U.S. patent application number 10/956242 was filed with the patent office on 2005-07-28 for optical sorting method.
Invention is credited to Griffiths, Andrew, Sepp, Armin, Tawfik, Dan.
Application Number | 20050164239 10/956242 |
Document ID | / |
Family ID | 10845700 |
Filed Date | 2005-07-28 |
United States Patent
Application |
20050164239 |
Kind Code |
A1 |
Griffiths, Andrew ; et
al. |
July 28, 2005 |
Optical sorting method
Abstract
The invention describes a method for isolating one or more
genetic elements encoding a gene product having a desired activity,
comprising the steps of: (a) compartmentalising genetic elements
into microcapsules; (b) expressing the genetic elements to produce
their respective gene products within the microcapsules; (c)
sorting the genetic elements which produce the gene product having
the desired activity using a change in the optical properties of
the genetic elements. The invention enables the in vitro evolution
of nucleic acids and proteins by repeated mutagenesis and iterative
applications of the method of the invention.
Inventors: |
Griffiths, Andrew;
(Cambridge, GB) ; Tawfik, Dan; (Jerusalem, IL)
; Sepp, Armin; (Cambridge, GB) |
Correspondence
Address: |
PALMER & DODGE, LLP
KATHLEEN M. WILLIAMS
111 HUNTINGTON AVENUE
BOSTON
MA
02199
US
|
Family ID: |
10845700 |
Appl. No.: |
10/956242 |
Filed: |
October 1, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10956242 |
Oct 1, 2004 |
|
|
|
09896915 |
Jun 29, 2001 |
|
|
|
6808882 |
|
|
|
|
09896915 |
Jun 29, 2001 |
|
|
|
PCT/GB00/00030 |
Jan 6, 2000 |
|
|
|
Current U.S.
Class: |
435/6.16 ; 264/4;
435/455 |
Current CPC
Class: |
C12N 15/113 20130101;
C12Q 1/6811 20130101; C12N 15/1075 20130101; C12N 15/1062
20130101 |
Class at
Publication: |
435/006 ;
435/455; 264/004 |
International
Class: |
C12Q 001/68; C12N
015/85 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 7, 1999 |
GB |
GB9900298.2 |
Claims
1. A method for isolating one or more genetic elements encoding a
gene product having a desired activity the expression of which may
result, directly or indirectly, in the modification of an optical
property of a genetic element encoding the gene product, comprising
the steps of: (a) expressing the genetic elements to produce their
respective gene products such that the gene products are linked to
the genes encoding them; (b) compartmentalising genetic elements
into microcapsules; and (c) sorting the genetic elements which
produce the gene product(s) having the desired activity according
to a change in the optical properties of the genetic elements.
2. The method according to claim 1, wherein the activity of the
desired gene product results, directly or indirectly, in the
modification of the genetic element encoding the gene product to
enable the isolation of the genetic element.
3. The method according to claim 2, wherein in the modification of
the genetic element induces a change in its optical properties.
4. The method according to claim 2, wherein the modification of the
genetic element enables it to be further modified outside the
microcapsule so as to induce a change in its optical
properties.
5. The method according to claim 2, wherein a part of the genetic
element is a ligand and the desired gene product binds, directly or
indirectly, to said ligand to enable the isolation of the genetic
element.
6. The method according to claim 5, wherein the ligand is also
encoded by the genetic element.
7. The method according to claim 2, wherein a part of the genetic
element is a substrate and the activity of the desired gene product
results, directly or indirectly, in the conversion of said
substrate into a product which remains part of the genetic element
and enables its isolation.
8. The method according to claim 2, wherein the product of the
activity of the desired gene product results, directly or
indirectly, in the generation of a product which is subsequently
complexed with the genetic element and enables its isolation.
9. The method according to claim 1 wherein the activity of the
desired gene product results, directly or indirectly, in the
alteration of the expression of a second gene within the
compartment and the activity of the product of the said second gene
enables the isolation of the genetic element using a change in the
optical properties of the genetic element.
10. The method according to claim 1, wherein step (a) comprises:
expressing the genetic elements to produce their respective gene
products, linking the gene products to the genetic elements
encoding them and isolating the complexes thereby formed.
11. The method according to claim 1, wherein in step (c) the
complexes are directly sorted based on their changed optical
properties to isolate genetic elements encoding a gene product
having the desired activity.
12. The method according to claim 1, wherein in step (c) the
complexes are further reacted to induce a conditional change in
optical properties of the genetic element dependent on the presence
of gene products with the desired activity in the complex.
13. The method according to claim 1, wherein the complexes are
subjected to a further compartmentalisation step in order to
isolate the genetic elements encoding a gene product having the
desired activity.
14. The method according to claim 1, wherein the change in optical
properties of the genetic element is due to binding of a gene
product with distinctive optical properties to the genetic
element.
15. The method according to claim 1, wherein the change in optical
properties of the genetic element is due to binding of a ligand
with distinctive optical properties by the gene product.
16. The method according to claim 1, wherein the change in optical
properties of the genetic element is due to a change in the optical
properties of the gene product when bound to ligand.
17. The method according to claim 1, wherein the change in optical
properties of the genetic element is due to a change in the optical
properties of the ligand when bound by the gene product.
18. A method according to claim 1, wherein the change in optical
properties of the genetic element is due to a change in the optical
properties of both ligand and gene product on binding.
19. The method according to claim 1, wherein the change in optical
properties of the genetic element is due to the different optical
properties of the substrate and the product of the reaction being
selected.
20. The method according to claim 1, wherein both substrate and
product have similar optical properties, but only the product, and
not the substrate of the reaction being selected binds to, or
reacts with, the genetic clement, thereby changing the optical
properties of the genetic element.
21. The method according to claim 1, wherein further reagents
specifically bind to, or specifically react with, the product (and
not the substrate) attached to the genetic element, thereby
altering the optical properties of the genetic element.
22. The method according to claim 1, wherein a non-desired activity
of a gene product results in a change in the optical properties of
the genetic element which is distinct from that resulting from the
desired activity.
23. The method according to claim 22, wherein the optical change
resulting from the non-desired activity is used to negatively
select the genetic elements.
24. The method according to claim 22, wherein negative selection is
combined with positive selection to improve reaction
specificity.
25. The method according to claim 24, wherein the improved reaction
specificity is an improvement in binding specificity.
26. The method according to claim 24, wherein the improved reaction
specificity is an improvement in regio- and/or stereo-selectivity
for substrate and/or product.
27. The method according to claim 1, wherein the genetic elements
are isolated from a library of genetic elements encoding a
repertoire of gene products.
28. The method according to claim 1, wherein each genetic element
encodes two or more genes and each gene product must have a desired
activity in order for the optical properties of the genetic element
to be modified to enable them to be sorted.
29. The method according to claim 1, wherein each genetic element
encodes two or more genes and the gene products must bind to each
other in order for the optical properties of the genetic element to
be modified and the genetic elements sorted.
30. The method according to claim 1 further comprising the
additional step of: (d) introducing one or more mutations into the
genetic element(s) isolated in step (c).
31. The method according to claim 30 further comprising iteratively
repeating one or more of steps (a) to (d).
32. The method according to claim 1 further comprising amplifying
the genetic elements.
33. The method according to claim 1, wherein microencapsulation is
achieved by forming a water-in-oil emulsion of the aqueous solution
in an oil-based medium.
34. The method according to claim 1, wherein the genetic element
comprises the gene attached to a microbead.
35. The method according to claim 34, wherein the microbead is
nonmagnetic, magnetic or paramagnetic.
36. The method according to claim 1, wherein the genetic elements
are sorted by detection of a change in their fluorescence.
37. The method according to claim 36, wherein the sorting of
genetic elements is performed using a fluorescence activated cell
sorter (FACS).
38. The method according to claim 36, wherein the different
fluorescence properties of the substrate and the product are due to
fluorescence resonance energy transfer (FRET).
39. The method according to claim 1, wherein the internal
environment of the microcapsules is modified by the addition of one
or more reagents to the oil phase.
40. The method according to claim 1, wherein genetic elements
modified directly or indirectly by the activity of the desired gene
product are further modified by Tyramide Signal Amplification
(TSA.TM.; NEN), resulting directly or indirectly in a change in the
optical properties of said genetic elements thereby enabling their
separation.
41. A product isolated according to the method of claim 1.
42. A method for preparing a gene product, comprising the steps of:
(a) preparing a genetic element encoding the gene product; (b)
expressing the genetic elements to produce their respective gene
products; (c) compartmentalising genetic elements into
microcapsules, (d) sorting the genetic elements which produce the
gene product(s) having the desired activity using a change in their
optical properties; and (e) expressing the gene product having the
desired activity.
43. A method for screening a compound or compounds capable of
modulating the activity of a gene product, comprising the steps of:
(a) preparing a genetic element encoding the gene product; (b)
expressing the genetic elements to produce their respective gene
products; (c) compartmentalising genetic elements into
microcapsules; (d) sorting the genetic elements which produce the
gene product(s) having the desired activity using a change in their
optical properties; and (e) contacting a gene product having the
desired activity with the compound or compounds and monitoring the
modulation of an activity of the gene product by the compound or
compounds.
44. A method for preparing a compound or compounds comprising the
steps of: (a) providing a synthesis protocol wherein at least one
step is facilitated by a polypeptide; (b) preparing genetic
elements encoding variants of the polypeptide which facilitates
this step; (c) expressing the genetic elements to produce their
respective gene products; (d) compartmentalising the genetic
elements into microcapsules; (e) sorting the genetic elements which
produce polypeptide gene product(s) having the desired activity
using a change in their optical properties; and (f) preparing the
compound or compounds using the polypeptide gene product identified
in (e) to facilitate the relevant step of the synthesis.
Description
[0001] This application is a Continuation-in-Part of International
Application No. PCT/GB00/00030, filed Jan. 6, 2000, designating the
United States, and claims the priority of United Kingdom
Application No.: GB 9900298.2, filed Jan. 7, 1999.
[0002] The present invention relates to methods for use in in vitro
evolution of molecular libraries. In particular, the present
invention relates to methods of selecting nucleic acids encoding
gene products in which the nucleic acid and the activity of the
encoded gene product are linked by compartmentation.
[0003] Evolution requires the generation of genetic diversity
(diversity in nucleic acid) followed by the selection of those
nucleic acids which result in beneficial characteristics. Because
the nucleic acid and the activity of the encoded gene product of an
organism are physically linked (the nucleic acids being confined
within the cells which they encode) multiple rounds of mutation and
selection can result in the progressive survival of organisms with
increasing fitness. Systems for rapid evolution of nucleic acids or
proteins in vitro advantageously mimic this process at the
molecular level in that the nucleic acid and the activity of the
encoded gene product are linked and the activity of the gene
product is selectable.
[0004] Recent advances in molecular biology have allowed some
molecules to be co-selected according to their properties along
with the nucleic acids that encode them. The selected nucleic acids
can subsequently be cloned for further analysis or use, or
subjected to additional rounds of mutation and selection.
[0005] Common to these methods is the establishment of large
libraries of nucleic acids. Molecules having the desired
characteristics (activity) can be isolated through selection
regimes that select for the desired activity of the encoded gene
product, such as a desired biochemical or biological activity, for
example binding activity.
[0006] Phage display technology has been highly successful as
providing a vehicle that allows for the selection of a displayed
protein by providing the essential link between nucleic acid and
the activity of the encoded gene product (Smith, 1985; Bass et al.,
1990; McCafferty et al., 1990; for review see Clackson and Wells,
1994). Filamentous phage particles act as genetic display packages
with proteins on the outside and the genetic elements which encode
them on the inside. The tight linkage between nucleic acid and the
activity of the encoded gene product is a result of the assembly of
the phage within bacteria. As individual bacteria are rarely
multiply infected, in most cases all the phage produced from an
individual bacterium will carry the same genetic element and
display the same protein.
[0007] However, phage display relies upon the creation of nucleic
acid libraries in vivo in bacteria. Thus, the practical limitation
on library size allowed by phage display technology is of the order
of 10.sup.7 to 10.sup.11, even taking advantage of .lambda. phage
vectors with excisable filamentous phage replicons. The technique
has mainly been applied to selection of molecules with binding
activity. A small number of proteins with catalytic activity have
also been isolated using this technique, however, selection was not
directly for the desired catalytic activity, but either for binding
to a transition-state analogue (Widersten and Mannervik, 1995) or
reaction with a suicide inhibitor (Soumillion et al., 1994; Janda
et al., 1997). More recently there have been some examples of
enzymes selected using phage-display by product formation (Atwell
& Wells, 1999; Demartis et al., 1999; Jestin et al., 1999;
Pederson, et al., 1998), but in all these cases selection was not
for multiple turnover.
[0008] Specific peptide ligands have been selected for binding to
receptors by affinity selection using large libraries of peptides
linked to the C terminus of the lac repressor LacI (Cull et al.,
1992). When expressed in E. coli the repressor protein physically
links the ligand to the encoding plasmid by binding to a lac
operator sequence on the plasmid.
[0009] An entirely in vitro polysome display system has also been
reported (Mattheakis et al., 1994; Hanes and Pluckthun, 1997) in
which nascent peptides are physically attached via the ribosome to
the RNA which encodes them. An alternative, entirely in vitro
system for linking genotype to phenotype by making RNA-peptide
fusions (Roberts and Szostak, 1997; Nemoto et al., 1997) has also
been described.
[0010] However, the scope of the above systems is limited to the
selection of proteins and furthermore does not allow direct
selection for activities other than binding, for example catalytic
or regulatory activity.
[0011] In vitro RNA selection and evolution (Ellington and Szostak,
1990), sometimes referred to as SELEX (systematic evolution of
ligands by exponential enrichment) (Tuerk and Gold, 1990) allows
for selection for both binding and chemical activity, but only for
nucleic acids. When selection is for binding, a pool of nucleic
acids is incubated with immobilised substrate. Non-binders are
washed away, then the binders are released, amplified and the whole
process is repeated in iterative steps to enrich for better binding
sequences. This method can also be adapted to allow isolation of
catalytic RNA and DNA (Green and Szostak, 1992; for reviews see
Chapman and Szostak, 1994; Joyce, 1994; Gold et al., 1995; Moore,
1995).
[0012] However, selection for "catalytic" or binding activity using
SELEX is only possible because the same molecule performs the dual
role of carrying the genetic information and being the catalyst or
binding molecule (aptamer). When selection is for "auto-catalysis"
the same molecule must also perform the third role of being a
substrate. Since the genetic element must play the role of both the
substrate and the catalyst, selection is only possible for single
turnover events. Because the "catalyst" is in this process itself
modified, it is by definition not a true catalyst. Additionally,
proteins may not be selected using the SELEX procedure. The range
of catalysts, substrates and reactions which can be selected is
therefore severely limited.
[0013] Those of the above methods that allow for iterative rounds
of mutation and selection are mimicking in vitro mechanisms usually
ascribed to the process of evolution: iterative variation,
progressive selection for a desired the activity and replication.
However, none of the methods so far developed have provided
molecules of comparable diversity and functional efficacy to those
that are found naturally. Additionally, there are no man-made
"evolution" systems which can evolve both nucleic acids and
proteins to effect the full range of biochemical and biological
activities (for example, binding, catalytic and regulatory
activities) and that can combine several processes leading to a
desired product or activity.
[0014] There is thus a great need for an in vitro system that
overcomes the limitations discussed above.
[0015] In Tawfik and Griffiths (1998), and in International patent
application PCT/GB98/01889, we describe a system for in vitro
evolution that overcomes many of the limitations described above by
using compartmentalisation in microcapsules to link genotype and
phenotype at the molecular level.
[0016] In Tawfik and Griffiths (1998), and in several embodiments
of International patent application PCT/GB98/01889, the desired
activity of a gene product results in a modification of the genetic
element which encoded it (and is present in the same microcapsule).
The modified genetic element can then be selected in a subsequent
step.
[0017] Here we describe a further invention in which the
modification of the genetic element causes a change in the optical
properties of the element itself, and which has many advantages
over the methods described previously.
BRIEF DESCRIPTION OF THE INVENTION
[0018] According to a first aspect of the present invention, there
is provided a method for isolating one or more genetic elements
encoding a gene product having a desired activity the expression of
which may result, directly or indirectly, in the modification of an
optical property of a genetic element encoding the gene product,
comprising the steps of:
[0019] (a) compartmentalising genetic elements into
microcapsules;
[0020] (b) expressing the genetic elements to produce their
respective gene products within the microcapsules;
[0021] (c) sorting the genetic elements which produce the gene
product(s) having the desired activity according to the changed
optical properties of the genetic elements.
[0022] The microcapsules according to the present invention
compartmentalise genetic elements and gene products such that they
remain physically linked together.
[0023] As used herein, a genetic element is a molecule or molecular
construct comprising a nucleic acid. The genetic elements of the
present invention may comprise any nucleic acid (for example, DNA,
RNA or any analogue, natural or artificial, thereof). The nucleic
acid component of the genetic element may moreover be linked,
covalently or non-covalently, to one or more molecules or
structures, including proteins, chemical entities and groups, and
solid-phase supports such as beads (including nonmagnetic, magnetic
and paramagnetic beads), and the like. In the method of the
invention, these structures or molecules can be designed to assist
in the sorting and/or isolation of the genetic element encoding a
gene product with the desired activity.
[0024] Expression, as used herein, is used in its broadest meaning,
to signify that a nucleic acid contained in the genetic element is
converted into its gene product. Thus, where the nucleic acid is
DNA, expression refers to the transcription of the DNA into RNA;
where this RNA codes for protein, expression may also refer to the
translation of the RNA into protein. Where the nucleic acid is RNA,
expression may refer to the replication of this RNA into further
RNA copies, the reverse transcription of the RNA into DNA and
optionally the transcription of this DNA into further RNA
molecule(s), as well as optionally the translation of any of the
RNA species produced into protein. Preferably, therefore,
expression is performed by one or more processes selected from the
group consisting of transcription, reverse transcription,
replication and translation.
[0025] Expression of the genetic element may thus be directed into
either DNA, RNA or protein, or a nucleic acid or protein containing
unnatural bases or amino acids (the gene product) within the
microcapsule of the invention, so that the gene product is confined
within the same microcapsule as the genetic element.
[0026] The genetic element and the gene product thereby encoded are
linked by confining each genetic element and the respective gene
product encoded by the genetic element within the same
microcapsule. In this way the gene product in one microcapsule
cannot cause a change in any other microcapsules. In addition,
further linking means may be employed to link gene products to the
genetic elements encoding them, as set forth below.
[0027] The term "microcapsule" is used herein in accordance with
the meaning normally assigned thereto in the art and further
described hereinbelow. In essence, however, a microcapsule is an
artificial compartment whose delimiting borders restrict the
exchange of the components of the molecular mechanisms described
herein which allow the sorting of the genetic elements according to
the function of the gene products which they encode.
[0028] Preferably, the microcapsules used in the method of the
present invention will be capable of being produced in very large
numbers, and thereby to compartmentalise a library of genetic
elements which encodes a repertoire of gene products.
[0029] As used herein, a change in optical properties of the
genetic elements refers to a change greater than 10% in absorption
or emission of electromagnetic radiation, including changes in
absorbance, luminescence, phosphorescence or fluorescence, relative
to the optical property measured before expression of a genetic
element. All such properties are included in the term "optical".
Genetic elements can be sorted, for example, by luminescence,
fluorescence or phosphorescence activated sorting. In a preferred
embodiment, flow cytometry is employed to sort genetic elements,
for example, light scattering (Kerker, 1983) and fluorescence
polarisation (Rolland et al., 1985) can be used to trigger flow
sorting. In a highly preferred embodiment genetic elements are
sorted using a fluorescence activated cell sorter (FACS) sorter
(Norman, 1980; Mackenzie and Pinder, 1986).
[0030] Changes in optical properties may be direct or indirect.
Thus, the change may result in the alteration of an optical
property in the genetic element itself, or may lead indirectly to
such a change. For example, modification of a genetic element may
alter (i.e., change by at least 10%) its ability to bind an
optically active ligand, thus indirectly altering its optical
properties.
[0031] Alternatively, imaging techniques can be used to screen thin
films of genetic elements to allow enrichment for a genetic element
with desirable properties, for example by physical isolation of the
region where a genetic element with desirable properties is
situated, or ablation of non-desired genetic elements. The genetic
elements can be detected by luminescence, phosphorescence or
fluorescence.
[0032] According to a preferred embodiment of the first aspect of
the present invention, the sorting of genetic elements may be
performed in one of essentially two techniques.
[0033] (I) In a first embodiment, the genetic elements are sorted
following pooling of the microcapsules into one or more common
compartments. In this embodiment, a gene product having the desired
activity modifies the genetic element which encoded it (and which
resides in the same microcapsule) so as to make it selectable as a
result of its modified optical properties in a subsequent step. The
reactions are stopped and the microcapsules are then broken so that
all the contents of the individual microcapsules are pooled. The
modification of the genetic element in the microcapsule may result
directly in the modification of the optical properties of the
genetic element. Alternatively, the modification may allow the
genetic elements to be further modified outside the microcapsules
so as to induce a change in their optical properties. Selection for
the genetic elements with modified optical properties enables
enrichment of the genetic elements encoding the gene product(s)
having the desired activity. Accordingly, the invention provides a
method according to the first aspect of the invention, wherein in
step (b) the gene product having the desired activity modifies the
genetic element encoding it to enable the isolation of the genetic
element as a result in a change in the optical properties of the
genetic element. It is to be understood, of course, that
modification may be direct, in that it is caused by the direct
action of the gene product on the genetic element, or indirect, in
which a series of reactions, one or more of which involve the gene
product having the desired activity, leads to modification of the
genetic element.
[0034] (II) In a second embodiment, the genetic elements may be
sorted by a multi-step procedure, which involves at least two
steps, for example, in order to allow the exposure of the genetic
elements to conditions which permit at least two separate reactions
to occur. As will be apparent to persons skilled in the art, the
first microencapsulation step of the invention advantageously
results in conditions which permit the expression of the genetic
elements be it transcription, transcription and/or translation,
replication or the like. Under these conditions, it may not be
possible to select for a particular gene product activity, for
example because the gene product may not be active under these
conditions, or because the expression system contains an
interfering activity. The invention therefore provides a method
according to the first aspect of the present invention, wherein
step (b) comprises expressing the genetic elements to produce their
respective gene products within the microcapsules, linking the gene
products to the genetic elements encoding them and isolating the
complexes thereby formed. This allows for the genetic elements and
their associated gene products to be isolated from the capsules
before sorting according to gene product activity takes place. In a
preferred embodiment, the complexes are subjected to a further
compartmentalisation step prior to isolating the genetic elements
encoding a gene product having the desired activity. This further
compartmentalisation step, which advantageously takes place in
microcapsules, permits the performance of further reactions, under
different conditions, in an environment where the genetic elements
and their respective gene products are physically linked. Eventual
sorting of genetic elements may be performed according to
embodiment (I) above.
[0035] The "secondary encapsulation" may also be performed with
genetic elements linked to gene products by other means, such as by
phage display, polysome display, RNA-peptide fusion or lac
repressor peptide fusion.
[0036] The selected genetic element(s) may also be subjected to
subsequent, optionally more stringent rounds of sorting in
iteratively repeated steps, reapplying the method of the invention
either in its entirety or in selected steps only. By tailoring the
conditions appropriately, genetic elements encoding gene products
having a better optimised activity may be isolated after each round
of selection.
[0037] Additionally, the genetic elements isolated after a first
round of sorting may be subjected to mutagenesis before repeating
the sorting by iterative repetition of the steps of the method of
the invention as set out above. After each round of mutagenesis,
some genetic elements will have been modified in such a way that
the activity of the gene products is enhanced (i.e., measurable
activity increased by at least 10% relative to wild-type).
[0038] Moreover, the selected genetic elements can be cloned into
an expression vector to allow further characterisation of the
genetic elements and their products.
[0039] In a second aspect, the invention provides a product when
selected according to the first aspect of the invention. As used in
this context, a "product" may refer to a gene product, selectable
according to the invention, or the genetic element (or genetic
information comprised therein).
[0040] In a third aspect, the invention provides a method for
preparing a gene product, the expression of which may result,
directly or indirectly, in the modification the optical properties
of a genetic element encoding it, comprising the steps of:
[0041] (a) preparing a genetic element encoding the gene
product;
[0042] (b) compartmentalising genetic elements into
microcapsules;
[0043] (c) expressing the genetic elements to produce their
respective gene products within the microcapsules;
[0044] (d) sorting the genetic elements which produce the gene
product(s) having the desired activity using the changed optical
properties of the genetic elements; and
[0045] (e) expressing the gene product having the desired
activity.
[0046] In accordance with the third aspect, step (a) preferably
comprises preparing a repertoire of genetic elements, wherein each
genetic element encodes a potentially differing gene product.
Repertoires may be generated by conventional techniques, such as
those employed for the generation of libraries intended for
selection by methods such as phage display. Gene products having
the desired activity may be selected from the repertoire, according
to the present invention, according to their ability to modify the
optical properties of the genetic elements in a manner which
differs (i.e., by at least 10% in at least one optical property)
from that of other gene products. For example, desired gene
products may modify the optical properties to a greater extent than
other gene products, or to a lesser extent, including not at
all.
[0047] In a fourth aspect, the invention provides a method for
screening a compound or compounds capable of modulation the
activity of a gene product, the expression of which may result,
directly or indirectly, in the modification of the optical
properties of a genetic element encoding it, comprising the steps
of:
[0048] (a) preparing a repertoire of genetic elements encoding gene
product;
[0049] (b) compartmentalising genetic elements into
microcapsules;
[0050] (c) expressing the genetic elements to produce their
respective gene products within the microcapsules;
[0051] (d) sorting the genetic elements which produce the gene
product(s) having the desired activity using the changed optical
properties of the genetic elements; and
[0052] (e) contacting a gene product having the desired activity
with the compound or compounds and monitoring the modulation of an
activity of the gene product by the compound or compounds.
[0053] Advantageously, the method further comprises the step
of:
[0054] (g) identifying the compound or compounds capable of
modulating the activity of the gene product and synthesising said
compound or compounds.
[0055] This selection system can be configured to select for RNA,
DNA or protein molecules with catalytic, regulatory or binding
activity.
BRIEF DESCRIPTION OF THE FIGURES
[0056] FIG. 1. Dihydrofolate reductase can be expressed from genes
in vitro translated in solution and genes attached to paramagnetic
beads with identical efficiency. The DHFR activity resulting from
in vitro translation of folA genes in solution or folA genes
attached to paramagnetic microbeads is determined by monitoring the
oxidation of NADPH to NADP spectrophotometrically at 340 nm and
activity is calculated by initial velocities under
So>>K.sub.M conditions (.upsilon.max). (.diamond-solid.),
translated from genes in solution; (.box-solid.), translated from
genes attached to microbeads 2.
[0057] FIG. 2. Epifluorescence microscopy of water-in-oil emulsions
demonstrating that GFP can be translated in vitro from genes
attached to single microbeads encapsulated in the aqueous
compartments of the emulsions and the translated gene-product bound
back the microbeads making them fluorescent.
[0058] FIG. 3. Flow cytometric analysis of GFP expression in
microcapsules and in situ binding to the genetic element
(microbeads). A: The light scattering characteristics of the beads
before reaction. 75% of beads run as single beads. B: The light
scattering characteristics of the beads after in vitro translation
reaction. About 50% of beads fall into the gate for single beads.
C: Fluorescence from microbeads (gated for single beads only)
coated with T7-GFP gene and anti-GFP polyclonal antibody is
significantly higher than the signal from the beads where either
the GFP gene or the anti-GFP antibody were omitted.
[0059] FIG. 4. Synthesis of Biotin-GS-DNP by the human glutathione
S-transferase M2-2 (GST M2-2) catalysed reaction of
1-chloro-2,4-dinitrobenzene (CDNB; Sigma) with reduced
biotinylated-glutathione (Biotin-GSH).
