U.S. patent application number 11/101271 was filed with the patent office on 2005-08-04 for target molecule attachment to surfaces.
This patent application is currently assigned to SurModics, Inc.. Invention is credited to Chappa, Ralph A., Guire, Patrick E., Hu, Sheau-Ping, Swan, Dale G., Swanson, Melvin J..
Application Number | 20050170427 11/101271 |
Document ID | / |
Family ID | 22854960 |
Filed Date | 2005-08-04 |
United States Patent
Application |
20050170427 |
Kind Code |
A1 |
Chappa, Ralph A. ; et
al. |
August 4, 2005 |
Target molecule attachment to surfaces
Abstract
Method and reagent composition for covalent attachment of target
molecules, such as nucleic acids, onto the surface of a substrate.
The reagent composition includes groups capable of covalently
binding to the target molecule. Optionally, the composition can
contain photoreactive groups for use in attaching the reagent
composition to the surface. The reagent composition can be used to
provide activated slides for use in preparing microarrays of
nucleic acids.
Inventors: |
Chappa, Ralph A.; (Prior
Lake, MN) ; Hu, Sheau-Ping; (Falcon Heights, MN)
; Swan, Dale G.; (St. Louis Park, MN) ; Swanson,
Melvin J.; (Carver, MN) ; Guire, Patrick E.;
(Eden Prairie, MN) |
Correspondence
Address: |
MERCHANT & GOULD PC
P.O. BOX 2903
MINNEAPOLIS
MN
55402-0903
US
|
Assignee: |
SurModics, Inc.
Eden Prairie
MN
|
Family ID: |
22854960 |
Appl. No.: |
11/101271 |
Filed: |
April 6, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11101271 |
Apr 6, 2005 |
|
|
|
10192917 |
Jul 9, 2002 |
|
|
|
10192917 |
Jul 9, 2002 |
|
|
|
09227913 |
Jan 8, 1999 |
|
|
|
6465178 |
|
|
|
|
09227913 |
Jan 8, 1999 |
|
|
|
08940213 |
Sep 30, 1997 |
|
|
|
5858653 |
|
|
|
|
Current U.S.
Class: |
435/6.15 ;
435/287.2; 536/25.32 |
Current CPC
Class: |
B01J 2219/00722
20130101; B01J 2219/00659 20130101; C07C 45/63 20130101; B01J
2219/00677 20130101; C07C 323/42 20130101; C12Q 1/6834 20130101;
B01J 2219/00612 20130101; C07B 2200/11 20130101; B01J 2219/00608
20130101; C07C 235/84 20130101; B01J 2219/00605 20130101; C40B
40/06 20130101; B01J 2219/00531 20130101; B01J 2219/0061 20130101;
C07C 49/813 20130101; C40B 60/14 20130101; C07C 45/63 20130101;
B82Y 30/00 20130101; B01J 2219/00317 20130101; B01J 2219/00711
20130101; B01J 2219/00635 20130101; C07H 21/00 20130101; B01J
2219/00716 20130101; B01J 2219/00626 20130101; B01J 2219/00621
20130101; B01J 2219/00637 20130101 |
Class at
Publication: |
435/006 ;
435/287.2; 536/025.32 |
International
Class: |
C12Q 001/68; C07H
021/04; C12M 001/34 |
Claims
What is claimed is:
1. A method comprising the steps of: a. providing a support; b.
disposing a reagent composition on the support, wherein the reagent
composition comprises a polymeric backbone having more than one
thermochemically amine-reactive or sulfhydryl-reactive groups
attached thereto, and wherein the reagent composition is configured
and arranged to form covalent bonds with functional groups on a
target molecule without use of attracting groups to attract the
target molecule to the reagent composition; c. coupling the reagent
composition to the support surface to form a reagent
composition-coupled support surface; and d. disposing at least one
target molecule on the reagent composition-coupled support surface,
wherein the functional groups of the target molecule forms covalent
bonds with the reagent composition.
2. The method according to claim 1 wherein the target molecule is a
biomolecule.
3. The method according to claim 2 wherein the biomolecule is a
nucleic acid.
4. The method according to claim 3 wherein the nucleic acid
comprises one or more functional groups selected from the group
consisting of amine and sulfhydryl groups.
5. The method according to claim 1 wherein the reagent composition
comprises one or more photoreactive groups.
6. The method according to claim 5 wherein the photoreactive groups
are photoreactive aryl ketones selected from the group consisting
of acetophenone, benzophenone, anthraquinone, anthrone, and
heterocyclic analogs of anthrone.
7. The method according to claim 5 wherein the thermochemically
reactive groups and photoreactive groups are pendent from the
polymeric backbone of the reagent composition.
8. The method according to claim 1 wherein the polymeric backbone
of the reagent composition is selected from the group consisting of
acrylics, vinyls, nylons, polyurethanes, and polyethers.
9. The method according to claim 1 wherein the thermochemically
reactive groups are selected from the group consisting of activated
esters, epoxides, azlactones, activated hydroxyls, and
maleimide.
10. The method according to claim 1 wherein the support is selected
from the group consisting of plastic, silicon hydride, or
organosilane-pretreated glass or silicone slides.
11. The method according to claim 1 wherein the support comprises
crystalline thermoplastics or amorphous thermoplastics.
12. The method according to claim 1 wherein the step of disposing
at least one target molecule is performed with a printing
apparatus.
13. The method according to claim 1 wherein the step of disposing
at least one target molecule comprises disposing a plurality of
different target molecules on the reagent composition-coupled
support surface.
14. The method according to claim 13 performed to fabricate a
microarray.
15. A method according to claim 14 wherein the microarray includes
regions of disposed target molecules which are generally circular
in shape, have a diameter of between about 10 microns and about 500
microns, and are separated from other regions in the array by
center to center spacing of about 20 microns to about 1000
microns.
16. The method according to claim 1 where, in the step of disposing
at least one target molecule, the target molecule is disposed on
the reagent composition-coupled support surface in a sample having
a volume of twenty nanoliters or less.
17. The method according to claim 1 where, in the step of disposing
at least one target molecule, the target molecule is disposed on
the reagent composition-coupled support surface in a quantity in
the range of 0.1 femtomoles to 10 nanomoles.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a divisional application of U.S.
application Ser. No. 10/192,917, filed Jul. 9, 2002; which is a
divisional application of U.S. application Ser. No. 09/227,913,
filed Jan. 8, 1999, now U.S. Pat. No. 6,465,178; which is a
continuation-in-part application of U.S. application Ser. No.
08/940,213, filed Sep. 30, 1997, now U.S. Pat. No. 5,858,653, the
disclosures of which are incorporated in their entirety herein by
reference.
TECHNICAL FIELD
[0002] The present invention relates to methods for attaching
target molecules such as oligonucleotides (oligos) to a surface,
and to compositions for use in such methods. In another aspect, the
invention relates to the resultant coated surfaces themselves. In
yet another aspect, the invention relates to the use of
photochemical and thermochemical means to attach molecules to a
surface.
BACKGROUND OF THE INVENTION
[0003] The immobilization of deoxyribonucleic acid (DNA) onto
support surfaces has become an important aspect in the development
of DNA-based assay systems as well as for other purposes, including
the development of microfabricated arrays for DNA analysis. See,
for instance, "Microchip Arrays Put DNA on the Spot", R. Service,
Science 282(5388): 396-399, 16 Oct. 1998; and "Fomenting a
Revolution, in Miniature", I. Amato, Science 282(5388): 402-405, 16
Oct. 1998.
[0004] See also, "The Development of Microfabricated Arrays of DNA
Sequencing and Analysis", O'Donnell-Maloney et al., TIBTECH 14:
401-407 (1996). Generally, such procedures are carried out on the
surface of microwell plates, tubes, beads, microscope slides,
silicon wafers or membranes. Certain approaches, in particular,
have been developed to enable or improve the likelihood of
end-point attachment of a synthetic oligonucleotide to a surface.
End-point attachment (i.e., with the nucleic acid sequence attached
through one or the other terminal nucleotide) is desirable because
the entire length of the sequence will be available for
hybridization to another nucleic acid sequence. This is
particularly advantageous for the detection of single base pair
changes under stringent hybridization conditions.
[0005] Hybridization is the method used most routinely to measure
nucleic acids by base pairing to probes immobilized on a solid
support. When combined with amplification techniques such as the
polymerase chain reaction (PCR) or ligase chain reaction (LCR),
hybridization assays are a powerful tool for diagnosis and
research. Microwell plates, in particular, are convenient and
useful for assaying relatively large numbers of samples. Several
methods have been used for immobilization of nucleic acid probes
onto microwell plates. Some of these involve adsorption of
unmodified or modified oligonucleotides onto polystyrene plates.
Others involve covalent immobilization. Various methods have also
been used to increase the sensitivity of hybridization assays.
Polymeric capture probes (also known as target molecules) and
detection probes have been synthesized and used to obtain
sensitivities down to 10.sup.7 DNA molecules/ml. Another method
used branched oligonucleotides to increase the sensitivity of
hybridization assays. Yet another method used a multi-step
antibody-enhanced method. Other types of nucleic acid probes such
as ribonucleic acid (RNA), complementary DNA (cDNA) and peptide
nucleic acids (PNA's) have also been immobilized onto microwell
plates for hybridization of PCR products in diagnostic
applications. Furthermore, PCR primers have been immobilized onto
microwell plates for solid phase PCR.
[0006] Only a relative few approaches to immobilizing DNA, to date,
have found their way into commercial products. One such product is
known as "NucleoLink.TM.", and is available from Nalge Nunc
International (see, e.g., Nunc Tech Note Vol. 3, No. 17). In this
product, the DNA is reacted with a carbodiimide to activate
5'-phosphate groups which then react with functional groups on the
surface. Disadvantages of this approach are that it requires the
extra step of adding the carbodiimide reagent as well as a five
hour reaction time for immobilization of DNA, and it is limited to
a single type of substrate material.
[0007] As another example, Pierce has recently introduced a
proprietary DNA immobilization product known as "Reacti-BindTM.TM.
DNA Coating Solutions" (see "Instructions--Reacti-Bind.TM. DNA
Coating Solution" 1/1997). This product is a solution that is mixed
with DNA and applied to surfaces such as polystyrene or
polypropylene. After overnight incubation, the solution is removed,
the surface washed with buffer and dried, after which it is ready
for hybridization. Although the product literature describes it as
being useful for all common plastic surfaces used in the
laboratory, it does have some limitations. For example, Applicants
were not able to demonstrate useful immobilization of DNA onto
polypropylene using the manufacturer's instructions. Furthermore,
this product requires large amounts of DNA. The instructions
indicate that the DNA should be used at a concentration between 0.5
and 5 .mu.g/ml.
[0008] Similarly, Costar sells a product called "DNA-BIND.TM." for
use in attaching DNA to the surface of a well in a microwell plate
(see, e.g., the DNA-BIND.TM. "Application Guide"). The surface of
the DNA-BIND.TM. plate is coated with an uncharged, nonpolymeric
heterobifunctional reagent containing an N-oxysuccinimide (NOS)
reactive group. This group reacts with nucleophiles such as primary
amines. The heterobifunctional coating reagent also contains a
photochemical group and spacer arm which covalently links the
reactive group to the surface of the polystyrene plate. Thereafter,
amine-modified DNA can be covalently coupled to the NOS surface.
The DNA is modified by adding a primary amine either during the
synthesis process to the nascent oligomer or enzymatically to the
preformed sequence. Since the DNA-BIND.TM. product is polystyrene
based, it is of limited use for those applications that require
elevated temperatures such as thermal cycling.
[0009] These various products may be useful for some purposes, or
under certain circumstances, but all tend to suffer from one or
more drawbacks and constraints. In particular, they either tend to
require large amounts of oligonucleotide, render background noise
levels that are unsuitably high and/or lack versatility.
[0010] International Patent Application No. PCT/US98/20140,
assigned to the assignee of the present application, describes and
claims, inter alia, a reagent composition for attaching a target
molecule to the surface of a substrate, the reagent composition
comprising one or more groups for attracting the target molecule to
the reagent, and one or more thermochemically reactive groups for
forming covalent bonds with corresponding functional groups on the
attracted target molecule. Optionally, the composition further
provides photogroups for use in attaching the composition to a
surface. In one embodiment, for instance, a plurality of
photogroups and a plurality of cationic groups (in the form of
quaternary ammonium groups) are attached to a hydrophilic polymer
backbone. This polymer can then be coimmobilized with a second
polymer backbone that provides the above-described thermochemically
reactive groups (e.g., N-oxysuccinimide ("NOS") groups) for
immobilization of target molecules.
[0011] While reagent compositions having both attracting groups and
thermochemically reactive groups, as described in the
above-captioned PCT application, remain useful and preferred for
many applications, Applicants also find that the attracting groups
may not be required under all circumstances. For instance, one
suitable process for preparing activated slides for microarrays
includes the steps of coating the slides with a reagent composition
of a type described in the PCT application (and particularly, one
having both attracting groups as well as photoreactive and
thermochemically reactive groups). The polymers are attached to the
slide by activation of the photoreactive groups, following by the
application of small volumes (e.g., several nanoliters or less) of
target molecules (e.g., oligonucleotides) using precision printing
techniques.
[0012] Once applied, the solvent used to deliver the
oligonucleotide is dried (as the oligonucleotides are attracted to
the bound polymer), and the slide incubated under conditions
suitable to permit the thermochemical coupling of the
oligonucleotide to the bound polymer. Thereafter, however, any
unbound oligonucleotide is typically washed off of the slide.
Applicants have found, however, that there occasionally remains a
detectable trail of unbound oligonucleotide, referred to as a
"comet effect", leading away from the spot. This trail is
presumably due to the attractive forces within the bound polymer
present on the slide surface that surrounds the spot, serving to
tie up the generally negatively charged oligonucleotide as it is
washed from the spot. This trail, in turn, can provide undesirable
and unduly high levels of background noise.
[0013] Applicants have found that under such circumstances (e.g.,
the application of small volumes directly to a generally flat
surface) polymeric reagents are preferably provided without the
presence of such attracting groups (though with the
thermochemically reactive groups and optional photogroups).
Suitable reagents of this type are disclosed in the above-captioned
co-pending PCT application. Such reagents, in turn, can be used to
coat oligonucleotides in a manner that provides an improved
combination of such properties as reduced background, small spot
size (e.g., increased contact angle), as compared to polymeric
reagents having charged attracting groups.
