curve prepared
by a standard solution containing the known amount of antigen. For
exmaple, nephrometry, competitive method, immunometric method and
sanwich method are suitably used and, in terms of sensitivity and
specificity, the sandwich method which will be described herein
later is particularly preferred.
[0349] Examples of the labeling agent used in the measuring method
using the labeling substance are radioisotopes, enzymes,
fluorescent substances, luminescent substances, colloids, magnetic
substances, etc. Examples of the radioisotope are [.sup.125 I],
[.sup.131I], [.sup.3H] and [.sup.14C]; preferred examples of the
enzyme are those which are stable and with big specific activity,
such as .beta.-galactosidase, .beta.-glucosidase, alkali
phosphatase, peroxidase and malate dehydrogenase; examples of the
fluorescent substance are fluorescamine, fluorescein
isothiocyanate, etc.; and examples of the luminescent substance are
luminol, luminol derivatives, luciferin, lucigenin, etc. Further, a
biotin-avidin system may also be used for binding an antibody or
antigen with a labeling agent.
[0350] In an insolubilization (immobilization) of antigens or
antibodies, a physical adsorption may be used or a chemical binding
which is usually used for insolubilization or immobilization of
proteins or enzymes may be used as well. Examples of the carrier
are insoluble polysaccharides such as agarose, dextran and
cellulose; synthetic resins such as polystyrene polyacrylamide and
silicone; glass; etc.
[0351] In a sandwich (or two-site) method, the test liquid is made
to react with an insolubilized anti-ligand polypeptide or anti-G
protein-coupled receptor antibody (the first reaction), then it is
made to react with a labeled anti-ligand polypeptide or a labeled
anti-G protein-coupled receptor antibody (the second reaction) and
the activity of the labeling agent on the insoluble carrier is
measued whereupon the amount of the ligand polypeptide or the G
protein-coupled receptor in the test liquid can be determined. The
first reaction and the second reaction may be conducted reversely
or simultaneously or they may be conducted with an interval. The
type of the labeling agent and the method of insolubilization
(immobilization) may be the same as those mentioned already herein.
In the immunoassay by means of a sandwich method, it is not always
necessary that the antibody used for the labeled antibody and the
antibody for the solid phase is one type or one species but, with
an object of improving the measuring sensitivity, etc., a mixture
of two or more antibodies may be used too.
[0352] In the method of measuring ligand polypeptide or G
protein-coupled receptors by the sandwich method of the present
invention, the preferred anti-ligand polypeptide antibodies or
anti-G protein-coupled receptor antibodies used for the first and
the second reactions are antibodies wherein their sites binding to
the ligand polypeptide or the G protein-coupled receptors are
different each other. Thus, the antibodies used in the first and
the second reactions are those wherein, when the antibody used in
the second reaction recognizes the C-terminal region of the ligand
polypeptide or the G protein-coupled receptor, then the antibody
recognizing the site other than C-terminal regions, e.g.
recognizing the N-terminal region, is preferably used in the first
reaction.
[0353] The anti-ligand polypeptide antibody or the anti-G
protein-coupled receptor antibody of the present invention may be
used in a measuring system other than the sandwich method such as a
competitive method, an immunometric method and a naphrometry. In a
competitive method, an antigen in the test solution and a labeled
antigen are made to react with an antibody in a competitive manner,
then an unreacted labeled antigen (F) and a labeled antigen binding
with an antibody (B) are separated (i.e. B/F separation) and the
labeled amount of any of B and F is measured whereupon the amount
of the antigen in the test solution is determined. With respect to
a method for such a reaction, there are a liquid phase method in
which a soluble antibody is used as the antibody and the B/F
separation is conducted by polyethylene glycol, a second antibody
to the above-mentioned antibody, etc.; and a solid phase method in
which an immobilized antibody is used as the first antibody or a
soluble antibody is used as the first antibody while an immobilized
antibody is used as the second antibody.
[0354] In an immunometric method, an antigen in the test solution
and an immobilized antigen are subjected to a competitive reaction
with a certain amount of a labeled antibody followed by separating
into solid and liquid phases; or the antigen in the test solution
and an excess amount of labeled antibody are made to react, then a
immobilized antigen is added to bind an unreacted labeled antibody
with the solid phase and separated into solid and liquid phases.
After that, the labeled amount of any of the phases is measured to
determine the antigen amount in the test solution.
[0355] In a nephrometry, the amount of insoluble sediment which is
produced as a result of the antigen-antibody reaction in a gel or
in a solution is measured. Even when the antigen amount in the test
solution is small and only a small amount of the sediment is
obtained, a laser nephrometry wherein scattering of laser is
utilized can be suitably used.
[0356] In applying each of those immunological measuring methods
(immunoassays) to the measuring method of the present invention, it
is not necessary to set up any special condition, operation, etc.
therefor. A measuring system (assay system) for ligand polypeptide
or G protein-coupled receptor may be constructed taking the
technical consideration of the persons skilled in the art into
consideration in the conventional conditions and operations for
each of the methods. With details of those conventional technical
means, a variety of reviews, reference books, etc. may be referred
to. They are, for example, Hiroshi Irie (ed): "Radioimmunoassay"
(Kodansha, Japan, 1974); Hiroshi Irie (ed): "Radioimmunoassay;
Second Series" (Kodansha, Japan, 1979); Eiji Ishikawa et al. (ed):
"Enzyme Immunoassay" (Igaku Shoin, Japan, 1978); Eiji Ishikawa et
al. (ed): "Enzyme-Immunoassay" (Second Edition) (Igaku Shoin,
Japan, 1982); Eiji Ishikawa et al. (ed): "Enzyme Immunoassay"
(Third Edition) (Igaku Shoin, Japan, 1987); "Methods in Enzymology"
Vol. 70 (Immunochemical Techniques (Part A)); ibid. Vo. 73
(Immunochemical Techniques (Part B)); ibid. Vo. 74 (Immunochemical
Techniques (Part C)); ibid. Vo. 84 (Immunochemical Techniques (Part
D: Selected Immunoassays)); ibid. Vol. 92 (Immunochemical
Techniques (Part E: Monoclonal Antibodies and General Immunoassay
Methods)); ibid. Vol. 121 (Immunochemical Techniques (Part I:
Hybridoma Technology and Monoclonal Antibodies)) (Academic Press);
etc.
[0357] As such, the amount of ligand polypeptide or G
protein-coupled receptor proteins can now be determined with a high
precision using the anti-ligand polypeptide or the anti-G
protein-coupled receptor antibody of the present invention.
[0358] In the specification and drawings of the present
application, the abbreviations used for bases (nucleotides), amino
acids and so forth are those recommended by the IUPAC-IUB
Commission on Biochemical Nomenclature or those conventionally used
in the art. Examples thereof are given below. Amino acids for which
optical isomerism is possible are, unless otherwise specified, in
the L form.
[0359] DNA: Deoxyribonucleic acid
[0360] cDNA: Complementary deoxyribonucleic acid
[0361] A: Adenine
[0362] T: Thymine
[0363] G: Guanine
[0364] C: Cytosine
[0365] RNA: Ribonucleic acid
[0366] mRNA: Messenger ribonucleic acid
[0367] DATP: Deoxyadenosine triphosphate
[0368] dTTP: Deoxythymidine triphosphate
[0369] dGTP: Deoxyguanosine triphosphate
[0370] dCTP: Deoxycytidine triphosphate
[0371] ATP: Adenosine triphosphate
[0372] EDTA: Ethylenediamine tetraacetic acid
[0373] SDS: Sodium dodecyl sulfate
[0374] EIA: Enzyme Immunoassay
[0375] G, Gly: Glycine (or Glycyl)
[0376] A, Ala: Alanine (or Alanyl)
[0377] V, Val: Valine (or Valyl)
[0378] L, Leu: Leucine (or Leucyl)
[0379] I, Ile: Isoleucine (or Isoleucyl)
[0380] S, Ser: Serine (or Seryl)
[0381] T, Thr: Threonine (or Threonyl)
[0382] C, Cys: Cysteine (or Cysteinyl)
[0383] M, Met: Methionine (or Methionyl)
[0384] E, Glu: Glutamic acid (or Glutamyl)
[0385] D, Asp: Aspartic acid (or Aspartyl)
[0386] K, Lys: Lysine (or Lysyl)
[0387] R, Arg: Arginine (or Arginyl)
[0388] H, His: Histidine (or Histidyl)
[0389] F, Phe: Phenylalamine (or Phenylalanyl)
[0390] Y, Tyr: Tyrossine (or Tyrosyl)
[0391] W, Trp: Tryptophan (or Tryptophanyl)
[0392] P, Pro: Proline (or Prolyl)
[0393] N, Asn: Asparagine (or Asparaginyl)
[0394] Q, Gln: Glutamine (or Glutaminyl)
[0395] pGlu: Pyroglutamic acid (or Pyroglutamyl)
[0396] Me: Methyl
[0397] Et: Ethyl
[0398] Bu: Butyl
[0399] Ph: Phenyl
[0400] TC: Thiazolidinyl-4(R)-carboxamide
[0401] In this specification, substitutions, protective groups and
reagents commonly used are indicated by the following
abbreviations:
[0402] BHA: benzhydrylamine
[0403] PMBHA: p-methylbenzhydrylamine
[0404] Tos: p-toluenesulfonyl
[0405] CHO: formyl
[0406] HONB: N-hydroxy-5-norbornene-2,3-dicarboxyimide
[0407] OcHex: cyclohexyl ester
[0408] Bzl: benzyl
[0409] Bom: benzyloxymethyl
[0410] Br-Z: 2-bromobenzyloxycarbonyl
[0411] Boc: t-butoxycarbonyl
[0412] DCM: dichloromethane
[0413] HOBt: 1-hydroxybenztriazole
[0414] DCC: N,N'-dicyclohexylcarbodiimide
[0415] TFA: trifluoro acetate
[0416] DIEA: diisopropylethylamine
[0417] Fmoc: N-9-fluorenylmethoxycarbonyl
[0418] DNP: dinitrophenyl
[0419] Bum: t-butoxymethyl
[0420] Trt: trityl
[0421] Each SEQ ID NO set forth in the SEQUENCE LISTING of the
specification refers to the following sequence:
[0422] [SEQ ID NO:1] is an entire amino acid sequence of the bovine
pituitary-derived ligand polypeptide encoded by the cDNA included
in pBOV3.
[0423] [SEQ ID NO:2] is an entire nucleotide sequence of the bovine
pituitary-derived ligand polypeptide cDNA.
[0424] [SEQ ID NO:3] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide which was obtained by
purification and analysis of N-terminal sequence for P-3 fraction.
The amino acid sequence corresponds to 23rd to 51st positions of
the amino acid sequence of SEQ ID NO:1.
[0425] [SEQ ID NO:4] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide which was obtained by
purification and analysis of N-terminal sequence for P-2 fraction.
The amino acid sequence corresponds to 34th to 52nd positions of
the amino acid sequencce of SEQ ID NO:1.
[0426] [SEQ ID NO:5] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide. The amino acid sequence
corresponds to 23rd to 53rd positions of the amino acid sequence of
SEQ ID NO:1.
[0427] [SEQ ID NO:6] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide. The amino acid sequence
corresponds to 23rd to 54th positions of the amino acid sequence of
SEQ ID NO:1.
[0428] [SEQ ID NO:7] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide. The amino acid sequence
corresponds to 23rd to 55th positions of the amino acid sequence of
SEQ ID NO:1.
[0429] [SEQ ID NO:8] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide. The amino acid sequence
corresponds to 34th to 53rd positions of the amino acid sequence of
SEQ ID NO:1.
[0430] [SEQ ID NO:9] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide. The amino acid sequence
corresponds to 34th to 54th positions of the amino acid sequence of
SEQ ID NO:1.
[0431] [SEQ ID NO:10] is an amino acid sequence of the bovine
pituitary-derived ligand polypeptide. The amino acid sequence
corresponds to 34th to 55th positions of the amino acid sequence of
SEQ ID NO:1.
[0432] [SEQ ID NO:11] is a nucleotide sequence of DNA coding for
the bovine pituitary-derived ligand polypeptide (SEQ ID NO:3).
[0433] [SEQ ID NO:12] is a nucleotide sequence of DNA coding for
the bovine pituitary-derived ligand polypeptide (SEQ ID NO:4).
[0434] [SEQ ID NO:13] is a nucleotide sequence of DNA coding for
the bovine pituitary-derived ligand polypeptide (SEQ ID NO:5).
[0435] [SEQ ID NO:14] is a nucleotide sequence of DNA coding for
the bovine pituitary-derived ligand polypeptide (SEQ ID NO:6).
[0436] [SEQ ID NO:15] is a nucleotide sequence of DNA coding for
the bovine pituitary-derived ligand polypeptide (SEQ ID NO:7).
[0437] [SEQ ID NO:16] is a nucleotide sequence of DNA coding for
the bovine pituitary-derived ligand polypeptide (SEQ ID NO:8).
[0438] [SEQ ID NO:17] is a nucleotide sequence of DNA coding for
the bovine pituitary derived ligand polypeptide (SEQ ID NO:9).
[0439] [SEQ ID NO:18] is a nucleotide sequence of DNA coding for
the bovine pituitary-derived ligand polypeptide (SEQ ID NO:10).
[0440] [SEQ ID NO:19] is a partial amino acid sequence of the human
pituitary-derived G protein-coupled receptor protein encoded by the
human pituitary-derived G protein-coupled receptor protein cDNA
fragment included in p19P2.
[0441] [SEQ ID NO:20] is a partial amino acid sequence of the human
pituitary-derived G protein-coupled receptor protein encoded by the
human pituitary-derived G protein-coupled receptor protein cDNA
fragment include in p19P2.
[0442] [SEQ ID NO:21] is an entire amino acid sequence of the human
pituitary-derived G protein-coupled receptor protein encoded by the
human pituitary-derived G protein-coupled receptor protein cDNA
include in phGR3.
[0443] [SEQ ID NO:22] is a partial amino acid sequence of the mouse
pancreatic .beta.-cell line, MIN6-derived G protein-coupled
receptor protein encoded by the mouse pancreatic .beta.-cell line,
MIN6-derived G protein-coupled receptor protein cDNA fragment
having a nucleotide sequence (SEQ ID NO:27), derived based upon the
nucleotide sequences of the mouse pancreatic .beta.-cell line,
MIN6-derived G protein-coupled receptor protein cDNA fragments each
included in pG3-2 and pG1-10.
[0444] [SEQ ID NO:23] is a partial amino acid sequence of the mouse
pancreatic .beta.-cell line, MIN6-derived G protein-coupled
receptor protein encoded by p5S38.
[0445] [SEQ ID NO:24] is a nucleotide sequence of the human
pituitary-derived G protein-coupled receptor protein cDNA fragment
include in p19P2.
[0446] [SEQ ID NO:25] is a nucleotide sequence of the human
pituitary-derived G protein-coupled receptor protein cDNA fragment
include in p19P2.
[0447] [SEQ ID NO:26] is an entire nucleotide sequence of the human
pituitary-derived G protein-coupled receptor protein cDNa include
in phGR3.
[0448] [SEQ ID NO:27] is a nucleotide sequence of the mouse
pancreatic .beta.-cell line, MIN6-derived G protein-coupled
receptor protein cDNA, derived based upon the nucleotide sequences
of the mouse pancreatic .beta.-cell line, MIN6-derived G
protein-coupled receptor protein cDNA fragments each included in
pG3-2 and pG1-10.
[0449] [SEQ ID NO: 28] is a nucleotide sequence of the mouse
pancreatic .beta.-cell line, MIN6-derived G protein-coupled
receptor protein cDNA include in p5S38.
[0450] [SEQ ID NO:29] is a synthetic DNA primer for screening of
cDNA coding for the G protein-coupled receptor protein.
[0451] [SEQ ID NO:30] is a synthetic DNA primer for screening of
cDNA coding for the G protein-coupled receptor protein.
[0452] [SEQ ID NO:31] is a synthetic DNA primer for screening of
cDNA coding for the G protein-coupled receptor protein.
[0453] [SEQ ID NO:32] is a synthetic DNA primer for screening of
cDNA coding for the G protein-coupled receptor protein.
[0454] [SEQ ID NO:33] is a synthetic DNA primer for screening of
cDNA coding for the G protein-coupled receptor protein.
[0455] [SEQ ID NO:34] is a synthetic DNA primer for screening of
cDNA coding for the G protein-coupled receptor protein.
[0456] [SEQ ID NO:35] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by P5-1.
[0457] [SEQ ID NO:36] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by P3-1.
[0458] [SEQ ID NO:37] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by P3-2.
[0459] [SEQ ID NO:38] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by PE.
[0460] [SEQ ID NO:39] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by PDN.
[0461] [SEQ ID NO:40] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by FB.
[0462] [SEQ ID NO:41] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by FC.
[0463] [SEQ ID NO:42] is a synthetic DNA primer for screening of
cDNA coding for the bovine-pituitary-derived ligand polypeptide,
wherein the primer is represented by BOVF.
[0464] [SEQ ID NO:43] is a synthetic DNA primer for screening of
cDNA coding for the bovine pituitary-derived ligand polypeptide,
wherein the primer is represented by BOVR.
[0465] [SEQ ID NO:44] is an entire amino acid sequence of the
bovine genome-derived ligand polypeptide.
[0466] [SEQ ID NO: 45] is an entire amino acid sequence of the rat
type ligand polypeptide encoded by the cDNA included in pRAV3.
[0467] [SEQ ID NO:46] is an entire nucleotide sequence of the rat
type ligand polypeptide cDNA.
