U.S. patent application number 10/696488 was filed with the patent office on 2005-07-21 for 2'-substituted nucleosides and oligonucleotide derivatives.
Invention is credited to Altmann, Karl-Heinz, Cuenoud, Bernard, Martin, Pierre, Moser, Heinz Ernst.
Application Number | 20050159374 10/696488 |
Document ID | / |
Family ID | 4210329 |
Filed Date | 2005-07-21 |
United States Patent
Application |
20050159374 |
Kind Code |
A1 |
Cuenoud, Bernard ; et
al. |
July 21, 2005 |
2'-Substituted nucleosides and oligonucleotide derivatives
Abstract
The invention relates to an oligonucleotide derivative which
comprises at least one nucleoside building block of the formula (I)
1 The invention furthermore relates to nucleoside building blocks,
intermediates and processes for preparing the oligonucleotide
derivatives and the nucleoside building blocks. The invention also
relates to pharmaceutical compositions and to uses of the
oligonucleotide derivatives and the nucleoside building blocks.
Inventors: |
Cuenoud, Bernard; (Horsham,
GB) ; Altmann, Karl-Heinz; (Reinach, CH) ;
Martin, Pierre; (Rheinfelden, CH) ; Moser, Heinz
Ernst; (Horsham, GB) |
Correspondence
Address: |
NOVARTIS
CORPORATE INTELLECTUAL PROPERTY
ONE HEALTH PLAZA 104/3
EAST HANOVER
NJ
07936-1080
US
|
Family ID: |
4210329 |
Appl. No.: |
10/696488 |
Filed: |
October 29, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10696488 |
Oct 29, 2003 |
|
|
|
09753943 |
Jan 3, 2001 |
|
|
|
6670468 |
|
|
|
|
09753943 |
Jan 3, 2001 |
|
|
|
09194844 |
May 14, 1999 |
|
|
|
09194844 |
May 14, 1999 |
|
|
|
PCT/EP97/02738 |
May 27, 1997 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/455; 435/6.16; 536/23.1 |
Current CPC
Class: |
C07H 21/00 20130101 |
Class at
Publication: |
514/044 ;
435/455; 435/006; 536/023.1 |
International
Class: |
A61K 048/00; C12Q
001/68; C07H 021/02 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 6, 1996 |
CH |
1432/96 |
Claims
What is claimed is:
1. An oligonucleotide derivative comprising at least one nucleoside
building block of the formula (I) 117in which A is a radical of the
formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which R.sub.1 and
R.sub.2 are, independently of each other H, C.sub.1-C.sub.10alkyl,
a radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (1), in which each X is,
in each case independently of each other, O or N(R.sub.6), R.sub.5
and R.sub.6 are, in each case independently of each other, H,
C.sub.1-C.sub.10alkyl, amino-C.sub.2-C.sub.10alkyl,
N-mono-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl or
N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl, and m is
an integer from 1 up to and including 3,
amino-C.sub.3-C.sub.10alkyl,
N-mono-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10-alkyl, or
N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10alkyl; or in
which --N(R.sub.1)(R.sub.2) are together a radical of the formula
(III), 118in which Y is O, S, SO, SO.sub.2 or N(R.sub.7), and
R.sub.7 is H or --CH.sub.3; R.sub.3 is H, --CH.sub.3,
--CH.sub.2CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--C.sub.1-C.sub.4alkyl; or A is a radical of the
formula (IVa) or (IVb) 119in which R, independently, has the
meaning of R.sub.1 or R.sub.2, and U is O or CH.sub.2; R.sub.4 is
H, --CH.sub.3, --CH.sub.2CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--C.sub.1-C.sub.4alkyl; n is 0, 1 or 2; B is the
radical of a nucleic acid base; and V and W are, independently of
each other, the same or different radicals of an internucleosidic
bridging group or are a terminal radical; and a salt thereof; where
those compounds are excepted in which, in the radical A, two
heteroatoms are linked to the same carbon atom.
2. An oligonucleotide derivative according to claim 1, in which A
is a radical of the formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2),
in which R.sub.1 and R.sub.2 are, independently of each other, H,
C.sub.1-C.sub.5alkyl, amino-C.sub.2-C.sub.5alkyl,
N-mono-C.sub.1-C.sub.3a- lkylamino-C.sub.2-C.sub.5alkyl,
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C- .sub.5alkyl or a
radical of the formula II --(CH.sub.2--CH.sub.2--X).sub.m-
--R.sub.5 (II), in which X is O or N(R.sub.6), R.sub.5 and R.sub.6
are, independently of each other, H, C.sub.1-C.sub.3alkyl,
amino-C.sub.2-C.sub.3alkyl,
N-mono-C.sub.1-C.sub.3alkylamino-C.sub.2-C.su- b.5alkyl or
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C.sub.5-alkyl, and m is
1.
3. An oligonucleotide derivative according to claim 2, in which
R.sub.1 and R.sub.2 are, independently of each other, H, methyl,
ethyl, aminoethyl, aminopropyl, N-monomethylaminoethyl,
N-monomethylaminopropyl, N-monoethylaminoethyl,
N-monoethylaminopropyl, N,N-dimethylaminoethyl,
N,N-dimethylaminopropyl, N,N-diethylaminoethyl,
N,N-diethylaminopropyl, or a radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II), in which X is O or
N(R.sub.6), R.sub.5 and R.sub.6 are, independently of each other,
H, methyl, ethyl or propyl, and m is 1.
4. An oligonucleotide derivative according to claim 3, in which
R.sub.1 and R.sub.2 are, independently of each other, H, methyl,
ethyl, aminoethyl, N-monomethylaminoethyl, N-monoethylaminoethyl,
N,N-dimethylaminoethyl or N,N-diethylaminoethyl.
5. An oligonucleotide derivative according to claim 4, in which
R.sub.1 and R.sub.2 are, independently of each other, H, methyl or
ethyl.
6. An oligonucleotide derivative according to claim 5, in which
R.sub.1 and R.sub.2 are in each case H, or R.sub.1 and R.sub.2 are
in each case methyl, or one of the substituents R.sub.1 and R.sub.2
is H and the other is methyl.
7. An oligonucleotide derivative according to claim 5, in which
R.sub.1 and R.sub.2 are in each case methyl, or one of the
substituents R.sub.1 and R.sub.2 is H and the other is methyl.
8. An oligonucleotide derivative according to claim 1, in which
R.sub.3 and R.sub.4 are, independently of each other, H,
--CH.sub.3, --CH.sub.2OH or --CH.sub.2--O--CH.sub.3.
9. An oligonucleotide derivate according to claim 1, in which n is
0.
10. An oligonucleotide derivative according to claim 9, in which A
is a radical of the formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2),
in which R.sub.3 is H, and R.sub.1 and R.sub.2 are defined as in
claim 1.
11. An oligonucleotide derivative according to claim 1, in which B
is a radical of the formula (V1) to (V14) 120121in which R.sub.b1
is --NH.sub.2, --SH or --OH; R.sub.b2 is H, --NH.sub.2 or --OH; and
R.sub.b3 is H, Br, I, --CN, --C.ident.C--CH.sub.3, --C(O)NH.sub.2
or --CH.sub.3; R.sub.b4 is --NH.sub.2 or --OH; and R.sub.b5 is H,
F, Br, I, --CN, --C.ident.C--CH.sub.3, --C(O)NH.sub.2 or
--CH.sub.3.
12. An oligonucleotide derivative according to claim 11, in which B
is a radical of the formula (V1), (V2), (V3), (V4) or (V5) 122in
which R.sub.b1 is --NH.sub.2, --SH or --OH; R.sub.b2 is H,
--NH.sub.2 or --OH; and R.sub.b3 is H, Br, I, --CN,
--C.ident.C--CH.sub.3, --C(O)NH.sub.2 or --CH.sub.3; R.sub.b4 is
--NH.sub.2 or --OH; and R.sub.b5 is H, F, Br, I, --CN,
--C.ident.C--CH.sub.3, --C(O)NH.sub.2 or --CH.sub.3.
13. An oligonucleotide derivative according to claim 12, in which B
is a radical of the formula (V1) or (V5) 123in which R.sub.b1 is
--NH.sub.2, --SH or --OH; R.sub.b2 is H, --NH.sub.2 or --OH;
R.sub.b4 is --NH.sub.2 or --OH; and R.sub.b5 is H, F, Br, I, --CN,
--C.ident.C--CH.sub.3, --C(O)NH.sub.2 or --CH.sub.3.
14. An oligonucleotide derivative according to claim 13, in which B
is selected from the group of the following radicals: xanthine,
hypoxanthine, adenine, 2-aminoadenine, guanine, 6-thioguanine,
uracil, thymine, cytosine, 5-methylcytosine, 5-propynyluracil,
5-fluorouracil and 5-propynylcytosine.
15. An oligonucleotide derivate according to claim 1, in which V
and W, as radicals of an internucleosidic bridging group, are,
independently of each other, selected from the following group:
5'-O--P(O)(OH)--O-3' (phosphodiester), 5'-O--P(O) (SH)--O-3'
(phosphorothioate), 5'-O--P(S) (SH)--O-3' (phosphodithioate),
5'-O--P(O)(CH.sub.3)--O-3' (methylphosphonate),
5'-O--P(O)(NH--R.sub.7)--O-3' (phosphoamidate) in which R.sub.7 is
C.sub.1-C.sub.3alkyl, 5'-O--P(O)(OR.sub.8)--O-3' (phosphotriester)
in which R.sub.8 is C.sub.1-C.sub.3alkyl,
5'-O--S(O).sub.2--CH.sub.2-3' (sulfonate), 5'-O--S(O).sub.2--NH-3'
(sulfamate), 5'-NH--S(O).sub.2--CH.sub.2-3' (sulfonamide),
5'-CH.sub.2--S(O).sub.2--CH.sub.2-3' (sulfone), 5'-O--S(O)--O-3'
(sulfite), 5'-CH.sub.2--S(O)--CH.sub.2-3' (sulfoxide),
5'-CH.sub.2--S--CH.sub.2-3' (sulfide), 5'-O--CH.sub.2--O-3'
(formacetal), 5'-S--CH.sub.2--O-3' (3'-thioformacetal),
5'-O--CH.sub.2--S-3' (5'-thioformacetal),
5'-CH.sub.2--CH.sub.2--S-3' (thioether), 5'-CH.sub.2--NH--O-3'
(hydroxylamine), 5'-CH.sub.2--N(CH.sub.3)--O-3'
(methylene(methylimino)), 5'-CH.sub.2--O--N(CH.sub.3)-3'
(methyleneoxy(methylimino)), 5'-O--C(O)--NH-3' (5'-N-carbamate),
5'-CH.sub.2--C(O)--NH-3' (amide), 5'-NH--C(O)--CH.sub.2-3' (amide
II), 5'-CH.sub.2--NH--C(O)-3' (amide III) and
5'-C(O)--NH--CH.sub.2-3' (amide IV), and the tautomeric forms
thereof.