SUMMARY OF THE INVENTION
[0014] The present invention provides a method and reagent
composition for covalent attachment of target molecules onto the
surface of a substrate, such as microwell plates, tubes, beads,
microscope slides, silicon wafers or membranes. In one embodiment,
the method and composition are used to immobilize nucleic acid
probes onto plastic materials such as microwell plates, e.g., for
use in hybridization assays. In a preferred embodiment the method
and composition are adapted for use with substantially flat
surfaces, such as those provided by microscope slides and other
plastic, silicon hydride, or organosilane-pretreated glass or
silicone slide support surfaces. The reagent composition can then
be used to covalently attach a target molecule such as a
biomolecule (e.g., a nucleic acid) which in turn can be used for
specific binding reactions (e.g., to hybridize a nucleic acid to
its complementary strand).
[0015] Support surfaces can be prepared from a variety of
materials, including but not limited to plastic materials selected
from the group consisting of crystalline thermoplastics (e.g., high
and low density polyethylenes, polypropylenes, acetal resins,
nylons and thermoplastic polyesters) and amorphous thermoplastics
(e.g., polycarbonates and poly(methyl methacrylates). Suitable
plastic or glass materials provide a desired combination of such
properties as rigidity, toughness, resistance to long term
deformation, recovery from deformation on release of stress, and
resistance to thermal degradation.
[0016] A reagent composition of the invention contains one or more
thermochemically reactive groups (i.e., groups having a reaction
rate dependent on temperature). Suitable groups are selected from
the group consisting of activated esters (e.g., NOS), epoxide,
azlactone, activated hydroxyl and maleimide groups. Optionally, and
preferably, the composition can also contain one or more
photoreactive groups. Additionally, the reagent may comprise one or
more hydrophilic polymers, to which the thermochemically reactive
and/or photoreactive groups can be pendent. The photoreactive
groups (alternatively referred to herein as "photogroups") can be
used, for instance, to attach reagent molecules to the surface of
the support upon the application of a suitable energy source such
as light. The thermochemically reactive groups, in turn, can be
used to form covalent bonds with appropriate and complementary
functional groups on the target molecule.
[0017] Generally, the reagent molecules will first be attached to
the surface by activation of the photogroups, thereafter the target
molecule, (e.g., an oligonucleotide) is contacted with the bound
reagent under conditions suitable to permit it to come into binding
proximity with the bound polymer. The target molecule is
thermochemically coupled to the bound reagent by reaction between
the reactive groups of the bound reagent and appropriate functional
groups on the target molecule. The thermochemically reactive groups
and the ionic groups can either be on the same polymer or, for
instance, on different polymers that are coimmobilized onto the
surface. Optionally, and preferably, the target molecule can be
prepared or provided with functional groups tailored to groups of
the reagent molecule. During their synthesis, for instance, the
oligonucleotides can be prepared with functional groups such as
amines or sulfhydryl groups.
[0018] The invention further provides a method of attaching a
target molecule, such as an oligo, to a surface, by employing a
reagent as described herein. In turn, the invention provides a
surface having nucleic acids attached thereto by means of such a
reagent, as well as a material (e.g., microwell plate) that
provides such a surface. In yet another aspect, the invention
provides a composition comprising a reagent(s) of this invention in
combination with a target molecule that contains one or more
functional groups reactive with the thermochemically reactive
group(s) of the reagent.
[0019] Using such reagents, applicants have found that capture
probes can be covalently immobilized to a variety of surfaces,
including surfaces that would not otherwise adsorb the probes (such
as polypropylene and polyvinylchloride). The resulting surfaces
provide signals comparable to or better than those obtained with
modified oligonucleotides adsorbed onto polystyrene or
polycarbonate.
[0020] The present immobilization reagent and method can be used in
amplification methods in a manner that is simpler than those
previously reported, and can also provide improved surfaces for the
covalent immobilization of nucleophile-derivatized nucleic acids.
In addition to immobilized probes for amplification methods and
hybridization assays, the reagents of this invention may provide
improved nucleic acid immobilization for solid phase sequencing and
for immobilizing primers for PCR and other amplification
techniques.
DETAILED DESCRIPTION
[0021] A preferred reagent molecule of the present invention
comprises a hydrophilic backbone bearing one or more
thermochemically reactive groups useful for forming a covalent bond
with the corresponding functional group of the target molecule,
together with one or more photoreactive groups useful for attaching
the reagent to a surface.
[0022] In another embodiment of the invention, it is possible to
immobilize nucleic acid sequences without the use of the
photoreactive group. For instance, the surface of the material to
be coated can be provided with thermochemically reactive groups,
which can be used to immobilize hydrophilic polymers having
thermochemically reactive groups as described above. For example, a
surface may be treated with an ammonia plasma to introduce a
limited number of reactive amines on the surface of the material.
If this surface is then treated with a hydrophilic polymer having
thermochemically reactive groups (e.g., NOS groups), then the
polymer can be immobilized through reaction of the NOS groups with
corresponding amine groups on the surface. Preferably, the reactive
groups on the polymer are in excess relative to the corresponding
reactive groups on the surface to insure that a sufficient number
of these thermochemically reactive groups remain following the
immobilization to allow coupling with the nucleic acid
sequence.
[0023] While not intending to be bound by theory, it appears that
by virtue of the small spot size, as well as the kinetics and fluid
dynamics encountered in the use of reduced spot sizes, the
oligonucleotide is able to come into binding proximity with the
bound reagent without the need for the attracting groups described
above. When used for preparing microarrays, e.g., to attach capture
molecules (e.g., oligonucleotides or cDNA) to the microarray
surface, such capture molecules are generally delivered to the
surface in a volume of less than about 1 nanoliter per spot, using
printing pins adapted to form the spots into arrays having center
to center spacing of about 200 .mu.m to about 500 .mu.m.
[0024] Given their small volumes, the printed target arrays tend to
dry quickly, thus further affecting the coupling kinetics and
efficiency. Unlike the coupling of DNA from solution and onto the
surface of coated microplate wells, oligonucleotides printed in
arrays of extremely small spot sizes tend to dry quickly, thereby
altering the parameters affecting the manner in which the
oligonucleotides contact and couple with the support. In addition
to the design and handling of the printing pins, other factors can
also affect the spot size, and in turn, the ultimate hybridization
signals, including: salt concentrations, type of salts and wetting
agents in the printing buffer; hydrophobic/hydrophilic properties
of the surfaces; the size and/or concentration of the
oligonucleotide; and the drying environments.
[0025] As described herein (e.g., in Examples 25, 26 and 28),
coatings of reagents having both photogroups and thermochemically
reactive groups ("Photo-PA-PolyNOS"), as well as reagents having
those groups together with attracting groups (a mixture of
"Photo-PA-PolyNOS/Photo-PA-PolyQuat"- ) both provided useful and
specific immobilization of amine-modified DNA, with the choice
between the two approaches being largely dependent on the choice of
substrate (e.g., flat slide as opposed to microwell).
[0026] In a preferred embodiment, the reagent composition can be
used to prepare activated slides having the reagent composition
photochemically immobilized thereon. The slides can be stably
stored and used at a later date to prepare microarrays by
immobilizing amine-modified DNA. The coupling of the capture DNA to
the surface takes place at pH 8-9 in a humid environment following
printing the DNA solution in the form of small spots.
[0027] Activated slides of the present invention are particularly
well suited to replace conventional (e.g., silylated) glass slides
in the preparation of microarrays using manufacturing and
processing protocols, reagents and equipment such as micro-spotting
robots (e.g., as available from Cartesian), and a chipmaker
micro-spotting device (e.g., as available from TeleChem
International). Suitable spotting equipment and protocols are
commercially available, such as the "ArrayIt".TM. ChipMaker 3
spotting device. This product is said to represent an advanced
version of earlier micro-spotting technology, employing 48 printing
pins to deliver as many as 62,000 samples per solid substrate.
[0028] The use of such an instrument, in combination with
conventional (e.g., poly-1-lysine coated) slides, is well known in
the art. See, for instance, U.S. Pat. No. 5,087,522 (Brown et al.)
"Methods for Fabricating Microarrays of Biological Samples", and
the references cited therein, the disclosures of each of which are
incorporated herein by reference.
[0029] For instance, the method and system of the present invention
can be used to provide a substrate, such as a glass slide, with a
surface having one or more microarrays. Each microarray preferably
provides at least about 100/cm.sup.2 (and preferably at least about
1000/cm.sup.2) distinct target molecules (e.g., polynucleotide or
polypeptide biopolymers) in a surface area of less than about 1
cm.sup.2. Each distinct target molecule 1) is disposed at a
separate, defined position in the array, 2) has a length of at
least 10 subunits, 3) is present in a defined amount between about
0.1 femtomoles and about 10 nanomoles, and 4) is deposited in
selected volume in the volume range of about 0.01 nanoliters to
about 100 nanoliters. These regions (e.g., discrete spots) within
the array can be generally circular in shape, with a typical
diameter of between about 10 microns and about 500 microns (and
preferably between about 20 and about 200 microns). The regions are
also preferably separated from other regions in the array by about
the same distance (e.g., center to center spacing of about 20
microns to about 1000 microns). A plurality of analyte-specific
regions can be provided, such that each region includes a single,
and preferably different, analyte specific reagent ("target
molecule").
[0030] Those skilled in the art, given the present description,
will be able to identify and select suitable reagents depending on
the type of target molecule of interest. Target molecules include,
but are not limited to, plasmid DNA, cosmid DNA, bacteriophage DNA,
genomic DNA (includes, but not limited to yeast, viral, bacterial,
mammalian, insect), RNA, cDNA, PNA, and oligonucleotides.
[0031] A polymeric backbone can be either synthetic or naturally
occurring, and is preferably a synthetic polymer selected from the
group consisting of oligomers, homopolymers, and copolymers
resulting from addition or condensation polymerization. Naturally
occurring polymers, such as polysaccharides, polypeptides can be
used as well. Preferred backbones are biologically inert, in that
they do not provide a biological function that is inconsistent
with, or detrimental to, their use in the manner described.
[0032] Such polymer backbones can include acrylics such as those
polymerized from hydroxyethyl acrylate, hydroxyethyl methacrylate,
glyceryl acrylate, glyceryl methacrylate, acrylamide and
methacrylamide, vinyls such as polyvinyl pyrrolidone and polyvinyl
alcohol, nylons such as polycaprolactam, polylauryl lactam,
polyhexamethylene adipamide and polyhexamethylene dodecanediamide,
polyurethanes and polyethers (e.g., polyethylene oxides).
[0033] The polymeric backbones of the invention are chosen to
provide hydrophilic backbones capable of bearing the desired number
and type of thermochemically reactive groups, and optionally
photogroups, the combination dependent upon the reagent selected.
The polymeric backbone is also selected to provide a spacer between
the surface and the thermochemically reactive groups. In this
manner, the reagent can be bonded to a surface or to an adjacent
reagent molecule, to provide the other groups with sufficient
freedom of movement to demonstrate optimal activity. The polymer
backbones are preferably hydrophilic (e.g., water soluble), with
polyacrylamide and polyvinylpyrrolidone being particularly
preferred polymers.
[0034] Reagents of the invention carry one or more pendent latent
reactive (preferably photoreactive) groups covalently bound
(directly or indirectly) to the polymer backbone. Photoreactive
groups are defined herein, and preferred groups are sufficiently
stable to be stored under conditions in which they retain such
properties. See, e.g., U.S. Pat. No. 5,002,582, the disclosure of
which is incorporated herein by reference. Latent reactive groups
can be chosen that are responsive to various portions of the
electromagnetic spectrum, with those responsive to ultraviolet and
visible portions of the spectrum (referred to herein as
"photoreactive") being particularly preferred.
[0035] Photoreactive groups respond to specific applied external
stimuli to undergo active specie generation with resultant covalent
bonding to an adjacent chemical structure, e.g., as provided by the
same or a different molecule. Photoreactive groups are those groups
of atoms in a molecule that retain their covalent bonds unchanged
under conditions of storage but that, upon activation by an
external energy source, form covalent bonds with other
molecules.
[0036] The photoreactive groups generate active species such as
free radicals and particularly nitrenes, carbenes, and excited
states of ketones upon absorption of electromagnetic energy.
Photoreactive groups may be chosen to be responsive to various
portions of the electromagnetic spectrum, and photoreactive groups
that are responsive to e.g., ultraviolet and visible portions of
the spectrum are preferred and may be referred to herein
occasionally as "photochemical group" or "photogroup".
[0037] Photoreactive aryl ketones are preferred, such as
acetophenone, benzophenone, anthraquinone, anthrone, and
anthrone-like heterocycles (i.e., heterocyclic analogs of anthrone
such as those having N, O, or S in the 10-position), or their
substituted (e.g., ring substituted) derivatives. The functional
groups of such ketones are preferred since they are readily capable
of undergoing the activation/inactivation/reacti- vation cycle
described herein. Benzophenone is a particularly preferred
photoreactive moiety, since it is capable of photochemical
excitation with the initial formation of an excited singlet state
that undergoes intersystem crossing to the triplet state. The
excited triplet state can insert into carbon-hydrogen bonds by
abstraction of a hydrogen atom (from a support surface, for
example), thus creating a radical pair. Subsequent collapse of the
radical pair leads to formation of a new carbon-carbon bond. If a
reactive bond (e.g., carbon-hydrogen) is not available for bonding,
the ultraviolet light-induced excitation of the benzophenone group
is reversible and the molecule returns to ground state energy level
upon removal of the energy source. Photoactivatible aryl ketones
such as benzophenone and acetophenone are of particular importance
inasmuch as these groups are subject to multiple reactivation in
water and hence provide increased coating efficiency. Hence,
photoreactive aryl ketones are particularly preferred.