[0468] [SEQ ID NO:47] is an amino acid sequence of the rat type
ligand polypeptide. The amino acid sequence corresponds to 22nd to
52nd positions of the amino acid sequence of SEQ ID NO:45.
[0469] [SEQ ID NO:48] is an amino acid sequence of the rat type
ligand polypeptide. The amino acid sequence corresponds to 22nd to
53rd positions of the amino acid sequence of SEQ ID NO:45.
[0470] [SEQ ID NO:49] is an amino acid sequence of the rat type
ligand polypeptide. The amino acid sequence corresponds to 22nd to
54th positions of the amino acid sequence of SEQ ID NO:45.
[0471] [SEQ ID NO:50] is an amino acid sequence of the rat type
ligand polypeptide. The amino acid sequence corresponds to 33rd to
52nd positions of the amino acid sequence of SEQ ID NO:45.
[0472] [SEQ ID NO:51] is an amino acid sequence of the rat type
ligand polypeptide. The amino acid sequence corresponds to 33rd to
53rd positions of the amino acid sequence of SEQ ID NO:45.
[0473] [SEQ ID NO:52] is an amino acid sequence of the rat type
ligand polypeptide. The amino acid sequence corresponds to 33rd to
54th positions of the amino acid sequence of SEQ ID NO.45.
[0474] [SEQ ID NO:53] is a nucleotide sequence encoding for the rat
type ligand polypeptide of SEQ ID NO:47.
[0475] [SEQ ID NO:54] is a nucleotide sequence encoding for the rat
type ligand polypeptide of SEQ ID NO:48.
[0476] [SEQ ID NO:55] is a nucleotide sequence encoding for the rat
type ligand polypeptide of SEQ ID NO:49.
[0477] [SEQ ID NO:56] is a nucleotide sequence encoding for the rat
type ligand polypeptide of SEQ ID NO:50.
[0478] [SEQ ID NO:57] is a nucleotide sequence encoding for the rat
type ligand polypeptide of SEQ ID NO:51.
[0479] [SEQ ID NO:58] is a nucleotide sequence encoding for the rat
type ligand polypeptide of SEQ ID NO:52.
[0480] [SEQ ID NO:59] is an entire amino acid sequence of the human
type ligand polypeptide encoded by the cDNA included in pHOB7.
[0481] [SEQ ID NO:60] is an entire nucleotide sequence of the human
type ligand polypeptide cDNA.
[0482] [SEQ ID NO:61] is an amino acid sequence of the human type
ligand polypeptide. The amino acid sequence corresponds to 23rd to
53rd positions of the amino acid sequence of SEQ ID NO.59.
[0483] [SEQ ID NO:62] is an amino acid sequence of the human type
ligand polypeptide. The amino acid sequence corresponds to 23rd to
54th positions of the amino acid sequence of SEQ ID NO.59.
[0484] [SEQ ID NO:63] is an amino acid sequence of the human type
ligand polypeptide. The amino acid sequence corresponds to 23rd to
55th positions of the amino acid sequence of SEQ ID NO.59.
[0485] [SEQ ID NO:64] is an amino acid sequence of the human type
ligand polypeptide. The amino acid sequence corresponds to 34th to
53rd positions of the amino acid sequence of SEQ ID NO.59.
[0486] [SEQ ID NO:65] is an amino acid sequence of the human type
ligand polypeptide. The amino acid sequence corresponds to 34th to
54th positions of the amino acid sequence of SEQ ID NO.59.
[0487] [SEQ ID NO:66] is an amino acid sequence of the human type
ligand polypeptide. The amino acid sequence corresponds to 34th to
55th positions of the amino acid sequence of SEQ ID NO.59.
[0488] [SEQ ID NO:67] is a nucleotide sequence encoding for the
human type ligand polypeptide of SEQ ID NO:61.
[0489] [SEQ ID NO:68] is a nucleotide sequence encoding for the
human type ligand polypeptide of SEQ ID NO:62.
[0490] [SEQ ID NO:69] is a nucleotide sequence encoding for the
human type ligand polypeptide of SEQ ID NO:63.
[0491] [SEQ ID NO:70] is a nucleotide sequence encoding for the
human type ligand polypeptide of SEQ ID NO:64.
[0492] [SEQ ID NO:71] is a nucleotide sequence encoding for the
human type ligand polypeptide of SEQ ID NO:65.
[0493] [SEQ ID NO:72] is a nucleotide sequence encoding for the
human type ligand polypeptide of SEQ ID NO:66.
[0494] [SEQ ID NO:73] is a partial amino acid sequence of the
ligand polypeptide, wherein Xaa of the 10th position is Ala or Thr,
Xaa of the 11th position is Gly or Ser and Xaa of the 21st position
is H, Gly or GlyArg.
[0495] [SEQ ID NO:74] is a partial amino acid sequence of the
ligand polypeptide, wherein Xaa of the 3rd position is Ala or Thr,
Xaa of the 5th position is Gln or Arg and Xaa of the 10th position
is Ile or Thr.
[0496] [SEQ ID NO:75] is a synthetic DNA primer for screening of
cDNA coding for the rat type ligand polypeptide, wherein the primer
is represented by RA.
[0497] [SEQ ID NO:76] is a synthetic DNA primer for screening of
cDNA coding for the rat type ligand polypeptide, wherein the primer
is represented by RC.
[0498] [SEQ ID NO:77] is a synthetic DNA primer for screening of
cDNA coding for the rat type ligand polypeptide, wherein the primer
is represented by rF.
[0499] [SEQ ID NO:78] is a synthetic DNA primer for screening of
cDNA coding for the rat type ligand polypeptide, wherein the primer
is represented by rR.
[0500] [SEQ ID NO:79] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by R1.
[0501] [SEQ ID NO:80] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by R3.
[0502] [SEQ ID NO:81] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by R4.
[0503] [SEQ ID NO:82] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by HA.
[0504] [SEQ ID NO:83] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by HB.
[0505] [SEQ ID NO:84] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by HE.
[0506] [SEQ ID NO:85] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by HF.
[0507] [SEQ ID NO:86] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by 5H.
[0508] [SEQ ID NO:87] is a synthetic DNA primer for screening of
cDNA coding for the human type ligand polypeptide, wherein the
primer is represented by 3HN.
[0509] [SEQ ID NO:88] is a synthetic DNA primer for screening of
cDNA coding for the rat type G protein-coupled receptor protein
(UHR-1), wherein the primer is represented by rRECF.
[0510] [SEQ ID NO:89] is a synthetic DNA primer for screening of
cDNA coding for the rat type G protein-coupled receptor protein
(UHR-1), wherein the primer is represented by rRECR.
[0511] [SEQ ID NO:90] is a synthetic DNA which is used for
amplification of G3PDH, UHR-1 and ligand, wherein the primer
represented by r19F.
[0512] [SEQ ID NO:91] is a synthetic DNA which is used for
amplification of G3PDH, UHR-1 and ligand, wherein the primer
represented by r19R.
[0513] [SEQ ID NO:92] is a N-terminal peptide of the ligand
polypeptide, which is used for antigen. (Peptide-I)
[0514] [SEQ ID NO:93] is a C-terminal peptide of the ligand
polypeptide, which is used for antigen. (Peptide-II)
[0515] [SEQ ID NO:94] is a peptide of the central portion in ligand
polypeptide, which is used for antigen. (Peptide-III)
[0516] [SEQ ID NO:95] is a synthetic DNA primer for screening of
cDNA coding for rat type G protein-coupled receptor protein
(UHR-1).
[0517] [SEQ ID NO:96] is a synthetic DNA primer for screening of
cDNA coding for rat type G protein-coupled receptor protein
(UHR-1).
[0518] The transformant Escherichia coli, designated
INV.alpha.F'/p19P2, which is obtained in the Example 2 mentioned
herein below, is on deposit under the terms of the Budapest Treaty
from Aug. 9, 1994, with the National Institute of Bioscience and
Human-Technology (NIBH), Agency of Industrial Science and
Technology, Ministry of International Trade and Industry, Japan and
has been assigned the Accession Number FERM BP-4776. It is also on
deposit from Aug. 22, 1994 with the Institute for Fermentation,
Osaka, Japan (IFO) and has been assigned the Accession Number IFO
15739.
[0519] The transformant Escherichia coli, designated
INV.alpha.F'/pG3-2, which is obtained in the Example 4 mentioned
herein below, is on deposit under the terms of the Budapest Treaty
from Aug. 9, 1994, with NIBH and has been assigned the Accession
Number FERM BP-4775. It is also on deposit from Aug. 22, 1994 with
IFO and has been assigned the Accession Number IFO 15740.
[0520] The transformant Escherichia coli, designated JM109/phGR3,
which is obtained in the Example 5 mentioned herein below, is on
deposit under the terms of the Budapest Treaty from Sep. 27, 1994,
with NIBH and has been assigned the Accession Number FERM BP-4807.
It is also on deposit from Sep. 22, 1994 with IFO and has been
assigned the Accession Number IFO 15748.
[0521] The transformant Escherichia coli, designated JM109/p5S38,
which is obtained in the Example 8 mentioned herein below, is on
deposit under the terms of the Budapest Treaty from Oct. 27, 1994,
with NIBH and has been assigned the Accession Number FERM BP-4856.
It is also on deposit from Oct. 25, 1994 with IFO and has been
assigned the Accession Number IFO 15754.
[0522] The transformant Escherichia coli, designated JM109/pBOV3,
which is obtained in the Example 20 mentioned herein below, is on
deposit under the terms of the Budapest Treaty from Feb. 13, 1996,
with NIBH and has been assigned the Accession Number FERM BP-5391.
It is also on deposit from Jan. 25, 1996 with IFO and has been
assigned the Accession Number IFO 15910.
[0523] The transformant Escherichia coli, designated JM109/pRAV3,
which is obtained in the Example 29 mentioned herein below, is on
deposit under the terms of the Budapest Treaty from Sep. 12, 1996,
with NIBH and has been assigned the Accession Number FERM BP-5665.
It is also on deposit from Sep. 3, 1996 with IFO and has been
assigned the Accession Number IFO 16012.
[0524] The transformant Escherichia coli, designated JM109/pHOV7,
which is obtained in the Example 32 mentioned herein below, is on
deposit under the terms of the Budapest Treaty from Sep. 12, 1996,
with NIBH and has been assigned the Accession Number FERM BP-5666.
It is also on deposit from Sep. 5, 1996 with IFO and has been
assigned the Accession Number IFO 16013.
Industrial Application
[0525] The bioactive substance of the present invention, namely the
ligand polypeptide or its amide or ester thereof, or a salt
thereof, a partial peptide thereof, or the DNA coding for said
ligand polypeptide, has function modulating activity for various
tissues or internal organs, e.g. heart, lung, liver, spleen,
thymus, kidney, adrenal glands, skeltal muscle, testis etc.,
besides pituitary, central nervous system or pancreas, and are
useful as medicines. Furthermore, the substance is useful for the
screening of agonists or antagonists of G protein-coupled receptor
proteins. The compounds which can be obtained by such screening
also have function modulating activity for above-described tissues
or internal organs, and are useful as medicines.
EXAMPLES
[0526] Described below are working examples of the present
invention which are provided only for illustrative purposes, and
not to limit the scope of the present invention.
REFERENCE EXAMPLE 1
[0527] Preparation of Synthetic DNA Primer for Amplifying DNA
Coding for G protein-coupled receptor Protein
[0528] A compariton of deoxyribonucleotide sequences coding for the
known amino acid sequences corresponding to or near the first
membrane-spanning domain each of human-derived TRH receptor protein
(HTRHR), human-derived RANTES receptor protein (L10918, HUMRANTES),
human Burkitt's lymphoma-derived unknown ligand receptor protein
(X68149, HSBLR1A), human-derived somatostatin receptor protein
(L14856, HUMSOMAT), rat-derived .mu.-opioid receptor protein
(U02083, RNU02083), rat-derived K-opioid receptor protein (U00442,
U00442), human-derived neuromedin B receptor protein (M734.82,
HUMNMBR), human-derived muscarinic acetylcholine receptor protein
(X15266, HSHM4), rat-derived adrenaline .alpha..sub.1B receptor
protein (L08609, RATAADRE01), human-derived somatostatin 3 receptor
protein (M96738, HUMSSTR3X), human-derived C.sub.5a receptor
protein (HUMC5AAR), human-derived unknown ligand receptor protein
(HUMRDC1A), human-derived unknown ligand receptor protein (M84605,
HUMOPIODRE) and rat-derived adrenaline .alpha..sub.2B receptor
protein (M91466, RATA2BAR) was made. As a result, highly homologous
regions or parts were found.
[0529] Further, a comparison of deoxynucleotide sequences coding
for the known amino acid sequences corresponding to or near the
sixth membrane-spanning domain each of mouse-derived unknown ligand
receptor protein (M80481, MUSGIR), human-derived bombesin receptor
protein (L08893, HUMBOMB3S), human-derived adenosine A2 receptor
protein (S46950, S46950), mouse-derived unknown ligand receptor
protein (D21061, MUSGPCR), mouse-derived TRH receptor protein
(S43387, S43387), rat-derived neuromedin K receptor protein
(J05189, RATNEURA), rat-derived adenosine A1 receptor protein.
(M69045, RATA1ARA), human-derived neurokinin A receptor protein
(M57414, HUMNEKAR), rat-derived adenosine A3 receptor protein
(M94152, DATADENREC), human-derived somatostatin 1 receptor protein
(M81829, HUMSRI1A), human-derived neurokinin 3 receptor protein
(S86390, S86371S4), rat-derived unknown ligand receptor protein
(X61496, RNCGPCR), human-derived somatostatin 4 receptor protein
(L07061, HUMSSTR4Z) and rat-derived GnRH receptor protein (M31670,
RATGNRHA) was made. As a result, highly homologous regions or parts
were found.
[0530] The aforementioned abbreviations in the parentheses are
identifiers (reference numbers) which are indicated when
GenBank/EMBL Data Bank is retrieved by using DNASIS Gene/Protein
Sequencing Data Base (CD019, Hitachi Software Engineering, Japan)
and are usually called "Accession Numbers" or "Entry Names". HTRHR
is, however, the sequence as disclosed in Japanese Patent
Publication No. 304797/1993 (EPA 638645).
[0531] Specifically, it was planned to incorporate mixed bases
relying upon the base regions that were in agreement with cDNAs
coding for a large number of receptor proteins in order to enhance
base agreement of sequences with as many receptor cDNAs as possible
even in other regions. Based upon these sequences, the degenerate
synthetic DNA having a nucleotide sequence represented by SEQ ID
NO:29 or SEQ ID NO:30 which is complementary to the homologous
nucleotide sequence were produced.
1 [Synthetic DNAs] 5'-CGTGG (G or C) C (A or C) T (SEQ ID NO: 29)
(G or C) (G or C) TGGGCAAC (A, G, C or T) (C or T) CCTG-3' 5'-GT
(A, G, C or T) G (A or T) (SEQ ID NO: 30) (A or G) (A or G) GGCA
(A, G, C or T) CCAGCAGA (G or T) GGCAAA-3'
[0532] The parentheses indicate the incorporation of a plurality of
bases, leading to multiple oligonucleotides in the primer
preparation. In other words, nucleotide resides in parentheses of
the aforementioned DNAs were incorporated in the presence of a
mixture of plural bases at the time of synthesis.
Example 1
[0533] Amplification of Receptor cDNA by PCR Using Human Pituitary
Gland-Derived cDNA
[0534] By using human pituitary gland-derived cDNA (QuickClone,
CLONTECH Laboratories, Inc.) as a template, PCR amplification using
the DNA primers synthesized in Reference Example 1 was carried out.
The composition of the reaction solution consisted of the synthetic
DNA primers (SEQ: 5' primer sequence and 3' primer sequence) each
in an amount of 1 .mu.M, 1 ng of the template cDNA, 0.25 mM dNTPs,
1 .mu.l of Taq DNA polymerase and a buffer attached to the enzyme
kit, and the total amount of the reaction solution was made to be
100 .mu.l. The cycle for amplification including 95.degree. C. for
1 min., 55.degree. C. for 1 min. and 72.degree. C. for 1 min. was
repeated 30 times by using a Thermal Cycler (Perkin-Elmer Co.).
Prior to adding Taq DNA polymerase, the remaining reaction solution
was mixed and was heated at 95.degree. C. for 5 minutes and at
65.degree. C. for 5 minutes. The amplified products were confirmed
relying upon 1.2% agarose gel electrophoresis and ethidium bromide
staining.
Example 2
[0535] Subcloning of PCR Product into Plasmid Vector and Selection
of Novel Receptor Candidate Clone Via Decoding Nucleotide Sequence
of Inserted cDNA Region
[0536] The PCR products were separated by using a 0.8% low-melting
temperature agarose gel, the band parts were excised from the gel
with a razor blade, and were heat-melted, extracted with phenol and
precipitated in ethanol to recover DNAs. According to the protocol
attached to a TA Cloning Kit (Invitrogen Co.), the recovered DNAs
were subcloned into the plasmid vector, pCR.TM.II (TM represents
registered trademark). The recombinant vectors were introduced into
E. coli INV.alpha.F' competent cells (Invitrogen Co.) to produce
transformants. Then, transformant clones having a cDNA-inserted
fragment were selected in an LB agar culture medium containing
ampicillin and X-gal. Only transformant clones exhibiting white
color were picked with a sterilized toothstick to obtain
transformant Escherichia coli INV.alpha.F'/p19P2.