16. An oligonucleotide derivative according to claim 15, in which V
and W, as radicals of an internucleosidic bridging group, are,
independently of each other, selected from the following group:
5'-O--P(O)(OH)--O-3' (phosphodiester), 5'-O--P(O)(SH)--O-3'
(phosphorothioate) and 5'-CH.sub.2--C(O)--NH-3' (amide).
17. An oligonucleotide derivative according to claim 16, in which
one of the radicals V or W, as radicals of an internucleosidic
bridging group, is 5'-O--P(O)(OH)--O-3' (phosphodiester) and the
other radical is 5'-O--P(O)(SH)--O-3' (phosphorothioate).
18. An oligonucleotide derivate according to claim 16, in which V
and W as radicals of an internucleosidic bridging group, are in
each case 5'-O--P(O)(OH)--O-3' (phosphodiester) or in each case
5'-O--P(O)(SH)--O-3' (phosphorothioate).
19. An oligonucleotide derivative according to claim 1, in which V
and W, as terminal radicals, are, independently of each other,
--OH, --NH.sub.2 or a hydroxyl or amino group which is protected by
a protecting group.
20. An oligonucleotide derivative according to claim 17, in which
V, as terminal radical, is --OH, --NH.sub.2 or a protected hydroxyl
or amino group, and, W is --OH or --NH.sub.2.
21. An oligonucleotide derivative according to claim 1, which has a
length of from 3 to 50 nucleoside building blocks.
22. An oligonucleotide derivative according to claim 18, which has
a length of from 10 to 25 nucleoside building blocks.
23. An oligonucleotide derivative according to claim 1, wherein the
oligonucleotide derivative has a chimeric structure.
24. A compound of the formula (Ia) 124in which A is a radical of
the formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which R.sub.1
and R.sub.2 are, independently of each other, H,
C.sub.1-C.sub.10alkyl, a radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II), in which each X is,
in each case, independently of each other, O or N(R.sub.6), R.sub.5
and R.sub.6 are, in each case, independently of each other, H,
C.sub.1-C.sub.10alkyl, amino-C.sub.2-C.sub.10alkyl,
N-mono-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl or
N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl, and m is
an integer from 1 up to and including 3,
amino-C.sub.3-C.sub.10alkyl,
N-mono-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10alkyl, or
N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10alkyl; or in
which --N(R.sub.1)(R.sub.2) are together a radical of the formula
(III) 125in which Y is O, S, SO, SO.sub.2 or N(R.sub.7), and
R.sub.7 is H or --CH.sub.3; R.sub.3 is H, --CH.sub.3,
--CH.sub.2CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--C.sub.1-C.sub.4alkyl; or A is a radical of the
formula (IVa) or (IVb) 126in which R, independently, has the
meaning of R.sub.1 or R.sub.2, and U is O or CH.sub.2; R.sub.4 is
H, --CH.sub.3, --CH.sub.2CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--C.sub.1-C.sub.4alkyl; n is 0, 1 or 2; B' is the
radical of a protected or unprotected nucleic acid base; and
V.sub.a and W.sub.a are, independently of each other, --OH,
--NH.sub.2 or identically or differently protected hydroxyl or
amino groups, where those compounds are excepted in which, in the
radical A, two heteroatoms are linked to the same carbon atom, and
where other reactive groups are present in the protected or
unprotected state.
25. A compound according to claim 24, in which A is a radical of
the formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which R.sub.1
and R.sub.2 are, independently of each other, H,
C.sub.1-C.sub.5alkyl, amino-C.sub.2-C.sub.5alkyl,
N-Mono-C.sub.1-C.sub.3alkylamino-C.sub.2-C.su- b.5alkyl,
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C.sub.5alkyl or a radical
of the formula II --(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II), in
which X is O or N(R.sub.6), R.sub.5 and R.sub.6 are, independently
of each other, H, C.sub.1-C.sub.3alkyl, amino-C.sub.2-C.sub.3alkyl,
N-mono-C.sub.1-C.sub.3alkylamino-C.sub.2-C.sub.5alkyl or
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C.sub.5-alkyl, and m is
1.
26. A compound according to claim 25, in which R.sub.1 and R.sub.2
are, independently of each other, H, methyl, ethyl, aminoethyl,
aminopropyl, N-monomethylaminoethyl, N-monomethylaminopropyl,
N-monoethylaminoethyl, N-monoethylaminopropyl,
N,N-dimethylaminoethyl, N,N-dimethylaminopropyl,
N,N-diethylaminoethyl, N,N-diethylaminopropyl, or a radical of the
formula II --(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II), in which
X is O or N(R.sub.6), R.sub.5 and R.sub.6 are, independently of
each other, H, methyl, ethyl or propyl and m is 1.
27. A compound according to claim 26, in which R.sub.1 and R.sub.2
are, independently of each other, H, methyl, ethyl, aminoethyl,
N-monomethylaminoethyl, N-monoethylaminoethyl,
N,N-dimethylaminoethyl or N,N-diethylaminoethyl.
28. A compound according to claim 27, in which R.sub.1 and R.sub.2
are, independently of each other, H, methyl or ethyl.
29. A compound according to claim 28, in which R.sub.1 and R.sub.2
are in each case H, or R.sub.1 and R.sub.2 are in each case methyl,
or one of the substituents R.sub.1 and R.sub.2 is H and the other
is methyl.
30. A compound according to claim 29, in which R.sub.1 and R.sub.2
are in each case methyl, or one of the substituents R.sub.1 and
R.sub.2 is H and the other is methyl.
31. A compound according to claim 24, in which R.sub.3 and R.sub.4
are, independently of each other, H, --CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--CH.sub.3.
32. A compound according to claim 24, in which n is 0.
33. A compound according to claim 32, in which A is a radical of
the formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which R.sub.3
is H, and R.sub.1 and R.sub.2 are defined as in claim 24.
34. A compound according to claim 24, in which B' is a radical of
the formula (V1) to (V14) 127128in which R.sub.b1 is --NH.sub.2,
--SH or --OH; R.sub.b2 is H, --NH.sub.2 or --OH; and R.sub.b3 is H,
Br, I, --CN, --C.dbd.C--CH.sub.3, --C(O)NH.sub.2 or --CH.sub.3;
R.sub.b4 is --NH.sub.2 or --OH; and R.sub.b5 is H, F, Br, I, --CN,
--C.ident.C--CH.sub.3, --C(O)NH.sub.2 or --CH.sub.3, with exocyclic
amino groups being present in unprotected or protected form.
35. A compound according to claim 34, in which B' is a radical of
the formula (V1), (V2), (V3), (V4) or (V5) 129in which R.sub.b1 is
--NH.sub.2, --SH or --OH; R.sub.b2 is H, --NH.sub.2 or --OH; and
R.sub.b3 is H, Br, I, --CN, --C.ident.C--CH.sub.3, --C(O)NH.sub.2
or --CH.sub.3; R.sub.b4 is --NH.sub.2 or --OH; and R.sub.b5 is H,
F, Br, 1, --CN, --C.ident.C--CH.sub.3, --C(O)NH.sub.2 or
--CH.sub.3, with exocyclic amino groups being present in
unprotected or protected form.
36. A compound according to claim 35, in which B' is selected from
the group of the following radicals: xanthine, hypoxanthine,
adenine, 2-aminoadenine, guanine, 6-thioguanine, uracil, thymine,
cytosine, 5-methylcytosine, 5-propynyluracil, 5-fluorouracil and
5-propynylcytosine, with exocyclic amino groups being present in
protected or unprotected form.
37. A compound according to claim 24, in which the protecting group
for exocyclic amino groups of the nucleic acid base B' is selected
from the following group: --C(O)CH.sub.3,
--C(O)--CH(CH.sub.3).sub.2, --C(O)-phenyl,
--C(O)--CH.sub.2--O-phenyl, --C(O)--CH-p-(tert-butyl)pheny- l,
--C(O)--CH.sub.2--O-p-(tert-butyl)phenyl,
--C(O)--CH.sub.2--O-p-(isopro- pyl)phenyl,
.dbd.CH--N(CH.sub.3).sub.2, .dbd.CH--N(butyl).sub.2 and 130
38. A compound according to claim 24, in which the protecting group
for V.sub.a or W.sub.a, as a protected hydroxyl or amino group, is
a trityl-type protecting group.
39. A compound according to claim 38, wherein the trityl-type
protecting group is selected from the following group: trityl,
4-monomethoxytrityl, 4,4'-dimethoxytrityl and
4,4',4"-tris-tert-butyltrityl.
40. A process for preparing a compound of the formula (Ia)
according to claim 24 131in which V.sub.a, W.sub.a, A and B' are
defined as in claim 24, and (a) R.sub.4 is H, --CH.sub.3,
--CH.sub.2CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--C.sub.1-C.sub.4alkyl, and n is 0, which comprises
reacting a compound of the formula (A) 132in which V.sub.a and
W.sub.a are, independently of each other, a protected hydroxyl or
amino group, and B' is defined as above, with exocyclic amino
groups in B' being protected by protecting groups, with a compound
of the formula (B) X--CH.sub.2-A (B), in which X is Cl, Br, I,
tosyl-O or mesyl-O, and A is defined as above, with primary and
secondary amino groups and primary hydroxyl groups in A being
protected by protecting groups; or (b) R.sub.4 is H, --CH.sub.3,
--CH.sub.2CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--C.sub.1-C.sub.4alkyl and n is 1 or 2, which
comprises reacting a compound of the formula (A) 133in which
V.sub.a and W.sub.a are, independently of each other, a protected
hydroxyl or amino group, and B is defined as above, with exocyclic
amino groups in B' being protected by the protecting groups, with a
compound of the formula (C) X--CH.sub.2--C(H)
(R.sub.4)--[O--CH.sub.2--C(H)(R.sub.4)].sub.(n-1)--O--CH.sub.2-A
(C) in which X is Cl, Br, I, tosyl-O or mesyl-O, and R.sub.4 and A
are defined as above, with primary and secondary amino groups and
primary hydroxyl groups in A being protected by protecting groups;
or (c) R.sub.4 is H and n is 1 or 2, which comprises reacting a
compound of the formula (D) 134in which V.sub.a and W.sub.a are,
independently of each other, a protected hydroxyl or amino group,
B' is defined as above, with exocyclic amino groups in B' being
protected by protecting groups, and L is a leaving group, with a
compound of the formula (E) HO--(CH.sub.2--CH.sub.2-
).sub.n-1--O--CH.sub.2-A (E) in which A is defined as above, and
with primary and secondary amino groups and primary hydroxyl groups
in A being protected by protecting groups; or (d) R.sub.4 is H, n
is 0, and A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), which comprises reacting a
compound of the formula (D) 135which is defined as above, with a
compound of the formula (F) NH(R.sub.1)(R.sub.2) (F) in which
R.sub.1, R.sub.2 or the group --N(R.sub.1)(R.sub.2) are defined as
in claim 24, and with functional groups in R.sub.1 or R.sub.2 being
protected if necessary; or (e) R.sub.4 is H, n is 0 and A is a
radical of the formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), which
comprises reacting a compound of the formula (D) 136which is
defined as above, with an azide and subsequent reduction, if
necessary using a catalyst, to give a compound of the formula (G)
137and, if necessary, subjecting the compound of the formula (G) to
further derivatization; with in cases (a) to (e), protected groups
subsequently being deprotected if necessary.
