Novel serine protease BSSP2

Abstract

There are provided proteins having the amino acid sequences represented by SEQ ID NOS: 2, 4, 6, 8 and 10; proteins having amino acid sequences derived from these amino acid sequences by deletion, substitution or addition of one to several amino acids; and nucleotide sequences encoding the same; transgenic non-human animals with altered expression level of a serine protease BSSP2; an antibody against BSSP2; and a method for detecting BSSP2 in a specimen by using the antibody.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application is a divisional of application Ser. No. 09/856,371, filed May 21, 2001, which is the national stage under 35 U.S.C. .sctn.371 of international application PCT/JP99/06475, filed Nov. 19, 1999, which designated the United States, and which application was not published in the English language.

FIELD OF THE INVENTION

[0002] The present invention relates to isolated polynucleotides of human and mouse serine proteases (hereinafter referred to as "hBSSP2" and "mBSSP2", respectively, and, in case no differentiation thereof from each other is needed, simply referred to as "BSSP2"), and their homologous forms, mature forms, precursors and polymorphic variants as well as a method for detecting thereof. Further, it relates to hBSSP2 and mBSSP2 proteins, compositions containing hBSSP2 and mBSSP2 polynucleotides and proteins, as well as their production and use.

BACKGROUND OF THE INVENTION

[0003] In general, proteases are biosynthesized as inactive precursors. They undergo limited hydrolysis in molecules to be converted into activated type proteases. In so far as enzymes are proteases, they have an activity for hydrolyzing a peptide bond, while their actions vary according to kinds of proteases. According to a particular kind of catalytic site, proteases are divided into serine proteases, cysteine proteases, aspartate proteases, metal proteases and the like. Proteases of each kind have a variety of properties, ranging from a protease having general digestive properties to a protease having various regulatory domains and strict substrate specificity, thereby specifically hydrolyzing only characteristic proteins.

[0004] Further, proteins undergo various types of processing even after translation to produce active proteins. In many secretory proteins, a protein is first synthesized on the ribosome in cytoplasm as an inactive precursor (pro-form) which comprises an active protein bearing at the N-terminus thereof a peptide of about 15 to 60 amino acids responsible for secretion (secretory signal). This peptide region is concerned with the mechanism for passing through the cell membrane and is removed upon cleavage by a specific protease during the passage through the membrane, in almost all the cases, to produce the mature form. A secretory signal has a broad hydrophobic region comprising hydrophobic amino acids in the middle of the sequence, and basic amino acid residues at a site close to the N-terminus. A secretory signal is a synonym for a signal peptide. In addition, in some proteins, a peptide moiety which functions as a secretory signal is further attached to the N-terminus of the inactive precursor (pro-form). Such a protein is called a prepro-protein (prepro-form).

[0005] For example, trypsin is present in the form of a prepro-form immediately after translation into amino acids. After being secreted from cells, it is present in the form of a pro-form and is then converted into active trypsin in the duodenum upon limited hydrolysis by enteropeptidase or by trypsin itself.

[0006] The optimal pH range of serine proteases is neutral to weak alkaline and, in general, many of them have a molecular weight of about 30,000 or lower. All proteases relating to blood coagulation, fibrinolysis and complement systems having a large molecular weight belong to the family of trypsin-like serine proteases. They have many regulator domains and form a protease cascade which is of very importance to reactions in a living body.

[0007] Recently, cDNAs and amino acid sequences of many novel proteases have been determined by PCR for consensus sequences of serine proteases using oligonucleotide primers. According to this method, novel proteases have been found by various researchers such as Yamamura et al. (Yamanura, Y et al., Biochem. Biophys. Res. Commun., 239, 386, 1997), Gschwend, et al. (Gschwend, T. P. et al., Mol. Cell. Neurosci., 9. 207, 1997), Chen et al. (Chen, Z-L, et al., J. Neurosci., 15, 5088, 1995) and others.

[0008] SEQ ID NO: 3 of JP 9-149790 A discloses neurosin as a novel serine protease. Neurosin has also been reported in Biochimica et Byophysica Acta, 1350, 11-14, 1997. By this, there is provided a method for mass production of neurosin using the serine protease gene and a method for screening specific inhibitors using the enzyme. In addition, the screening method has been shown to be useful for screening medicines for treating various diseases.

[0009] Serine proteases expressed in a brain-nerve system such as neurosin are considered to play various roles in the brain-nerve system. Therefore, there is a possibility that isolation of a gene encoding a novel protease expressed in a brain-nerve system and production of a protein using the gene would be useful for diagnosis or therapy of various diseases related to the brain-nerve system.

[0010] Nowadays, in general, clinical diagnosis of Alzheimer's disease is based on the diagnosis standard of DSM-IIIR and NINCDS-ADRDA (Mckhann, G. et al., Neurology, 34. 939, 1994) or the diagnosis standard of DSM-IV (American Psychiatric Association; Diagnostic and statistical manuals of mental disorders, 4th ed., Washington D.C., American Psychiatric Association, 1994). However, these standards are conditioned by a decline in recognition functions which causes a severe disability in daily life or social life. Then, it is pointed out that the diagnosis is less than scientifically objective because the diagnosis may be influenced by the level of an individual's social life and further the specialty and experience of a physician who diagnoses particular conditions. In addition, definite diagnosis of Alzheimer's disease is conducted by pathohistological analyses and, in this respect, substantial inconsistency between clinical diagnosis and autopsy diagnosis exists.

[0011] At present, image diagnosis is employed as a supplemental means in clinical diagnosis of Alzheimer's diagnosis and it is possible to analyze brain functions, for example, decline of metabolism and atrophy in specific sites such as hippocampus, parietal lobe of cerebral cortex and the like which are specific for Alzheimer's disease by PET and SPECT. However, to define Alzheimer's disease based on lowering of a blood flow from parietal lobe to temporal lobe is very dangerous. In addition, there is a report showing that MRS test is useful for patients with dementia including those of Alzheimer's disease. Further, although CT-MRI image diagnosis is used, a lesion of white matter such as atrophy of brain, PVL or the like is not specific for Alzheimer type dementia. Since it has been reported that atrophy of brain proceeds with aging, the above observation is not necessarily found in Alzheimer type dementia. Furthermore, since an image obtained by MRI varies according to strength of a magnetic field, performance of the apparatus and imaging conditions, numerical data obtained in different facilities cannot be compared with each other except for atrophic change. In addition, there is a limit to image measurement. Further, enlargement of the ventricle can be recognized in vascular dementia cases and there are cases wherein atrophy of the hippocampus is observed after ischemia of the basilar artery.

[0012] Under these circumstances, many researchers have requested to develop biological diagnosis markers as a means for providing better precision and objectivity for clinical diagnosis of Alzheimer's disease. At the same time, the following important roles in the future will be expected.

[0013] 1) Objective judgment system of effect of medicaments for treating Alzheimer's disease.

[0014] 2) Detection of Alzheimer's disease before a diagnosis standard is met, or disease conditions are manifested.

[0015] Further, data obtained in different facilities can be compared with each other by using the same diagnosis marker. Therefore, development of biological diagnosis markers is recognized to be a most important field among fields of Alzheimer's disease studies and its future prospects will be expected. Approaches to development of biological diagnosis markers up to now are divided into those based on constitute components of characteristic pathological changes of Alzheimer's disease such as senile plaque and neurofibril change, and an approach based on other measures. Examples of the former include cerebrospinal fluid tau protein, A.beta. and its precursor, .beta.APP. Examples of the latter include mydriasis test with cholilytic drug, Apo E and other genes relating to Alzheimer's disease. However, no good results have been obtained.

[0016] Serine proteases are also considered to play an important role in cancer cells. The reason why extermination of cancer by surgical treatment or topical irradiation of radioactive ray is difficult is the metastatic capability of cancer. To spread solid tumor cells in a body, they loosen their adhesion to original adjacent cells, followed by separating from original tissue, passing through other tissues to reach the blood vessels or lymph nodes, entering into the circulatory system through stratum basal and endothelial layer of the vessel, leave from the circulatory system at somewhere in the body, and surviving and proliferating in a new environment. While adhesion to adjacent epidermal cells is lost when expression of cadherin which is an intercellular adhesive molecule of epithelium is stopped, to break through tissues is considered to depend on proteolytic enzymes which decompose an extracellular matrix.

[0017] As enzymes which decompose the matrix, mainly, metal proteases (Rha, S. Y. et al., Breast Cancer Research Treatment, 43, 175, 1997) and serine proteases are known. They cooperate to decompose matrix proteins such as collagen, laminin and fibronectin. Among the serine proteases known to be concerned in decomposition of the matrix, in particular, there is urokinase type plasminogen activator (U-PA). U-PA has a role as a trigger specific for a protein decomposition chain reaction. Its direct target is plasminogen. It is present in blood abundantly and is a precursor of an inactive serine protease which accumulates in reconstructed sites of tissues such as injured sites and tumors as well as inflammatory sites. In addition, as proteases which are concerned in metastasis and infiltration of cancers, for example, a tissue factor, lysosomal type hydrolase and collagenase have been known.

[0018] At present, cancer is the top cause of death in Japan and more than 200,000 people die per year. Accordingly, specific substances which can be used as markers for diagnosis and therapy or prophylaxis of cancer are studied intensively. Such specific substances are referred to as tumor markers or tumor marker relating biomarkers. They are utilized in aid of diagnosis before treatment of cancer, for presuming carcinogenic organ and pathological tissue type, for monitoring effect of treatment, for finding recurrence early, for presuming prognosis, and the like. At present, tumor markers are essential in clinical analyses. Among them, alpha fetoprotein (AFP) which has high specificity to hepatocellular carcinoma and yolk sac tumor (Taketa K. et al., Tumour Biol., 9, 110, 1988), and carcinoembronic antigen (CEA) are used worldwide. In the future, tumor markers will be required more and more, and it is desired to develop, for example, organ specific markers and tumor cell specific markers which are highly reliable serologic diagnosis of cancer. Up to now, humunglandular kallikrein (hK2) which is a serine protease expressed at human prostatic epithelial cells has been reported as a marker for prostatic cancer. And, hK2 has 78% homology with the sequence of prostatic specific antigen (PSA) and PSA is also used widely as a biochemical marker of prostatic cancer (Mikolajczyk, S. d. et al., Prostate, 34, 44, 1998; Pannek, J. et al., Oncology, 11, 1273, 1997; Chu, T. M. et al., Tumour Biology, 18, 123, 1997; Hsieh, M. et al., Cancer Res., 57, 2651, 1997). Further, hK2 is reported to be useful as a marker for not only prostatic cancer but also stomach cancer (Cho, J. Y. et al. Cancer, 79, 878, 1997). Moreover, CYFRA (CYFRA 211) for measuring cytokeratin 19 fragment in serum is reported, to be useful for lung cancer (Sugiyama, Y. et al., Japan J. Cancer Res., 85, 1178, 1994). Gastrin release peptide precursor (ProGRP) is reported to be useful as a tumor marker (Yamaguchi, K. et al., Japan, J. Cancer Res., 86, 698, 1995).

OBJECTS OF THE INVENTION

[0019] Thus, the main object of the present invention is to provide a novel serine protease which can be used for treating or diagnosing various diseases such as Alzheimer's disease (AD), epilepsy, cancer, inflammation, infertility, prostatomegaly and the like in various tissues such as brain, lung, prostate, testicle, skeletal muscle, liver and the like, and can be used as an excellent marker instead of that presently used.

SUMMARY OF THE INVENTION

[0020] Under these circumstances, the present inventors have succeeded in cloning cDNA encoding novel human and mouse serine proteases.

[0021] In summary, the 1st feature of the present invention is the amino acid sequences of biologically active mature serine proteases BSSP2 and nucleotide sequences encoding the amino acid sequences.

[0022] That is, they are the amino acid sequence composed of 238 amino acids (mature type BSSP2 (SEQ ID NO: 2)) and a nucleotide sequence encoding the amino acid sequence (the 1st to 714th bases of SEQ ID NO: 1). In addition, they include amino acid sequences substantially similar to SEQ ID NO: 2 and nucleotide sequences encoding such similar amino acid sequences. Further, they include modified derivatives of proteins having these amino acid sequences. An amino acid sequence substantially similar to a given amino acid sequence used herein means an amino acid sequence derived from the given amino acid sequence by modification such as substitution, deletion, addition and/or insertion of one to several amino acids with maintaining the same property as that of the protein having the given amino acid sequence. The modified derivative of the proteins includes, for example, phosphate adduct, sugar chain adduct, metal adduct (e.g., calcium adduct), the protein fused to another protein such as albumin etc., dimer of the protein, and the like.

[0023] In the nucleotide sequences in the Sequence Listing hereinafter, the symbol "n" represents that any of the normal bases of a nucleic acid, i.e., adenine (a), cytosine (c), guanine (g) and thymine (t) is present at that position.

[0024] The 2nd feature of the present invention is an amino acid sequence composed of 273 amino acids [type 1 BSSP2 (SEQ ID NO: 4)] wherein 35 amino acids of -35th to -1st amino acids represented by SEQ ID NO: 4 are added to the N-terminus side of the mature BSSP2 amino acid sequence (SEQ ID NO: 2) and a nucleotide sequence encoding the amino acid sequence (247th to 1065th bases of SEQ ID NO: 3). In addition, this feature includes amino acid sequences substantially similar to SEQ ID NO: 4 and nucleotide sequences encoding these substantially similar amino acid sequences. Further, this feature includes modified derivatives of proteins having these amino acid sequences.

[0025] The 3rd feature of the present invention is an amino acid sequence composed of 311 amino acids [type 2 BSSP2 (SEQ ID NO: 6)] wherein 73 amino acids of -73rd to -1st amino acids represented by SEQ ID NO: 6 are added to the N-terminus side of the mature BSSP2 amino acid sequence (SEQ ID NO: 2) and a nucleotide sequence encoding the amino acid sequence (516th to 1448th bases of SEQ ID NO: 5). In addition, this feature includes amino acid sequences substantially similar to SEQ ID NO: 6 and nucleotide sequences encoding these substantially similar amino acid sequences. Further, this feature includes modified derivatives of proteins having there amino acid sequences.

[0026] The 4th feature of the present invention is an amino acid sequence composed of 445 amino acids [type 3 BSSP2 (SEQ ID NO: 8)] wherein 207 amino acids of -207th to -1st amino acids represented by SEQ ID NO: 8 are added to the N-terminus side of the mature BSSP2 amino acid sequence (SEQ ID NO: 2) and a nucleotide sequence encoding the amino acid sequence (116th to 1450th bases of SEQ ID NO: 7). In addition, this feature includes amino acid sequences substantially similar to SEQ ID NO: 8 and nucleotide sequences encoding these substantially similar amino acid sequences. Further, this feature includes modified derivatives of proteins having there amino acid sequences.

[0027] The 5th feature of the present invention is an amino acid sequence of a biologically active, mature human serine protease, hBSSP2, and a nucleotide sequence encoding the amino acid sequence. That is, they are an amino acid sequence [mature type hBSSP2 (SEQ ID NO: 10) composed of 240 amino acids represented by SEQ ID NO: 10 (1st to 240th amino acids) and a nucleotide sequence encoding the amino acid sequence (807th to 1526th bases of SEQ ID NO: 9). In addition, this feature includes amino acid sequences substantially similar to SEQ ID NO: 10 (1st to 240th amino acids) and nucleotide sequences encoding these substantially similar amino acid sequences. Further, this feature includes modified derivatives of proteins having there amino acid sequences.

[0028] The 6th feature of the present invention is an amino acid sequence composed of 457 amino acids (-217th to 240th amino acids of SEQ ID NO: 10) wherein 217 amino acids of -217th to -1st amino acids represented by SEQ ID NO: 10 are added to the N-terminus side of the mature human serine protease hBSSP2 amino acid sequence (1st to 240 amino acids of SEQ ID NO: 10) and a nucleotide sequence encoding the amino acid sequence (156th to 1526th bases of SEQ ID NO: 9). In addition, this feature includes amino acid sequences substantially similar to SEQ ID NO: 10 and nucleotide sequences encoding these substantially similar amino acid sequences. Further, this feature includes modified derivatives of proteins having there amino acid sequences.

[0029] The 7th feature of the present invention is an amino acid sequence composed of 217 amino acids of -217th to -1st amino acids of SEQ ID NO: 10 and a nucleotide sequence encoding the amino acid sequence (156th to 806th bases of SEQ ID NO: 9). In addition, this feature includes amino acid sequences substantially similar to the amino acid composed of 217 amino acids of -217th to -1st SEQ ID NO: 10 and nucleotide sequences encoding these substantially similar amino acid sequences. Further, this feature includes modified derivatives of proteins having there amino acid sequences.