[0537] The individual clones were cultured overnight in an LB
culture medium containing ampicillin and treated with an automatic
plasmid extracting machine (Kurabo Co., Japan) to prepare plasmid
DNAS. An aliquot of the DNA thus prepared was cut by EcoRI to
confirm the size of the cDNA fragment that was inserted. An aliquot
of the remaining DNA was further processed with RNase, extracted
with phenol/chloroform, and precipitated in ethanol so as to be
condensed. Sequencing was carried out by using a DyeDeoxy
terminator cycle sequencing kit (ABI Co.), the DNAs were decoded by
using a fluorescent automatic sequencer, and the data of the
nucleotide sequences obtained were read by using DNASIS (Hitachi
System Engineering Co., Japan). The underlined portions represent
regions corresponding to the synthetic primers.
[0538] Homology retrieval was carried out based upon the determined
nucleotide sequences [SEQ ID NO:24 and 25 (Here, the determined
nucleotide sequence is the nucleotide sequence which the underlined
portion is deleted from the sequence of FIG. 1 or FIG. 2
respectively)].
[0539] As a result, it was learned that a novel G protein-coupled
receptor protein was encoded by the cDNA fragment insert in the
plasmid, p19P2, possessed by the transformant Escherichia coli
INV.alpha.F'/p19P2. To further confirm this fact, by using DNASIS
(Hitachi System Engineering Co., Japan) the nucleotide sequences
were converted into amino acid sequences [SEQ ID NO:19 and 20], and
homology retrieval was carried out in view of hydrophobicity
plotting [FIGS. 3 and 4] and at the amino acid sequence level to
find homology relative to neuropeptide Y receptor proteins [FIG.
5].
Example 3
[0540] Preparation of Poly(A).sup.+RNA Fraction from Mouse
Pancreatic .beta.-Cell Strain, MIN6 and Synthesis of cDNA
[0541] A total RNA was prepared from the mouse pancreatic
.beta.-cell strain, MIN6 (Jun-ichi Miyazaki et al., Endocrinology,
Vol. 127, No. 1, p. 126-132) according to the guanidine thiocyanate
method (Kaplan B. B. et al., Biochem. J., 183, 181-184 (1979) and,
then, poly(A).sup.+RNA fractions were prepared with a mRNA
purifying kit (Pharmacia Co.). Next, to 5 .mu.g of the
poly(A).sup.+RNA fraction was added a random DNA hexamer (BRL Co.)
as a primer, and the resulting mixture was subjected to reaction
with mouse Moloney Leukemia virus (MMLV) reverse transcriptase (BRL
Co.) in the buffer attached to the MMLV reverse transcriptase kit
to synthesize complementary DNAs. The reaction product was
extracted with phenol/chloroform (1:1), precipitated in ethanol,
and was then dissolved in 30 .mu.l of TE buffer (10 mM Tris-HCL at
pH8.0, 1 mM EDTA at pH8.0).
Example 4
[0542] Amplification of Receptor cDNA by PCR Using MIN6-Derived
cDNA and Sequencing
[0543] By suing, as a template, 5 .mu.l of cDNA prepared from the
mouse pancreatic .beta.-cell strain, MIN6 in the above Example 3,
PCR amplification using the DNA primers synthesized in Reference
Example 1 was carried out under the same condition as in Example 1.
The resulting PCR product was subcloned into the plasmid vector,
pCR.TM.II, in the same manner as in Example 2 to obtain a plasmid,
pG3-2. The plasmid pG3-2 was transfected into E. coli INV.alpha.F'
to obtain transformed Escherichia coli INV.alpha.F'/pG3-2.
[0544] By using, as a template, 5 .mu.l of the cDNA parepared from
the mouse pancreatic .beta.-cell strain, MIN6, PCR amplification
using DNA primers as disclosed in Libert F. et al., "Science, 244:
569-572, 1989", i.e., a degenerate synthetic primer represented by
the following sequence:
2 5'-CTGTG (C or T) G (C or T) (G (SEQ ID NO: 31) or C) AT (C or T)
GCIIT (G or T) GA (C or T) (A or C) G (G or C) TAC-3'
[0545] wherein I is inosine; and
[0546] a degenerate synthetic primer represented by the following
sequence:
3 5'-A (G or T) G (A or T) AG (A or (SEQ ID NO: 32) T)
AGGGCAGCCAGCAGAI (G or C) (A or G) (C or T) GAA-3'
[0547] wherein I is inosine,
[0548] was carried out under the same conditions as in Working
Example 1. The resulting PCR product was subcloned into the plasmid
vector, pCR.TM.II, in the same manner as described in Example 2 to
obtain a plasmid, pG1-10.
[0549] The reaction for determining the nucleotide sequence
(sequencing) was carried out with a DyeDeoxy terminator cycle
sequencing kit (ABI Co.), the DNA was decoded with the fluorescent
automatic sequencer (ABI Co.), and the data of the nucleotide
sequence obtained were analyzed with DNASIS (Hitachi System
Engineering Co., Japan).
[0550] FIG. 6 shows a mouse pancreatic .beta.-cell strain
MIN6-derived G protein-coupled receptor protein-encoding DNA (SEQ
ID NO:27) and an amino acid sequence (SEQ ID NO:22) encoded by the
isolated DNA based upon the nucleotide sequences of plasmids pG3-2
and pG1-10 which are held by the transformant Escherichia coli
INV.alpha.F'/pG3-2. The underlined portions represent regions
corresponding to the synthetic primers.
[0551] Homology retrieval was carried out based upon the determined
necleotide sequence [FIG. 6]. As a result, it was learned that a
novel G protein-coupled receptor protein was encoded by the cDNA
fragment obtained. To further confirm this fact, by using DNASIS
(Hitachi System Engineering Co., Japan) the nucleotide sequence was
converted into an amino acid sequence [FIG. 6], hydrophobicity
plotting was carried out to confirm the presence of six hydrophobic
regions [FIG. 8]. Upon comparing the amino acid sequence with that
of p19P2 obtained in Example 2, furthermore, a high degree of
homology was found as shown in [FIG. 7]. As a result, it is
strongly suggested that the G protein-coupled receptor proteins
encoded by pG3-2 and pG1-10 recognize the same ligand as the G
protein-coupled receptor protein encoded by p19P.sup.2 does while
the animal species from which the receptor proteins encoded by
pG3-2 and pG1-10 are derived is different from that from which the
receptor protein encoded by p19P2 is.
Example 5
[0552] Cloning of cDNA Comprising Whole Coding Regions for Receptor
Protein from Human Pituitary Gland-Derived cDNA Library
[0553] The DNA library constructed by Clontech Co. wherein .lambda.
gt11 phage vector is used (CLONTECH Laboratories, Inc.; CLH L1139b)
was employed as a human pituitary gland-derived cDNA library. The
human pituitary gland cDNA library (2.times.10.sup.6 pfu (plaque
forming units)) was mixed with E. coli Y1090 treated with magnesium
sulfate, and incubated at 37.degree. C. for 15 minutes followed by
addition of 0.5% agarose (Pharmacia Co.) LB. The E. coli was plated
onto a 1.5% agar (Wako-Junyaku Co.) LB plate (containing 50
.mu.g/ml of ampicillin). A nitrocellulose filter was placed on the
plate on which plaques were formed and the plaque was transferred
onto the filter. The filter was denatured with an alkali and then
heated at 80.degree. C. for 3 hours to fix DNAs.
[0554] The filter was incubated overnight at 42.degree. C. together
with the probe mentioned herein below in a buffer containing 50%
formamide, 5.times.SSPE (20.times.SSPE (pH 7.4) is 3 M NaCl, 0.2 M
NaH.sub.2PO.sub.4H.sub.2O, 25 mM EDTA), 5.times. Denhardt's
solution (Nippon Gene, Japan), 0.1% SDS and 100 .mu.g/ml of salmon
sperm DNA for hybridization.
[0555] The probe used was obtained by cutting the DNA fragment
inserted in the plasmid, p19P2, obtained in Working Example 2, with
EcoRI, followed by recovery and labelling by incorporation of
[.sup.32P]dCTP (Dupont Co.) with a random prime DNA labelling kit
(Amasham Co.).
[0556] It was washed with 2.times.SSC (20.times.SSC is 3 M NaCl,
0.3 M sodium citrate), 0.1% SDS at 55.degree. C. for 1 hour and,
then, subjected to an autoradiography at -80.degree. C. to detect
hybridized plaques.
[0557] In this screening, hybridization signals were recognized in
three independent plaques. Each DNA was prepared from the three
clones. The DNAs digested with EcoRI were subjected to an agarose
electrophoresis and were analyzed by the southern blotting using
the same probe as the one used in the screening. Hybridizing bands
were identified at about 0.7 kb, 0.8 kb and 2.0 kb, respectively.
Among them, the DNA fragment corresponding to the band at about 2.0
kb (.lambda. hGR3) was selected. The .lambda. hGR3-derived EcoRI
fragment with a hybridizable size was subcloned to the EcoRI site
of the plasmid, pUC18, and E. coli JM109 was transformed with the
plasmid to obtain transformant E. coli JM109/phGR3. A restriction
enzyme map of the plasmid, phGR3, was prepared relying upon a
restriction enzyme map deduced from the nucleotide sequence as
shown in Example 2. As a result, it was learned that it carried a
full-length receptor protein-encoding DNA which was predicted from
the receptor protein-encoding DNA as shown in Example 2.
Example 6
[0558] Sequencing of Human Pituitary Gland-Derived Receptor Protein
cDNA
[0559] Among the EcoRI fragments inserted in the plasmid, phGR3,
obtained in the above Example 5, the from EcoRI to NheI nucleotide
sequence with about 1330 bp that is considered to be a receptor
protein-coding region was sequenced. Concretely speaking, by
utilizing restriction enzyme sites that exist in the EcoRI
fragments, unnecessary parts were removed or necessary fragments
were subcloned in order to prepare template plasmids for analyzing
the nucleotide sequence.
[0560] The reaction for determining the nucleotide sequence
(sequencing) was carried out with a DyeDeoxy terminator cycle
sequencing kit (ABI Co.), the DNA was decoded with the fluorescent
automatic sequencer (ABI Co.), and the data of the nucleotide
sequence obtained were analyzed with DNASIS (Hitachi System
Engineering Co., Japan).
[0561] FIG. 9 shows a nucleotide sequence of from immediate after
the EcoRI site up to the NheI site encoded by phGR3. The nucleotide
sequence of the human pituitary gland-derived receptor
protein-encoding DNA corresponds to the nucleotide sequence (SEQ ID
NO:26) of from 118th to 1227th nucleotides (FIG. 9). An amino acid
sequence of the receptor protein that is encoded by the nucleotide
sequence is shown in SEQ ID NO:21.
Example 7
[0562] Northern Hybridization with Human Pituitary Gland-Derived
Receptor Protein-Encoding phGR3
[0563] Northern blotting was carried out in order to detect the
expression of phGR3-encoded human pituitary gland-derived receptor
proteins obtained in Example 5 in the pituitary gland at a mRNA
level. Human pituitary gland mRNA (2.5 .mu.g, Clontech Co.) was
used as a template mRNA and the same as the probe used in Working
Example 5 was used as a probe. Nylon membrane (Pall Biodyne,
U.S.A.) was used as a filter for northern blotting and migration of
the mRNA and adsorption (sucking) thereof with the blotting filter
was carried out according to the method as disclosed in Molecular
Cloning, Cold Spring Harbor Laboratory Press, 1989.
[0564] The hybridization was effected by incubating the
above-mentioned filter and probe in a buffer containing 50%
formamide, 5.times.SSPE, 5.times. Denhardt's solution, 0.1% SDS and
100 .mu.g/ml of salmon sperm DNA overnight at 42.degree. C. The
filter was washed with 0.1.times.SSC, 0.1% SDS at 50.degree. C.
and, after drying with an air, was exposed to an X-ray film (XAR5,
Kodak) for three days at -80.degree. C. The results were as shown
in FIG. 10 from which it is considered that the receptor gene
encoded by phGR3 is expressed in the human pituitary gland.
Example 8
[0565] Amplification of Receptor cDNA by PCR Using MIN6-Derived
cDNA and Sequencing
[0566] By using, as a template, 5 .mu.l of cDNA prepared from the
mouse pancreatic .beta.-cell strain, MIN6 in Working Example 3, PCR
amplification using the DNA primers synthesized in Example 4 as
disclosed in Libert F. et al., "Science, 244: 569-572, 1989", i.e.,
a synthetic primer represented by the following sequence:
4 5'-CTGTG (C or T) G (C or T) (SEQ ID NO: 31) (G or C) AT (C or T)
GCIIT (G or T) GA (C or T) (A or C) G (G or C) TAC-3'
[0567] wherein I is inosine; and
[0568] a synthetic primer represented by the following
sequence:
5 5'-A (G or T) G (A or T) AG (A or (SEQ ID NO: 32) T)
AGGGCAGCCAGCAGAI (G or C) (A or G) (C or T) GAA-3'
[0569] wherein I is inosine, was carried out under the same
conditions as in Example 1. The resulting PCR product was subcloned
to the plasmid vector, pCR.TM.II, in the same manner as in Example
2 to obtain a plasmid, p5S38. The plasmid p5S38 was transfected
into E. coli JM109 to obtain transformant Escherichia coli
JM109/p5S38.
[0570] The reaction for determining the nucleotide sequence
(sequencing) was carried out with a DyeDeoxy terminator cycle
sequencing kit (ABI Co.), the DNA was decoded with the fluorescent
automatic sequencer (ABI Co.), and the data of the nucleotide
sequence obtained were read with DNASIS (Hitachi System Engineering
Co., Japan).
[0571] FIG. 12 showns a mouse pancreatic .beta.-cell strain
MIN6-derived G protein-coupled receptor protein-encoding DNA (SEQ
ID NO:28) and an amino acid sequence (SEW ID NO:23) encoded by the
isolated DNA based upon the nucleotide sequence of plasmid, p5S38.
The underlined portions represent regions corresponding to the
synthetic primers.
[0572] Homology retrieval was carried out based upon the determined
nucleotide sequence [FIG. 12]. As a result, it was learned that a
novel G protein-coupled receptor protein was encoded by the cDNA
fragment obtained. To further confirm this fact, by using DNASIS
(Hitachi System Engineering Co., Japan), the nucleotide sequence
was converted into an amino acid sequence [FIG. 12], and
hydrophobicity plotting was carried out to confirm the presence of
four hydrophobic regions [FIG. 14]. Upon comparing the amino acid
sequence with those encoded by p19P2 obtained in Example 2 and
encoded by pG3-2 obtained in Example 4, furthermore, a high degree
of homology was found as shown in FIG. 13. As a result, it is
strongly suggested that the mouse pancreatic .beta.-cell strain,
MIN6-derived G protein-coupled receptor protein encoded by p5S38
recognizes the same ligand as the human pituitary gland-derived G
protein-coupled receptor protein encoded by p19P2 does while the
animal species from which the receptor protein encoded by p5S38 is
derived is different from that from which the receptor protein
encoded by p19P2 is. It is also strongly suggested that the mouse
pancreatic .beta.-cell strain, MIN6-derived G protein-coupled
receptor protein encoded by p5S38 recognized the same ligand as the
mouse pancreatic .beta.-cell strain, MIN6-derived G protein-coupled
receptor proteins encoded by pG3-2 and pG1-10 do and they are
analogous receptor proteins one another (so-called "subtype").
Example 9
[0573] Preparation of CHO Cells Which Express phGR3
[0574] The plasmid phGR3 (Example 5) containing a cDNA encoding the
full-length amino acid sequence of human pituitary receptor protein
was digested with the restriction enzyme Nco I and electrophoresed
on agarose gel and a fragment of about 1 kb was recovered. Both
ends of the recovered fragment were blunted with a DNA blunting kit
(Takara Shuzo Co., Japan) and, with the SalI linker added, treated
with SalI and inserted into the SalI site of pUC119 to provide
plasmid S10. Then, S10 was treated with SalI and SacII to prepare a
fragment of about 700 bp (containing the N-terminal coding region).
Then, a fragment of about 700 bp (containing the C-terminal coding
region including initiation and termination codons) was cut out
from phGR3 with Sac II and Nhe I. These two fragments were added to
the animal cell expression vector plasmid pAKKO-111H (the vector
plasmid identical to the pAKKO1.11 H described in Biochim. Biophys.
Acta, Hinuma, S., et al., 1219 251-259, 1994) and a ligation
reaction was carried out to construct a full-length receptor
protein expression plasmid pAKKO-19P2.
[0575] E. coli transfected with pAKKO-19P2 was cultured and the
pAKKO-19P2 plasmid DNA was mass-produced using QUIAGEN Maxi. A 20
.mu.g portion of the plasmid DNA was dissolved in 1 ml of sterile
PBS, and in a gene transfer vial (Wako Pure Chemical Ind.), the
solution was vortexed well for riposome formation. This riposome,
125 .mu.l, was added to CHOdhfr.sup.- cells subcultured at
1.times.10.sup.6 per 10 cm-dia. dish 24 hr before and placed in
fresh medium immediately before addition and overnight culture was
carried out. After a further one-day culture in fresh medium, the
medium was changed to a screening medium and the incubation was
further carried out for a day. For efficient screening of
transformants, subculture was carried out at a low cell density and
only the cells growing in the screening medium were selected to
establish a full-length receptor protein expression CHO cell line
CHO-19P2.