41. A process for preparing an oligonucleotide derivative according
to claim 1, which comprises the following steps: (i) converting a
compound of the formula (Ia) according to claim 24 into a form
suitable for oligonucleotide synthesis, (ii) using the compound of
the formula Ia according to claim 24, which compound is in a
suitable form, in the oligonucleotide synthesis.
42. A use of a compound of the formula (Ia) according to claim 24
as a nucleoside building block, if desired after converting it into
a suitable form for oligonucleotide synthesis, in the
oligonucleotide synthesis.
43. A use of an oligonucleotide derivative according to claim 1 as
an antisense oligonucleotide.
44. A use, according to claim 43, of an oligonucleotide derivative
which is defined in claim 12.
45. A use of an oligonucleotide derivative according to claim 1 as
a triplex-forming oligonucleotide.
46. A use, according to claim 45, of an oligonucleotide derivative
which is defined in claim 11.
47. A use according to claim 45 of an oligonucleotide derivative
which is defined in claim 12.
48. A pharmaceutical composition, which comprises an
oligonucleotide derivative according to claim 1, or a
pharmaceutically tolerated salt thereof, in a pharmaceutically
effective quantity, if desired together with a pharmaceutically
tolerated excipient and/or auxiliary substance.
49. A pharmaceutical composition according to claim 48, which
additionally comprises a customary cytostatic agent.
50. An oligonucleotide derivative according to claim 1, or a
pharmaceutically tolerated salt thereof, for use in the therapeutic
treatment of a mammalian subject, including man.
51. A use of an oligonucleotide derivative according to claim 1, or
of a pharmaceutically tolerated salt thereof, for preparing a
pharmaceutical composition for the therapeutic treatment of a
pathological state, in a mammalian subject including man, which is
characterized by the expression of a protein or an RNA
molecule.
52. A process for the therapeutic treatment of a pathological
state, in a mammalian subject including man, which is characterized
by the expression of a protein or an RNA molecule, which comprises
administering a pharmaceutical composition according to claim 48 to
the mammalian subject.
53. A process for modulating the expression of a protein or an RNA
molecule in a cell, which comprises bringing the cell, or a tissue
or body fluid containing this cell, into contact with an
oligonucleotide derivative according to claim 1 or a pharmaceutical
composition according to claim 48.
54. An oligonucleotide derivative according to claim 1 for use in a
diagnostic method.
55. A compound of the formula (Ia) according to claim 24 for use in
the therapeutic treatment of a mammalian subject, including
man.
56. A compound of the formula (Ic) 138in which V.sub.a, R.sub.4, A
and B' are defined as in claim 24, and Rx is a protecting
group.
57. An oligonucleotide derivative according to claim 1, wherein the
oligonucleotide derivative is essentially complementary to the
region which extends from base position 2484 to base position 2503
of human c-raf mRNA.
58. An oligonucleotide derivative according to claim 57, wherein
the oligonucleotide derivative possesses a base sequence according
to SEQ.ID.NO.2 or a base sequence which is analogous thereto.
Description
AREA OF THE INVENTION
[0001] The present invention relates to an oligonucleotide
derivative which comprises at least one nucleoside building block
which is substituted at the 2' position. The invention furthermore
relates to intermediates, to processes for preparing the
oligonucleotide derivatives, to their uses and to pharmaceutical
compositions.
BACKGROUND TO THE INVENTION
[0002] As chemotherapeutic agents, oligonucleotides and
oligonucleotide derivatives open up effective possibilities for
treating many different pathological states which are characterized
by expression of a protein or an RNA molecule, for example
hyperplastic or neoplastic changes in a cell or a tissue. They can
exert their effect, in particular, by way of the so-called
antisense mechanism. Oligonucleotides and oligonucleotide
derivatives which are employed in this manner are consequently
termed "antisense oligonucleotides". Alternatively, an
oligonucleotide can exert its effect by way of the so-called
triplex mechanism. Such oligonucleotides and oligonucleotide
derivatives are termed "triplex-forming oligonucleotides".
[0003] For an oligonucleotide or oligonucleotide derivative to be
advantageously suitable for use as an antisense oligonucleotide or
as a triplex-forming oligonucleotide, it should possess specific
properties. Thus, for example, it should have adequate binding
affinity for a target nucleic acid, possess adequate resistance to
nucleases, in particular towards endogenous nucleases, and, in the
case of exerting an effect by way of an antisense mechanism,
completely or partially inhibit the translation of a target DNA by
means of the formation of a hybrid and subsequent cleavage of the
target RNA strand by endogenous nucleases, such as RNAse H, or by
means of the formation of a hybrid and subsequent complete or
partial inhibition of the ribosomal translation process (so-called
translation arrest), or, in the case of exerting an effect by way
of a triplex mechanism, the transcription of a particular
double-stranded gene segment or DNA segment should be completely or
partially inhibited by means of the formation of a triple helix.
Furthermore, the oligonucleotide or oligonucleotide derivative
should be taken up to an adequate extent by the cell to be treated,
should exert an effect which is as sequence-specific as possible,
and possess adequate bioavailability (cf., for example, S. T.
Crooke, "Therapeutic Applications of Oligonucleotides", R. G.
Landes Company Publisher (1995); Plum, G. E., Annu. Rev. Biophys.
Biomol. Struct. 24 (1995), 319-350; Cohen, J. S. et al., Sci. Am.
(1994), 50-55; Stull, R. A. et al., Pharm. Res. 12 (1995),
465-483).
[0004] In order to obtain oligonucleotides or oligonucleotide
derivatives which possess one or more of the abovementioned
properties, substitutions have, for example, been performed on the
nucleoside building blocks or the internucleosidic bonds from which
the oligonucleotides and oligonucleotide derivatives are
assembled.
[0005] There is a particular need for additional or improved
oligonucleotide derivatives in the antisense field or the triplex
field.
[0006] Ready industrial accessibility to such oligonucleotide
derivatives, for example a simple or economic preparation method,
would be a further advantage.
[0007] An object of the present invention is consequently to make
available additional or improved oligonucleotide derivatives which,
particularly in relation to their use as antisense oligonucleotides
or triplex-forming oligonucleotides, have advantageous properties
with regard to one or more of the following criteria:
[0008] binding affinity
[0009] resistance to nucleases
[0010] sequence-specific effect
[0011] inhibition or modulation of expression
[0012] uptake by the cell
[0013] bioavailability.
[0014] Another object of the present invention is to make available
compounds which ensure ready industrial accessibility to
oligonucleotide derivatives according to the invention.
[0015] A further object lies in the provision of an oligonucleotide
derivative or a pharmaceutical which can be used in a mammalian
subject, including man, to treat, in particular, pathological
states which are characterized by the expression of a protein or an
RNA molecule.
SUMMARY OF THE INVENTION
[0016] The invention provides an oligonucleotide derivative which
comprises at least one nucleoside building block which has a
substituent of the type described below at the 2'-O position.
[0017] The invention also provides a nucleoside compound which can
be used as an intermediate in the preparation of the novel
oligonucleotide derivatives.
[0018] The invention also provides processes for preparing the
novel oligonucleotide derivatives and processes for preparing the
nucleoside compounds and also other intermediates which are
used.
[0019] The invention furthermore provides a pharmaceutical
composition which comprises the novel oligonucleotide derivatives
and also a use of these oligonucleotide derivatives for therapeutic
treatment, for modulating the expression of a protein or an RNA
molecule, and in diagnostic methods.
[0020] The invention also provides the use of the novel nucleoside
compounds in pharmaceutical compositions and for therapeutic
treatment.
PRECISE DESCRIPTION OF THE INVENTION
[0021] Surprisingly, it has been ascertained that one or more of
the above-described objects is/are achieved by a novel
oligonucleotide derivative according to the present invention.
[0022] Consequently, the invention provides an oligonucleotide
derivative which comprises at least one nucleoside building block
of the formula I 2
[0023] in which
[0024] A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which
[0025] R.sub.1 and R.sub.2 are, independently of each other
[0026] H,
[0027] C.sub.1-C.sub.10alkyl,
[0028] a radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II),
[0029] in which each X is, in each case independently of each
other, O or N(R.sub.6), R.sub.5 and R.sub.6 are, in each case
independently of each other, H, C.sub.1-C.sub.10alkyl,
amino-C.sub.2-C.sub.10alkyl,
N-mono-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl or
N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl, and m is
an integer from 1 up to and including 3,
[0030] amino-C.sub.3-C.sub.10alkyl,
[0031] N-mono-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10alkyl,
or
[0032] N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10alkyl; or
in which
[0033] --N(R.sub.1)(R.sub.2) are together a radical of the formula
(III), 3
[0034] in which Y is O, S, SO.sub.2 or N(R.sub.7), and R.sub.7 is H
or --CH.sub.3;
[0035] R.sub.3 is H, --CH.sub.3, --CH.sub.2CH.sub.3, --CH.sub.2OH
or --CH.sub.2--O--C.sub.1-C.sub.4alkyl; or
[0036] A is a radical of the formula (IVa) or (IVb) 4
[0037] in which R, independently, has the meaning of R.sub.1 or
R.sub.2, and U is O or CH.sub.2;
[0038] R.sub.4 is H, --CH.sub.3, --CH.sub.2CH.sub.3, --CH.sub.2OH
or --CH.sub.2--O--C.sub.1-C.sub.4alkyl;
[0039] n is 0, 1 or 2;
[0040] B is the radical of a nucleic acid base; and
[0041] V and W are, independently of each other, the same or
different radicals of an internucleosidic bridging group or are a
terminal radical; or a salt thereof;
[0042] where those compounds are excepted in which, in the radical
A, two heteroatoms are linked to the same carbon atom.
[0043] In a further embodiment of the radical of formula (III) Y is
SO.