[0038] The azides constitute a preferred class of photoreactive
groups and include arylazides (C.sub.6R.sub.5N.sub.3) such as
phenyl azide and particularly 4-fluoro-3-nitrophenyl azide, acyl
azides (--CO--N.sub.3) such as benzoyl azide and p-methylbenzoyl
azide, azido formates (--O--CO--N.sub.3) such as ethyl
azidoformate, phenyl azidoformate, sulfonyl azides
(--SO.sub.2--N.sub.3) such as benzenesulfonyl azide, and phosphoryl
azides (RO).sub.2PON.sub.3 such as diphenyl phosphoryl azide and
diethyl phosphoryl azide. Diazo compounds constitute another class
of photoreactive groups and include diazoalkanes (--CHN.sub.2) such
as diazomethane and diphenyldiazomethane, diazoketones
(--CO--CHN.sub.2) such as diazoacetophenone and
t-trifluoromethyl-1-diazo-2-pentanone, diazoacetates
(--O--CO--CHN.sub.2) such as t-butyl diazoacetate and phenyl
diazoacetate, and beta-keto-alpha-diazoacetates
(--CO--CN.sub.2--CO--O--) such as t-butyl alpha diazoacetoacetate.
Other photoreactive groups include the diazirines (--CHN.sub.2)
such as 3-trifluoromethyl-3-phenyldiazirine, and ketenes
(--CH.dbd.C.dbd.O) such as ketene and diphenylketene.
Photoactivatible aryl ketones such as benzophenone and acetophenone
are of particular importance inasmuch as these groups are subject
to multiple reactivation in water and hence provide increased
coating efficiency.
[0039] Upon activation of the photoreactive groups, the reagent
molecules are covalently bound to each other and/or to the material
surface by covalent bonds through residues of the photoreactive
groups. Exemplary photoreactive groups, and their residues upon
activation, are shown as follows.
1 Photoreactive Group Residue Functionality aryl azides amine
R--NH--R' acyl azides amide R--CO--NH--R' azidoformates carbamate
R--O--CO--NH--R' sulfonyl azides sulfonamide R--SO.sub.2--NH--R'
phosphoryl azides phosphoramide (RO).sub.2PO--NH--R' diazoalkanes
new C--C bond diazoketones new C--C bond and ketone diazoacetates
new C--C bond and ester beta-keto-alpha- new C--C bond and beta-
diazoacetates ketoester aliphatic azo new C--C bond diazirines new
C--C bond ketenes new C--C bond photoativated new C--C bond and
alcohol ketones
[0040] Those skilled in the art, given the present description,
will be able to identify and select suitable thermochemically
reactive groups to provide for covalent immobilization of
appropriately derivatized nucleic acid sequences. For example, an
amino derivatized nucleic acid sequence will undergo a covalent
coupling reaction with an activated ester such as a NOS ester to
provide an amide linking group. Similar activated esters such
p-nitrophenyl and pentafluorophenyl esters would also provide amide
links when reacted with amine groups. Those skilled in the art
would also recognize numerous other amine-reactive functional
groups such as isocyanates, thioisocyanates, carboxylic acid
chlorides, epoxides, aldehydes, alkyl halides and sulfonate esters,
such as mesylate, tosylate and tresylate, each of which could serve
as the thermochemically reactive group.
[0041] In another example, the nucleic acid sequence can be
derivatized with a sulfhydryl group using techniques well known in
the art. The corresponding thermochemically reactive group would
be, for example, a maleimide ring structure or an
.alpha.-iodoacetamide. Either of these structures would react
readily to provide a covalent linkage with the sulfhydryl
derivatized nucleic acid sequence.
[0042] The functionalized polymers of this invention can be
prepared by appropriate derivatization of a preformed polymer or,
more preferably, by polymerization of a set of comonomers to give
the desired substitution pattern. The latter approach is preferred
because of the ease of changing the ratio of the various comonomers
and by the ability to control the level of incorporation into the
polymer. A combination of these two approaches can also be used to
provide optimal structures.
[0043] In a preferred embodiment, for instance, monomers are
prepared having a polymerizable group at one end of the molecule,
separated by a spacer group from a photoreactive or
thermochemically reactive group at the other end. For example,
polymerizable vinyl groups such as acrylamides, acrylates, or
maleimides can be coupled through a short hydrocarbon spacer to an
activated ester such as a NOS ester or to a photoreactive group
such as a substituted benzophenone. These compounds can be prepared
and purified using organic synthesis techniques well known to those
skilled in the art. Some of desired monomers are commercially
available, such as MAPTAC, N-[3-(dimethylamino)propyl]methac-
rylamide (DMAPMA), and N-(3-aminopropyl)methacrylamide
hydrochloride (APMA), these compounds providing quaternary ammonium
salts, tertiary amines, and primary amines respectively along the
backbone of the polymer.
[0044] Polymers and copolymers can be prepared from the above
monomers as well, using techniques known to those skilled in the
art. Preferably, these monomers and copolymers undergo free radical
polymerization of vinyl groups using azo initiators such as
2,2'-azobisisobutyronitrile (AIBN) or peroxides such as benzoyl
peroxide. The monomers selected for the polymerization are chosen
based on the nature of the final polymer product. For example, a
photoreactive polymer containing a NOS group is prepared from a
monomer containing the photoreactive group and a second monomer
containing the activated NOS ester.
[0045] The composition of the final polymer can be controlled by
mole ratio of the monomers charged to the polymerization reaction.
Typically these fictionalized monomers are used at relatively low
mole percentages of the total monomer content of the polymerization
reaction with the remainder of the composition consisting of a
monomer which is neither photoreactive nor thermochemically
reactive toward the nucleic acid sequence. Examples of such
monomers include, but are not limited to, acrylamide and
N-vinylpyrrolidone. Based on the relative reactivities of the
monomers used, the distribution of the monomers along the backbone
is largely random.
[0046] In some cases, the thermochemically reactive group on the
backbone of the polymer can itself act as polymerizable monomer, if
present during polymerization, thus requiring the introduction of
that group in a second step following the initial formation of the
polymer. For example, the preparation of a photoreactive polymer
having maleimide along the backbone can be accomplished by an
initial preparation of a polymer containing both photoreactive
groups and amine groups using the techniques described above,
followed by reaction of the amine groups with a heterobifunctional
molecule containing a maleimide group and an isocyanate connected
by a short hydrocarbon spacer. A wide variety of such polymer
modification techniques are available using typical organic
reactions known to those skilled in the art.
[0047] The invention will be further described with reference to
the following non-limiting Examples. It will be apparent to those
skilled in the art that many changes can be made in the embodiments
described without departing from the scope of the present
invention. Thus the scope of the present invention should not be
limited to the embodiments described in this application, but only
by embodiments described by the language of the claims and the
equivalents of those embodiments. Unless otherwise indicated, all
percentages are by weight. Structures of the various "Compounds"
identified throughout these Examples can be found in Table 13
included below. NMR analyses were run on a 80 Mhz spectrometer
unless otherwise stated.
EXAMPLES
Example 1
Preparation of 4-Benzoylbenzoyl Chloride (BBA-C1) (Compound I)
[0048] 4-Benzoylbenzoic acid (BBA), 1.0 kg (4.42 moles), was added
to a dry 5 liter Morton flask equipped with reflux condenser and
overhead stirrer, followed by the addition of 645 ml (8.84 moles)
of thionyl chloride and 725 ml of toluene. Dimethylformamide, 3.5
ml, was then added and the mixture was heated at reflux for 4
hours. After cooling, the solvents were removed under reduced
pressure and the residual thionyl chloride was removed by three
evaporations using 3.times.500 ml of toluene. The product was
recrystallized from 1:4 toluene: hexane to give 988 g (91% yield)
after drying in a vacuum oven. Product melting point was
92-94.degree. C. Nuclear magnetic resonance (NMR) analysis at 80
MHz (.sup.1H NMR (CDCl.sub.3)) was consistent with the desired
product: aromatic protons 7.20-8.25 (m, 9H). All chemical shift
values are in ppm downfield from a tetramethylsilane internal
standard. The final compound was stored for use in the preparation
of a monomer used in the synthesis of photoactivatable polymers as
described, for instance, in Example 3.
Example 2
Preparation of N-(3-Aminopropyl)methacrylamide Hydrochloride (APMA)
(Compound II)
[0049] A solution of 1,3-diaminopropane, 1910 g (25.77 moles), in
1000 ml of CH.sub.2Cl.sub.2 was added to a 12 liter Morton flask
and cooled on an ice bath. A solution of t-butyl phenyl carbonate,
1000 g (5.15 moles), in 250 ml of CH.sub.2Cl.sub.2 was then added
dropwise at a rate which kept the reaction temperature below
15.degree. C. Following the addition, the mixture was warmed to
room temperature and stirred 2 hours. The reaction mixture was
diluted with 900 ml of CH.sub.2Cl.sub.2 and 500 g of ice, followed
by the slow addition of 2500 ml of 2.2 N NaOH. After testing to
insure the solution was basic, the product was transferred to a
separatory funnel and the organic layer was removed and set aside
as extract #1. The aqueous was then extracted with 3.times.1250 ml
of CH.sub.2Cl.sub.2, keeping each extraction as a separate
fraction. The four organic extracts were then washed successively
with a single 1250 ml portion of 0.6 N NaOH beginning with fraction
#1 and proceeding through fraction #4. This wash procedure was
repeated a second time with a fresh 1250 ml portion of 0.6 N NaOH.
The organic extracts were then combined and dried over
Na.sub.2SO.sub.4. Filtration and evaporation of solvent to a
constant weight gave 825 g of N-mono-t-BOC-1,3-diaminopropane which
was used without further purification.
[0050] A solution of methacrylic anhydride, 806 g (5.23 moles), in
1020 ml of CHCl.sub.3 was placed in a 12 liter Morton flask
equipped with overhead stirrer and cooled on an ice bath.
Phenothiazine, 60 mg, was added as an inhibitor, followed by the
dropwise addition of N-mono-t-BOC-1,3-diaminopropane, 825 g (4.73
moles), in 825 ml of CHCl.sub.3. The rate of addition was
controlled to keep the reaction temperature below 10.degree. C. at
all times. After the addition was complete, the ice bath was
removed and the mixture was left to stir overnight. The product was
diluted with 2400 ml of water and transferred to a separatory
funnel. After thorough mixing, the aqueous layer was removed and
the organic layer was washed with 2400 ml of 2 N NaOH, insuring
that the aqueous layer was basic. The organic layer was then dried
over NaSO.sub.4 and filtered to remove drying agent. A portion of
the CHCl.sub.3 solvent was removed under reduced pressure until the
combined weight of the product and solvent was approximately 3000
g. The desired product was then precipitated by slow addition of
11.0 liters of hexane to the stirred CHCl.sub.3 solution, followed
by overnight storage at 4.degree. C. The product was isolated by
filtration and the solid was rinsed twice with a solvent
combination of 900 ml of hexane and 150 ml of CHCl.sub.3. Thorough
drying of the solid gave 900 g of
N-[N'-(t-butyloxycarbonyl)-3-aminopropyl]-methacrylamide, m.p.
85.8.degree. C. by DSC. Analysis on an NMR spectrometer was
consistent with the desired product: .sup.1H NMR (CDCl.sub.3) amide
NH's 6.30-6.80, 4.55-5.10 (m, 2H), vinyl protons 5.65, 5.20 (m,
2H), methylenes adjacent to N 2.90-3.45 (m, 4H), methyl 1.95 (m,
3H), remaining methylene 1.50-1.90 (m, 2H), and t-butyl 1.40 (s,
9H).
[0051] A 3-neck, 2 liter round bottom flask was equipped with an
overhead stirrer and gas sparge tube. Methanol, 700 ml, was added
to the flask and cooled on an ice bath. While stirring, HCl gas was
bubbled into the solvent at a rate of approximately 5 liters/minute
for a total of 40 minutes. The molarity of the final HCl/MeOH
solution was determined to be 8.5 M by titration with 1 N NaOH
using phenolphthalein as an indicator. The
N-[N'-(t-butyloxycarbonyl)-3-aminopropyl]methacrylamide, 900 g
(3.71 moles), was added to a 5 liter Morton flask equipped with an
overhead stirrer and gas outlet adapter, followed by the addition
of 1150 ml of methanol solvent. Some solids remained in the flask
with this solvent volume. Phenothiazine, 30 mg, was added as an
inhibitor, followed by the addition of 655 ml (5.57 moles) of the
8.5 M HCl/MeOH solution. The solids slowly dissolved with the
evolution of gas but the reaction was not exothermic. The mixture
was stirred overnight at room temperature to insure complete
reaction. Any solids were then removed by filtration and an
additional 30 mg of phenothiazine were added. The solvent was then
stripped under reduced pressure and the resulting solid residue was
azeotroped with 3.times.1000 ml of isopropanol with evaporation
under reduced pressure. Finally, the product was dissolved in 2000
ml of refluxing isopropanol and 4000 ml of ethyl acetate were added
slowly with stirring. The mixture was allowed to cool slowly and
was stored at 4.degree. C. overnight. Compound II was isolated by
filtration and was dried to constant weight, giving a yield of 630
g with a melting point of 124.7.degree. C. by DSC. Analysis on an
NMR spectrometer was consistent with the desired product: .sup.1H
NMR (D.sub.2O) vinyl protons 5.60, 5.30 (m, 2H), methylene adjacent
to amide N 3.30 (t, 2H), methylene adjacent to amine N 2.95 (t,
2H), methyl 1.90 (m, 3H), and remaining methylene 1.65-2.10 (m,
2H). The final compound was stored for use in the preparation of a
monomer used in the synthesis of photoactivatable polymers as
described, for instance, in Example 3.
Example 3
Preparation of N-[3-(4-Benzoylbenzamido)propyl]methacrylamide
(BBA-APMA) (Compound III)
[0052] Compound II 120 g (0.672 moles), prepared according to the
general method described in Example 2, was added to a dry 2 liter,
three-neck round bottom flask equipped with an overhead stirrer.
Phenothiazine, 23-25 mg, was added as an inhibitor, followed by 800
ml of chloroform. The suspension was cooled below 10.degree. C. on
an ice bath and 172.5 g (0.705 moles) of Compound I, prepared
according to the general method described in Example 1, were added
as a solid. Triethylamine, 207 ml (1.485 moles), in 50 ml of
chloroform was then added dropwise over a 1-1.5 hour time period.
The ice bath was removed and stirring at ambient temperature was
continued for 2.5 hours. The product was then washed with 600 ml of
0.3 N HCl and 2.times.300 ml of 0.07 N HCl. After drying over
sodium sulfate, the chloroform was removed under reduced pressure
and the product was recrystallized twice from 4:1
toluene:chloroform using 23-25 mg of phenothiazine in each
recrystallization to prevent polymerization. Typical yields of
Compound III were 90% with a melting point of 147-151.degree. C.