Example 10
[0576] Confirmation of the Amount of Expression of the Full-Length
Receptor Protein in the CHO-19P2 Cell Line at the Transcription
Level
[0577] Using FastTrack Kit (Invitrogen), CHO cells transfected with
pAKKO-19P2 according to the kit manual and mock CHO cells were used
to prepare poly(A).sup.+RNA. Using 0.02 .mu.g of this
poly(A).sup.+RNA, a cDNA was synthesized by means of RNA PCR Kit
(Takara Shuzo, Co., Japan). The kind of primer used was a random
9mer and the total volume of the reaction mixture was 40 .mu.l. As
a negative control of cDNA synthesis, a reverse transcriptase-free
reaction mixture was also provided. First, the reaction mixture was
incubated at 30.degree. C. for 10 minutes to conduct an
amplification reaction to some extent. Then, it was incubated at
42.degree. C. for 30 minutes to let the reverse transcription
reaction proceed. The enzyme was inactivated by heating at
99.degree. C. for 5 minutes and the reaction system was cooled at
5.degree. C. for 5 minutes.
[0578] After completion of the reverse transcription reaction, a
portion of the reaction mixture was recovered and after dilution
with distilled water, extraction was carried out with
phenol/chloroform and further with diethyl ether. The extract was
subjected to precipitation from ethanol and the precipitate was
dissolved in a predetermined amount of distilled water for use as a
cDNA sample. This cDNA solution and the plasmid DNA (pAKKO-19P2)
were serially diluted and using primers specific to full-length
receptor protein, PCR was carried out. The sequences of the primers
prepared according to the base sequence of the coding region of the
full-length receptor protein were CTGACTTATTTTCTGGGCTGCCGC (SEQ ID
NO:33) for 5' end and AACACCGACACATAGACGGTGACC (SEQ ID NO:34) for
3' end.
[0579] The PCR reaction was carried out in a total volume of 100
.mu.l using 1 .mu.M each of the primers, 0.5 .mu.l of Taq DNA
polymerase (Takara Shuzo Co., Japan), the reaction buffer and dNTPs
accompanying the enzyme, and 10 .mu.l of template DNA (cDNA or
plasmid solution). First the reaction mixture was heat-treated at
94.degree. C. for 2 minutes for sufficient denaturation of the
template DNA and subjected to 25 cycles of 95.degree. C..times.30
seconds, 65.degree. C..times.30 seconds, and 72.degree. C..times.60
seconds. After completion of the reaction, 10 .mu.l of the reaction
mixture was subjected to agarose gel electrophoresis and the
detection and quantitative comparison of amplification products
were carried out. As a result, a PCR product of the size (400 bp)
predictable from the sequence of the cDNA coding for the
full-length receptor protein was detected [FIG. 15]. In the lane of
the PCR reaction mixture using the product of the reverse
transcriptase-free transcription system as the template, no
specific band was detected, thus extruding the possibility of its
being a PCR product derived from the genomic DNA of CHO cells.
Moreover, no specific band appeared in the lane of mock cells,
either. Therefore, it was clear that the product was not derived
from the mRNA initially expressed in CHO cells [FIG. 15].
Example 11
[0580] Detection of the Activity to Specifically Promote Release of
Arachidonic Acid Metabolites from CHO-19P2 Cells in a Rat Whole
Brain Extract
[0581] A crude peptide fraction was prepared from rat whole brain
by the following procedure. The rat whole brain enucleated
immediately after sacrifice was frozen in liquefied nitrogen and
stored at -80.degree. C. The frozen rat whole brain, 20 g (the
equivalent of 10 rats) was finely divided and boiled in 80 ml of
distilled water for 10 minutes. After the boiled tissue was
quenched on ice, 4.7 ml of acetic acid was added at a final
concentration of 1.0 M and the mixture was homogenized using a
Polytron (20,000 rpm, 6 min.). The homogenate was stirred overnight
and then centrifuged (10,000 rpm, 20 min.) to separate the
supernatant. The sediment was homogenized in 40 ml of 1.0 M acetic
acid and centrifuged again to recover the supernatant. The
supernatants were pooled, diluted in 3 volumes of acetone, allowed
to stand on ice for 30 minutes, and centrifuged (10,000 rpm, 20
min.) to recover the supernatant. The recovered supernatant was
evaporated to remove acetone. To the resulting acetone-free
concentrate was added 2 volumes of 0.05% trifluoroacetic acid
(TFA)/H.sub.2O and the mixture was applied to a reversed-phase C18
column (Prep C18 125A, Millipore). After application of the
supernatant, the column was washed with 0.05% TFA/H.sub.2O, and
gradient elution was carried out with 10%, 20%, 30%, 40%, 50%, and
60% CH.sub.3CN/0.05% TFA/H.sub.2O. The fractions were respectively
divided into 10 equal parts and lyophilized. The dried sample
derived from one animal equivalent of rat whole brain was dissolved
in 20 .mu.l of dimethyl sulfoxide (DMSO) and suspended in 1 ml of
Hank's balanced saline solution (HBSS) supplemented with 0.05%
bovine serum albumin (BSA) to provide a crude peptide fraction.
[0582] The full-length receptor protein-expressed CHO cells and
mock CHO cells were seeded in a 24-well plate, 0.5.times.10.sup.5
cells/well, and cultured for 24 hours. Then, [.sup.3H] arachidonic
acid was added at a final concentration of 0.25 .mu.Ci/well.
Sixteen (16) hours after addition of [.sup.3H] arachidonic acid,
the cells were rinsed with 0.05% BSA-HBSS and the above-mentioned
crude peptide fraction was added, 400 .mu.l/well. The mixture was
incubated at 37.degree. C. for 30 minutes and a 300 .mu.l portion
of the reaction mixture (400 .mu.l) was added to 4 ml of a
scintillator and the amount of [.sup.3H] arachidonic acid
metabolite released into the reaction mixture was determined with a
scintillation counter. As a result, an arachidonic acid
metabolite-releasing activity specific to the full-length receptor
protein expressed CHO cells (CHO-19P2) was detected in the 30%
CH.sub.3CN fraction of the eluate [FIG. 16].
Example 12
[0583] Detection of the Activity to Specifically Promote Release of
Arachidonic Acid Metabolites from CHO-19P2 Cells in a Bovine
Hypothalamus Extract
[0584] A crude peptide fraction was prepared from 360 g (the
equivalent of 1 animals) of bovine brain tissue including
hypothalamus in the same manner as in Example 11. A dried peptide
sample per 0.05 animal was dissolved in 40 .mu.l of DMSO and
suspended in 2 ml of 0.05% BSA-HBSS and the detection of
arachidonic acid metabolite-releasing activity was attempted in the
same manner as in Example 11. As a result, the activity to
specifically promote release of arachidonic acid metabolites from
the CHO-19P2 cell line was detected in the fraction eluted with 30%
CH.sub.3CN from a C18 column to which the crude bovine hypothalamus
peptide fraction had been applied [FIG. 17].
Example 13
[0585] Preparation of the Activity (Peptide) to Specifically
Promote Release of Arachidonic Acid Metabolites from CHO-19P2 Cells
by Purification from Bovine Hypothalamus
[0586] A typical process for harvesting the activity to
specifically promote release of arachidonic acid metabolites from
the CHO-19P2 cell line by purification from bovine hypothalamus is
now described. A frozen bovine brain tissue specimen including
hypothalamus, 4.0 kg (the equivalent of 80 animals) was ground and
boiled in 8.0 L of distilled water for 20 minutes. After quenching
on ice, 540 ml of acetic acid was added at a final concentration of
1.0 M and the mixture was homogenized using a Polytron (10,000 rpm,
12 min.). The homogenate was stirred overnight and then centrifuged
(9,500 rpm, 20 min) to recover a supernatant. The sediment was
suspended in 4.0 L of 1.0 M acetic acid and homogenized with the
Polytron and centrifuged again to recover a further supernatant.
The supernatants were pooled and TFA was added at a final
concentration of 0.05%. The mixture was applied to reversed-phase
C18 (Prep C18 125A % 160 ml; Millipore) packed in a glass column.
After addition, the column was washed with 320 ml of 0.05%
TFA/H.sub.2O and 3-gradient elution was carried out with 10%, 30%,
and 50% CH.sub.3CN/0.05% TFA/H.sub.2O. To the 30% CH.sub.3CN/0.05%
TFA/H.sub.2O fraction was added 2 volumes of 20 mM
CH.sub.3COONH.sub.4/H.sub.2O and the mixture was applied to the
cation exchange column HiPrep CM-Sepharose FF (Pharmacia). After
the column was washed with 20 mM CH.sub.3COONH.sub.4/10%
CH.sub.3CN/H.sub.2O, 4-gradient elution was carried out with 100
mM, 200 mM, 500 mM, and 1000 mM CH.sub.3COONH.sub.4/10%
CH.sub.3CN/H.sub.2O. In the 200 mM CH.sub.3COONH.sub.4 fraction,
activity to specifically promote release of arachidonic acid
metabolites from CHO-19P2 was detected. Therefore, this fraction
was diluted with 3 volumes of acetone, centrifuged for
deproteination, and concentrated in an evaporator. To the
concentrated fraction was added TFA (final concentration 0.1%) and
the mixture was adjusted to pH 4 with acetic acid and applied to 3
ml of the reversed-phase column RESOURCE RPC (Pharmacia). Elution
was carried out on a concentration gradient of 15%-30% CH.sub.3CN.
As a result, activity to specifically promote the release of
arachidonic acid metabolites from the CHO-19P2 cell line was
detected in the 19%-21% CH.sub.3CN fraction. The active fraction
eluted from RESOURCE RPC was lyophilized, dissolved with DMSO,
suspended in 50 mM MES pH 5.0/10% CH.sub.3CN, and added to 1 ml of
the cation exchange column RESOURCE S. Elution was carried out on a
concentration gradient of 0 M-0.7 M NaCl. As a result, the activity
to specifically promote release of arachidonic acid metabolites
from CHO-19P2 cells was detected in the 0.32 M-0.46 M NaCl
fraction. The active eluate from RESOURCE S was lyophilized,
dissolved with DMSO, suspended in 0.1% TFA/H.sub.2O, and added to
reversed-phase column C18 218TP5415 (Vydac), and elution was
carried out on a concentration gradient of 20%-30% CH.sub.3CN. As a
result, the activity to specifically promote release of arachidonic
acid metabolites from CHO-19P2 cells was detected in the three
fractions 22.5%, 23%, and 23.5% CH.sub.3CN (these active fractions
are designated as P-1, P-2, and P-3) (FIG. 18). Of the three active
fractions, the 23.5% CH.sub.3CN fraction (P-3) was lyophilized,
dissolved with DMSO, suspended in 0.1% TFA/H.sub.2O, and added to
the reversed-phase column diphenyl 219TP5415 (Vydac), and elution
was carried out on a gradient of 22%-25% CH.sub.3CN. As a result,
the activity to specifically promote release of arachidonic acid
metabolites from CHO-19P2 cells was converged by recovered in one
elution peak obtained with 23% CH.sub.3CN [FIG. 19]. The peak
activity fraction from the reverse-phased column diphenyl 219TP5415
was lyophilized, dissolved with DMSO, suspended in 0.1%
TFA/H.sub.2O, and added to the reversed-phase column .mu.RPC C2/C18
SC 2.1/10 (Pharmacia), and elution was carried out on a gradient of
22%-23.5% CH.sub.3CN. As a result, the activity to specifically
promote release of arachidonic acid metabolites from CHO-19P2 cells
was detected in the two peaks eluted with 23.0% and 23.2%
CH.sub.3CN [FIG. 20].
Example 14
[0587] Determination of the Amino Acid Sequence of the Peptide
Having the Activity to Specifically Promote Release of Arachidonic
Acid Metabolites from CHO-19P2 Cells as Purified from Bovine
Hypothalamus
[0588] The amino acid sequence of the peptide (P-3) having activity
to specifically promote release of arachidonic acid metabolites
from CHO-19P2 cells as purified in Example 13 was determined. The
fraction of peak activity from the reversed-phase .mu.RPC C2/C18 SC
2.1/10 was lyophilized and dissolved in 20 .mu.l of 70% CH.sub.3CN
and analyzed for amino acid sequence with the peptide sequencer
(ABI.491). As a result, the sequence defined by SEQ ID NO:3 was
obtained. However, the 7th and 19th amino acids were not determined
by only the analysis of amino acid sequence.
Example 15
[0589] Preparation of the Active Substance (Peptide) Which
Specifically Promotes Release of Arachidonic Acid Metabolites from
CHO-19P2 Cells as Purified from Bovine Hypothalamus
[0590] Of the three active fractions obtained with Vydac C18
218TP5415 in Example 13, the active fraction (P-2) eluted with
23.0% CH.sub.3CN was further purified. This active fraction was
lyophilized, dissolved with DMSO, suspended in 0.1% TFA/dH.sub.2O,
and added to reversed-phase column diphenyl 219TP5415 (Vydac), and
elution was carried out on a gradient of 21.0%-24.0% CH.sub.3CN. As
a result, activity to specifically promote release of arachidonic
acid metabolites from CHO-19P2 cells was detected in a peak eluted
with 21.9% CH.sub.3CN. This fraction was lyophilized, dissolved
with DMSO, suspended in 0.1% TFA/dH.sub.2O, and added to
reversed-phase .mu.RPC C2/C18 SC 2.1/10 (Pharmacia), and elution
was carried out on a CH.sub.3CN gradient of 21.5%-23.0%. As a
result, the activity to specifically promote release of arachidonic
acid metabolites from CHO-19P2 cells converged in one peak eluted
with 22.0% CH.sub.3CN [FIG. 21].
Example 16
[0591] Determination of the Amino Acid Sequence of the Peptide
(P-2) Purified from Bovine Hypothalamus Which Specifically Promotes
Release of Arachidonic Acid Metabolites from CHO-19P2 Cells
[0592] The amino acid sequence of the peptide (P-2) having the
activity to specifically promote release of arachidonic acid
metabolites from CHO-19P2 cells as purified in Example 15 was
determined. The peak activity fraction from the reversed-phase
column .mu.RPC C2/C18 SC 2.1/10 was lyophilized, dissolved in 20
.mu.l of 70% CH.sub.3CN, and analyzed for amino acid sequence with
the peptide sequencer (ABI, 492) (SEQ ID NO:4).
Example 17
[0593] Preparation of a Poly(A).sup.+RNA Fraction from Bovine
Hypothalamus and Synthesis of a cDNA
[0594] Using Isogen (Nippon Gene), total RNA was prepared from one
animal equivalent of bovine hypothalamus. Then, using Fast Track
(Invitrogen), a poly(A).sup.+RNA fraction was prepared. From 1
.mu.g of this poly(A).sup.+RNA fraction, cDNA was synthesized using
3' RACE system (GIBCO BRL) and Marathon cDNA amplification kit
(Clontech) according to the manuals and dissolved in 20 and 10
.mu.l, respectively.
Example 18
[0595] Acquisition of cDNA Coding for the amino acid Sequence
established in Example 14
[0596] To obtain a cDNA coding for a polypeptide comprising the
amino acid sequence established in Example 14, the acquisition of a
base sequence coding for SEQ ID NO:1 was attempted in the first
place. Thus, primers P5-1 (SEQ ID NO:35), P3-1 (SEQ ID NO:36), and
P3-2 (SEQ ID NO:37) were synthesized. (In the Sequence Table, I
represents inosine). Using 0.5 .mu.l of the cDNA prepared by 3'
RACE in Example 17 as a template and EXTaq (Takara Shuzo Co.,
Japan) as DNA polymerase, 2.5 .mu.l of accompanying buffer, 200
.mu.M of accompanying dNTP, and primers P5-1 and P3-1 were added
each at a final concentration of 200 nM, with water added to make
25 .mu.l, and after one minute at 94.degree. C., the cycle of
98.degree. C..times.10 seconds, 50.degree. C..times.30 seconds,
68.degree. C..times.10 seconds was repeated 30 times. This reaction
mixture was diluted 50-fold with tricine-EDTA buffer and using 2.5
.mu.l of the dilution as a template and the primer combination of
P5-1 and P3-2, the reaction was carried out in otherwise the same
manner as described above. As the thermal cycler, Gene Amp 9600
(Perkin Elmer) was used. The amplification product was subjected to
4% agarose electrophoresis and ethidium bromide staining and a band
of about 70 bp was cut out and subjected to thermal fusion, phenol
extraction, and ethanol precipitation. The recovered DNA was
subcloned into plasmid vector PCR.TM.II according to the manual of
TA Cloning kit (Invitrogen). The vector was then introduced into E.
coli JM109 and the resultant transformant was cultured in
ampicillin-containing LB medium. The plasmid obtained with an
automatic plasmid extractor (Kurabo) was reacted according to the
manual of Dye Terminator Cycle Sequencing Kit (ABI) and decoded
with a fluorescent automatic DNA sequencer (ABI). As a result, the
sequence shown in FIG. 22 was obtained and confirmed to be part of
the base sequence coding for SEQ ID NO:1.
Example 19
[0597] Acquisition of a Bioactive Polypeptide cDNA by RACE Using
the Sequence Established in Example 18
[0598] First, for amplification (5' RACE) of the sequence at 5'
end, the two primers PE (SEQ ID NO:38) and PDN (SEQ ID NO:39) were
synthesized by utilizing the sequence shown in FIG. 22. The cDNA
prepared using Marathon cDNA amplification kit in Example 17 was
diluted 100-fold with tricine-EDTA buffer. Then, in the same manner
as Example 2, a reaction mixture was prepared using 2.5 .mu.l of
the dilution and a combination of the adapter primer AP1
accompanying the kit and the primer PE and after one minute at
94.degree. C., the cycle of 98.degree. C..times.10 seconds and
68.degree. C..times.5 minutes was repeated 30 times. This reaction
system was further diluted 50-fold with tricine-EDTA buffer and
using 2.5 .mu.l of the dilution as a template and the changed
primer combination of AP1 and PDN, the reaction was conducted at
94.degree. C. for one minute, followed by 4 cycles of 94.degree.