[0060] FIG. 5. Detecting paramagnetic beads coated with the product
of an enzyme catalysed reaction by flow cytometry. Sera-Mag.TM.
streptavidin-coated magnetic microparticles incubated with
Biotin-GS-DNP made by the GST M2-2 catalysed reaction of Biotin-GSH
and CDNB. The captured Biotin-GS-DNP was detected by incubation of
the microparticles with a mouse anti-dinitrophenyl antibody
followed by a (FITC)-conjugated F(ab').sub.2 fragment goat
anti-mouse IgG, F(ab').sub.2 fragment. After washing,
2.times.10.sup.5 microparticles were analysed by flow cytometry.
All reagents, no reagents omitted from the enzymatic synthesis of
with Biotin-GS-DNP; minus GST, the enzyme GST M2-2 was omitted from
the synthesis; minus biotin-GSH, biotin-GSH was omitted from the
synthesis; minus CDNB, CDNB was omitted from the synthesis.
[0061] FIG. 6. Synthesis of MeNPO-CO-Biotin-.beta.-Ala-GSH
(caged-biotin-.beta.ala-GSH). Acetyl chloride (5 ml) was added to
anhydrous methanol (80 ml). The stirred solution was allowed to
cool down and d-biotin (4 g) was added. After over-night stirring
the solvents were evaporated in vacuum to afford a white solid. The
solid was triturated with ether, filtered and dried under vacuum
(in the presence of phosphorus pentoxide) and stored at -20.degree.
C.
[0062] FIG. 7. Reaction of caged-biotin-.beta.ala-GSH with
1-chloro-2,4-dinitrobenzene (CDNB) and photochemical uncaging of
the biotin group.
[0063] FIG. 8. Reaction of caged-biotin-.beta.ala-GSH with
4-chloro-3-nitrobenzoate (CNB) and photochemical uncaging of the
biotin group
[0064] FIG. 9. Human GST M2-2 catalyses the reaction of
caged-biotin-.beta.ala-GSH with CDNB and CNB in solution and the
reaction products can be uncaged by UV irradiation, captured on
beads and detected using fluorescently labelled anti-product
antibodies and flow cytometry.
[0065] Panel A: light scattering characteristics of beads and gate
for single beads (R1). Panel B: fluorescence from microbeads (gated
through R1) from reactions with CDNB. Panel C: fluorescence from
microbeads (gated through R1) from reactions with CNB. Signals from
microbeads from reactions with and without GST M2-2 are annotated
+enz and -enz respectively. Signals from microbeads from reactions
which were UV irradiated and those which were not are annotated +UV
and -UV respectively.
[0066] FIG. 10. Flow cytometry can be used to distinguish beads
from aqueous compartments of an emulsion containing GST M2-2 from
beads from compartments without GST M2-2 by using
caged-biotinylated-.beta.Ala-GSH and CNB as substrates.
[0067] Panel A: light scattering characteristics of a mixture of a
mixture of 1.0 .mu.m diameter nonfluorescent neutravidin labelled
microspheres (Molecular Probes, F-8777) or 0.93 .mu.m diameter
streptavidin-coated polystyrene beads (Bangs Laboratories) and
gates set for single Bangs beads (R1) and single Molecular Probes
beads (R2). Panel B: fluorescence from microbeads taken from a
non-emulsified mixture of 98% Bangs beads (without GST) and 2%
Molecular Probes beads (with GST). Panel C: fluorescence from
microbeads taken from a mixture of two emulsions in a ratio of 98%
emulsion containing Bangs beads (without GST) and an emulsion
containing 2% Molecular Probes beads (with GST). Panel D:
fluorescence from microbeads taken from a non-emulsified mixture of
98% Molecular Probes beads (without GST) and 2% Bangs beads (with
GST). Panel E: fluorescence from microbeads taken from a mixture of
two emulsions in a ratio of 98% emulsion containing Molecular
Probes beads (without GST) and an emulsion containing 2% Bangs
beads (with GST). Fluorescence of ungated beads (No gate), beads
gated through R1 (R1) and beads gated through R2 (R2) are
overlayed.
[0068] FIG. 11. Human GST M2-2 transcribed and translated in vitro
in the aqueous compartments of a water-in oil emulsion catalyses a
reaction which gives rise to a change in the fluorescence
properties of co-compartmentalised microspheres.
[0069] Panel A: light scattering characteristics of beads and gate
for single beads (R1). Panel B: fluorescence from microbeads (gated
through R1) from non-emulsified reactions. Panel C: fluorescence
from microbeads (gated through R1) emulsified reactions. Signals
from microbeads from reactions with and without GSTM2-2.LMB2-3 DNA
are annotated +DNA and -DNA respectively. Signals from microbeads
from reactions with and without recombinant GST M2-2 are annotated
+GST and -GST respectively.
[0070] FIG. 12. Synthesis of the caged-biotinylated substrate
EtNP-BzGlu-caged Biotin (17).
[0071] FIG. 13. Hydrolysis of the PTE substrate EtNP-Bz-Glu-caged
Biotin (17) to yield the product Et-Bz-Glu-caged Biotin, and
uncaging of both substrate and product to yield the corresponding
biotinylated substrate (EtNP-Bz-Glu-Biotin) and product
(EtNP-Bz-Glu-Biotin)
[0072] FIG. 14. Preparation of protein conjugates of a PTE
substrate and product for immunisation and ELISA.
[0073] FIG. 15. PTE catalyses the reaction of EtNP-Bz-Glu-caged
Biotin in the presence of streptavidin-coated beads, and the
reaction products uncaged by UV irradiation, are captured on beads
and detected using fluorescently labelled anti-product antibodies
and flow cytometry.
[0074] Panel A: light scattering characteristics of the beads and
gate selected for single beads (R2).
[0075] Panel B: fluorescence from beads (gated through R2) from
reactions with 10 .mu.M EtNP-Bz-Glu-caged Biotin in the presence of
in vitro translated OPD.LMB3-2biotin DNA fragments (OPD) or
M.HaeIII.LMB3-2biotin DNA fragments (M.HaeIII). Panel C: As B but
with 20 .mu.M EtNP-Bz-Glu-caged Biotin. Panel D: As B but with 50
.mu.M EtNP-Bz-Glu-caged Biotin.
[0076] FIG. 16. Reaction of EtNP-Bz-Glu-caged Biotin in the
presence of beads to which genetic elements encoding the
phosphotriesterase tagged with, the Flag peptide
(N-Flag-OPD.LMB3-2biotin) or another enzyme
(N-Flag-MaeIII.LMB3-2biotin) were attached alongside with an
antibody that binds the Flag peptide. The beads were reacted and
subsequently analysed by flow-cytometry as described in the
text.
[0077] Panel A: light scattering characteristics of beads and gate
for single beads (R1). Panel B: fluorescence from microbeads (gated
through R1) to which were attached N-Flag-OPD.LMB3-2biotin DNA
fragments (OPD) or M.HaeIII.LMB3-2biotin DNA fragments (M.HaeIII)
from reactions with 12.5 .mu.M EtNP-Bz-Glu-caged Biotin. Panel C:
As B but with 25 .mu.M EtNP-Bz-Glu-caged-Biotin.
[0078] FIG. 17. E. coli BirA transcribed and translated in vitro
catalyses a reaction which gives rise to a change in the
fluorescence properties of substrate-labelled microspheres in the
aqueous compartments of a water-in oil emulsion and in bulk
solution.
[0079] FIG. 18. Flow cytometric analysis of samples prepared for
the sorting experiment.
[0080] FIG. 19. Fluorescence-activated flow cytometric sorting of
the genetic elements.
[0081] Panel A: Samples #1 to #4 before sorting and after sorting.
Panel B: Genes recovered from individual beads sorted from sample
#3 sorted into a 96-well plate. Panel C: Genes recovered from
individual beads sorted from sample #4 sorted into a 96-well plate.
DNA markers (M) are .phi.X174-HaeIII digest.
(A) GENERAL DESCRIPTION
[0082] The microcapsules of the present invention require
appropriate physical properties to allow the working of the
invention.
[0083] First, to ensure that the genetic elements and gene products
may not diffuse between microcapsules, the contents of each
microcapsule are preferably isolated from the contents of the
surrounding microcapsules, so that there is no or little exchange
of the genetic elements and gene products between the microcapsules
over the timescale of the experiment.
[0084] Second, the method of the present invention requires that
there are only a limited number of genetic elements per
microcapsule. This ensures that the gene product of an individual
genetic element will be isolated from other genetic elements. Thus,
coupling between genetic element and gene product will be highly
specific. The enrichment factor is greatest with on average one or
fewer genetic elements per microcapsule, the linkage between
nucleic acid and the activity of the encoded gene product being as
tight as is possible, since the gene product of an individual
genetic element will be isolated from the products of all other
genetic elements. However, even if the theoretically optimal
situation of, on average, a single genetic element or less per
microcapsule is not used, a ratio of 5, 10, 50, 100 or 1000 or more
genetic elements per microcapsule may prove beneficial in sorting a
large library. Subsequent rounds of sorting, including renewed
encapsulation with differing genetic element distribution, will
permit more stringent sorting of the genetic elements. Preferably,
there is a single genetic element, or fewer, per microcapsule.
[0085] Third, the formation and the composition of the
microcapsules advantageously does not abolish the function of the
machinery the expression of the genetic elements and the activity
of the gene products.
[0086] The appropriate system(s) may vary depending on the precise
nature of the requirements in each application of the invention, as
will be apparent to the skilled person.
[0087] A wide variety of microencapsulation procedures are
available (see Benita, 1996) and may be used to create the
microcapsules used in accordance with the present invention.
Indeed, more than 200 microencapsulation methods have been
identified in the literature (Finch, 1993).
[0088] These include membrane enveloped aqueous vesicles such as
lipid vesicles (liposomes) (New, 1990) and non-ionic surfactant
vesicles (van Hal et al., 1996). These are closed-membranous
capsules of single or multiple bilayers of non-covalently assembled
molecules, with each bilayer separated from its neighbour by an
aqueous compartment. In the case of liposomes the membrane is
composed of lipid molecules; these are usually phospholipids but
sterols such as cholesterol may also be incorporated into the
membranes (New, 1990). A variety of enzyme-catalysed biochemical
reactions, including RNA and DNA polymerisation, can be performed
within liposomes (Chakrabarti et al., 1994; Oberholzer et al.,
1995a; Oberholzer et al., 1995b; Walde et al., 1994;Wick &
Luisi, 1996).
[0089] With a membrane-enveloped vesicle system much of the aqueous
phase is outside the vesicles and is therefore
non-compartmentalised. This continuous, aqueous phase is removed or
the biological systems in it inhibited or destroyed (for example,
by digestion of nucleic acids with DNase or RNase) in order that
the reactions are limited to the microcapsules (Luisi et al.,
1987).
[0090] Enzyme-catalysed biochemical reactions have also been
demonstrated in microcapsules generated by a variety of other
methods. Many enzymes are active in reverse micellar solutions (Bru
& Walde, 1991; Bru & Walde, 1993; Creagh et al., 1993;
Haber et al., 1993; Kumar et al., 1989; Luisi & B., 1987; Mao
& Walde, 1991; Mao et al., 1992; Perez et al., 1992; Walde et
al., 1994; Walde et al., 1993; Walde et al., 1988) such as the
AOT-isooctane-water system (Menger & Yamada, 1979).
[0091] Microcapsules can also be generated by interfacial
polymerisation and interfacial complexation (Whateley, 1996).
Microcapsules of this sort can have rigid, nonpermeable membranes,
or semipermeable membranes. Semipermeable microcapsules bordered by
cellulose nitrate membranes, polyamide membranes and
lipid-polyamide membranes can all support biochemical reactions,
including multienzyme systems (Chang, 1987; Chang, 1992; Lim,
1984). Alginate/polylysine microcapsules (Lim & Sun, 1980),
which can be formed under very mild conditions, have also proven to
be very biocompatible, providing, for example, an effective method
of encapsulating living cells and tissues (Chang, 1992; Sun et al.,
1992).
[0092] Non-membranous microencapsulation systems based on phase
partitioning of an aqueous environment in a colloidal system, such
as an emulsion, may also be used.
[0093] Preferably, the microcapsules of the present invention are
formed from emulsions; heterogeneous systems of two immiscible
liquid phases with one of the phases dispersed in the other as
droplets of microscopic or colloidal size (Becher, 1957; Sherman,
1968; Lissant, 1974; Lissant, 1984).
[0094] Emulsions may be produced from any suitable combination of
immiscible liquids. Preferably the emulsion of the present
invention has water (containing the biochemical components) as the
phase present in the form of finely divided droplets (the disperse,
internal or discontinuous phase) and a hydrophobic, immiscible
liquid (an oil) as the matrix in which these droplets are suspended
(the nondisperse, continuous or external phase). Such emulsions are
termed "water-in-oil" (W/O). This has the advantage that the entire
aqueous phase containing the biochemical components is
compartmentalised in discreet droplets (the internal phase). The
external phase, being a hydrophobic oil, generally contains none of
the biochemical components and hence is inert.
[0095] The emulsion may be stabilised by addition of one or more
surface-active agents (surfactants). These surfactants are termed
emulsifying agents and act at the water/oil interface to prevent
(or at least delay) separation of the phases. Many oils and many
emulsifiers can be used for the generation of water-in-oil
emulsions; a recent compilation listed over 16,000 surfactants,
many of which are used as emulsifying agents (Ash and Ash, 1993).
Suitable oils include light white mineral oil and non-ionic
surfactants (Schick, 1966) such as sorbitan monooleate (Span.TM.80;
ICI) and polyoxyethylenesorbitan monooleate (Tween.TM.80; ICI).
[0096] The use of anionic surfactants may also be beneficial.
Suitable surfactants include sodium cholate and sodium
taurocholate. Particularly preferred is sodium deoxycholate,
preferably at a concentration of 0.5% w/v, or below. Inclusion of
such surfactants can in some cases increase the expression of the
genetic elements and/or the activity of the gene products. Addition
of some anionic surfactants to a non-emulsified reaction mixture
completely abolishes translation. During emulsification, however,
the surfactant is transferred from the aqueous phase into the
interface and activity is restored. Addition of an anionic
surfactant to the mixtures to be emulsified ensures that reactions
proceed only after compartmentalisation.
[0097] Creation of an emulsion generally requires the application
of mechanical energy to force the phases together. There are a
variety of ways of doing this which utilise a variety of mechanical
devices, including stirrers (such as magnetic stir-bars, propeller
and turbine stirrers, paddle devices and whisks), homogenisers
(including rotor-stator homogenisers, high-pressure valve
homogenisers and jet homogenisers), colloid mills, ultrasound and
`membrane emulsification` devices (Becher, 1957; Dickinson,
1994).
[0098] Aqueous microcapsules formed in water-in-oil emulsions are
generally stable with little if any exchange of genetic elements or
gene products between microcapsules. Additionally, we have
demonstrated that several biochemical reactions proceed in emulsion
microcapsules. Moreover, complicated biochemical processes, notably
gene transcription and translation are also active in emulsion
microcapsules. The technology exists to create emulsions with
volumes all the way up to industrial scales of thousands of litres
(Becher, 1957; Sherman, 1968; Lissant, 1974; Lissant, 1984).
[0099] The preferred microcapsule size will vary depending upon the
precise requirements of any individual selection process that is to
be performed according to the present invention. In all cases,
there will be an optimal balance between gene library size, the
required enrichment and the required concentration of components in
the individual microcapsules to achieve efficient expression and
reactivity of the gene products.
[0100] The processes of expression occurs within each individual
microcapsule provided by the present invention. Both in vitro
transcription and coupled transcription-translation become less
efficient at sub-nanomolar DNA concentrations. Because of the
requirement for only a limited number of DNA molecules to be
present in each microcapsule, this therefore sets a practical upper
limit on the possible microcapsule size. Preferably, the mean
volume of the microcapsules is less that 5.2.times.10.sup.-16
m.sup.3, (corresponding to a spherical microcapsule of diameter
less than 10 .mu.m, more preferably less than 6.5.times.10.sup.-17
m.sup.3 (5 .mu.m diameter), more preferably about
4.2.times.10.sup.-18 m.sup.3 (2 .mu.m diameter) and ideally about
9.times.10.sup.-18 m.sup.3 (2.6 .mu.m diameter).
[0101] The effective DNA or RNA concentration in the microcapsules
may be artificially increased by various methods that will be
well-known to those versed in the art. These include, for example,
the addition of volume excluding chemicals such as polyethylene
glycols (PEG) and a variety of gene amplification techniques,
including transcription using RNA polymerases including those from
bacteria such as E. Coli (Roberts, 1969; Blattner and Dahlberg,
1972; Roberts et al. 1975; Rosenberg et al., 1975), eukaryotes e.g.
(Weil et al., 1979; Manley et al., 1983) and bacteriophage such as
T7, T3 and SP6 (Melton et al., 1984); the polymerase chain reaction
(PCR) (Saiki et al., 1988); Qb replicase amplification (Miele et
al., 1983; Cahill et al., 1991; Chetverin and Spirin, 1995;
Katanaev et al., 1995); the ligase chain reaction (LCR) (Landegren
et al., 1988; Barany, 1991); and self-sustained sequence
replication system (Fahy et al., 1991) and strand displacement
amplification (Walker et al., 1992). Gene amplification techniques
requiring thermal cycling such as PCR and LCR may be used if the
emulsions and the in vitro transcription or coupled
transcription-translation systems are thermostable (for example,
the coupled transcription-translation systems can be made from a
thermostable organism such as Thermus aquaticus).
[0102] Increasing the effective local nucleic acid concentration
enables larger microcapsules to be used effectively. This allows a
preferred practical upper limit to the microcapsule volume of about
5.2.times.10.sup.-16 m.sup.3 (corresponding to a sphere of diameter
10 .mu.m).
[0103] The microcapsule size is preferably sufficiently large to
accommodate all of the required components of the biochemical
reactions that are needed to occur within the microcapsule. For
example, in vitro, both transcription reactions and coupled
transcription-translation reactions require a total nucleoside
triphosphate concentration of about 2 mM.
[0104] For example, in order to transcribe a gene to a single short
RNA molecule of 500 bases in length, this would require a minimum
of 500 molecules of nucleoside triphosphate per microcapsule
(8.33.times.10.sup.-22 moles). In order to constitute a 2 mM
solution, this number of molecules is contained within a
microcapsule of volume 4.17.times.10.sup.-19 litres
(4.17.times.10.sup.-22 m.sup.3 which if spherical would have a
diameter of 93 nm.
[0105] Furthermore, particularly in the case of reactions involving
translation, it is to be noted that the ribosomes necessary for the
translation to occur are themselves approximately 20 nm in
diameter. Hence, the preferred lower limit for microcapsules is a
diameter of approximately 0.1 .mu.m (100 nm).
[0106] Therefore, the microcapsule volume is preferably of the
order of between 5.2.times.10.sup.-22 m.sup.3 and
5.2.times.10.sup.-16 m.sup.3 corresponding to a sphere of diameter
between 0.1 .mu.m and 10 .mu.m, more preferably of between about
5.2.times.10.sup.-19 m.sup.3 and 6.5.times.10.sup.-17 m.sup.3 (1
.mu.m and 5 .mu.m). Sphere diameters of about 2.6 .mu.m are most
advantageous.
[0107] It is no coincidence that the preferred dimensions of the
compartments (droplets of 2.6 .mu.m mean diameter) closely resemble
those of bacteria, for example, Escherichia are
1.1-1.5.times.2.0-6.0 .mu.m rods and Azotobacter are 1.5-2.0 .mu.m
diameter ovoid cells. In its simplest form, Darwinian evolution is
based on a `one genotype one phenotype` mechanism. The
concentration of a single compartmentalised gene, or genome, drops
from 0.4 nM in a compartment of 2 .mu.m diameter, to 25 pM in a
compartment of 5 .mu.m diameter. The prokaryotic
transcription/translation machinery has evolved to operate in
compartments of 1-2 .mu.m diameter, where single genes are at
approximately nanomolar concentrations. A single gene, in a
compartment of 2.6 .mu.m diameter is at a concentration of 0.2 nM.
This gene concentration is high enough for efficient translation.
Compartmentalisation in such a volume also ensures that even if
only a single molecule of the gene product is formed it is present
at about 0.2 nM, which is important if the gene product is to have
a modifying activity of the genetic element itself. The volume of
the microcapsule is thus selected bearing in mind not only the
requirements for transcription and translation of the genetic
element, but also the modifying activity required of the gene
product in the method of the invention.
[0108] The size of emulsion microcapsules may be varied simply by
tailoring the emulsion conditions used to form the emulsion
according to requirements of the selection system. The larger the
microcapsule size, the larger is the volume that will be required
to encapsulate a given genetic element library, since the
ultimately limiting factor will be the size of the microcapsule and
thus the number of microcapsules possible per unit volume.
[0109] The size of the microcapsules is selected not only having
regard to the requirements of the transcription/translation system,
but also those of the selection system employed for the genetic
element. Thus, the components of the selection system, such as a
chemical modification system, may require reaction volumes and/or
reagent concentrations which are not optimal for
transcription/translation. As set forth herein, such requirements
may be accommodated by a secondary re-encapsulation step; moreover,
they may be accommodated by selecting the microcapsule size in
order to maximise transcription/translation and selection as a
whole. Empirical determination of optimal microcapsule volume and
reagent concentration, for example as set forth herein, is
preferred.
[0110] A "genetic element" in accordance with the present invention
is as described above. Preferably, a genetic element is a molecule
or construct selected from the group consisting of a DNA molecule,
an RNA molecule, a partially or wholly artificial nucleic acid
molecule consisting of exclusively synthetic or a mixture of
naturally-occurring and synthetic bases, any one of the foregoing
linked to a polypeptide, and any one of the foregoing linked to any
other molecular group or construct. Advantageously, the other
molecular group or construct may be selected from the group
consisting of nucleic acids, polymeric substances, particularly
beads, for example polystyrene beads, and magnetic or paramagnetic
substances such as magnetic or paramagnetic beads.
[0111] The nucleic acid portion of the genetic element may comprise
suitable regulatory sequences, such as those required for efficient
expression of the gene product, for example promoters, enhancers,
translational initiation sequences, polyadenylation sequences,
splice sites and the like.
[0112] As will be apparent from the following, in many cases the
polypeptide or other molecular group or construct is a ligand or a
substrate which directly or indirectly binds to or reacts with the
gene product in order to alter the optical properties of the
genetic element. This allows the sorting of the genetic element on
the basis of the activity of the gene product. The ligand or
substrate can be connected to the nucleic acid by a variety of
means that will be apparent to those skilled in the art (see, for
example, Hermanson, 1996).
[0113] One way in which the nucleic acid molecule may be linked to
a ligand or substrate is through biotinylation. This can be done by
PCR amplification with a 5'-biotinylation primer such that the
biotin and nucleic acid are covalently linked.
[0114] The ligand or substrate can be attached to the modified
nucleic acid by a variety of means that will be apparent to those
of skill in the art (see, for example, Hermanson, 1996). A
biotinylated nucleic acid may be coupled to a polystyrene or
paramagnetic microbead (0.02 to approx. 5.0 .mu.m in diameter) that
is coated with avidin or streptavidin, that will therefore bind the
nucleic acid with very high affinity. This bead can be derivatised
with substrate or ligand by any suitable method such as by adding
biotinylated substrate or by covalent coupling.
[0115] Alternatively, a biotinylated nucleic acid may be coupled to
avidin or streptavidin complexed to a large protein molecule such
as thyroglobulin (669 Kd) or ferritin (440 Kd). This complex can be
derivatised with substrate or ligand, for example by covalent
coupling to the .epsilon.-amino group of lysines or through a
non-covalent interaction such as biotin-avidin.
[0116] The substrate may be present in a form unlinked to the
genetic element but containing an inactive "tag" that requires a
further step to activate it such as photoactivation (e.g. of a
"caged" biotin analogue, (Sundberg et al., 1995; Pirrung and Huang,
1996)). The catalyst to be selected then converts the substrate to
product. The "tag" is then activated and the "tagged" substrate
and/or product bound by a tag-binding molecule (e.g. avidin or
streptavidin) complexed with the nucleic acid. The ratio of
substrate to product attached to the nucleic acid via the "tag"
will therefore reflect the ratio of the substrate and product in
solution.
[0117] An alternative is to couple the nucleic acid to a
product-specific antibody (or other product-specific molecule). In
this scenario, the substrate (or one of the substrates) is present
in each microcapsule unlinked to the genetic element, but has a
molecular "tag" (for example biotin, DIG or DNP or a fluorescent
group). When the catalyst to be selected converts the substrate to
product, the product retains the "tag" and is then captured in the
microcapsule by the product-specific antibody. In this way the
genetic element only becomes associated with the "tag" when it
encodes or produces an enzyme capable of converting substrate to
product.
[0118] The terms "isolating", "sorting" and "selecting", as well as
variations thereof, are used herein. Isolation, according to the
present invention, refers to the process of separating an entity
from a heterogeneous population, for example a mixture, such that
it is free of at least one substance with which it was associated
before the isolation process. In a preferred embodiment, isolation
refers to purification of an entity essentially to homogeneity.
Sorting of an entity refers to the process of preferentially
isolating desired entities over undesired entities. In as far as
this relates to isolation of the desired entities, the terms
"isolating" and "sorting" are equivalent. The method of the present
invention permits the sorting of desired genetic elements from
pools (libraries or repertoires) of genetic elements which contain
the desired genetic element. Selecting is used to refer to the
process (including the sorting process) of isolating an entity
according to a particular property thereof.
[0119] In a highly preferred application, the method of the present
invention is useful for sorting libraries of genetic elements. The
invention accordingly provides a method according to preceding
aspects of the invention, wherein the genetic elements are isolated
from a library of genetic elements encoding a repertoire of gene
products. Herein, the terms "library", "repertoire" and "pool" are
used according to their ordinary signification in the art, such
that a library of genetic elements encodes a repertoire of gene
products. In general, libraries are constructed from pools of
genetic elements and have properties which facilitate sorting.
[0120] Initial selection of a genetic element from a genetic
element library using the present invention will in most cases
require the screening of a large number of variant genetic
elements. Libraries of genetic elements can be created in a variety
of different ways, including the following.
[0121] Pools of naturally occurring genetic elements can be cloned
from genomic DNA or cDNA (Sambrook et al., 1989); for example,
phage antibody libraries, made by PCR amplification repertoires of
antibody genes from immunised or unimmunised donors have proved
very effective sources of functional antibody fragments (Winter et
al., 1994; Hoogenboom, 1997). Libraries of genes can also be made
by encoding all (see for example Smith, 1985; Parmley and Smith,
1988) or part of genes (see for example Lowman et al., 1991) or
pools of genes (see for example Nissim et al., 1994) by a
randomised or doped synthetic oligonucleotide. Libraries can also
be made by introducing mutations into a genetic element or pool of
genetic elements `randomly` by a variety of techniques in vivo,
including; using mutator strains of bacteria such as E. coli mutD5
(Liao et al., 1986; Yamagishi et al., 1990; Low et al., 1996);
using the antibody hypermutation system of B-lymphocytes (Yelamos
et al., 1995). Random mutations can also be introduced both in vivo
and in vitro by chemical mutagens, and ionising or UV irradiation
(see Friedberg et al., 1995), or incorporation of mutagenic base
analogues (Freese, 1959; Zaccolo et al., 1996). Random mutations
can also be introduced into genes in vitro during polymerisation
for example by using error-prone polymerases (Leung et al.,
1989).
[0122] Further diversification can be introduced by using
homologous recombination either in vivo (see Kowalczykowski et al.,
1994) or in vitro (Stemmer, 1994a; Stemmer, 1994b).