[0030] The present invention also relates to the nucleotide sequences represented by SEQ ID NOS: 1, 3, 5, 7 and 9 as well as nucleotide sequences similar to them.

[0031] The 8th feature of the present invention is a vector comprising the nucleotide sequence according to any of the above 1st to the 7th feature, and transformant cells transformed with the vector.

[0032] The 9th feature of the present invention is a process for producing BSSP2 protein from the transformed cells of the 8th feature.

[0033] The 10th feature of the present invention is a transgenic non-human animal, wherein the expression level of BSSP2 gene has been altered.

[0034] The 11th feature of the present invention is an antibody against BSSP2 protein or its fragment and a process for producing thereof.

[0035] The 12th feature of the present invention is a method for determining BSSP2 protein or its fragment in a specimen using the antibody of the 11th feature.

[0036] The 13th feature is a diagnostic marker of diseases comprising BSSP2 protein.

[0037] Hereinafter, unless otherwise stated, the nucleotide sequence represented by each SEQ ID NO: includes the above-described various fragments thereof, and similar nucleotide sequences and their fragments. Likewise, the amino acid sequence represented by each SEQ ID NO: includes the above-described various fragments thereof, similar nucleotide sequences and their fragments, and modified derivatives thereof. In addition, unless otherwise stated, BSSP2, hBSSP2, and mBSSP2 include proteins having the above-described respective amino acid sequences.

BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIG. 1 illustrates the results of northern blotting using mRNAs prepared from mice in Example 2 hereinafter.

[0039] FIG. 2 illustrates the results of northern blotting using mRNAs prepared from mice in Example 2 hereinafter.

[0040] FIG. 3 is a plasmid constructed by the method of Example 4 hereinafter.

[0041] FIG. 4 illustrates the construction of plasmid pFBTrypSigTag/BSSP2 according to the method of Example 4 hereinafter.

[0042] FIG. 5 illustrates the detection of hBSSP2 mRNA by northern hybridization.

[0043] FIG. 6 illustrates the detection of hBSSP2 mRNA by RT-PCR.

[0044] FIG. 7 illustrates the expression of hBSSP2 by a baculovirus system.

DETAILED DESCRIPTION OF THE INVENTION

[0045] The nucleotide sequences encoding hBSSP2 or mBSSP2 of the present invention can be obtained by preparing mRNAs from cells expressing the protein and converting it into double stranded DNAs according to a conventional manner. For preparing mRNA, guanidine isothiocyanate-calcium chloride method (Chirwin, et al., Biochemistry, 18, 5294, 1979) or the like can be used. For preparing poly (A)+RNA from total RNAs, there can be used affinity chromatography using a carrier, for example, Sepharose, latex particles, etc., to which oligo (dT) is attached, and the like. The above-obtained RNA can be used as a template and treated with reverse transcriptase by using, as a primer, oligo (dT) which is complementary to the poly (A) strand at the 3'-terminus, or a random primer, or a synthesized oligonucleotide corresponding to a part of the amino acid sequence of hBSSP2 or mBSSP2 to obtain a hybrid mRNA strand comprising DNA or cDNA complementary to the mRNA. The double stranded DNA can be obtained by treating the above-obtained hybrid mRNA strand with E. coli RNase, E. coli DNA polymerase and E. coli DNA ligase to convert into a DNA strand.

[0046] It is also possible to carry out cloning by RT-PCR method using primers synthesized on the basis of the nucleotide sequence of hBSSP2 or mBSSP2 gene and using hBSSP2 or mBSSP2 expressing cell poly (A)+RNA as a template. Alternatively, the desired cDNA can be obtained without using PCR by preparing or synthesizing a probe on the basis of the nucleotide sequence of hBSSP2 or mBSSP2 gene and screening a cDNA library directly. Among genes obtained by these methods, the gene of the present invention can be selected by confirming a nucleotide sequence thereof. The gene of the present invention can also be prepared according to a conventional method using chemical syntheses of nucleic acids, for example, phosphoamidite method (Mattencci, M. D. et al., J. Am. Chem. Soc., 130, 3185, 1981) and the like.

[0047] By using the thus-obtained hBSSP2 or mBSSP2 gene, their expression in various tissues can be examined.

[0048] In case of northern blotting analysis, mBSSP2 shows the expression in the head of a 15-20 days mouse fetus, and in the lung, prostate and testicle of a 3 month-old mouse. hBSSP2 shows the expression in brain, skeletal muscle and liver (see FIGS. 1, 2 and 5). In case of RT-PCR analysis, mBSSP2 shows the expression in the brain and testicle of a 12 day-old mouse, and hBSSP2 shows the expression in the brain and skeletal muscle. Then, the novel proteases of the present invention are presumed to play various roles in the brain, prostate, lung, testicle, skeletal muscle and liver. For example, in the brain, there is a possibility that they can be used for treatment and diagnosis of brain diseases such as Alzheimer's disease (AD), epilepsy, brain tumor and the like. Further, in other tissues, there is a possibility that BSSP2 of the present invention and a gene encoding it can be used for treatment and diagnosis of various diseases such as cancer, inflammation, infertility, prostatomegaly and the like. Further, it is presumed they may have a certain influence on blood coagulation, fibrinolysis and complement systems. Furthermore, there is a possibility that inhibitors of serine proteases can be used for treatment and diagnosis of Alzheimer's disease, epilepsy, cancer, inflammation, infertility, prostatomegaly and the like.

[0049] The novel mouse serine protease can be divided into types 1, 2 and 3. It has been shown that type 1 is composed of 273 amino acids, type 2 is composed of 311 amino acids, and type 3 is composed of 445 amino acids. These amino acid sequences contain a common amino acid sequence of 238 amino acids whose N-terminus side starts with Ile-Val-Gly-Gly-Gln-Ala- -Val (amino acid 1-7 of SEQ ID NO:2) as the mature serine protease. Further, the amino acid sequence of the mature serine protease contains a consensus sequence having serine protease activity. Since there are two or more amino acid sequences which are characteristic of sugar chain binding sites, the amino acid sequence is presumed to have at least two sugar chains.

[0050] Furthermore, in the novel human serine protease (hBSSP2), there are a transmembrane region and a scavenger receptor cysteine rich-like domain in the N-terminus side of hBSSP2 mature protein as seen from SEQ ID NO: 10.

[0051] The term "pro part" used herein means a part of a pro-form, i.e., the pro-form from which the corresponding active type protein part is removed. The term "pre part" used herein means a part of a prepro-form, i.e., the prepro-form from which the corresponding pro-form is removed. The term "prepro part" used herein means a part of a prepro-form, i.e., the prepro-form from which the corresponding active type protein part is removed.

[0052] The amino acid sequence represented by SEQ ID NO: 2 is the BSSP2 mature or active type protein composed of 238 amino acids, and the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 1 is composed of 714 bases. The present inventors have shown that the serine protease activity is maintained even when one to several amino acids of the N-terminus of the mature type protein of the present invention is deleted or added, while the sequence represented by SEQ ID NO: 2 is preferred.

[0053] The amino acid sequence represented by SEQ ID NO: 4 is type 1 BSSP2 protein composed of 273 amino acids, and the nucleotide sequence encoding the amino acid sequence represented SEQ ID NO: 3 is composed of 1685 bases. The sequence of the -35th to -1st amino acids is the prepro or pro part and the amino acid sequence represented by SEQ ID NO: 4 is considered to be a precursor type of the BSSP2 protein.

[0054] The amino acid sequence represented by SEQ ID NO: 6 is type 2 BSSP 2 protein composed of 311 amino acids and the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 5 is composed of 2068 bases. The sequence of the -73rd to -1st amino acids is the prepro or pro part and the amino acid sequence represented by SEQ ID NO: 6 is considered to be a precursor type of BSSP2 protein.

[0055] The amino acid sequence represented by SEQ ID NO: 8 is type 3 BSSP2 protein composed of 445 amino acids and the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 7 is composed of 2070 bases. The amino acid sequence of the -207th to -1st amino acids is the prepro or pro part and the amino acid sequence represented by SEQ ID NO: 8 is considered to be a precursor type of BSSP2 protein.

[0056] SEQ ID NOS: 4, 6 and 8 contain the common amino acid sequence represented by SEQ ID NO: 2 as the mature BSSP2 protein. Further, each of amino acid sequences of -25th to 238th amino acids in SEQ ID NOS: 4, 6 and 8 is the consensus sequence.

[0057] The amino acid sequence represented by SEQ ID NO: 10 is hBSSP2 protein composed of 457 amino acids and the nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 9 is composed of 1371 bases. Since a transmembrane region and a scavenger receptor cysteine rich-like domain are present in the amino acid sequence of the -217th to -1st amino acids of SEQ ID NO: 10, it is considered that hBSSP2 exhibits its activity not only in the form of the mature protein but also in the form of an adduct of the -217th to -1st amino acids.

[0058] In general, many genes of eucaryotes exhibit polymorphism and, sometimes, one or more amino acids are substituted by this phenomenon. Further, even in such a case, sometimes, a protein maintains its activity. Then, the present invention includes a gene encoding a protein obtained by modifying a gene encoding any one of the amino acid sequences represented by SEQ ID NOS: 2, 4, 6, 8 and 10, artificially, in so far as the protein has the characteristic function of the gene of the present invention. Further, the present invention includes a protein which is a modification of any one of amino acid sequences represented by SEQ ID NOS: 2, 4, 6, 8 and 10 in so far as the protein has the characteristics of the present invention. Modification is understood to include substitution, deletion, addition and/or insertion. In particular, the present inventors have shown that, even when several amino acids are added to or deleted from the N-terminus amino acid of the BSSP2 mature protein represented by SEQ ID NO: 2, the resultant sequence maintains its activity.

[0059] That is, the present invention includes a protein comprising any one of the amino acid sequences described in SEQ ID NOS: 2, 4, 6, 8 and 10; an amino acid sequence encoded 5 by any one of the nucleotide sequences represented by SEQ ID NOS: 1, 3, 5, 7 and 9; or one of these amino acid sequences wherein one to several amino acids have been substituted, deleted, added and/or inserted, and belonging to serine protease family.

[0060] Each codon for the desired amino acid itself has been known and can be selected freely. For example, codons can be determined according to a conventional manner by taking into consideration the frequency of use of codons in a host to be utilized (Grantham, R. et al., Nucleic Acids Res., 9, r43, 1989). Therefore, the present invention also includes a nucleotide sequence appropriately modified by taking into consideration the degeneracy of a codon. Further, these nucleotide sequences can be modified by a site directed mutagenesis using a primer composed of a synthetic oligonucleotide encodinq the desired modification (Mark, D. F. et al., Proc. Natl. Acad. Sci. USA., 81, 5662, 1984), or the like.

[0061] Furthermore, the DNA of the present invention includes DNA which is hybridizable to any one of the nucleotide sequences described in SEQ ID NOS: 1, 3, 5, 7 and 9 or nucleotide sequences complementary to these nucleotide sequences in so far as the protein encoded by the nucleotide sequence has the same properties as those of the BSSP2 of the present invention. It is considered that many of the sequences which are hybridizable to a given sequence under stringent conditions have a similar activity to that of a protein encoded by the given sequence. The stringent conditions according to the present invention includes, for example, incubation in a solution containing 5.times.SSC, 5% Denhardt's solution (0.1% BSA, 0.1% Ficol 1400, 0.1% PVP), 0.5% SDS and 20 .mu.g/ml denatured salmon sperm DNA at 37.degree. C. overnight, followed by washing with 2.times.SSC containing 0.1% SDS at room temperature. Instead of SSC, SSPE can be appropriately used.

[0062] Probes for detecting a BSSP2 gene can be designed based on any one of nucleotide sequences described in SEQ ID NOS: 1, 3, 5, 7 and 9. Or, primers can be designed for amplifying DNA or RNA containing the nucleotide sequence. To design probes or primers is carried out routinely by a person skilled in the art. An oligonucleotide having a designed nucleotide sequence can be synthesized chemically. And, when a suitable label is added to the oligonucleotide, the resultant oligonucleotide can be utilized in various hybridization assay. Or, it can be utilized in nucleic acid synthesis reactions such as PCR. An oligonucleotide to be utilized as a primer has, preferably, at least 10 bases, more preferably 15 to 50 bases in length. An oligonucleotide to be utilized as a probe has, preferably, 100 bases to full length.

[0063] Moreover, it is possible to obtain a promoter region and an enhancer region of a BSSP2 gene present in the genome based on the cDNA nucleotide sequence of BSSP2 provided by the present invention. Specifically, these control regions can be obtained according to the same manner as described in JP 6-181767 A; J. Immunol., 155, 2477, 1995; Proc. Natl. Acad. Sci., USA, 92, 3561, 1995 and the like. The promoter region used herein means a DNA region which is present upstream from a transcription initiation site and controls expression of a gene. The enhancer region used herein means a DNA region which is present in an intron, a 5'-non-translated region or a 3'-non-translated region and enhances expression of a gene.

[0064] The present invention also relates to a vector comprising the nucleotide sequence represented by SEQ ID NO: 1 or a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2; the nucleotide sequence represented by SEQ ID NO: 3 or a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 4; the nucleotide sequence represented by SEQ ID NO: 5 or a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 6; the nucleotide sequence represented by SEQ ID NO: 7 or a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 8; or the nucleotide sequence represented by SEQ ID NO: 9 or a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 10; or a nucleotide sequence similar to them. A nucleotide sequence similar to a given nucleotide sequence used herein means a nucleotide sequence which is hybridizable to the given nucleotide sequence or its complementary nucleotide sequence under the above-described stringent conditions and which encodes a protein having the same properties as those of the protein encoded by the nucleotide sequence.

[0065] The vector is not specifically limited in so far as it can express the protein of the present invention. Examples thereof include pBAD/His, pRSETA, pcDNA2.1, pTrcHis2A, pYES2, pBlueBac4.5, pcDNA3.1 and pSecTag2 manufacture by Invitrogen, pET and PBAC manufactured by Novagen, pGEM manufactured by Promega, pBluescriptII manufactured by Stratagene, PGEX and pUC18/19 manufactured by Pharmacia, PfastBAC1 manufactured by GIBCO and the like. Preferably, a protein expression vector (described in the specification of a patent application entitled "Protein expression vector and its use" and filed by the same applicant on the same day) is used. This expression vector is constructed by using pCRII-TOPO vector described in the Examples hereinafter, or a commercially available expression vector, for example pSecTag2A vector or pSecTag2B vector (Invitrogen) and integrating a secretory signal nucleotide sequence suitable for expression of the protein of the present invention, in the 3' downstream side thereof, a Tag nucleotide sequence, a cleavable nucleotide sequence and a cloning site, into which a nucleotide sequence encoding a target protein can be inserted, in this order. More specifically, it is preferred to use trypsin signal as the secretory signal, a nucleotide sequence encoding polyhistidine as the Tag nucleotide sequence, and a nucleotide sequence encoding an amino acid sequence which is susceptible to enzyme-specific cleavage, i.e., a nucleotide sequence encoding the amino acid sequence of Asp-Asp-Asp-Asp-Lys SEQ ID NO:42 (said amino acid sequence is recognized by enterokinase, and the recombinant fusion protein is cleaved at the C-terminus part thereof) as the cleavable nucleotide sequence.

[0066] Furthermore, the present invention provides transformed cells having the nucleotide sequence of the present invention in an expressible state by means of the above vector. Preferably, host cells to be used for the transformed cells of the present invention are animal cells and insect cells. However, host cells include any cells (including those of microorganisms) which can express a nucleotide sequence encoding the desired protein in the expression vector of the present invention and can secrete extracellularly.

[0067] The animal cells and insect cells used herein include cells derived from human beings and cells derived from flies or silk worms. For example there are CHO cells, COS cells, BHK cells, Vero cells, myeloma cells, HEK293 cells, HeLa cells, Jurkat cells, mouse L cells, mouse C127 cells, 10 mouse FM3A cells, mouse fibroblast, osteablast, cartilage cells, S2, Sf9, Sf21, High Five.TM. (registered trade mark) cells and the like.