C..times.1 minute, 98.degree. C..times.10 seconds, 72.degree.
C..times.5 minutes, 4 cycles of 98.degree. C..times.10 seconds,
70.degree. C..times.5 minutes, and 26 cycles of 98.degree.
C..times.10 seconds, 68.degree. C..times.5 minutes. The
amplification product was electrophoresed on 1.2% agarose gel and
stained with ethidium bromide and a band of about 150 bp was cut
out and centrifugally filtered through a centrifugal filter tube
(Millipore), extracted with phenol, and precipitated from ethanol.
The recovered DNA was subcloned into plasmid vector PCR.TM.II
according to the manual of TA Cloning Kit (Invitrogen). The vector
was then introduced into E. coli JM109 and the resulting
transformant was cultured and the sequence of the inserted cDNA
fragment was analyzed as in Example 18. As a result, the sequence
shown in FIG. 23 was obtained. Based on this sequence, primers FB
(SEQ ID NO:40) and FG (SEQ ID NO:41) were synthesized and the 3'
sequence was cloned (3' RACE). Using the same template as that for
5' RACE in the same quantity and the combination of the
accompanying adapter primer AP1 with the primer FC, PCR was carried
out at 94.degree. C. for 1 minute, followed by 5 cycles of
98.degree. C..times.10 seconds, 72.degree. C..times.5 minutes, 5
cycles of 98.degree. C..times.10 seconds, 70.degree. C..times.5
minutes, and 25 cycles of 98.degree. C..times.10 seconds,
68.degree. C..times.5 minutes. Then, using 2.5 .mu.l of a 50-fold
dilution of this reaction mixture in tricine-EDTA buffer as the
template and the combination of the accompanying primer AP2 with
the primer FB, the reaction was further conducted at 94.degree. C.
for one minute, followed by 4 cycles of 98.degree. C..times.10
seconds, 72.degree. C..times.5 minutes, 4 cycles of 98.degree.
C..times.10 seconds, 70.degree. C..times.5 minutes, and 27 cycles
of 98.degree. C..times.10 seconds, 68.degree. C..times.5 minutes.
The amplification product was electrophoresed on 1.2% agarose gel
and stained with ethidium bromide and a band of about 400 bp was
cut out and the DNA was recovered as in 5'-RACE. This DNA fragment
was subcloned into plasmid vector pCR.TM.II and introduced into E.
coli JM109 and the sequence of the inserted cDNA fragment in the
resulting transformant was analyzed. From the results of 5' RACE
and 3' RACE, the DNA sequence [FIG. 24] coding for the complete
coding region of the bioactive polypeptide defined by SEQ ID NO:1
was established. Thus, in FIGS. 24(a) and (b), the base.sup.134 is
G, the base.sup.184 is T or C, and the base.sup.245 was T or C.
[0599] The cDNA shown in FIG. 24 was the cDNA encoding a
polypeptide consisting of 98 amino acids. The fact that the amino
acids in 1-22-positions comprise a cluster of hydrophobic amino
acids taken together with the fact that the N-terminal region of
the active peptide begins with Ser in 23-position as shown in
Example 14 suggested that the amino acids 1-22 represent a
secretion signal sequence. On the other hand, the Gly Arg Arg Arg
sequence in 54-57 positions of the polypeptide was found to be a
typical amino acid sequence motif which exists in the event of
cleavage of a bioactive peptide. As it is the case with this
cleavage motif, it is known that because of the presence of Gly,
the C-terminus of the product peptide is frequently amidated.
[0600] The P-3 N-terminal sequence data of Example 14 and P-2
N-terminal sequence data in Example 16 coupled with this
GlyArgArgArg sequence suggest that at least same of the bioactive
peptides cut out from the polypeptide encoded by this cDNA are
defined by SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ
ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
Example 20
[0601] Acquisition of a DNA Fragment Comprising the Full Coding
Region of Bovine-Derived Bioactive Polypeptide cDNA by PCR
[0602] Using the cDNA prepared with Marathon cDNA amplification kit
in Example 17 as a template, a DNA fragment including the entire
coding region of bioactive polypeptide cDNA was constructed. First,
based on the sequence of cDNA elucidated in Example 19, two primers
having base sequences defined by SEQ ID NO:42 and SEQ ID NO:43,
respectively, were synthesized.
6 BOVF 5'-GTGTCGACGAATGAAGGCGGTGGGGGC (SEQ ID NO: 42) CTGGC-3' BOVR
(24 mer) 5'-AGGCTCCCGCTGTTATTCCTGG- AC-3' (SEQ ID NO: 43)
[0603] BOVF contains the initiation codon of bioactive polypeptide
cDNA and is a sense sequence corresponding to -2-+22 (A of the
initiation codon ATG being reckoned as +1) with restriction enzyme
SalI site added. On the other hand, BOVR is an antisense sequence
corresponding to +285-+309 which includes the termination codon of
bioactive polypeptide cDNA.
[0604] The PCR was conduced as follows. The cDNA prepared using
Marathon cDNA amplification kit in Example 17 was diluted 100-fold
in tricine-EDTA buffer and using 2.5 .mu.l of the dilution, a
reaction mixture was prepared as in Example 2 and subjected to
94.degree. C..times.1 minute, 3 cycles of 98.degree. C..times.10
seconds, 72.degree. C..times.5 minutes, 3 cycles of 98.degree.
C..times.10 seconds, 70.degree. C..times.5 minutes, and 27 cycles
of 98.degree. C..times.10 seconds, 68.degree. C..times.5 minutes.
The amplification product was subjected to 2% agarose
electrophoresis and ethidium bromide staining and a band of about
320 bp was cut out. The DNA was recovered and subcloned in plasmid
vector PCR.TM.II as in Example 3. The vector was introduced into
Escherichia coli JM109 to provide the transformant E. coli
JM109/pBOV3. The sequence of the cDNA fragment inserted in the
transformant was then analyzed. As a result, this DNA fragment was
confirmed to be a fragment covering the entire coding region of the
bioactive polypeptide cDNA.
Example 21
[0605] Synthesis of
Ser-Arg-Ala-His-Gln-His-Ser-Met-Glu-Ile-Arg-Thr-Pro-As-
p-Ile-Asn-Pro-Ala-Trp-Tyr-Ala-Gly-Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe-NH2
(19P2-L31)
[0606] 1) Synthesis of
Ser(Bzl)-Arg(Tos)-Ala-His(Bom)-Gln-His(Bom)-Ser(Bzl-
)-Met-Glu(OcHex)-Ile-Arg(Tos)-Thr(Bzl)-Pro-Asp(OcHex)-Ile-Asn-Pro-Ala-Trp(-
CHO)-Tyr(Br-Z)-Ala-Gly-Arg(Tos)-Gly-Ile-Arg(Tos)-Pro-Val-Gly-Arg(Tos)-Phe--
pMBHA-resin
[0607] The reactor of a peptide synthesizer (Applied Biosystems
430A) was charged with 0.71 g (0.5 mmole) of commercial
p-methyl-BHA resin (Applied Biosystems, currently Perkin Elmer).
After wetting with DCM, the initial amino acid Boc-Phe was
activated by the HOBt/DCC method and introduced into the
p-methyl-BHA resin. The resin was treated with 50% TFA/DCM to
remove Boc and make the amino group free and neutralized with DIEA.
To this amino group was condensed the next amino acid Boc-Arg (Tos)
by the HOBt/DCC method. After the absence of unreacted amino
function was verified by ninhydrin test, a sequential condensation
of Boc-Gly, Boc-Val, Boc-Pro, Boc-Arg(Tos), Boc-Ile, Boc-Gly,
Boc-Arg(Tos), Boc-Gly, Boc-Ala, Boc-Tyr(Br-Z) was carried out. The
Boc-Ala, Boc-Tyr (Br-Z), the condensation of which was found
insufficient by ninhydrin test, was recondensed to complete the
reaction. The resin was dried and a half of the resin was
withdrawn. To the remainder, Boc-Trp(CHO), Boc-Ala, Boc-Pro,
Boc-Asn, Boc-Ile, Boc-Asp(OcHex), Boc-Pro, Boc-Thr(Bzl),
Boc-Arg(Tos), Boc-Ile, Boc-Glu(OcHex), Boc-Met, Boc-Ser(Bzl),
Boc-His(Bom), Boc-Gln, Boc-His(Bom), Boc-Ala, Boc-Arg(Tos),
Boc-Ser(Bzl) were serially condensed and recondensed until
sufficient condensation was confirmed by ninhydrin test. After
introduction of the full sequence of amino acids of 19P2-L31, the
resin was treated with 50% TFA/DCM to remove Boc groups on the
resin and, then, dried to provide 1.28 g of the peptide resin.
[0608] 2) Synthesis of
Ser-Arg-Ala-His-Gln-His-Ser-Met-Glu-Ile-Arg-Thr-Pro-
-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Ala-Gly-Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe-N-
H2 (19P2-L31)
[0609] In a Teflon hydrogen fluoride reactor, the resin obtained in
1) was reacted with 3.8 g of p-cresol, 1 ml of 1,4-butanedithiol,
and 10 ml of hydrogen fluoride at 0.degree. C. for 60 minutes. The
hydrogen fluoride and 1,4-butanedithiol (1 ml) were distilled off
under reduced pressure and the residue was diluted with 100 ml of
diethyl ether, stirred, filtered th rough a glass filter, and the
fraction on the filter was dried. This fraction was suspended in 50
ml of 50% acetic acid/H.sub.2O and stirred to extract the peptide.
After separation of the resin, the extract was concentrated under
reduced pressure to about 5 ml and chromatographed on Sephadex G-25
(2.times.90 cm). Development was carried out with 50% acetic
acid/H.sub.2O and the 114 ml-181 ml fraction was pooled and
lyophilized to recover 290 mg of white powders containing 19P2-L31.
The powders were applied to a reversed-phase column of LiChroprep
RP-18 (Merck) and repeatedly purified by gradient elution using
0.1% TFA/H.sub.2O and 0.1% TFA-containing 30%
acetonitrile/H.sub.2O. The fraction eluted at about 25%
acetonitrile was pooled and lyophilized to provide 71 mg of white
powders.
[0610] Mass spectrum (M+H).sup.+ 3574.645
[0611] HPLC elution time 18.2 min.
[0612] Column conditions
[0613] Column: Wakosil 5C18 (4.6.times.100 mm)
[0614] Eluent:
[0615] A (0.1% TFA/H.sub.2O)
[0616] B (0.1% TFA-containing 50 (% acetonitrile/H.sub.2O)
[0617] Linear gradient elution from A to B (25 min.) Flow rate: 1.0
ml/min.
Example 22
[0618] Synthesis of
Ser-Arg-Ala-His-Gln-His-Ser-Met(O)-Glu-Ile-Arg-Thr-Pro-
-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Ala-Gly-Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe-N-
H2(19P2-L31(O))
[0619] In 20 ml of 5% acetic acid/H.sub.2O was dissolved 6 mg of
synthetic 19P2-L31 and the Met only was selectively oxidized with
40 .mu.l of 30% H.sub.2O.sub.2. After completion of the reaction,
the reaction mixture was immediately applied to a reversed-phase
column of LiChroprep RP-18 (Merck) for purification to provide 5.8
mg of the objective peptide.
[0620] Mass spectrum (M+H).sup.+ 3590.531
[0621] HPLC elution time 17.9 min.
[0622] Column conditions
[0623] Column: Wakosil 5C18 (4.6.times.100 mm)
[0624] Eluent:
[0625] A (0.1% TFA/H.sub.2O)
[0626] B (0.1% TFA-containing 50% aceto nitrile/H.sub.2O)
[0627] Linear gradient elution from A to B (25 min.) Flow rate: 1.0
ml/min.
Example 23
[0628] Synthesis of
Thr-Pro-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Ala-Gly-Arg-Gly-Il-
e-Arg-Pro-Val-Gly-Arg-Phe-NH2(19P2-L20)
[0629] To the resin subjected to condensations up to Boc-Tyr(Br-Z)
in Example 21-1) was further condensed Boc-Trp(CHO), Boc-Ala,
Boc-Pro, Boc-Asn, Boc-Ile, Boc-Asp(OcHex), Boc-Pro, Boc-Thr(Bzl)
serially in the same manner to provide 1.14 g of
Boc-Thr(Bzl)-Pro-Asp(OcHex)-Ile-Asn-Pro--
Ala-Trp(CHO)-Tyr(Br-Z)-Ala-Gly-Arg(Tos)-Gly-Ile-Arg(Tos)-Pro-Val-Gly-Arg(T-
os)-Phe-pMBHA-resin. This resin was treated with hydrogen fluoride
and columnwise purified in the same manner as Example 21-2) to
provide 60 mg of white powders.
[0630] Mass spectrum (M+H).sup.+ 2242.149
[0631] HPLC elution time 10.4 min.
[0632] Column conditions
[0633] Column: Wakosil 5C18 (4.6.times.100 mm)
[0634] Eluent:
[0635] A (0.1% TFA-containing 15% aceto nitrile/H.sub.2O)
[0636] B (0.1% TFA-containing 45% aceto nitrile/H.sub.2O)
[0637] Linear gradient elution from A to B (15 min.) Flow rate: 1.0
ml/min.
Example 24
[0638] Determination of Arachidonic Acid Metabolites-Releasing
Activity of Synthetic Peptide (19P2-L31)
[0639] The activity of the peptide (19P2-L31) synthesized in
Example 21 to specifically release arachidonic acid metabolites
from CHO-19P2 cells was assayed in the same manner as Example 11.
The synthetic peptide was dissolved in degassed dH.sub.2O at a
concentration of 10.sup.-3M and diluted with 0.05% BSA-HBSS and the
activity to promote release of arachidonic acid metabolites from
CHO-19P2 cells at each concentration was assayed using the amount
of [.sup.3H]arachidonic acid metabolites as the indicator. As a
result, concentration-dependent arachidonic acid
metabolite-releasing activity was detected over the range of
10.sup.-12M-10.sup.-6M [FIG. 25]. When the arachidonic acid
metabolite-releasing activity of peptide 19P2-L31(O), i.e. the
methionine-oxidation product of 19P2-L31 synthesized in Example 22,
was compared with that of 19P2-L31, it was found that the activity
of 19P2-L31(O) was equivalent to the activity of 19P2-L31 as can be
seen from FIG. 26.
Example 25
[0640] Determination of Arachidonic Acid Metabolites-Releasing
Activity of Synthetic Peptide (19P2-L20)
[0641] The activity of the synthetic equivalent (19P2-L20) of
natural peptide P-2 as synthesized in Example 23 to specifically
promote release of arachidonic acid metabolites from CHO-19P2 cells
was determined as in Example 11. Thus, the synthetic peptide was
dissolved in degassed dH.sub.2O at a final concentration of
10.sup.-3M and this solution was serially diluted with 0.05%
BAS-HBSS. The activity to specifically promote release of
arachidonic acid metabolites from CHO-19P2 cells at each
concentration was assayed using the amount of [.sup.3H]arachidonic
acid metabolites as the indicator.
[0642] As a result, concentration-dependent arachidonic acid
metabolite-releasing activity was detected over the range of
10.sup.-12-10.sup.-6 M in nearly the same degree as 19P2-L31 [FIG.
27].
Example 26
[0643] Analysis of the Coding Region Base Sequence of Bovine
Genomic DNA
[0644] pBOV3 was digested with restirction enzyme EcoRI and after
fractionation by agarose gel electrophoresis, the DNA
corressponding to the cDNA fragment was recovered to prepare a
probe. This DNA was labeled with .sup.32P using a multiprime DNA
labeling kit (Amersham). About 2.0.times.10.sup.6 phages of Bovine
Genomic Library (Clontech BL1015j) constructed using cloning vector
EMBL3 SP6/T7 and Escherichia coli K802 as the host were seeded in
an LB agar plate and cultured overnight for plaque formation. The
plaques were transferred to a nitrocellulose filter and after
alkaline modification and neutralization, heat-treated (80.degree.
C., 2 hours) to inactivate the DNA. This filter was incubated with
the labeled probe in 50% formamide-Hybri buffer (50% formamide,
5.times. Denhardt solution, 4.times.SSPE, 0.1 mg/ml heat-denatured
salmon sperm DNA, 0.1% SDS) at 42.degree. C. overnight for
hybridization. After this hybridization, the filter was washed with
2.times.SSC, 0.1% SDS at room temperature for 1.5 hours, and
further washed in the same buffer at 55.degree. C. for 30 minutes.
Detection of the clone hybridizing with the probe was carried out
on Kodak X-ray film (X-OMAT.TM.AR) after 4 days of exposure using a
sensitization screen at -80.degree. C. After development of the
film, the film was collated with plate positions and the phages
which had hybridized were recovered. Then, plating and
hybridization were repeated in the same manner for cloning of the
pharges.
[0645] The cloned phages were prepared on a large scale by the
plate lysate method and the phage DNA was extracted. Then, cleavage
at the restriction enzyme SalI and BamHI cleavage sites at both
ends of the cloning site of the vector and detection of the
inserted fragment derived from bovine genomic DNA was carried out
by 1.2% agarose gel electrophoresis [FIG. 28]. As a result, in the
case of BamHI digestion, 3 fragments were detected in addition to
the bands derived from the phages. In the case of SalI digestion,
one band overlapping the phage band was detected. The SalI-digested
fragment being considered to harbor the full length and in order to
subclone this fragment into a plasmid vector, it was ligated to BAP
(E. coli-derived alkaline phosphatase)-treated plasmid vector pUC18
(Pharmacia) and introduced into E. coli JM109. From this
microorganism, a genome-derived SalI fragment-inserted plasmid DNA
was prepared on a production scale and the base sequence in the
neighborhood of its coding region was analyzed using Perkin Elmer
Applied Biosystems 370A fluorecent sequencer and the same
manufacturer's kit. As a result, the sequence shown in FIG. 29 was
obtained. Comparison with the coding region of cDNA reveals that
because of its being derived from genomic DNA, the coding region is
divided in two by a 472 bp intron [FIG. 30]. FIG. 31 and SEQ ID
NO:44 present the amino acid sequence predicted from this bovine
genome coding region (excluding the intron region).