[0044] The expression "oligonucleotide derivative" is familiar to
the skilled person and will only be explained here for the sake of
completeness. Within the context of the present invention, the
expression "oligonucleotide derivative" denotes, in particular, a
derivatized oligonucleotide. An oligonucleotide per se is
preferably an oligomer which consists of a sequence of natural
nucleoside building blocks which are connected to each other by way
of natural internucleosidic bridging groups. A natural nucleoside
as such preferably consists of a sugar, in particular a
.beta.-D-erythropentofuranose, in particular .beta.-D-ribose,
together with a natural nucleic acid base which is linked to it in
the .beta. position. Within the context of the present invention,
nucleic acid base preferably denotes a base which, in relation to a
naturally occurring nucleoside, is capable of forming Watson-Crick
base pairing (for antisense oligonucleotides) or of forming
Hoogsteen or reverse Hoogsteen base pairing (for triplex-forming
oligonucleotides). Examples of natural nucleic acid bases are
adenine, guanine, cytosine, thymine and uracil and also other bases
with which the skilled person is familiar. In an oligonucleotide, a
natural internucleosidic bridging group, in particular a
phosphodiester group connects the individual nucleosides to each
other, in each case by way of the 3' and 5' positions. In this
connection, "natural" preferably means that the corresponding
compounds or residues occur in nature and are accessible by
isolation from corresponding natural products or by means of
chemical synthesis. Consequently, those compounds or residues which
are not regarded as being natural are termed "derivatives" or
"analogues". Within the context of this invention, the expression
"oligonucleotide derivative" therefore preferably denotes an
oligonucleotide which encompasses a nucleoside building block of
the formula (I) at at least one position. Furthermore, such an
oligonucleotide derivative can be structurally modified, as
compared with a corresponding natural oligonucleotide, at at least
one further position (this can relate to the sugar or the base of
another nucleoside building block, or to an internucleosidic
bridging group). Thus, for example, another internucleosidic
bridging group can be present in place of the naturally occurring
phosphodiester bond; another linkage, for example a 2'-5' linkage,
can be present in place of the natural internucleosidic 3'-5'
linkage of nucleoside building blocks; a base analogue which is
likewise capable of hybridizing with the strand of a target nucleic
acid within the sense of Watson-Crick, Hoogsteen or reverse
Hoogsteen base pairing can be present in place of a natural base;
or the sugar residue can be derivatized at different positions, for
example the 2'-position or the 6'-position. However, an
oligonucleotide derivative can also comprise, in place of at least
one nucleoside building block, at least one nucleoside analogue
which encompasses a non-sugar backbone to which a nucleic acid base
is linked.
[0045] Derivatized oligonucleotides, nucleosides, internucleosidic
bridging groups and analogues have been described (cf., for
example, De Mesmaeker, A. et al., Curr. Op. Struct. Biol. 5 (1995),
343-355; Sanghvi Y. S. et al., (Ed.), "Carbohydrate Modifications
in Antisense Research", ACS Symposium Series 580 (1994); S. T.
Crooke, "Therapeutic Applications of Oligonucleotides", R. G.
Landes Company Publisher (1995); the entire content of these
publications is hereby incorporated by reference).
[0046] A preferred embodiment of the present invention relates to a
novel oligonucleotide derivative which comprises at least one
abovementioned nucleoside building block of the formula (I), in
which
[0047] A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which
[0048] R.sub.1 and R.sub.2 are, independently of each other, H,
C.sub.1-C.sub.5alkyl, amino-C.sub.2-C.sub.5alkyl,
N-mono-C.sub.1-C.sub.3a- lkylamino-C.sub.2-C.sub.5alkyl,
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C- .sub.5alkyl or a
radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II),
[0049] in which X is O or N(R.sub.6), R.sub.5 and R.sub.6 are,
independently of each other, H, C.sub.1-C.sub.3alkyl,
amino-C.sub.2-C.sub.3alkyl,
N-mono-C.sub.1-C.sub.3alkylamino-C.sub.2-C.su- b.5alkyl or
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C.sub.5-alkyl, and m is 1;
and where R.sub.3 has the said meanings and is, in particular,
H.
[0050] R.sub.1 and R.sub.2 are preferably, independently of each
other, H, methyl, ethyl, aminoethyl, aminopropyl,
N-monomethylaminoethyl, N-monomethylaminopropyl,
N-monoethylaminoethyl, N-monoethylaminopropyl,
N,N-dimethylaminoethyl, N,N-dimethylaminopropyl,
N,N-diethylaminoethyl, N,N-diethylaminopropyl, or a radical of the
formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II),
[0051] in which X is O or N(R.sub.6), R.sub.5 and R.sub.6 are,
independently of each other, H, methyl, ethyl or propyl, and m is
1.
[0052] In addition, R.sub.1 and R.sub.2 are preferably,
independently of each other, H, methyl, ethyl, aminoethyl,
N-monomethylaminoethyl, N-monoethylaminoethyl,
N,N-dimethylaminoethyl or N,N-diethylaminoethyl, and R.sub.1 and
R.sub.2 are particularly preferably, independently of each other,
H, methyl or ethyl.
[0053] Very particular preference is given to oligonucleotide
derivatives according to the invention in which
[0054] R.sub.1 and R.sub.2 are in each case H, or
[0055] R.sub.1 and R.sub.2 are in each case methyl, or
[0056] one of the substituents R.sub.1 and R.sub.2 is H and the
other is methyl.
[0057] Oligonucleotide derivatives according to the invention are
also preferred in which
[0058] R.sub.1 and R.sub.2 are in each case methyl, or
[0059] one of the substituents R.sub.1 and R.sub.2 is H and the
other is methyl.
[0060] In the oligonucleotide derivatives according to the
invention, including the said preferences, R.sub.3 and R.sub.4 are,
independently of each other, preferably H, --CH.sub.3, --CH.sub.2OH
or --CH.sub.2--O--CH.sub.3.
[0061] Preference is given to oligonucleotide derivatives according
to the invention, including the said preferences, in which n is
0.
[0062] Oligonucleotide derivatives according to the invention are
particularly advantageous in which n is 0 and A is a radical of the
formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which R.sub.3 is
H, and R.sub.1 and R.sub.2 are defined as above, including the said
preferences.
[0063] An oligonucleotide derivative according to the invention is
furthermore preferred which comprises at least one said nucleoside
building block of the formula (I), in which A is a radical of the
formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which
--N(R.sub.1)(R.sub.2) is a radical of the said formula (III), with,
particularly preferably, Y being N(R.sub.7) and R.sub.7 being H or,
particularly preferably, being --CH.sub.3; in this context, n is
preferably 0, R.sub.3 is preferably H.
[0064] Another preferred embodiment relates to an oligonucleotide
derivative according to the invention which comprises a said
nucleoside building block of the formula (I) in which A is a
radical of the said formula (IVa) with, particularly preferably, R
being H or C.sub.1-C.sub.10alkyl, in particular H; in this context,
n is preferably 0.
[0065] Within the context of the present invention, a nucleic acid
base B (or B', see below) is understood as being, in particular,
natural nucleic acid bases and known analogues (cf., for example,
Accounts of Chem. Res. 28 (1955), pp. 366-374; Sanghvi, Y. S. in:
Antisense Research and Applications, Crooke, S. T. and Lebleu, B.
(Ed.), CRC Press, Boca Raton (1993), pp. 273-288; the entire
content of these publications is hereby incorporated by reference).
As is familiar to the skilled person, nucleic acid bases B (or B',
see below) can exist in tautomeric forms depending on the ambient
conditions. According to the invention, such tautomeric forms are
also encompassed by the oligonucleotide derivatives according to
the invention, including the preferred embodiments.
[0066] The invention furthermore relates to oligonucleotide
derivatives according to the invention, including the said
preferences, in which
[0067] B is a radical of the formula (V1) to (V14) 56
[0068] in which
[0069] R.sub.b1 is --NH.sub.2, --SH or --OH;
[0070] R.sub.b2 is H, --NH.sub.2 or --OH; and
[0071] R.sub.b3 is H, Br, I, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3;
[0072] R.sub.b4 is --NH.sub.2 or --OH; and
[0073] R.sub.b5 is H, F, Br, I, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3.
[0074] Preference is given to an oligonucleotide derivative
according to the invention in which B is a radical of the formula
(V1), (V2), (V3), (V4) or (V5) 7
[0075] in which
[0076] R.sub.b1 is --NH.sub.2, --SH or --OH;
[0077] R.sub.b2 is H, --NH.sub.2 or --OH; and
[0078] R.sub.b3 is H, Br, I, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3;
[0079] R.sub.b4 is --NH.sub.2 or --OH; and
[0080] R.sub.b5 is H, F, Br, I, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3.
[0081] In a preferred embodiment of an oligonucleotide derivative
according to the invention, B is a radical of the formula (V1) or
(V5) 8
[0082] in which
[0083] R.sub.b1 is --NH.sub.2, --SH or --OH;
[0084] R.sub.b2 is H, --NH.sub.2 or --OH;
[0085] R.sub.b4 is --NH.sub.2 or --OH; and
[0086] R.sub.b5 is H, F, Br, I, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3.
[0087] In particular, B is selected from the group of the following
radicals: xanthine, hypoxanthine, adenine, 2-aminoadenine, guanine,
6-thioguanine, uracil, thymine, cytosine, 5-methylcytosine,
5-propynyluracil, 5-fluorouracil and 5-propynylcytosine.
[0088] In the oligonucleotide derivatives according to the
invention, including the said preferences, V and W in particular
constitute, independently of each other, the radical of an
internucleosidic bridging group. Such internucleosidic bridging
groups, and methods for preparing them and introducing them into
nucleoside building blocks, oligonucleotides and oligonucleotide
derivatives have been described in large numbers and are familiar
to the skilled person, as mentioned above. Customary
internucleosidic bridging groups are suitable within the context of
the present invention.
[0089] Preferably, V and W, as radicals of an internucleosidic
bridging group, are selected, independently of each other, from the
following group: 5'-O--P(O)(OH)--O-3' (phosphodiester),
5'-O--P(O)(SH)--O-3' (phosphorothioate), 5'-O--P(S)(SH)--O-3'
(phosphodithioate), 5'-O--P(O)(CH.sub.3)--O-3' (methylphosphonate),
5'-O--P(O)(NH--R.sub.7)--- O-3' (phosphoamidate) in which R.sub.7
is C.sub.1-C.sub.3alkyl, 5'-O--P(O)(OR.sub.8)--O-3'
(phosphotriester) in which R.sub.8 is C.sub.1-C.sub.3alkyl,
5'-O--S(O).sub.2--CH.sub.2-3' (sulfonate), 5'-O--S(O).sub.2--NH-3'
(sulfamate), 5'-NH--S(O).sub.2--CH.sub.2-3' (sulfonamide),
5'-CH.sub.2--S(O).sub.2--CH.sub.2-3' (sulfone), 5'-O--S(O)--O-3'
(sulfite), 5'-CH.sub.2--S(O)--CH.sub.2-3' (sulfoxide),
5'-CH.sub.2--S--CH.sub.2-3' (sulfide), 5'-O--CH.sub.2--O-3'
(formacetal), 5'-S--CH.sub.2--O-3' (3'-thioformacetal),
5'-O--CH.sub.2--S-3' (5'-thioformacetal),
5'-CH.sub.2--CH.sub.2--S-3' (thioether), 5'-CH.sub.2--NH--O-3'
(hydroxylamine), 5'-CH.sub.2--N(CH.sub.3)--O-3'
(methylene(methylimino)), 5'-CH.sub.2--O--N(CH.sub.3)-3'
(methyleneoxy(methylimino)), 5'-O--C(O)--NH-3' (5'-N-carbamate),
5'-CH.sub.2--C(O)--NH-3' (amide), 5'-NH--C(O)--CH.sub.2-3' (amide
II), 5'-CH.sub.2--NH--C(O)-3' (amide III) and
5'-C(O)--NH--CH.sub.2-3' (amide IV), and the tautomeric forms
thereof.