[0123] According to a further aspect of the present invention,
therefore, there is provided a method of in vitro evolution
comprising the steps of:
[0124] (a) selecting one or more genetic elements from a genetic
element library according to the present invention;
[0125] (b) mutating the selected genetic element(s) in order to
generate a further library of genetic elements encoding a
repertoire to gene products; and
[0126] (c) iteratively repeating steps (a) and (b) in order to
obtain a gene product with enhanced activity.
[0127] Mutations may be introduced into the genetic elements(s) as
set forth above.
[0128] The genetic elements according to the invention
advantageously encode enzymes, preferably of pharmacological or
industrial interest, activators or inhibitors, especially of
biological systems, such as cellular signal transduction
mechanisms, antibodies and fragments thereof, and other binding
agents (e.g. transcription factors) suitable for diagnostic and
therapeutic applications. In a preferred aspect, therefore, the
invention permits the identification and isolation of clinically or
industrially useful products. In a further aspect of the invention,
there is provided a product when isolated by the method of the
invention.
[0129] The selection of suitable encapsulation conditions is
desirable. Depending on the complexity and size of the library to
be screened, it may be beneficial to set up the encapsulation
procedure such that 1 or less than 1 genetic element is
encapsulated per microcapsule. This will provide the greatest power
of resolution. Where the library is larger and/or more complex,
however, this may be impracticable; it may be preferable to
encapsulate several genetic elements together and rely on repeated
application of the method of the invention to achieve sorting of
the desired activity. A combination of encapsulation procedures may
be used to obtain the desired enrichment.
[0130] Theoretical studies indicate that the larger the number of
genetic element variants created the more likely it is that a
molecule will be created with the properties desired (see Perelson
and Oster, 1979 for a description of how this applies to
repertoires of antibodies). Recently it has also been confirmed
practically that larger phage-antibody repertoires do indeed give
rise to more antibodies with better binding affinities than smaller
repertoires (Griffiths et al., 1994). To ensure that rare variants
are generated and thus are capable of being selected, a large
library size is desirable. Thus, the use of optimally small
microcapsules is beneficial.
[0131] The largest repertoire created to date using methods that
require an in vivo step (phage-display and LacI systems) has been a
1.6.times.10.sup.11 clone phage-peptide library which required the
fermentation of 15 litres of bacteria (Fisch et al., 1996). SELEX
experiments are often carried out on very large numbers of variants
(up to 10.sup.15).
[0132] Using the present invention, at a preferred microcapsule
diameter of 2.6 .mu.m, a repertoire size of at least 10.sup.11 can
be selected using 1 ml aqueous phase in a 20 ml emulsion.
[0133] In addition to the genetic elements described above, the
microcapsules according to the invention will comprise further
components required for the sorting process to take place. Other
components of the system will for example comprise those necessary
for transcription and/or translation of the genetic element. These
are selected for the requirements of a specific system from the
following; a suitable buffer, an in vitro transcription/replication
system and/or an in vitro translation system containing all the
necessary ingredients, enzymes and cofactors, RNA polymerase,
nucleotides, nucleic acids (natural or synthetic), transfer RNAs,
ribosomes and amino acids, and the substrates of the reaction of
interest in order to allow selection of the modified gene
product.
[0134] A suitable buffer will be one in which all of the desired
components of the biological system are active and will therefore
depend upon the requirements of each specific reaction system.
Buffers suitable for biological and/or chemical reactions are known
in the art and recipes provided in various laboratory texts, such
as Sambrook et al., 1989.
[0135] The in vitro translation system will usually comprise a cell
extract, typically from bacteria (Zubay, 1973; Zubay, 1980; Lesley
et al., 1991; Lesley, 1995), rabbit reticulocytes (Pelham and
Jackson, 1976), or wheat germ (Anderson et al., 1983). Many
suitable systems are commercially available (for example from
Promega) including some which will allow coupled
transcription/translation (all the bacterial systems and the
reticulocyte and wheat germ TNT.TM. extract systems from Promega).
The mixture of amino acids used may include synthetic amino acids
if desired, to increase the possible number or variety of proteins
produced in the library. This can be accomplished by charging tRNAs
with artificial amino acids and using these tRNAs for the in vitro
translation of the proteins to be selected (Ellman et al., 1991;
Benner, 1994; Mendel et al., 1995).
[0136] After each round of selection the enrichment of the pool of
genetic elements for those encoding the molecules of interest can
be assayed by non-compartmentalised in vitro
transcription/replication or coupled transcription-translation
reactions. The selected pool is cloned into a suitable plasmid
vector and RNA or recombinant protein is produced from the
individual clones for further purification and assay.
[0137] In a preferred aspect, the internal environment of a
microcapsule may be altered by addition of reagents to the oil
phase of the emulsion. The reagents diffuse through the oil phase
to the aqueous microcapsule environment. Preferably, the reagents
are at least partly water-soluble, such that a proportion thereof
is distributed from the oil phase to the aqueous microcapsule
environment. Advantageously, the reagents are substantially
insoluble in the oil phase. Reagents are preferably mixed into the
oil phase by mechanical mixing, for example vortexing.
[0138] The reagents which may be added via the oil phase include
substrates, buffering components, factors and the like. In
particular, the internal pH of microcapsules may be altered in situ
by adding acidic or basic components to the oil phase.
[0139] The invention moreover relates to a method for producing a
gene product, once a genetic element encoding the gene product has
been sorted by the method of the invention. Clearly, the genetic
element itself may be directly expressed by conventional means to
produce the gene product. However, alternative techniques may be
employed, as will be apparent to those skilled in the art. For
example, the genetic information incorporated in the gene product
may be incorporated into a suitable expression vector, and
expressed therefrom.
[0140] The invention also describes the use of conventional
screening techniques to identify compounds which are capable of
interacting with the gene products identified by the first aspect
of the invention. In preferred embodiments, gene product encoding
nucleic acid is incorporated into a vector, and introduced into
suitable host cells to produce transformed cell lines that express
the gene product. The resulting cell lines can then be produced for
reproducible qualitative and/or quantitative analysis of the
effect(s) of potential drugs affecting gene product function. Thus
gene product expressing cells may be employed for the
identification of compounds, particularly small molecular weight
compounds, which modulate (i.e., increase or decrease by at least
10% relative to a sample without a test compound) the function of
gene product. Thus host cells expressing gene product are useful
for drug screening and it is a further object of the present
invention to provide a method for identifying compounds which
modulate the activity of the gene product, said method comprising
exposing cells containing heterologous DNA encoding gene product,
wherein said cells produce functional gene product, to at least one
compound or mixture of compounds or signal whose ability to
modulate the activity of said gene product is sought to be
determined, and thereafter monitoring said cells for changes caused
by said modulation. Such an assay enables the identification of
modulators, such as agonists, antagonists and allosteric
modulators, of the gene product. As used herein, a compound or
signal that modulates the activity of gene product refers to a
compound that alters the activity of gene product in such a way
that the activity of the gene product is different in the presence
of the compound or signal (as compared to the absence of said
compound or signal).
[0141] Cell-based screening assays can be designed by constructing
cell lines in which the expression of a reporter protein, i.e. an
easily assayable protein, such as .beta.-galactosidase,
chloramphenicol acetyltransferase (CAT), green fluorescent protein
(GFP) or luciferase, is dependent on gene product. Such an assay
enables the detection of compounds that directly modulate gene
product function, such as compounds that antagonise gene product,
or compounds that inhibit or potentiate other cellular functions
required for the activity of gene product.
[0142] The present invention also provides a method to exogenously
affect gene product dependent processes occurring in cells.
Recombinant gene product producing host cells, e.g. mammalian
cells, can be contacted with a test compound, and the modulating
effect(s) thereof can then be evaluated by comparing the gene
product-mediated response in the presence and absence of test
compound, or relating the gene product-mediated response of test
cells, or control cells (i.e., cells that do not express gene
product), to the presence of the compound.
[0143] In a further aspect, the invention relates to a method for
optimising a production process which involves at least one step
which is facilitated by a polypeptide. For example, the step may be
a catalytic step, which is facilitated by an enzyme. Thus, the
invention provides a method for preparing a compound or compounds
comprising the steps of:
[0144] (a) providing a synthesis protocol wherein at least one step
is facilitated by a polypeptide;
[0145] (b) preparing genetic elements encoding variants of the
polypeptide which facilitates this step, the expression of which
may result, directly or indirectly, in the modification of the
optical properties of the genetic elements;
[0146] (c) compartmentalising genetic elements into
microcapsules;
[0147] (d) expressing the genetic elements to produce their
respective gene products within the microcapsules;
[0148] (e) sorting the genetic elements which produce polypeptide
gene product(s) having the desired activity using the changed
optical properties of the genetic elements; and
[0149] (f) preparing the compound or compounds using the
polypeptide gene product identified in
[0150] (g) to facilitate the relevant step of the synthesis.
[0151] By means of the invention, enzymes involved in the
preparation of a compound may be optimised by selection for optimal
activity. The procedure involves the preparation of variants of the
polypeptide to be screened, which equate to a library of
polypeptides as refereed to herein. The variants may be prepared in
the same manner as the libraries discussed elsewhere herein.
[0152] (B) Selection Procedures
[0153] The system can be configured to select for RNA, DNA or
protein gene product molecules with catalytic, regulatory or
binding activity.
[0154] (i) Selection for Binding
[0155] In the case of selection for a gene product with affinity
for a specific ligand the genetic element may be linked to the gene
product in the microcapsule via the ligand. Only gene products with
affinity for the ligand will therefore bind to the genetic element
and only those genetic elements with gene product bound via the
ligand will acquire the changed optical properties which enable
them to be retained in the selection step. In this embodiment, the
genetic element will thus comprise a nucleic acid encoding the gene
product linked to a ligand for the gene product.
[0156] The change in optical properties of the genetic element
after binding of the gene product to the ligand may be induced in a
variety of ways, including:
[0157] (1) the gene product itself may have distinctive optical
properties, for example, it is fluorescent (e.g. green fluorescent
protein, (Lorenz et al., 1991)).
[0158] (2) the optical properties of the gene product may be
modified on binding to the ligand, for example, the fluorescence of
the gene product is quenched or enhanced on binding (Guixe et al.,
1998; Qi and Grabowski, 1998)
[0159] (3) the optical properties of the ligand may be modified on
binding of the gene product, for example, the fluorescence of the
ligand is quenched or enhanced on binding (Voss, 1993; Masui and
Kuramitsu, 1998).
[0160] (4) the optical properties of both ligand and gene product
are modified on binding, for example, there can be a fluorescence
resonance energy transfer (FRET) from ligand to gene product (or
vice versa) resulting in emmission at the "acceptor" emmission
wavelength when excitation is at the "donor" absoption wavelength
(Heim & Tsien, 1996; Mahajan et al., 1998; Miyawaki et al.,
1997).
[0161] In this embodiment, it is not necessary for binding of the
gene product to the genetic element via the ligand to directly
induce a change in optical properties. All the gene products to be
selected can contain a putative binding domain, which is to be
selected for, and a common feature a tag. The genetic element in
each microcapsule is physically linked to the ligand. If the gene
product produced from the genetic element has affinity for the
ligand, it will bind to it and become physically linked to the same
genetic element that encoded it, resulting in the genetic element
being `tagged`. At the end of the reaction, all of the
microcapsules are combined, and all genetic elements and gene
products pooled together in one environment. Genetic elements
encoding gene products exhibiting the desired binding can be
selected by adding reagents which specifically bind to, or react
specifically with, the "tag" and thereby induce a change in the
optical properties of the genetic element allowing there sorting.
For example, a fluorescently-labelled anti-"tag" antibody can be
used, or an anti-"tag" antibody followed by a second fluorescently
labelled antibody which binds the first.
[0162] In an alternative embodiment, genetic elements may be sorted
on the basis that the gene product, which binds to the ligand,
merely hides the ligand from, for example, further binding partners
which would otherwise modify the optical properties of the genetic
element. In this case genetic elements with unmodified optical
properties would be selected.
[0163] In an alternative embodiment, the invention provides a
method according to the first aspect of the invention, wherein in
step (b) the gene products bind to genetic elements encoding them.
The gene products together with the attached genetic elements are
then sorted as a result of binding of a ligand to gene products
having the desired binding activity. For example, all gene products
can contain an invariant region which binds covalently or
non-covalently to the genetic element, and a second region which is
diversified so as to generate the desired binding activity.
[0164] In an alternative embodiment, the ligand for the gene
product is itself encoded by the genetic element and binds to the
genetic element. Stated otherwise, the genetic element encodes two
(or indeed more) gene products, at least one of which binds to the
genetic element, and which can potentially bind each other. Only
when the gene products interact in a microcapsule is the genetic
element modified in a way that ultimately results in a change in a
change in its optical properties that enables it to be sorted. This
embodiment, for example, isused to search gene libraries for pairs
of genes encoding pairs of proteins which bind each other.
[0165] Fluorescence may be enhanced by the use of Tyramide Signal
Amplification (TSA.TM.) amplification to make the genetic elements
fluorescent. This involves peroxidase (linked to another protein)
binding to the genetic elements and catalysing the conversion of
fluorescein-tyramine in to a free radical form which then reacts
(locally) with the genetic elements. Methods for performing TSA are
known in the art, and kits are available commercially from NEN.
[0166] TSA may be configured such that it results in a direct
increase in the fluorescence of the genetic element, or such that a
ligand is attached to the genetic element which is bound by a
second fluorescent molecule, or a sequence of molecules, one or
more of which is fluorescent.
[0167] (ii) Selection for Catalysis
[0168] When selection is for catalysis, the genetic element in each
microcapsule may comprise the substrate of the reaction. If the
genetic element encodes a gene product capable of acting as a
catalyst, the gene product will catalyse the conversion of the
substrate into the product. Therefore, at the end of the reaction
the genetic element is physically linked to the product of the
catalysed reaction.
[0169] It may also be desirable, in some cases, for the substrate
not to be a component of the genetic element. In this case the
substrate would contain an inactive "tag" that requires a further
step to activate it such as photoactivation (e.g. of a "caged"
biotin analogue, (Sundberg et al., 1995; Pirrung and Huang, 1996)).
The catalyst to be selected then converts the substrate to product.
The "tag" is then activated and the "tagged" substrate and/or
product bound by a tag-binding molecule (e.g. avidin or
streptavidin) complexed with the nucleic acid. The ratio of
substrate to product attached to the nucleic acid via the "tag"
will therefore reflect the ratio of the substrate and product in
solution.
[0170] The optical properties of genetic elements with product
attached and which encode gene products with the desired catalytic
activity can be modified by either:
[0171] (1) the product-genetic element complex having
characteristic optical properties not found in the
substrate-genetic element complex, due to, for example;
[0172] (a) the substrate and product having different optical
properties (many fluorogenic enzyme substrates are available
commercially (see for example Haugland, 1996) including substrates
for glycosidases, phosphatases, peptidases and proteases (Craig et
al., 1995; Huang et al., 1992; Brynes et al., 1982; Jones et al.,
1997; Matayoshi et al., 1990; Wang et al., 1990)), or
[0173] (b) the substrate and product having similar optical
properties (i.e., measurable parameters of one or more optical
properties are within 5% of each other), but only the product, and
not the substrate binds to, or reacts with, the genetic
element;
[0174] (2) adding reagents which specifically bind to, or react
with, the product and which thereby induce a change in the optical
properties of the genetic elements allowing their sorting (these
reagents can be added before or after breaking the microcapsules
and pooling the genetic elements). The reagents;
[0175] (a) bind specifically to, or react specifically with, the
product, and not the substrate, if both substrate and product are
attached to the genetic element, or
[0176] (b) optionally bind both substrate and product if only the
product, and not the substrate binds to, or reacts with, the
genetic element.
[0177] The pooled genetic elements encoding catalytic molecules can
then be enriched by selecting for the genetic elements with
modified optical properties.
[0178] An alternative is to couple the nucleic acid to a
product-specific antibody (or other product-specific molecule). In
this scenario, the substrate (or one of the substrates) is present
in each microcapsule unlinked to the genetic element, but has a
molecular "tag" (for example biotin, DIG or DNP or a fluorescent
group). When the catalyst to be selected converts the substrate to
product, the product retains the "tag" and is then captured in the
microcapsule by the product-specific antibody. In this way the
genetic element only becomes associated with the "tag" when it
encodes or produces an enzyme capable of converting substrate to
product. When all reactions are stopped and the microcapsules are
combined, the genetic elements encoding active enzymes will be
"tagged" and may already have changed optical properties, for
example, if the "tag" was a fluorescent group. Alternatively, a
change in optical properties of "tagged" genes can be induced by
adding a fluorescently labelled ligand which binds the "tag" (for
example fluorescently-labelled avidin/streptavidin, an anti-"tag"
antibody which is fluorescent, or a non-fluorescent anti-"tag"
antibody which can be detected by a second fluorescently-labelled
antibody).
[0179] Alternatively, selection may be performed indirectly by
coupling a first reaction to subsequent reactions that takes place
in the same microcapsule. There are two general ways in which this
may be performed. In a first embodiment, the product of the first
reaction is reacted with, or bound by, a molecule which does not
react with the substrate of the first reaction. A second, coupled
reaction will only proceed in the presence of the product of the
first reaction. A genetic element encoding a gene product with a
desired activity can then be purified by using the properties of
the product of the second reaction to induce a change in the
optical properties of the genetic element as above.
[0180] Alternatively, the product of the reaction being selected
may be the substrate or cofactor for a second enzyme-catalysed
reaction. The enzyme to catalyse the second reaction can either be
translated in situ in the microcapsules or incorporated in the
reaction mixture prior to microencapsulation. Only when the first
reaction proceeds will the coupled enzyme generate a product which
can be used to induce a change in the optical properties of the
genetic element as above.
[0181] This concept of coupling can be elaborated to incorporate
multiple enzymes, each using as a substrate the product of the
previous reaction. This allows for selection of enzymes that will
not react with an immobilised substrate. It can also be designed to
give increased sensitivity by signal amplification if a product of
one reaction is a catalyst or a cofactor for a second reaction or
series of reactions leading to a selectable product (for example,
see Johannsson and Bates, 1988; Johannsson, 1991). Furthermore an
enzyme cascade system can be based on the production of an
activator for an enzyme or the destruction of an enzyme inhibitor
(see Mize et al., 1989). Coupling also has the advantage that a
common selection system can be used for a whole group of enzymes
which generate the same product and allows for the selection of
complicated chemical transformations that cannot be performed in a
single step.
[0182] Such a method of coupling thus enables the evolution of
novel "metabolic pathways" in vitro in a stepwise fashion,
selecting and improving first one step and then the next. The
selection strategy is based on the final product of the pathway, so
that all earlier steps can be evolved independently or sequentially
without setting up a new selection system for each step of the
reaction.
[0183] Expressed in an alternative manner, there is provided a
method of isolating one or more genetic elements encoding a gene
product having a desired catalytic activity, comprising the steps
of:
[0184] (1) expressing genetic elements to give their respective
gene products;
[0185] (2) allowing the gene products to catalyse conversion of a
substrate to a product, which may or may not be directly
selectable, in accordance with the desired activity;
[0186] (3) optionally coupling the first reaction to one or more
subsequent reactions, each reaction being modulated by the product
of the previous reactions, and leading to the creation of a final,
selectable product;
[0187] (4) linking the selectable product of catalysis to the
genetic elements by either:
[0188] a) coupling a substrate to the genetic elements in such a
way that the product remains associated with the genetic elements,
or
[0189] b) reacting or binding the selectable product to the genetic
elements by way of a suitable molecular "tag" attached to the
substrate which remains on the product, or
[0190] c) coupling the selectable product (but not the substrate)
to the genetic elements by means of a product-specific reaction or
interaction with the product; and
[0191] (5) selecting the product of catalysis, together with the
genetic element to which it is bound, either by means of its
characteristic optical properties, or by adding reagents which
specifically bind to, or react specifically with, the product and
which thereby induce a change in the optical properties of the
genetic elements wherein steps (1) to (4) each genetic element and
respective gene product is contained within a microcapsule.
[0192] (iii) Selecting for Enzyme Substrate
Specificity/Selectivity
[0193] Genetic elements encoding enzymes with substrate specificity
or selectivity can be specifically enriched by carrying out a
positive selection for reaction with one substrate and a negative
selection for reaction with another substrate. Such combined
positive and negative selection pressure can improve (i.e.,
increase by at least 10%) the specificity or selectivity of the
enzyme for a given substrate, and should be of great importance in
isolating regio-selective and stereo-selective enzymes (for
example, enzymes that can distinguish between two enantiomers of
the same substrate). For example, two substrates (e.g. two
different enantiomers) are each labelled with different tags (e.g.
two different fluorophores) such that the tags become attached to
the genetic element by the enzyme-catalysed reaction. If the two
tags confer different optical properties on the genetic element the
substrate specificity of the enzyme can be determined from the
optical properties of the genetic element and those genetic
elements encoding gene products with the wrong (or no) specificity
rejected. Tags conferring no change in optical activity can also be
used if tag-specific ligands with different optical properties are
added (e.g. tag-specific antibodies labelled with different
fluorophores).
[0194] (iv) Selection for Regulation
[0195] A similar system can be used to select for regulatory
properties of enzymes.
[0196] In the case of selection for a regulator molecule which acts
as an activator or inhibitor of a biochemical process, the
components of the biochemical process can either be translated in
situ in each microcapsule or can be incorporated in the reaction
mixture prior to microencapsulation. If the genetic element being
selected is to encode an activator, selection can be performed for
the product of the regulated reaction, as described above in
connection with catalysis. If an inhibitor is desired, selection
can be for a chemical property specific to the substrate of the
regulated reaction.
[0197] There is therefore provided a method of sorting one or more
genetic elements coding for a gene product exhibiting a desired
regulatory activity, comprising the steps of:
[0198] (1) expressing genetic elements to give their respective
gene products;
[0199] (2) allowing the gene products to activate or inhibit a
biochemical reaction, or sequence of coupled reactions, in
accordance with the desired activity, in such a way as to allow the
generation or survival of a selectable molecule;
[0200] (3) linking the selectable molecule to the genetic elements
either by
[0201] a) having the selectable molecule, or the substrate from
which it derives, attached to the genetic elements, or
[0202] b) reacting or binding the selectable product to the genetic
elements, by way of a suitable molecular "tag" attached to the
substrate which remains on the product, or
[0203] c) coupling the product of catalysis (but not the substrate)
to the genetic elements, by means of a product-specific reaction or
interaction with the product;
[0204] (4) selecting the selectable product, together with the
genetic element to which it is bound, either by means of its
characteristic optical properties, or by adding reagents which
specifically bind to, or react specifically with, the product and
which thereby induce a change in the optical properties of the
genetic elements wherein steps (1) to (3) each genetic element and
respective gene product is contained within a microcapsule.
[0205] (v) Selection for Optical Properties of the Gene Product
[0206] It is possible to select for inherent optical properties of
gene products if, in the microcapsules, the gene product binds back
to the genetic element, for example through a common element of the
gene product which binds to a ligand which is part of the genetic
element. After pooling the genetic elements they can then be sorted
using the optical properties of the bound gene products. This
embodiment can be used, for example, to select variants of green
fluorescent protein (GFP) (Cormack et al., 1996; Delagrave et al.,
1995; Ehrig et al., 1995), with improved fluorescence and/or novel
absoption and emmission spectra.
[0207] (vi) Flow Sorting of Genetic Elements
[0208] In a preferred embodiment of the invention the genetic
elements will be sorted by flow cytometry. A variety of optical
properties can be used to trigger sorting, including light
scattering (Kerker, 1983) and fluorescence polarisation (Rolland et
al., 1985). In a highly preferred embodiment the difference in
optical properties of the genetic elements will be a difference in
fluorescence and the genetic elements will be sorted using a
fluorescence activated cell sorter (Norman, 1980; Mackenzie and
Pinder, 1986), or similar device. In an especially preferred
embodiment the genetic element comprises of a nonfluorescent
nonmagnetic (e.g. polystyrene) or paramagnetic microbead (see
Fornusek and Vetvicka, 1986), optimally 0.6 to 1.0 .mu.m diameter,
to which are attached both the gene and the groups involved in
generating a fluorescent signal:
[0209] (1) commercially available fluorescence activated cell
sorting equipment from established manufacturers (e.g.
Becton-Dickinson, Coulter) allows the sorting of up to 10.sup.8
genetic elements (events) per hour;
[0210] (2) the fluorescence signal from each bead corresponds
tightly to the number of fluorescent molecules attached to the
bead. At present as little as few hundred fluorescent molecules per
particle can be quantitatively detected;
[0211] (3) the wide dynamic range of the fluorescence detectors
(typically 4 log units) allows easy setting of the stringency of
the sorting procedure, thus allowing the recovery of the optimal
number of genetic elements from the starting pool (the gates can be
set to separate beads with small differences in fluorescence or to
only separate out beads with large differences in fluorescence,
dependant on the selection being performed;
[0212] (4) commercially available fluorescence-activated cell
sorting equipment can perform simultaneous excitation at up to two
different wavelengths and detect fluorescence at up to four
different wavelengths (Shapiro, 1983) allowing positive and
negative selections to be performed simultaneously by monitoring
the labelling of the genetic element with two (or more) different
fluorescent markers, for example, if two alternative substrates for
an enzyme (e.g. two different enantiomers) are labelled with
different fluorescent tags the genetic element can labelled with
different fluorophores dependent on the substrate used and only
genes encoding enzymes with enantioselectivity selected.
[0213] (5) highly uniform derivatised and non-derivatised
nonmagnetic and paramagnetic microparticles (beads) are
commercially available from many sources (e.g. Sigma, and Molecular
Probes) (Fornusek and Vetvicka, 11986).
[0214] (vii) Multi-Step Procedure
[0215] It will be also be appreciated that according to the present
invention, it is not necessary for all the processes of
transcription/replication and/or translation, and selection to
proceed in one single step, with all reactions taking place in one
microcapsule. The selection procedure may comprise two or more
steps. First, transcription/replication and/or translation of each
genetic element of a genetic element library may take place in a
first microcapsule. Each gene product is then linked to the genetic
element which encoded it (which resides in the same microcapsule),
for example via a gene product-specific ligand such as an antibody.
The microcapsules are then broken, and the genetic elements
attached to their respective gene products optionally purified.
Alternatively, genetic elements can be attached to their respective
gene products using methods which do not rely on encapsulation. For
example phage display (Smith, G. P., 1985), polysome display
(Mattheakkis et al., 1994), RNA-peptide fusion (Roberts and
Szostak, 1997) or lac repressor peptide fusion (Cull, et al.,
1992).
[0216] In the second step of the procedure, each purified genetic
element attached to its gene product is put into a second
microcapsule containing components of the reaction to be selected.
This reaction is then initiated. After completion of the reactions,
the microcapsules are again broken and the modified genetic
elements are selected. In the case of complicated multistep
reactions in which many individual components and reaction steps
are involved, one or more intervening steps may be performed
between the initial step of creation and linking of gene product to
genetic element, and the final step of generating the selectable
change in the genetic element.
[0217] If necessary, release of the gene product from the genetic
element within a secondary microcapsule can be achieved in a
variety of ways, including by specific competition by a
low-molecular weight product for the binding site or cleavage of a
linker region joining the binding domain of the gene product from
the catalytic domain either enzymatically (using specific
proteases) or autocatalytically (using an integrin domain).
[0218] (viii) Selection by Activation of Reporter Gene Expression
In Situ
[0219] The system can be configured such that the desired binding,
catalytic or regulatory activity encoded by a genetic element
leads, directly or indirectly to the activation of expression of a
"reporter gene" that is present in all microcapsules. Only gene
products with the desired activity activate expression of the
reporter gene. The activity resulting from reporter gene expression
allows the selection of the genetic element (or of the compartment
containing it) by any of the methods described herein.
[0220] For example, activation of the reporter gene may be the
result of a binding activity of the gene product in a manner
analogous to the "two hybrid system" (Fields and Song, 1989).