Example 27
[0646] Preparation of Rat Medulla Oblongata Poly(A.sup.+)RNA
Fraction and Synthesis of cDNA
[0647] Using Isogen (Nippon Gene), total RNA was prepared from the
dorsal region of rat medulla oblongata and using FastTrack
(Invitrogen), poly(A).sup.+RNA fraction was prepared. To 5 .mu.g of
this poly(A).sup.+RNA was added the primer random DNA hexamer (BRL)
and using Moloney mouse leukemia reverse transcriptase (BRL) and
the accompanying buffer, complementary DNA was synthesized. The
reaction product was precipitated from ethanol and dissolved in 12
.mu.l of DW. In addition, from 1 .mu.g of this poly(A).sup.+RNA, a
cDNA was synthesized using Marathon cDNA amplification kit
(Clontech) according to the manual and dissolved in 10 .mu.l of
DW.
Example 28
[0648] Acquisition of Rat Bioactive Polypeptide cDNA by RACE
[0649] To obtain the full coding region of rat bioactive
polypeptide cDNA, an experiment was performed in the same manner as
the acquisition of bovine cDNA. First, PCR was carried out using
the same primers P5-1 (SEQ ID NO:35) and P3-1 (SEQ ID NO:36) as
used in Example 18 as primers and the complementary DNA synthesized
in Example 27 using the primer random DNA hexamer (BRL) and Moloney
mouse leukemia reverse transcriptase (BRL) as a template. The
reaction system was composed of 1.25 .mu.l of the template cDNA,
200 .mu.M of dNTP, 1 .mu.M each of the primers, ExTaq (Takara Shuzo
Co., Japan) as DNA polymerase, and 2.5 .mu.l of the accompanying
buffer, with a sufficient amount of water to make a total of 25
.mu.l. The reaction was carried out at 94.degree. C. for 1 minute,
followed by 40 cycles of 98.degree. C..times.10 seconds, 50.degree.
C..times.30 seconds, and 72.degree. C..times.5 seconds, and the
reaction mixture was then allowed to stand at 72.degree. C. for 20
seconds. The thermal cycler used was GeneAmp2400 (Perkin Elmer).
The amplification product was subjected to 4% agarose
electrophoresis and ethidium bromide staining and the band of about
80 bp was cut out. Then, in the manner described in Example 19, the
DNA was recovered, subcloned into plasmid vector pCR.TM.II, and
introduced into E. coli JM109, and the inserted cDNA fragment was
sequenced. As a result, a partial sequence of rat bioactive
polypeptide could be obtained. Based on this sequence, two primers,
namely RA (SEQ ID NO:75) for 3' RACE and RC (SEQ ID NO:76) for 5'
RACE were synthesized and 5' and 3' RACEs were carried out.
7 RA: 5'-CARCAYTCCATGGAGACAAGAACCCC-3' (SEQ ID NO: 75) (where R
means A or G; Y means T or G) RC: 5'-TACCAGGCAGGATTGATACAGGGG-3'
(SEQ ID NO: 76)
[0650] As a template, the template synthesized using Marathon cDNA
amplification kit (Clontech) in Example 27 was diluted 40-fold with
the accompanying tricine-EDTA buffer and 2.5 .mu.l of the dilution
was used. As primers, RA and the adapter primer AP1 accompanying
the kit were used for 3' RACE, and RC and AP1 for 5' RACE. The
reaction mixture was prepared in otherwise the same manner as
above. The reaction conditions were 94.degree. C..times.1 minute, 5
cycles of 98.degree. C..times.10 seconds, 72.degree. C..times.45
seconds, 3 cycles of 98.degree. C..times.10 seconds, 70.degree.
C..times.45 seconds, and 40 cycles of 98.degree. C..times.10
seconds, 68.degree. C..times.45 seconds. As a result, a band of
about 400 bp was obtained from 3' RACE and bands of about 400 bp
and 250 bp from 5' RACE. These bands were recovered in the same
manner as above and using them as templates and the primers used in
the reaction, sequencing was carried out with Dye Terminator Cycle
Sequencing Kit (ABI). As a result, the sequence up to poly A could
be obtained from the region considered to be the 5' noncoding
region.
Example 29
[0651] Acquisition of the Full-Length cDNA of Rat Bioactive
Polypeptide by PCR
[0652] Based on the sequence obtained in Example 28, two primers,
viz. rF for the region including the initiation codon (SEQ ID
NO:77) and rR for the 3' side from the termination codon (SEQ ID
NO:78), were synthesized to amplify the fragment including the
full-length cDNA.
8 rF: 5'-GGCATCATCCAGGAAGACGGAGCAT-3' (SEQ ID NO: 77) rR:
5'-AGCAGAGGAGAGGGAGGGTAGAGGA-3' (SEQ ID NO: 78)
[0653] Using the cDNA prepared using Moloney mouse leukemia reverse
transcriptase in Example 27 as a template and ExTaq (Takara Shuzo
Co., Japan), PCR was carried out by repeating 40 cycles of
95.degree. C..times.30 seconds, 68.degree. C..times.60 seconds. The
amplification product was subjected to agarose electrophoresis and
ethidium bromide staining and a band of about 350 bp was cut out.
The DNA was recovered, subcloned into plasmid vector pCR.TM.II, and
introduced into E. coli JM109 as in Example 19. The plasmid was
extracted from the transformant and the base sequence was
determined. As a result, E. coli JM 109/pRAV3 having the
full-length cDNA of rat bioactive polypeptide was obtained [FIG.
32].
Example 30
[0654] Synthesis of cDNA from the Human Total Brain Ply(A).sup.+RNA
Fraction
[0655] From 1 .mu.g of human total brain poly(A).sup.+RNA fraction
(Clontech), cDNA was synthesized with Marathon cDNA amplification
kit (Clontech) according to the manual and dissolved in 10 .mu.l.
In addition, the random DNA hexamer (BRL) was added as primer to 5
.mu.g of the same poly(A).sup.+RNA fraction and using Moloney mouse
leukemia reverse transcriptase (BRL) and the accompanying buffer,
complementary DNA was synthesized. The reaction product was
precipitated from ethanol and dissolved in 30 .mu.l of TE.
Example 31
[0656] Acquisition of Human Bioactive Polypeptide cDNA by RACE
[0657] From the amino acid sequence of rat bioactive polypeptide
established in Example 28 [FIG. 33], the well-preserved regions of
rat and bovine polypeptides were selected and the following 3
primers R1 (SEQ ID NO:79), R3 (SEQ ID NO:80), and R4 (SEQ ID NO:81)
were synthesized. Then, amplification of the region flanked by them
was attempted by PCR using human cDNA as a template. Referring to
FIG. 33, bovine. aa represents the amino acid sequence of bovine
polypeptide, bovine. seq represents the base sequence of the DNA
coding for bovine polypeptide, and rat. seq represents the base
sequence of the DNA coding for rat polypeptide.
9 R1: 5'-ACGTGGCTTCTGTGCTTGCTGC-3' (SEQ ID NO: 79) R3:
5'-GCCTGATCCCGCGGCCCGTGTACCA-3' (SEQ ID NO: 80) R4:
5'-TTGCCCTTCTCCTGCCGAAGCGGCCC-3' (SEQ ID NO: 81)
[0658] The cDNA prepared using Marathon cDNA amplification kit
(Clontech) in Example 30 was diluted 30-fold with tricine-EDTA
buffer and 0.25 .mu.l of the dilution was used as a template. The
reaction mixture was composed of 200 .mu.M of dNTP, 0.2 .mu.M each
of the primers R1 and R4, a 50:50 mixture of Taq Start Antibody
(Clontech) and DNA polymerase ExTaq (Takara Shuzo Co., Japan), 2.5
.mu.l of the accompanying buffer, and a sufficient amount of water
to make a total of 25 .mu.l. The reaction conditions were
94.degree. C..times.1 minute, followed by 42 cycles of 98.degree.
C..times.10 seconds, 68.degree. C..times.40 seconds, and 1 minute
of standing at 72.degree. C. Then, using 1 .mu.l of a 100-fold
dilution of the above reaction mixture in tricine-EDTA buffer as a
template, the same reaction mixture as above except that the primer
combination was changed to R1 and R3 was prepared and PCR was
carried out in the sequence of 94.degree. C..times.1 minute and 25
cycles of 98.degree. C..times.10 seconds, 68.degree. C..times.40
seconds. The amplification product was subjected to 4% agarose
electrophoresis and ethidium bromide staining. As a result, a band
of about 130 bp was obtained as expected. This band was recovered
in the same manner as in Example 28 and using the recovered
fragment as a template, sequencing was carried out with Dye
Terminator Cycle Sequencing Kit (ABI). As a result, a partial
sequence of human bioactive polypeptide could be obtained.
Therefore, based on this sequence, primers HA (SEQ ID NO:82) and HB
(SEQ ID NO:83) were synthesized for 3' RACE and primers HE (SEQ ID
NO:84) and HF (SEQ ID NO:85) for 5' RACE and 5' and 3' RACEs were
carried out.
10 HA: 5'-GGCGGGGGCTGCAAGTCGTACCCATCG-3' (SEQ ID NO: 82) HB:
5'-CGGCACTCCATGGAGATCCGCACCCCT-3' (SEQ ID NO: 83) HE:
5'-CAGGCAGGATTGATGTCAGGGGTGCGG-3' (SEQ ID NO: 84) HF:
5'-CATGGAGTGCCGATGGGTACGACTTGC-3' (SEQ ID NO: 85)
[0659] As the template, 2.5 .mu.l of a 20-fold dilution of the cDNA
prepared in Example 30 in tricine-EDTA buffer was used. For the
initial PCR, reaction mixtures were prepared in the same manner as
above except that HA and adapter primer AP1 were used for 3' RACE
and HE and AP1 for 5' RACE. The reaction sequence was 94.degree.
C..times.1 minute, 5 cycles of 98.degree. C..times.10 seconds,
72.degree. C. for 35 seconds, 5 cycles of 98.degree. C..times.10
seconds, 70.degree. C..times.35 seconds, and 40 cycles of
98.degree. C..times.10 seconds, 68.degree. C..times.35 seconds.
Then, using 1 .mu.l of a 100-fold dilution of this reaction mixture
in tricine-EDTA buffer as a template, a second PCR was carried out
in the same cycles as the first PCR. However, the reaction mixture
was prepared using primers HB and AP1 for 3' RACE or HF and AP2 for
5' RACE and Klen Taq (Clontech) as DNA polymerase and the
accompanying buffer. As a result, a band of about 250 bp was
obtained from 3' RACE and a band of about 150 bp from 5'-RACE.
These bands were sequenced by the same procedure as above and using
them in combination with the partial sequence obtained previously,
the sequence from the region presumed to be 5'-noncoding region to
polyA of human bioactive polypeptide was obtained.
Example 32
[0660] Acquisition of Human Bioactive Polypeptide Full-Length cDNA
by PCR
[0661] Based on the sequence obtained in Example 31, two primers 5H
(SEQ ID NO:86) and 3HN (SEQ ID NO:87) were synthesized for
amplification of a fragment including full-length cDNA.
11 5H: 5'-GGCCTCCTCGGAGGAGCCAAGGGATGA-3' (SEQ ID NO: 86) 3HN:
5'-GGGAAAGGAGCCCGAAGGAGAGGAGAG-3' (SEQ ID NO: 87)
[0662] Using 2.5 .mu.l of the cDNA prepared using Moloney mouse
leukemia reverse transcriptase (BRL) in Example 30 as a template
and the reaction mixture prepared using Klen Taq DNA polymerase
(Clontech), the PCR reaction was conducted in the sequence of
94.degree. C..times.1 minute and 40 cycles of 98.degree.
C..times.10 seconds, 68.degree. C..times.30 seconds. The fragment
of about 360 bp obtained was recovered and subcloned (pCR.TM. 2.1
was used as the vector) in otherwise the same manner as Example 29.
The plasmid was recovered and its base sequence was determined. As
a result, E. coli JM109/pHOV7 harboring the human bioactive
polypeptide full-length cDNA was obtained [FIG. 34]. In regard to
the amino acid sequence of the translation region, a comparison was
made between this human bioactive polypeptide and the bovine
polypeptide shown in Example 20 or the rat polypeptide in Example
29 [FIG. 35].
Example 33
[0663] An orphan G-protein coupled receptor, UHR-1, has been cloned
from rat hypothalamic suprachiasmic nuclei, and its nucleotide
sequences have been reported (Biochemical and Biophysical Research
Communications, vol. 209, No. 2, pp 606-613, 1995, Genbank
Accession Number: S77867). A protein coded by UHR-1 showed 91.6%
identity over 359 amino acids with that of phGR3, suggesting UHR-1
is a counterpart of hGR3. To confirm this we cloned a cDNA for
UHR-1 coding regions and established a CHO cells stably expressing
UHR-1 as described below. Poly(A).sup.+ RNA was prepared from rat
anterior pituitary using a FastTrack.TM. Kit (Invitrogen Co.), and
cDNA was synthesized from 0.2 .mu.g of this with Takara RNA PCR Kit
(Takara). The cDNA was dissolved in 10 .mu.l of distilled water,
and used as a template for the following PCR. To isolate UHR-1
cDNA, two primers, namely 5'-GTTCACAG(GTCGAC)ATGACCTCAC-3' [SEQ ID
NO:95] (UHF), and 5'-CTCAGA(GCTAGC)AGAGTGTCATCAG-3' [SEQ ID NO:96]
(UHR), were synthesized on the basis of the sequence of UHR-1
submitted to Genbank (Accesion Number: S77867). In these primers,
GTCGAC and GCTAGC indicate the SalI and NheI site respectively. Ex
Taq (Takara) was admixed with an equal amount of Taq Start Antibody
(Clontech Laboratories, Inc.) to prevent amplification of
nonspecific products and primer dimers. Reaction mixture was
prepared by adding 5 .mu.l of the buffer attached to Ex Taq, 4
.mu.l of dNTPs, 1 .mu.l of the mixed solution of Ex Taq and Taq
Start Antibody, and 1 .mu.l of 50 .mu.M each primers. The cDNA was
diluted to one fifth with distilled water, and an aliguot (5 .mu.l)
was added to the reaction mixture. PCR conditions were as follows:
denatured at 95.degree. C. for 2 minutes, followed by 27 cycles at
95.degree. C. for 30 seconds, 65.degree. C. for 30 seconds and
72.degree. C. for 1 minutes, and after these cycles at 72.degree.
C. for 7 minutes.
[0664] The PCR products were separated with 1.2% agarose gel and
stained with ethidium bromide. Slices of agarose gel containing the
band about 1.1 kbp were cut out with razor blade, and then filtered
using an Ultra Free filter unit (Millipore). The eluent was
extracted with phenol: chloroform and precipitated in ethanol. The
amplified DNA was subcloned into pCR.TM.II with a TA cloning Kit
(Invitrogen Co.), and then introduced into E. coli JM109 competent
cells. Transformants were selected in LB (Luria-Bertani) agar
culture medium containing ampicillin, IPTG
(isopropylthio-beta-D-galactoside), and X-gal
(5-bromo-4-chloro-3-indolyl-beta-D-galactoside). The individual
clones were cultured in an LB culture medium containing ampicillin
and treated with an automatic plasmid extracting machine (Kurabo)
to prepare plasmid DNAs respectively. Sequencing was carried out
with a ABI PRISM Dye Terminator Cycle Sequencing Kit FS
(Perkin-Elmer), and an ABI automatic sequencer. In the FIG. 52,
underlines indicate the sequences corresponding to the parts of
primer sequences. Double-lined bases indicate the base substitution
compared with the sequence data reported, and one of these
substitutions was accompanied by an amino acid substitution from
.sup.289Leu(CTC) to .sup.289Val(GTC). A plasmid, pCRII-UHR-1,
containing the UHR-1 cDNA fragment was thus constructed.
[0665] UHR-1 cDNA expression plasmid was prepared as follows.
First, pCRII-UHR-1 was digested with NheI and SalI. The resultant
fragment of about 1.1 kbp was separated through electrophoresis
using a 1.2% agarose gel and precipitated as above. The DNA
fragment was then ligated into the NheI-SalI site of pAKKO-111H,
with a Ligation System (Takara). A resultant expression plasmid,
pAKKO-UHR-1 was introduced into E. coli JM109.
[0666] CHO dhfr.sup.- cells were grown in 10 cm diameter Petri
dishes at the cell number of 1.times.10.sup.6, and cultured at
37.degree. C. for 24 hours in .alpha.-MEM containing 10% of fetal
bovine serum. The expression plasmid (20 .mu.g) was introduced into
the cells by a liposome method using a Gene Transfer (Nippon Gene).
After 24 hours from the introduction, the medium was substituted
with fresh one. After additional 24 hour incubation, the culture
medium was changed to a Selection medium, .alpha.-MEM without
nucleosides containing 10% of dialyzed fetal bovine serum. Culture
was carried out until cells growing in the Selection medium were
obtained. CHO-UHR-1 which highly expressed UHR-1 was thus
established.