[0090] The 5' and 3' orientation of the said radicals V and W, as
an internucleosidic bridging bond, may be clarified as follows:
[0091] When V is a radical 5'-CH.sub.2--C(O)--NH-3' (amide), the
corresponding nucleoside building block of the above-defined
formula (I) has the following structure (I.1): 9
[0092] When W is a radical 5'-CH.sub.2--C(O)--NH-3' (amide), the
corresponding nucleoside building block of the above-defined
formula (I) has the following structure (I.2): 10
[0093] Some of the said radicals of internucleosidic bridging
groups can exist in different tautomeric forms, depending, inter
alia, on the solvent and on the degree of ionization of ionizable
groups. Thus, for example, the bridging group in a phosphorothioate
[O--(P--SH)(.dbd.O)--O] can be tautomerized to
[O--(P--OH)(.dbd.S)--O], with the more stable form depending, inter
alia, on the solvent and the ionization state. Within the context
of the present invention, the term "oligonucleotide derivative"
also encompasses those tautomeric forms which are familiar to the
skilled person.
[0094] Particularly preferably, V and W, as the radical of an
internucleosidic bridging group, are selected, independently, from
the following group: 5'-O--P(O)(OH)--O-3' (phosphodiester),
5'-O--P(O)(SH)--O-3' (phosphorothioate) and
5'-CH.sub.2--C(O)--NH-3' (amide).
[0095] In particular, one of the radicals V or W, as the radical of
an internucleosidic bridging group, is 5'-O--P(O)(OH)--O-3'
(phosphodiester) and the other radical is 5'-O--P(O)(SH)--O-3'
(phosphorothioate).
[0096] V and W are also preferably, as the radical of an
internucleosidic bridging group, in each case 5'-O--P(O)(OH)--O-3'
(phosphodiester) or in each case 5'-O--P(O)(SH)--O-3'
(phosphorothioate).
[0097] As the terminal radical in formula (I), V and W are
preferably, independently of each other, --OH, --NH.sub.2, or a
protected hydroxyl group or amino group. It is furthermore
preferred for V, as a terminal radical, to be --OH, --NH.sub.2 or a
protected hydroxyl group or amino group, and W to be --OH or
--NH.sub.2. In particular, V and W, as a terminal radical, are in
each case --OH or --NH.sub.2. Otherwise, the abovementioned
preferences for oligonucleotide derivatives according to the
invention are preferred in this case as well.
[0098] In addition to at least one nucleoside building block of the
formula I, the oligonucleotide derivatives according to the
invention can comprise further natural or derivatized nucleoside
building blocks.
[0099] A natural nucleoside building block consists of a
pentofuranosyl radical, preferably a ribosyl radical, in particular
a .beta.-D-ribosyl radical or a .beta.-D-2'-deoxyribosyl radical
with a nucleic acid base linked to it, and of a radical of a
phosphodiester bond as the radical of an internucleosidic bridging
group. Such a natural nucleoside building block has the following
formula VI and/or VI* (here, and in that which follows, the
structural difference between nucleoside building blocks whose
formula is labelled with an asterisk "*" and those whose formula is
not marked by an asterisk lies in the position of the linking point
of the internucleosidic bridging group on the sugar or sugar
analogue of the nucleoside): 11
[0100] in which Q.sub.a is H or --OH; and B.sub.a is the radical of
a nucleic acid base, selected, in particular, from thymine, uracil,
5-propynyluracil, cytosine, 5-methylcytosine, 5-propynylcytosine,
adenine, 2-aminoadenine and guanine.
[0101] It is known that the replacement, in an oligonucleotide or
oligonucleotide derivative, of one or more phosphodiester bonds
with a derivatized internucleosidic bridging bond, preferably with
one of the abovementioned internucleosidic bridging bonds, confers
advantageous properties on the oligonucleotide derivative, in
particular with regard to resistance to nucleases or binding
affinity for a target nucleic acid. It is furthermore known that
the insertion into an oligonucleotide of particular substituents
(other than those which form part of the subject-matter of the
present invention), in particular at the 2' position, likewise
confers advantageous properties, in particular with regard to
resistance to nucleases or binding affinity for a target nucleic
acid (cf., for example, Martin, P., Helv. Chem. Acta, 78 (1995),
486-504; Lesnik, E. A. et al., Biochemistry 32 (1993), 7832-7838;
Inoue, H. et al., Nucl. Acids Res. 15 (1987), 6131-6148; Douglas,
M. E. et al., Bioorg. Med. Chem. Let. 4 (1994), 995-1000;
Manoharan, M. et al., Tet. Lett. 32 (1991), 7171-7174; Keller, T.
H. et al., Helv. Chimia Acta 76 (1993), 884-892; Iribarren, A. M.
et al., Proc. Natl. Acad. Sci. USA 87 (1990), 7747-7751;
International Applications WO 94/02501; WO 93/13121; WO 95/16696;
WO 91/06556; WO 93/07883; WO 91/15499; WO 92/03568; DE 91-4110085;
WO 95/06659).
[0102] The following are therefore preferred examples of further
nucleoside building blocks for oligonucleotide derivatives
according to the invention:
[0103] Nucleoside building blocks which differ from those of the
formula VI or VI* in that, in place of the substituents Q.sub.a a
substituent Q is present which is H, --OH, --SCH.sub.3, --F,
--N.sub.3, --CN, --OCN, --OCH.sub.3, --O(CH.sub.2).sub.nCH.sub.3,
where z is from 1 to 10, --O(CH.sub.2CH.sub.2O).sub.vCH.sub.3 where
v is 0 to 12, in particular 1 or 3, in particular 1,
--CH.sub.2CH(CH.sub.3)OCH.sub.3 or --CH.sub.2CH(OH)CH.sub.2OH, or,
in a wider sense, another substituent having similar properties,
for example, Cl, Br, CF.sub.3, ONO.sub.2, NO.sub.2, NH.sub.2 and
O--, S-- or NH--C.sub.1-C.sub.4alkyl, where Q is, in particular,
OH, F, methoxy, preferably 2'-(2-methoxy)ethoxy, or, in particular,
H.
[0104] Nucleoside building blocks which, in place of the
phosphodiester radical, comprise a phosphorothioate radical or a
radical which is selected from the following group:
phosphodithioate, sulfate, sulfonate, sulfonamide, sulfone,
sulfite, sulfoxide, sulfide, formacetal, 3'-thioformacetal,
5'-thioether, hydroxylamine (with CH.sub.2--NH--O--CH.sub.2 in
place of the phosphodiester bond
O--[(HO--)P(.dbd.O)]--O--CH.sub.2), methylene(methylimino) (with
CH.sub.2--N(CH.sub.3)--O--CH.sub.3 in place of the phosphodiester
bond); methyleneoxy(methylimino) (with
CH.sub.2--O--N(CH.sub.3)--CH.sub.2 in place of the phosphodiester
bond), methylene((methylimino)methylimino) (with
CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2 in place of the
phosphodiester bond), carbonate, 5'-N-carbamate, amides (with
CH.sub.2--(C.dbd.O)--NH--CH.sub.2 in place of the phosphodiester
bond, cf. International Application WO 92/20823),
morpholinocarbamate (cf. Summerton, J. E. and Weller, D. D., U.S.
Pat. No. 5,034,506) or peptide nucleic acid (cf. P. E. Nielsen, M.
Egholm, R. H. Berg, O. Buchardt, Science 254, 1497 (1991)), all of
which belong to the state of the art (for review with references to
further information, cf. Milligan et al., J. Med. Chem. 36(14),
1923-37 (1993), and Uhlmann et al., Chemical Reviews 90 (4), 543-84
(1990)).
[0105] Such 2'-substituted nucleoside building blocks, and such
nucleoside building blocks containing the said internucleosidic
bridging groups, and their preparation, are known to the skilled
person, as mentioned above, and belong to preferred embodiments of
oligonucleotide derivatives according to the invention which, in
addition to at least one nucleoside building block of the formula
I, possess at least one of the following nucleoside building blocks
of the formulae VII to XV or VII* to XV*:
1 (VIIa-VIIf) 12 (VIIa*-VIIf*) 13 Radical of the formula Type
(VIIa), phosphorothioate D = SH E = O (VIIa*) VIIb),
phosphodithioate D = SH E = S (VIIb*) (VIIc), alkylphosphonate D =
R' E = O (VIIc*) (VIId), phosphoamidate D = R.sup.II E = O (VIId*)
(VIIe), boranophosphate D = BH.sub.3 E = O (VIIe*) (VIIf),
phosphotriester D = O-R.sup.III E = O (VIIf*) in which R.sup.I is
--CH.sub.3 or --CH.sub.2--CH.sub.2--NH.sub.2; R.sup.II is
--N(H)(C.sub.1-C.sub.4alkyl), --N(H)((CH.sub.2).sub.3--N(CH.sub-
.3).sub.2), --N(CH.sub.3)(CH.sub.2--CH.sub.2--N(CH.sub.3).sub.2,
--N(H)((CH.sub.2).sub.5--NH.sub.2),
--N(H)(CH.sub.2--CH.sub.2-R.sup.IV) in which R.sup.IV = 14
(VIIIa-VIIIe) 15 (VIIIa*-VIIIe*) 16 Radical of the formula Type n
D' E' (VIIIa), sulfonate 2 O CH.sub.2 (VIIIa*) (VIIIb), sulfone 2
CH.sub.2 CH.sub.2 (VIIIb*) (VIIIc), ssulfite 1 O O (VIIIc*)
(VIIId), sulfoxide 1 CH.sub.2 CH.sub.2 (VIIId*) (VIIIe), sulfide 0
CH.sub.2 CH.sub.2; (VIIIe*) (IXa-IXd) 17 (IXa*-IXd*) 18 Radical of
the formula Type D" E" (IXa), (IXa*) formacetal O O (IXb), (IXb*)
3'-thioformacetal S O (IXc), (IXc*) 5'-thioformacetal O S (IXd),
(IXd*) thioether CH.sub.2 S (Xa-Xc) 19 (Xa*-Xc*) 20 Radical of the
formula Type D* E* (Xa), (Xa*) hydroxylamine N--H O (Xb), (Xb*)
methylene(methylimino) N--CH.sub.3 O (Xc), (Xc*)
methylenoxy(methyl- O N--CH.sub.3 imino) (XIa-XId) 21 (XIa*-XId*)
22 Radical of the formula Type D** E** (XIa), (XIa*) carbonate O O
(XIb), (XIb*) 5'-N-carbamate O NH (XIc), (XIc*) amide CH.sub.2
N(R.sup.VI) (XId), (XId*) amide II NH CH.sub.2 in chich R.sup.VI is
H, methyl or phenyl, preferably H (XII) 23 (XII*) 24 Radical of the
formula Type D.sub.1 E.sub.1 (XII), (XII*) amide III NH CH.sub.2
(XIII) 25 (XIII*) 26 Radical of the formula Type D.sub.2 (XIII),
amide IV NH (XIII*) (XIV) 27 (XIV*) 28 Radical of the formula Type
IX, IX* morpholinocarbamate (XV) 29 (XV*) 30 Radical of the formula
Type XV, XV* peptide nucleic acid where Q and B are defined as
above, including the given preferences.