[0068] The protein of the present invention as such can be expressed as a recombinant fused protein so as to facilitate isolation, purification and recognition. The recombinant fused protein used herein means a protein expressed as an adduct wherein a suitable peptide chain is added to the N-terminus and/or C-terminus of the desired protein expressed by a nucleotide sequence encoding the desired protein. The recombinant protein used herein means that obtained by integrating a nucleotide sequence encoding the desired protein in the expression vector of the present invention and cut off an amino acid sequence which derived from nucleic acids other than those encoding the desired protein from the expressed recombinant fused protein, and is substantially the same as the protein of the present invention.

[0069] Introduction of the above vector into host cells can be carried out by, for example, transfection according to the lipopolyamine method, DEAE-dextran method, Hanahan method, lipofectin method or calcium phosphate method, microinjection, eletroporation and the like.

[0070] As described above, the present invention also relates to a process for producing hBSSP2 of mBSSP2 comprising culturing cells transformed with the above nucleotide sequence of the present invention and collecting the produced hBSSP2 of mBSSP2. The culture of cells and separation and purification of the protein can be carried out by a per se known method.

[0071] The present invention also relates to an inhibitor of the novel serine protease of the present invention. Screening of the inhibitor can be carried out according to a per se known method such as comparing the enzyme activity upon bringing into contact with a candidate compound with that without contact with the candidate compound, or the like

[0072] The present invention relates to a non-human transgenic animal whose expression level of hBSSP2 or mBSSP2 gene has been altered. The hBSSP2 or mBSSP2 gene used herein includes cDNA, genomic DNA or synthetic DNA encoding hBSSP2 or mBSSP2. In addition, expression of a gene includes any steps of transcription and translation. The non-human transgenic animal of the present invention is useful for studies of functions or expression control of hBSSP2 or mBSSP2, elucidation of mechanisms of diseases in which hBSSP2 or mBSSP2 is presumed to be involved, and development of disease model animals for screening and safety test of medicine.

[0073] In the present invention, expression of a gene can be modified artificially by mutagenizing at a part of several important sites which control normal gene expression (enhancer, promoter, intron, etc.) such as deletion, substitution, addition and/or insertion to increase or decrease an expression level of the gene in comparison with its inherent expression level. This mutagenesis can be carried out according to a known method to obtain the transgenic animal.

[0074] In a narrow sense, the transgenic animal means an animal wherein a foreign gene is artificially introduced into reproductive cells by gene recombinant techniques. In a broad sense, the transgenic animal includes an antisense transgenic animal the function of whose specific gene is inhibited by using antisense RNA, an animal whose specific gene is knocked out by using embryonic stem cells (ES cells), and an animal into which point mutation DNA is introduced, and the transgenic animal means an animal into which a foreign gene is stably introduced into a chromosome at an initial stage of ontogeny and the genetic character can be transmitted to the progeny.

[0075] The transgenic animal used herein should be understood in a broad sense and includes any vertebrates other than a human being. The transgenic animal of the present invention is useful for studies of functions or expression control of BSSP2, elucidation of mechanisms of diseases associated with cells expressing in a human being, and development of disease model animals for screening and safety test of medicine.

[0076] As a technique for creating the transgenic animal, a gene is introduced into a nucleus in a pronucleus stage of egg cells with a micropipette directly under a phase-contrast microscope (microinjection, U.S. Pat. No. 4,873,191). Further, there are a method using embryonic stem cell (ES cell), and the like. In addition, there are newly developed methods such as a method wherein a gene is introduced into a retroviral vector or adenoviral vector to infect egg cells, a sperm vector method wherein a gene is introduced into egg cells through sperms, and the like.

[0077] A sperm vector method is a gene recombinant technique wherein a foreign gene is incorporated into sperm cells by adhesion, electroporation, etc., followed by fertilization of egg cells to introduce the foreign gene into the egg cells (M. Lavitranoet et al., Cell, 57, 717, 1989). Alternatively, an in vivo site specific gene recombinant technique such as that using cre/loxP recombinase system of bacteriophage P1, FLP recombinase system of Saccharomyces cerevisiae, etc. can be used. Furthermore, introduction of a transgene of the desired protein into a non-human animal using a retroviral vector has been reported.

[0078] For example, a method for creating a transgenic animal by microinjection can be carried out as follows.

[0079] First, a transgene primarily composed of a promoter responsible for expression control, a gene encoding a specific protein and a poly A signal is required. It is necessary to confirm expression modes and amounts between respective systems because an expression mode and amount of a specific molecule is influenced by a promoter activity, and transgenic animals differ from each other according to a particular system due to the difference in a copy number of an introduced transgene and a introduction site on a chromosome. An intron sequence which is spliced may be previously introduced before the poly A signal because it has been found that an expression amount varies due to a non-translation region and splicing. Purity of a gene to be used for introduction into fertilized egg cells should be as high as possible. This is of importance. Animals to be used include a mouse for collecting fertilized eggs (5 to 6 week old), a male mouse for mating, a false pregnancy female mouse, a seminiferous tubule-ligated mouse, and the like.

[0080] For obtaining fertilized egg cells efficiently, ovulation may be induced with gonadotropin or the like. Fertilized egg cells are recovered and a gene in an injection pipette is injected into male pronucleus of the egg cells by microinjection. For returning the injected egg cells to a fallopian tube, an animal (false pregnancy female mouse, etc.) is provided and about 10 to 15 eggs/mice are transplanted. Then, genomic DNA is extracted from the end part of the tail to confirm whether the transgene is introduced into newborn mouse or not. This confirmation can be carried out by detection of the transgene with southern blot technique or PCR technique, or by positive cloning wherein a marker gene, which is activated only when homologous recombination is caused, has been introduced. Further, transcribed products derived from the transgene are detected by northern blot technique or RT-PCR technique to confirm expression of the transgene. Or, western blotting can be carried out with a specific antibody to a protein.

[0081] The knockout mouse of the present invention is treated so that the function of mBSSP2 gene is lost. A knockout mouse means a transgenic mouse in which any one of its genes is destroyed by homologous recombination technique so that its function is deficient. A knockout mouse can be created by carrying out homologous recombination with ES cells and selecting embryonic stem cells wherein either of allele genes are modified or destroyed. For example, embryonic stem cells whose genes are manipulated at the blastocyte or morula stage of fertilized eggs are injected to obtain a chimeric mouse wherein cells derived from the embryonic stem cells are mixed with those derived from the embryo. The chimeric mouse (chimeric means a single individual formed by somatic cells based on two or more fertilized eggs) can be mated with a normal mouse to create a heterozygote mouse wherein all of the allele genes have been modified or destroyed. Further, a homozygote mouse can be created by mating heterozygote mice.

[0082] Homologous recombination means recombination between two genes whose nucleotide sequences are the same or very similar to each other in terms of gene recombination mechanism. PCR can be employed to select homologous recombinant cells. A PCR reaction can be carried out by using a part of a gene to be inserted and a part of a region where the insertion is expected as primers to find out occurrence of homologous recombination in cells which give an amplification product. Further, for causing homologous recombination in a gene expressed in embryonic stem cells, homologous recombinant cells can readily be selected by using a known method or its modification. For example, cells can be selected by joining a neomycin resistant gene to a gene to be introduced to impart neomycin resistance to cells after introduction.

[0083] The present invention also provide an antibody recognizing hBSSP2 or mBSSP2 or a fragment thereof. The antibody of the present invention includes an antibody against a protein having the amino acid sequence described in any of SEQ ID NOS: 2, 4, 6, 8 and 10 or its fragment. An antibody against hBSSP2 or mBSSP2 or a fragment thereof (e.g., polyclonal antibody, monoclonal antibody, peptide antibody) or an antiserum can be produced by using hBSSP2 or mBSSP2 or a fragment thereof, etc. as an antigen according to a per se known process for producing an antibody or an antiserum.

[0084] The hBSSP2 or mBSSP2 of a fragment thereof is administered to a site of a warm-blooded animal where an antibody can be produced by administration thereof as such or together with a diluent or carrier. For enhancing the antibody production, upon administration, Freund's complete adjuvant or Freund's incomplete adjuvant may be administrated. Normally, the administration is carried out once every 1 to 6 weeks, 2 to 10 times in all. Examples of the warm-blooded to be used include monkey, rabbit, dog, guinea pig, mouse, rat, sheep, goat, chicken and the like with mouse and rat being preferred. As rats, for example, Wistar and SD rats are preferred. As mice, for example, BALB/c, C57BL/6 and ICR mice are preferred.

[0085] For producing monoclonal antibody producer cells, individuals whose antibody titer have been recognized are selected from warm-blooded animals, e.g., a mouse immunized with an antigen. Two to 5 days after the last immunization, the spleen or lymph node of the immunized animal is collected and antibody producer cells contained therein are subjected to cell fusion with myeloma cells to prepare a monoclonal antibody producer hybridoma. The antibody titer in an antiserum can be determined by, for example, reacting the antiserum with a labeled hBSSP2 or mBSSP2 as described hereinafter, followed by measurement of the activity bound to the antibody. The cell fusion can be carried out according to a known method, for example, that described by Koehler and Milstein (Nature, 256, 495, 1975) or its modifications (J. Immunol. Method, 39, 285, 1980; Eur. J. biochem, 118, 437, 1981; Nature, 285, 446, 1980). As a fusion promoting agent, there are polyethylene glycol (PEG), Sendai virus and the like. Preferably, PEG is used. Further, for improving fusion efficiency, lectin, poly-L-lysine or DMSO can be appropriately added.

[0086] Examples of myeloma cells include X-63Ag8, NS-1, P3U1, SP2/0, AP-1 and the like with SP2/0 being preferred. The preferred ratio of the number of the antibody producer cells (spleen cells):the number of spleen cells are 1:20 to 20:1. PEG (preferably PEG 1000 to PEG 6000) is added at a concentration of about 10 to 80% and the mixture is incubated at 20 to 40.degree. C., preferably 30 to 37.degree. C. for 1 to 10 minutes to carry out the cell fusion efficiently. Screening of anti-hBSSP2 or mBSSP2 antibody producer hybridomas can be carried out by various methods. For example, a supernatant of a hybridoma culture is added to a solid phase to which hBSSP2 or mBSSP2 antigen is adsorbed directly or together with a carrier (e.g., microplate), followed by addition of an anti-immunoglobulin antibody (in case that the cells used in cell fusion are those of a mouse, anti-mouse immunoglobulin antibody is used) or protein A to detect the anti-hBSSP2 or mBSSP2 monoclonal antibody attached to the solid phase. Or, a supernatant of a hybridoma culture is added to a solid phase to which an anti-immunoglobulin antibody or protein A is adsorbed, followed by addition of hBSSP2 or mBSSP2 labeled with a radioactive substance, an enzyme, etc., to detect the anti-hBSSP2 or mBSSP2 monoclonal antibody attached to the solid phase.

[0087] Selection and cloning of the anti-hBSSP or mBSSP monoclonal antibody can be carried out according to a per se known method or its modification. Normally, a HAT (hypoxanthine, aminopterin, thymidine)-added medium for culturing animal cells is used. Any culture medium can be used for selection, cloning and growing up in so far as the hybridoma can grow. For example, there can be used RPMI culture medium containing 1 to 20%, preferably 10 to 20% fetal bovine serum, a serum-free medium for culturing hybridomas. Preferably, the culture is carried out at a temperature of about 37.degree. C. Normally, the culture time is 5 days to 3 weeks, preferably 1 week to 2 weeks. Normally, the culture is carried out under 5% CO.sub.2. The antibody titer of a supernatant of a hybridoma culture can be measured according to the same manner as that of the above-described measurement of anti-BSSP2 antibody titer in an antiserum. That is, examples of the measurement to be used include radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), FIA (fluorescence immunoassay), plaque assay, agglutination reaction method, and the like. Among them, ELISA as shown below is preferred.

[0088] Screening by ELISA

[0089] A protein prepared according to the same operation as that for an immunogen is immobilized on the surface of each well of an ELISA plate. Next, BSA, MSA, OVA, KLH, gelatin, skimmed milk, or the like is immobilized on each well to prevent non-specific adsorption. A supernatant of a hybridoma culture is added to each well and is allowed to stand for a given time so that an immunological reaction proceeds. Each well is washed with a washing solution such as PBS or the like. Preferably, a surfactant is added to this washing solution. An enzyme labeled secondary antibody is added and allowed to stand for a given time. As the enzyme to be used for the label, there can be used .beta.-galactosidase, alkaline phosphatase, peroxidase and the like. After washing each well with the same washing solution, a substrate solution of the labeled enzyme used is added so that an enzymatic reaction proceeds. When the desired antibody is present in the supernatant of a hybridoma culture, the enzymatic reaction proceeds and the color of the substrate solution is changed.

[0090] Normally, cloning is carried out by a per se known method such as semi-solid agar method, limiting dilution method and the like. Specifically, after confirming a well in which the desired antibody is produced by the above-described method, cloning is carried out to obtain a single clone. For cloning, it is preferred to employ limiting dilution method wherein hybridoma cells are diluted so that one colony is formed per one well of a culture plate. For cloning by limiting dilution method, feeder cells can be used, or a cell growth factor such as interleukin 6, etc. can be added to improve colony forming capability. In addition, cloning can be carried out by using FACS and single cell manipulation method. The cloned hybridoma is preferably cultured in a serum-free culture medium and an optimal amount of an antibody is added to its supernatant. The single hybridoma thus obtained can be cultured in a large amount by using a flask or a cell culture device, or cultured in the abdominal cavity of an animal (J. Immunol. Meth., 53, 313, 1982) to obtain a monoclonal antibody. When culturing in a flask, there can be used a cell culture medium (e.g., IMDM, DMEM, RPMI1640, etc.) containing 0 to 20% of FCS. When culturing in the abdominal cavity of an animal, the animal to be used is preferably the same species or the same line as that from which the myeloma cells used in the cell fusion are derived, a thymus deficient nude mouse or the like, and the hybridoma is transplanted after administration of a mineral oil such as pristane, etc. After 1 to 2 weeks, myeloma cells are proliferated in the abdominal cavity to obtain ascites containing a monoclonal antibody.

[0091] The monoclonal antibody of the present invention which does not cross-react with other proteins can be obtained by selecting a monoclonal antibody which recognizes an epitope specific to hBSSP2 or mBSSP2. In general, an epitope presented by an amino acid sequence composed of at least 3, preferably 7 to 20 successive amino acid residues in an amino acid sequence which constitutes a particular protein is said to be an inherent epitope of the protein. Then, a monoclonal antibody recognizing an epitope constituted by a peptide having an amino acid sequence composed of at least 3 successive amino acid residue selected from the amino acid residues disclosed in any of SEQ ID NOS: 2, 4, 6 and 8 can be said to be the monoclonal antibody specific for BSSP2 of the present invention. An epitope common to BSSP2 family can be selected by selecting an amino acid sequence conservative among the amino acid sequences described in SEQ ID NOS: 2, 4, 6, 8 and 10. Or, in case of a region containing an amino acid sequence specific for each sequence, a monoclonal antibody which can differentiate respective proteins can be selected.

[0092] Separation and purification of the anti-hBSSP2 or mBSSP2 monoclonal antibody, like a conventional polyclonal antibody, can be carried out according to the same manner as those of immunoglobulins. As a known purification method, there can be used a technique, for example, salting out, alcohol precipitation, isoelectric precipitation, electrophoresis, ammonium sulfate precipitation, absorption and desorption with an ion exchange material (e.g., DEAE), ultrafiltration, gel filtration, or specific purification by collecting only an antibody with an antibody-binding solid phase or an active adsorber such as protein A or protein G, etc., and dissociating the binding to obtain the antibody. For preventing formation of aggregates during purification or decrease in the antibody titer, for example, human serum albumin is added at a concentration of 0.05 to 2%. Alternatively, amino acids such as glycine, .alpha.-alanine, etc., in particular, basic amino acids such as lysine, arginine, histidine, etc., saccharides such as glucose, mannitol, etc., or salts such as sodium chloride, etc. can be added. In case of IgM antibody, since it is very liable to be aggregated, it may be treated with .beta.-propionilactone and acetic anhydride.