Activation can also result from the product of a reaction catalysed
by a desirable gene product. For example, the reaction product can
be a transcriptional inducer of the reporter gene. For example
arabinose may be used to induce transcription from the araBAD
promoter. The activity of the desirable gene product can also
result in the modification of a transcription factor, resulting in
expression of the reporter gene. For example, if the desired gene
product is a kinase or phosphatase the phosphorylation or
dephosphorylation of a transcription factor may lead to activation
of reporter gene expression.
[0221] (ix) Amplification
[0222] According to a further aspect of the present invention the
method comprises the further step of amplifying the genetic
elements. Selective amplification may be used as a means to enrich
for genetic elements encoding the desired gene product.
[0223] In all the above configurations, genetic material comprised
in the genetic elements may be amplified and the process repeated
in iterative steps. Amplification may be by the polymerase chain
reaction (Saiki et al., 1988) or by using one of a variety of other
gene amplification techniques including; Qb replicase amplification
(Cahill, Foster and Mahan, 1991; Chetverin and Spirin, 1995;
Katanaev, Kurnasov and Spirin, 1995); the ligase chain reaction
(LCR) (Landegren et al., 1988; Barany, 1991); the self-sustained
sequence replication system (Fahy, Kwoh and Gingeras, 1991) and
strand displacement amplification (Walker et al., 1992).
[0224] Various aspects and embodiments of the present invention are
illustrated in the following examples. It will be appreciated that
modification of detail may be made without departing from the scope
of the invention.
[0225] All documents mentioned in the text are incorporated by
reference.
EXAMPLES
Example 1
[0226] Enzymes can be expressed from genes in solution and genes
attached to paramagnetic microbeads with identical efficiency.
[0227] One format for the selection of genetic elements by using a
change in their optical properties is one in which the genetic
element comprises a microbead to which the gene is attached. Here
it is shown how a gene for an enzyme (E. coli dihydrofolate
reductase) can be linked to a paramagnetic bead and is translated
in vitro just as efficiently as in solution.
[0228] The E. coli folA gene encoding dihydrofolate reductase
(DHFR) is PCR-amplified using oligonucleotides EDHFRFo and EDHFRBa.
This DNA is then cloned into the pGEM-4Z vector (Promega) digested
with HindIII and KpnI downstream of the lac promoter and the T7 RNA
polymerase promoter. The oligonucleotide EDHFRBa appends the
efficient phage T7 gene 10 translational start site upstream of the
DHFR start codon.
[0229] DNA sequencing identifies a clone which has the correct
nucleotide sequence. Bacteria transformed with this clone
(pGEM-folA) are found to over-express active DHFR (driven from the
lac promoter) when induced with IPTG.
[0230] The folA gene in pGEM-folA plasmid is then PCR-amplified
using primers folA-FW and folA-BW, the resulting DNA fragment in
HindIII and XhoI digested and subcloned into HindIII/XhoI-digested
pET23a expression vector (Novagen) to give construct pET23a/folA.
The sequence of PCR-amplified folA gene was verified by
sequencing.
[0231] pET23a/folA was further amplified with 5'-biotinylated
primers pETfor.b and pETrev.b and radio-labelled by including 10
.mu.Ci .alpha..sup.35S-dATP (Amersham Pharmacia Biotech, U.K.) in
the PCR mix. The resulting 1765 bp double biotinylated fragment
T7-folA was gel purified using a Qiagen kit and quantified
spectrophotometrically. The specific activity of the product was
210000 CPM/pmol T7-folA DNA, as measured on the Beckman LS6000SC
scintillation counter. 10 nM and 1 nM dilutions of this DNA were
made in 1 mg/ml HindIII digested lambda DNA to eliminate
non-specific binding to the plastic.). This PCR fragment was used
thereafter to program a prokaryotic in vitro coupled
transcription/translation system designed for linear templates
(Lesley, Brow and Burgess, 1991). A commercial preparation of this
system is used (E. coli S30 Extract System for Linear Templates;
Promega) supplemented with T7 RNA polymerase (10.sup.3 units).
[0232] The DNA fragment is bound to streptavidin-paramagnetic beads
(0.74 .mu.m diameter Sera-Mag beads, biotin-binding capacity
46mmol/mg, Seradyn, USA), partially precoated with biotinylated
protein A (Sigma). 2 .mu.l of 80 .mu.M biotinylated protein A is
added to 100 .mu.l (1 mg) beads, allowed to bind at room
temperature for 1 hour, washed once and coated for one hour at room
temperature with rabbit IgG (10 .mu.l 1 mg/ml antibody per 1 mg
beads in TBS/0.1% Tween-20 (TBST)). Beads were thereafter washed
twice with TBS/T before radiolabeled biotinylated T7-folA DNA was
added and allowed to bind for 1 hour at room temperature. The
amount of bound T7-folA DNA was calculated by counting the
radioactivity bound to an aliquot of beads. .about.50% of the total
DNA was bound.
[0233] DNA fragments bound on beads or unbound DNA fragment are
added directly to the S30 Extract System. Reactions are incubated
for 2 hours at 37.degree. C.
[0234] Dihydrofolate reductase activity is assayed by
spectrophotometrically monitoring the oxidation of NADPH to NADP at
340 nm over a 10 minute time course as described by (Williams et
al., 1979; Ma et al., 1993). 2 .mu.l of each quenched in vitro
translation reaction is added to 150 .mu.l Buffer A (100 mM
Imidazole, pH 7.0, 10 mM .beta.-mercaptoethanol) and 20 .mu.l 1 mM
NADPH. 20 .mu.l dihydrofolate (1 mM)(H.sub.2F) is added after 1
minute and the reaction monitored at 340 nm using a ThermoMax
microplate reader (Molecular Devices). Activity is calculated by
initial velocities under So>>K.sub.M conditions
(.upsilon.max).
[0235] There is no significant difference in the amount of active
DHFR produced if the DNA is free, or attached via terminal biotins
to a streptavidin coated bead (see FIG. 1).
Example 2
[0236] A fluorescent protein (GFP) can be translated in vitro from
genes attached to single microbeads encapsulated in the aqueous
compartments of a water-in-oil emulsion and the translated
gene-product bound back to the microbeads making them
fluorescent.
[0237] One format for the selection of genetic elements is where
the genetic element comprises a gene linked to a microbead and the
product is coupled back onto the microbead within the microcapsule
resulting directly, or indirectly, in a change in the optical
properties of the microbead which allows it to be sorted.
[0238] Here it is shown that a fluorescent protein (green
fluorescent protein or GFP) can be transcribed and translated in
vitro from genes attached to single microbeads encapsulated in the
aqueous compartments of a water-in-oil emulsion and the translated
gene-product bound back the microbeads making them fluorescent.
[0239] The GFP in pBS/GFP6 plasmid (Siemering et al., 1996) was
PCR-amplified using primers GFP-FW and GFP-BW, the resulting DNA
fragment in HindIII and XhoI digested and subcloned into
HindIII/XhoI-digested pET23a expression vector (Novagen) to give
construct pET23a/GFP. The sequence of PCR-amplified GFP gene was
verified by sequencing pET23a/GFP was further amplified with
5'-biotinylated primers pETfor.b and pETrev.b. The resulting 2038
bp double biotinylated fragment T7-GFP was gel purified using a
Qiagen kit and quantified spectrophotometrically. 10 nM and 1 nM
dilutions of this DNA were made in 1 mg/ml HindIII digested lambda
DNA to eliminate non-specific binding to the plastic.). This PCR
fragment was used thereafter to program a prokaryotic in vitro
coupled transcription/translation system designed for linear
templates (Lesley, Brow and Burgess, 1991). A commercial
preparation of this system is used (E. coli S30 Extract System for
Linear Templates; Promega) supplemented with T7 RNA polymerase
(10.sup.3 units).
[0240] As a control, a biotinylated 1765 bp DNA fragment T7-folA
(synthesised by PCR as in example 1) was used to program the
synthesis of the non-fluorescent protein DHFR.
[0241] 150 .mu.l ProActive streptavidin-coated paramagnetic beads
(Bangs Laboratories, 2.times.10.sup.7 beads/.mu.l) were suspended
in 5 mM Tris 7.4/1M NaCl/0.1% Tween20 and split into three aliquots
of 50 .mu.l. 0.5 .mu.l of 0.2 .mu.M DNA (T7-folA or T7-GFP) was
added to each aliquot of beads, incubated at 43.degree. C. for 15
min, washed three times in 25 mM NaH.sub.2PO.sub.4, 125 mM NaCl,
0.1% Tween20, pH 7.0 (PBS/0.1% Tween20), resuspended in 40 .mu.l
TBST and 10 .mu.l 80 .mu.M biotinylated protein A (Sigma) was added
(to give final concentration of 15 .mu.M). After incubation for 30
minutes at room temperature, the beads were washed three times in
PBS/0.1% Tween20 and resuspended in 20 .mu.l 1:10 dilution rabbit
anti-GFP polyclonal antibody (Clontech) or 1 mg/ml unimmunised
rabbit IgG (Sigma). After incubation for 30 minutes at room
temperature, the beads were washed three times in PBS/0.1% Tween20
and resuspended in 15 .mu.l of S30 premix from an E: coli S30
Extract System for Linear Templates (Promega), sonicated for one
minute in a sonication bath, then the rest of the S30 in vitro
translation mixture was added (on ice) and supplemented with T7 RNA
polymerase (103 units).
[0242] The 50 .mu.l ice-cooled in vitro translation reactions were
added gradually (in 5 aliquots of 10 .mu.l over .about.2 minutes)
to 0.95 ml of ice-cooled oil-phase (freshly prepared by dissolving
4.5% (v/v) Span 80 (Fluka) in mineral oil (Sigma, #M-5904) followed
by 0.5% (v/v) Tween 80 (SigmaUltra; #P-8074) in a 5 ml Costar
Biofreeze Vial (#2051)) whilst stirring with a magnetic bar
(8.times.3 mm with a pivot ring; Scientific Industries
International, Loughborough, UK). Stirring (at 1150 rpm) was
continued for an additional 3 minutes on ice. Reactions were then
incubated 3 h at 32.degree. C.
[0243] 2 .mu.l of emulsion were spread on a microscope slide
beneath a 13 mm round cover slip and visualised using a 20.times.
Neofluar objective on an Axioplan microscope (Zeiss) equipped with
an RTEA CCD-1300-Y CCD camera (Princeton Instruments). Standard
excitation and emission filters for fluorescein were used and
images were processed with IPLab software.
[0244] As can be seen from FIG. 2 the GFP translated from genes
attached to single microbeads encapsulated in the aqueous
compartments of the emulsions is bound to the microbeads in situ
when the microbeads are coated with an anti-GFP antibody. This
binding is observed as concentration of fluorescence on the beads
by epifluorescence microscopy. No bead fluorescence is observed
when either the GFP gene or the anti-GFP antibody are missing.
Example 3
[0245] A fluorescent protein (GFP) can be translated in vitro from
genes attached to single microbeads encapsulated in the aqueous
compartments of a water-in-oil emulsion, the translated
gene-product bound back the microbeads and the increased
fluorescence of the microbeads detected by flow cytometry.
[0246] 150 .mu.l streptavidin-coated polystyrene beads (diameter 1
.mu.M; Bangs Laboratories, 2.times.10.sup.7 beads/.mu.l) were
suspended in 5 mM Tris 7.4/1M NaCl/0.1% Tween20 and split into
three aliquots of 50 .mu.l. 0.5 .mu.l of 0.2 .mu.M DNA (T7-folA or
T7-GFP) was added to each aliquot of beads, incubated at 43.degree.
C. for 15 min, washed three times in 25 mM NaH.sub.2PO.sub.4, 125
mM NaCl, 0.1% Tween20, pH 7.0 (PBS/0.1% Tween20), resuspended in 40
.mu.l TBST and 10 .mu.l 80 .mu.M biotinylated protein A (Sigma) was
added (to give final concentration of 15 .mu.M). After incubation
for 30 minutes at room temperature, the beads were washed three
times in PBS/0.1% Tween20 and resuspended in 20 .mu.l 1:10 dilution
rabbit anti-GFP polyclonal antibody (Clontech) or 1 mg/ml
unimmunised rabbit IgG (Sigma). After incubation for 30 minutes at
room temperature, the beads were washed three times in PBS/0.1%
Tween20 and resuspended in 15 .mu.l of S30 premix from an E. coli
S30 Extract System for Linear Templates (Promega), sonicated for
one minute in a sonication bath, then the rest of the S30 in vitro
translation mixture was added (on ice) and supplemented with T7 RNA
polymerase (10.sup.3 units). The 50 .mu.l ice-cooled in vitro
translation reactions were added gradually (in 5 aliquots of 10
.mu.l over .about.2 minutes) to 0.95 ml of ice-cooled oil-phase
(freshly prepared by dissolving 4.5% (v/v) Span 80 (Fluka) in
mineral oil (Sigma, #M-5904) followed by 0.5% (v/v) Tween 80
(SigmaUltra; #P-8074) in a 5 ml Costar Biofreeze Vial (#2051))
whilst stirring with a magnetic bar (8.times.3 mm with a pivot
ring; Scientific Industries International, Loughborough, UK).
Stirring (at 1150 rpm) was continued for an additional 3 minutes on
ice. Reactions were then incubated 3 h at 32.degree. C. To recover
the reaction mixtures, the emulsions were spun at 3,000 g for. 5
minutes and the oil phase removed leaving the concentrated (but
still intact) emulsion at the bottom of the vial. PBS and 2 ml of
water-saturated ether were added and the mixture was vortexed,
centrifuged briefly, and the ether phase removed. Beads were washed
twice with PBS and finally resuspended at 10.sup.8 beads/ml in PBS.
10.sup.4 beads were analysed using a FACScalibur flow cytometer
(Becton Dickinson) using excitation at 488 nm and the fluorescein
emission filter. The GFP translated from genes attached to single
microbeads encapsulated in the aqueous compartments of the
emulsions is bound to the microbeads in situ when the microbeads
are coated with an anti-GFP antibody. The binding of GFP to the
microbeads makes them fluorescent (FIG. 2), and those beads with
GFP bound can be clearly distinguished from those which do not by
flow cytometry (FIG. 3).
Example 4
[0247] The product of an enzyme catalysed reaction can be captured
on paramagnetic beads and beads derivatised with product identified
by flow cytometry.
[0248] A reaction catalysed by the enzyme human glutathione
S-transferase M2-2 (GST M2-2) was performed to generate a
biotinylated product (FIG. 4). The two substrates used were
1-chloro-2,4-dinitrobenzene (CDNB; Sigma) and reduced
biotinylated-glutathione (Biotin-GSH). The product generated
(Biotin-GS-DNP) has biotin at one end to enable coupling to
streptavidin-coated paramagnetic microparticles and a
2,4-dinitrophenyl (DNP) group which can be bound by an anti-DNP
antibody.
[0249] Biotin-GSH was synthesised by adding 100 mg
biotinamidocaproate N-hydroxysuccinimide ester (biotin-NHS; Sigma)
in 1 ml DMF to a solution of oxidised glutathione (Fluka) in 1 ml
water, 30 .mu.l 12.5N NaOH plus 1 ml DMF. The biotin-NHS was added,
on ice, in 100 .mu.l aliquots over 20 minutes. The pH was then
adjusted to 7.0 with 1N NaOH. The syrup-like precipitate which
formed during the reaction was dissolved by warming to room
temperature, vortexing and adding 300 .mu.l water. Stirring was
continued for 2 hours at room temperature, the pH brought back to
7.0 by adding 1N NaOH and stirred overnight at room temperature.
NaOH was then used to bring the pH back to 7.5, the reaction
stirred a further 30 minutes at room temperature and then incubated
30 minutes more after adding 500 .mu.l 1M DTT. The solvents were
evaporated under vacuum and the product purified by reverse-phase
HPLC using a C8 column and a gradient of 10-40% Acetonitrile, 0.1%
TFA. Biotin-GS-DNP was synthesised enzymatically in a 100 .mu.l
reaction containing 1 .mu.g purified recombinant GST M2-2, 500
.mu.M CDNB and 200 .mu.M Biotin-GSH in 0.1 M KH.sub.2PO.sub.4, 1 mM
EDTA, pH6.5. Incubation was for 1 hour at 25.degree. C. The
reaction went essentially to completion as judged by following the
increase in absorbance at 340 nm. Control reactions were also
performed 1) with no GST, 2) with no CDNB, and 3) with no
biotin-GSH. Reactions were diluted 200 times (giving a final
concentration of 1 .mu.M biotin) into 5 mM Tris-HCl, 0.5 mM EDTA,
1.0 M NaCl, pH7.4 (B/W buffer). 50 .mu.l of the diluted reactions
were mixed with 50 .mu.l B/W buffer containing 29.3 .mu.g (10.sup.8
microparticles) 0.737 .mu.m diameter Sera-Mag.TM.
streptavidin-coated magnetic microparticles (MG-SA; Seradyn) and
incubated 1 hour at room temperature. Microparticles were separated
in a microtitre plate (Falcon 3911) using a magnet (Dynal MPC-96)
and washed three times with 10 mM Tris-HCl, 1 mM EDTA, 2.0 M NaCl,
pH7.4 (2.times. B/W buffer), then twice with PBS, 0.1% Tween 20.
The microparticles were resuspended in a 1:2500 dilution of the
mouse anti-dinitrophenyl monoclonal antibody SPE 21-11 (a gift from
Prof. Zelig Eshhar) in PBS/0.1% Tween 20 and incubated 45 minutes
at room temperature. The microparticles were washed three times in
PBS/0.1% Tween 20, resuspended in PBS/0.1% Tween 20 containing 15
.mu.g/ml fluorescein (FITC) conjugated F(ab').sub.2 fragment goat
anti-mouse IgG, F(ab')2 fragment (Jackson; 115-096-006) and
incubated 30 minutes at room temperature. The microparticles were
washed four times in PBS/0.1% Tween 20, resuspended 1 ml PBS/0.1%
Tween 20 and 2.times.10.sup.5 microparticles analysed using a
FACScan flow cytometer (Becton Dickinson). As can be seen from FIG.
5, there is no difference in the distribution of fluorescence
intensity of beads from all three control reactions (no GST, no
CDNB, and no biotin-GSH), where mean fluorescence is .about.3. In
contrast beads from the enzyme catalysed reaction have a mean
fluorescence of 34, over 10 times higher. Indeed, using the gate
shown (FIG. 5), 81.1% of beads from the enzyme catalysed reaction
(and coated with the biotinylated product) are in the gate whereas
in the control reactions no more than 0.06% of beads are in the
gate. Hence, beads coated with the product of the GST catalysed
reaction can easily be sorted from those which are not.
Example 5
[0250] Glutathione S-transferase M2-2 (GST M2-2) will use as a
substrate caged-biotinylated-glutathione and the caged-biotinylated
product generated can subsequently be uncaged by UV irradiation,
captured on avidin-coated beads and detected by flow cytometry.
[0251] The synthesis of caged-biotin (5) and its derivatives (7)
was based on the published protocols (Pirrung & Huang, 1996;
Sundberg et al. (1995). However, significant modifications of these
protocols were made in several steps of the synthesis as described
below.
[0252] Biotin methyl ester (3, Biotin-OMe) was prepared essentially
as described in Sundberg et al. (1995) (see FIG. 6):
[0253] Methylnitropiperonyl alcohol (1, MeNPOH).
3',4-(Methylenedioxy)-6'-- nitroacetophenone (Lancaster; 6.2 g.,
29.6 mmol) was dissolved in a mixture of THF (100 ml) and ethanol
(100 ml). Sodium borohydride (1.12 g., 29.6 mmol) was added and the
solution stirred for 3 hours at room temperature. TLC (on silica
coated plates; solvent -3% methanol in DCM) indicated the full
conversion of the starting material (Rf=0.8) to the alcohol
(Rf=0.6). Hydrochloric acid (1N) was added slowly until the
evolution of hydrogen stopped and the solvents evaporated under
vacuum. The residual solid was dissolved in DCM (500 ml) and washed
with brine (40 ml). The organic phase was dried (over MgSO.sub.4)
and the solvent removed under vacuum. Recrystallisation from hot
DCM and hexane gave 6.1 g. of 1 (a yellow crystalline solid).
[0254] O-Methylnitropiperonyl-Carbonylimdazole (2, MeNPO-CO-Im).
Methylnitropiperonyl alcohol (1.69 g, 8 mmol) was added (in several
portions during 20 minutes) to a solution of carbonyldiimidazole
(CDI, 2.6 g, 16 mmol) in DCM (50 ml). The solution was stirred for
3 hrs after which TLC indicated the complete conversion of the
alcohol (Rf=0.6-3% methanol in DCM) into product (Rf=0.45). DCM
(100 ml) and water (30 ml) were added and the reaction mixture
transferred to a separatory funnel. The mixture was mixed and 1N
HCl was added (in 1 ml aliquots) until the pH of the aqueous phase
went below 6. The aqueous phase was removed, more water added (30
ml) and acidified to pH 6 while mixed. Finally, the DCM phase was
washed with brine, dried (over MgSO.sub.4) and the solvent removed
under vacuum. The remnant solid was re-crystallised from hot DCM
and hexane to give 2.2 g of 2 (a yellow crystalline solid).
[0255] N-(O-Methylnitropiperonyl-carbonyl)-Biotin methyl ester (4,
MeNPO-CO-Biotin-OMe). Sodium hydride (60% suspension in oil; 100
mg, 2.5 mmol) was added to a stirred suspension of Biotin-OMe (517
mg, 2 mmol) and MeNPO-CO-Im (305 mg, 1 mmol) in anhydrous DCM (10
ml) on ice. The solution was stirred for 30 minutes on ice and 30
minutes at room temperature. TLC indicated the complete
disappearance of the MeNPO-CO-Im (Rf==0.6-5% methanol in DCM) and
the appearance of the product (Rf==0.45). Traces of alcohol 1
(Rf=0.7), and a side-product with Rf=0.95 (probably
di-MeNPO-carbonate) were also observed (The ratio of product vs.
the above side-product varied from one preparation to another;
careful drying of the starting materials and performing the
reaction on ice gave generally higher yields of the product).
[0256] Once the reaction had been completed, DCM was added (100 ml)
and the solution extracted three times with 1M NaH.sub.2PO.sub.4.
The organic phase was dried (MgSO.sub.4) and the solvent removed
under vacuum. The remnant syrup was dissolved in hot DCM (ca. 5
ml), hexane (ca. 5 ml) was added to the cloud-point and the
solution was allowed to stand at 4.degree. C. overnight. This
resulted in the precipitation of the excess of the Biotin-OMe as a
white crystalline solid (which was washed with ether, dried and
used in subsequent reactions). The filtrate was concentrated in
vacuum and purified by chromatography on silica (1.5 to 3% methanol
in DCM) to give 4 as a yellow foam (with yields up to 385 mg, or
80% based on molar equivalents of 2 as starting material).
[0257] N-(O-Methylnitropiperonyl-carbonyl)-Biotin (5,
MeNPO-CO-Biotin-OH). MeNPO-CO-Biotin-OMe (940 mg; 1.73 mmol) was
dissolved in 25 ml of 0.5N HCl and dioxane (4:6; flashed with
argon). The solution was stirred at 44.degree. C. for 24 hours
under argon. The solvents were reduced under vacuum to ca. 1 ml,
water was added (10 ml) and the resulting mixture lyophilised. The
resulting solid was dissolved in DCM with 2% methanol (20 ml) and
charcoal was added. The mixture was boiled for few minutes and
filtered. TLC (10% methanol in DCM) indicated the appearance of the
product of the hydrolysis (Rf=0.2) and about 5% of starting
material (MeNPO-CO-Biotin-OMe; Rf=0.9). The solvents were removed
under vacuum to give a yellow solid that was dried under vacuum
(860 mg of ca. 95% of 5 plus 5% of 4). Higher concentrations of HCl
(e.g., 1N) and higher temperatures (e.g., reflux with THF as a
co-solvent) resulted in complete hydrolysis of the methyl ester.
However, significant amount of alcohol 1 and biotin were also
observed, indicating the hydrolysis of the carbamate under these
conditions. It should also be noted that methyl ester 4, and in
particular, the product of its hydrolysis (5) were found to be
sensitive to oxidation. Warming or even storing solutions of 5 in
the presence of air resulted in browning. Similarly, attempts to
purify 5 (or derivatives of, e.g., 7) by chromatography on silica
led to very high losses due to oxidation.
[0258]
N-(N-(O-Methylnitropiperonyl-carbonyl)-Biotin)-3-aminopropionic
acid tert-butyl ester (6, MeNPO-CO-Biotin-.beta.-Ala-OBu.sup.t).
MeNPO-CO-Biotin-OH (860 mg containing .about.5% of
MeNPO-CO-Biotin-Ome; .about.1.6 mmol) was dissolved in 20 ml of
anhydrous DCM. .beta.-Alanine tert-butyl ester
(H-.beta.-Ala-OBu.sup.t) hydrochloride salt (Bachem; 362 mg; 2
mmol), N-hydroxysuccinimide (172 mg; 1.5 mmol) and triethylamine
(280 .mu.l; 2 mmol) were added. The stirred solution was cooled on
ice and EDCI was added (420 mg; 2.2 mmol). The reaction was stirred
for 24 hours at 4.degree. C. and 2 hours at room temperature. TLC
(5% methanol in DCM) indicated the appearance of the product
(Rf=0.3) and the remaining, unreacted MeNPO-CO-Biotin-OMe
(Rf=0.45). The reaction was diluted with DCM (30 ml) and extracted
three times with 1M NaH.sub.2PO.sub.4 and once with saturated
NaHCO.sub.3. The organic phase was dried (Na.sub.2SO.sub.4) and the
solvent removed under vacuum. The remnant syrup was purified by
chromatography on silica (3.0-4.5% methanol in DCM) to give 640 mg
of 6 (a yellow foam).
[0259]
N-(N-(O-Methylnitropiperonyl-carbonyl)-Biotin)-3-aminopropionic
acid (7, MeNPO-CO-Biotin-.beta.-Ala-OH). Tert-butyl ester 6 (510
mg; 0.84 mmol) was dissolved in 15 ml of 0.5N HCl and dioxane (4:6;
flashed with argon). The solution was stirred at 52.degree. C. for
24 hours under argon. Water was added (10 ml) and the resulting
solution was freeze-dried to give a solid that contained (as judged
by TLC) the product of the hydrolysis (7) and starting material (6;
.about.10%). This mixture was purified by column chromatography on
silica (10% methanol in acetone plus 0.1% acetic acid) to give 60
mg of 7 (the low yields were primarily the result of oxidation of 7
on the silica).
[0260]
N-(N-(N-(O-Methylnitropiperonyl-carbonyl)-Biotin)-3-aminopropionyl)-
-glutathione (8, MeNPO-CO-Biotin-.beta.-Ala-GSH).
Carbonyldiimidazole (20 mg, 120 .mu.mol) was added to a solution of
MeNPO-CO-Biotin-.beta.-Ala-OH (7, 49 mg, 89 .mu.mol) in DMF (1.5
ml). The solution was stirred for 30 minutes at room temperature
and was then added, in several aliquots, to a solution of oxidised
glutathione (62 mg, 100 .mu.mol) and triethylamine (55 .mu.l, 0.4
mmol), in DMF (2 ml) plus water (0.15 ml), stirred on ice. The
solution was stirred on ice for 30 minutes and then at room
temperature. Triethylamine was added, until the solution became
clear (25 .mu.l), and the reaction was then stirred for another 2
hours at room temperature. DTT was then added (0.25 ml of 1M
solution; 0.25 mmol), and the solution was stirred at room
temperature for 10 minutes.