Analysis on an NMR spectrometer was consistent with the desired
product: .sup.1H NMR (CDCl.sub.3) aromatic protons 7.20-7.95 (m,
9H), amide NH 6.55 (broad t, 1H), vinyl protons 5.65, 5.25 (m, 2H),
methylene adjacent to amide N's 3.20-3.60 (m, 4H), methyl 1.95 (s,
3H), and remaining methylene 1.50-2.00 (m, 2H). The final compound
was stored for use in the synthesis of photoactivatable polymers as
described, for instance, in Examples 9-11.
Example 4
Preparation of N-Succinimidyl 6-Maleimidohexanoate (MAL-EAC-NOS)
(Compound IV)
[0053] A functionalized monomer was prepared in the following
manner, and was used as described in Examples 9 and 12 to introduce
activated ester groups on the backbone of a polymer.
6-Aminohexanoic acid, 100 g (0.762 moles), was dissolved in 300 ml
of acetic acid in a three-neck, 3 liter flask equipped with an
overhead stirrer and drying tube. Maleic anhydride, 78.5 g (0.801
moles), was dissolved in 200 ml of acetic acid and added to the
6-aminohexanoic acid solution. The mixture was stirred one hour
while heating on a boiling water bath, resulting in the formation
of a white solid. After cooling overnight at room temperature, the
solid was collected by filtration and rinsed with 2.times.50 ml of
hexane. After drying, the typical yield of the
(Z)-4-oxo-5-aza-2-undecend- ioic acid was 158-165 g (90-95%) with a
melting point of 160-165.degree. C. Analysis on an NMR spectrometer
was consistent with the desired product: .sup.1H NMR (DMSO-d.sub.6)
amide proton 8.65-9.05 (m, 1H), vinyl protons 6.10, 6.30 (d, 2H),
methylene adjacent to nitrogen 2.85-3.25 (m, 2H), methylene
adjacent to carbonyl 2.15 (t, 2H), and remaining methylenes
1.00-1.75 (m, 6H).
[0054] (Z)-4-Oxo-5-aza-2-undecendioic acid, 150.0 g (0.654 moles),
acetic anhydride, 68 ml (73.5 g, 0.721 moles), and phenothiazine,
500 mg, were added to a 2 liter three-neck round bottom flask
equipped with an overhead stirrer. Triethylamine, 91 ml (0.653
moles), and 600 ml of THF were added and the mixture was heated to
reflux while stirring. After a total of 4 hours of reflux, the dark
mixture was cooled to <60.degree. C. and poured into a solution
of 250 ml of 12 N HCl in 3 liters of water. The mixture was stirred
3 hours at room temperature and then was filtered through a
filtration pad (Celite 545, J. T. Baker, Jackson, Tenn.) to remove
solids. The filtrate was extracted with 4.times.500 ml of
chloroform and the combined extracts were dried over sodium
sulfate. After adding 15 mg of phenothiazine to prevent
polymerization, the solvent was removed under reduced pressure. The
6-maleimidohexanoic acid was recrystallized from 2:1
hexane:chloroform to give typical yields of 76-83 g (55-60%) with a
melting point of 81-85.degree. C. Analysis on a NMR spectrometer
was consistent with the desired product: .sup.1H NMR (CDCl.sub.3)
maleimide protons 6.55 (s, 2H), methylene adjacent to nitrogen 3.40
(t, 2H), methylene adjacent to carbonyl 2.30 (t, 2H), and remaining
methylenes 1.05-1.85 (m, 6H).
[0055] The 6-maleimidohexanoic acid, 20.0 g (94.7 mmol), was
dissolved in 100 ml of chloroform under an argon atmosphere,
followed by the addition of 41 ml (0.47 mol) of oxalyl chloride.
After stirring for 2 hours at room temperature, the solvent was
removed under reduced pressure with 4.times.25 ml of additional
chloroform used to remove the last of the excess oxalyl chloride.
The acid chloride was dissolved in 100 ml of chloroform, followed
by the addition of 12 g (0.104 mol) of N-hydroxysuccinimide and 16
ml (0.114 mol) of triethylamine. After stirring overnight at room
temperature, the product was washed with 4.times.100 ml of water
and dried over sodium sulfate. Removal of solvent gave 24 g of
product (82%) which was used without further purification. Analysis
on an NMR spectrometer was consistent with the desired product:
.sup.1H NMR (CDCl.sub.3) maleimide protons 6.60 (s, 2H), methylene
adjacent to nitrogen 3.45 (t, 2H), succinimidyl protons 2.80 (s,
4H), methylene adjacent to carbonyl 2.55 (t, 2H), and remaining
methylenes 1.15-2.00 (m, 6H). The final compound was stored for use
in the synthesis of photoactivatable polymers as described, for
instance, in Examples 9 and 12.
Example 5
Preparation of N-Succinimidyl 6-Methacrylamidohexanoate
(MA-EAC-NOS) (Compound V)
[0056] A functionalized monomer was prepared in the following
manner, and was used as described in Example 11 to introduce
activated ester groups on the backbone of a polymer. 6-Aminocaproic
acid, 4.00 g (30.5 mmol), was placed in a dry round bottom flask
equipped with a drying tube. Methacrylic anhydride, 5.16 g (33.5
mmol), was then added and the mixture was stirred at room
temperature for four hours. The resulting thick oil was triturated
three times with hexane and the remaining oil was dissolved in
chloroform, followed by drying over sodium sulfate. After
filtration and evaporation, a portion of the product was purified
by silica gel flash chromatography using a 10% methanol in
chloroform solvent system. The appropriate fractions were combined,
1 mg of phenothiazine was added, and the solvent was removed under
reduced pressure. Analysis on an NMR spectrometer was consistent
with the desired product: .sup.1H NMR (CDCl.sub.3) carboxylic acid
proton 7.80-8.20 (b, 1H), amide proton 5.80-6.25 (b, 1H), vinyl
protons 5.20 and 5.50 (m, 2H), methylene adjacent to nitrogen
3.00-3.45 (m, 2H), methylene adjacent to carbonyl 2.30 (t, 2H),
methyl group 1.95 (m, 3H), and remaining methylenes 1.10-1.90 (m,
6H). 6-Methacrylamidohexanoic acid, 3.03 g (15.2 mmol), was
dissolved in 30 ml of dry chloroform, followed by the addition of
1.92 g (16.7 mmol) of N-hydroxysuccinimide and 6.26 g (30.4 mmol)
of 1,3-dicyclohexylcarbodiimide. The reaction was stirred under a
dry atmosphere overnight at room temperature. The solid was then
removed by filtration and a portion was purified by silica gel
flash chromatography. Non-polar impurities were removed using a
chloroform solvent, followed by elution of the desired product
using a 10% tetrahydrofuran in chloroform solvent. The appropriate
fractions were pooled, 0.2 mg of phenothiazine were added, and the
solvent was evaporated under reduced pressure. This product,
containing small amounts of 1,3-dicyclohexylurea as an impurity,
was used without further purification. Analysis on an NMR
spectrometer was consistent with the desired product: .sup.1H NMR
(CDCl.sub.3) amide proton 5.60-6.10 (b, 1H), vinyl protons 5.20 and
5.50 (m, 2H), methylene adjacent to nitrogen 3.05-3.40 (m, 2H),
succinimidyl protons 2.80 (s, 4H), methylene adjacent to carbonyl
2.55 (t, 2H), methyl 1.90 (m, 3H), and remaining methylenes
1.10-1.90 (m, 6H). The final compound was stored for use in the
synthesis of photoactivatable polymers as described, for instance,
in Example 11.
Example 6
Preparation of 4-Bromomethylbenzophenone (BMBP) (Compound VI)
[0057] 4-Methylbenzophenone, 750 g (3.82 moles), was added to a 5
liter Morton flask equipped with an overhead stirrer and dissolved
in 2850 ml of benzene. The solution was then heated to reflux,
followed by the dropwise addition of 610 g (3.82 moles) of bromine
in 330 ml of benzene. The addition rate was approximately 1.5
ml/min and the flask was illuminated with a 90 watt (90 joule/sec)
halogen spotlight to initiate the reaction. A timer was used with
the lamp to provide a 10% duty cycle (on 5 seconds, off 40
seconds), followed in one hour by a 20% duty cycle (on 10 seconds,
off 40 seconds). At the end of the addition, the product was
analyzed by gas chromatography and was found to contain 71% of the
desired Compound VI, 8% of the dibromo product, and 20% unreacted
4-methylbenzophenone. After cooling, the reaction mixture was
washed with 10 g of sodium bisulfite in 100 ml of water, followed
by washing with 3.times.200 ml of water. The product was dried over
sodium sulfate and recrystallized twice from 1:3 toluene: hexane.
After drying under vacuum, 635 g of Compound VI were isolated,
providing a yield of 60% and having a melting point of
112-114.degree. C. Analysis on an NMR spectrometer was consistent
with the desired product: .sup.1H NMR (CDCl.sub.3) aromatic protons
7.20-7.80 (m, 9H) and benzylic protons 4.48 (s, 2H). The final
compound was stored for use in the preparation of a
photoactivatable chain transfer agent as described in Example
7.
Example 7
Preparation of
N-(2-Mercaptoethyl)-3,5,-bis(4-benzoylbenzoyloxy)benzamide
(Compound VI)
[0058] 3,5-Dihydroxybenzoic acid, 46.2 g (0.30 mol), was weighed
into a 250 ml flask equipped with a Soxhlet extractor and
condenser. Methanol, 48.6 ml, and concentrated sulfuric acid, 0.8
ml, were added to the flask and 48 g of 3A molecular sieves were
placed in the Soxhlet extractor. The extractor was filled with
methanol and the mixture was heated at reflux overnight. Gas
chromatographic analysis of the resulting product showed a 98%
conversion to the desired methyl ester. The solvent was removed
under reduced pressure to give approximately 59 g of crude product.
The product was used in the following step without further
purification. A small sample was previously purified for NMR
analysis, resulting in a spectrum consistent with the desired
product: .sup.1H NMR (DMSO-d.sub.6) aromatic protons 6.75 (d, 2H)
and 6.38 (t, 1H), and methyl ester 3.75 (s, 3H).
[0059] The entire methyl ester product from above was placed in a 2
liter flask with an overhead stirrer and condenser, followed by the
addition of 173.25 g (0.63 mol) of Compound VI, prepared according
to the general method described in Example 6, 207 g (1.50 mol) of
potassium carbonate, and 1200 ml of acetone. The resulting mixture
was then refluxed overnight to give complete reaction as indicated
by thin layer chromatography (TLC). The solids were removed by
filtration and the acetone was evaporated under reduced pressure to
give 49 g of crude product. The solids were diluted with 1 liter of
water and extracted with 3.times.1 liter of chloroform. The
extracts were combined with the acetone soluble fraction and dried
over sodium sulfate, yielding 177 g of crude product. The product
was recrystallized from acetonitrile to give 150.2 g of a white
solid, a 90% yield for the first two steps. Melting point of the
product was 131.5.degree. C. (DSC) and analysis on an NMR
spectrometer was consistent with the desired product: .sup.1H NMR
(CDCl.sub.3) aromatic protons 7.25-7.80 (m, 18H), 7.15 (d, 2H), and
6.70 (t, 1H), benzylic protons 5.05 (s, 4H), and methyl ester 3.85
(s, 3H).
[0060] The methyl 3,5-bis(4-benzoylbenzyloxy)benzoate, 60.05 g
(0.108 mol), was placed in a 2 liter flask, followed by the
addition of 120 ml of water, 480 ml of methanol, and 6.48 g (0.162
mol) of sodium hydroxide. The mixture was heated at reflux for
three hours to complete hydrolysis of the ester. After cooling, the
methanol was removed under reduced pressure and the sodium salt of
the acid was dissolved in 2400 ml of warm water. The acid was
precipitated using concentrated hydrochloric acid, filtered, washed
with water, and dried in a vacuum oven to give 58.2 g of a white
solid (99% yield). Melting point on the product was 188.3.degree.
C. (DSC) and analysis on an NMR spectrometer was consistent with
the desired product: .sup.1H NMR (DMSO-d.sub.6) aromatic protons
7.30-7.80 (m, 18H), 7.15 (d, 2H), and 6.90 (t, 1H), and benzylic
protons 5.22 (s, 4H).
[0061] The 3,5-bis(4-benzoylbenzyloxy)benzoic acid, 20.0 g (36.86
mmol), was added to a 250 ml flask, followed by 36 ml of toluene,
5.4 ml (74.0 mmol) of thionyl chloride, and 28 .mu.l of
N,N-dimethylformamide. The mixture was refluxed for four hours to
form the acid chloride. After cooling, the solvent and excess
thionyl chloride were removed under reduced pressure. Residual
thionyl chloride was removed by four additional evaporations using
20 ml of chloroform each. The crude material was recrystallized
from toluene to give 18.45 g of product, an 89% yield. Melting
point on the product was 126.9.degree. C. (DSC) and analysis on an
NMR spectrometer was consistent with the desired product: .sup.1H
NMR (CDCl.sub.3) aromatic protons 7.30-7.80 (m, 18H), 7.25 (d, 2H,
and 6.85 (t, 1H), and benzylic protons 5.10 (s, 4H).
[0062] The 2-aminoethanethiol hydrochloride, 4.19 g (36.7 mmol),
was added to a 250 ml flask equipped with an overhead stirrer,
followed by 15 ml of chloroform and 10.64 ml (76.5 mmol) of
triethylamine. After cooling the amine solution on an ice bath, a
solution of 3,5-bis(4-benzoylbenzyloxy)b- enzoyl chloride, 18.4 g
(32.8 mmol), in 50 ml of chloroform was added dropwise over a 50
minute period. Cooling on ice was continued 30 minutes, followed by
warming to room temperature for two hours. The product was diluted
with 150 ml of chloroform and washed with 5.times.250 ml of 0.1 N
hydrochloric acid. The product was dried over sodium sulfate and
recrystallized twice from 15:1 toluene: hexane to give 13.3 g of
product, a 67% yield. Melting point on the product was
115.9.degree. C. (DSC) and analysis on an NMR spectrometer was
consistent with the desired product: .sup.1H NMR (DMSO-d.sub.6)
aromatic protons 7.20-7.80 (m, 18H), 6.98 (d, 2H), and 6.65 (t,
1H), amide NH 6.55 (broad t, 1H), benzylic protons 5.10 (s, 4H),
methylene adjacent to amide N 3.52 (q, 2H), methylene adjacent to
SH 12.10 (q, 2H), and SH 1.38 (t, 1H). The final compound was
stored for use as a chain transfer agent in the synthesis of
photoactivatable polymers as described, for instance, in Example
12.