[0106] In place of at least one phosphodiester bond, a preferred
oligonucleotide derivative according to the invention comprises at
least one derivatized internucleosidic bridging group, more
advantageously one of the abovementioned groups, in particular a
phosphorothioate group or an amide group.
[0107] In compounds whose terminal nucleoside building block is
selected from the formulae VI, VIIa to VIIf, VIIIc, IXa to Ixd, Xa
to Xc, XIa to XIc, XIV and XV*, a terminal OH group is preferably
bonded to the 5' terminus and a terminal H is bonded to the 3'
terminus.
[0108] In compounds whose terminal nucleoside building block is
selected from the formulae VI*, VIIa*-VIIh*, VIIIa*-VIIIe*,
IXa*-IXc*, Xa*-Xc*, XIa*-XId, XII*, XIII* and XV, a terminal H is
preferably bonded to the 5' terminus and a terminal OH group is
preferably bonded to the 3' terminus.
[0109] In compounds which possess a terminal nucleoside building
block of the formula XIe, an H is preferably in each case bonded
both to the 5' terminus and the 3' terminus.
[0110] In compounds which possess a terminal radical of the formula
XIV*, a terminal OH group, which replaces the terminal group
--(C.dbd.O)--O, is preferably bonded to the 5' terminus and a
terminal H is bonded to the 3' terminus.
[0111] In compounds whose terminal nucleoside building block is
selected from the formulae VIIIb, VIIIb, VIIIb*, VIIId, VIIId*,
VIIIe, VIIIe*, IXd*, XId, XII, XIII and XIII*, a terminal OH group
is preferably bonded to the 5' terminus and a terminal OH group is
preferably bonded to the 3' terminus.
[0112] In an oligonucleotide derivative according to the invention
which comprises one or more nucleoside building block(s) of the
formula 1, the combination with one or more nucleoside building
blocks, which can be identical or different, of the formulae VI to
XV or VI* to XV* is effected, for example, by one or more building
block(s) of the formula I being combined randomly with identical or
different nucleoside building block(s) of the formulae VI, XV or
VI* to XV*, preferably of the formulae VI, VI*, VIIa, VIIa*, XIc
and XIc*. An oligonucleotide derivative according to the invention
is further preferred which comprises nucleoside building blocks of
the formula I in alternation with identical or different nucleoside
building blocks of the formulae VI to XV, in particular of the
formulae VI, VI*, VIIa, VIIa*, XIc and XIc*.
[0113] An oligonucleotide derivative according to the invention is
furthermore preferred in which at least one nucleic acid building
block corresponds to the formula I and the remaining nucleic acid
building blocks are identical and correspond to a nucleic acid
building block of the formulae VI to XV or VI* to XV*, preferably
of the formulae VI, VI*, VIIa, VIIa*, XIc and XIc*.
[0114] A preferred oligonucleotide derivative according to the
invention, which consists exclusively of nucleic acid building
blocks of the formula (I), comprises preferably from 3 to 50, more
preferably from 10 to 25, in particular 15 to 20, nucleic acid
building blocks of the formula (I).
[0115] An oligonucleotide derivative according to the invention,
which consists both of one or more nucleic acid building block(s)
of the formula I and one or more nucleic acid building block(s) of
the formulae VI to XV or VI* to XV*, comprises a total of from 3 to
50, preferably from 10 to 25, in particular from 15 to 20, nucleic
acid building blocks, of which preferably from 3 to 20, preferably
from 5 to 15, are nucleic acid building blocks of the formula (I),
which building blocks are distributed randomly in the sequence of
the oligonucleotide derivative, are present in the sequence in
alternation with the remaining nucleic acid building blocks, or are
joined together in the sequence, in particular joined together.
[0116] Preferably, an oligonucleotide derivative according to the
invention possesses only phosphodiester bonds or only
phosphorothioate bonds as the internucleosidic bridging groups.
[0117] Preference is furthermore given to oligonucleotide
derivatives according to the invention which have a "chimeric"
structure. Within the context of the present invention, a "chimeric
structure", also termed a "chimera", is to be understood as meaning
an oligonucleotide derivative which contains 2 or more chemically
different regions which are in each case synthesized from one type
of nucleic acid building block. Such chimeric oligonucleotide
derivatives typically comprise at least one region of modified
nucleic acid building blocks which confer one or more advantageous
property/properties (for example increased resistance to nucleases,
increased binding affinity or diminished occurrence of
sequence-independent side-effects) on the oligonucleotide
derivative, the so-called "wing", also designated the M region in
that which follows, and a region which enables RNAse H-mediated
cleavage of the target nucleic acid to take place, i.e. the
so-called "RNAse H window", also designated the U region in that
which follows. The affinity of an oligonucleotide or an
oligonucleotide derivative is customarily determined by measuring
the T.sub.m value of the oligonucleotide (derivative)/target
nucleic acid hybrid. The T.sub.m value is the temperature at which
the oligonucleotide, or its derivative, and the target nucleic acid
dissociate from a previously formed hybrid. The dissociation is
determined spectrophotometrically. The higher ther T.sub.m value,
the higher is the affinity of the oligonucleotide, or the
derivative, for the target nucleic acid. Methods for determining
the T.sub.m value belong to the state of the art (cf. Sambrook,
Fritsch and Maniatis, "Molecular Cloning--A Laboratory Manual", 2nd
Edition, Cold Spring Harbor Laboratory Press, 1989). Within the
context of the present invention, increased resistance to nucleases
denotes decreased or slowed-down degradation of the oligonucleotide
derivatives according to the invention by exonucleases or
endonucleases which are present in a cell. The resistance to
nucleases or the degradation of an oligonucleotide or a derivative
can be monitored by gel electrophoresis, for example. RNAse H is a
cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of the enzyme therefore leads to cleavage of the
target RNA and consequently increases the efficacy of the antisense
mechanism. Cleavage of the target RNA can customarily be
demonstrated by gel electrophoresis. Since, in a chimera, different
advantageous properties are present in one and the same molecule,
oligonucleotide derivatives according to the invention possess a
pronounced antisense effect with regard to inhibiting the
expression of a protein or RNA.
[0118] In one embodiment, a chimeric oligonucleotide derivative
according to the invention comprises at least one M region, which
consists of at least one nucleic acid building block of the formula
I, and at least one U region, which enables RNAse H-mediated
cleavage of the target nucleic acid to take place. The U region
consists, in particular, of customary 2'-deoxyribonucleic acid
building blocks which are linked to each other by way of
phosphodiester bonds, or preferably phosphorothioate bonds, as the
internucleosidic group. The M region of a chimeric oligonucleotide
derivative according to the invention consists, in particular, of
nucleic acid building blocks of the formula I in which W and V, as
the radical of an internucleosidic bridging group, are a
phosphodiester bond, a phosphorothioate bond or an amide bond, with
a phosphodiester bond being preferred.
[0119] Chimeric oligonucleotide derivatives according to the
invention of the abovementioned type, which preferably consist of a
total of from 3 to 50, in particular of from 10 to 25, particularly
preferably of from 15 to 20, nucleoside building blocks, comprise
one or more M region(s) having, for example, from 3 to 25,
preferably having from 5 to 15, nucleoside building blocks of the
formula I, in which V and W are, in particular, in each case,
phosphodiester, phosphorothioate or amide, preferably
phosphodiester or phosphorothioate, in particular phosphodiester,
as the radical of an internucleosidic bridging group; and one or
more U region(s) having, for example, from 3 to 25 2'-deoxyribose
building blocks which are not further substituted and which in each
case possess a phosphodiester group or phosphorothioate group,
preferably a phosphorothioate group, as the radical of an
internucleosidic bridging group.
[0120] The M and U regions in chimeric oligonucleotide derivatives
according to the invention are preferably present in one of the
following arrangements:
[0121] 5'-M-U-M-3'
[0122] 5'-M-U-3' or
[0123] 5'-U-M-3'.
[0124] Additional oligonucleotide derivatives according to the
invention are conjugated with other units, for example a
micelle-forming group, an antibody, a carbohydrate, a
receptor-binding group, a steroid such as cholesterol, a
polypeptide, an intercalating agent, such as an acridine
derivative, a long-chain alcohol, a dendrimer, a phospholipid and
other lipophilic groups. Conjugating in this way confers
advantageous properties with regard to the pharmacokinetic
characteristics on the oligonucleotide derivative according to the
invention. In particular, conjugating in this way achieves
increased cellular uptake.
[0125] In a very particularly preferred embodiment, an
oligonucleotide derivative according to the invention consists
exclusively of nucleoside building blocks of the formula I which
are connected to each other by way of phosphodiester bonds as the
internucleosidic bridging groups. In another very particularly
preferred embodiment, an oligonucleotide derivative according to
the invention exclusively comprises nucleoside building blocks of
the formula I which are connected to each other by way of
phosphorothioate bonds as the internucleosidic bridging groups.
[0126] Provided that salt-forming groups are present, the term
"oligonucleotide derivative" also encompasses salts, in particular
acid addition salts, salts with bases or, if several salt-forming
groups are present, possibly also mixed salts or internal
salts.
[0127] Salts of oligonucleotide derivatives according to the
invention are, in particular, pharmaceutically tolerated salts,
i.e. essentially nontoxic salts.
[0128] Such salts are formed, for example, from the oligonucleotide
derivatives according to the invention which possess an acidic
group, for example a carboxyl group, a phosphodiester group or a
phosphorothioate group, and are, for example, salts with suitable
bases. These salts include, for example, nontoxic metal salts which
are derived from metals of groups Ia, Ib, IIa and IIb of the
Periodic System of the elements, in particular suitable alkali
metal salts, for example lithium, sodium or potassium salts, or
alkaline earth metal salts, for example magnesium or calcium salts.
They furthermore include zinc and ammonium salts and also salts
which are formed with suitable organic amines, such as
unsubstituted or hydroxyl-substituted mono-, di- or
tri-alkylamines, in particular mono-, di- or tri-alkylamines, or
with quaternary ammonium compounds, for example with
N-methyl-N-ethylamine, diethylamine, triethylamine, mono-, bis- or
tris-(2-hydroxy-lower alkyl)amines, such as mono-, bis- or
tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine or
tris(hydroxymethyl)methylamine, N,N-di-lower alkyl-N-(hydroxy-lower
alkyl)amines, such as N,N-dimethyl-N-(2-hydroxyethyl)amine or
tri-(2-hydroxyethyl)amine, or N-methyl-D-glucamine, or quaternary
ammonium compounds such as tetrabutylammonium salts.
[0129] Lithium salts, sodium salts, magnesium salts, zinc salts or
potassium salts are preferred, with sodium salts being particularly
preferred.