[0093] The polyclonal antibody of the present invention can be produced according to a per se known method or its modification. For example, an immunogen (protein antigen) per se or a complex thereof with a carrier protein is prepared and, according to the same manner as that in the above monoclonal antibody production, a warm-blooded animal is immunized. A material containing an antibody against the protein of the present invention or its fragment is collected from the immunized animal and the antibody is separated and purified to obtain the desired antibody. As for a complex of an immunogen and a carrier protein for immunizing a warm-blooded animal, the kind of a carrier protein and the mixing ratio of a carrier and a hapten are not specifically limited in so far as an antibody against hapten immunized by cross-linking with the carrier is efficiently produced. For example, there can be used about 0.1 to 20, preferably about 1 to 5 parts by weight of bovine serum albumin, bovine cycloglobulin, hemocyanin, etc. coupled with one part by weight of a hapten. For coupling a carrier and a hapten, various condensing agents can be used. Examples thereof include glutaraldehyde, carbodiimide or maleimide active ester, active ester agents having thiol group or dithiopyridyl group, and the like. The condensed product is administered as such or together with a carrier or diluent to a site of a warm-blooded animal where an antibody can be produced. For enhancing the antibody production, upon administration, Freund's complete adjuvant or Freund's incomplete adjuvant may be administered. Normally, the administration is carried out once every 2 to 6 weeks, 3 to 10 times in all. The polyclonal antibody can be collected from blood, ascites, or the like, preferably blood of the immunized animal. The polyclonal antibody titer in an antiserum can be measured according to the same manner as measurement of the above monoclonal antibody titer in the antiserum. Separation and purification of the polyclonal antibody, like the above monoclonal antibody, can be carried out according to the same manner as those of immunoglobulins.

[0094] The monoclonal antibody and polyclonal antibody against hBSSP2 or mBSSP2 or a fragment thereof can be utilized for diagnosis and treatment of diseases associated with cells expressing hBSSP2 or mBSSP2. By using these antibodies, hBSSP2 or mBSSP2 or a fragment thereof can be determined based on their immunological binding to hBSSP2 or mBSSP2 or a fragment thereof of the present invention. Specifically, examples of a method for determining hBSSP2 or mBSSP2 or a fragment thereof in a specimen by using these antibodies include a sandwich method wherein the antibody attached to an insoluble carrier and the labeled antibody are reacted with hBSSP2 or mBSSP2 or a fragment thereof to form a sandwich complex and the sandwich complex is detected, as well as a competitive method wherein labeled hBSSP2 or mBSSP2, and hBSSP2 or mBSSP2 or a fragment thereof in the specimen are competitively reacted with the antibody and hBSSP2 or mBSSP2 or a fragment thereof in the specimen is determined based on the amount of the labeled antigen reacted with the antibody.

[0095] As a sandwich method for determining hBSSP2 or mBSSP2 or a fragment thereof, there can be used a two step method, a one step method and the like. In the two step method, first, the immobilized antibody is reacted with hBSSP2 or mBSSP2 or a fragment thereof and then unreacted materials are completely removed by washing, followed by addition of the labeled antibody to form immobilized antibody-hBSSP2 or mBSSP2-labeled antibody. In the one step method, the immobilized antibody, labeled antibody and hBSSP2 or mBSSP2 or a fragment thereof are added at the same time.

[0096] Examples of an insoluble carrier used for the determination include synthetic resins such as polystyrene, polyethylene, polypropylene, polyvinyl chloride, polyester, polyacrylate, nylon, polyacetal, fluorine plastic, etc.; polysaccharides such as cellulose, agarose, etc.; glass; metal; and the like. An insoluble carrier may be shaped in various forms, for example, tray, sphere, fiber, rod plate, container, cell, test tube, and the like. The antibody adsorbed by a carrier is stored at a cold place in the presence of an appropriate preservative such as sodium azide or the like.

[0097] For immobilization of the antibody, a known chemical bonding method or a physical adsorption can be used. Examples of a chemical bonding method include a method using glutaraldehyde; maleimide method using N-succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate, N-succinimdyl-2-maleimide acetate or the like; carbodiimide method using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride; or the like. In addition, there are maleimidobenzoyl-N-hydroxysuccinimide ester method, N-succinimidyl-3-(2-pyridylthio)propionic acid method, bisdiazobenzidine method, and dipalmityllysine method. Or, it is possible to capture a complex formed beforehand by reacting a material to be tested with two antibodies, whose epitopes are different, with an immobilized a 3rd antibody against the antibody.

[0098] For labeling, it is preferred to use an enzyme, fluorescent substance, luminous substance, radioactive substance, metal chelate, or the like. Examples of the enzyme include peroxidase, alkaline phosphatase, .beta.-D-galactosidase, malate dehydrogenase, Staphylococcus nuclease, .delta.-5-steroidisomerase, .alpha.-glycerol phosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, asparaginase, glucose oxidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, acetylcholinesterase and the like. Examples of the fluorescent substance include fluorescein isothiocyanate, phycobiliprotein, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthalaldehyde, and the like. Examples of the luminous substance include isoluminol, lucigenin, luminol, aromatic acridinium ester, imidazole, acrdinium salt and its modified ester, luciferin, luciferase, aequorin and the like. Examples of the radioactive substance include .sup.125I, .sup.127I, .sup.131I, .sup.14C, .sup.3H, .sup.32P, .sup.35S and the like. The labeling material is not limited to them and any material which can be used for immunological determination can be used. Further, a low molecular weight hapten such as biotin, dinitrophenyl, pyridoxal or fluorescamine may be attached to the antibody. Preferably, horseradish peroxidase is used as a labeling enzyme. This enzyme can be reacted with various substrates and can readily be attached to the antibody by periodate method.

[0099] When an enzyme is used as a labeling material, a substrate and, if necessary, a coloring enzyme is used for measuring its activity. In case of using peroxidase as the enzyme, H.sub.2O.sub.2 is used as a substrate and, as a coloring agent, there can be used 2,2'-azino-di-[3-ethylbenzthi- azoline sulfonic acid] ammonium salt (ABTS), 5'-aminosalicylic acid, o-phenylenediamine, 4-aminoantipyrine, 3,3',5,5'-tetramethylbenzidine and the like. In case of using alkaline phosphatase as the enzyme, o-nitrophenylphosphate, p-nitrophenylphosphoric acid, or the like can be used as a substrate. In case of using .beta.-D-galactosidase as the enzyme, fluorescein-d-(.beta.-D-galactopyranoside), 4-methylumbelliphenyl-.beta.-D-galactopyranoside, or the like can be used as a substrate. The present invention also includes a kit comprising the above monoclonal antibody, polyclonal antibody and reagents.

[0100] As a cross-linking agent, a known cross-linking agent such as N,N'-o-phenylenedimaleimide, 4-(N-maleimidomethyl) cyclohexanoate-N-succinimide ester, 6-maleimidohexanoate-N-succineimide ester, 4,4'-dithiopyridine or the like can be utilized. The reaction of these cross-linking agents with enzymes and antibodies can be carried out by a known method according to properties of a particular cross-linking agent. Further, as the antibody, a fragment thereof, for example, Fab', Fab, F(b'2) can be used as the case may be. A labeled enzyme can be obtained by the same treatment regardless of whether the antibody is polyclonal or monoclonal. When the above labeled enzyme obtained by using a cross-linking agent is purified by a known method such as affinity chromatography or the like, an immunoassay system having more higher sensitivity can be obtained. The enzyme labeled and purified antibody is stored in a dark cold place with addition of a stabilizer such as thimerosal, glycerin or after lyophilization.

[0101] An objective to be determined is not specifically limited in so far as it is a sample containing BSSP2 or a fragment thereof, or a sample containing a precursor of BSSP2 or a fragment thereof and includes body fluids such as plasma, serum, blood, serum, urine, tissue fluid, cerebrospinal fluid and the like.

[0102] The following Examples further illustrate the present invention in detail but are not construed to limit the scope thereof.

EXAMPLE 1

Cloning of Novel Serine Protease mBSSP2 Gene

[0103] The cloning was carried out by PCR using a mouse brain cDNA library (Clontech) as a template and nucleotide sequences corresponding to an amino acid sequence common to serine proteases represented by

1 Primer 1: GTG CTC ACN GCN GCB CAY TG (SEQ ID NO: 20) Primer 2: CCV CTR WSD CCN CCN GGC GA (SEQ ID NO: 21)

[0104] as primers. Namely, 5 .mu.l of the template, 5 .mu.l of 10.times.ExTaq buffer, 5 .mu.l of dNTP, 10 pmol of each of the above primers and 0.5 .mu.l of ExTaq (TAKARA) were added and the total volume was adjusted to 50 .mu.l with sterilized water. PCR was carried out by repeating a cycle of heating at 94.degree. C. for 0.5 minute, at 55.degree. C. for 0.5 minute and then at 72.degree. C. for 1 minute, 30 times. The PCR product was mixed with pCR II-TOPO vector attached to TOPO TA cloning kit (Invitrogen) and the mixture was allowed to stand at room temperature for 5 minutes. Then, according to a conventional manner, E. coli Top 10 attached to the kit was transformed and applied to a LB (Amp+) plate (containing 100 .mu.g/ml of ampicillin). According to a conventional manner, a plasmid was extracted from each colony obtained and its nucleotide sequence was determined by cycle sequencing method with a fluorescence sequencer (ABI). Homology of the sequence of each clone was examined by means of GenBank. Regarding an unknown sequence, i.e., BSSP2 gene, the full length cDNA was obtained by 5' RACE and 3' RACE and, according to the same manner as described above, the nucleotide sequence was determined. Namely, BSSP2 clone specific primers, GSP1 primers [mBSSP2.2 (SEQ ID NO: 27) or mBSSP2.0 (SEQ ID NO: 22)] and GSP2 primers [mBSSP2R2 (SEQ ID NO: 28) or mBSSP2.1 (SEQ ID NO: 23)] were prepared. PCR was carried out by using mouse brain Marathon-Ready cDNA (Clontech), AP1 primer attached to this reagent and either of the above GSP1 primers and heating at 94.degree. C. for 2 minutes once and repeating a cycle of heating at 94.degree. C. for 30 seconds, at 60.degree. C. for 30 seconds and then at 72.degree. C. for 30 seconds 35 times. Then, 5 .mu.l of the PCR product diluted to {fraction (1/100)}, 5 .mu.l of 10.times.buffer, 5 .mu.l of dNTP, 10 pmol of either of 10 .mu.M of the above GSP2 primer, 10 pmol of AP2 primer attached to the above reagent and 0.5 unit of ExTaq were admixed and adjusted to 50 .mu.l with sterilized water. Then, according to the same manner as the above, PCR was carried out. The PCR product was cloned by the above TOPO TA cloning kit and sequenced to obtain the upstream and downstream regions of the above clone. At this time, as for a clone which seemed not to cover the full length of a protein, the specific primers shown hereinafter were prepared based on the newly found nucleotide sequence. Further, based on this sequence, the primers capable of amplifying ORF as shown hereinafter [mBSSPF7 (SEQ ID NO: 26), mBSSP2R/E (SEQ ID NO: 29)] were prepared and PCR carried out using mouse brain Marathon-ready cDNA as a template to confirm that these clones were identical. This was cloned into pCR II-TOPO vector attached to TOPO TA cloning kit to obtain the plasmid pCR II/mBSSP2 containing the full length cDNA clone. The nucleotide sequence of DNA contained in this plasmid is shown in SEQ ID NO: 7 and the amino acid sequence of mSSP2 protein deduced from the nucleotide sequence is shown in SEQ ID NO: 8. Further, two different types of clones were obtained. The nucleotide sequences of these DNA are shown in SEQ ID NOS: 3 and 5, respectively. The amino acid sequences of mBSSP2 proteins deduced from these nucleotide sequences are shown in SEQ ID NOS: 4 and 6. These novel proteases are divided into types 1, 2 and 3. Type 1 is composed of 273 amino acids, type 2 is composed of 311 amino acids and type 3 is composed of 445 amino acids. These amino acid sequences contained the common amino acid sequence composed of 238 amino acids whose N-terminus side started with Ile-Val-Gly-Gly-Gln-Ala-Val (amino acid 1-7 of SEQ ID NO:2) as the mature serine protease. Further, in the amino acid sequence of the mature serine protease, a consensus sequence having a serine protease activity was contained. Furthermore, since there were two or more amino acid sequences specific for a sugar chain bonding site, it was presumed that the amino acid sequence had at least two sugar chains.

2TABLE 1 SEQ ID Name of NO: primer Direction Sequence Use 22 mBSSP2.0 Forward ATGGTGGAGAAGATCATTCCT RACE 23 mBSSP2.1 Forward TACAGTGCCCAGAACCATG RACE 24 mBSSPF4 Forward CTCAACTCTCTGCTAGACCG RACE 25 mBSSP2F5 Forward ATAGTTGGCGGCCAAGCTGT mature 26 mBSSPF7 Forward CCCAGCAGAACTTACTGCCT FL* 27 mBSSP2.2 Reverse TGTTGCAGAGGTGGGTGCTG RACE 28 mBSSP2R2 Reverse TACCATTGTGTCCTGCAGTGT RACE 29 mBSSP2R5/E Reverse TGAATTCTGCTGCTTCTTCGGCTAGCG FL* *for full length

EXAMPLE 2

Expression mBSSP2 Gene in Mice Internal Organs

[0105] According to the protocol of QuickPrep Micro mRNA purification Kit (Amersham-Pharmacia), mRNAs were isolated from various internal organs of Balb/c mice or their fetuses. They were subjected to electrophoresis according to a conventional manner and transcribed to a nylon membrane. A probe was prepared separately by isolating a part of a nucleotide sequence encoding the mature protein of mBSSP2 from pCR II/mBSSP2, purifying it and labeling it with .alpha.-32P dCTP. The probe was diluted with 5.times.SSC and reacted with the above membrane filter at 65.degree. C. for a whole day and night. Then, the filter was washed twice each with 2.times./0.1% SDS at room temperature for 30 minutes, 1.times./0.1% SDS at room temperature for 30 minutes and 0.1.times./0.1% SDS at 65.degree. C. for 30 minutes. The filter was exposed to an imaging plate for FLA2000 (Fuji Film) for one day to analyze the expression. The results shown in the drawings are those obtained by using mRNAs prepared from head of fetuses of mice and mRNAs prepared from brain of 5-day-, 10-day-, 14-day-, 18-day-, 30-day-, 3-month-, 7-month and 1-year-old mice (FIG. 1) and mRNAs prepared from various internal organs of 3-month-old mice (FIG. 2). In addition, the mRNAs of mice prepared above were subjected to RT-PCR by using Ready To Go RT-PCR Beads (Amersham-Pharmacia) and mBSSP2 gene specific primers (SEQ ID NOS: 25 and 29) according to the protocol attached to the kit.

[0106] As seen from FIGS. 1 and 2, in the case of northern blotting analysis, the expression of mBSSP2 was recognized in the head of 15th to 20th day fetuses of mice and, as to the 3-month-old mice, the expression was recognized in the prostate and testicle. Further, according to the results of RT-PCR, the expression was recognized in the head of 12-day-old mice and the testicle of 3-month-old mice.

EXAMPLE 3

Expression of Novel Serine Protease Mature Protein Encoded by mBSSP2 Gene

[0107] (1) Construction of Expression Plasmid

[0108] A cDNA region encoding the mature protein of BSSP2 protein was amplified by PCR using the plasmid pCR II/mBSSP2 as a template (the sequence of the 1st to 717th bases of SEQ ID NO: 1 was amplified by using the primers having the sequences represented by SEQ ID NOS: 25 and 29). The PCR product was ligated to pTrc-HisB (Invitrogen) which had been digested with BamHI and blunted with mung bean nuclease. E. coli JM109 was transformed by the resultant and colonies formed were analyzed by PCR to obtain E. coli containing the desired serine protease expressing plasmid pTrcHis/mBBSP2.

[0109] The resultant E. coli was designated E. coli pTrcHis/mBSSP2 and deposited at National Institute of Bioscience and Human-Technology (NIBH), Agency of Industrial Science & Technology of 1-1-3 Higashi, Tsukuba-shi, Ibaraki-ken, Japan on Oct.29, 1998 under the accession numbers of FERM P-17033.

[0110] (2) Expression of Protein by E. coli Containing Expression Plasmid

[0111] A single colony of E. coli having the expression plasmid was inoculated in 10 ml of LB (Amp+) culture medium and incubated at 37.degree. C. overnight. This was inoculated in 250 ml of LB (Amp+) culture medium and incubated at 37.degree. C. When the absorbance at 600 nm became 0.5, 250 .mu.l of 0.1 M IPTG (isopropyl-.beta.-D-(-)-thiogalact- opyranoside) was added and the incubation was continued for additional 5 hours. The E. coli was centrifuged and suspended in a cell disruption buffer (10 mM phosphate buffer pH 7.5, 1 mM EDTA) and sonicated on ice to disrupt E. coli. This was centrifuged at 14,000 r.p.m. for 20 minutes to obtain a precipitate. The precipitate was washed twice with a cell disruption buffer containing 0.5% Triton X-100TM and washed with water to remove Triton X-100TM. Then, the resultant mixture was dissolved by soaking in a denaturation buffer containing 8 M urea (8 M urea, 50 mM Tris pH8.5, 20 mM 2 ME) at 37.degree. C. for 1 hour. The solution was passed through TALON metal affinity resin (Clontech), washed with the denaturation buffer containing 10 mM imidazole, and then eluted with the denaturation buffer containing 100 mM imidazole to purify the solution. The purified product was dialyzed against PBS for 3 days with exchanging the buffer every other night to obtain the protein mBSSP2-His.