Example 8
Preparation of N-Succinimidyl 11-(4-Benzoylbenzamido)undecanoate
(BBA-AUD-NOS) (Compound VIII)
[0063] Compound I (50 g, 0.204 mol), prepared according to the
general method described in Example 1, was dissolved in 2500 ml of
chloroform, followed by the addition of a solution of 43.1 g (0.214
mol) of 11-aminoundecanoic acid and 60.0 g (1.5 mmol) of sodium
hydroxide in 1500 ml of water. The mixture was stirred vigorously
for one hour in a 5 liter Morton flask to insure thorough mixing of
the two layers. The mixture was acidified with 250 ml of
concentrated hydrochloric acid and stirred an additional 30
minutes. The organic layer was separated and the aqueous was
extracted with 3.times.500 ml of chloroform. The combined organic
extracts were dried over sodium sulfate, filtered, and evaporated
to give a solid. The product was recrystallized from toluene to
give 68.37 g (82%) of 11-(4-benzoylbenzamido)undecanoic acid with a
melting point of 107-109.degree. C. Analysis on an NMR spectrometer
was consistent with the desired product: .sup.1H NMR (CDCl.sub.3)
aromatic protons 7.20-7.80 (m, 9H), amide NH 6.30 (broad t, 1H),
methylene adjacent to amide N 3.35 (in, 2H), methylene adjacent to
carbonyl 2.25 (t, 2H), and remaining methylenes 1.00-1.80 (m,
16H).
[0064] The 11-(4-benzoylbenzamido)undecanoic acid, 60.0 g (0.146
mmol), was dissolved with warming in 1200 ml of anhydrous
1,4-dioxane in an oven-dried 2000 ml flask. After cooling to room
temperature, 17.7 g (0.154 mmol) of N-hydroxysuccinimide and 33.2 g
(0.161 mol) of 1,3-dicyclohexylcarbodiimide were added to the
solution and the mixture was stirred overnight under a dry
atmosphere. The solids were then removed by filtration, rinsing the
filter cake with 1,4-dioxane. The solvent was then removed under
vacuum and the product was recrystallized twice from ethanol. After
thorough drying in a vacuum oven, 53.89 g (73% yield) of a white
solid were obtained with a melting point of 97-99.degree. C.
Analysis on an NMR spectrometer was consistent with the desired
product: .sup.1H NMR (CDCl.sub.3) aromatic protons 7.20-7.80 (m,
9H), amide NH 6.25 (broad t, 1H), methylene adjacent to amide N
3.35 (m, 2H), methylenes on succinimidyl ring 2.75 (s, 4H),
methylene adjacent to carbonyl 2.55 (t, 2H), and remaining
methylenes 1.00-1.90 (m, 16H).
Example 9
Preparation of Copolymer of Acrylamide BBA-APMA, and MAL-EAC-NOS
(Random Photo PA-PolyNOS--(Compounds IX), A-D)
[0065] A photoactivatable copolymer of the present invention was
prepared in the following manner. Acrylamide, 4.298 g (60.5 mmol),
was dissolved in 57.8 ml of tetrahydrofuran (THF), followed by
0.219 g (0.63 mmol) of Compound III, prepared according to the
general method described in Example 3, 0.483 g (1.57 mmol) of
Compound IV, prepared according to the general method described in
Example 4, 0.058 ml (0.39 mmol) of
N,N,N',N'-tetramethylethylenediamine (TEMED), and 0.154 g (0.94
mmol) of 2,2'-azobisisobutyronitrile (AIBN). The solution was
deoxygenated with a helium sparge for 3 minutes, followed by an
argon sparge for an additional 3 minutes. The sealed vessel was
then heated overnight at 60.degree. C. to complete the
polymerization. The solid product was isolated by filtration and
the filter cake was rinsed thoroughly with THF and CHCl.sub.3. The
product was dried in a vacuum oven at 30.degree. C. to give 5.34 g
of a white solid. NMR analysis (DMSO-d.sub.6) confirmed the
presence of the NOS group at 2.75 ppm and the photogroup load was
determined to be 0.118 mmol BBA/g of polymer. The MAL-EAC-NOS
composed 2.5 mole % of the polymerizable monomers in this reaction
to give Compound IX-A.
[0066] The above procedure was used to prepare a polymer having 5
mole % Compound IV. Acrylamide, 3.849 g (54.1 mmol), was dissolved
in 52.9 ml of THF, followed by 0.213 g (0.61 mmol) of Compound VI,
prepared according to the general method described in Example 3,
0.938 g (3.04 mmol) of Compound IV, prepared according to the
general method described in Example 4, 0.053 ml (0.35 mmol) of
TEMED and 0.142 g (0.86 mmol) of AIBN. The resulting solid,
Compound IX-B, when isolated as described above, gave 4.935 g of
product with a photogroup load of 0.101 mmol BBA/g of polymer.
[0067] The above procedure was used to prepare a polymer having 10
mole % Compound IV. Acrylamide, 3.241 g (45.6 mmol), was dissolved
in 46.4 ml of THF, followed by 0.179 g (0.51 mmol) of Compound III,
prepared according to the general method described in Example 3,
1.579 g (5.12 mmol) of Compound IV, prepared according to the
general method described in Example 4, 0.047 ml (0.31 mmol) of
TEMED and 0.126 g (0.77 mmol) of AIBN. The resulting solid,
Compound IX-C, when isolated as described above, gave 4.758 g of
product with a photogroup load of 0.098 mmol BBA/g of polymer.
[0068] A procedure similar to the above procedure was used to
prepare a polymer having 2.5 mole % Compound IV and 2 mole %
Compound III. Acrylamide, 16.43 g (231.5 mmol); Compound III,
prepared according to the general method described in Example 3,
1.70 g (4.85 mmol); Compound IV, prepared according to the general
method described in Example 4, 1.87 g (6.06 mmol); and THF (222 ml)
were stirred in a round bottom flask with an argon sparge at room
temperature for 15 minutes. TEMED, 0.24 ml (2.14 mmol), and AIBN,
0.58 g (3.51 mmol), were added to the reaction. The reaction was
then refluxed for 4 hours under an atmosphere of argon. The
resulting solid, Compound IX-D, when isolated as described above,
gave 19.4 g of product with a photogroup load of 0.23 mmol BBA/g of
polymer.
Example 10
Preparation of Copolymer of Acrylamide, BBA-APMA, and
[3-(Methacryloylamino)propyl]trimethylammonium Chloride (Random
Photo PA-PolyQuat) (Compounds X, A-B)
[0069] A photoactivatable copolymer of the present invention was
prepared in the following manner. Acrylamide, 10.681 g (0.150 mol),
was dissolved in 150 ml of dimethylsulfoxide (DMSO), followed by
0.592 g (1.69 mmol) of Compound III, prepared according to the
general method described in Example 3, 3.727 g (16.90 mmol) of
[3-(methacryloylamino)propyl]trimethyl- ammonium chloride (MAPTAC),
delivered as 7.08 ml of a 50% aqueous solution, 0.169 ml (1.12
mmol) of TEMED and 0.333 g (2.03 mmol) of AIBN. The solution was
deoxygenated with a helium sparge for 4 minutes, followed by an
argon sparge for an additional 4 minutes. The sealed vessel was
then heated overnight at 55.degree. C. to complete the
polymerization. The DMSO solution was diluted with water and
dialyzed against deionized water using 12,000-14,000 molecular
weight cutoff tubing. Lyophilization of the resulting solution gave
14.21 g of a white solid. NMR analysis (D.sub.2O) confirmed the
presence of the methyl groups on the quaternary ammonium groups at
3.10 ppm and the photogroup load was determined to be 0.101 mmol
BBA/g of polymer. The Compound III constituted 1 mole % of the
polymerizable monomer in this reaction to give Compound X-A.
[0070] The above procedure was used to prepare a polymer having 2
mole % of Compound III. Acrylamide, 10.237 g (0.144 mol), was
dissolved in 145 ml of DMSO, followed by 1.148 g (3.277 mmol) of
Compound III, prepared according to the general method described in
Example 3, 3.807 g (17.24 mmol) of MAPTAC, delivered as 7.23 ml of
a 50% aqueous solution, 0.164 ml (1.09 mmol) of TEMED and 0.322 g
(1.96 mmol) of AIBN. Workup as described above gave 12.54 g of
product (Compound X-B) with a photogroup load of 0.176 mmol BBA/g
of polymer.
Example 11
Preparation of Copolymer of Acrylamide, BBA-APMA, MA-EAC-NOS and
[3-(Methacryloylamino)propyl]trimethylammonium Chloride (Random
Photo PA-PolyNOS-Poly Quat (Compound XII)
[0071] A photoactivatable copolymer of the present invention was
prepared in the following manner. The water in the commercially
available 50% aqueous MAPTAC was removed by azeotropic distillation
with chloroform. The aqueous MAPTAC solution, 20 ml containing
10.88 g of MAPTAC, was diluted with 20 ml of DMSO and 100 ml of
chloroform. This mixture was refluxed into a heavier-than-water
liquid-liquid extractor containing anhydrous sodium sulfate for a
total of 80 minutes. A slow flow of air was maintained during the
reflux to inhibit polymerization of the monomer. At the end of the
reflux, the excess chloroform was removed under reduced pressure to
leave a DMSO solution of MAPTAC at an approximate concentration of
352 mg/ml.
[0072] Acrylamide, 1.7 g (23.90 mmol), was dissolved in 57.7 ml of
dimethylsulfoxide (DMSO), followed by 0.215 g (0.614 mmol) of
Compound III, prepared according to the general method described in
Example 3, 1.93 ml (0.677 g, 3.067 mmol) of the above MAPTAC/DMSO
solution, 0.91 g (3.068 mmol) of Compound V, prepared according to
the general method described in Example 5, and 0.060 g (0.365 mmol)
of AIBN. The solution was deoxygenated with a helium sparge for 4
minutes, followed by an argon sparge for an additional 4 minutes.
The sealed vessel was then heated overnight at 55.degree. C. to
complete the polymerization. The polymer was isolated by pouring
the reaction mixture into 600 ml of diethyl ether. The solids were
separated by centrifuging and the product was washed with 200 ml of
diethyl ether and 200 ml of chloroform. Evaporation of solvent
under vacuum gave 3.278 g of product with a photoload of 0.185 mmol
BBA/g of polymer.
Example 12
Copolymer of Acrylamide and MAL-EAC-NOS using
N-(2-Mercaptoethyl)-3,5-bis(- 4-benzoylbenzyloxy)benzamide
(End-Point Diphoto PA-PolyNOS) (Compound XII)
[0073] A photoactivatable copolymer of the present invention was
prepared in the following manner. Acrylamide, 3.16 g (44.5 mmol),
was dissolved in 45.0 ml of tetrahydrofuran, followed by 0.164 g (1
mmol) of AIBN, 0.045 ml (0.30 mmol) of TEMED, 0.301 g (0.5 mmol) of
Compound VII, prepared according to the general method in Example
7, and 1.539 g (5 mmol) of Compound IV, prepared according to the
general method described in Example 4. The solution was
deoxygenated with a helium sparge for 4 minutes, followed by an
argon sparge for an additional 4 minutes. The sealed vessel was
then heated overnight at 55.degree. C. to complete the
polymerization. The precipitated polymer was isolated by filtration
and was washed with chloroform. The final product was dried in a
vacuum oven to provide 4.727 g of polymer having a photogroup load
of 0.011 mmol BBA/g of polymer.
Example 13
Copolymer of N-[3-(Dimethylamino)propyl]methacrylamide and BBA-APMA
(Random Photo Poly Tertiary Amine) (Compound XIII)
[0074] A photoactivatable copolymer of the present invention was
prepared in the following manner.
N-[3-(Dimethylamino)propyl]methacrylamide, 33.93 g (0.2 mol), was
dissolved in 273 ml of DMSO, followed by 16.6 ml of concentrated
HCl and 6.071 g (17.3 mmol) of Compound III, prepared according to
the general method described in Example 3. Finally, 0.29 ml (1.93
mmol) of TEMED, 0.426 g (2.6 mmol) of AIBN, and 100 ml of water
were added to the reaction mixture. The solution was deoxygenated
with a helium sparge for 10 minutes and the head space was then
filled with argon. The sealed vessel was heated overnight at
55.degree. C. to complete the polymerization. The product was then
dialyzed against deionized water for several days using
12,000-14,000 MWCO tubing. The product was filtered following
dialysis to remove any solids and was lyophilized to give 47.27 g
of a solid product. The polymer was determined to have a photoload
of 0.33 mmol BBA/g of polymer.
Example 14
Preparation of N-succinimidyl 5-oxo-6-aza-8-nonenoate
(Allyl-GLU-NOS) (Compound XIV)
[0075] A functional monomer was prepared in the following manner,
and was used in Example 15 to introduce activated ester groups on
the backbone of the polymer. Glutaric anhydride, 20 g (0.175 mole),
was dissolved in 100 ml chloroform. The glutaric anhydride solution
was cooled to <10.degree. C. using an ice bath. Allyl amine, 10
g (0.177 mole), was dissolved in 50 ml chloroform and added to the
cooled solution of glutaric anhydride with stirring. The addition
rate of allyl amine was adjusted to keep the reaction
temperature<10.degree. C. After the allyl amine addition was
completed, the reaction solution was allowed to come to room
temperature while stirring overnight. After removing the solvent,
the 5-oxo-6-aza-8-nonenoic acid isolated amounted to 31.4 g (105%
crude) with a dual DSC melting point of 35.1.degree. C. and
44.9.degree. C. NMR analysis at 300 MHz was consistent with the
desired product: .sup.1H NMR (CDCl.sub.3) amide proton 6.19 (b,
1H), vinyl protons 5.13, 5.81 (m, 3H), methylene adjacent to amide
N 3.85 (m, 2H), methylenes adjacent to carbonyls 2.29, 2.39 (t;
4H), and central methylene 1.9. (m, 2H).