[0130] Oligonucleotide derivatives according to the invention which
possess a basic group, for example an amino group or imino group,
can form acid addition salts, for example with inorganic acids, for
example with a hydrohalic acid, such as hydrochloric acid, sulfuric
acid or phosphoric acid, or with organic carboxylic acids, sulfonic
acids, sulfo acids or phospho acids or N-substituted sulfamic acid,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, gluconic acid, glucaric acid,
glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic
acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid,
2-acetoxybenzoic acid, embonic acid, nicotonic acid or isonicotonic
acid, and, in addition, with amino acids, for example with
.alpha.-amino acids, and also with methanesulfonic acid,
ethanesulfonic acid, 2-hydroxymethanesulfonic acid,
ethane-1,2-disulfonic acid, benzenedisulfonic acid,
4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate or N-cyclohexylsulfamic
acid (with formation of the cyclamates) or with other acidic
organic compounds, such as ascorbic acid.
[0131] Oligonucleotide derivatives according to the invention which
possess both acidic and basic groups can also form internal
salts.
[0132] Oligonucleotide conjugates according to the invention which
possess more than one group which is suitable for salt formation
can also form mixed salts.
[0133] Pharmaceutically unsuitable salts, for example picrates or
perchlorates, can also be used for isolation and purification.
[0134] It is only the pharmaceutically tolerated salts, which are
nontoxic when used correctly, which are employed for therapeutic
purposes and which are therefore preferred.
[0135] The invention furthermore provides a compound of the formula
(Ia) 31
[0136] in which
[0137] A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which
[0138] R.sub.1 and R.sub.2 are, independently of each other,
[0139] H,
[0140] C.sub.1-C.sub.10alkyl,
[0141] a radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II),
[0142] in which each X is, in each case, independently of each
other, O or N(R.sub.6), R.sub.5 and R.sub.6 are, in each case,
independently of each other, H, C.sub.1-C.sub.10alkyl,
amino-C.sub.2-C.sub.10alkyl,
N-mono-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl or
N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.2-C.sub.10alkyl, and m is
an integer from 1 up to and including 3,
[0143] amino-C.sub.3-C.sub.10alkyl,
[0144] N-mono-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10alkyl,
or
[0145] N,N-di-C.sub.1-C.sub.10alkylamino-C.sub.3-C.sub.10alkyl; or
in which
[0146] --N(R.sub.1)(R.sub.2) are together a radical of the formula
(III) 32
[0147] in which Y is O, S, SO.sub.2 or N(R.sub.7), and R.sub.7 is H
or --CH.sub.3;
[0148] R.sub.3 is H, --CH.sub.3, --CH.sub.2CH.sub.3, --CH.sub.2OH
or --CH.sub.2--O--C.sub.1-C.sub.4alkyl; or
[0149] A is a radical of the formula (IVa) or (IVb) 33
[0150] in which R, independently, has the meaning of R.sub.1 or
R.sub.2, and U is O or CH.sub.2;
[0151] R.sub.4 is H, --CH.sub.3, --CH.sub.2CH.sub.3, --CH.sub.2OH
or --CH.sub.2--O--C.sub.1-C.sub.4alkyl;
[0152] n is 0, 1 or 2;
[0153] B' is the radical of a protected or unprotected nucleic acid
base; and
[0154] V.sub.a and W.sub.a are, independently of each other, --OH,
--NH.sub.2 of identically or differently protected hydroxyl or
amino groups,
[0155] where those compounds are excepted in which, in the radical
A, two heteroatoms are linked to the same carbon atom,
[0156] and where other reactive groups are present in protected or
unprotected form.
[0157] In a further embodiment of the radical of formula (III) Y is
SO.
[0158] A compound of the formula (Ia) is preferred in which
[0159] A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which
[0160] R.sub.1 and R.sub.2 are, independently of each other, H,
C.sub.1-C.sub.5alkyl, amino-C.sub.2-C.sub.5alkyl,
N-mono-C.sub.1-C.sub.3a- lkylamino-C.sub.2-C.sub.5alkyl,
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C- .sub.5alkyl or a
radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II),
[0161] in which X is O or N(R.sub.6), R.sub.5 and R.sub.6 are,
independently of each other, H, C.sub.1-C.sub.3alkyl,
amino-C.sub.2-C.sub.3alkyl,
N-mono-C.sub.1-C.sub.3alkylamino-C.sub.2-C.su- b.5alkyl or
N,N-di-C.sub.1-C.sub.3alkylamino-C.sub.2-C.sub.5alkyl, and m is 1;
and where R.sub.3 has the said meanings and is, in particular,
H.
[0162] A compound of the formula (Ia) is further preferred in
which
[0163] R.sub.1 and R.sub.2 are, independently of each other, H,
methyl, ethyl, aminoethyl, aminopropyl, N-monomethylaminoethyl,
N-monomethylaminopropyl, N-monoethylaminoethyl,
N-monoethylaminopropyl, N,N-dimethylaminoethyl,
N,N-dimethylaminopropyl, N,N-diethylaminoethyl,
N,N-diethylaminopropyl, or a radical of the formula II
--(CH.sub.2--CH.sub.2--X).sub.m--R.sub.5 (II),
[0164] in which X is O or N(R.sub.6), R.sub.5 and R.sub.6 are,
independently of each other, H, methyl, ethyl or propyl, and m is
1.
[0165] A compound of the formula (Ia) is particularly preferred in
which
[0166] R.sub.1 and R.sub.2 are, independently of each other, H,
methyl, ethyl, aminoethyl, N-monomethylaminoethyl,
N-monoethylaminoethyl, N,N-dimethylaminoethyl or
N,N-diethylaminoethyl.
[0167] In particular, R.sub.1 and R.sub.2 are, independently of
each other, H, methyl or ethyl.
[0168] In an advantageous embodiment of the compound of the formula
(Ia),
[0169] R.sub.1 and R.sub.2 are in each case H, or
[0170] R.sub.1 and R.sub.2 are in each case methyl, or
[0171] one of the substituents R.sub.1 and R.sub.2 is H and the
other is methyl.
[0172] In this context, in particular, R.sub.1 and R.sub.2 are in
each case methyl, or one of the substituents R.sub.1 and R.sub.2 is
H and the other is methyl.
[0173] In the compounds of the formula (Ia) according to the
invention, including the said preferences, R.sub.3 and R.sub.4 are,
independently of each other, H, --CH.sub.3, --CH.sub.2OH or
--CH.sub.2--O--CH.sub.3.
[0174] Preference is given to compounds of the formula (Ia)
according to the invention, including the said preferences, in
which n is 0.
[0175] Compounds of the formula (Ia) according to the invention are
particularly advantageous in which n is 0 and A is a radical of the
formula --C(H)(R.sub.3)--N(R.sub.1)(R.sub.2) in which
[0176] R.sub.3 is H and R.sub.1 and R.sub.2 are defined as above,
including the said preferences.
[0177] A compound of the formula (Ia) according to the invention is
furthermore preferred in which A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2), in which
--N(R.sub.1)(R.sub.2) is a radical of the said formula (III), where
particular preference is given to Y being N(R.sub.7) and R.sub.7
being H or, particularly preferably --CH.sub.3; in this context, n
is preferably 0, R.sub.3 is preferably H.
[0178] An embodiment which is further preferred relates to a
compound of the formula (Ia) according to the invention in which A
is a radical of the abovementioned formula (IVa), where R is
particularly preferably H or C.sub.1-C.sub.10alkyl, in particular
H; in this context, n is preferably 0.
[0179] In the compounds of the formula (Ia), other reactive groups
in the 2' substituent, for example an unsubstituted or
monosubstituted amino group in the said substituent A, can be
present in protected form, with the compounds of the formula (Ia)
which are present in protected form being particularly suitable for
oligonucleotide synthesis.
[0180] The invention furthermore relates to compounds of the
formula (Ia) according to the invention, including the said
preferences, in which
[0181] B' is a radical of the formula (VI) to (V14) 3435
[0182] in which
[0183] R.sub.b1 is --NH.sub.2, --SH or --OH;
[0184] R.sub.b2 is H, --NH.sub.2 or --OH; and
[0185] R.sub.b3 is H, Br, I, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3;
[0186] R.sub.b4 is --NH.sub.2 or --OH; and
[0187] R.sub.b5 is H, F, Br, I, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3;
[0188] with exocyclic amino groups being present in unprotected or
protected form.
[0189] A compound of the formula (Ia) is preferred in which
[0190] B' is a radical of the formula (V1), (V2), (V3), (V4) or
(V5) 36
[0191] in which
[0192] R.sub.b1 is --NH.sub.2, --SH or --OH;
[0193] R.sub.b2 is H, --NH.sub.2 or --OH; and
[0194] R.sub.b3 is H, Br, 1, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3;
[0195] R.sub.b4 is --NH.sub.2 or --OH; and
[0196] R.sub.b5 is H, F, Br, 1, --CN, --C.ident.C--CH.sub.3,
--C(O)NH.sub.2 or --CH.sub.3:
[0197] with exocyclic amino groups being present in unprotected or
protected form.
[0198] B' in a compound of the formula (Ia) is, in particular,
selected from the group of the following radicals: xanthine,
hypoxanthine, adenine, 2-aminoadenine, guanine, 6-thioguanine,
uracil, thymine, cytosine, 5-methylcytosine, 5-propynyluracil,
5-flourouracil and 5-propynylcytosine, with exocyclic amino groups
being present in protected or unprotected form.