EXAMPLE 4

Expression of Novel Serine Protease Mature Protein Encoded by mBSSP2 Gene by Using pFBTrypSigTag/BSSP2

[0112] (1) Construction of pFBTrypSigTag/BSSP2

[0113] The sequences represented by SEQ ID NOS: 11 and 12 were subjected to annealing and digested with NheI and BamHI. The resultant fragment was inserted into pSecTag2A (Invitrogen) to obtain pSecTrypHis. Twenty units of BAmHI was added to 5 .mu.g of pSecTrypHis vector and the vector was cleaved at 37.degree. C. over 4 hours. Then, 6 units of mung bean nuclease (TAKARA) was added thereto and reacted at room temperature (25.degree. C.) for 30 minutes to blunt the terminal ends. Further, the 3'-terminus side of the cloning site was digested cleaved with 20 units of XhoI, 1 unit of bacterial alkaline phosphatase (TAKARA) was added thereto and the reaction was carried out at 65.degree. C. for 30 minutes.

[0114] According to the same manner as that described in JP 9-149790 A or Biochim. Biophys. Acta, 1350, 11, 1997, mRNA was prepared from COLO201 cells and cDNA was synthesized to obtain the plasmid pSPORT/neurosin. cDNA of an active region of neurosin was obtained from pSPORT/neurosin by PCR using primers having the sequences represented by SEQ ID NOS: 13 and 14. Ten units of XhoI was reacted with the PCR product at 37.degree. C. for 3 hours to cleave XhoI site at the 3'-side thereof. This was inserted into pSecTrypHis by TAKARA ligation kit to obtain pSecTrypHis/neursoin (FIG. 3).

[0115] Amplification was carried out by using the primers having the sequences represented by SEQ ID NOS: 15 and 16 so that the peptide of Leu-Val-His-Gly (SEQ ID NO:43) was present at the C-terminus of the part from trypsin signal to the enterokinase recognition site of pSecTrypHis/neurosin. This was inserted between NheI and HindIII sites of pSecTag2A to construct the plasmid pTrypSig.

[0116] One .mu.g (0.1 .mu.l) of the plasmid pSecTab2A was treated with the restriction enzymes NheI and BamHI to completely remove a region encoding the leader sequence of IgGk. One hundred pmol portions of DANs represented by SEQ ID NOS: 40 and 41 were added to the resultant solution and the mixture was heated at 70.degree. C. for 10 minutes and subjected to annealing by allowing to stand at room temperature for 30 minutes. Two .mu.l of I solution of DNA ligation kit Ver. 2 (TAKARA) was added to 1 .mu.l portions of His secretory signal sequence treated by NheI and BamHI and pSecTag2A and the reaction was carried out at 16.degree. C. for 30 minutes.

[0117] To the reaction mixture was add 0.1 ml of E. coli competent cell XL1-Blue (STRATAGENE) and reacted on ice for 30 minutes. Then, the reaction mixture was subjected to heat shock at 42.degree. C. for 60 seconds. After standing on ice for 2 minutes, 0.9 ml of SOC culture medium (Toyo Boseki K.K.) was added thereto and the mixture was shaken with a shaker at 37.degree. C. for 1 hour. The mixture was centrifuged at 5,000 r.p.m. for 1 minutes and the supernatant was discarded. The precipitated competent cells were suspended in the liquid remained in the centrifuge tube and the suspension was applied to 2 ampicillin LB plates containing 100 .mu.g/ml of ampicillin in the ratio of 1:10. The plates were incubated at 37.degree. C. for one night. Among the colonies formed, a colony into which DNA of His secretory signal was inserted was selected by PCR to obtain pTrypHis.

[0118] A sequence of about 200 bp containing His Tag region of pTrypHis was amplified by using primers having the sequence represented by SEQ ID NOS: 16 and 17 and a fragment of about 40 bp containing His Tag and enterokinase recognizing site formed by digestion of HindIII and BamHI was inserted into pTrypSig to construct pTrypSigTag (FIG. 4A).

[0119] cDNA was prepared by PCR of the sequence from trypsin signal to enterokinase recognizing site of pTrypSigTag using primers having the sequences represented by SEQ ID NOS 14 and 18 and cut out by digestion with BglII and BamHI. It was inserted into BamHI site of pFastBAC1. The insertion direction was confirmed by PCR using primers having the sequences represented by SEQ ID NOS: 14 and 19. A clone into which the cDNA was inserted in the direction toward transcription and translation was selected to obtain pFBTrypSigTag.

[0120] Twenty units of BamHI was added to 5 .mu.g of pFBTrypSigTag vector and the vector was cleaved at 37.degree. C. over 4 hours, followed by addition of 6 units of mung bean nuclease (TAKARA) and reaction at room temperature (25.degree. C.) for 30 minutes to blunt the terminal ends. Further, the 3'-side of the cloning site was cleaved by 20 units of EcoRI, followed by addition of 1 unit of bacterial alkaline phosphatase (TAKARA). The reaction was carried out at 65.degree. C. for 30 minutes.

[0121] cDNA of the active region of mBSSP2 was obtained by PCR according to a conventional manner using pTrcHis/mBSSP2 or pCRII/mBSSP2 prepared from E. coli pTrcHis/mBSSP2 (accession No. FERM P-17033). The resultant cDNA was inserted into pFBTrypSigTag to obtain pFBTrypSigTag/mBSSP2 (FIG. 4B). At this time, correct insertion of mBSSP2 was confirmed by determining the sequence.

[0122] Bacmid DNA was transformed with PFBTrypSigTag/mBSSP2 according to a protocol of Gibco BRL BAC-TO-BAC baculovirus expression system to prepare a recombinant bacmid having chimera BSSP2 fused with trypsinogen signal peptide, HisTag and enterokinase recognizing site. When this was expressed in Sf-9 cell according to a manual of BAC-TO-BAC baculovirus expression system, it was secreted in the culture supernatant from 2 days after infection of the virus.

[0123] (2) Determination of Enzyme Activity

[0124] The recombinant fused protein mSSP2 obtained in the culture supernatant was passed through a chelate column to purify it and, after dialysis, its enzyme activity was determined. First, the culture supernatant was applied to a chelate column (Ni-NTA-Agarose, Qiagen) with PBS buffer and eluted stepwise with a solution of imidazole (Wako Pure Chemical Industries, Ltd.) dissolved in PBS. The resultant imidazole-eluted fraction was applied to a PD-10 column (Pharmacia) to exchange to PBS buffer. Fifty .mu.l of this sample was mixed with 10 .mu.l of enterokinase (1 U/1 .mu.l, Invitrogen) and the reaction was carried out at room temperature for 60 minutes. Each of various synthetic substrates (Peptide Laboratory, Boc-Gln-Ala-Arg-MCA, Boc-Phe-Ser-Arg-MCA, Bz-Arg-MCA, Boc-Val-Leu-Lys-MCA, Pyr-Gly-Arg-MCA, Pro-Phe-Arg-MCA, Boc-Val-Pro-Arg-MCA, Z-Arg-Arg-MCA, Arg-MCA, Z-Phe-Arg-MCA) was dissolved in DMSO and diluted with 1 M Tris-HCl (pH 8.0) to obtain a substrate solution. Fifty .mu.l of 0.2 M substrate solution was added thereto and further the reaction was carried out at 37.degree. C. After one hour, the fluorescence of AMC (7-amino-4-methylcoumalin) formed by the enzymatic reaction was measured at 380 nm of excitation wavelength and 460 nm of fluorescence wavelength to determine the activity.

[0125] As a result, the recombinant fused protein mBSSP2 has been shown to have serine protease activity.

EXAMPLE 5

Cloning of hBSSP2 Gene

[0126] Reverse transcription of 1 .mu.g of mRNA of human fetus brain (Clontech) was carried out by using Superscript II (Gibco BRL) and oligo dT-Not I primer (5' GGCCACGCGTCGACTAGTA C(T).sub.17 3' SEQ ID NO:44) to obtain cDNA. By using this as a template, PCR was carried out with primes prepared from mBSSP2 nucleotide sequence and represented by SEQ ID NOS: 30 and 31 to obtain a cDNA fragment of hBSSP2. Namely, 5 .mu.l of the template, 5 .mu.l of 10.times.ExTaq buffer (TAKARA), 5 .mu.l of dNTPs, 10 pmol portions of the above primers and 0.5 .mu.l of ExTaq (TAKARA) were adjusted to 50 .mu.l with sterilized water and PCR was carried out by repeating a cycle of heating at 94.degree. C. for 0.5 minute, at 55.degree. C. for 0.5 minute and then at 72.degree. C. for 1 minute, 35 times. The PCR reactions described hereinafter were carried out according to the same manner as the above composition and conditions except the template and primers. The PCR product was mixed with pGEM-T Easy vector (Promega) and Takara Ligation Solution I (TAKARA) and the reaction was carried out at 16.degree. C. for 2 hours. Then, according to the same manner, E. coli JM109 was transformed and applied to a LB (Amp.sup.+) plate. A plasmid was extracted from each colony formed according to a conventional manner and its nucleotide sequence was determined by dideoxy method. As for a clone having homology to mBSSP2, full length cDNA was obtained by 5' RACE and 3' RACE and its sequence was determined as described above. PCR was carried out by using the above cDNA as a template and primers having the sequences represented by SEQ ID NOS: 30 and 37. 3' RACE was carried out by PCR using a {fraction (1/100)} dilution of the above PCR product as a template and primers having the sequences represented by SEQ ID NOS: 32 and 37. As for 5' RACE, cDNA for RACE was prepared from human fetal brain mRNA (Clontech) by using Superscript II and SMART RACE cDNA amplification kit (Clontech). PCR of this cDNA was carried out by using a primer of 10.times.Universal Primer Mix (attached to the kit) and a primer having the sequence represented by SEQ ID NO: 33. Further, PCR was carried out by using the {fraction (1/100)} dilution of the latter PCR product, a template, Nested PCR Primer (attached to the kit) and a primer having the sequence represented by SEQ ID NO: 34. The finally obtained PCR product was subjected to TA cloning as described above and the nucleotide sequence was determined to obtain the upstream and downstream regions of the above clone. In addition, primers for amplifying the full length cDNA as represented by SEQ ID NOS: 35 and 36 were prepared based on the resultant nucleotide sequence and PCR was carried out by using the above synthetic cDNA as a template. This PCR product was cloned into pGEM-T Easy vector to obtain the plasmid pGEM-TE/hBSSP2 containing the full length cDNA clone. The DNA sequence contained in this plasmid is shown in SEQ ID NO: 9 and hBSSP2 protein deduced from the nucleotide sequence is shown in SEQ ID NO:10.

[0127] E. coli containing this plasmid was designated E. coli pGEM-TE/hBSSP2 and deposited at National Institute of Bioscience and Human-Technology (NIBH), Agency of Industrial Science & Technology of 1-1-3 Higashi, Tsukuba-shi, Ibaraki-ken, Japan on Jul. 27, 1999 under the accession numbers of FERM P-17487.

3TABLE 2 SEQ ID Name of NO: primer Direction Sequence Use 30 BSSP2SPF Forward ACTGCTGCCCACTGCATG for part 31 BSSP2SPR Reverse CAGGGGTCCCCCGCTGTCTCC for part 32 hBSSP2F11 Forward GCTCTCAACTTCTCAGACAC RACE 33 hBSSP2R12 Reverse ACTCAGCTACCTTGGCGTAG RACE 34 hBSSP2R11 Reverse CCTGGAGCATATCCGAGCTG RACE 35 hBSSR2F12 Forward GCTTTACAACAGTGCTAC WB* 36 hBSSP2R13/E Reverse TGGAATTCGAGGAAACAGCAGGACTCAG WB* 37 TACTAGTCGACGCGTGGCC *whole body

EXAMPLE 6

Detection of hBSSP2 mRNA by Northern Blotting

[0128] Poly A+RNA extracted from respective tissues of human adults and fetuses were blotted on a membrane (Clontech) and the membrane was subjected to northern hybridization with a hBSSP2 probe. The probe was labeled by Takara BcaBEST random labeling kit (TAKARA) according to random priming method using a cDNA fragment which was amplified by using the full length of hBSSP2 as a template and the sequences represented by SEQ ID NOS: 34 and 35 as primers. The hybridization was carried out at 60.degree. C. overnight and the filter was finally washed with 0.1.times.SSC and 0.1% SDS. The radioactivity was detected by FLA-2000 (Fuji Film). The signal corresponding to the adult brain was recognized at about 2.4 kb, the signal corresponding to the adult skeletal muscle was recognized at 7 kb and 1.3 kb and further the signal of the fetus liver was recognized at 7 kb (FIG. 5). The signal of the adult brain is considered to correspond to the exact nucleotide sequence and the others are considered to correspond to polymorphic forms resulted from the difference in splicing.

EXAMPLE 7

Detection of hBSSP2 mRNA by RT-PCR

[0129] mRNAs of human tissues purchased from Clontech were subjected to RT-PCR against hBSSP2 by using Ready To Go RT-PCR Beads (Amersham-Pharmacia) according to the protocol attached to the kit. Expression of hBSSP2 was recognized in brain and skeletal muscle (FIG. 6). No clear band was obtained in pancreas due to the combination of primers. This is considered to be non-specific amplification by a large amount of a serine protease present in pancreas.

EXAMPLE 8

Expression of hBSSP2 by Baculovirus System

[0130] The signal sequence of human trypsinogen 2 and (His)6 Tag and a sequence encoding the cleavage site of enterokinase were inserted into pFastBac1 (Gibco BRL) to obtain the plasmid pFBTrypSigTag. The mature form of hBSSP2 was inserted into the plasmid pFBTrypSigTag so that it was located in the flame (FIG. 4B). The mature form of hBSSP2 amplified by the sequences represented by SEQ ID NOS: 38 and 36 was cleaved by EcoRI and, according to the same manner as described with respect to mBSSP2, it was inserted into pFBTrySigTag to construct pFastBacTrypSigTag/hBSSP2. At this time, correct insertion of BSSP2 was confirmed by determining the nucleotide sequence by using the fluorescent labeled sequence represented by SEQ ID NO: 39. Bacmid DNA was transformed with PFBTrypSigTag/hBSSP2 according to a protocol of Gibco BRL BAC-TO-BAC baculovirus expression system to prepare a recombinant bacmid having chimera BSSP2 fused with trypsinogen signal peptide, HisTag and enterokinase recognizing site. When this was expressed in Sf-9 cell according to a manual of BAC-TO-BAC baculovirus expression system and the culture supernatant from 3 days after infection of the virus subjected to western blot technique with anti-DDDDK antibody, a specific band was detected to confirm expression of hBSSP2 (FIG. 7).

4TABLE 3 SEQ ID Name of NO: primer Direction Sequence Use 38 hBSSP2F13 Forward ACTGCTGCCCACTGCATG for part 39 FBTrypSigTagF5 GCGCTAGCAGATCTCCATGAATCTACTCCTGATCC NS* *nucleotide sequence

INDUSTRIAL UTILITY

[0131] According to the present invention, there are provided isolated human and mouse serine protease (hBSSP2 and mBSSP2) polynucleotides, their homologous forms, mature forms, precursors and polymorphic variants. Further, according to the present invention, there are provided hBSSP2 and mBSSP2 proteins as well as compositions containing hBSSP2 and mBssP2 polynucleotides and proteins, their production and use.

[0132] Sequence Listing Free Text

[0133] SEQ ID NO: 11: Designed oligonucleotide to construct plasmid pSecTrypHis.

[0134] SEQ ID NO: 12: Designed oligonucleotide to construct plasmid pSecTrypHis.

[0135] SEQ ID NO: 13: Designed oligonucleotide primer to amplify neurosin-encoding sequence.

[0136] SEQ ID NO: 14: Designed oligonucleotide primer to amplify neurosin-encoding sequence.

[0137] SEQ ID NO: 15: Designed oligonucleotide primer to amplify a portion of plasmid pSecTrypHis/Neurosin.