[0076] The 5-oxo-6-aza-8-nonenoic acid, 20.54 g (0.12 mole),
N-hydroxysuccinimide (NHS), 15.19 g (0.13 mole), and 204 ml dioxane
were placed in a 1 L 3-necked round bottom flask equipped with an
overhead stirrer and an addition funnel. Dicyclohexylcarbodiimide
("DCC"), 29.7 g (0.144 mole), was dissolved in 50 ml dioxane and
placed in the addition funnel. The DCC solution was added with
stirring to the acid/NHS solution over 20 minutes, and the
resulting mixture was allowed to stir at room temperature
overnight. The reaction mixture was filtered on a Buchner funnel to
remove dicyclohexylurea (DCU). The solid was washed with
2.times.100 ml dioxane. The solvent was evaporated to give 41.37 g
residue, which was washed with 4.times.75 ml hexane. After the
solvents were removed, the yield of crude NOS ester was 41.19 g.
One recrystallization of the crude NOS product from toluene gave a
60% yield with a DSC melting point of 90.10 C. NMR analysis at 300
MHz was consistent with the desired product: .sup.1H NMR
(CDCl.sub.3) amide proton 6.02 (b, 1H), vinyl protons 5.13, 5.80
(m, 3H), methylene adjacent to amide N 3.88 (m, 2H), succinimidyl
protons 2.83 (s, 4H), methylenes adjacent to carbonyls 2.31, 2.68
(t, 4H), and central methylene 2.08 (m, 2H). The final compound was
stored for use in the synthesis of photoactivatable polymers as
described in Example 15.
Example 15
Preparation of Copolymer of Vinylppyrrolidinone, BBA-APMA, and
Allyl-GLU-NOS (Random Photo PVP-PolyNOS) (Compound XV)
[0077] A photoactivatable copolymer of the present invention was
prepared in the following manner. Vinylpyrrolidinone, 4.30 g (38.73
mmol), was dissolved in 5.2 ml of DMSO along with 0.14 g (0.41
mmol) of Compound III, prepared according to the general method
described in Example 3, 0.55 g (2.06 mmol) Compound XIV, prepared
according to the general method described in Example 14, by
combining 0.08 g (0.49 mmol) of AIBN and 0.005 ml (0.033 mmol) of
TEMED. The solution was deoxygenated with a helium sparge for 3
minutes. The head space was replaced with argon, and the vessel was
sealed for an overnight heating at 55.degree. C. The viscous
solution was diluted with 15 ml chloroform, and then precipitated
by pouring into 200 ml diethyl ether. The precipitate was dissolved
in 15 ml chloroform, and precipitated a second time in 200 ml
ether. The product was dried in a vacuum oven at 30.degree. C. to
give 4.79 g of a white solid. NMR analysis (CDCL.sub.3) confirmed
the presence of the NOS group at 2.81 ppm and the photogroup load
was determined to be 1.1 mmol BBA/g of polymer. The Allyl-GLU-NOS
composed 5.0 mole % of the polymerizable monomers in this reaction
to give Compound XV.
Example 16
Comparison of Random Photo PA-PolyNOS (Compound IX-C) with Random
Photo PA PolyNOS-PolyQuat (Compound XI) on Polystyrene (PS)
Microwell Plates
[0078] Plates Compound IX-C and Compound XI were separately
dissolved in deionized water at 5 mg/ml. The PS plates (PS, Medium
Bind, Corning Costar, Cambridge, Mass.) containing 100 .mu.l of
Compound IX-C and Compound XI in separate wells were illuminated
with a Dymax lamp (model no. PC-2, Dymax Corporation, Torrington,
Conn.) which contained a Heraeus bulb (W. C. Heraeus GmbH, Hanau,
Federal Republic of Germany). The illumination duration was for 1.5
minutes at a intensity of 1-2 mW/cm.sup.2 in the wavelength range
of 330-340 nm. The coating solution was then discarded and the
wells were air dried for two hours. The plates were then
illuminated for an additional one minute. The coated plates were
used immediately to immobilize oligonucleotides stored in a sealed
pouch for up to 2 months.
[0079] The 50 base oligomer (-mer) capture probe
5'-NH.sub.2-GTCTGAGTCGGAG- CCAGGGCGGCCGCCAACAGCAGGAGCAGCGTGCACGG-3'
(SEQ ID NO:1) (synthesized with a 5'-amino-modifier containing a
C-12 spacer) at 10 pmoles/well was incubated in PS wells in 50 mM
phosphate buffer, pH 8.5, 1 mM EDTA at 37.degree. C. for one hour.
The hybridization was performed as follows using the complementary
5'-Biotin-CCGTGCACGCTGCTCCTGCTGTTGGCGGCCGCCCTGGCT- CCGACTC AGAC-3'
(SEQ ID NO:3) detection probe or non-complementary
5-Biotin-CGGTGGATGGAGCAGGAGGGGCCC GAGTATGGGAGCGGGAGACA CAGAA-3'
(SEQ ID NO:4) oligo, both of which were synthesized with a
5'-biotin modification.
[0080] The plates with immobilized capture probe were washed with
phosphate buffered saline (PBS, 10 mM Na.sub.2PO.sub.4, 150 mM
NaCl, pH 7.2) containing 0.05% Tween 20 using a Microplate Auto
Washer (model EL 403H, Bio-Tek Instruments, Winooski, Vt.). The
plates were then blocked at 55.degree. C. for 30 minutes with
hybridization buffer, which consisted of 5.times.SCC (0.75 M NaCl,
0.075 M citrate, pH 7.0), 0.1% lauroylsarcosine, 1% casein, and
0.02% sodium dodecyl sulfate. When the detection probe was
hybridized to the capture probe, 50 fmole of detection probe in 100
.mu.l were added per well and incubated for one hour at 55.degree.
C. The plates were then washed with 2.times.SSC containing 0.1%
sodium dodecyl sulfate for 5 minutes at 55.degree. C. The bound
detection probe was assayed by adding 100 .mu.l of a conjugate of
streptavidin and horseradish peroxidase (SA-HRP, Pierce, Rockford,
Ill.) at 0.5 .mu.g/ml and incubating for 30 minutes at 37.degree.
C. The plates were then washed with PBS/Tween, followed by the
addition of peroxidase substrate (H.sub.2O.sub.2) and
tetramethylbenzidine, Kirkegard and Perry Laboratories,
Gaithersburg, Md.) and measurement at 655 nm on a microwell plate
reader (model 3550, Bio-Rad Labs, Cambridge, Mass.). The plates
were read at 10 minutes.
[0081] The results listed in Table 1 indicate that microwell plates
coated with Compound IX-C did not effectively immobilize
amine-derivatized capture probes. However, by comparison Compound
XI, as a coating, provided significant binding and good
hybridization signals. Compound IX-C reagent most likely passivated
the surfaces and prevented the association of capture oligos. In
contrast when Compound XI was used, the oligonucleotide was
attracted to the surface by ionic interactions where it could then
be covalently bonded with the NOS groups.
2TABLE 1 Hybridization Signals (A.sub.655) from PS Microwell Plates
Coated with Compound IX-C and Compound XI. Compound IX-C Compound
XI Complementary Detection 0.187 .+-. 0.031 1.666 .+-. 0.064 Probe
Non-complementary 0.127 .+-. 0.016 0.174 .+-. 0.005 Detection
Probe
Example 17
Coating of Various Microwell Plates with a Mixture of Random Photo
PA-PolyNOS (Compound IX-B) and Random Photo PA-PolyQuat (Compound
X-B)
[0082] A coating solution containing a mixture of 5 mg/ml of
Compound IX-B and 0.5 mg/ml of Compound X-B was prepared in
deionized water. This mixture was used to treat polypropylene (PP,
Corning Costar, Cambridge, Mass.), PS, polycarbonate (PC, Corning
Costar, Cambridge, Mass.) and polyvinyl chloride (PVC, Dynatech,
Chantilly, Va.) multiwells as described in Example 16. A 30-mer
capture oligonucleotide5'-NH.sub.2-GTCT-
GAGTCGGAGCCAGGGCGGCCGCCAAC-3' (SEQ ID NO:2), (synthesized with a
5'-amino-modifier containing a C-12 spacer) at 0.03, 0.1, 0.3, 1,
3, or 10 pmole/well was incubated at 4.degree. C. overnight. The
hybridization was performed as previously described in Example 16
using complementary SEQ ID NO:3 detection oligonucleotide or
non-complementary SEQ ID NO:4 oligo. Since PP plates are not
optically transparent, the contents of each well were transferred
to PS wells after a 20 minute incubation with the chromogenic
substrate. The hybridization signals were measured in the PS
plates. The other plates were read without transferring at 10
minutes. Signal levels are only comparable within the same
substrate group due to the different geometries of microwell plates
made from different materials. Table 2 lists the hybridization
signals and shows the relationship between the intensity of the
hybridization signals and the amount of capture probe applied to
various microwell plates coated with a mixture of Compound IX-B and
Compound X-B. On PP and PVC plates, adsorption of probes was very
low and the coatings with the polymeric reagents improved the
signals dramatically. The signal increased with increasing capture
probe added to the coated wells, but leveled off at approximately 3
pmole/well capture. The plateau in the amount of signal generated
was not due to a saturating level of hybridization, but rather to
the limits of the color change reaction in the colorimetric
assay.
[0083] Oligonucleotide derivatives adsorb efficiently onto uncoated
PS and PC microwell plates and result in specific hybridization
signals. Cros et al. (U.S. Pat. No. 5,510,084) also reported that
amine-functionalized oligonucleotides adsorbed satisfactorily onto
polystyrene microwell plates by unknown mechanisms. However, there
is marked variability in the amount of adsorption on uncoated PS
plates among different lots (Chevier et al. EEMS, 10: 245,
1995).
3TABLE 2 Hybridization Signals (A.sub.655) From Various Microwell
Plate Materials Coated With a Mixture of Compound IX-B and Compound
X-B. Capture Oligonucleotide Added (pmole/well) 0.03 0.1 0.3 1 3 10
Comp NC Comp NC Comp NC Comp NC Comp NC Comp NC PP Uncoated 0.083
0.082 0.076 0.072 0.076 0.074 0.088 0.074 0.070 0.067 0.078 0.073
Coated 0.541 0.099 1.070 0.099 1.769 0.091 2.283 0.094 2.582 0.141
2.490 0.320 PVC Uncoated 0.074 0.079 0.081 0.075 0.097 0.078 0.137
0.076 0.215 0.081 0.337 0.092 Coated 0.423 0.116 0.875 0.110 1.326
0.112 1.583 0.142 1.628 0.186 1.604 0.332 PS Uncoated 0.235 0.099
0.435 0.091 0.827 0.090 1.205 0.093 1.380 0.093 1.404 0.136 Coated
0.435 0.121 0.801 0.105 1.177 0.116 1.401 0.132 1.470 0.132 1.487
0.302 PC Uncoated 0.676 0.248 1.364 0.244 2.103 0.256 2.701 0.266
2.745 0.295 2.930 0.388 Coated 1.034 0.327 1.602 0.306 2.136 0.295
2.218 0.287 2.380 0.342 2.500 0.572 Comp.: Complementary detection
probe was added for hybridization. NC: Non-complementary detection
probe was added for hybridization.
Example 18
Evaluation of End-Point Diphoto PA-polyNOS (Compound XII) and
Random Photo PA-PolyQuat (Compound X-B) on PP and PVC Microwell
Plates
[0084] A coating solution containing a mixture of 5 mg/ml of
Compound XII and 0.5 mg/ml of Compound X-B was prepared with
deionized water. This mixture of the two reagents was used to coat
PP and PVC microwell plates under conditions comparable to those
described in Example 16. The 30-mer SEQ ID NO:2 capture
oligonucleotide at 0.03, 0.1, 0.3, 1, 3, or 10 pmole/well in 0.1 ml
was incubated at 4.degree. C. overnight. The hybridization was
performed as described in Example 16 using complementary SEQ ID
NO:3 detection oligonucleotide or non-complementary SEQ ID NO:4
oligo. The hybridization signals listed in Table 3 demonstrate the
relationship between the intensity of the hybridization signals and
the amount of capture probe applied to PP and PVC microwell plates
coated with a mixture of Compound XII and Compound X-B. The signal
increased with increasing capture oligonucleotides added to the
coated wells, but leveled off at approximately 1 pmole/well. The
signal-to-noise ratio (from complementary vs. non-complementary
detection probes) was as high as 26 and 11 for coated PP and PVC
surfaces, respectively.
4TABLE 3 Hybridization Signals (A.sub.655) From PP and PVC Plates
Coated With Mixture of Compound XII and Compound X-B. pmole/ well
PP Microwell plates PVC Microwell plates Capture Comp. Comp. Added
Detection Non-comp. Detection Non-comp. 0.03 0.153 .+-. 0.008 0.070
.+-. 0.007 0.289 .+-. 0.029 0.094 .+-. 0.020 0.1 0.537 .+-. 0.042
0.075 .+-. 0.009 0.759 .+-. 0.054 0.104 .+-. 0.014 0.3 1.206 .+-.
0.106 0.080 .+-. 0.003 1.262 .+-. 0.023 0.117 .+-. 0.011 1 2.157
.+-. 0.142 0.081 .+-. 0.003 1.520 .+-. 0.044 0.189 .+-. 0.064 3
2.624 .+-. 0.162 0.108 .+-. 0.012 1.571 .+-. 0.031 0.179 .+-. 0.016
10 2.921 .+-. 0.026 0.200 .+-. 0.018 1.625 .+-. 0.040 0.286 .+-.
0.021
Example 19
Sequential Coating with Random Photo PA-PolyQuat (Compound X-B) and
BBA-AUD-NOS (Compound VIII)
[0085] Compound X-B at 0.1 mg/ml in deionized water was incubated
in PP and PVC wells for 20 minutes. The plates were illuminated as
previously described in Example 16 with the solution in the wells
for 1.5 minutes. The solution was discarded and the wells were
dried. Compound VIII at 0.5 mg/ml in isopropyl alcohol (IPA) was
incubated in the Compound X-B coated wells for 5 minutes. The
solution was then removed, the plate dried and illuminated as
described in Example 16 for one minute after the wells were dried.