Example 34
[0667] Radioiodination of 19P2-L31 and Receptor Binding
Experiments
[0668] 19P2-L31 was radioiodinated with [.sup.125I]-Bolton-Hunter
Reagent (NEN.Dupont; NEX-120) as follows. Two hundred microliter of
[.sup.125I]-Bolton-Hunter Reagent was dried in a 500 .mu.l
Eppendorf tube with N.sub.2 gas. The dried reagent was dissolved in
2 .mu.l of acetonitrile, and then mixed with 4 ml of 50 mM
phosphate buffer (pH 8.0) and 4 .mu.l of 19P2-L31
3.times.10.sup.-4M The mixture was incubated at room temperature
for 40 min and the reaction was stopped by adding 5 .mu.l of 1.0 M
glycine. The all reaction mixture was diluted with 300 .mu.l of 18%
acetonitrile and injected onto reverse-phase HPLC column TSK gel
ODS-80.TM. (4.6.times.100 mm; TOSO). The radioiodinated 19P2-L31
was eluted with a linear gradient of acetonitrile concentration
from 18 to 32.4% in 0.1% teifluoroacetic acid for 24 min at a flow
rate of 1 ml/min. The peak fraction of radioiodinated 19P2-L31 was
collected and diluted with twice volume of 50 mM Tris-HCl (pH7.5)
containing 0.1% BSA and 0.05% CHAPS, and then stored at -20.degree.
C.
[0669] Receptor binding experiments were performed with [.sup.125
I]-19P2-L31 as follows. As receptor-expressing CHO cells,
CHO-19P2-9; mono-clone of CHO-19P2, CHO-UHR-1, and mock CHO were
used in this experiment. CHO-19P2-9 cells are ones selected from
CHO-19P2 cells by ultradilution technique using 96-well microplate
as clone which indicated stronger arachidonic acid
metabolic-release promoting reaction by 19P2-L31. The mock CHO
cells are ones for control which were transformed with expression
vector pAKKO alone. These cells cultured in flasks for culturing
tissues were harvested with 5 mM EDTA/PBS, and then resuspended in
HBSS containing 0.05% BSA and 0.05% CHAPS at 0.5.times.10.sup.7
cells/ml. The cell suspensions were incubated with 200 pM
[.sup.125I]-19P2-L31 for 2.5 hr at room temperature in a 100 .mu.l
total volume. The reaction mixture were diluted with 2 ml of an
ice-cold beffer (50 mM Tris-HCl pH7.5 containing 5 mM EDTA, 0.05%
BSA, and 0.05% CHAPS) and immediately filtered though glass filters
GF/F (Whattman) which were pre-wetted with the buffer containing
0.3% polyethylenimine. The glass filters were subjected to
.gamma.-counting. Non-specific binding was determined in the
presence of 200 nM unlabeled 19P2-L31.
[0670] [FIG. 36] shows receptor binding experiments with
[.sup.125I]-19P2-L31 on live cells.
[0671] Specific binding of [.sup.125I]-19P2-L31 was detected on CHO
cells which were expressed with hGR3 and rat homolog UHR-1
respectively. The experiments were performed in triplicate. These
results show that the proteins encoded by hGR3 and UHR-1 is
functioning as the specific receptor of 19P2-L31.
Example 35
[0672] Release of Arachidonic Acid Metabolites from CHO-19P2-9 and
CHO-UHR1 by 19P2-L31
[0673] Same as described in Example 11, the release activity of
arachidonic acid metabolite was measured on CHO-19P2-9 and CHO-UHR1
and mock CHO.
[0674] [FIG. 37] shows the release activity of arachidonic acid
metabolite on CHO-19P2-9 and CHO-UHR1 by 19P2-L31.
[0675] On CHO cells which were expressed with rat homolog UHR1, the
release activity of arachidonic acid metabolite was detected same
as CHO-19P2-9. The experiments were performed in duplicate. These
results show that the protein encoded by UHR-1 is functioning as
the specific receptor as well as hGR3.
Example 36
[0676] Quantification of Rat 19P2 Ligand and Rat UHR-1 mRNA, BBRC,
209,606-613, 1995) by RT-PCR
[0677] (1) Preparation of Poly(A)+RNA and cDNA Synthesis from Rat
tissues.
[0678] Poly(A)+RNA was isolated from a variety of tissues in rats
(Wister strain, male, 8 weeks old) by homogenization with Isogen
(Nippon Gene) followed by an oligo (dT)-cellulose chromatography
(Pharmacia). One .mu.g of poly(A)+RNA was treated with DNase I
(Amplification grade, GibcoBRL) to eliminate the contamination of
genomic DNA. DNase I was inactivated by the addition of 25 mM EDTA
solution at 65.degree. C. Then RNA (160 ng) was reverse-transcribed
in 4011 of a reaction miexture containing 10 mM of Tris-HCl (pH
8.3), 2.5 .mu.M of random hexamers (Takara), 0.4 mM of each dNTP,
and 10 U of AMV reverse transcriptase XL (Takara). The samples were
incubated at 30.degree. C. for 10 min followed by 42.degree. C. for
1 h, then 99.degree. C. for 5 min to stop the reaction. The
reaction mixture was purified by ethanol precipitation, and then
the cDNA was diluted to 40 .mu.l with tricine-EDTA buffer
(correspond to 4 ng poly(A)+RNA/.mu.l).
[0679] (2) Construction of Positive Control Plasmid Vectors
[0680] Rat glycerolardehyde-3-phasphate-dehydrogenase (G3PDH) and
rat UHR-1 cDNAs were isolated from rat pituitary tumor cell line
GH.sub.3 by means of RT-PCR Poly(A)+RNA of GH.sub.3 was prepared by
FastTrack (Invitrogen), and cDNA was synthesized as Example 36(1).
Oligonucleotide primers used for the amplification are as follows:
rat G3PDH amplification primer set (Clontech), rRECF
(5'-CCTGCTGGCCATTCTCCTGTCTTAC-- 3') (SEQ ID NO:88) and rRECR
(0.5'-GGGTCCAGGTCCCGCAGAAGGTTGA-3') (SEQ ID NO:89) for UHR-1. The
fragments amplified from GH.sub.3 cDNA were subcloned with a TA
cloning Kit (Invitrogen). The recombinant vectors were introduced
into E. coli JM109. The transformant clones were cultured in a LB
culture medium containing ampicillin, and the plasmid DNAs were
prepared with a Quiagen Plasmid Midi Kit (Quiagen). The plasmid of
rat ligand polypeptide was prepared from E. coli JM109/pRAV3 which
was deposited.
[0681] (3) Quantification RT-PCR
[0682] cDNA and plasmid DNA prepared in (1) and (2) above were
diluted with distilled water to adequate concentrations and used as
templates of quantitative RT-PCR. G3PDH, UHR-1, and ligand
polypeptide cDNA fragments were amplified using human G3PDH
amplimer (Clontech), rRECF and rRECR, and r19F
(5'-GAAGACGGAGCATGGCCCTGAAGAC-3') (SEQ ID NO:91) and r19R
(5'-GGCAGCTGAGTTGGCCAAGTCCAGT-3') (SEQ ID NO:91), respectively.
Each reaction sample contained 100 .mu.M of dNTP mixture, 200 nM of
each primer, 4 .mu.l of template DNA, 0.25 .mu.l of 50.times.
KlenTaq DNA polymerase mix (Clontech), and 2.5 .mu.l of the buffer
attached to KenTaq DNA polymerase mix in a final volume of 25
.mu.l. PCR conditions for G3PDH were as follows: denatured at
94.degree. C. for 1 min, followed by 26 cycles at 98.degree. C. for
10 sec, at 65.degree. C. for 20 sec, and at 72.degree. C. for 40
sec. PCR conditions for UHR-1 and ligand polypeptide were as
follows: denatured at 94.degree. C. for 1 min, followed by 34
cycles at 98.degree. C. for 10 sec, and at 68.degree. C. for 25
sec. An aliquot 5 .mu.l of each RT-PCR product was separated with
4% Nusieve 3:1 agarose gel (F.M.C.) electrophoresis and stained
with ethidium bromide. The bands were quantified using a
densitometry program (Advanced American Biotechnology).
[0683] The results measured the expression levels of UHR-1 and
ligand polypeptide mRNA in the tissues were shown in FIGS. 38 and
39 respectively. UHR-1 and ligand polypeptide mRNA were detected in
all the tissues tested. The highest level of UHR-1 mRNA expression
was detected in the pituitary, and moderate expression levels in
the brain, whereas poorly expressed in peripheral tissues except
for the adrenal glands. Ligand polypeptide mRNA expressed mainly in
the hypothalamus and dosal medulla among brain regions, and
expressed comparatively high levels in the lung, thymus, pancreas,
kidney, adrenal glands, and testis. These results show that the
UHR-1 and ligand polypeptide play a significant role for the
regulation of function in various tissues.
Example 37
[0684] Effect of 19P2-L31 on Glucose-Induced Increase in Plasma
Insulin Concentration
[0685] Male Wistar rats (8-10 w) were anesthetized by i.p.
injection of pentobarbital (65 mg/kg). Glucose alone (86 mg/rat) or
glucose and 19P2-L31 (675 pmol, 2.25 nmol, 6.75 nmol and 67.5
nmol/rat) were administered by bolus injection in the jugular vein.
Blood samples were withdrawn from the contralateral vein. Plasma
insulin concentration was determined with a radioimnunoassay kit
(Amersham).
[0686] Administration of 19P2-L31 at the doses of 675 pmol, 2.25
nmol, and 6.75 nmol partially inhibited glucose-induced sharp
increase (the first phase) in plasma insulin concentration at 2 min
postinjection and the blunt increase (the second phase) after 6 min
postinjection. It completely inhibited the first and second phase
of increase in insulin concentration at the dose of 67.5 nmol [FIG.
40].
Example 38
[0687] Effects of Ligand Polypeptide on Motor Activity of Mouse
[0688] The effects of administration of 19P1-L31 to mouse lateral
ventricle on motor activity were studied. The mature ICR male mice
(weight at operation: about 35 g) were anesthetized by
intraperitoneal administration of 50 mg/kg of pentobarbital, and
then fixed on a stereotaxic apparatus. The skull of a said mouse
was exposed, then a hole was made by dental drill for
guide-cannulization into the left lateral ventricle. The tip of a
stainless-steel guide-cannula (24G, length: 5 mm) for drug
injection to lateral ventricle, was inserted to the position of AP:
+0.6 mm (from bregma), L: left 1 mm and H: -1 mm (from dura
matter). The guide-cannula was fixed onto the skull with adhesive.
The cannula-implanted mice were housed as described above and were
used for behavioral analysis at least 3 days after the
operation.
[0689] Motor activity such as spontaneous motor activity and
rearing was measured while each mouse was in a transparent acrylic
cage (24.times.37.times.30 cm) within a soundproofed, illuminated
(light up: at 6-18 o'clock) box. Tap water and laboratory chow were
available ad libitum. Motor activity was measured by means of a
Supermex (Muromachi Kikai). Drugs and PBS were administered at
2:30.+-.30 p.m. At the administration, a stainless-steel
micro-injection cannula (30G, length: 6 mm) was inserted into the
guide-cannula. The micro-injection cannula was connected to a
microsyringe pump with Teflon tube, and injection of PBS or a
peptide dissolved in PBS lasted for 2 minutes at a speed of 2
.mu.l/min. The micro-injection cannula was withdrawn after over a
period of 2 minutes from end of injection, then motor activity was
meausred.
[0690] The results are expressed as a mean.+-.S.E.M. Student's t
test was used to determine the significance of differences between
values from the mice treated with a peptide and the PBS-injected
controls. For the purpose of this analysis, p<0.05 was assumed
to be the minimal level of significance.
[0691] As shown in [FIG. 41], administration of 10 nmol of 19P2-L31
caused a significant increase in spontaneous motor activity at
70-105 min after injection. Rearing behavior also showed
significant variation. While the administration of 1 nmol of
19P2-L31 did not cause statistically significant change of
spontaneous motor activity, rearing behavior showed a significant
decrease at only 105 min after injection [FIG. 42]. The
administration of 0.1 nmol of 19P2-L31 caused a significant
increase at 25 min, 40 min and 70 min after injection. In that
case, rearing behavior showed an increasing tendency similarly to
spontaneous motor activity, however that was not statistically
significant [FIG. 43]. The administration of 0.01 nmol of 19P2-L31
caused a significant increase at 20 min and 40 min after injection.
In that case, rearing behavior showed an increasing tendency
similarly to spontaneous motor activity, however that was not
statistically significant [FIG. 44].
Example 39
[0692] Effects of Ligand Polypeptide on Reserpine-Induced
Hypothermia in Mice
[0693] The mature ICR male mice (weight at operation: about 35 g)
were anesthetized by administration of pentobarbital (50 mg/kg,
i.p.), and then fixed on stereotaxic apparatus. The skull of a said
mouse was exposed, then a hole was made by dental drill for
guide-cannulization into the left lateral ventricle. The tip of a
stainless-steel guide-cannula (24G, length: 5 mm) for drug
injection to lateral ventricle, was inserted to the position of AP:
+0.6 mm (from bregma), L: left 1 mm and H: -1 mm (from dura
matter). The guide-cannula was fixed onto the skull with adhesive.
The cannula-implanted mice were housed as described above and were
used for measurements of body temperature at least 3 days after the
operation. Reserpine (Apoplon; Daiichi Pharmaceutical) was
administered to mice at a dose of 3 mg/kg, s.c., and after 15
hours, each mouse was placed in a cage for the measurement. Then a
stainless-steel micro-injection cannula (30G, length: 6 mm) was
inserted into the guide-cannula. The micro-injection cannula was
connected to a microsyringe pump with Teflon tube, and injection of
PBS or a peptide dissolved in PBS lasted for 2 minutes at a speed
of 1 .mu.l/min. The micro-injection cannula was withdrawn after
over a period of 2 minutes from end of injection, then the
temperature in rectum was measured.
[0694] The results are expressed as a mean.+-.S.E.M. Student's t
test was used to determine the significance of differences between
values from the mice treated with a peptide and the PBS-injected
controls. For the purpose of this analysis, p<0.05 was assumed
to be the minimal level of significance.
[0695] As shown in (FIG. 45), body temperature which was lowered by
reserpine increased significantly after a 10 nmol injection of
19P2-L31 in contrast to the control which PBS were administered.
This increase of body temperature reached a maximum level at 45 min
after administration of the peptide. On the other hand, there was
no statistically significant difference in temperature variation
between 1 nmol of 19P2-L31 and the PBS-injected control throughout
the experimental period.
Example 40
[0696] Effects of Ligand Polypeptide on Blood Pressure in Rats
[0697] The inventors explored the influence of injection of
19P2-L31 into the area postrema of medula oblongata on blood
pressure. Mature male Wistar rats (body weights at operation: ca
300 g) were anesthetized with pentobarbital 50 mg/kg i.p. and each
animal was immobilized in a rat brain stereotaxic apparatus. The
incisor bar was lowered by 3.3 mm from the interaural line. The
skull was exposed, and using a dental drill a hole was made on the
skull for implantation of a guide cannula. In addition, anchor
screws were buried in two positions around the drilled hole. A
stainless-steel guide cannula, AG-12 (0.4 mm inside dia., 0.5 mm
out. dia., EICOM), was inserted in such a manner that its leading
end would be situated in the upper part of the area postrema. For
this purpose, the guide cannula was instered from a forward
direction at an angle of 200 with the perpendicular (FIG. 46; Note,
however, that the drawing shows a microinjection cannula 1.0 mm
longer than the guide cannula). With reference to the atlas of
Paxinos and Watson (1986), the stereotaxic coordinates were AP:
-6.0 mm (from interaural line), L: 0.0 mm, and H: +1.5 mm (from
interaural line). The guide cannula was secured to the skull using
an instant adhesive, a dental cement, and anchor pieces. A
stainless-steel dummy cannula, AD-12 (0.35 mm out. dia., EICOM),
was inserted into the guide cannula and locked in position with a
cap nut (EICOM). Thereafter, the rats were kept in individual
cages.
[0698] About a week of feeding after implantation of the guide
cannula for postoperative recuperation, an operation was performed
for measurements of blood pressure in conscious state. The rat
described above was anesthetized with pentobarbital 50 mg/kg i.p.
and immobilized in spine position on a necropsy pad and the left
femoral artery was exposed. Polyethylene tubing, SP35 (0.5 mm in.
dia., 0.9 mm out. dia., Natsume Seisakusho), was cut to about 60 cm
in length and filled with 200 U/ml heparin-containing saline. This
tube was inserted about 2.5 cm deep into the femoral artery and
secured in position. The free end of the tube was passed under the
dorsal skin and exposed in the cervical region (dorsal side).
[0699] After waiting overnight postoperatively, the polyethylene
tube was connected to a transducer (Spectramed) and the blood
pressure was measured. After blood pressure readings became steady,
the cap nut and dummy cannula were removed from the rat skull and,
instead, a stainless steel microinjection cannula (0.17 mm in.
dia., 0.35 mm out. dia., EICOM) connected to a Teflon tube (50 cm
long, 0.1 mm in. dia., 0.4 mm out. dia., EICOM) was inserted. The
length of the microinjection cannula was adjusted beforehand so
that its tip would extend 1 mm from the guide cannula (FIG. 46).
One end of the Teflon tube was connected to a microsyringe pump and
either PBS or 19P2-L31 dissolved in PBS was injected, in a total
volume of 2 .mu.l, into the area postrema at a flow rate of 1.0
.mu.l/min.