[0138] SEQ ID NO: 16: Designed oligonucleotide primer to amplify a portion of plasmid pSecTrypHis/Neurosin.

[0139] SEQ ID NO: 17: Designed oligonucleotide primer to amplify a portion of plasmid pTrypHis.

[0140] SEQ ID NO: 18: Designed oligonucleotide primer to amplify a portion of plasmid pTrypSigTag.

[0141] SEQ ID NO: 19: Designed oligonucleotide primer to amplify a portion of plasmid pFBTrypSigTag.

[0142] SEQ ID NO: 20: Designed oligonucleotide primer to amplify conserved region of serine proteases-encoding sequence; n is a, c, g or t.

[0143] SEQ ID NO: 21: Designed oligonucleotide primer to amplify conserved region of serine proteases-encoding sequence; n is a, c, g or t.

[0144] SEQ ID NO: 22: Designed oligonucleotide primer designated as mBSSP2.0 for RACE for mBSSP2 (forward).

[0145] SEQ ID NO: 23: Designed oligonucleotide primer designated as mBSSP2.1 for RACE for mBSSP2 (forward).

[0146] SEQ ID NO: 24: Designed oligonucleotide primer designated as mBSSPF4 for RACE for mBSSP2 (forward).

[0147] SEQ ID NO: 25: Designed oligonucleotide primer designated as mBSSP2F5 to amplify mature mBSSP2-encoding region (forward).

[0148] SEQ ID NO: 26: Designed oligonucleotide primer designated as mBSSPF7 to amplify full-length mBSSP2-encoding mRNA (forward).

[0149] SEQ ID NO: 27: Designed oligonucleotide primer designated as mBSSP2.2 for RACE for mBSSP2 (reverse).

[0150] SEQ ID NO: 28: Designed oligonucleotide primer designated as mBSSP2R2 for RACE for mBSSP2 (reverse).

[0151] SEQ ID NO: 29: Designed oligonucleotide primer designated as mBSSP2R5/E to amplify full-length mBSSP2-encoding mRNA (reverse).

[0152] SEQ ID NO: 30: Designed oligonucleotide primer designated as BSSP2SPF to amplify a portion of hBSSP2 (forward).

[0153] SEQ ID NO: 31: Designed oligonucleotide primer designated as BSSP2SPR to amplify a portion of hBSSP2 (reverse).

[0154] SEQ ID NO: 32: Designed oligonucleotide primer designated as hBSSP2F11 for RACE for hBSSP2 (forward).

[0155] SEQ ID NO: 33: Designed oligonucleotide primer designated as hBSSP2R12 for RACE for hBSSP2 (reverse).

[0156] SEQ ID NO: 34: Designed oligonucleotide primer designated as hBSSP2R11 for RACE for hBSSP2 (reverse).

[0157] SEQ ID NO: 35: Designed oligonucleotide primer designated as hBSSP2F12 to amplify full length hBSSP2 (forward).

[0158] SEQ ID NO: 36: Designed oligonucleotide primer designated as hBSSP2R13/E to amplify full length hBSSP2 (reverse).

[0159] SEQ ID NO: 37: Designed oligonucleotide primer for RACE for hBSSP2.

[0160] SEQ ID NO: 38: Designed oligonucleotide primer designated as hBSSP2F13 to amplify a portion of hBSSP2 (forward).

[0161] SEQ ID NO: 39: Designed oligonucleotide primer designated as FBTrpsigtagF5 to detect hBSSP2.

[0162] SEQ ID NO: 40: Designed oligonucleotide to construct plasmid pTrypHis.

[0163] SEQ ID NO: 41: Designed oligonucleotide to construct plasmid pTrypHis.

Sequence CWU 1

1

44 1 717 DNA Mus sp. CDS (1)..(717) 1 ata gtt ggc ggc caa gct gtg gct tct ggg cgc tgg cca tgg caa gct 48 Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro Trp Gln Ala 1 5 10 15 agc gtg atg ctt ggc tcc cgg cac acg tgt ggg gcc tct gtg ttg gca 96 Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala 20 25 30 cca cac tgg gta gtg act gct gcc cac tgc atg tac agt ttc agg ctg 144 Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu 35 40 45 tcc cgc cta tcc agc tgg cgg gtt cat gca ggg ctg gtc agc cat ggt 192 Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His Gly 50 55 60 gct gtc cga caa cac cag gga act atg gtg gag aag atc att cct cat 240 Ala Val Arg Gln His Gln Gly Thr Met Val Glu Lys Ile Ile Pro His 65 70 75 80 cct ttg tac agt gcc cag aac cat gac tat gat gtg gct ctg ctg cag 288 Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr Asp Val Ala Leu Leu Gln 85 90 95 ctc cgg aca cca atc aac ttc tca gac acc gtg gac gct gtg tgc ttg 336 Leu Arg Thr Pro Ile Asn Phe Ser Asp Thr Val Asp Ala Val Cys Leu 100 105 110 ccg gcc aag gag cag tac ttt cca tgg ggg tcg cag tgc tgg gtg tct 384 Pro Ala Lys Glu Gln Tyr Phe Pro Trp Gly Ser Gln Cys Trp Val Ser 115 120 125 ggc tgg ggc cac acc gac ccc agc cat act cat agc tca gat aca ctg 432 Gly Trp Gly His Thr Asp Pro Ser His Thr His Ser Ser Asp Thr Leu 130 135 140 cag gac aca atg gta ccc ctg ctc agc acc cac ctc tgc aac agc tca 480 Gln Asp Thr Met Val Pro Leu Leu Ser Thr His Leu Cys Asn Ser Ser 145 150 155 160 tgc atg tac agt ggg gca ctt aca cac cgc atg ttg tgt gct ggc tac 528 Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met Leu Cys Ala Gly Tyr 165 170 175 ctg gat gga agg gca gac gca tgc cag gga gac agc ggg gga ccc ctg 576 Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu 180 185 190 gta tgt ccc agt ggt gac acg tgg cac ctt gta ggg gtg gtc agc tgg 624 Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly Val Val Ser Trp 195 200 205 ggt cgt ggc tgt gca gag ccc aat cgc cca ggt gtc tat gcc aag gta 672 Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr Ala Lys Val 210 215 220 gca gag ttc ctg gac tgg atc cat gac act gtg cag gtc cgc tag 717 Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gln Val Arg 225 230 235 2 238 PRT Mus sp. 2 Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro Trp Gln Ala 1 5 10 15 Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala 20 25 30 Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu 35 40 45 Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His Gly 50 55 60 Ala Val Arg Gln His Gln Gly Thr Met Val Glu Lys Ile Ile Pro His 65 70 75 80 Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr Asp Val Ala Leu Leu Gln 85 90 95 Leu Arg Thr Pro Ile Asn Phe Ser Asp Thr Val Asp Ala Val Cys Leu 100 105 110 Pro Ala Lys Glu Gln Tyr Phe Pro Trp Gly Ser Gln Cys Trp Val Ser 115 120 125 Gly Trp Gly His Thr Asp Pro Ser His Thr His Ser Ser Asp Thr Leu 130 135 140 Gln Asp Thr Met Val Pro Leu Leu Ser Thr His Leu Cys Asn Ser Ser 145 150 155 160 Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met Leu Cys Ala Gly Tyr 165 170 175 Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu 180 185 190 Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly Val Val Ser Trp 195 200 205 Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr Ala Lys Val 210 215 220 Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gln Val Arg 225 230 235 3 1685 DNA Mus sp. CDS (247)..(1065) 3 ctcacatgta tctttcagaa taaatggaga ggatcttctg cttcaagtac aagtaagagc 60 tcggccagac tggctcctgg tatgccatga gggccggagc ccagccctgg gcatgcacat 120 ctgcaagagt cttgggcata tcaggcttac tcaacacaag gccgtgaatc tgtctgacat 180 caagctcaac agatcccagg agtttgctca actctctgct agaccgggag gccttgtaga 240 ggaggc atg gaa gcc cag gta ggg ctt ctg tgg gtt agc gct aac tgt 288 Met Glu Ala Gln Val Gly Leu Leu Trp Val Ser Ala Asn Cys -35 -30 -25 cct tct ggc cga att gtt tct ctc aaa tgt tct gag tgt ggg gca agg 336 Pro Ser Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg -20 -15 -10 cct ctg gct tct cga ata gtt ggc ggc caa gct gtg gct tct ggg cgc 384 Pro Leu Ala Ser Arg Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg -5 -1 1 5 10 tgg cca tgg caa gct agc gtg atg ctt ggc tcc cgg cac acg tgt ggg 432 Trp Pro Trp Gln Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly 15 20 25 gcc tct gtg ttg gca cca cac tgg gta gtg act gct gcc cac tgc atg 480 Ala Ser Val Leu Ala Pro His Trp Val Val Thr Ala Ala His Cys Met 30 35 40 tac agt ttc agg ctg tcc cgc cta tcc agc tgg cgg gtt cat gca ggg 528 Tyr Ser Phe Arg Leu Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly 45 50 55 ctg gtc agc cat ggt gct gtc cga caa cac cag gga act atg gtg gag 576 Leu Val Ser His Gly Ala Val Arg Gln His Gln Gly Thr Met Val Glu 60 65 70 75 aag atc att cct cat cct ttg tac agt gcc cag aac cat gac tat gat 624 Lys Ile Ile Pro His Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr Asp 80 85 90 gtg gct ctg ctg cag ctc cgg aca cca atc aac ttc tca gac acc gtg 672 Val Ala Leu Leu Gln Leu Arg Thr Pro Ile Asn Phe Ser Asp Thr Val 95 100 105 gac gct gtg tgc ttg ccg gcc aag gag cag tac ttt cca tgg ggg tcg 720 Asp Ala Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe Pro Trp Gly Ser 110 115 120 cag tgc tgg gtg tct ggc tgg ggc cac acc gac ccc agc cat act cat 768 Gln Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser His Thr His 125 130 135 agc tca gat aca ctg cag gac aca atg gta ccc ctg ctc agc acc cac 816 Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro Leu Leu Ser Thr His 140 145 150 155 ctc tgc aac agc tca tgc atg tac agt ggg gca ctt aca cac cgc atg 864 Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met 160 165 170 ttg tgt gct ggc tac ctg gat gga agg gca gac gca tgc cag gga gac 912 Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp 175 180 185 agc ggg gga ccc ctg gta tgt ccc agt ggt gac acg tgg cac ctt gta 960 Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val 190 195 200 ggg gtg gtc agc tgg ggt cgt ggc tgt gca gag ccc aat cgc cca ggt 1008 Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly 205 210 215 gtc tat gcc aag gta gca gag ttc ctg gac tgg atc cat gac act gtg 1056 Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val 220 225 230 235 cag gtc cgc tagccgaaga agcagcagca gccacctgtg acgccgagct 1105 Gln Val Arg gtggatcgcc catggatcac cccagtctgg gggccagcat ctgggtcact gggcctctcc 1165 ccaaaggctc tgacttcgag ttcatctttc tcatctgaga acctccacaa caggaaaagg 1225 agtctgcggc tagattggga atgatggtga gaggaaggga taggaggaca gaagagacag 1285 cagaggcttc tggaagcatc tgggagactg ctcctctgct ccccccacac cccacgtgca 1345 tccactgggg gatgctggag atgcccaatc cttgtttctt gtggggccac tggaaggcta 1405 agtccaactt tagaggatgc cctgtctcga gagttactag gcagataagg ttaaggttgg 1465 acaagctcag gtaaaggcac ggaagtcaag atcccctctc ccccgtgcgg tcctgttctg 1525 aggtaagcta atagccccgc accaggcaga ggtctacagg gtaagaagga tgcagttggg 1585 ctacacgacg ctatttttca aatgatgttt ctgtaaattg gttgagagag ttttgttatt 1645 aaacagaaat tatgtataaa aaaaaaaaaa aaaaaaaaaa 1685 4 273 PRT Mus sp. 4 Met Glu Ala Gln Val Gly Leu Leu Trp Val Ser Ala Asn Cys Pro Ser -35 -30 -25 -20 Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu -15 -10 -5 Ala Ser Arg Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro -1 1 5 10 Trp Gln Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser 15 20 25 Val Leu Ala Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser 30 35 40 45 Phe Arg Leu Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val 50 55 60 Ser His Gly Ala Val Arg Gln His Gln Gly Thr Met Val Glu Lys Ile 65 70 75 Ile Pro His Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr Asp Val Ala 80 85 90 Leu Leu Gln Leu Arg Thr Pro Ile Asn Phe Ser Asp Thr Val Asp Ala 95 100 105 Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe Pro Trp Gly Ser Gln Cys 110 115 120 125 Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser His Thr His Ser Ser 130 135 140 Asp Thr Leu Gln Asp Thr Met Val Pro Leu Leu Ser Thr His Leu Cys 145 150 155 Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met Leu Cys 160 165 170 Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp Ser Gly 175 180 185 Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly Val 190 195 200 205 Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr 210 215 220 Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gln Val 225 230 235 Arg 5 2068 DNA Mus sp. CDS (516)..(1448) 5 ctggctgggc tgttgaatca atcccgacat gaggacagga gcctcaccct gcccagcaga 60 acttactgcc ttatatcagt gcagctgact catatgagtc caacactgga tgaccaaagc 120 ccaatggaga ttcggtgcac ggaagagggt gctgggcctg ggatcttcag aatggagttg 180 ggagaccaga ggcaatccat ttctcagtcc caacgctggt gctgcctgca acgtggctgt 240 gtaatactgg gcgtcctggg gctgctggct ggagcaggca ttgcttcatg gctcttagtg 300 ttgtatctat ggccggctgc ctctccatcc atctctggga cgttgcagga ggaggagatg 360 actttgaact gtccaggagt gagctgtgag gaagagctcc ttccatctct tcccaaaaca 420 gaataaatgg aggggatctt ctgcttcaag tacaagtaag agctcggcca gactggctcc 480 tggtctgcca tgagggctgg agccccgccc tgggc atg cac atc tgc aag agt 533 Met His Ile Cys Lys Ser -70 ctt ggg cat atc agg ctt act caa cac aag gcc gtg aat ctg tct gac 581 Leu Gly His Ile Arg Leu Thr Gln His Lys Ala Val Asn Leu Ser Asp -65 -60 -55 atc aag ctc aac aga tcc cag gag ttt gct caa ctc tct gct aga ccg 629 Ile Lys Leu Asn Arg Ser Gln Glu Phe Ala Gln Leu Ser Ala Arg Pro -50 -45 -40 gga ggc ctt gta gag gag gca tgg aag ccc agc gct aac tgt cct tct 677 Gly Gly Leu Val Glu Glu Ala Trp Lys Pro Ser Ala Asn Cys Pro Ser -35 -30 -25 -20 ggc cga att gtt tct ctc aaa tgt tct gag tgt ggg gca agg cct ctg 725 Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu -15 -10 -5 gct tct cga ata gtt ggc ggc caa gct gtg gct tct ggg cgc tgg cca 773 Ala Ser Arg Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro -1 1 5 10 tgg caa gct agc gtg atg ctt ggc tcc cgg cac acg tgt ggg gcc tct 821 Trp Gln Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser 15 20 25 gtg ttg gca cca cac tgg gta gtg act gct gcc cac tgc atg tac agt 869 Val Leu Ala Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser 30 35 40 45 ttc agg ctg tcc cgc cta tcc agc tgg cgg gtt cat gca ggg ctg gtc 917 Phe Arg Leu Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val 50 55 60 agc cat ggt gct gtc cga caa cac cag gga act atg gtg gag aag atc 965 Ser His Gly Ala Val Arg Gln His Gln Gly Thr Met Val Glu Lys Ile 65 70 75 att cct cat cct ttg tac agt gcc cag aac cat gac tat gat gtg gct 1013 Ile Pro His Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr Asp Val Ala 80 85 90 ctg ctg cag ctc cgg aca cca atc aac ttc tca gac acc gtg gac gct 1061 Leu Leu Gln Leu Arg Thr Pro Ile Asn Phe Ser Asp Thr Val Asp Ala 95 100 105 gtg tgc ttg ccg gcc aag gag cag tac ttt cca tgg ggg tcg cag tgc 1109 Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe Pro Trp Gly Ser Gln Cys 110 115 120 125 tgg gtg tct ggc tgg ggc cac acc gac ccc agc cat act cat agc tca 1157 Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser His Thr His Ser Ser 130 135 140 gat aca ctg cag gac aca atg gta ccc ctg ctc agc acc cac ctc tgc 1205 Asp Thr Leu Gln Asp Thr Met Val Pro Leu Leu Ser Thr His Leu Cys 145 150 155 aac agc tca tgc atg tac agt ggg gca ctt aca cac cgc atg ttg tgt 1253 Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met Leu Cys 160 165 170 gct ggc tac ctg gat gga agg gca gac gca tgc cag gga gac agc ggg 1301 Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp Ser Gly 175 180 185 gga ccc ctg gta tgt ccc agt ggt gac acg tgg cac ctt gta ggg gtg 1349 Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly Val 190 195 200 205 gtc agc tgg ggt cgt ggc tgt gca gag ccc aat cgc cca ggt gtc tat 1397 Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr 210 215 220 gcc aag gta gca gag ttc ctg gac tgg atc cat gac act gtg cag gtc 1445 Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gln Val 225 230 235 cgc tagccgaaga agcagcagca gccacctgtg acgccgagct gtggatcgcc 1498 Arg catggatcac cccagtctgg gggccagcat ctgggtcact gggcctctcc ccaaaggctc 1558 tgacttcgag ttcatctttc tcatctgaga acctccacaa caggaaaagg agtctgcggc 1618 tagattggga atgatggtga gaggaaggga taggaggaca gaagagacag cagaggcttc 1678 tggaagcatc tgggagactg ctcctctgct ccccccacac cccacgtgca tccactgggg 1738 gatgctggag atgcccaatc cttgtttctt gtggggccac tggaaggcta agtccaactt 1798 tagaggatgc cctgtctcga gagttactag gcagataagg ttaaggttgg acaagctcag 1858 gtaaaggcac ggaagtcaag atcccctctc ccccgtgcgg tcctgttctg aggtaagcta 1918 atagccccgc accaggcaga ggtctacagg gtaagaagga tgcagttggg ctacacgacg 1978 ctatttttca aatgatgttt ctgtaaattg gttgagagag ttttgttatt aaacagaaat 2038 tatgtataaa aaaaaaaaaa aaaaaaaaaa 2068 6 311 PRT Mus sp. 6 Met His Ile Cys Lys Ser Leu Gly His Ile Arg Leu Thr Gln His Lys -70 -65 -60 Ala Val Asn Leu Ser Asp Ile Lys Leu Asn Arg Ser Gln Glu Phe Ala -55 -50 -45 Gln Leu Ser Ala Arg Pro Gly Gly Leu Val Glu Glu Ala Trp Lys Pro -40 -35 -30 Ser Ala Asn Cys Pro Ser Gly Arg Ile Val Ser Leu Lys Cys Ser Glu -25 -20 -15 -10 Cys Gly Ala Arg Pro Leu Ala Ser Arg Ile Val Gly Gly Gln Ala Val -5 -1 1 5 Ala Ser Gly Arg Trp Pro Trp Gln Ala Ser Val Met Leu Gly Ser Arg 10 15 20 His Thr Cys Gly Ala Ser Val Leu Ala Pro His Trp Val Val Thr Ala 25 30 35 Ala His Cys Met Tyr Ser Phe Arg Leu Ser Arg Leu Ser Ser Trp Arg 40 45 50 55 Val His Ala Gly Leu Val Ser His Gly Ala Val Arg Gln His Gln Gly 60 65 70 Thr Met Val Glu Lys Ile Ile Pro His Pro Leu Tyr Ser Ala Gln Asn 75 80 85 His Asp Tyr Asp Val Ala Leu Leu Gln Leu Arg Thr Pro Ile Asn Phe 90 95 100 Ser Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe 105 110 115 Pro Trp Gly Ser Gln Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro 120 125 130 135 Ser His Thr His Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro Leu 140 145 150 Leu Ser Thr His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu 155 160 165 Thr His Arg Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala 170