[0261] The product of the above reaction was purified by
reverse-phase HPLC, on an RP-8 preparative column, using a
water-acetonitrile gradient in the presence of 0.1% trifluoroacetic
acid. The peak corresponding to 8 (retention time=28.6 minutes) was
collected. The product was then isolated by freeze-drying and
purified again on reverse-phase HPLC (using the same column and
solvent system). Analysis of the product after the second HPLC
purification, using analytical reverse-phase HPLC, indicated a
product (>95%) the UV spectrum of which corresponded to 8
(specifically, .lambda..sup.max at 355 nm indicated the presence of
the O-methylnitropiperonyl-carbonyl group of the caged-biotin). The
concentration of 8 was determined by titrating the free thiol
groups (using DTNB, 5,5'-dithiobis (2-nitrobenzoic acid), as
Hermanson, 1996) derived from the glutathione, and also by
absorbance at 355 nm (corresponding to the caged-biotin). Both
these independent measurements gave the same result within
experimental error.
[0262] The purified 8 was also found to be a substrate for human
M2-2 GST in the electrophilic substitution of CDNB (monitored by
the change of absorbance at 340 nm; Habig & Jakoby, 1981) with
rates that are about 10 fold slower than those observed with
glutathione under similar conditions.
[0263] The reduced MeNPO-CO-Biotin-.beta.-Ala-GSH
(caged-biotin-.beta.ala-- GSH) was reacted with either
1-chloro-2,4-dinitrobenzene (CDNB; Sigma) or
4-chloro-3-nitrobenzoate (CNB, Acros). The caged product generated
does not bind avidin or streptavidin. However, after photochemical
uncaging by ultraviolet radiation the product has a biotin at one
end which will bind to avidin or streptavidin-coated microparticles
and either a 2,4-dinitrophenyl (DNP) or a 3-nitrobenzoate group
which can be bound by appropriate anti-DNP or anti-3-nitrobenzoate
antibodies (see FIGS. 7 & 8).
[0264] 5 .mu.l (10.sup.8 beads) 1.0 .mu.m diameter nonfluorescent
neutravidin labelled microspheres (Molecular Probes, F-8777) were
spun in a microfuge at 10,000 g for 3 min. and the supernatant
removed. The beads were resuspended in 5 .mu.l 0.1 M
KH.sub.2PO.sub.4, pH 6.5, 1 mM EDTA, 2 mM dithiothreitol, 10 .mu.M
caged-biotin-.beta.ala-GSH, and either 500 .mu.M CDNB or 500 .mu.M
CNB. The 5 .mu.l reaction mixes contained either 0.75 .mu.g
purified recombinant human GST M2-2 or no enzyme.
[0265] Reactions were incubated for 30 min (CDNB reactions) or 4
hours (CNB reactions) at 25.degree. C., after which time they were
stopped by the addition of 35 .mu.l 0.1 M sodium acetate, pH 5.0
and transferred to ice. Each reaction was then split into two
aliquots of 20 .mu.l each, one of which was placed as a spot on a
layer of parafilm on the surface of an ice-cooled aluminium block.
This spot was then irradiated for 2 min with a B 100 AP UV lamp
(UVP) held at a distance of .about.6 cm. The other aliquot was left
un-irradiated. All samples were then incubated 30 mins. at ambient
temperature and then washed three times with 200 .mu.l PBS, 0.1%
Tween 20 in a 0.45 .mu.m MultiScreen-HV filter plate (Millipore,
MAHVN4510), thoroughly resuspending between each wash.
[0266] Beads were then resuspend in 200 .mu.l PBS, 0.1% Tween 20
containing 20 ng/.mu.l Alexa-488 labelled rabbit anti-DNP antibody
(Dako, #V0401) 20 ng/.mu.l Alexa-488 labelled anti-CNB antisera and
incubated for 1 hour at room temperature. The anti-CNB antiserum
was elicited in rabbits by immunisation with CNB-CH.sub.2-KLH
conjugates prepared by adding aliquots of a 200 mM solution of
4-(bromomethyl)-3-nitrobenzoic acid (CNB-CH.sub.2Br) in DMF to 5
mg/ml solutions of bovine serum albumin (BSA) or keyhole limpet
hemocyanin (KLH) in 50 mM borate pH 8.8 (to give 1.5 to 6 .mu.mole
of CNB-CH.sub.2Br per mg protein). The reaction mixtures were
stirred for 6 hours at room temperature and temperature, and the
resulting protein conjugates were dialysed extensively against
phosphate buffer saline (PBS) at 4.degree. C. The level of
conjugation (hapten density or Hd) was determined by measuring
optical densities of the conjugates at 355 nm. These were found to
be: 7 to 11 CNB-CH.sub.2 groups per BSA molecule and 9.4 to 24.3
per KLH molecule depending on the amount of CNB-CH.sub.2Br added to
the protein samples. The CNB-CH.sub.2-KLH conjugate with Hd of 14.2
was used to immunise rabbits using published protocols (Tawfik et
al., 1993; Tawfik et al., 1997) (by Prof. Z Eshhar, Weizmann
Institute of Science, Rehovot). Sera were tested by ELISA for
binding the conjugate CNB-CH.sub.2-BSA (Hd=11) and to BSA. The
first bleed from both immunised rabbits (when diluted 50 fold or
more) exhibited the desirable selectivity yielding high signal when
incubated with the CNB-CH.sub.2-BSA conjugate and very low
background (<5%) with BSA. The anti-CNB serum was purified using
a HiTrap Protein A column (Pharmacia). Both anti-CDNB and anti-CNB
antibodies were labelled with an Alexa Fluor 488 protein labelling
kit (Molecular Probes) according to the manufacturer's
instructions.
[0267] The beads were washed three times with 200 .mu.l PBS, 0.1%
Tween 20 as above, then resuspended in 1 ml PBS, 0.1% Tween 20 and
10,000 events analysed using a FACScan flow cytometer (Becton
Dickinson).
[0268] As can be seen from FIG. 9, the caged-biotin moiety is
uncaged on UV irradiation and binds to beads. A 19-fold increase in
mean bead fluorescence was observed after GST M2-2 catalysed
reaction of caged-biotin-.beta.ala-GSH with CDNB even in the
absence of UV irradiation. This correlates with the apparent
presence of .about.4% biotin-.beta.ala-GSH in the preparation of
caged-biotin-.beta.ala-GSH as determined by using fluorimetry to
measure the displacement of 2-anilonaphthalene-6-sulphonic acid
(2,6-ANS) from avidin (Mock et al., 1985). These results are
consistent with the previously observed background immobilisation
of caged-biotin to avidin `in the dark` (i.e., without UV
illumination) which was as high as 15% of the signal observed after
illumination (Sundberg et al. 1995). The `dark` signal observed
previously was ascribed to either trace contaminants of biotin in
the caged-biotin preparation, or to weak interactions between
avidin and components of the caged-biotin including the linker
(Sundberg et al. 1995). After UV irradiation a large difference in
the mean fluorescence of those beads incubated in the presence and
absence of GST was observed. The mean bead fluorescence with GST
was 84 times and 56 times that observed without GST with CDNB and
CNB as substrates respectively (FIG. 9).
Example 6
[0269] Glutathione S-transferase M2-2 (GST M2-2) compartmentalised
in the aqueous droplets of a water-in-oil emulsion catalyses the
reaction of caged-biotinylated-glutathione with
4-chloro-3-nitrobenzoate (CNB). the caged-biotinylated product
generated remains compartmentalised and can subsequently be uncaged
by UV irradiation in the compartments, captured on an avidin-coated
bead in the same compartment and the product-coated beads detected
by flow cytometry.
[0270] 20 .mu.l aliquots (4.times.10.sup.8 beads) of 1.0 .mu.m
diameter nonfluorescent neutravidin labelled microspheres
(Molecular Probes, F-8777) or 0.93 .mu.m diameter
streptavidin-coated polystyrene beads (Bangs Laboratories) were
each spun in a microfuge at 2,600 g (6,500 rpm) for 3 min. The
supernatant was removed and the beads resuspended, on ice, in 20
.mu.l 0.1 M KH.sub.2PO.sub.4, pH 6.5, 1 mM EDTA, 2 mM
dithiothreitol, 50 .mu.M caged-biotin-.beta.ala-GSH, containing
either 3 .mu.g purified recombinant human GST M2-2 or no
enzyme.
[0271] Six reaction mixtures were then emulsified essentially as
Tawfik & Griffiths (1998):
[0272] a) Bangs beads, no GST
[0273] b) Bangs beads, plus GST
[0274] c) Molecular Probes beads, no GST
[0275] d) Molecular probes beads, plus GST
[0276] e) Bangs beads, no GST
[0277] f) Molecular Probes beads, no GST
[0278] The oil phase was freshly prepared by dissolving 4.5% (v/v)
Span 80 (Fluka) in mineral oil (Sigma, #M-5904) followed by 0.5%
(v/v) Tween 80 (SigmaUltra; #P-8074). Ice-cooled reaction mixtures
were added gradually (in 5 aliquots of 4 .mu.l over .about.2
minutes) to 0.4 ml of ice-cooled oil-phase in a 5 ml Biofreeze Vial
(Costar, #2051) whilst stirring with a magnetic bar (8.times.3 mm
with a pivot ring; Scientific Industries International,
Loughborough, UK). Stirring (at 1150 rpm) was continued for an
additional 1 minute on ice.
[0279] 8 .mu.l of emulsion d) was added to 0.4 ml emulsion e), and
8 .mu.l of emulsion b) was added to 0.4 ml emulsion f) (to give
1:50 dilutions) and the emulsion mixtures vortexed for 5 seconds to
mix.
[0280] Six reaction mixtures were left non-emulsified:
[0281] a) Bangs beads, no GST
[0282] b) Bangs beads, plus GST
[0283] c) Molecular Probes beads, no GST
[0284] d) Molecular probes beads, plus GST
[0285] e) Bangs beads, no GST
[0286] f) Molecular Probes beads, no GST
[0287] 0.4 .mu.l of d) was added to 20 .mu.l of e), and 0.4 .mu.l
b) was added to 20 .mu.l of f) (to give 1:50 dilutions).
[0288] Both emulsions and non-emulsified reactions were incubated
for 15 min at 25.degree. C. Then 0.8 .mu.l 500 mM CNB (in absolute
ethanol) was added to each 0.4 ml emulsion and the emulsion
vortexed for 5 seconds (the CNB is transferred through the mineral
oil to the aqueous compartments). 5 .mu.l 5 mM CNB (in 0.1 M
KH.sub.2PO.sub.4, 1 mM EDTA, pH, 6.5) was added to the
non-emulsified reactions.
[0289] All reactions were incubating for 4 hours at 25.degree.
C.
[0290] The pH of the aqueous droplets was lowered to quench the GST
catalysed reaction by vortexing the emulsions with 200 .mu.l Sigma
Mineral Oil for Molecular Biology (M-5904) containing 4.5% Span 80
(Fluka), 0.5% Tween 80 (Sigma Ultra) in Sigma Mineral Oil for
Molecular Biology) and 25 mM acetic acid. The non-emulsified
reactions were quenched by adding 25 .mu.l 0.5 M acetic acid.
[0291] All reactions were transferred to a 24-well flat bottom
plate (Corning, #25820) floating on iced water and irradiated for 2
min with a B 100 AP UV lamp (UVP) held at a distance of .about.6
cm. All samples were then incubated 30 mins. at ambient
temperature.
[0292] The emulsions were transferred to 1.5 ml microfuge tubes,
spun 1 min. 13.5 k rpm in a microfuge and the oil phase removed
leaving the concentrated (but still intact) emulsion at the bottom
of the tube. 200 .mu.l 0.1 M Na acetate, pH 5.0 were added and the
emulsion broken by extracting 4 times with 1 ml hexane, vortexing
between each hexane addition. Residual hexane was removed by
spinning for 10 min at ambient temperature under vacuum in a
Speedvac (Farmingdale, N.Y.).
[0293] All samples were then washed three times with 200 .mu.l PBS,
0.1% Tween 20 in a 0.45 .mu.m MultiScreen-HV filter plate
(Millipore, MAHVN4510), thoroughly resuspending between each wash.
Beads were then resuspend in 200 .mu.l PBS, 0.1% Tween 20.25 .mu.l
(.about.5.times.10.sup.7 beads) were then added to 200 .mu.l PBS,
0.1% Tween 20 containing 20 ng/.mu.l Alexa-488 labelled anti-DNP
antibody or 20 ng/.mu.l Alexa-488 labelled anti-CNB antibody (see
Example 5) and incubated for 1 hour at ambient temperature. The
beads were washed three times with 200 .mu.l PBS, 0.1% Tween 20 as
above, then resuspended in 1 ml PBS, 0.1% Tween 20 and 300,000
events analysed using a FACScan flow cytometer (Becton
Dickinson).
[0294] In the non-emulsified mixtures, where neither GST nor the
product of the GST catalysed reaction, (caged-biotin-.beta.Ala-NB)
were compartmentalised, all beads have a similarly low fluorescence
(FIG. 10, Panels B and D). In contrast, in the emulsion mixtures,
where both GST and the product of the GST catalysed reaction,
(caged-biotin-.beta.Ala-NB- ) were compartmentalised, two
populations of beads, one of low and one of higher fluorescence are
clearly visible (FIG. 10, Panels C and E). Gating through R1 and R2
enables the Bangs and Molecular Probes beads to be largely
separated on the basis of their slightly different light scattering
characteristics (FIG. 10, Panel A). The ratio of Bangs to Molecular
Probes beads passing through R1 is 68%:0.1% and the ratio passing
through R2 is 0.08%:87%. Using these gates it is clear that the
beads with high fluorescence are those which were compartmentalised
with the enzyme GST. Hence, compartmentalisation of beads, enzyme
and reaction product was obtained by emulsification and those beads
present in compartments which contained enzymes can be
distinguished from those which do not by their fluorescence
characteristics.
Example 7bar (8.times.3 mm with a pivot ring; Scientific Industries
International, Loughborough, UK). Stirring (at 1150 rpm) was
continued for an additional 1 minute on ice.
[0295] Both emulsions and non-emulsified reactions were incubated
for 45 min at 25.degree. C. to allow translation to proceed. Then 5
.mu.l 100 mM 1-chloro-2,4-dinitrobenzene (CDNB) (in absolute
ethanol) was added to each 1.0 ml emulsion and the emulsion
vortexed for 5 seconds (the CDNB is transferred through the mineral
oil to the aqueous compartments). 1.0 .mu.l 2.5 mM CDNB (in water)
was added to the non-emulsified reactions. CDNB inhibits in vitro
translation and adding it in this way, after translation is
completed, maximises the yield of GST.
[0296] All reactions were incubating for 30 mins at 25.degree. C.
The pH of the aqueous droplets was then lowered to quench the
reaction by vortexing the emulsions with 500 .mu.l Sigma Mineral
Oil for Molecular Biology (M-5904) containing 4.5% Span 80 (Fluka),
0.5% Tween 80 (Sigma Ultra) in Sigma Mineral Oil for Molecular
Biology) and 25 mM acetic acid. The non-emulsified reactions were
quenched by adding 5 .mu.l 0.5 M acetic acid and 20 .mu.l 0.1M Na
acetate, pH 5.0.
[0297] All reactions were transferred to a 24-well flat bottom
plate (Coming, #25820) floating on iced water and irradiated for 2
min with a B 100 AP UV lamp (UVP) held at a distance of .about.6
cm. All samples were then incubated 30 mins. at ambient
temperature.
[0298] The emulsions were transferred to 1.5 ml microfuge tubes,
spun 1 min. 13.5 k rpm in a microfuge and the oil phase removed
leaving the concentrated (but still intact) emulsion at the bottom
of the tube. 200 .mu.l 0.1M Na acetate, pH 5.0 were added and the
emulsion broken by extracting 4 times with 1 ml hexane, vortexing
between each hexane addition. Residual hexane was removed by
spinning for 10 min at ambient temperature under vacuum in a
Speedvac (Farmingdale, N.Y.).
[0299] Approximately 5.times.10.sup.7 beads from the broken
emulsions and the non-emulsified reactions were then washed three
times with 200 .mu.l PBS, 0.1% Tween 20 in a 0.45 .mu.M
MultiScreen-HV filter plate (Millipore, MAHVN4510), thoroughly
resuspending between each wash. Beads were then resuspend 200 .mu.l
PBS, 0.1% Tween 20 containing 10 ng/.mu.l Alexa-488 labelled
anti-DNP antibody (see Example 5) and incubated for 1 hour at
ambient temperature. The beads were washed three times with 200
.mu.l PBS, 0.1% Tween 20 as above, then resuspended in 1 ml PBS,
0.1% Tween 20 and 10,000 events analysed using a FACScan flow
cytometer (Becton Dickinson).
[0300] As can be seen from FIG. 11, both in emulsified and
non-emulsified reactions, the reaction catalysed by in vitro
translated GST M2-2 results in an in beads with higher fluorescence
than when no enzyme was present. This difference in fluorescence
would, however, not be sufficient for efficient fluorescence
activated sorting (FACS). However, beads from both emulsified and
non-emulsified reactions containing 5.0 .mu.g of purified
recombinant GST M2-2 per 50 .mu.l were even more fluorescent than
those containing in vitro translated GST M2-2 enabling efficient
enrichment of these beads by FACS from those incubated in the
absence of GST. This simulates the situation where a mutant GST of
higher activity than wild-type is translated in vitro.
Example 8
[0301] Genes attached to microbeads are expressed in vitro and the
resulting gene-product (an enzyme) binds to the microbeads whilst
retaining catalytic activity.
[0302] One format for the selection of genetic elements is where
the genetic element comprises a gene linked to a microbead, which
is translated in a microcapsule, and the translated gene-product is
coupled back onto the microbead within the microcapsule. Thus,
compartmentalisation leads to the formation of complexes of
gene-products (e.g., proteins or enzymes) attached to the gene
encoding them. These complexes could be subsequently selected for
binding a ligand (see Example 12), or for enzymatic activity via a
second compartmentalised reaction.
[0303] Here it is shown, that an enzyme (phosphotriesterase or PTE)
can be transcribed and translated in vitro from genes attached to
microbeads and the translated enzyme is bound back the microbeads.
We also show that the translated enzyme can be modified, assembled
or complemented with a cofactor whilst it is bound on the beads--in
this example, metal ions are added to the apo-enzyme to give an
active metalloenzyme. Moreover, we show here that the catalytic
activity of the enzyme is retained whilst it is bound to the
microbead together with the gene that encodes it.
[0304] The opd gene encoding a phosphotriesterase (PTE; also known
as paraoxon hydrolase; Mulbry & Karns, 1989) is amplified from
Flavobacterium sp. strain ATCC 27551 by PCR using a forward primer
that appends stop codons and an EcoRI site (OPD-Fo; see Table 1),
and a back primer that appends the phage T7 gene 10 transitional
site (RBS) and a HindIII cloning site (OPD-Bc). This DNA is cloned
into pGEM-4Z using the HindIII and the EcoRI sites downstream of
the T7 RNA polymerise promoter. DNA sequencing identifies a clone
which has the correct nucleotide sequence. Bacteria (E. coli, TG1)
transformed with this clone (Gem-OPD) are found to overexpress
active PTE when grown in the presence of cobalt chloride and
induced with IPTG (Omburo et al., 1992).
[0305] The OPD gene is also cloned with a Flag.TM. peptide
(Met-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys; Sigma-Aldrich) appended to
its N-terminus. The OPD gene is amplified Flavobacterium sp. strain
ATCC 27551 by PCR using a forward primer (N-Flag-OPD-Fo) that
appends stop codons and a KpnI site, and a back primer
(N-Flag-OPD-Bc) appending an NcoI site, a Flag peptide and a short
linker between the Flag peptide and the OPD reading frame. The
resulting DNA fragment is cloned into plasmid pGEM-4Z.sup.NcoI
(using the KpnI and NcoI sites). pGEM-4Z.sup.NcoI is a modification
of p-GEM-4Z into which, the phage T7 gene 10 transitional site
(RBS) and an ATG start codon are appended downstream to the T7 RNA
polymerise promoter, to create an NcoI site that allows cloning of
reading frames in the context of the RBS and ATG codon. The
sequence of the section incorporated into pGEM-4Z (between the
HindIII and the KpnI sites downstream to the T7 RNA polymerise
promoter), to give pGEM-4Z.sup.NcoI, is indicated in Scheme I.
[0306] The rest of pGEM-4Z, including the KpnI and EcoRI cloning
sites, remained intact.
1 -----5'-AAGCTTAATAATTTTGTTTAACTTTAAGAAGGAGATATAGCCATGG...
pGEM-4Z-HindIII site appended RBS, ATG and NcoI cloning site
....GGTACC-3'-------- KpnI site of pGEM-4Z Scheme I
[0307] DNA sequencing identifies a clone that has the correct
nucleotide sequence. Bacteria transformed with this clone
(Gem-N-Flag-OPD) are found to over-express an active PTE when grown
in the presence of Cobalt Chloride and induced with IPTG.
[0308] The gem-OPD and gem-N-Flag-OPD plastids described above are
amplified by PCR, using primers LMB2-biotin and LMB3, to create DNA
fragments (OPD.LMB3-2biotin and N-Flag-OPD.LMB3-2biotin,
respectively) that carry the T7 RNA polymerise promoter, the phage
T7 gene 10 transitional start site and the OPD or the N-Flag-OPD
genes and are labelled with biotin at the 3' end. The PCR fragments
are purified directly using Wizard PCR Preps (Promega).
[0309] Aliquots of a suspension of 0.95 .mu.m non-fluorescent
streptavidin labelled microspheres (Bangs, .about.2.times.10.sup.7
beads per 11 suspension) are spun in a microfuge at 10,000 g
(13.500 rpm) for 3 min. The supernatant is removed and the beads
resuspended in TNT buffer (0.1M Tris 7.5, 0.15M NaCl, 0.05%
Tween-20). An antibody that is capable of binding amino-teimini
Flag peptides and is labelled by biotinylation (BioM5, a
biotin-labelled anti-Flag antibody; Sigma) is added to the bead
suspensions to an average of 4.times.10.sup.4 antibody molecules
per bead. The resulting mixture is incubated for several hours with
occasional mixing. The beads are rinsed twice by spinning down and
resuspending them in TNT buffer. Biotinylated DNA fragments
(fragments OPD.LMB3-2biotin, N-Flag-OPD.LMB3-2biotin, or fragments
that carry the T7 RNA polymerise promoter, the phage T7 gene 10
transitional start-site and a gene encoding a different enzyme that
is also tagged with N-Flag peptide, e.g., methyltransferase
HaeIII-N-Flag-M.HaeIII.LMB3-2biotin) are added to a suspension of
antibody-coated beads and the mixture is incubated overnight at
4.degree. C. The beads-are rinsed 3 times by spinning down and
resuspending them in TNT buffer.
[0310] 50 .mu.l aliquots of the above suspension of beads
(.about.10.sup.9 beads) are spun in a microfuge at 10,000 g for 3
min. The supernatant is removed and the beads gently resuspended,
on ice, in 50 .mu.l of a prokaryotic in vitro coupled
transcription/translation system designed for linear templates
(Lesley et al., 1991). A commercial preparation of this system is
used (E. coli S30 Extract System for Linear Templates; Promega)
supplemented with T7 RNA polymerise (2,000 units). The reactions
are incubated at 25.degree. C. for 1.5 hours and spun in a
microfuge at 10,000 g for 3 min. The supernatant is removed and the
beads resuspended in 100 .mu.l of 50 mM Tris, 10 mM of Potassium
Carbonate, pH 8.0. An aqueous solution of Cobalt Chloride is added
to a concentration of 1 mM and the reactions incubated for several
hours at room temperature (or overnight at 4.degree. C.). The beads
are rinsed 4 times by spinning down and resuspending them in TNT
buffer.
[0311] Aliquots of the above beads are added to a solution of 0.25
mM Paraoxon in 50 mM Tris pH 8.3. The beads are incubated at
25.degree. C. with occasional stirring for different periods of
time. The beads are spun in a microfuge at 10,000 g for 3 min, the
supernatant is removed and its optical density measured at 405 nm.
A significant change in optical density, relative to the optical
density observed under the same conditions in the absence of beads
or phosphotriesterase, is not observed when beads to which
biotinylated DNA fragments OPD.LMB3-2biotin or
N-Flag-M.HaeIII.LMB3-2biotin are attached (and are subsequently
reacted as described above) are incubated with Paraoxon. However, a
significant change in optical density at 405 nm is observed when
beads to which biotinylated DNA fragments N-Flag-OPD.LMB3-2biotin
are attached (and are subsequently reacted as described above) are
incubated with Paraoxon. For example, when biotinylated DNA
fragments N-Flag-OPD.LMB3-2biotin are added at a concentration of 1
nM (to a 50 .mu.l suspension of beads (.about.10.sup.9 beads) that
is then resuspended in 50 .mu.l in vitro
transcription/translation), and reacted as described above, the
change in optical density observed after 3 hours corresponds to
more than 50% hydrolysis of Paraoxon (at 0.25 mM in a 50 .mu.l
reaction volume). Thus, microbeads carrying a gene encoding a
protein with the desired catalytic activity (phosphotriesterase in
the above example) can be clearly distinguished from microbeads
carrying genes that do not encode a protein with the desired
catalytic activity (methyltransferase HaeIII in the above example).
Moreover, almost no change in optical density at 405 nm is observed
when biotinylated DNA fragments N-Flag-OPD.LMB3-2biotin are
attached to beads and reacted as described above, except that
Cobalt Chloride is not added to the resuspended beads after
transcription/translation.
[0312] These results show that an enzyme (phosphotriesterase) can
be transcribed and translated in vitro from genes that encode this
enzyme and are attached to microbeads. When the genes encode a
tag--an N-terminus Flag peptide in the above example--the
translated enzyme binds back to the microbeads to which the genes
are attached. If necessary, the translated enzyme can be then
modified whilst it remains attached to the microbeads (together
with the gene that encodes it)--in this example, Cobalt ions are
added to give a reactive metallo-enzyme. These result also indicate
that the enzyme is catalytically active whilst it is bound to
microbeads together with the gene that encodes it.
Example 9
[0313] An enzyme catalyses a reaction with a caged-biotinylated
substrate, and the caged-biotinylated product generated is uncaged
by UV irradiation and captured on streptavidin-coated microbeads.
subsequently these beads are detected by flow-cytometry.
[0314] One format for the selection of genetic elements is where
the genetic element comprises a gene linked to a microbead, which
is translated in a microcapsule, and the translated gene-product is
coupled back onto the microbead within the microcapsule. Thus,
compartmentalisation leads to the formation of complexes of
gene-products (e.g., proteins or enzymes) attached to the gene
encoding them. These complexes could be subsequently selected for
binding a ligand (see Example 12), or for enzymatic activity via a
second compartmentalised reaction.
[0315] However, for such complexes to be selected for catalytic
activity, a soluble substrate should be available for the
immobilised enzyme, and, once the catalytic reaction had been
completed, the product of the enzymatic activity that is being
selected for should become attached to the gene encoding this
enzyme. The resulting complexes could be then sorted or selected by
virtue of the product being linked to them, for example by using a
fluorescently-labelled antibody that recognises the product. In
other compartments, containing complexes of genes and gene-products
that do not encode proteins with the desired enzymatic activity,
the unreacted substrate should become linked to the gene. These
complexes will not be labelled with the product and will therefore
be discarded.
[0316] Here it is shown that an enzyme (phosphotriesterase or PTE)
can react with a caged-biotinylated substrate in the presence of
streptavidin-coated beads. The caged-biotinylated product generated
can then be uncaged by UV irradiation and captured on avidin-coated
beads. Subsequently, these beads are detected by flow cytometry and
are clearly distinguished from beads incubated with a
caged-biotinylated substrate in the presence of other enzymes or
proteins that do not exhibit phosphotriesterase activity.