The 30-mer SEQ ID NO:2 capture oligonucleotide at 0.03, 0.1, 0.3,
1, 3, or 10 pmole/well in 0.1 ml was incubated at 4.degree. C.
overnight. The hybridization was performed as described in Example
16 using complementary SEQ ID NO:3 detection oligonucleotide or
non-complementary SEQ ID NO:4 oligo. Table 4 contains the
hybridization signals and shows the relationship between the
intensity of the hybridization signals and the amount of capture
probe applied to PP and PVC microwell plates coated with Compound
X-B followed by Compound VIII coating. The signal increased with
increasing capture probe added to the coated wells, but leveled off
at approximately 1 pmole/well capture oligo. The signals were up to
29- and 11-fold higher for coated PP and PVC surfaces,
respectively, as compared to the uncoated controls.
5TABLE 4 Hybridization Signals (A.sub.655) From PP and PVC
Microwell Plates Coated With Compound X-B Followed by Compound VIII
Coating. p-mole/ well Capture PP Microwell plates PVC Microwell
plates Added Uncoated Coated Uncoated Coated 0.03 0.083 .+-. 0.003
0.157 .+-. 0.004 0.074 .+-. 0.004 0.244 .+-. 0.014 0.1 0.076 .+-.
0.003 0.544 .+-. 0.006 0.081 .+-. 0.005 0.694 .+-. 0.065 0.3 0.076
.+-. 0.006 1.095 .+-. 0.015 0.097 .+-. 0.010 1.113 .+-. 0.033 1
0.088 .+-. 0.006 1.676 .+-. 0.030 0.137 .+-. 0.016 1.304 .+-. 0.027
3 0.070 .+-. 0.010 1.865 .+-. 0.057 0.215 .+-. 0.023 1.237 .+-.
0.013 10 0.078 .+-. 0.009 2.274 .+-. 0.005 0.337 .+-. 0.024 1.182
.+-. 0.041
Example 20
Comparison of Random Photo PA-PolyQuat (Compound X-A) with a
Mixture of Random Photo PA-PolyNOS (Compound IX-A) and Random Photo
PA-PolyQuat (Compound X-A)
[0086] Compound X-A at 0.5 or 0.1 mg/ml was incubated in PP
microwell plates for 10 minutes. The plates were then illuminated
as described in Example 16. A coating solution containing a mixture
of Compound IX-A and Compound X-A was prepared at two ratios, 5/0.5
mg/ml and 0.5/0.1 mg/ml of Compound IX-A/Compound X-A in deionized
water to coat PP microwell plates. The solution was incubated in
the wells for 10 minutes and the wells were illuminated as
described in Example 16. The 30-mer SEQ ID NO:2 capture
oligonucleotide at 1 pmole/well was incubated in each well at
37.degree. C. for one hour. The hybridization was done as described
in Example 16 using complementary SEQ ID NO:3 detection
oligonucleotide or non-complementary SEQ ID NO:4 oligo. The results
listed in Table 5 indicate that the coating containing the
combination of Compound IX-A and Compound X-A gave higher signals
as compared to those from Compound X-A coating alone.
6TABLE 5 Hybridization Signals (A.sub.655) From Compound X-A Coated
PP Microwell Plates. Ration of Compound IX-A/ Compound X-A (mg/ml)
Comp. Detection Non-comp Detection 5/0.5 1.436 .+-. 0.056 0.077
.+-. 0.001 0/0.5 0.454 .+-. 0.149 0.052 .+-. 0.006 0.5/0.1 1.346
.+-. 0.044 0.062 .+-. 0.003 0/0.1 0.192 .+-. 0.082 0.055 .+-.
0.002
Example 21
Comparision of Non-Modified Oligonucleotide vs. Amine-Modified
Oligonucleotide on Random Photo PA-PolyNOS (Compound IX-B) and
Random Photo PA-PolyQuat (Compound X-B) on Coated Microwell
Plates
[0087] A coating solution containing a mixture of Compound IX-B (5
mg/ml) and Compound X-B (0.5 mg/ml) was prepared in deionized water
to coat PP, PS and PVC microwell plates. The solution was incubated
for approximately 10 minutes and illuminated as described in
Example 16. The 30-mer capture 5'-NH.sub.2-TTCTGTGTCTCC
CGCTCCCAATACTCGGGC-3' (SEQ ID NO:5) oligonucleotide at 1 pmole/well
was coupled to the wells in 50 mM phosphate buffer, pH 8.5, 1 mM
EDTA at 4.degree. C. overnight. The hybridization was performed as
described in Example 16 using complementary detection
oligonucleotide SEQ ID NO:4 or non-complementary oligonucleotide
SEQ ID NO:3. To determine the effect of the amine-functionality of
the capture oligo, a non-modified 30-mer capture probe
5'-TTCTGTGTCTCC CGCTCCCAATACTCGGGC-3' (SEQ ID NO:6) (with no amine)
was also added to the coated surfaces and tested. The results shown
in Table 6 indicate that when an oligonucleotide without the
5'-amine modification was used as the capture probe on Compound
IX-B/Compound X-B coated surfaces, the hybridization signal was
less than 30% of that with amine modification.
7TABLE 6 Signals (A.sub.655) Generated From Hybridization Reactions
With Either SEQ ID NO: 5 or SEQ ID NO: 6 Oligonucleotides on
Compound IX-B/ Compound X-B Coated Microwell Plates. No Capture
Added Non-modified Capture Amine-modified Capture Comp. Non-comp.
Comp. Non-comp. Comp. Non-comp. Detection Detection Detection
Detection Detection Detection PP Uncoated 0.032 .+-. 0.001 0.036
.+-. 0.004 0.033 .+-. 0.001 0.036 .+-. 0.001 0.037 .+-. 0.005 0.033
.+-. 0.001 Coated 0.038 .+-. 0.002 0.040 .+-. 0.001 0.555 .+-.
0.041 0.044 .+-. 0.001 1.915 .+-. 0.029 0.066 .+-. 0.003 PVC
Uncoated 0.248 .+-. 0.049 0.176 .+-. 0.008 0.259 .+-. 0.049 0.128
.+-. 0.013 0.404 .+-. 0.100 0.118 .+-. 0.025 Coated 0.115 .+-.
0.027 0.090 .+-. 0.014 0.379 .+-. 0.028 0.091 .+-. 0.014 1.319 .+-.
0.027 0.101 .+-. 0.017 PS Uncoated 0.084 .+-. 0.013 0.089 .+-.
0.014 0.668 .+-. 0.047 0.085 .+-. 0.023 1.269 .+-. 0.034 0.106 .+-.
0.024 Coated 0.080 .+-. 0.006 0.081 .+-. 0.023 0.364 .+-. 0.010
0.089 .+-. 0.015 1.437 .+-. 0.012 0.098 .+-. 0.005
Example 22
Oligonucleotide Loading Densities on Microwell Plates Coated with
Random Photo PA-PolyNOS (Compound IX-A) and Random Photo
PA-PolyQuat (Compound X-A)
[0088] Radiolabeled assays were performed to determine
oligonucleotide loading densities and to verify results from the
colorimetric assay system. In this Example, combination coatings of
Compound IX-A and Compound X-A were performed on PVC wells as
described in Example 16. The SEQ ID NO:2 and SEQ ID NO:5 30-mer
capture oligonucleotides were immobilized on coated wells. A
radiolabeled SEQ ID NO:2 probe was used to determine the loading
density of immobilized capture oligonucleotides on the well
surface. A radiolabeled SEQ ID NO:3 detection probe, which was
complementary to SEQ ID NO:2, but not to SEQ ID NO:5, was used to
measure hybridization reactions of the immobilized capture probes.
Oligonucleotides SEQ ID NO:2 and SEQ ID NO:3 were radiolabeled at
the 3'-end using terminal transferase (Boehringer Mannheim,
Indianapolis, Ind.) and .alpha.-.sup.32P-ddATP (3000 Ci/mmole,
Amersham, Arlington Heights, Ill.) according to the manufacturer's
specifications. .sup.32P-labeled SEQ ID NO:2 and unlabeled SEQ ID
NO:2 and SEQ ID NO:5 capture probes were incubated in coated wells
at 50 pmole/well for 2.25 hours at room temperature. The plates
were washed and blocked as described in Example 16.
[0089] The wells with the unlabeled capture probes were hybridized
with the .sup.32P-labeled SEQ ID NO:3 detection probe in
hybridization buffer for 1 hour at 55.degree. C. Wells containing
the .sup.32P-labeled capture probe were incubated in hybridization
buffer without the SEQ ID NO:3 probe. After washing three times
with 2.times.SSC containing 0.1% SDS for 5 minutes at 55.degree. C.
and three times with PBS/0.05% Tween, the plates were cut into
individual wells and dissolved in tetrahydrofuran. The amount of
radioactivity in each well was measured by scintillation counting
in Aquasol-2 Floor (DuPont NEN, Boston, Mass.). The results in
Table 7 show that both Compound IX-A and Compound X-A were required
to give good immobilization of capture probe. Also, increasing the
concentrations of Compound IX-A and Compound X-A increased the
amount of the capture oligonucleotide immobilized. At the highest
concentrations tested, the signal to noise ratio was greater than
3000 to 1.
8TABLE 7 Densities of Immobilized Capture Oligonucleotide and
Hybridized .sup.32P-Detection Oligo. Hybridized Hybridized Mixture
of Coating Reagents Immobilized comp. non-comp. Compound Compound
capture detection detection IX-A (mg/ml) X-A (mg/ml) fmole/well
f/mole well f/mole/well 0 0 41.3 2.3 0.6 0 0.05 37.5 10.9 0.7 0.55
0 32.6 5.4 0.6 1 0.1 344.1 308.8 26.4 0.1 0.1 285.7 222.2 55.7 1
0.001 52.8 26.2 0.6 0.1 0.001 73.5 20.8 13.1 1.19 0.05 280.4 256.9
1.1 0.55 0.12 401.9 379.1 0.7 0.55 0.05 338.0 315.1 1.6 2 0.5
1633.4 1108.4 0.3
Example 23
Comparison Between Random Photo-Polytertiary Amine (Compound XIII),
Random Photo-PA-PolyNOS (Compound IX-A) and a Mixture of Random
Photo PA-PolyNOS (Compound IX-A) and Random Photo-Polytertiary
Amine (Compound XIII)
[0090] Compound XIII at 0.02 mg/ml in deionized water was incubated
in PP microwell plates for 10 minutes. The wells were illuminated
as described in Example 16. Compound IX-A was coated on PP wells at
2 mg/ml in deionized water as described for Compound XIII. A
coating solution containing a mixture of 2 mg/ml Compound IX-A and
0.02 mg/ml Compound XIII in deionized water was prepared and coated
as described for Compound XIII. The 30-mer SEQ ID NO:2 capture
oligonucleotide at 5 pmole/well was incubated in each well at
37.degree. C. for one hour. The hybridization was done as described
in Example 16 using complementary SEQ ID NO:3 detection
oligonucleotide and non-complementary SEQ ID NO:4 oligonucleotide.
The contents of each well were transferred to PS wells after a 10
minute incubation with the peroxidase substrate. The results listed
in Table 8 indicate that the combination of Compound IX-A and
Compound XIII gave higher signals compared to those from Compound
IX-A or Compound XIII coating alone.
9TABLE 8 Hybridization Signals (A.sub.655) From Coated PP Microwell
Plates. Coating Comp. Detection Non-comp. Detection Compound IX-A
0.057 .+-. 0.001 0.052 .+-. 0.006 Compound XIII 0.746 .+-. 0.042
0.0810 .+-. 0.009 Compound IX-A/Compound 1.195 .+-. 0.046 0.078
.+-. 0.014 III Mixture
Example 24
Nucleic Acid Sequence Immobilization on an Amine Derivatized
Surface
[0091] A copolymer of the present invention is prepared in the
following manner. Acrylamide, 5.686 g (80.0 mmol), is dissolved in
100 ml of DMSO, followed by the addition of 3.083 g (10.0 mmol) of
Compound IV, prepared according to the general method described in
Example 4, and 2.207 g (10.0 mmol) of MAPTAC, delivered as a dry
DMSO solution prepared according to the general method described in
Example 11. TEMED, 0.134 ml (0.89 mmol), and AIBN, 0.197 g (1.20
mmol), are added to the mixture and the system is deoxygenated with
a helium sparge for 5 minutes, followed by an argon sparge for an
additional 5 minutes. The sealed vessel is heated at 55.degree. C.
to complete the polymerization. The polymer is isolated by pouring
the reaction mixture into 800 ml of diethyl ether and centrifuging
to separate the solids. The product is washed with 200 ml of
diethyl ether, followed by 200 ml of chloroform. The polymer is
dried under vacuum to remove remaining solvent.
[0092] A polymer surface is derivatized by plasma treatment using a
3:1 mixture of methane and ammonia gases. (See, e.g., the general
method described in U.S. Pat. No. 5,643,580). A mixture of methane
(490 SCCM) and ammonia (161 SCCM) are introduced into the plasma
chamber along with the polymer part to be coated. The gases are
maintained at a pressure of 0.2-0.3 torr and a 300-500 watt glow
discharge is established within the chamber. The sample is treated
for a total of 3-5 minutes under these conditions. Formation of an
amine derivatized surface is verified by a reduction in the water
contact angle compared to the uncoated surface.
[0093] The amine derivatized surface is incubated for 10 minutes at
room temperature with a 10 mg/ml solution of the above polymer in a
50 mM phosphate buffer, pH 8.5. Following this reaction time, the
coating solution is removed and the surface is washed thoroughly
with deionized water and dried thoroughly. Immobilization of
oligomer capture probe and hybridization is performed as described
in Example 16.
Example 25
Immobilization and Hybridization of Oligonucleotides on
Photo-Polymeric NOS Coated Glass Slides--Comparison of Coatings
with and with out Photo PA PolyQuat (Compound X-A)
[0094] Soda lime glass microscope slides (Erie Scientific,
Portsmouth, N.H.) were silane treated by dipping in a mixture of
p-tolyldimethylchlorosilane (T-Silane) and
N-decyldimethylchlorosilane (D-Silane, United Chemical
Technologies, Bristol, Pa.), 1% each in acetone, for 1 minute.
After air drying, the slides were cured in an oven at 120.degree.
C. for one hour. The slides were then washed with acetone followed
by DI water dipping. The slides were further dried in oven for 5-10
minutes.