175 180 Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr 185 190 195 Trp His Leu Val Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro 200 205 210 215 Asn Arg Pro Gly Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile 220 225 230 His Asp Thr Val Gln Val Arg 235 7 2070 DNA Mus sp. CDS (116)..(1450) 7 cccagcagaa cttactgcct tatatcagtg cagctgactc atatgccctg gtgtggggct 60 gctggatctt caaccactat ttctccagag tccaacactg gatgaccaaa gccca atg 118 Met gag att cgg tgc acg gaa gag ggt gct ggg cct ggg atc ttc aga 163 Glu Ile Arg Cys Thr Glu Glu Gly Ala Gly Pro Gly Ile Phe Arg -205 -200 -195 atg gag ttg gga gac cag agg caa tcc att tct cag tcc caa cgc 208 Met Glu Leu Gly Asp Gln Arg Gln Ser Ile Ser Gln Ser Gln Arg -190 -185 -180 tgg tgc tgc ctg caa cgt ggc tgt gta ata ctg ggc gtc ctg ggg 253 Trp Cys Cys Leu Gln Arg Gly Cys Val Ile Leu Gly Val Leu Gly -175 -170 -165 ctg ctg gct gga gca ggc att gct tca tgg ctc tta gtg ttg tat 298 Leu Leu Ala Gly Ala Gly Ile Ala Ser Trp Leu Leu Val Leu Tyr -160 -155 -150 cta tgg cca gct gcc tct cca tcc atc tct ggg acg ttg cag gag 343 Leu Trp Pro Ala Ala Ser Pro Ser Ile Ser Gly Thr Leu Gln Glu -145 -140 -135 gag gag atg act ttg aac tgt cca gga gtg agc tgt gag gaa gag 388 Glu Glu Met Thr Leu Asn Cys Pro Gly Val Ser Cys Glu Glu Glu -130 -125 -120 ctc ctt cca tct ctt ccc aaa aca gta tct ttc aga ata aat gga 433 Leu Leu Pro Ser Leu Pro Lys Thr Val Ser Phe Arg Ile Asn Gly -115 -110 -105 gag gat ctt ctg ctt caa gta caa gta aga gct cgg cca gac tgg ctc 481 Glu Asp Leu Leu Leu Gln Val Gln Val Arg Ala Arg Pro Asp Trp Leu -100 -95 -90 ctg gtc tgc cat gag ggc tgg agc ccc gcc ctg ggc atg cac atc tgc 529 Leu Val Cys His Glu Gly Trp Ser Pro Ala Leu Gly Met His Ile Cys -85 -80 -75 -70 aag agt ctt ggg cat atc agg ctt act caa cac aag gcc gtg aat ctg 577 Lys Ser Leu Gly His Ile Arg Leu Thr Gln His Lys Ala Val Asn Leu -65 -60 -55 tct gac atc aag ctc aac aga tcc cag gag ttt gct caa ctc tct gct 625 Ser Asp Ile Lys Leu Asn Arg Ser Gln Glu Phe Ala Gln Leu Ser Ala -50 -45 -40 aga ccg gga ggc ctt gta gag gag gca tgg aag ccc agc gct aac tgt 673 Arg Pro Gly Gly Leu Val Glu Glu Ala Trp Lys Pro Ser Ala Asn Cys -35 -30 -25 cct tct ggc cga att gtt tct ctc aaa tgt tct gag tgt ggg gca agg 721 Pro Ser Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg -20 -15 -10 cct ctg gct tct cga ata gtt ggc ggc caa gct gtg gct tct ggg cgc 769 Pro Leu Ala Ser Arg Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg -5 -1 1 5 10 tgg cca tgg caa gct agc gtg atg ctt ggc tcc cgg cac acg tgt ggg 817 Trp Pro Trp Gln Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly 15 20 25 gcc tct gtg ttg gca cca cac tgg gta gtg act gct gcc cac tgc atg 865 Ala Ser Val Leu Ala Pro His Trp Val Val Thr Ala Ala His Cys Met 30 35 40 tac agt ttc agg ctg tcc cgc cta tcc agc tgg cgg gtt cat gca ggg 913 Tyr Ser Phe Arg Leu Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly 45 50 55 ctg gtc agc cat ggt gct gtc cga caa cac cag gga act atg gtg gag 961 Leu Val Ser His Gly Ala Val Arg Gln His Gln Gly Thr Met Val Glu 60 65 70 75 aag atc att cct cat cct ttg tac agt gcc cag aac cat gac tat gat 1009 Lys Ile Ile Pro His Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr Asp 80 85 90 gtg gct ctg ctg cag ctc cgg aca cca atc aac ttc tca gac acc gtg 1057 Val Ala Leu Leu Gln Leu Arg Thr Pro Ile Asn Phe Ser Asp Thr Val 95 100 105 gac gct gtg tgc ttg ccg gcc aag gag cag tac ttt cca tgg ggg tcg 1105 Asp Ala Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe Pro Trp Gly Ser 110 115 120 cag tgc tgg gtg tct ggc tgg ggc cac acc gac ccc agc cat act cat 1153 Gln Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser His Thr His 125 130 135 agc tca gat aca ctg cag gac aca atg gta ccc ctg ctc agc acc cac 1201 Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro Leu Leu Ser Thr His 140 145 150 155 ctc tgc aac agc tca tgc atg tac agt ggg gca ctt aca cac cgc atg 1249 Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met 160 165 170 ttg tgt gct ggc tac ctg gat gga agg gca gac gca tgc cag gga gac 1297 Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp 175 180 185 agc ggg gga ccc ctg gta tgt ccc agt ggt gac acg tgg cac ctt gta 1345 Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val 190 195 200 ggg gtg gtc agc tgg ggt cgt ggc tgt gca gag ccc aat cgc cca ggt 1393 Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly 205 210 215 gtc tat gcc aag gta gca gag ttc ctg gac tgg atc cat gac act gtg 1441 Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val 220 225 230 235 cag gtc cgc tagccgaaga agcagcagca gccacctgtg acgccgagct 1490 Gln Val Arg gtggatcgcc catggatcac cccagtctgg gggccagcat ctgggtcact gggcctctcc 1550 ccaaaggctc tgacttcgag ttcatctttc tcatctgaga acctccacaa caggaaaagg 1610 agtctgcggc tagattggga atgatggtga gaggaaggga taggaggaca gaagagacag 1670 cagaggcttc tggaagcatc tgggagactg ctcctctgct ccccccacac cccacgtgca 1730 tccactgggg gatgctggag atgcccaatc cttgtttctt gtggggccac tggaaggcta 1790 agtccaactt tagaggatgc cctgtctcga gagttactag gcagataagg ttaaggttgg 1850 acaagctcag gtaaaggcac ggaagtcaag atcccctctc ccccgtgcgg tcctgttctg 1910 aggtaagcta atagccccgc accaggcaga ggtctacagg gtaagaagga tgcagttggg 1970 ctacacgacg ctatttttca aatgatgttt ctgtaaattg gttgagagag ttttgttatt 2030 aaacagaaat tatgtataaa aaaaaaaaaa aaaaaaaaaa 2070 8 445 PRT Mus sp. 8 Met Glu Ile Arg Cys Thr Glu Glu Gly Ala Gly Pro Gly Ile Phe -205 -200 -195 Arg Met Glu Leu Gly Asp Gln Arg Gln Ser Ile Ser Gln Ser Gln -190 -185 -180 Arg Trp Cys Cys Leu Gln Arg Gly Cys Val Ile Leu Gly Val Leu -175 -170 -165 Gly Leu Leu Ala Gly Ala Gly Ile Ala Ser Trp Leu Leu Val Leu -160 -155 -150 Tyr Leu Trp Pro Ala Ala Ser Pro Ser Ile Ser Gly Thr Leu Gln -145 -140 -135 Glu Glu Glu Met Thr Leu Asn Cys Pro Gly Val Ser Cys Glu Glu -130 -125 -120 Glu Leu Leu Pro Ser Leu Pro Lys Thr Val Ser Phe Arg Ile Asn -115 -110 -105 Gly Glu Asp Leu Leu Leu Gln Val Gln Val Arg Ala Arg Pro Asp Trp -100 -95 -90 Leu Leu Val Cys His Glu Gly Trp Ser Pro Ala Leu Gly Met His Ile -85 -80 -75 Cys Lys Ser Leu Gly His Ile Arg Leu Thr Gln His Lys Ala Val Asn -70 -65 -60 -55 Leu Ser Asp Ile Lys Leu Asn Arg Ser Gln Glu Phe Ala Gln Leu Ser -50 -45 -40 Ala Arg Pro Gly Gly Leu Val Glu Glu Ala Trp Lys Pro Ser Ala Asn -35 -30 -25 Cys Pro Ser Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala -20 -15 -10 Arg Pro Leu Ala Ser Arg Ile Val Gly Gly Gln Ala Val Ala Ser Gly -5 -1 1 5 10 Arg Trp Pro Trp Gln Ala Ser Val Met Leu Gly Ser Arg His Thr Cys 15 20 25 Gly Ala Ser Val Leu Ala Pro His Trp Val Val Thr Ala Ala His Cys 30 35 40 Met Tyr Ser Phe Arg Leu Ser Arg Leu Ser Ser Trp Arg Val His Ala 45 50 55 Gly Leu Val Ser His Gly Ala Val Arg Gln His Gln Gly Thr Met Val 60 65 70 Glu Lys Ile Ile Pro His Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr 75 80 85 90 Asp Val Ala Leu Leu Gln Leu Arg Thr Pro Ile Asn Phe Ser Asp Thr 95 100 105 Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe Pro Trp Gly 110 115 120 Ser Gln Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser His Thr 125 130 135 His Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro Leu Leu Ser Thr 140 145 150 His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg 155 160 165 170 Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly 175 180 185 Asp Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu 190 195 200 Val Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro 205 210 215 Gly Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr 220 225 230 Val Gln Val Arg 235 9 2265 DNA Homo sapiens CDS (156)..(1526) 9 acgcgggata cagggagggg ccatgtgcga accagggaga cctcatcttc caaccaagct 60 tgctgggctt gcatttaatc aatgcatggc cagagaacag gagcggaaca ttgcctagta 120 gaccctgagg ctttacaaca gtgctactga cccct atg agc ctg atg ctg gat 173 Met Ser Leu Met Leu Asp -215 gac caa ccc cct atg gag gcc cag tat gca gag gag ggc cca gga 218 Asp Gln Pro Pro Met Glu Ala Gln Tyr Ala Glu Glu Gly Pro Gly -210 -205 -200 cct ggg atc ttc aga gca gag cct gga gac cag cag cat ccc att 263 Pro Gly Ile Phe Arg Ala Glu Pro Gly Asp Gln Gln His Pro Ile -195 -190 -185 tct cag gcg gtg tgc tgg cgt tcc atg cga cgt ggc tgt gca gtg 308 Ser Gln Ala Val Cys Trp Arg Ser Met Arg Arg Gly Cys Ala Val -180 -175 -170 ctg gga gcc ctg ggg ctg ctg gcc ggt gca ggt gtt ggc tca tgg 353 Leu Gly Ala Leu Gly Leu Leu Ala Gly Ala Gly Val Gly Ser Trp -165 -160 -155 ctc cta gtg ctg tat ctg tgt cct gct gcc tct cag ccc att tcc 398 Leu Leu Val Leu Tyr Leu Cys Pro Ala Ala Ser Gln Pro Ile Ser -150 -145 -140 ggg acc ttg cag gat gag gag ata act ttg agc tgc tca gag gcc 443 Gly Thr Leu Gln Asp Glu Glu Ile Thr Leu Ser Cys Ser Glu Ala -135 -130 -125 agc gct gag gaa gct ctg ctc cct gca ctc ccc aaa aca gta tct 488 Ser Ala Glu Glu Ala Leu Leu Pro Ala Leu Pro Lys Thr Val Ser -120 -115 -110 ttc aga ata aac agc gaa gac ttc ttg ctg gaa gcg caa gtg agg gat 536 Phe Arg Ile Asn Ser Glu Asp Phe Leu Leu Glu Ala Gln Val Arg Asp -105 -100 -95 cag cca cgc tgg ctc ctg gtc tgc cat gag ggc tgg agc ccc gcc ctg 584 Gln Pro Arg Trp Leu Leu Val Cys His Glu Gly Trp Ser Pro Ala Leu -90 -85 -80 -75 ggg ctg cag atc tgc tgg agc ctt ggg cat ctc aga ctc act cac cac 632 Gly Leu Gln Ile Cys Trp Ser Leu Gly His Leu Arg Leu Thr His His -70 -65 -60 aag gga gta aac ctc act gac atc aaa ctc aac agt tcc cag gag ttt 680 Lys Gly Val Asn Leu Thr Asp Ile Lys Leu Asn Ser Ser Gln Glu Phe -55 -50 -45 gct cag ctc tct cct aga ctg gga ggc ttc ctg gag gag gcg tgg cag 728 Ala Gln Leu Ser Pro Arg Leu Gly Gly Phe Leu Glu Glu Ala Trp Gln -40 -35 -30 ccc agg aac aac tgc act tct ggt caa gtt gtt tcc ctc aga tgc tct 776 Pro Arg Asn Asn Cys Thr Ser Gly Gln Val Val Ser Leu Arg Cys Ser -25 -20 -15 gag tgt gga gcg agg ccc ctg gct tcc cgg ata gtt ggt ggg cag tct 824 Glu Cys Gly Ala Arg Pro Leu Ala Ser Arg Ile Val Gly Gly Gln Ser -10 -5 -1 1 5 gtg gct cct ggg cgc tgg ccg tgg cag gcc agc gtg gcc ctg ggc ttc 872 Val Ala Pro Gly Arg Trp Pro Trp Gln Ala Ser Val Ala Leu Gly Phe 10 15 20 cgg cac acg tgt ggg ggc tct gtg cta gcg cca cgc tgg gtg gtg act 920 Arg His Thr Cys Gly Gly Ser Val Leu Ala Pro Arg Trp Val Val Thr 25 30 35 gct gca cat tgt atg cac agt ttc agg ctg gcc cgc ctg tcc agc tgg 968 Ala Ala His Cys Met His Ser Phe Arg Leu Ala Arg Leu Ser Ser Trp 40 45 50 cgg gtt cat gcg ggg ctg gtc agc cac agt gcc gtc agg ccc cac caa 1016 Arg Val His Ala Gly Leu Val Ser His Ser Ala Val Arg Pro His Gln 55 60 65 70 ggg gct ctg gtg gag agg att atc cca cac ccc ctc tac agt gcc cag 1064 Gly Ala Leu Val Glu Arg Ile Ile Pro His Pro Leu Tyr Ser Ala Gln 75 80 85 aat cat gac tac gac gtc gcc ctc ctg agg ctc cag acc gct ctc aac 1112 Asn His Asp Tyr Asp Val Ala Leu Leu Arg Leu Gln Thr Ala Leu Asn 90 95 100 ttc tca gac act gtg ggc gct gtg tgc ctg ccg gcc aag gaa cag cat 1160 Phe Ser Asp Thr Val Gly Ala Val Cys Leu Pro Ala Lys Glu Gln His 105 110 115 ttt ccg aag ggc tcg cgg tgc tgg gtg tct ggc tgg ggc cac acc cac 1208 Phe Pro Lys Gly Ser Arg Cys Trp Val Ser Gly Trp Gly His Thr His 120 125 130 cct agc cat act tac agc tcg gat atg ctc cag gac acg gtg gtg ccc 1256 Pro Ser His Thr Tyr Ser Ser Asp Met Leu Gln Asp Thr Val Val Pro 135 140 145 150 ttg ttc agc act cag ctc tgc aac agc tct tgc gtg tac agc gga gcc 1304 Leu Phe Ser Thr Gln Leu Cys Asn Ser Ser Cys Val Tyr Ser Gly Ala 155 160 165 ctc acc ccc cgc atg ctt tgc gct ggc tac ctg gac gga agg gct gat 1352 Leu Thr Pro Arg Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp 170 175 180 gca tgc cag gga gat agc ggg ggc ccc cta gtg tgc cca gat ggg gac 1400 Ala Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Pro Asp Gly Asp 185 190 195 aca tgg cgc cta gtg ggg gtg gtc agc tgg ggg cgt gcg tgc gca gag 1448 Thr Trp Arg Leu Val Gly Val Val Ser Trp Gly Arg Ala Cys Ala Glu 200 205 210 ccc aat cac cca ggt gtc tac gcc aag gta gct gag ttt ctg gac tgg 1496 Pro Asn His Pro Gly Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp 215 220 225 230 atc cat gac act gct cag gac tcc ctc ctc tgagtcctgc tgtttcctcc 1546 Ile His Asp Thr Ala Gln Asp Ser Leu Leu 235 240 agtctcactg cacaccactg cctcatgctt cctggggcct ccagcagctc cactaatgga 1606 ggagaggcag tagcctccga cacagaacgc atggacctcc tactactgtg tgtgaggaac 1666 agtcactacc cactggccag ccacccagcc aacaggtctc tcctcttggg ccctgatttc 1726 agagtcctct ttctcactag agactcaatg acagaagaga ggctgggact tggttgggca 1786 tgctgtggtt gctgagggat gagggggagg agagaggtag gagctggaga tgaagagact 1846 gctagaagca gcaggaagcc tgcccttctg ccctctcccc tccctgcccc tgtgtgagtc 1906 ttttagggag ggtgactggg aggtgccccc cgtcccacct ttttcctgtg ctctaggtgg 1966 gctaagtgcc tccctagagg actccatggc tgagaggctc ctgggcagat ggggtcaagg 2026 ctgggccagt cccagatgaa gcctatggga gtcaggaccc tctccactct ccctctccac 2086 tccccttcct gttctcacct ggctgtggct ggccctgtgt ggggtgggta cactggaaaa 2146 caagaaggtt ggagttggtc taggacattg gttttaaatg acagttctgt gaactggtcc 2206 aaggaggttc tgttattaaa gtgatatatg gtcttgaaaa aaaaaaaaaa aaaaaaaaa 2265 10 457 PRT Homo sapiens 10 Met Ser Leu Met Leu Asp Asp Gln Pro Pro Met Glu Ala Gln Tyr -215 -210 -205 Ala Glu Glu Gly Pro Gly Pro Gly Ile Phe Arg Ala Glu Pro Gly -200 -195 -190 Asp Gln Gln His Pro Ile Ser Gln Ala Val Cys Trp Arg Ser Met -185 -180 -175 Arg Arg Gly Cys Ala Val Leu Gly Ala Leu Gly Leu Leu Ala Gly -170 -165 -160 Ala Gly Val Gly Ser Trp Leu Leu Val Leu Tyr Leu Cys Pro Ala -155 -150 -145 Ala Ser Gln Pro Ile Ser Gly Thr Leu Gln Asp Glu Glu Ile Thr -140 -135 -130 Leu Ser Cys Ser Glu Ala Ser Ala Glu Glu Ala Leu Leu Pro Ala -125 -120 -115 Leu Pro Lys Thr Val Ser Phe Arg Ile Asn Ser Glu Asp Phe Leu -110 -105 -100 Leu Glu Ala Gln Val Arg Asp Gln Pro Arg Trp Leu Leu Val Cys His -95 -90 -85 Glu Gly Trp Ser Pro Ala Leu Gly Leu Gln Ile Cys Trp Ser Leu Gly -80 -75 -70 His Leu Arg Leu Thr His His Lys Gly Val Asn Leu Thr Asp Ile Lys -65 -60