[0317] A caged-biotinylated substrate for PTE (EtNP-Bz-Glu-caged
Biotin; FIG. 12) is synthesised as follows:
[0318] Boc-5-aminopentanol: Di-tert-butyl dicarbonate (20.8 g;
0.095 mol) is added to stirred solution of 5-aminopentanol (10.37
g; 0.1 mol) in dicholoromethane (DCM) (200 ml) on ice. Following
addition, the solution becomes turbid and a syrup separates.
Triethylamine is added (13.8 ml; 0.1 mol) drop-wise, and the
resulting solution is stirred for 10 minutes on ice and then
overnight at room temperature. The solvents are removed under
vacuum, the resulting syrup is dissolved in ethyl acetate (500 ml),
extracted 3 times with 1M Na.sub.2HPO.sub.4 (pH 4), once with
saturated NaHCO.sub.3, and finally with brine, and then dried over
MgSO.sub.4. The solvents are removed under vacuum and the resulting
syrup (after extensive drying under vacuum in the presence of
potassium hydroxide), comprised primarily of Boc-5-aminopentanol,
is used without further purification.
[0319] (11) Triethylamine (3 ml; 22 mmol) is added drop-wise to a
stirred solution of p-nitrophenyl phoshphodichloridate (5.15 g; 20
mmol) and ethanol (1.15 ml, 20 mmol) cooled on dry-ice in acetone,
with in 30 minutes. The solution is allowed to slowly warm up to
room temperature and is stirred for an additional 90 minutes. A
solution of Boc-5-aminopentanol (4.3 g; ca. 20 mmol) and
trietheylamine (3 ml; 22 mmol) in DCM (20 ml) is then added
drop-wise. The reaction is allowed to stir at room temperature for
10 minutes, 1H-tetrazole is added (0.35 g; 5 mmol) and the reaction
stirred for another 2 hours. DCM is added (100 ml) and the solution
extracted 3 times with 1M Na.sub.2HPO.sub.4 (pH 4), saturated
NaHCO.sub.3, and finally with brine, and then dried over
MgSO.sub.4. The solvents are removed under vacuum to give a syrup
that is purified by column chromatography on silica (solvent: 1% to
2% methanol in DCM) to give 3.52 g of 11 (a syrup).
[0320] 4-N-Boc-aminomethylbenzoic acid N-hydroxy succinimide ester
Dicyclohecyldicarbodiimide (DCC; 5.15 g; 25 mmol) is added to a
stirred suspension of 4-N-Boc-aminomethylbenzoic acid (Tiger,
Monmouth N.J.; 5.2 g; 25 mmol) and N-hydroxy succinimide (2.88 g;
25 mmol) in DCM (200 ml) plus acetonitrile (20 ml). The reaction is
stirred overnight at 4.degree. C. and then 3 hours at room
temperature. The dicyclohecyl urea precipitate is removed by
filtration, and the filtrate concentrated under vacuum to give a
syrup. The syrup is dissolved in chloroform and DCM and treated
with activated charcoal. Addition of ether gives a white
crystalline solid. Recrystallisation from DCM and petroleum ether
gives 6.2 g of the N-hydroxy succinimide ester of
4-N-Boc-aminomethylbenzoic acid.
[0321] (12) Trifluoroacetic acid (TFA; 4 ml) is added to a solution
of 11 (900 mg; 2.07 mmol) in DCM (5 ml). The solution is left at
room temperature for 45 minutes and the solvents are removed under
vacuum. The residual syrup is triturated by dissolving it DCM and
methanol and adding ether. The resulting 12 (as TFA salt; syrup) is
dried over vacuum in the presence of potassium hydroxide, and then
reacted immediately without further purification (see below).
[0322] (13) 4-N-Boc-aminomethylbenzoic acid N-hydroxy succinimide
ester (670 mg; 2.2 mmol) and triethylamine (0.345 ml; 2.5 mmol) are
added to 12 (see above) in DCM (15 ml). The solution is stirred for
30 minutes, triethylamine (0.1 ml; 0.72 mmol) is added, and the
solution stirred for additional 3 hours. DCM is added (20 ml), and
the solution extracted twice with 1M Na.sub.2HPO.sub.4 (pH 4), once
with saturated NaHCO.sub.3, and finally with brine, and then dried
over MgSO.sub.4. The solvents are removed under vacuum to give a
syrup that is purified by column chromatography on silica (solvent:
5% methanol in DCM) to give 0.86 g of 13 (a syrup).
[0323] (14) 0.84 g 13 of 14 (1.6 mmol) is treated with TFA as
described above to give 14 (as TFA salt; syrup) which is reacted
immediately as described below.
[0324] (15) Boc-Glu(OSu)-OBu.sup.t (Bachem; 641 mg; 1.6 mmol) and
triethylamine (0.235 ml; 1.7 mmol) are added to 14 (see above) in
DCM (15 ml). The solution is stirred for 1 hour, triethylamine (60
.mu.L; 0.43 mmol) is added, and the solution stirred for 1 hour.
DCM is added (20 ml), and the solution extracted twice with 1M
Na.sub.2HPO.sub.4 (pH 4), once with saturated NaHCO.sub.3, and
finally with brine, and then dried over MgSO.sub.4. The solvents
are removed under vacuum to give a syrup that is purified by column
chromatography on silica (solvent: 7% methanol in DCM) to give 0.8
g of 15 (a white crystalline solid).
[0325] EtNP-Bz-Glu (16).0.4 g of 15 (0.56 mmol) are dissolved in
DCM (5 ml) and TFA (5 ml). The solution is stirred for 1 hour at
room temperature, and the solvents are removed under vacuum. The
residual syrup is crystallised by dissolving it methanol and adding
ether. Recrystallisation (in methanol and ether) gives 200 mg of 16
(as TFA salt; white solid).
[0326] EtNP-Bz-Glu-caged Biotin (17) Carbonyldiimidazole (6 mg,
37.5 .mu.mol) is added to a solution of MeNPO-CO-Biotin-OH (5, 17
mg, 35 .mu.mol) in DMF (1 ml). The solution is stirred for 60
minutes at room temperature and added to 16 (20 mg, 30 .mu.mol).
Triethylamine (5.5 .mu.l, 40 .mu.mol), DMF (1 ml) and water (0.5
ml) are added to the stirred reaction mixture until it became
clear. The solution is stirred for 2 hours at room temperature and
stored at -20.degree. C.
[0327] The product of the above reaction is purified by
reverse-phase HPLC on a C8 preparative column using a
water-acetonitrile gradient in the presence of 0.1% trifluoroacetic
acid. The peak corresponding to 17 (retention time=23.1 minutes) is
collected. The product is isolated by freeze-drying as a yellow
solid. Analysis of the product after the HPLC purification using
analytical reverse-phase HPLC indicated a major product (>80%),
the UV spectrum of which corresponded to 17. Specifically,
.lambda..sup.max at 355 nm indicates the presence of the
O-methylnitropiperonyl-carbonyl group of the caged-biotin (Pirrung
& Huang, 1996), and a `shoulder` at 277 nm, absent in
caged-biotin, indicates the presence of the p-nitrophenyl phosphate
ester of 17. The concentration of 17 is verified by hydrolysing the
p-nitrophenyl phosphate ester in 0.1M potassium hydroxide and
determining the amount of p-nitrophenyl released (optical density
at 405 nm).
[0328] The purified 17 is also found to be a substrate for PTE
leading to the release of p-nitrophenyl (FIG. 13; monitored by the
change in optical density at 405 nm) with rates that are only about
6 fold slower than those observed with Paraoxon. Notably, unlike
the base-catalysed hydrolysis of 17 which proceeds to completion
(and the PTE-catalysed hydrolysis of Paraoxon), the PTE-catalysed
hydrolysis of 17 proceeds with significant rates only until half of
the substrate has been hydrolysed. The second half of the substrate
could also be hydrolysed, but only in the presence of much higher
quantities of PTE and after long incubations (several hours to
overnight). This is probably due to the fact that there 17 is
comprised of two diastereomers (corresponding to two enantiomers
with regard to the chiral phosphotriester), only one of which is an
effective substrate for the enzyme. Indeed, stereoselectivity was
previously observed with PTE and other chiral phosphotriesters
(Hong & Raushel, 1999).
[0329] Antibodies are generated that would recognise
ethyl-phosphodiesters that are the products of hydrolysis of the
corresponding p-nitrophenyl phosphotriesters. To this end, a
suitable ethylphosphodiester derivative is synthesised and
conjugated to carrier proteins as described below (FIG. 14).
[0330] EtNPBG (18) (Glutaric anhydride (180 mg; 1.6 mmol) and
triethylamine (0.22 ml; 1.6 mmol) are added to 12 (prepared by
de-protection of 1.6 mmol of 11, as described above) in DCM (15
ml). The solution is stirred for 20 minutes, triethylamine (0.12
ml; 0.85 mmol) is added, and the solution stirred for an additional
1 hour. DCM is added (20 ml), and the solution extracted twice with
1M Na.sub.2HPO.sub.4 (pH 4) and then dried over MgSO.sub.4. The
solvents are removed under vacuum to give a syrup that is purified
by column chromatography on silica (solvent: 12.5% methanol in DCM
plus 0.1% acetic acid) to give 445 mg of 18 (a syrup).
[0331] Substrate conjugates EtNPBG-KLH and EtNPBG-KLH.
Carbonyldiimidazole (CDI; 32 mg, 200 .mu.mol) is added to a
solution of 18 (60 mg, 134 .mu.mol) in DMF (1 ml). The solution is
stirred for 60 minutes at room temperature. Aliquots of the
activated 18 are then added to 5 mg/ml solutions of bovine serum
albumin (BSA) or keyhole limpet hemocyanin (KLH) in 0.1M phosphate
pH 8.0 (at 0.5 to 4 .mu.mole of 18 per mg protein). The reactions
are stirred for 1 hour at room temperature, and the resulting
protein conjugates are dialysed extensively against phosphate
buffer saline (PBS) at 4.degree. C. The level of conjugation
(hapten density or Hd) is determined by hydrolysing a sample of the
dialysed conjugates in 0.1M potassium hydroxide and monitoring the
amount of released p-nitrophenyl (at 405 nm). These are found to
be: 8.5 to 24 EtNPBG molecules per BSA molecule and 14 to 63 per
KLH molecule depending on the amount of activated 18 added to the
protein samples.
[0332] Product conjugates EtBG-KLH and EtBG-KLH. The EtNPBG-KLH and
EtNPBG-KLH conjugates described above are dialysed against 0.1M
carbonate pH 11.8 for 44 hours at room temperature, and then
extensively against PBS (at 4.degree. C.).
[0333] Anti-EtBG antibodies were elicited in rabbits by
immunisation with EtBG-KLH (Hd=14) using published protocols
(Tawfik et al., 1993; Tawfik et al., 1997) (gift of Prof. Z Eshhar,
Weizmann Institute of Science, Rehovot). Sera are tested by ELISA
for binding to both the substrate conjugate EtNPBG-BSA (Hd-8.5) and
the corresponding product conjugate (EtBG-BSA; Hd=8.5). The first
bleed from one of the immunised rabbits (when diluted-500 fold or
more) exhibits the desirable selectivity, yielding high signal when
incubated with the product conjugate and a low background (<20%)
with the substrate conjugate. Diluting the sera in COVAp buffer (2M
NaCl, 10 g, 1 MgSO.sub.47H.sub.2O, 0.04% Tween-20, 10 mM phosphate,
0.1 mM p-nitrophenyl, pH 6.5) further increases selectivity, with
background levels going below 5%. The anti-EtBG serum is purified
using a HiTrap Protein A column (Pharmacia). The purified rabbit
antibodies are labelled with an Alexa Fluor 488 protein labelling
kit (Molecular Probes) according to the manufacturer's
instructions.
[0334] 10 .mu.l (.about.2.times.10.sup.8 beads) of 0.95 .mu.m
streptavidin-coated microbeads (Bangs, .about.2.times.10.sup.7
beads per .mu.l suspension) are spun in a microfuge at 10,000 g for
3 min. and the supernatant removed. The beads are resuspended in 10
.mu.l of 50 mM Tris pH 8.3 containing EtNP-Bz-Glu-caged Biotin (17)
to give a final concentration of 10 .mu.M, 20 .mu.M or 30 .mu.M.
PTE is expressed in vitro by transcription/translation of
OPD.LMB3-2biotin DNA fragments (at 5 nM). A commercial preparation
is used (E. coli S30 Extract. System for Linear Templates; Promega)
supplemented with T7 RNA polymerise (2,000 units) and the reactions
are incubated at 25.degree. C. for 1.5 hours. The PTE is then
assembled by the addition of Potassium Carbonate (10 mM) and Cobalt
Chloride (1 mM) in Tris buffer (10 mM pH 8.0) and incubating for
overnight at 4.degree. C. Another enzyme, that does not exhibit
phosphotriesterase activity, methyltransferase HaeIII, is also
expressed in vitro by transcription/translation from
M.HaeIII.LMB3-2biotin DNA fragments (at 5 nM), and then treated
with carbonate and cobalt as with the PTE. 5 .mu.l aliquot of the
above reaction mixtures are added to the bead suspensions and the
reactions are incubated for 1 hour at 25.degree. C. in the dark.
The reaction is stopped by the addition of 15 .mu.l 0.1 M sodium
acetate, pH 5.0 and transferred to ice. Each reaction is then split
into two aliquots of 15 .mu.l each, one of which is placed as a
spot on a layer of parafilm on the surface of an ice-cooled
aluminium block. This aliquot is then irradiated for 2 min with a B
100 AP UV lamp (UVP) held at a distance of .about.6 cm. The other
aliquot is left in the dark. All bead samples are then incubated
for 30 minutes at ambient temperature and washed three times with
200 .mu.l PBS. 0.1% Tween 20 in a 0.45 .mu.m MultiScreen-HV filter
plate (Millipore, MAHVN4510), thoroughly resuspending between each
wash. Beads (.about.2.times.10.sup.7) are then resuspended in 200
.mu.l COVAp containing 100 ng/.mu.l Alexa-488 labelled rabbit
anti-EtBG antibodies and incubated for 1 hour at room temperature
and then 1 hour at 4.degree. C. The beads were washed three times
with 200 .mu.l PBS, 0.1% Tween 20 as above, then resuspended in 1
ml PBS, 0.1% Tween 20 and 10,000 events analysed using a FACScan
flow-cytometer (Becton Dickinson).
[0335] As can be seen in FIG. 15, up to 20-fold increase in mean
bead fluorescence is observed following the PTE catalysed
hydrolysis of EtNP-Bz-Glu-caged Biotin in the presence of
streptavidin-coated beads and after UV irradiation. This is
increase is observed relative to beads treated essentially the same
but in the presence of another enzyme (M.HaeIII), with no
phosphotriesterase activity. Notably, the differences in
fluorescence signal are observed when both the PTE and the
M.HaeIII, are expressed in vitro from the corresponding genes and
are added together with the entire content of the in vitro
transcription/translatio- n reaction mixture.
[0336] At high substrate concentrations the observed mean
fluorescence is lower than observed at 20 .mu.M. In addition, at
substrate concentrations above 20 .mu.M, there is essentially no
difference in the fluorescence signal between reactions kept in the
dark and those UV irradiated (data not shown). Since the beads,
under the reaction conditions described above, start to exhibit
saturation of binding signal at concentrations above 10 .mu.M (of
product as detected by the subsequent addition of
fluorescently-labelled anti-EtBG antibodies), these results may be
explained by the presence of a contamination of ETNP-Bz-Glu-Biotin
in the preparation of EtNP-Bz-Glu-caged Biotin. These results are
also consistent with the previously observed background
immobilisation of caged-biotin to avidin `in the dark` (i.e.,
without UV illumination) which was as high as 15% of the signal
observed after illumination (Sundberg et al. 1995). The `dark`
signal observed previously was ascribed to either trace
contaminants of biotin in the caged-biotin preparation, or to weak
interactions between avidin and components of the caged-biotin
including the linker (Sundberg et al. 1995). Both mechanisms may
account for the fact that at high concentrations of
caged-biotinylated substrate (and above the binding capacity of the
beads), the `dark` signal becomes significant. Nevertheless, at
Substrate concentrations of 20 .mu.M, or lower, the `dark` signal
constitutes only 25%, or even less than 10% (e.g., at 10 .mu.M
EtNP-Bz-Glu-caged Biotin) of the illuminated signal. This indicates
that most of the PTE-catalysed hydrolysis of EtNP-Bz-Glu-caged
Biotin takes place whilst the substrate is in solution and not
attached to the beads, and that the resulting product
(Et-Bz-Glu-caged Biotin), after illumination with UV light, is
un-caged and becomes immobilised onto the microbeads.
Example 10
[0337] Genes Attached to Beads are Expressed In Vitro and the
Resulting Gene-Products (Enzymes) Become Immobilised to the
Microbeads Whilst Retaining Catalytic Activity. The Immobilised
Enzyme Catalyses a Reaction with a Caged-Biotinylated Substrate,
and the Resulting Caged-Biotinylated Product is Subsequently
Uncaged by UV Irradiation and Becomes Attached to These Beads
Together with the Gene Encoding the Enzyme that Led to its
Formation. Subsequently, These Beads are Detected by
Flow-Cytometry.
[0338] One format for the selection of genetic elements is where
the genetic element comprises a gene linked to a microbead, which
is translated in a microcapsule, and the translated gene-product is
coupled back onto the microbead within the microcapsule. Thus,
compartmentalisation leads to the formation of complexes of
gene-products (e.g., proteins or enzymes) attached to the gene
encoding them. These complexes could be subsequently selected for
binding a ligand (see Example 12), or for enzymatic activity via a
second compartmentalised reaction.
[0339] For such complexes to be selected for catalytic activity, a
soluble substrate should be available for the immobilised enzyme,
and, once the catalytic reaction had been completed, the product of
the enzymatic activity that is being selected for should become
attached to the gene encoding this enzyme. The resulting complexes
could be then sorted or selected by virtue of the product being
linked to them, for example by using a fluorescently-labelled
antibody that recognises the product. In other compartments,
containing complexes of genes and gene-products that do not exhibit
the desired enzymatic activity, the unreacted substrate would
become linked to the gene. These complexes will not be labelled
with the product and will therefore be discarded.
[0340] Here it is shown that an enzyme (phosphotriesterase or PTE)
can be transcribed and translated in vitro from genes attached to
microbeads and the translated enzyme is bound back to the
microbeads. The translated enzyme can be then modified to
incorporate the active-site Cobalt, and its catalytic activity is
retained whilst it is bound to the microbead together the gene that
encodes it. The immobilised PTE subsequently reacts with a
caged-biotinylated substrate, and the caged-biotinylated product
generated is uncaged by UV irradiation and captured onto the same
avidin-coated beads to which the gene encoding the PTE is attached.
Subsequently these beads are detected by flow-cytometry and are
clearly distinguished from beads carrying a gene encoding a protein
that does not exhibit phosphotriesterase activity.
[0341] Aliquots of a suspension of 0.95 .mu.m streptavidin-coated
microspheres (Bangs, .about.2.times.10.sup.7 beads per .mu.l
suspension) are spun in a microfuge at 10,000 g for 3 min. The
supernatant is removed and the beads resuspended in TNT buffer
(0.1M Tris 7.5, 0.15M NaCl, 0.05% Tween-20). An antibody, capable
of binding the Flag peptide and biotinylated (BioM5, a
biotin-labelled anti-Flag antibody; Sigma) is added to the bead
suspensions to give an average of 10.sup.4 antibody molecules per
bead and the mixture is incubated for several hours. The beads are
rinsed by spinning down and resuspending them in TNT buffer to the
original volume. Biotinylated DNA fragments
N-Flag-OPD.LMB3-2biotin, or fragments that carry the T7 RNA
polymerise promoter, the phase T7 gene 10 transitional start site
and a gene encoding a different enzyme (also tagged with N-Flag
peptide), e.g., methyltransferase
HaeIII-N-Flag-M.HaeIII.LMB3-2biotin) are added to the suspension of
antibody-coated beads at 1.6 nM concentration and the mixture is
incubated overnight at 4.degree. C. The beads are rinsed 3 times by
spinning down and resuspending them in TNT buffer.
[0342] 50 .mu.l aliquots of the above suspension of beads
(.about.10.sup.9 beads) are spun in a microfuge at 10,000 g for 3
min. The supernatant is removed and the beads gently resuspended,
on ice, in 50 .mu.l of a prokaryotic in vitro coupled
transcription/translation system designed for linear templates
(Lesley et al., 1991). A commercial preparation of this system is
used (E. coli S30 Extract System for Linear Templates; Promega)
supplemented with T7 RNA polymerise (2,000 units). The reactions
are incubated at 25.degree. C. for 1.5 hours and spun in a
microfuge at 10,000 g for 3 min. The supernatant is removed and the
beads resuspended in 100 .mu.l of 50 mM Tris, 10 mM of potassium
carbonate, pH 8.0. An aqueous solution of Cobalt Chloride is added
to a concentration of 1 mM and the reactions incubated for 2 hours
at room temperature. The beads are rinsed 4 times by spinning down
and resuspending them in TNT buffer. Finally, beads are resuspended
in TNT buffer to the original volume.
[0343] Aliquots of the above beads are added to solutions of 0.25
mM Paraoxon in 50 mM Tris pH 8.3. The beads are incubated at
25.degree. C. with occasional stirring for different periods of
time. The beads are spun in a microfuge at 10,000 g for 3 min, the
supernatant is removed and its optical density measured at 405 nm.
A significant change in optical density at 405 nm is observed when
beads to which biotinylated DNA fragments N-Flag-OPD.LMB3-2biotin
are attached (and are subsequently reacted as described above) in
contrast to reactions conducted under the same conditions but in
the absence of beads or phosphotriesterase, or with beads to which
N-Flag-M.HaeIII.LMB3-2biotin DNA fragments are attached and are
subsequently reacted as described above.
[0344] Next, 10 .mu.l (.about.2.times.10.sup.8 beads) of the above
beads are spun in a microfuge at 10,000 g for 3 min. and the
supernatant removed. The beads are resuspended in 10 .mu.l of 12.5
or 25 .mu.M EtNP-Bz-Glu-caged Biotin in 50 mM Tris pH 8.3. The bead
suspensions are incubated for 1.5 hour at 25.degree. C. in the
dark. The reaction is stopped by the addition of 10 .mu.l 0.1 M
sodium acetate, pH 5.0 and transferred to ice and irradiated for 2
min with a B 100 AP UV lamp (UVP) held at a distance of .about.6
cm. All bead samples are then incubated for 30 minutes at ambient
temperature and then washed three times with 200 .mu.l PBS, 0.1%
Tween 20 in a 0.45 .mu.m MultiScreen-HV filter plate (Millipore,
MAHVN4510), thoroughly resuspending between each wash. Beads
(.about.7.times.10.sup.7) are then resuspend in 125 .mu.l of a
rabbit anti-EtBG serum diluted 1:125 in COVAp and incubated for
overnight at 4.degree. C. The beads are washed once with 200 .mu.l
COVAp and then 3 times with 200 .mu.l PBS, 0.1% Tween 20 as above
and are resuspended in 200 .mu.l PBS, 0.1% Tween 20. 70 .mu.l of
the above bead suspensions (.about.2.times.10.sup.7) are added to
50 .mu.l of 40 ng/.mu.l FITC-labelled goat anti rabbit Fab (Jackson
115-095-006) in PBS, 0.1% Tween 20 and incubated 1 hour at room
temperature. The beads are washed 3 times with 200 .mu.l PBS, 0.1%
Tween 20 as above, then resuspended in 1 ml PBS, 0.1% Tween 20 and
10,000 events analysed using a FACScan flow cytometer (Becton
Dickinson).
[0345] Consequently, as seen in FIG. 16, beads to which genes
encoding the phosphotriesterase tagged with the Flag peptide were
attached (along with an antibody that binds the Flag peptide) could
be clearly distinguished from genes to which other genes, encoding
enzymes with no phosphotriesterase activity (e.g.,
N-Flag-M.HaeIII), were attached.
Example 11
[0346] E. coli BirA transcribed and translated in vitro catalyses a
reaction which gives rise to a change in the fluorescence
properties of substrate-labelled microspheres in the aqueous
compartments of a water-in oil emulsion.
[0347] The gene encoding a peptide from Propionibacterium shermanii
which is biotinylated in vivo in E. coli is amplified using
oligonucleotides BCCP5 and BCCP3 from the vector Pinpoint Xa-1
(Promega). The PCR fragment is cloned into the vector pET-23d
(FLAG) digested with BamHI and HindIII, downstream of a T7 RNA
polymerase promoter and the phage T7 gene 10 translational start
site, and in frame with an N-terminal FLAG peptide-coding region;
this vector is termed pET-23d (FLAG-BCCP). The vector pET-23d
(FLAG) is identical to the vector pET-23d (Novagen) except for the
region between the unique NcoI and BamHI sites, which has been
modified to include an N-terminal FLAG peptide-coding region as
shown below in Scheme 2. In order to append a hexahistidine tag to
the C-terminus of the protein, the two oligonucleotides BCCPHis+
and BCCPHis- were annealed and then ligated into the vector pET-23d
(FLAG-BCCP) digested with SacI and NotI, yielding the vector
pET-(FLAG-BCCP-His). The protein FLAG-BCCP-His (termed FBH) is
overexpressed in strain C41(DE3) (Miroux & Walker, 1996),
harvested and purified with Ni-NTA agarose (Qiagen) under native
conditions, following the manufacturer's protocol. Biotinylated
protein is depleted by incubation with an equal volume of
avidin-agarose (Sigma), pre-equilibrated with a wash buffer (50 mM
NaH.sub.2PO.sub.4, pH 8.0; 300 mM NaCl; 20 mM imidazole) for 1 hour
at 4.degree. C. The suspension is then centrifuged at 10,000 g for
2 minutes and the supernatant retained, aliquoted and stored in
liquid nitrogen (long-term) or at 4.degree. C.
2 M D Y K D D D D K M H G N E G
------TATACCATGGACTACAAAGATGACGATGATAAAATGCATGGCAACGAAGGT
pET-23d-NcoI site (appended FLAG coding region) T
ACCGGATCC----------------------------AAGCTT BamHI site of pET-23d
HindIII site Scheme 2
[0348] The gene encoding E. coli BirA was amplified by PCR using
oligonucleotides BirA5 and BirA3 from a pBluescript 2SK+ vector
containing the E. coli BirA gene (gift from P. Wang, unpublished).
The PCR fragment is cloned into the vector pGEM-4Z (K2) digested
with KpnI and XhoI downstream of the lac promoter, T7 RNA
polymerase promoter and the efficient phage T7 gene 10
translational start site. The vector pGEM-4Z (K2) is identical to
the vector pGEM-4Z.sup.NcoI (see Example 8, Scheme 1), except for
the region between the unique NcoI and KpnI sites, which has been
modified according to Scheme 3 shown below to contain a unique XhoI
site downstream of the NcoI site.
3 M G G S S ------------CCATGGGGGGCTCGAG- C--------GGTACC---
pGEM-4Z.sup.NcoI---NcoI XhoI KpnI site of pGEM-4Z.sup.NcoI Scheme
3
[0349] DNA sequencing identifies a clone with the correct
nucleotide sequence, termed pGEM-BirA. The pGEM-BirA plasmid
described above is amplified by PCR using primers LMB2 and LMB3 as
above to create a 1139 base pair PCR fragment (BirA_LMB2-3) which
carries the T7 RNA polymerase promoter, the phage T7 gene 10
translational start site and the BirA gene. The PCR fragment is
purified directly using Wizard PCR Preps (Promega).