[0095] Compound IX-A, IX-D, and XV at various concentrations and
with or without Compound X-A, were sprayed onto the silane treated
slide, which were then illuminated using a Dymax lamp (25
mjoule/cm.sup.2 as measured at 335 nm with a 10 nm band pass filter
on an International Light radiometer) while wet, washed with water,
and dried. Oligonucleotides were printed on the slides using an X,
Y, Z motion controller to position a 0.006" id blunt end needle
filled with oligonucleotide solution. Two oligonucleotides were
immobilized to the prepared slides. One containing an amine on the
3' end and Cy3 fluorescent tag (Amersham, Arlington Heights, Ill.)
on the 5' end, 5'Cy3-GTCTGAGTCGGAGCCAGGGCGGCCGCCAAC-NH2-3' (SEQ ID
NO:7) (amino modifier has a C12 spacer) and the other containing an
amine on the 5' end, 5'-NH2-TTCTGTGTCTCCCGCTCCCAATACTCGGGC-3' (SEQ
ID NO:5)) (amino modifier has a C12 spacer). They were printed at a
concentration of 8 pmole/.mu.l in 50 mM sodium phosphate pH 8.5
containing 10% sodium sulfate and 1 mM EDTA. Slides were placed
overnight on a rack in a sealed container with saturated sodium
chloride to maintain a relative humidity of 75%. Slides printed
with (SEQ ID NO:7) were then washed for 5 minutes in PBS/0.05%
Tween-20, for 90 minutes in blocking buffer (0.2 M Tris with 10 mM
ethanolamine) at 50.degree. C., and for 2 hours in wash buffer
(5.times.SSC, 0.1% N-lauryl sarcosine, and 0.1% sodium dodecyl
sulfate). Slides were washed twice with water and spun in a
centrifuge to dry. They were than scanned using a General Scanning
Scan-Array 3000 fluorescence scanner (Watertown, Mass.) and the
average intensities of the resulting spots were measured. Slides
printed with (SEQ ID NO:5) were washed for 5 minutes in PBS/0.05%
Tween-20 and for 30 minutes in blocking buffer (0.2 M Tris with 10
mM ethanolamine) at 50.degree. C. The slides were finally washed
with water and dried in a centrifuge.
[0096] Fluorescently labeled complementary oligonucleotide,
5'-Cy3-CGGTGGATGGAGCAGGAGGGGCCCGAGTAT GGGAGCGGGAGACACAGAA-3' (SEQ
ID NO:8), was hybridized to the slides by placing 10 .mu.l of
hybridization solution (4.times.SSC, 0.1% N-laurylsarcosine, 2
mg/ml tRNA) on the slide and placing a cover slip on top. The
slides were then kept at 50.degree. C. high humidity (75%) to
prevent drying out of the hybridization solution. Slides were then
rinsed with 4.times.SSC, 2.times.SSC preheated to 50.degree. C. for
2 minutes, 2.times.SSC for 2 minutes, and then twice into
0.1.times.SSC for 2 minutes each. Slides were spun dry in a
centrifuge. They were then scanned using a General Scanning
fluorescence scanner. Average intensities of the resulting spots
and background levels were measured. The results listed in Table 9
show that the coatings without compound X-A immobilize slightly
less oligonucleotide but hybridization of a fluorescent
oligonucleotide results in slightly higher signal. The resulting
background is less on coatings which do not contain compound X-A.
It also shows that polymers containing PVP backbone compound (i.e.
Compound XV) are effective at immobilizing DNA and give good
hybridization results.
10TABLE 9 Immobilization and Hybridization of Oligonucleotides to
Glass Microscope Slides. immobilized SEQ ID hybridization Compound
Poly-NOS Cmpd X-A NO: 7 SEQ ID % BBA % NOS conc g/l conc g/l
signal.sup.1 NO: 8 signal.sup.2 bkg S/N Compound IX-A 1.25 0 39151
38512 45 856 Compound IX-A 1 0.25 42598 35674 88 405 Compound IX-A
2.5 0 35153 31061 34 914 Compound IX-A 2 0.5 44233 24735 75 332
Compound IX-D 1.25 0 30655 41669 45 926 Compound IX-D 1 0.25 38594
34300 99 346 Compound IX-D 2.5 0 41266 48976 67 736 Compound IX-D 2
0.5 46444 22743 123 185 Compound XV 1.25 0 28228 50248 34 1478
Compound XV 1 0.25 31544 47321 97 488 .sup.1Laser power set at 60%
and photomultiplier tube set at 60% .sup.2Laser power set at 80%
and photomultiplier tube set at 80%
Example 26
Hybridization of Immobilized PCR Products on Coated Glass Slides
with Oligonucleotide Detection Probe, Comparison Between Random
Photo-PA-PolyNOS (Compound IX-A) and a Mixture of Random
Photo-PA-PolyNOS (Compound IX-A) and Random Photo-PA-PolyQuat
(Compound X-A)
[0097] Glass slides were coated with organosilane as described in
Example 25. Compound IX-A at 1.25 mg/ml in water or a mixture of 1
mg/ml Compound IX-A and 0.25 mg/ml Compound X-A in water was coated
onto silane treated glass slides as described in Example 25.
[0098] PCR products from .beta.-galactosidase gene were custom
prepared by ATG Laboratories. Inc. (Eden Prairie). Primer with
5'-amine modification on the sense strand and unmodified primer on
the anti-sense strand were used to prepare double-stranded-PCR
products at 0.5 and 1 kilobase (kb) pair length. The control DNAs
without amine were also made. The DNAs at concentration 0.2
.mu.g/.mu.l in 80 mM sodium phosphate buffer, pH 8.5, and 8% sodium
sulfate were printed on the activated slides using microarraying
spotting pins from TeleChem International (San Jose, Calif.). The
coupling was allow to proceed in a sealed container with 75%
humidity overnight at room temperature.
[0099] To evaluate the signals from immobilized PCR products on
microarrays, the slides were placed in boiling water for 2 minutes
to denature double-stranded DNA and to remove the non-attached
strand. The slides were then incubated with 50 mM ethanolamine in
0.1 M Tris buffer, pH 9 at 50.degree. C. for 15 minutes to block
residual reactive groups on the surfaces. The slides were then
incubated with pre-hybridization solution under glass cover slips
at 50.degree. C. for 15 minutes to decrease the non-specific
backgrounds. The pre-hybridization solution contained 5.times.SSC,
5.times. Denhardt's solution (0.1 mg/ml each of bovine serum
albumin, Ficoll and PVP), 0.1 mg/ml salmon sperm DNA and 0.1% SDS.
The hybridization was then performed with 20 fmole/.mu.l of a
fluorescent complementary detection oligo, 5'-Cy3-ACGCCGA
GTTAACGCCATCA (SEQ ID NO:9), in the pine-hybridization solution
overnight at 45.degree. C. Slides were then washed and the
hybridization signals scanned as described in Example 25.
[0100] The results listed in Table 10 indicate that the glass
slides coated with Compound IX-A and mixture of Compound IX-A/X-A
had comparable signals. Amine-containing PCR product had at least
30-fold higher hybridization signals than non-modified DNA. The low
level of signals with unmodified DNA was probably due to side
reactions between amines on the heterocyclic bases to the activated
surfaces.
11TABLE 10 Hybridization Signals With Immobilized 0.5 Kb DNA And a
Complementary Detection Oligonucleotide SEQ ID NO: 9 on Compound
IX-A/Compound X-A Coated Glass Slides. Amine-primer Non-modified
primer Coating PCR product PCR product Compound IX-A 10,385 .+-.
2,379 341 .+-. 61 Compound IX-A and 16,858 .+-. 4,008 341 .+-. 79
Compound X-A Mixture
Example 27
Hybridization of Immobilized PCR Products on Coated Glass Slides
with Oligonucleotide Detection Probe--Comparison Between SurModics
and Other Commercial Slides
[0101] PCR products from cDNA clones can be attached to the
positively charged glass surfaces, such as polylysine; DeRisi, et.
al., (Science, 278, 680-686, 1997), and a covalent approach having
aldehyde groups has been reported by Schena (Schena et. al., Proc.
Natl. Acad. Sci. USA, 93, 10614-10619). In this example PCR
products were attached to those surfaces and the hybridization
signals were compared with the coatings from this invention.
SurModics glass slides were coated with mixture of Compound IX-A
and Compound X-A as described in Example 25. Silylated glass slides
that have reactive aldehyde groups for immobilizing
amine-functionalized DNA was manufactured by CEL Associates, Inc.
(Houston, Tex.). Polylysine glass slides were purchased from
Sigma.
[0102] PCR products at 1 kb length from .beta.-galactosidase at 1.5
pmole/.mu.l in 50 mM sodium phosphate buffer, pH 8.5, 1 mM EDTA and
3% sodium sulfate were printed onto silylated slides, polylysine
slides and SurModics coated slides using 0.006" id needle as
described in Example 25. The SurModics slides were then incubated
in 75% relative humidity chamber for 2 days, denatured by
submerging in boiling water bath for 2 minutes, and blocked with 10
mM ethanolamine, 0.2 M Tris, pH 8.5 for 30 minutes at 50.degree. C.
The silylated slides were incubated in a humidified incubator for 4
hours and then reduced with sodium borohydride as suggested by the
manufacturer. The polylysine slides were UV crosslinked and then
blocked with succinic anhydride as described in the
literature.sup.1. All the processed slides were hybridized with 20
fmole/.mu.l of complementary detection oligonucleotide SEQ ID NO:9
in 4.times.SSC, 2 mg/ml tRNA, 0.1% lauroylsarcosine at 45.degree.
C. overnight. The slides were washed and hybridization signals were
scanned as described in Example 25.
[0103] The results are shown in the following Table 11. There was
no difference in signals between amine-modified versus un-modified
DNA on silylated and polylysine slides. Only SurModics coatings
demonstrated that specific attachment was due to having a 5'-amine
on the PCR products. This provides evidence of end-point attachment
of DNA up to 1 kb with SurModics coatings. Polylysine slides had
the highest background probably due to ionic and/or non-specific
binding of the DNA onto the surfaces.
12TABLE 11 Hybridization Signals With Immobilized 1 Kb DNA and a
Complementary Detection Oligonucleotide SEQ ID NO: 9 on Coated
Glass Slides. Comparison of Compound IX-A/Compound X-A Coated
Slides and CommercialGlass Slides. Amine-primer Non-modified
Coating PCR Product primer PCR Product Background Compound 26,580
.+-. 3,219 946 .+-. 185 88 IX-A and Compound X-A Mixture Silylated
5,611 .+-. 2,063 7,050 .+-. 2,211 114 Polylysine 4,3674 .+-. 2,832
4,3206 .+-. 4,743 3,075
Example 28
Immobilization and Hybridization of PCR Products with cDNA
Detection Probe on Photo-Polymeric NOS Coated Glass Slides
[0104] Two sets of slides were prepared as described in Example 26.
Three PCR product sequences (designated F11, XEF, daf) containing
an amine on both, the forward, the reverse or neither strand
(provided by Axys Pharmaceuticals, La Jolla, Calif.) were dissolved
in printing buffer (80 ng/.mu.l), heated at 100.degree. C., cooled
on ice, and printed on the slides using a Generation II Arrayer
(Molecular Dynamics, Sunnyvale, Calif.). After incubation overnight
as described in Example 25, the slides were placed in a boiling
water bath for 2 minutes, washed twice with PBS/0.05% tween-20,
rinsed twice with water, and put in blocking buffer for 30 minutes
at 50.degree. C. The slides were than rinsed with water and spun
dry. Slides were prehybridized as described in Example 26 and
hybridized to a mixture of fluorescently (Cy3) labeled cDNA
(provided by Axys Pharmaceuticals) in 50% formamide, 5.times.SSC,
0.1% SDS, and 0.1 mg/ml salmon sperm DNA at 42.degree. C.
overnight. This mixture contained complementary probes to the
forward strand of all three PCR product targets. The F11 probe was
spiked at a 1 to 50,000 mass ratio relative to the other two
sequences. After hybridization, the slides were washed and scanned
as described in Example 25. The average intensities of the spots
are shown in Table 12. Slides which were hybridized to a cDNA probe
mixture which did not contain the F11 probe showed no signal in
these spots. The results show that both coating types give
comparable hybridization results. The coating containing compound
X-A had much higher background. This was especially true in the
area near where the PCR product was printed.
13TABLE 12 Immobilization of PCR Products and Hybridization to
Fluorescently Labeled cDNA on Glass Microscope Slides. Numbers are
Fluorescent Signal.sup.1. amine on both strands forward strand
reverse strand neither strand coated with compound IX-A 0.85 Kb XEF
2664.5 6125.5 759.5 3590.5 1 Kb daf 42921.5 14294 1 Kb F11 588
1859.5 123.5 891.5 background = 80 coated with mixture compounds
IX-A & X-A 0.85 Kb XEF 3001 12896 779 4119 1 Kb daf 44132.5
13269.5 1 Kb F11 535 1687.5 133 860.5 background = varies from 100
to 2500 .sup.1Laser power set at 80% and photomultiplier tube set
at 80%
[0105]
14TABLE 13 Compounds 1 COMPOUND I 2 COMPOUND II 3 COMPOUND III 4
COMPOUND IV 5 COMPOUND V 6 COMPOUND VI 7 COMPOUND VII 8 COMPOUND
VIII 9 COMPOUND IX 10 COMPOUND X 11 COMPOUND XI 12 COMPOUND XII 13
COMPOUND XIII 14 COMPOUND XIV 15 COMPOUND XV
[0106]
Sequence CWU 1
1
9 1 50 DNA Homo sapiens 1 gtctgagtcg gagccagggc ggccgccaac
agcaggagca gcgtgcacgg 50 2 30 DNA Homo sapiens 2 gtctgagtcg
gagccagggc ggccgccaac 30 3 50 DNA Homo sapiens 3 ccgtgcacgc
tgctcctgct gttggcggcc gccctggctc cgactcagac 50 4 50 DNA Homo
sapiens 4 cggtggatgg agcaggaggg gcccgagtat tgggagcggg agacacagaa 50
5 30 DNA Homo sapiens 5 ttctgtgtct cccgctccca atactcgggc 30 6 30
DNA Homo sapiens 6 ttctgtgtct cccgctccca atactcgggc 30 7 30 DNA
Homo sapiens 7 gtctgagtcg gagccagggc ggccgccaac 30 8 50 DNA Homo
sapiens 8 cggtggatgg agcaggaggg gcccgagtat tgggagcggg agacacagaa 50
9 20 DNA Homo sapiens 9 acgccgagtt aacgccatca 20
* * * * *