-55 -50 Leu Asn Ser Ser Gln Glu Phe Ala Gln Leu Ser Pro Arg Leu Gly Gly -45 -40 -35 Phe Leu Glu Glu Ala Trp Gln Pro Arg Asn Asn Cys Thr Ser Gly Gln -30 -25 -20 Val Val Ser Leu Arg Cys Ser Glu Cys Gly Ala Arg Pro Leu Ala Ser -15 -10 -5 Arg Ile Val Gly Gly Gln Ser Val Ala Pro Gly Arg Trp Pro Trp Gln -1 1 5 10 15 Ala Ser Val Ala Leu Gly Phe Arg His Thr Cys Gly Gly Ser Val Leu 20 25 30 Ala Pro Arg Trp Val Val Thr Ala Ala His Cys Met His Ser Phe Arg 35 40 45 Leu Ala Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His 50 55 60 Ser Ala Val Arg Pro His Gln Gly Ala Leu Val Glu Arg Ile Ile Pro 65 70 75 His Pro Leu Tyr Ser Ala Gln Asn His Asp Tyr Asp Val Ala Leu Leu 80 85 90 95 Arg Leu Gln Thr Ala Leu Asn Phe Ser Asp Thr Val Gly Ala Val Cys 100 105 110 Leu Pro Ala Lys Glu Gln His Phe Pro Lys Gly Ser Arg Cys Trp Val 115 120 125 Ser Gly Trp Gly His Thr His Pro Ser His Thr Tyr Ser Ser Asp Met 130 135 140 Leu Gln Asp Thr Val Val Pro Leu Phe Ser Thr Gln Leu Cys Asn Ser 145 150 155 Ser Cys Val Tyr Ser Gly Ala Leu Thr Pro Arg Met Leu Cys Ala Gly 160 165 170 175 Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro 180 185 190 Leu Val Cys Pro Asp Gly Asp Thr Trp Arg Leu Val Gly Val Val Ser 195 200 205 Trp Gly Arg Ala Cys Ala Glu Pro Asn His Pro Gly Val Tyr Ala Lys 210 215 220 Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Ala Gln Asp Ser Leu 225 230 235 Leu 240 11 99 DNA Artificial Sequence Synthetic 11 aagcttggct agcaacacca tgaatctact cctgatcctt acctttgttg ctgctgctgt 60 tgctgccccc tttgacgacg atgacaagga tccgaattc 99 12 99 DNA Artificial Sequence Synthetic 12 gaattcggat ccttgtcatc gtcgtcaaag ggggcagcaa cagcagcagc aacaaaggta 60 aggatcagga gtagattcat ggtgttgcta gccaagctt 99 13 15 DNA Artificial Sequence Synthetic 13 ttggtgcatg gcgga 15 14 27 DNA Artificial Sequence Synthetic 14 tcctcgagac ttggcctgaa tggtttt 27 15 35 DNA Artificial Sequence Synthetic 15 gcgctagcag atctccatga atctactcct gatcc 35 16 29 DNA Artificial Sequence Synthetic 16 tgaagcttgc catggaccaa cttgtcatc 29 17 26 DNA Artificial Sequence Synthetic 17 ccaagcttca ccatcaccat caccat 26 18 17 DNA Artificial Sequence Synthetic 18 gcacagtcga ggctgat 17 19 17 DNA Artificial Sequence Synthetic 19 caaatgtggt atggctg 17 20 20 DNA Artificial Sequence Synthetic 20 gtgctcacng cngcbcaytg 20 21 20 DNA Artificial Sequence Synthetic 21 ccvctrwsdc cnccnggcga 20 22 21 DNA Artificial Sequence Synthetic 22 atggtggaga agatcattcc t 21 23 19 DNA Artificial Sequence Synthetic 23 tacagtgccc agaaccatg 19 24 20 DNA Artificial Sequence Synthetic 24 ctcaactctc tgctagaccg 20 25 20 DNA Artificial Sequence Synthetic 25 atagttggcg gccaagctgt 20 26 20 DNA Artificial Sequence Synthetic 26 cccagcagaa cttactgcct 20 27 20 DNA Artificial Sequence Synthetic 27 tgttgcagag gtgggtgctg 20 28 21 DNA Artificial Sequence Synthetic 28 taccattgtg tcctgcagtg t 21 29 27 DNA Artificial Sequence Synthetic 29 tgaattctgc tgcttcttcg gctagcg 27 30 18 DNA Artificial Sequence Synthetic 30 actgctgccc actgcatg 18 31 21 DNA Artificial Sequence Synthetic 31 caggggtccc ccgctgtctc c 21 32 20 DNA Artificial Sequence Synthetic 32 gctctcaact tctcagacac 20 33 20 DNA Artificial Sequence Synthetic 33 actcagctac cttggcgtag 20 34 20 DNA Artificial Sequence Synthetic 34 cctggagcat atccgagctg 20 35 18 DNA Artificial Sequence Synthetic 35 gctttacaac agtgctac 18 36 28 DNA Artificial Sequence Synthetic 36 tggaattcga ggaaacagca ggactcag 28 37 19 DNA Artificial Sequence Synthetic 37 tactagtcga cgcgtggcc 19 38 18 DNA Artificial Sequence Synthetic 38 actgctgccc actgcatg 18 39 35 DNA Artificial Sequence Synthetic 39 gcgctagcag atctccatga atctactcct gatcc 35 40 117 DNA Artificial Sequence Synthetic 40 aagcttggct agcaacacca tgaatctact cctgatcctt acctttgttg ctgctgctgt 60 tgctgccccc tttcaccatc accatcacca tgacgacgat gacaaggatc cgaattc 117 41 117 DNA Artificial Sequence Synthetic 41 gaattcggat ccttgtcatc gtcgtcatgg tgatggtgat ggtgaaaggg ggcagcaaca 60 gcagcagcaa caaaggtaag gatcaggagt agattcatgg tgttgctagc caagctt 117 42 5 PRT Artificial Sequence Synthetic 42 Asp Asp Asp Asp Lys 1 5 43 4 PRT Artificial Sequence Synthetic 43 Leu Val His Gly 1 44 37 DNA Artificial Sequence Synthetic 44 ggccacgcgt cgactagtac tttttttttt ttttttt 37

Claims

What is claimed is:

1. An antibody against a protein selected from the group consisting of: (i) a protein having the amino acid sequence of 238 amino acids represented by SEQ ID NO: 2, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 2 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 2, or a modified derivative thereof; (ii) a protein having the amino acid sequence of 273 amino acids represented by SEQ ID NO: 4, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 4 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 4, or a modified derivative thereof; (iii) a protein having the amino acid sequence of 311 amino acids represented by SEQ ID NO: 6, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 6 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 6, or a modified derivative thereof; (iv) a protein having the amino acid sequence of 455 amino acids represented by SEQ ID NO: 8, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 8 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 8, or a modified derivative thereof; (v) a protein having the amino acid sequence of 240 amino acids represented by the 1st to 240th amino acids of SEQ ID NO: 10, a protein having an amino acid sequence derived from the amino acid sequence represented by the 1st to 240th amino acids of SEQ ID NO: 10 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by the 1st to 240th amino acids of SEQ ID NO: 10, or a modified derivative thereof; (vi) a protein having the amino acid sequence of 457 amino acids represented by the -217th to 240th amino acids of SEQ ID NO: 10, a protein having an amino acid sequence derived from the amino acid sequence represented by the -217th to 240th amino acids of SEQ ID NO: 10 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by the -217th to 240th amino acids of SEQ ID NO: 10, or a modified derivative thereof; and (vii) a protein having the amino acid sequence of 217 amino acids represented by the -217th to -1st amino acids of SEQ ID NO: 10, a protein having an amino acid sequence derived from the amino acid sequence represented by the -217th to -1st amino acids of SEQ ID NO: 10 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by the -217th to -1st amino acids of SEQ ID NO: 10, or a modified derivative thereof, or a fragment of said protein.

2. The antibody of claim 1 which is a polyclonal antibody, a monoclonal antibody or a peptide antibody.

3. The antibody of claim 1 which is against the protein having the amino acid sequence of 238 amino acids represented by SEQ ID NO: 2, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 2 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 2, or a modified derivative thereof.

4. The antibody of claim 1 which is against the protein having the amino acid sequence of 273 amino acids represented by SEQ ID NO: 4, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 4 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 4, or a modified derivative thereof.

5. The antibody of claim 1 which is against the protein having the amino acid sequence of 311 amino acids represented by SEQ ID NO: 6, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 6 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 6, or a modified derivative thereof.

6. The antibody of claim 1 which is against the protein having the amino acid sequence of 455 amino acids represented by SEQ ID NO: 8, a protein having an amino acid sequence derived from the amino acid sequence represented by SEQ ID NO: 8 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by SEQ ID NO: 8, or a modified derivative thereof;

7. The antibody of claim 1 which is against the protein having the amino acid sequence of 240 amino acids represented by the 1st to 240th amino acids of SEQ ID NO: 10, a protein having an amino acid sequence derived from the amino acid sequence represented by the 1st to 240th amino acids of SEQ ID NO: 10 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by the 1st to 240th amino acids of SEQ ID NO: 10, or a modified derivative thereof.

8. The antibody of claim 1 which is against the protein having the amino acid sequence of 457 amino acids represented by the -217th to 240th amino acids of SEQ ID NO: 10, a protein having an amino acid sequence derived from the amino acid sequence represented by the -217th to 240th amino acids of SEQ ID NO: 10 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by the -217th to 240th amino acids of SEQ ID NO: 10, or a modified derivative thereof.

9. The antibody of claim 1 which is against the protein having the amino acid sequence of 217 amino acids represented by the -217th to -1st amino acids of SEQ ID NO: 10, a protein having an amino acid sequence derived from the amino acid sequence represented by the -217th to -1st amino acids of SEQ ID NO: 10 by deletion, substitution or addition of one to several amino acids and having the same property as that of the protein having the amino acid sequence represented by the -217th to -1st amino acids of SEQ ID NO: 10, or a modified derivative thereof, or a fragment of said protein.