[0700] After measurement of blood pressure, the micro-injection
cannula used for injection of 19P2-L31 was disconnected and
replaced with a microinjection cannula for injection of a stain
(Evans Blue) solution. The stain was infused at the same rate of
1.0 .mu.l/min as the injection of 19P2-L31 for 2 minutes. After a
standby time of about 3 minutes, the microinjection cannula was
disconnected. The rat was decapitated and the brain was quickly
removed and frozen. The brains were cut serial frontal sections on
cryostat and the position of dye infusion was confirmed.
[0701] Results of the above experiment showed that injection of 10
nmol of 19P2-L31 into the area postrema of medula oblongata caused
an elevation of blood pressure. Typical examples of direct and mean
blood pressure are shown in FIG. 47.
Example 41
[0702] Effects of Ligand Polypeptide on Plasma Pituitary Hormone
Level
[0703] The inventors explored the effect of 19P2-L31 administered
into the third ventricle on pituitary hormone levels in the plasma.
Mature male Wistar rats (body weights at operation: 290-350 g) were
anesthetized with pentobarbital, 50 mg/kg i.p., and each
immobilized in a rat brain stereotaxic apparatus. The incisor bar
was set 3.3 mm lower from the interaural line. The skull was
exposed, and using a dental drill a hole was made on the bone for
implantation of a guide cannula. In addition, an anchor screw was
buried in one position around the hole. A stainless-steel guide
cannula, AG-12 (0.4 mm in. dia., 0.5 mm out. dia., EICOM), was
inserted in such a manner that its tip would be situated in the
upper part of the third ventricle. With reference to the atlas of
Paxinos and Watson (1986), the stereotaxic coordinates were AP:
+7.2 mm (from interaural line), L: 0.0 mm, and H: +2.0 mm (from
interaural line). The guide cannula was secured to the skull using
an instant adhesive, a dental cement, and an anchor piece. A
stainless-steel dummy cannula, AD-12 (0.35 mm out. dia., EICOM),
was then passed through the guide cannula and locked in position
with a cap nut (EICOM). After the operation the rats were housed in
individual cages and kept for at least 3 days for recuperation
before starting the experiment.
[0704] The operated rat was anesthetized with pentobarbital 50
mg/kg i.p. and immobilized in dorsal position. After the bilateral
jugular veins were exposed, 400 .mu.l of blood was drawn using a 1
ml tuberculin syringe and a 24-G needle (both by Termo). To prevent
clotting, the syringe was filled with 20 .mu.l of saline containing
200 U/ml of heparin beforehand. The cap nut and dummy cannula were
removed from the rat skull and, instead, a stainless steel
microinjection cannula (0.17 mm in. dia., 0.35 mm out. dia., EICOM)
connected to Teflon tube (50 cm long, 0.1 mm in. dia., 0.4 mm out.
dia., EICOM) was inserted. The length of the microinjection cannula
was adjusted beforehand so that its tip would be emergent from the
guide cannula by 1 mm. One end of the Teflon tube was connected to
a microsyringe pump and either PBS or 19P2-L31 dissolved in PBS was
injected, in a total volume of 10 .mu.l, into the third ventricle
at a flow rate of 2.5 .mu.l/min. After a standby time of 1 minute
following infusion, the microinjection cannula was disconnected and
the dummy cannula was reinstated and locked in position with a cap
nut. Immediately before initiation of intraventricular
administration and 10, 20, 30, 40, and 60 minutes after initiation
of administration, 400 .mu.l portions of blood were drawn from the
jugular vein. Each blood sample was centrifuged (5,000 rpm, 10
min.) with a high-speed refrigerated microcentrifuge (MR-150, Tommy
Seiko) and the supernatant (plasma) was recovered. The amounts of
pituitary hormones [prolactin, luteinizing hormone (LH),
adrenocorticotropic hormone (ACTH), thyroid-stimulating hormone
(TSH), and growth hormone (GH)] in the plasma were respectively
determined by radioimmunoassays.
[0705] The results were expressed as a mean.+-.S.E.M. To test for
significant difference between the group treated with 19P2-L31
dissolved in PBS and the control group treated with PBS alone,
Student's t-test was used. According to the two-tailed test,
p<0.05 was assumed to be the minimal level of significance. As
shown in FIG. 48, the plasma GH level was significantly decreased
at 20 minutes after administration of 50 nmol of 19P2-L31 into the
third ventricle, as compared with the control group. Tendencies
toward decrease were found at 10, 30, and 40 minutes after
administration as well but the changes were not statistically
significant. At 60 minutes after administration, there was no
difference from the control group. As to plasma prolactin, LH,
ACTH, and TSH, none showed significant changes.
Example 42
[0706] Effects of Ligand Polypeptide on plasma growth Hormone (GH)
Level in Freely Moving Rats
[0707] Mature male Wistar rats were anesthetized with pentobarbital
50 mg/kg i.p. and, as in Example 41, a stainless-steel guide
cannula AG-12 (0.4 mm in. dia., 0.5 mm out. dia., EICOM) was
implanted in position with its tip situated in the upper part of
the third ventricle. After the operation the rats were housed in
individual cages and kept for at least 3 days for recuperation and,
then, a cannula (30 cm long, 0.5 mm in. dia., 0.9 mm out. dia.,
Natsume Seisakusho) filled with heparin (200 U/ml)-containing
saline was inserted into the right atrium from the right jugular
vein under pentobarbital anesthesia. The rats were
maintained-overnight for complete arousal from anesthesia and then
transferred to transparent acrylic cages (30 cm.times.30
cm.times.35 cm). A 1 ml tuberculin syringe with a 24-G needle (both
by Termo) was connected to the cannula inserted in the atrium and
300 .mu.l of blood was drawn. To prevent clotting, the syringe was
filled with 20 .mu.l of saline containing 200 U/ml of heparin
beforehand. A stainless-steel microinjection cannula (0.17 mm in.
dia., 0.35 mm out. dia., EICOM) connected to Teflon tube (50 cm
long, 0.1 mm in. dia., 0.4 mm out. dia., EICOM) was inserted into
the guide cannula positioned in the third ventricle. The length of
the microinjection cannula was adjusted beforehand so that its tip
would be extend 1 mm from the guide cannula. One end of the Teflon
tube was connected to a microsyringe pump and either PBS or
19P2-L31 dissolved in PBS was injected, in a total volume of 10
.mu.l, into the third ventricle at a flow rate of 2.5 .mu.l/min.
Ten minutes after initiation of administration into the third
ventricle, 5 .mu.g/kg GHRH-saline was administered via the cannula
inserted into the atrium. Immediately before initiation of
intraventricular administration and 10, 20, 30, 40, and 60 minutes
after administration of GHRH, 300 .mu.l portions of blood were
drawn from the jugular vein. Each blood sample was centrifuged
(5,000 rpm, 10 min.) and the supernatant (plasma) was recovered.
The concentrations of GH in the plasma were determined by
radioimmunoassay.
[0708] The results were expressed as a mean.+-.S.E.M. To test for
significant difference between the group treated with 19P2-L31
dissolved in PBS and the control group treated with PBS alone,
Student's t-test was used. According to the two tailed test,
p<0.05 was assumed to be the minimal level of significance. As
shown in FIG. 49, administration of 5 .mu.g/kg of GHRH elevated the
plasma GH level. However, when 50 nmol of 19P2-L31 was administered
into the third ventricle, the GHRH-induced elevation of plasma GH
was significantly inhibited.
Example 43
[0709] Preparation of Rabbit Anti-Bovine 19P2-L31 Antibodies
[0710] Synthetic peptides containing partial 19P2-L31 sequence
(peptide-I: SRAHQHSMEIRTPDC (SEQ ID NO:92), peptide-II:
CAWYAGRGIRPVGRFNH.sub.2 (SEQ ID NO:93), and peptide-III:
CEIRTPDINPAWYAG (SEQ ID NO:94) were conjugated with KLH according
to the standard method. Each peptide conjugate (600 .mu.g as a
peptide) dissolved in saline was mixed with Freund's complete
adjuvant, and the resultant emulsion was subcutaneously injected
into three rabbits (NZW, male, 2.5 kg) respectively.
Hyperimmunization was carried out three times in total at the same
dose of the conjugate as the first injection with Freund's
imcomplete adjuvant every three weeks. Antibody titers were
determined as follows. Two weeks after the last immunization, blood
samples were obtained from the vein of the immunized rabbits
respectively. After being incubated at 37.degree. C. for 1 hour,
the blood samples were kept at 4.degree. C. over night. Sera were
then prepared by means of centrifugation. An aliquot (100 .mu.l) of
each serum sample diluted properly was introduced into 96-well
polystyrene microplates which were pre-coated with goat anti-rabbit
IgG (Fc) antibodies, and then the microplates were incubated at
4.degree. C. for 16 hours. After removing the sera, horse radish
peroxidase (HRP)-conjugated peptide-I, II, and III were added to
the wells respectively, and then the microplates were incubated at
room temperature for 4 hours. After removing the peptides, coloring
reaction was done by adding a substrate. The reaction was stopped
by adding 100 .mu.l of a stopping solution, and then the absorbance
at 450 nm in each well was measured. As shown in FIG. 50, serum
samples obtained from the rabbits after the immunization showed
binding activities to HRP-conjugated peptides respectively.
However, none of binding activities was detected in sera prepared
before the immunization. These results indicated that the rabbits
received the immunization produced antibodies against peptide-I,
II, and III, respectively. To prepare purified IgG antibody
fractions, sera obtained from the immunized rabbits was
percipitated with anmonium sulfate. The resultant precipitates were
dissolved in borate buffer, and then dialyzed with the same buffer.
The IgG fractions thus obtained were then subjected onto affinity
columns conjugated with peptide-1 or 19P2-L31 respectively. After
washing the columns with borate buffer and following with acetate
buffer (100 mM, pH 4.5), antibodies bound to the column were eluted
with glycine buffer (200 mM, pH 2.0). After being neutralized with
1M Tris, the eluents were used as purified antibodies
respectively.
Example 44
[0711] Inhibitory Activity of Antibodies Against the Release of
Arachidonic Acid Metabolites Induced by 19P2-L31
[0712] The purified antibodies prepared as described in Example 43
were tested their inhibitory activity against the release of
arachidonic acid metabolites induced by 19P2-L31. The antibodies
diluted as indicated in FIG. 51 were mixed with 19P2-L31
(5.times.10.sup.-10M) at room temperature for 1 hour, and then the
release of arachidonic acid metabolites was examined as described
in Example 11. As shown in FIG. 51, the highest inhibitory activity
was observed in anti-peptide-II antibodies.
Preparation Example 1
[0713] Fifty milligrams of the compound as obtained in Example 21
is dissolved in 50 ml of Japanese pharmacopoeial, distilled water
for injection, and Japanese pharmacopoeial, distilled water for
injection is added thereto to make 100 ml. The resulting solution
is filtered under a germ-free condition, and the filtrate of 1 ml
each is filled in vials for injection, freeze-dried and sealed
therein also under a germ-free condition.
Preparation Example 2
[0714] One hundred milligrams of the compound as obtained in
Example 21 is dissolved in 50 ml of Japanese pharmacopoeial,
distilled water for injection, and Japanese pharmacopoeial,
distilled water for injection is added thereto to make 100 ml. The
resulting solution is filtered under a germ-free condition, and the
filtrate of 1 ml each is filled in vials for injection,
freeze-dried and sealed therein also under a germ-free
condition.
[0715] [Evaluation of the Physiological Activities of Ligand
Polypeptide of the Present Invention]
[0716] The above examples 37-41 demonstrate that topical
administration of ligand polypeptide induces enhancement of
spontaneous motor activity and rearing behavior, elevation of body
temperature and blood pressure, and decrease in plasma growth
hormone concentration. These findings relating to physiological
activities are the first proof of various prominent physiologic
changes which occur when ligand polypeptide acts on the central
nervous system.
[0717] Since ligand polypeptide of the present invention, inclusive
of its salt, acts on the central nervous systems of warm-blooded
animals (e.g. rat, mouse, guinea pig, chicken, rabbit, dog, swine,
bovine, sheep, monkey, and man) to induce a variety of
pharmacological changes, it is showed that the ligand and salt have
the property to alter the intracranial nervous system and endocrine
system.
[0718] When 19P2-L31 was administered into the lateral ventricle of
mice, an increase in the amount of activity was found at the level
of 0.01-10 nmol. This fact shows that ligand polypeptide triggers
changes in the motor system via the G protein-coupled receptors of
the central nervous system. It was also found that administration
of the peptide into the lateral ventricle of mice results in
elevation of body temperature and that administration into the area
postrema of medula oblongata of rats results in elevation of blood
pressure. These actions resemble the pharmacologic actions of known
central stimulants (e.g. amphetamine, cocaine, methylphenidate,
etc.). Therefore, it is showed that ligand polypeptide or a salt
thereof releases biologic amines (dopamine, noradrenaline,
serotonin) from the nerve ending reservoirs, in the main (Michio
Yuzuru and Takeo Yoshikawa, Medical Science, 42, 535-536,
1991).
[0719] Furthermore, when 19P2-L31 was injected into the third
ventricle of rats, the plasma growth hormone level was depressed.
This finding shows that this peptide acts on the hypothalamus and
is associated with secretion of pituitary hormones via the
hypothalamopituitary system. It is also possible that this peptide
directly act on the pituitary so as to suppress the release of
growth hormone. Growth hormone releasing hormone (GHRH) which
regulates secretion of growth hormone from the hypophysis as well
as somatostatin exists in the neighborhood of the third ventricle
(Masahiro Tohyama et al., Kagakuteki Shinkeikino Kaibogaku
(Chemical Neuroanatomy), 167-216, 1987). Therefore, it is showed
that 19P2-L31 is modulating release of these substances.
[0720] The above facts show that ligand polypeptide is a peptide
acting on the central nervous system to control the autonomous
nervous system. The fact that the mRNA of this peptide and of its
receptor is expressed at high levels in the hypothalamus and medula
oblongata also shows the involvement of ligand polypeptide in the
modulation of the autonomous nervous system. In fact, the superior
center of autonomous nerve peripherals is the medula oblongata and
hypothalamus, where as already elucidated the sympathetic nervous
system and the parasympathetic nervous system are integrated to
play an important role in both neural regulation and humoral
regulation.
[0721] The above findings indicate the usefulness of ligand
polypeptide or an agonist of ligand polypeptide, or a salt thereof,
as a central nervous system stimulant causing enhancement of
spontaneous motor activity. Thus, the peptide can be used as a
prophylactic and/or therapeutic drug for a variety of diseases such
as senile dementia, cerebrovascular dementia (dementia due to
cerebrovascular disorder), dementia associated with
phylodegenerative retroplastic diseases (e.g. Alzheimer's disease,
Parkinson's disease, Pick's disease, Huntington's disease, etc.),
dementia due to infectious diseases (e.g. delayed viral infections
such as Creutzfelt-Jakob disease), dementia associated with
endocrine, metabolic, and toxic diseases (e.g. hypothyroidism,
vitamin B12 deficiency, alcoholism, and poisoning due to various
drugs, metals, or organic compounds), dementia associated with
oncogenous diseases (e.g. brain tumor), dementia due to traumatic
diseases (e.g. chronic subdural hematoma), depression
(melancholia), hyperkinetic (microencephalopathy) syndrome, or
disturbance of consciousness. On the other hand, an antagonist of
19P2 ligand or a salt thereof is of value as a CNS deppressant, for
instance, and can be used as an antipsychotic drug, an
anti-Huntigton's disease drug, an antianxiety drug, or a
hypnotic-sedative.
[0722] It was made clear that injection of ligand polypeptide into
the area postrema of medula oblongata elevates the blood pressure.
Therefore, ligand polypeptide or an agonist of ligand polypeptide,
or a salt thereof, is of value as a vasopressor. On the other hand,
a ligand polypeptide antagonist or a salt thereof is of value as a
depressor.
[0723] It was found that when ligand polypeptide acts on the
hypothalamus, the plasma growth hormone level is depressed.
Hypersecretion of growth hormone triggers somatomegaly and
acromegalic gigantism (Katamasu et al., Endocrine Syndrome, 78-80,
1993; Hiroi et al., Endocrine Syndrome, 149-151, 1993). Therefore,
ligand polypeptide or a ligand polypeptide antagonist, or a salt
thereof, can be used as a prophylactic and/or therapeutic drug for
somatomegaly and acromegalic gigantism. Moreover, growth hormone
promotes release of glucose from the liver and inhibits the uptake
of glucose by muscles and adipose tissues from the blood, causing
hyperglycemia and diabetes [Eiji Kobayashi, Naibumpi Gensho
(Endocrine Phenomena), 1980]. In fact, the secretion of growth
hormone is elevated in diabetic patients (Hiroshi Kiyono,
Endocrinology and Metabolic Diseases, 385-402, 1994). Therefore,
ligand polypeptide or an agonist of ligand polypeptide, or a salt
thereof, can be used as a prophylactic and/or therapeutic drug for
diabetes, for instance.
[0724] On the other hand, an antagonist of ligand polypeptide
promotes secretion of growth hormone. Therefore, a ligand
polypeptide antagonist or a salt thereof can be used as a
prophylactic and/or therapeutic drug for pituitarism leading to a
depressed growth hormone level, pituitary dwarfism, and
hypoglycemia. Moreover, growth hormone and insulin-like growth
factor secreted by growth hormone are effective in amyotrophic
lateral sclerosis, osteoporosis, renal failure, and improvement in
postoperative nutritional status (Shizume et al., Endocrine
Syndrome, 84-87, 1993, Nikkei Bio-Annal 96, 453-454, 1996; Tobiume
et al., Clinical Endocrinology, 44, 1205-1214, 1996). Therefore, a
ligand polypeptide antagonist or its salt can be used as a
prophylactic and/or therapeutic drug for such illnesses.
Sequence CWU 1
1
* * * * *