[0350] 60 .mu.L aliquots (1.2.times.10.sup.9 beads) of 1.0 .mu.m
diameter nonfluorescent goat anti-mouse IgG labelled microspheres
(Bangs Laboratories, CP03N) were spun in a microfuge at
approximately 2,600 g (6,000 rpm) for 3 minutes. The supernatant
was removed and the beads resuspended in 60 .mu.L 0.1 M Tris-HCl,
pH 7.5, 0.15 M NaCl, 0.05% Tween-20, 0.5% BSA. The beads were spun
again, resuspended in 60 .mu.L M5 anti-FLAG antibody (Sigma F4042)
and incubated overnight at 4.degree. C. The beads were spun again
(2,600 g) for 3 minutes, the supernatant was removed, and the beads
were resuspended in a mixture of 30 .mu.L 0.1 M Tris-HCl, pH 7.5,
0.15 M NaCl, 0.05% Tween-20, 0.5% BSA and 30 .mu.L of FBH protein
obtained as above (final protein concentration approx. 4 mg/ml) and
incubated for 1 hour at room temperature.
[0351] Meanwhile, 60 .mu.L aliquots of a prokaryotic in vitro
coupled transcription/translation system designed for linear
templates (Lesley et al., 1991) was prepared, using a commercial
kit (E. coli S30 Extract System for Linear Templates; Promega),
supplemented with T7 RNA polymerase (2,000 units), 10 nM
BirA_LMB2-3 DNA (or no DNA at all). These aliquots were incubated
at 25.degree. C. for 1 hour to allow translation.
[0352] The 60 .mu.L aliquots of beads were spun at 2,600 g (6,000
rpm) in a microfuge for 3 minutes and the supernatant removed. They
were resuspended in 60 .mu.L of 0.1 M Tris-HCl, pH 7.5, 0.15 M
NaCl, 0.05% Tween-20, 0.5% BSA, respun and the supernatant removed.
Finally they were resuspended on ice in a 54 .mu.L aliquot of the
prokaryotic in vitro coupled transcription/translation reactions
described above, supplemented with 3 .mu.L of 2 mM d-biotin and 3
.mu.L of 0.2 M ATP.
[0353] A 5 .mu.l aliquot was removed from each reaction mixture and
left non-emulsified. 50 .mu.l of the remaining reaction mixture was
emulsified essentially as Tawfik & Griffiths (1998).
[0354] The oil phase was freshly prepared by dissolving 4.5% (v/v)
Span 80 (Fluka) in mineral oil (Sigma, #M-5904) followed by 0.5%
(v/v) Tween 80 (SigmaUltra; #P-8074). Ice-cooled reaction mixtures
were added gradually (in 5 aliquots of 10 .mu.l over .about.2
minutes) to 1.0 ml of ice-cooled oil-phase in a 5 ml Biofreeze Vial
(Costar, #2051) whilst stirring with a magnetic bar (8.times.3 mm
with a pivot ring; Scientific Industries International,
Loughborough, UK). Stirring (at 1150 rpm) was continued for an
additional 1 minute on ice.
[0355] All reactions were incubated for 4 hours at 37.degree. C. to
allow the biotinylation reaction to proceed.
[0356] The emulsions were transferred to 1.5 ml microfuge tubes,
spun 1 min. 13.5 k rpm in a microfuge and the oil phase removed
leaving the concentrated (but still intact) emulsion at the bottom
of the tube. 200 .mu.l 0.1 M Tris-HCl, pH 7.5, 0.15 M NaCl, 0.05%
Tween-20, 0.5% BSA were added and the emulsion broken by extracting
4 times with 1 ml hexane, vortexing between each hexane addition.
Residual hexane was removed by spinning for 10 min at ambient
temperature under vacuum in a Speedvac (Farmingdale, N.Y.).
[0357] Approximately 1.times.10.sup.8 beads from the broken
emulsions and the non-emulsified reactions were then washed twice
with 100 .mu.l TNT/BSA in a 0.45 .mu.m MultiScreen-HV filter plate
(Millipore, MAHVN4510), thoroughly resuspending between each wash.
Beads were then resuspend in 50 .mu.l 0.1 M Tris-HCl, pH 7.5, 0.15
M NaCl, 0.05% Tween-20, 0.5% BSA containing 1 .mu.L of a
streptavidin-HRP solution (provided with the NEN TSA.TM.-Direct
kit) and incubated for 30 minutes at ambient temperature. The beads
were washed twice with 100 .mu.l 0.2 M Tris, 10 mM imidazole, pH
8.8, as above, then resuspended in 50 .mu.L 0.2 M Tris, 10 mM
imidazole, pH 8.8, 0.01% H.sub.2O.sub.2. 1 .mu.L of a fluorescein
tyramide stock solution (made up according to the manufacturer's
instructions (NEN TSA.TM.-Direct kit)) was added, and the reaction
left to proceed for ten minutes. The beads were washed twice with
PBS, as above, and finally resuspended in a total of 500 .mu.L PBS,
transferred to a 5 ml polystyrene round-bottomed tube (Falcon) and
10,000 events analysed using a FACScan flow cytometer (Becton
Dickinson).
[0358] As can be seen from FIG. 17, both in emulsified and
non-emulsified reactions, the reaction catalysed by in vitro
translated BirA results in beads with higher fluorescence than when
no enzyme was present. It appears that beads which have been
incubated in an emulsion with in vitro translated BirA are more
fluorescent than beads which have not been incubated in
emulsions.
Example 12
[0359] A change in fluorescence of genetic elements can be used to
selectively enrich genetic elements encoding peptides with a
binding activity. The fluorescently labelled genetic elements are
isolated by flow cytometric sorting.
[0360] One format for the selection of genetic elements is where
the genetic element comprises a gene linked to a microbead, which
is translated in a microcapsule, and the translated gene-product is
coupled back onto the microbead within the microcapsule. Thus,
compartmentalisation leads to the formation of complexes of
gene-products attached to the gene encoding them. These complexes
can subsequently be selected for binding to a ligand by flow
cytometric sorting if the binding interaction results in a change
in microbead fluorescence.
[0361] pET-23d (FLAG) vector encodes N-terminal FLAG-peptide fused
to the polylinker region of pET23d (Novagen). pET23d was digested
with Nco I/BamH I, gel purified and redissolved in water. Two
synthetic phosphorylated oligonucleotiodes (Vh Bio Ltd, Newcastle
upon Tyne, U.K.), FLAG and FLAGas, were mixed at 1 .mu.M
concentration each in water, heated for 3 min at 94.degree. C. and
allowed to cool to room temperature before being added to the
digested vector in the ligation mix. The ligation reaction was used
unpurified to transform E. coli TG-1. Clones containing the insert
were identified by Kpn I digest and verified by sequencing (Oswel
Research Product Ltd, Southampton, U.K.). The polylinker region of
pET-23d (FLAG) is as follows:
4 NcoI KpnI 10 20 30 40 50 CCATGGACTACAAAGATGACGAT-
GATAAAATGCATGGCAACGAAGGTACC 5
GGTACCTGATGTTTCTACTGCTACTATTTTACGTACC- GTTGCTTCCATGG 36 M D Y K D D
D D K 6 < FLAG-peptide tag > BamHI EcoRI SacI SalI HindIII
Not I XhoI 60 70 80 90
GGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCA
CCTAGGCTTAAGCTCGAGGCAGCTGTTCGAACGCCGGCGTGAGCTCGT
[0362] Biotinylated FLAG-HA expression construct was prepared from
the pET-23d (FLAG) vector by PCR. The peptide sequence YPYDVPDYA
from the influenza haemagglutinin was appended to the FLAG-tag in
pET-23d (FLAG) using the primer FLAGHA and the 5'-biotinylated
primer pETrev.b. The amplification product is 903 bases long and
the coding region of the construct is:
5 10 20 30 40 50 ATGGACTACAAAGATGACGATGATAAAATGCATGGCAACGAAGGTACCGG
TACCTGATGTTTCTACTGCTACTATTTTACGTACCGTTGCTTCCATGGCC M D Y K D D D D
K M H G N E G T G < FLAG-peptide tag > 60 70 80 90 100
ATCCGGAGGAGGATATCCGTATGATGTGCCGGATTATGCG- GGAGGAGGATCCTAA
TAGGCCTCCTCCTATAGGCATACTACACGGCCTAATACGCCCTCCTCCTAG- GATT S G G G Y
P Y D V P D Y A G G G S * < HA-peptide tag >
[0363] The competitor construct in the selection process is E. coli
folA gene encoding dihydrofolate reductase amplified from
pET23a/folA using primers pET for and pETrev.b.
[0364] PCR fragments were gel-purified using QIAquick Gel
Extraction kit (Qiagen). DNA concentration was measured by UV
spectrophotometry. Dilutions of PCR-prepared expression constructs
were made in 0.5 mg/ml carrier DNA prepared from Hind III digested
lambda phage DNA (40 min at 80.degree. C., followed by
ethanol-precipitation and dissolution in water).
[0365] 2.times.10.sup.9 streptavidin-coated 0.95 .mu.m polystyrene
beads in a 100 .mu.l aliquot of 1% suspension (Bangs Laboratories,
Inc. CP01N) were spun in a microfuge at approximately 2,600 g
(6,000 rpm) for 3 minutes. The supernatant was removed and the
beads resuspended in 100 .mu.L 0.1 M Tris-HCl, pH 7.5, 0.15 M NaCl,
0.05% Tween-20, 0.5% BSA (TNTB). 7 .mu.l of 2 mg/ml biotinylated
anti-FLAG monoclonal antibody M5 (Sigma) was added to the
resuspended beads and the mix was incubated at room temperature for
two hours. Following coating with the antibody, the beads were
washed for three times with 200 .mu.l TNTB, resuspended in 100
.mu.l TNTB and split into 10 .mu.l aliquots 1 and 2 and 40 .mu.l
aliquots 3 and 4. 0.7 nM stock solution of either, (#1) pure
FLAG-HA DNA,(#2) pure folA DNA, or (#3 and #4) pure FLAG-HA DNA
diluted in a 1000 fold excess of folA DNA were prepared in Hind
III-digested lambda DNA and applied to the bead aliquots. The
binding reaction was allowed to proceed overnight at 4.degree. C.
The maximum number of genes per bead was 2 in aliquots 1-3 and 0.2
in aliquot 4. The beads coated with FLAG-HA construct served as
positive control and the beads coated with folA as negative
control.
6 Ratio folA:FLAG-HA DNA DNA Molecules of S30 Emulsion # DNA Beads
(nM) (.mu.l) DNA/bead (.mu.l) (ml) 1 FLAG-HA -- 2 .times. 10.sup.8
0.7 1 2 25 0.5 2 folA -- 2 .times. 10.sup.8 0.7 1 2 25 0.5 3
folA:HA 1000:1 8 .times. 10.sup.8 0.7 4 2 50 2 .times. 0.5 4
folA:HA 1000:1 8 .times. 10.sup.8 0.7 0.4 0.2 50 2 .times. 0.5
[0366] After overnight incubation at 4.degree. C., the beads were
washed twice in TNTB and resuspended in S30 in vitro translation
mixture (S30 Extract System for Linear Templates, Promega)
supplemented with T7 RNA polymerase (20 units/.mu.l).
[0367] The ice-cooled in vitro translation reactions were added
gradually (in 5 aliquots of 10 .mu.l over .about.2 minutes) to 0.5
ml of ice-cooled oil-phase (freshly prepared by dissolving 4.5%
(v/v) Span 80 (Fluka) in mineral oil (Sigma, #M-5904) followed by
0.5% (v/v) Tween 80 (SigmaUltra; #P-8074) in a 5 ml Costar
Biofreeze Vial (#2051)) whilst stirring with a magnetic bar
(8.times.3 mm with a pivot ring; Scientific Industries
International, Loughborough, UK). Stirring (at 1150 rpm) was
continued for an additional 3 minutes on ice. Reactions were then
incubated 90 min at 30.degree. C.
[0368] The emulsions were transferred to 1.5 ml microfuge tubes,
spun 8 min. 6.5 k rpm in a microfuge and the oil phase removed
leaving the concentrated (but still intact) emulsion at the bottom
of the tube. 200 .mu.l 0.1 M Tris-HCl, pH 7.5, 0.15 M NaCl, 0.05%
Tween-20 (TNT) were added and the emulsion broken by extracting 4
times with 1 ml hexane, vortexing between each hexane addition.
Residual hexane was removed by bubbling air through the suspension
of beads for 1-2 min at ambient temperature.
[0369] Beads from the broken emulsions were then washed twice with
100 .mu.l TNT in a 0.45 .mu.m MultiScreen-HV filter plate
(Millipore, MAHVN4510), thoroughly resuspending between each wash.
Beads were then resuspend in TNTB at 10.sup.6 beads/.mu.l and
containing 100 mU/ml rat anti-HA-Peroxidase, High Affinity (3F10)
conjugate (Boehringer Mannheim).
[0370] The beads were incubated with the antibody for 30 minutes at
ambient temperature and washed three times with 200 .mu.l TNT
before being resuspended in 2 ml of 0.2 M Tris, 10 mM imidazole, pH
8.8. The suspended beads were sonicated for 1 min on ice using Heat
Systems sonicator at power 1, 95% cycle, 3.4 mm tip. The sonicated
beads were resuspended at 10.sup.8 beads/ml in 0.2 M Tris, 10 mM
imidazole, pH 8.8. To this suspension of beads an equal volume of
tyramine signal amplification (TSA) buffer 0.2 M Tris, 10 mM
imidazole, pH 8.8, 0.004% H.sub.2O.sub.2, 5 .mu.g/ml fluorescein
tyramine was added.
[0371] Fluorescein tyramine was synthesised as described by Hopman
et al. (Anthon H. N. Hopman, Frans C. S. Ramaekers, Ernst J. M.
Speel, The Journal of Histochemistry and Cytochemistry vol 46(6),
771-777, 1998).
[0372] The reaction is left to proceed for five minutes at room
temperature and stopped by addition of {fraction (1/10)}.sup.th of
volume of 10% bovine serum albumin in PBS (BSA, Sigma). The beads
were spun down in 2 ml aliquots of the labelling reaction and
washed 2 times in TNTB and once in PBS. Finally the beads were
resuspended in 2 ml of PBS and sonicated as above.
[0373] The beads coated with genes encoding folA, FLAG-HA or
1000-fold dilution of FLAG-HA in folA were analysed on a Becton
Dickinson FACScan flow cytometer.
[0374] In FIG. 18, low resolution histogram A demonstrates that the
beads carrying FLAG-HA DNA (sample #1) are significantly more
fluorescently labelled than the negative control folA (sample #2).
The spiked mixtures #3 and #4 run predominantly identically to
negative control sample except for a small number of highly
fluorescent beads (panel B). 0.04% of beads in sample #3 and 0.02%
of beads in sample #4 fell into the region M1 that covers 95% of
positive events.
[0375] The beads in samples #3 and #4 that fell into region M1 were
sorted using a MoFlo fluorescence-activated cell sorter. Two sets
of sorted beads were acquired for both samples #3 and #4. In set
one 500 beads were collected into a single tube. In set two 96
beads were collected individually into the wells of a 96-well
plate. Both sets of beads were subjected to 35-cycle PCR using
primers pETrev.b and FLAGrev1.
[0376] The amplification products were analysed by gel
electrophoresis (FIG. 19). The product sizes are 903 bases for
FLAG-HA and 1390 bp for folA.
[0377] The gel electrophoretic analysis of the amplification
reaction products suggests significant enrichment during the course
of sorting. In panel A there are no FLAG-HA bands visible on the
lanes of the products amplified from unsorted reactions #3 and #4
whereas the FLAG-HA band in the samples from the sorted beads is
strongly visible. Definitive data regarding the nature of the
amplified DNA were obtained from the analysis of DNA amplified from
single beads. In total 22 beads out of 96 yielded a DNA product for
reaction #3 and 50% of these were pure FLAG-HA. For reaction #4 9
beads yielded products and 8 were FLAG-HA.
[0378] Single-bead data for reaction #3 suggests that at the
concentration applied, nominally 2 DNA molecules/bead, most of the
beads in fact have only one gene attached allowing unambiguous
linkage between the gene and its product. Relatively high number of
positively labelled beads meant however that about 50% of the beads
recovered were false positives. In sample #4 where there were only
0.1 genes/bead the purity of the recovered DNA approached 90%,
indicating nearly 1000-fold enrichment in one step.
7 Oligonucleotides EDHFR-Fo 5'-CGA GCT AGA GGT ACC TTA (SEQ ID 9)
TTA CCG CCG CTC CAG AAT CTC AAA GCA ATA G-3' EDHFR-Ba 5'-GCA TCT
GAC AAG CTT AAT (SEQ ID 10) AAT TTT GTT TAA CTT TAA GAA GGA GAT ATA
CAT ATG ATC AGT CTG ATT GCG GCG TTA GCG GTA G-3' LMB2-
5'-Biotin-GTA AAA CGA CGG (SEQ ID 11) Biotin CCA GT-3' folA-FW
5'-GCG CGA AGC TTC GAT CAG SEQ ID 12 TCT GAT TGC GGC G-3' folA-BW
5'-GCG CCT CGA GTT CCG CCG (SEQ ID 13) CTC CAG AAT CTC-3' pETfor.b
5'-Biotin-GAC TCC AAC GTC (SEQ ID 14) AAA GGG CG-3' pETrev.b
5'-Biotin-GGT TTT CAC CGT (SEQ ID 15) CAT CAC CG-3' GFP-FW 5'-GCG
CGA AGC T TCG AGT (SEQ ID 16) AAA GGA GAA GAA CTT TTC-3' GFP-BW
5'-GCG CCT CGA GTT TTG TAT (SEQ) ID 17) AGT TCA TCC ATG CCA TG-3'
GSTM2-2Fo 5'-TGA TGC CGG TAC CTT ATT (SEQ ID 18) ACT TGT TGC CCC
AGA CAG CC-3' GSTM2-2Ba 5'-AGT TAA GTC TAA GCT TAA (SEQ ID 19) TAA
TTT TGT TTA ACT TTA AGA AGG AGA TAT ACA TAT GCC CAT GAC ACT GGG GTA
C-3' LMB2 5'-GTA AAA CGA CGG CCA GT- SEQ ID 20 3' LMB3 5'-CAG GAA
ACA GCT ATG AC- SEQ ID 21 3' N-Flag- 5'-TCG ATA CGT CGG TAC CTT SEQ
ID 22 OPD-Fo ATT ATG ACG CCC GCA AGG TCG GTG-3' N-Flag- 5'-CAT TGC
CAA GCC ATG GAC SEQ ID 23 OPD-Bc TAC AAA GAT GAC GAT GAT AAA ATC
ACC AAC AGC GGC GAT CGG ATC AAT ACC G-3' BCCP5 5'-CTA GGT CAT GGA
TCC ATG SEQ ID 24 AAA CTG AAG GTA ACA GTC AAC GGC-3' BCCP3 5'-CAG
ATA GCT AAG CTT TTA SEQ ID 25 TTA TTC GAT GAG CTC GAG ATC CCC-3'
BCCPHis+ 5'-CAT CGA AGG TGG CAG CTC SEQ ID 26 TGC-3' BCCPHis-
5'-GGC CGC AGA GCT GCC ACC SEQ ID 27 TTC GAT GAG CT-3' BirA5 5'-ATC
GTA GCA CTC GAG CAT SEQ ID 28 GAA GGA TAA CAC CGT GCC A-3' BirA3
5'-GTC ATG ACT GGT ACC TTA SEQ ID 29 TTA TTT TTC TGC ACT ACG CAG-3'
FLAG 5'-CAT GGA CTA CAA AGA TGA SEQ ID 30 CGA TGA TAA AAT GCA TGG
CAA CGA AGG TAC CG-3' FLAGas 5'-GAT CCG GTA CCT TCG TTG SEQ ID 31
CAT GCA TTT TAT CAT CGT CAT CTT TGT AGT C-3' FLAGHA 5'-AAC TCA GCT
TCC TTT CGG SEQ ID 32 GCT TTG TTA GGA TCC TCC TCC CGC ATA ATC CGG
CAC ATC ATA CGG ATA TCC TCC TCC GGA TCC GGT ACC TTC GTT GCC-3'
pETrev.b 5'-biotin-GGT TTT CAC CGT SEQ ID 33 CAT CAC CG-3' pETfor
5'-GAC TCC AAC GTC AAA GGG SEQ ID 34 CG-3' FLAGrev1 5'-AAC TCA GCT
TCC TTT CGG SEQ ID 35 GC-3'
REFERENCES
[0379] Anderson, C. W., Straus, J. W. and Dudock, B. S. (1983)
Methods Enzymol, 101, 635-44.
[0380] Anderson, J. E. (1993) Curr. Op. Struct. Biol., 3,
24-30.Ash, M. and Ash, I. (1993) Handbook of industrial
surfactants. Gower, Aldershot.
[0381] Atwell, S. & Wells, J. A. (1999). Proc. Natl. Acad. Sci.
USA 96, 9497-9502.
[0382] Baccanari, D. P., Averett, D., Briggs, C. and Burchall, J.
(1977) Biochemistry, 16, 3566-72. Barany, F. (1991) PCR Methods
Applic., 1, 5-16.
[0383] Baez. S., Segura-Aguilar, J., Widersten, M., Johansson,
A.-S. & Mannervik, B. (1997) Biochem. J 324, 25-28.
[0384] Bass, S., Greene, R. and Wells, J. A. (1990) Proteins, 8,
309-14.
[0385] Becher, P. (1957) Emulsions: theory and practice. Reinhold,
New York. Benita, S., Ed. (1996). Microencapsulation: methods and
industrial applications. Drugs and pharmaceutical sciences. Edited
by Swarbrick, J. New York: Marcel Dekker.
[0386] Benner, S. A. (1994) Trends Biotechnol, 12, 158-63.
[0387] Berman, J., Eisenberg, S. and Tye, B. K. (1987) Methods
Enzymol, 155, 528-37.
[0388] Betlach, L., Hershfield, V., Chow, L., Brown, W., Goodman,
H. M. & Boyer, H. W. (1976). A restriction endonuclease
analysis of the bacterial plasmid controlling the EcoRI restriction
and modification of DNA. Federation Proceedings 35, 2037-2043.
[0389] Blattner, F. R. and Dahlberg, J. E. (1972) Nature New Biol,
237, 227-32.
[0390] Bougueleret, L., Schwarzstein, M., Tsugita, A. & Zabeau,
M. (1984). Characterization of the genes coding for the Eco RV
restriction and modification system of Escherichia coli. Nucleic
Acids Res 12(8), 3659-76.
[0391] Bru, R. & Walde, P. (1991). Product inhibition of
alpha-chymotrypsin in reverse micelles. Eur J Biochem 199(1),
95-103. Bru, R. & Walde, P. (1993). Catalytic activity of
elastase in reverse micelles. Biochem Mol Biol Int 31(4),
685-92.
[0392] Brynes, P. J., Andrade, P. & Gordon D. (1982). Sensitive
fluorogenic substrates for the detection of trypsin-like proteases
and pancreatic elastase. Anal. Biochem. 126, 447.
[0393] Cahill, P., Foster, K. and Mahan, D. E. (1991) Clin Chem,
37, 1482-5.
[0394] Chakrabarti, A. C., Breaker, R. R., Joyce, G. F. &
Deamer, D. W. (1994). Production of RNA by a polymerase protein
encapsulated within phospholipid vesicles. J Mol Evol 39(6),
555-9.
[0395] Chamberlin, M. and Ring, J. (1973) J Biol Chem, 248,
2235-2244.
[0396] Chang, T. M. (1987). Recycling of NAD (P) by multienzyme
systems immobilized by microencapsulation in artificial cells.
Methods Enzymol 136(67), 67-82.
[0397] Chang, T. M. S. (1992). Recent advances in artificial cells
based on microencapsulation. In Microcapsules and nanoparticles in
medicine and pharmacy (Donbrow, M., ed.), pp. 323-339. CRC Press,
Boca Raton, Fla.
[0398] Chapman, K. B. and Szostak, J. W. (1994) Curr. op. Struct.
Biol., 4, 618-622.
[0399] Chetverin, A. B. and Spirin, A. S. (1995) Prog Nucleic Acid
Res Mol Biol, 51, 225-70.
[0400] Clackson, T. and Wells, J. A. (1994) Trends Biotechnol, 12,
173-84.
[0401] Cormack, B. P., Valdivia, R. H. & Falkow, S. (1996).
FACS-optimized mutants of the green fluorescent protein (GFP). Gene
(33).
[0402] Craig, D. et al. (1995). Fluorescence-based enzymatic assay
by capillary electrophoresis laser-induced fluorescence detection
for the determination of a few .beta.-galactosidase molecules.
Anal. Biochem. 226, 147.
[0403] Creagh, A. L., Prausnitz, J. M. & Blanch, H. W. (1993).
Structural and catalytic properties of enzymes in reverse micelles.
Enzyme Microb Technol 15(5), 383-92.
[0404] Cull, M. G., Miller, J. F. and Schatz, P. J. (1992) Proc
Natl Acad Sci USA, 89, 1865-9.
[0405] Delagrave, S., Hawtin, R. E., Silva, C. M., Yang, M. M.
& Youvan, D. C. (1995). Red-shifted excitation mutants of the
green fluorescent protein. Biotechnology N Y 13(2), 151-4.
[0406] Demartis, S., Huber, A., Viti, F., Lozzi, L., Giovannoni,
L., Neri, P., Winter, G. & Neri, D. (1999). J. Mol. Biol. 286,
617-633.
[0407] Dickinson, E. (1994) In Wedlock, D. J. (ed.), Emulsions and
droplet size control. Butterworth-Heine-mann, Oxford, Vol. pp.
191-257.
[0408] Ehrig, T., O'Kane, D. J. & Prendergast, F. G. (1995).
Green-fluorescent protein mutants with altered fluorescence
excitation spectra. Febs Lett 367(2), 163-6.
[0409] Ellington, A. D. and Szostak, J. W. (1990) Nature, 346,
81822.
[0410] Ellman, J., Mendel, D., Anthony, C. S., Noren, C. J. and
Schultz, P. G. (1991) Methods Enzymol, 202, 301-36.
[0411] Fahy, E., Kwoh, D. Y. and Gingeras, T. R. (1991) PCR Methods
Appl, 1, 25-33.
[0412] Fields, S. & Song, O. (1989) A novel genetic system to
detect protein-protein interactions. Nature 340, 245-6.
[0413] Finch, C. A. (1993). Encapsulation and controlled release.
Spec. Publ. -R. Soc. Chem. 138, 35.
[0414] Fisch, I., Konterrnann, R. E., Finnem, R., Hartley, O.,
Soler, G. A., Griffiths, A. D. and Winter, G. (1996) ProcNatl Acad
Sci USA, 93, 7761-6.
[0415] Fornusek, L. and Vetvicka, V. (1986). Polymeric microspheres
as diagnostic tools for cell surface marker tracing. Crit. Rev.
Ther. Drug Carrier Syst. 2, 137-74
[0416] Freese, E. (1959) J. Mol. Biol., 1, 87.
[0417] Friedberg, E. C., Walker, G. C. and Siede, W. (1995) DNA
repair and mutagenesis. ASM Press, Washington D.C.
[0418] Gold, L., Polisky, B., Uhlenbeck, O. and Yarus, M. (1995)
Annu Rev Biochem, 64, 763-97.
[0419] Green, R. and Szostak, J. W. (1992) Science, 258,
1910-5.
[0420] Gregoriadis, G. (1976) Methods Enzymol, 44, 21 8-27.
[0421] Griffiths, A. D., Williams, S. C., Hartley, O., Tomlinson,
I. M., Waterhouse, P., Crosby, W. L., Kontermann, R. E., Jones, P.
T., Low, N. M., Allison, T. J. and et al. (1994) Embo J. 13,
3245-60.
[0422] Guixe, V., Rodriguez, P. H. & Babul, J. (1998).
Ligand-induced conformational transitions in Escherichia coli
phosphofructokinase 2. Biochemistry 37, 13269-75.
[0423] Haber, J., Maslakiewicz, P., Rodakiewicz, N. J. & Walde,
P. (1993). Activity and spectroscopic properties of bovine liver
catalase in sodium bis(2-ethylhexyl)sulfosuccinate/isooctane
reverse micelles. Eur J Biochem 217(2), 567-73.
[0424] Habig, W. H. & Jakoby, W. B. (1981). Methods in
Enzymology, 77, 398-405.
[0425] Hanes, J. & Pluckthun, A. (1997). In vitro selection and
evolution of functional proteins by using ribosome display. Proc.
Natl. Acad. Sci. USA 94, 4937-4942.
[0426] Haugland, R. H. (ed.). (1996). Handbook of Fluorescent
Probes and Research Chemicals, Sixth Edition, Molecular Probes, pp
201-250.
[0427] Heim, R. & Tsien, R. Y. (1996). Engineering green
fluorescent protein for improved brightness, longer wavelengths and
fluorescence resonance energy transfer. Curr Biol 6(2), 178-82.
[0428] Hernanson, G. T. (1996) Bioconjugate techniques. Academic
Press, San Diego.
[0429] Hochuli, E., Dobeli, H. and Schacher, A. (1987) J
Chromatogr, 411, 177-84.
[0430] Hong, S.-B. & Raushel, F. M. (1999). Biochemistry, 38,
1159-1165.
[0431] Hoogenboom, H. R. (1997). Designing and optimizing library
selection strategies for generating high-affinity antibodies.
Trends Biotechnol. 15, 62-70.
[0432] Hoogenboom, H. R., et al., (1991) Nucl. Acids Res., 91,
4133-4137.
[0433] Huang, Z. et al. (1992). A sensitive competitive ELISA for
2,4-dinitrophenyl using 3,6-fluorescein diphosphate as a
fluorogenic substrate. J. Immol. Meth. 149, 261.
[0434] Janda, K. D., Lo, L.-C., Lo, C.-H. L., Sim, M., -M., Wang,
R., Wong, C.-H. and Lemer, R. A. (1997) Science, 275, 945-948.
[0435] Jestin, J.-L., Kristensen, P. & Winter, G. (1999).
Angew. Chem. Int. Ed. Engl. 38, 1124-1127.
[0436] Johannsson, A. (1991) In Price, C. P. and Newman, D. J.
(ed.), Heterogeneous enzyme immunoassays. Stockton Press, New York,
Vol. pp. 295-325.
[0437] Johannsson, A. and Bates, D. L. (1988) In Kemeny, D. M. and
Challacombe, S. i. (ed.) Amplification by second enzymes. John
Wiley, Chichester, Vol. pp. 85-106.
[0438] Jones, L. J. et al. (1997). Quenched BODIPY dye-labeled
casein substrates for the assay of protease activity by direct
fluorescence measurement. Anal. Biochem. 251, 144.
[0439] Joyce, G. F. (1994) Curr. op. Structural Biol., 4,
331-336.
[0440] Kadir, F. H. and Moore, G. R. (1990) Febs Lett, 276,
81-4.
[0441] Kallen, R. G. & Jencks, W. P. (1966). The mechanism of
the condensation of formaldehyde with tetrahydrofolic acid. J.
Biol. Chem. 241, 5851-5863.
[0442] Katanaev, V. L., Kumasov, O. V. and Spirin, A. S. (1995)
Febs Lett, 359, 89-92.
[0443] Keij, J. F., Groenewegen, A. C. & Visser, J. W. M.
(1994) High-speed photodamage cell sorting: An evaluation of the
ZAPPER prototype. Methods in cell biology 42, 371-358.
[0444] Kerker, M. (1983) Elastic and inelastic light scattering in
flow cytometry. Cytometry 4, 1-10
[0445] Klug, A. (1995) Ann N Y Acad Sci, 758, 143-60.
[0446] Klug, A. and Schwabe, J. W. (1995) Faseb T, 9, 597-604.
[0447] Kolb, V. A., Makeyev, E. V., Kommer, A. and Spirin, A. S.
(1995) Biochem Cell Biol, 73, 1217-20.
[0448] Kowalczykowski, S. C., Dixon, D. A., Eggleston, A. K.,
Lauder, S. D. and Rehrauer, W. M. (1994) Microbiol Rev, 58,
401-65.
[0449] Krumdiek, C. L. & Baugh, C. M. (1980) Solid-phase
synthesis of pteroylpolyglutamates.
[0450] Methods Enzymol. pp. 524-529
[0451] Kumar, A., Kumar, A. & Katiyar, S. S. (1989). Activity
and kinetic characteristics of glutathione reductase in vitro in
reverse micellar waterpool. Biochim Biophys Acta 996(1-2), 1-6.
[0452] Landegren, U., Kaiser, R., Sanders, J. and Hood, L. (1988)
Science, 241, 1077-80.
[0453] Lesley, S. A., Brow, M. A. & Burgess, R. R. (1991). Use
of in vitro protein synthesis from polymerase chain
reaction-generated templates to study interaction of Escherichia
coli transcription factors with core RNA polymerase and for epitope
mapping of monoclonal antibodies. J Biol Chem 266(4), 2632-8.
[0454] Lesley, S. A. (1995) Methods Mol Biol, 37, 265-78.
[0455] Leung, D. W., Chen, E. and Goeddel, D. V. (1989) Technique,
1, 11-15.
[0456] Liao, H., McKenzie, T. and Hageman, R. (1986) Proc Natl Acad
Sci USA, 83, 576-80.
[0457] Lim, F. & Sun, A. M. (1980). Microencapsulated islets as
bioartificial endocrine pancreas. Science 210(4472), 908-10.
[0458] Lim, F., Ed. (1984). Biomedical applications of
microencapsulation. Boca Raton, Fla.: CRC Press.
[0459] Lissant, K. J., ed Emulsions and emulsion technology.
Surfactant Science New York: Marcel Dekker, 1974.
[0460] Lissant, K. J., ed. Emulsions and emulsion technology.
Surfactant Science New York: Marcel Dekker, 1984.
[0461] Lorenz, W. W., McCann, R. O., Longiaru, M. & Corrnier,
M. J. (1991). Isolation and expression of a cDNA encoding Renilla
reniformis luciferase. Proc Natl Acad Sci USA 88(10), 4438-42.
[0462] Low, N. M., Holliger, P. H. and Winter, G. (1996) J Mol
Biol, 260, 359-68.
[0463] Lowman, H. B., Bass, S. H., Simpson, N. and Wells, J. A.
(1991) Biochemistry, 30, 10832-8.
[0464] Luisi, P. L. & B., S.-H. (1987). Activity and
conformation of enzymes in reverse micellar solutions. Methods
Enzymol 136(188), 188-216.
[0465] Ma, C., Kudlicki, W., Odom, O. W., Kramer, G. and Hardesty,
B. (1993) Biochemistry, 32, 7939-45.
[0466] Mackenzie, N. M. & Pinder, A. C. (1986). The application
of flow microfluorimetry to biomedical research and diagnosis: a
review. Dev. Biol. Stand. 64, 181-193.
[0467] Magdassi, S., Frenkel, M., Carti, N. and Cazan, R. (1984)
97, 377-379.
[0468] Mahajan, N. P., Linder, K., Berry, G., Gordon, G. W., Heim,
R. & Herman, B. (1998). Bcl-2 and Bax interactions in
mitochondria probed with green fluorescent protein and fluorescence
resonance energy transfer. Nat Biotechnol 16(6), 547-52.
[0469] Manley, J. L., Fire, A., Samuels, M. and Sharp, P. A. (1983)
Methods Enzymol, 101, 568-82.
[0470] Mao, Q. & Walde, P. (1991). Substrate effects on the
enzymatic activity of alpha-chymotrypsin in reverse micelles.
Biochem Biophys Res Commun 178(3), 1105-12.
[0471] Mao, Q., Walde, P. & Luisi, P. L. (1992). Kinetic
behaviour of alpha-chymotrypsin in reverse micelles. A stopped-flow
study. Eur J Biochem 208(1), 165-70.
[0472] Masui, R. & Kuramitsu, S. (1998). Probing of DNA-binding
sites of Escherichia coli RecA protein utilizing
1-anilinonaphthalene-8-sulfonic acid. Biochemistry 37,
12133-12143.
[0473] Matayoshi, E. D. et al. (1990). Novel fluorogenic substrates
for assaying retroviral proteases by resonance energy transfer.
Science 247, 954.
[0474] Mattheakis, L. C., Bhatt, R. R. and Dower, W. J. (1994) Proc
Natl Acad Sci USA, 91, 9022-6.
[0475] McCafferty, J., Griffiths, A. D., Winter, G. and Chiswell,
D. J. (1990) Nature, 348, 552-4.
[0476] Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis,
T., Zinn, K. and Green, M. R. (1984) Nucleic Acids Res, 12,
703556.
[0477] Mendel, D., Cornish, V. W. and Schultz, P. G. (1995) Annu
Rev Biophys Biomol Struct, 24, 435-62.
[0478] Menger, F. M. & Yamada, K. (1979). J. Am. Chem. Soc.
101, 6731-6734.
[0479] Miele, E. A., Mills, D. R. and Kramer, F. R. (1983) J Mol
Biol, 171, 281-95.
[0480] Miroux, B., Walker, J. E. (1996) Journal of Molecular
Biology, 260, 289-298
[0481] Miyawaki, A., Llopis, J., Heim, R., McCaffery, J. M., Adams,
J. A., Ikura, M. & Tsien, R. Y. (1997). Fluorescent indicators
for Ca2+ based on green fluorescent proteins and calmodulin. Nature
388(6645), 882-7.
[0482] Mize. P. D., Hoke, R. A., Linn, C. P., Reardon, J. E. and
Schulte, T. H. (1989) Anal Biochem, 179, 229-35.
[0483] Mock, D. M., Langford, G., DuBois, D., Criscimagna, N. &
Horowitz, P. (1985) Anal. Biochem. 151, 178-181.
[0484] Montigiani, S., Neri, G., Neri, P. and Neri, D. (1996) J Mol
Biol, 258, 6-13.
[0485] Moore, M. J. (1995) Nature, 374, 766-7.
[0486] Mulbry, W. W. & Karns, J. S. (1989) Journal of
Bacteriology, 171, 6740-6746.
[0487] Nemoto, N., Miyamoto-Sato, E., Husimi, Y. and Yanagawa, H.
(1997). In vitro virus: Bonding of mRNA bearing puromycin at the
3'-terminal end to the C-terminal end of its encoded protein on the
ribosome in vitro. FEBS Letters 414, 405-408.
[0488] New, R. R. C., Ed. (1990). Liposomes: a practical approach.
The practical appraoch series. Edited by Rickwood, D. & Hames,
B. D. Oxford: Oxford University Press.
[0489] Nissim, A., Hoogenboom, H. R. I Tomlinson, I. M., Flynn, G.,
Midgley, C., Lane, D. and Winter, G. (1994) Embo J, 13, 692-8.
[0490] Norman, S. O. (1980). Flow cytometry. Med. Phys. 7,
609-615.
[0491] Oberholzer, T., Albrizio, M. & Luisi, P. L. (1995a).
Polymerase chain reaction in liposomes. Chemistry and Biology 2,
677-682.
[0492] Oberholzer, T., Wick, R., Luisi, P. L. & Biebricher, C.
K. (1995b). Enzymatic RNA replication in self-reproducing vesicles:
an approach to a minimal cell. Biochem Biophys Res Commun 207(1),
250-7.
[0493] Omburo, G. A., Kuo, J. M., Mullins, L. S. and Raushel, F. M.
(1992) Journal of Biological Chemistry, 267, 13278-13283.
[0494] Parmley, S. F. and Smith, G. P. (1988) Gene, 73, 305-18.
[0495] Pederson, H., Holder, S., Sutherlin, D. P., Schwitter, U.,
King, D. S. & Schultz, P. G. (1998). Proc. Natl. Acad. Sci. USA
95, 10523-10528.
[0496] Pelham, H. R. and Jackson, R. J. (1976) Eur J Biochem, 67,
247-56.
[0497] Perelson, A. S. and Oster, G. F. (1979) J Theor Biol, 81,
64570.
[0498] Perez, G. M., Sanchez, F. A. & Garcia, C. F. (1992).
Application of active-phase plot to the kinetic analysis of
lipoxygenase in reverse micelles. Biochem J.
[0499] Pirrung & Huang (1996) Bioconjugate Chemistry, 7,
317-321.
[0500] Posner, B. A., Li, L., Bethell, R., Tsuji, T. and Benkovic,
S. J. (1996) Biochemistry, 35, 1653-63.
[0501] Qi-X; Grabowski-GA. (1998). Acid beta-glucosidase: intrinsic
fluorescence and conformational changes induced by phospholipids
and saposin C. Biochemistry 37, 11544-115554.
[0502] Roberts, B. E., Gorecki, M., Mulligan, R. C., Danna, K. J.,
Rozenblatt, S. and Rich, A. (1975) Proc Natl Acad Sci USA, 72,
1922-6.
[0503] Roberts, J. W. (1969) Nature, 224, 1168-74.
[0504] Roberts, R. W. & Szostak, J. W. (1997). RNA-peptide
fusions for the in vitro selection of peptides and proteins. Proc.
Natl. Acad. Sci. USA 94, 12297-12302.
[0505] Rolland, J. M., Dimitropoulos, K., Bishop, A., Hocking, G.
R., and Nairn R. C. 1985 Fluorescence polarization assay by flow
cytometry. J Immunol. Methods 76, 1-10.
[0506] Rosenberg, M., Weissman, S. and decrombrugghe, B. (1975) J
Biol Chem, 250, 4755-64.
[0507] Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J.,
Higuchi, R., Horn, G. T., Mullis, K. B. and Erlich, H. A. (1988)
Science, 239, 487-91.
[0508] Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989)
Molecular cloning: a laboratory manual. Cold Spring Harbor
Laboratory Press, New York.
[0509] Savage, M. D., Mattson, G., Desai, S., Nielander, G. W.,
Morgensen, S. and Conklin, E. J. (1994) Avidin-biotin chemistry: a
handbook. Pierce Chemical Company, Rockford.
[0510] Schick, M. J. (1966) Nonionic surfactants. Marcel Dekker,
New York.
[0511] Shapiro, H. M. (1983). Multistation multiparameter flow
cytometry: a critical review and rationale. Cytometry 3,
227-243.
[0512] Sherman, P. (1968) Emulsion science. Academic Press,
London.
[0513] Siemering, K. R., Golbik, R., sever, R. and Haselhof, J.
(1996). Mutations that suppress the thermosensitivity of green
fluorescent protein. Current Biology 6, 1653-1663.
[0514] Smith, G. P. (1985) Science, 228, 1315-7.
[0515] Soumillion, P., Jaspers, L., Bouchet, M., Marchand, B. J.,
Winter, G. and Fastrez, J. (1994) J Mol Biol, 237, 415-22.
[0516] Stemmer, W. P. (1994a) Nature, 370, 389-91.
[0517] Stemmer, W. P. (1994b) Proc Natl Acad Sci USA, 91,
10747-51.
[0518] Stofko, H. R., Carr, D. W. and Scott, J. D. (1992) Febs
Lett, 302, 274-8.
[0519] Sun, A. M., Vasek, I. & Tai, I. (1992).
Microencapsulation of living cells and tissues. In
Microencapsulation and nanoparticles in medicine and pharmacy
(Donbrow, M., ed.), pp. 315-322. CRC Press, Boca Raton, Fla.
[0520] Sundberg et al. (1995) J. Am. Chem. Soc., 117,
12050-12057.
[0521] Tawfik, D. S., Green, B. S., Chap, R., Sela, M. &
Eshhar, Z. (1993). catELISA: a facile general route to catalytic
antibodies. Proc Natl Acad Sci USA 90(2), 373-7.
[0522] Tawfik, D. S., Lindner, A. B., Chap, R., Kim, S.-H., Green,
B. S. & Eshhar, Z. (1997). In Immunology Methods Manual. pp.
553-559, Ed., I. Lefkovits. Academic Press, London.
[0523] Tawfik, D. S. & Griffiths, A. D. (1998). Man-made
cell-like compartments for molecular evolution. Nature
Biotechnology 16, 652-656.
[0524] Tokatlidis, K., Friguet, B., Deville, B. D., Baleux, F.,
Fedorov, A. N., Navon, A., Djavadi, O. L. and Goldberg, M. E.
(1995) Philos Trans R Soc Lond B Biol Sci, 348, 89-95.
[0525] Tripet, B., Yu, L., Bautista, D. L., Wong, W. Y., Irvin, R.
T. and Hodges, R. S. (1996) Protein Engng., 9, 1029-1042.
[0526] Tuerk, C. and Gold, L. (1990) Science, 249, 505-10.
[0527] van Hal, D. A., Bouwstra, J. A. & Junginger, H. E.
(1996). Nonionic surfactant vesicles containing estradiol for
topical application. In Microencapsulation: methods and industrial
applications (Benita, S., ed.), pp. 329-347. Marcel Dekker, New
York.
[0528] Voss, E. W. 1993. Kinetic measurements of molecular
interactions by spectrofluorometry. J. Mol. Recognit. 6, 51-58.
[0529] Walde, P. Goto, A., Monnard, P.-A., Wessicken, M. &
Luisi, P. L. (1994). Oparin's reactions revisited: enzymatic
synthesis of poly(adenylic acid) in micelles and self-reproducing
vesicles. J. Am. Chem. Soc. 116, 7541-7547.
[0530] Walde, P., Han, D. & Luisi, P. L. (1993). Spectroscopic
and kinetic studies of lipases solubilized in reverse micelles.
Biochemistry 32(15), 4029-34.
[0531] Walde, P., Peng, Q., Fadnavis, N. W., Battistel, E. &
Luisi, P. L. (1988). Structure and activity of trypsin in reverse
micelles. Eur J Biochem 173(2), 401-9.
[0532] Walker, G. T., Fraiser, M. S., Schram, J. L., Little, M. C.,
Nadeau, J. G. and Malinowski, D. P. (1992) Nucleic Acids Res, 20,
1691-6.
[0533] Wang, G. T. et al. (1990). Design and synthesis of new
fluorogenic HIV protease substrates based on resonance energy
transfer. Tetrahedron Lett. 31, 6493.
[0534] Weil, P. A., Luse, D. S., Segall, J. and Roeder, R. G.
(1979) Cell, 18, 469-84.
[0535] Whateley, T. L. (1996). Microcapsules: preparation by
interfacial polymerisation and interfacial complexation and their
applications. In Microencapsulation: methods and industrial
applications (Benita, S., ed.), pp. 349-375. Marcel Dekker, New
York.
[0536] Wick, R. & Luisi, P. L. (1996). Enzyme-containing
liposomes can endogenously produce membrane-constituting lipids.
Chem Biol 3(4), 277-85.
[0537] Widersten, M. and Mannervik,. B. (1995) J Mol Biol, 250,
115-22.
[0538] Williams, J. W., Morrison, J. F. and Duggleby, R. G. (1979)
Biochemistry, 18, 2567-73.
[0539] Winter, G., Griffiths, A. D., Hawkins, R. E. and Hoogenboom,
H. R. (1994) Annu Rev Immunol, 12, 433-55.
[0540] Wyatt, J. R. 1 Chastain, M. and Puglisi, J. D. (1991)
Biotechniques, 11, 764-9.
[0541] Yamagishi, J., Kawashima, H., Matsuo, N., Ohue, M.,
Yamayoshi, M., Fukui, T., Kotani, H., Furuta, R., Nakano, K. and
Yamada, M. (1990) Protein Eng, 3, 713-9.
[0542] Yelamos, J., Klix, N., Goyenechea, B., Lozano, F., Chui, Y.
L., Gonzalez, F. A., Pannell, R., Neuberger, M. S. and Milstein, C.
(1995) Nature, 376, 225-9.
[0543] Zaccolo, M., Williams, D. M., Brown, D. M. and Gherardi, E.
(1996) J Mol Biol, 255, 589-603.
[0544] Zakrzewski, S. F. (1980) Preparation of tritiated
dihydrofolic acid of high specific activity. Methods Enzymol. pp.
539-.
[0545] Zaug, A. J. and Cech, T. R. (1986) Biochemistry, 25,
4478-82.
[0546] Zaug, A. J. and Cech, T. R. (1986) Science, 231, 470-5.
[0547] Zaug, A. J., Been, M. D. and Cech, T. R. (1986) Nature, 324,
429-33.
[0548] Zubay, G. (1973) Annu Rev Genet, 7, 267-87.
[0549] Zubay, G. (1980) Methods Enzymol, 65, 856-77.
Sequence CWU 1
1
40 1 61 DNA Artificial sequence Sequence about the NcoI site of
vector pET-23d 1 tatacc atg gac tac aaa gat gac gat gat aaa atg cat
ggc aac gaa 48 Met Asp Tyr Lys Asp Asp Asp Asp Lys Met His Gly Asn
Glu 1 5 10 ggt taccggatcc 61 Gly 15 2 15 PRT Artificial sequence
Sequence encoded about the NcoI site of vector pET-23d 2 Met Asp
Tyr Lys Asp Asp Asp Asp Lys Met His Gly Asn Glu Gly 1 5 10 15 3 17
DNA Artificial sequence Sequence about the NcoI site of vector
pGEM-4ZNcoI 3 cc atg ggg ggc tcg agc 17 Met Gly Gly Ser Ser 1 5 4 5
PRT Artificial sequence Peptide sequence encoded about the NcoI
site of vector pGEM-4ZNcoI 4 Met Gly Gly Ser Ser 1 5 5 98 DNA
Artificial sequence Polylinker region of plasmid pET-23d(FLAG),
including FLAG encoding region 5 cc atg gac tac aaa gat gac gat gat
aaa atgcatggca acgaaggtac 49 Met Asp Tyr Lys Asp Asp Asp Asp Lys 1
5 cggatccgaa ttcgagctcc gtcgacaagc ttgcggccgc actcgagca 98 6 9 PRT
Artificial sequence FLAG epitope tag encoded by plasmid
pET-23d(FLAG) 6 Met Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 7 105 DNA
Artificial sequence Sequence encoding FLAG, HA epitope tag peptide
encoded by plasmid pET-23d(FLAGHA) 7 atg gac tac aaa gat gac gat
gat aaa atg cat ggc aac gaa ggt acc 48 Met Asp Tyr Lys Asp Asp Asp
Asp Lys Met His Gly Asn Glu Gly Thr 1 5 10 15 gga tcc gga gga gga
tat ccg tat gat gtg ccg gat tat gcg gga gga 96 Gly Ser Gly Gly Gly
Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Gly Gly 20 25 30 gga tcc taa
105 Gly Ser 8 34 PRT Artificial sequence FLAG, HA epitope tag
peptide encoded by plasmid pET-23d(FLAGHA) 8 Met Asp Tyr Lys Asp
Asp Asp Asp Lys Met His Gly Asn Glu Gly Thr 1 5 10 15 Gly Ser Gly
Gly Gly Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Gly Gly 20 25 30 Gly
Ser 9 49 DNA Artificial Sequence Oligonucleotide EDHFR-Fo 9
cgagctagag gtaccttatt accgccgctc cagaatctca aagcaatag 49 10 82 DNA
Artificial Sequence Oligonucleotide EDHFR-Ba 10 gcatctgaca
agcttaataa ttttgtttaa ctttaagaag gagatataca tatgatcagt 60
ctgattgcgg cgttagcggt ag 82 11 17 DNA Artificial Sequence
Biotynylated Oligonucleotide LMB2-Biotin 11 gtaaaacgac ggccagt 17
12 30 DNA Artificial Sequence Oligonucleotide folA-FW 12 gcgcgaagct
tcgatcagtc tgattgcggc 30 13 30 DNA Artificial Sequence
Oligonucleotide folA-BW 13 gcgcctcgag ttccgccgct ccagaatctc 30 14
25 DNA Artificial Sequence Biotinylated Oligonucleotide pETfor.b 14
gactccaacg tcaaagggcg artca 25 15 20 DNA Artificial Sequence
Biotinylated oligonucleotide pETrev.b 15 ggttttcacc gtcatcaccg 20
16 34 DNA Artificial Sequence oligonucleotide GFP-FW 16 gcgcgaagct
tcgagtaaag gagaagaact tttc 34 17 35 DNA Artificial Sequence
Oligonucleotide GFP-BW 17 gcgcctcgag ttttgtatag ttcatccatg ccatg 35
18 38 DNA Artificial Sequence oligonucleotide GSTM2-2Fo 18
tgatgccggt accttattac ttgttgcccc agacagcc 38 19 73 DNA Artificial
Sequence Oligonucleotide GSTM2-2Ba 19 agttaagtct aagcttaata
attttgttta actttaagaa ggagatatac atatgcccat 60 gacactgggg tac 73 20
17 DNA Artificial Sequence olidonucleotide LMB2 20 gtaaaacgac
ggccagt 17 21 17 DNA Artificial Sequence Oligonucleotide LMB3 21
caggaaacag ctatgac 17 22 42 DNA Artificial Sequence Oligonucleotide
N-Flag-OPD-Bc 22 tcgatacgtc ggtaccttat tatgacgccc gcaaggtcgg tg 42
23 70 DNA Artificial Sequence Oligonucleotide N-Flag-OPD-Bc 23
cattgccaag ccatggacta caaagatgac gatgataaaa tcaccaacag cggcgatcgg
60 atcaataccg 70 24 42 DNA Artificial Sequence Oligonucleotide
BCCP5 24 ctaggtcatg gatccatgaa actgaaggta acagtcaacg gc 42 25 42
DNA Artificial Sequence Oligonucleotide BCCP3 25 cagatagcta
agcttttatt attcgatgag ctcgagatcc cc 42 26 21 DNA Artificial
Sequence Oligonucleotide BCCPHis+ 26 catcgaaggt ggcagctctg c 21 27
29 DNA Artificial Sequence OligonucleotideBCCPHis- 27 ggccgcagag
ctgccacctt cgatgagct 29 28 37 DNA Artificial Sequence
Oligonucleotide BirA5 28 atcgtagcac tcgagcatga aggataacac cgtgcca
37 29 39 DNA Artificial Sequence Oligonucleotide BirA3 29
gtcatgactg gtaccttatt atttttctgc actacgcag 39 30 50 DNA Artificial
Sequence Oligonucleotide FLAG 30 catggactac aaagatgacg atgataaaat
gcatggcaac gaaggtaccg 50 31 49 DNA Artificial Sequence
Oligonucleotide FLAGas 31 gatccggtac cttcgttgca tgcattttat
catcgtcatc tttgtagtc 49 32 96 DNA Artificial Sequence
Oligonucleotide FLAGHA 32 aactcagctt cctttcgggc tttgttagga
tcctcctccc gcataatccg gcacatcata 60 cggatatcct cctccggatc
cggtaccttc gttgcc 96 33 20 DNA Artificial Sequence Oligonucleotide
pETrev.b 33 ggttttcacc gtcatcaccg 20 34 20 DNA Artificial Sequence
Oligonucleotide pETfor 34 gactccaacg tcaaagggcg 20 35 20 DNA
Artificial Sequence Oligonucleotide FLAGrev1 35 aactcagctt
cctttcgggc 20 36 98 DNA plasmid pET-23d(FLAG) 36 ggtacctgat
gtttctactg ctactatttt acgtaccgtt gcttccatgg cctaggctta 60
agctcgaggc agctgttcga acgccggcgt gagctcgt 98 37 9 PRT Influenza
virus 37 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 1 5 38 105 DNA plasmid
pET-23d(FLAGHA) 38 tacctgatgt ttctactgct actattttac gtaccgttgc
ttccatggcc taggcctcct 60 cctataggca tactacacgg cctaatacgc
cctcctccta ggatt 105 39 9 PRT Artificial Sequence Flag peptide 39
Met Asp Tyr Lys Asp Asp Asp Asp Lys 1 5 40 52 DNA Artificial
sequence pGEM -4Z plasmid 40 aagcttaata attttgttta actttaagaa
ggagatatag ccatggggta cc 52
* * * * *