[0199] Protecting groups for amino groups and hydroxyl groups, in
particular in the case of nucleic acid bases or in the case of a
sugar residue in a nucleoside, and methods for derivatizing these
functional groups, are well known in sugar chemistry and nucleic
acid chemistry and are applicable to the present invention (cf.,
for example, Beaucage, S. L. et al., Tetrahedron 48 (1992),
2223-2311; J. F. W. McOmie, "Protective Groups in Organic
Chemistry", Plenum Press, London and New York 1973; Th. W. Greene,
"Protective Groups in Organic Synthesis", Wiley, New York 1981, in
"The Peptides", Volume 3 (E. Gross and J. Meienhofer, eds.),
Academic Press, London und New York 1981; Greene, B. T.,
"Protective Groups in Organic Synthesis", Wiley Interscience, New
York (1991); Sonveaux, E., Bioorganic Chemistry 14, 274-325 (1986);
"Methoden der organischen Chemie" (Methods of organic chemistry),
Houben-Weyl, 4th Edition, Vol. 15/I, Georg Thieme Verlag, Stuttgart
1974; H.-D. Jakubke and H. Jescheit, "Aminosauren, Peptide,
Proteine" (Amino acids, Peptides and Proteins), Verlag Chemie,
Weinheim, Deerfield Beach and Basle 1982). Examples of these
protecting groups are: benzyl, methylbenzyl, dimethylbenzyl,
methoxybenzyl, dimethoxybenzyl, bromobenzyl, 2,4-dichlorobenzyl;
diphenylmethyl, di(methylphenyl)methyl, di(dimethylphenyl)methyl,
di(methoxyphenyl)methyl, di(dimethoxyphenyl)methyl,
triphenylmethyl, tris-4,4',4"-tert-butylphenyl- methyl,
di-p-anisylphenylmethyl, tri(methylphenyl)methyl,
tri(dimethylphenyl)methyl, methoxyphenyl(diphenyl)methyl,
di(methoxyphenyl)phenylmethyl, tri(methoxyphenyl)methyl,
tri(dimethoxyphenyl)methyl; triphenylsilyl, alkyldiphenylsilyl,
dialkylphenylsilyl and trialkylsilyl having from 1 to 20,
preferably from 1 to 12 and particularly preferably from 1 to 8 C
atoms in the alkyl groups, for example trimethylsilyl,
triethylsilyl, tri-n-propylsilyl, isopropyl-dimethylsilyl,
tert-butyldimethylsilyl, tert-butyldiphenylsilyl- ,
n-octyldimethylsilyl, (1,1,2,2-tetramethylethyl)dimethylsilyl;
--(C.sub.1-C.sub.8alkyl).sub.2Si--O--Si(C.sub.1-C.sub.8alkyl).sub.2--,
in which alkyl is, for example, methyl, ethyl, n- and iso-propyl or
n-, iso- or tert-butyl; C.sub.2-C.sub.12--, in particular
C.sub.2-C.sub.8acyl, for example acetyl, propanoyl, butanoyl,
pentanoyl, hexanoyl, benzoyl, methylbenzoyl, methoxybenzoyl,
chlorobenzoyl and bromobenzoyl; R.sub.S1--SO.sub.2--, in which
R.sub.S1 is C.sub.1-C.sub.12alkyl, in particular
C.sub.1-C.sub.6alkyl, C.sub.5- or C.sub.6cycloalkyl, phenyl,
benzyl, C.sub.1-C.sub.12-- and, in particular,
C.sub.1-C.sub.4alkylphenyl- , or C.sub.1-C.sub.12-- and, in
particular, C.sub.1-C.sub.4alkylbenzyl, or halophenyl or
halobenzyl, for example methyl-, ethyl-, propyl-, butyl-, phenyl-,
benzyl-, p-bromo-, p-methoxy- and p-methylphenylsulfonyl;
C.sub.1-C.sub.12--, preferably C.sub.1-C.sub.8alkoxycarbonyl, which
is unsubstituted or substituted by F, Cl, Br,
C.sub.1-C.sub.4alkoxy, tri-(C.sub.1-C.sub.4alkyl)silyl or
C.sub.1-C.sub.4alkylsulfonyl, for example methoxy-, ethoxy-, n- or
iso-propoxy- or n-, iso- or tert-butoxycarbonyl,
2-trimethylsilylethoxycarbonyl, 2-methylsulfonylethoxycarbonyl,
allyloxycarbonyl, or phenyloxycarbonyl which is unsubstituted or
substituted as in the case of alkoxycarbonyl, or benzyloxycarbonyl,
for example methyl-, methoxy- or chlorophenyloxycarbonyl, or
-benzyloxycarbonyl, and also 9-fluorenylmethyloxycarbonyl. Provided
that a protecting group is alkyl, this radical can be substituted
by F, Cl, Br, C.sub.1-C.sub.4alkoxy, phenyloxy, chlorophenyloxy,
methoxyphenyloxy, benzyloxy, methoxybenzyloxy or
chlorophenyloxy.
[0200] A protected amino group can, for example, be protected in a
form of an acylamino, arylamino, methylamino, etherified
mercaptoamino, 2-acyl-lower alk-1-enylamino, silylamino or N-lower
alkyl-pyrrolidinylidene group or in the form of an azido group.
[0201] In a corresponding acylamino group, acyl is, for example,
the acyl radical of an organic carboxylic acid which possesses, for
example, not more than 18 C atoms, in particular an unsubstituted
or substituted, for example substituted by halogen or aryl, lower
alkane carboxylic acid, or an unsubstituted or substituted, for
example halogen-, lower alkoxy- or nitro-substituted benzoic acid,
or preferably a carbonic acid semiester. Examples of such acyl
groups are lower alkanolyl, such as formyl, acetyl, propionyl,
isobutyryl or pivaloyl; halogen-lower alkanoyl, for example
2-haloacetyl, such as 2-chloro-, 2-bromo-, 2-iodo-,
2,2,2-triflouro- or 2,2,2-trichloro-acetyl; phenoxy- or (lower
alkoxy)phenoxy-lower alkyl, such as phenoxyacetyl or
4-tert-butylphenoxyacetyl; unsubstituted or substituted, for
example halogen-, lower alkoxy- or nitro-substituted, benzoyl, such
as benzoyl, 4-chlorobenzoyl, 4-methoxybenzoyl or 4-nitrobenzoyl;
lower alkoxycarbonyl, preferably lower alkoxycarbonyl which is
branched in the 1 position of the lower alkyl radical or is
suitably substituted in the 1 or 2 positions, for example
tert-lower alkoxycarbonyl, such as tert-butoxycarbonyl;
arylmethoxycarbonyl having one, two or three phenyl radicals which
are unsubstituted or monosubstituted or polysubstituted by, for
example, lower alkyl, in particular tert-lower alkyl, such as
tert-butyl, lower alkoxy, such as methoxy, hydroxyl, halogen, such
as chlorine, and/or nitro, for example benzyloxycarbonyl,
4-nitrobenzyloxycarbonyl, diphenylmethoxycarbonyl,
9-fluorenylmethoxycarbonyl or di(4-methoxyphenyl)-methoxycarbonyl;
aroylmethoxycarbonyl, in which the aroyl group is preferably
benzoyl which is unsubstituted or substituted, for example by
halogen such as bromine, for example phenacyloxycarbonyl;
2-halogen-lower alkoxycarbonyl, for example
2,2,2-trichloroethoxycarbonyl, 2-bromoethoxycarbonyl or
2-iodoethoxycarbonyl; 2-(tri-substituted silyl)-lower
alkoxycarbonyl, for example 2-lower alkylsilyl-lower
alkoxycarbonyl, such as 2-trimethylsilylethoxycarbonyl or
2-(di-n-butylmethylsilyl)ethoxycarbonyl- ; triarylsilyl-lower
alkoxycarbonyl, for example 2-triphenylsilylethoxycar- bonyl; or
N,N-di-lower alkylformamidinyl, such as N,N-dimethylformamidinyl-
.
[0202] In an arylmethylamino group, for example a mono-, di- or, in
particular, triarylmethylamino group, the aryl radicals are, in
particular, unsubstituted or substituted phenyl radicals. Examples
of such groups are benzyl-, diphenylmethyl- or, in particular,
tritylamino.
[0203] In an etherified mercaptoamino group, the mercapto group is
present, in particular, in the form of a substituted arylthio- or
aryl-lower alkylthio group, in which aryl is, for example, phenyl
which is unsubstituted or, for example, substituted by lower alkyl,
such as methyl or tert-butyl, lower alkoxy, such as methoxy,
halogen, such as chlorine, and/or nitro, for example
4-nitrophenylthio.
[0204] In a 2-acyl lower alk-1-enyl radical, which can be used as
an amino protecting group, acyl is, for example, the corresponding
radical of a lower alkanecarboxylic acid; of a benzoic acid which
can be unsubstituted or, for example, substituted by lower alkyl,
such as methyl or tert-butyl, lower alkoxy, such as methoxy,
halogen, such as chlorine, and/or nitro; or, in particular, a
carbonic acid semiester, such as a carbonic acid lower alkyl
semiester. Corresponding protecting groups are, in particular,
1-lower alkanoyl-lower alk-1-en-2-yl, for example 1-lower
alkanoylprop-1-en-2yl, for example 1-acetylprop-1-en-2-yl, or lower
alkoxycarbonyl-lower alk-1-en-2-yl, for example lower
alkoxycarbonylprop-1-en-2-yl, such as
1-ethoxycarbonylprop-1-en-2-yl.
[0205] A silylamino group is, for example, a tri-lower
alkylsilylamino group, for example trimethylsilylamino or
tert-butyldimethylsilylamino. The silicon atom of the silylamino
group can also be substituted by only two lower alkyl groups, for
example methyl groups. Compounds which possess such protecting
groups can be prepared, for example, using the corresponding
chlorosilanes, such as dimethylchlorosilane, as silylating
agents.
[0206] An N-lower alkylpyrrolidinylidene group is, preferably,
N-methylpyrrolidin-2-ylidene.
[0207] Preferred amino protecting groups are lower alkoxycarbonyl,
phenyl-lower alkoxycarbonyl, fluorenyl-lower alkoxycarbonyl,
2-lower alkanoyl-lower alk-1-en-2-yl and lower alkoxycarbonyl-lower
alk-1-en-2-yl, particularly preferably isobutyryl, benzoyl,
phenoxyacetyl, 4-tert-butylphenoxyacetyl, N,N-dimethylformamidinyl
and N-methylpyrrolidin-2-ylidene.
[0208] When V.sub.a and W.sub.a are protected hydroxyl or amino
groups, the protecting groups can be different or, preferably,
identical. Protecting groups on a nucleic acid base B' can be
different or, preferably, identical.
[0209] In a particularly preferred embodiment, protecting groups
for V.sub.a ad W.sub.a, as protected hydroxyl or amino groups, are
selected from the following group: benzyl, methylbenzyl,
dimethylbenzyl, methoxybenzyl, dimethoxybenzyl, halogenated benzyl,
in particular bromobenzyl; diphenylmethyl, di(methylphenyl)methyl,
di(dimethylphenyl)methyl, di(methoxyphenyl)methyl,
di(methoxyphenyl)(phenyl)methyl, triphenylmethyl,
tris-4,4',4"-tert-butyl- phenylmethyl, di-p-anisylphenylmethyl,
tri(methylphenyl)methyl, tri(dimethylphenyl)methyl,
tri(methoxyphenyl)methyl, tri(dimethoxyphenyl)methyl;
trimethylsilyl, triethylsilyl, tri-n-propylsilyl,
i-propyldimethylsilyl, t-butyldimethylsilyl, t-butyidiphenylsilyl,
n-octyldimethylsilyl, (1,1,2,2-tetramethylethyl)dim- ethylsilyl,
--(CH.sub.3).sub.2Si--O--Si(CH.sub.3).sub.2--,
-(i-C.sub.3H.sub.7).sub.2Si--O--Si(i-C.sub.3H.sub.7).sub.2--;
acetyl, propanoyl, butanoyl, pentanoyl, hexanoyl, benzoyl,
methylbenzoyl, methoxybenzoyl, chlorobenzoyl and bromobenzoyl;
methyl-, ethyl-, propyl-, butyl-, phenyl-, benzyl-, p-bromo-,
p-methoxy- and p-methylphenylsulfonyl; methoxy-, ethoxy-, n- or
i-propoxy- or n-, i- or t-butoxycarbonyl, or phenyloxycarbonyl,
benzyloxycarbonyl, methyl- or methoxy- or chlorophenyloxycarbonyl
or -benzyloxycarbonyl or 9-fluorenylmethyloxycarbonyl.
[0210] Within the context of the present invention, the prefix
"lower" denotes a radical of from 1 up to and including 7,
preferably of from 1 up to and including 4, particularly preferably
of from 1 up to and including 2, C atoms, unless otherwise
indicated.
[0211] A compound of the formula (Ia) including the said
preferences, is preferred in which the protecting group for
exocyclic amino groups of the nucleic acid base B' is selected from
the following group: --C(O)CH.sub.3, --C(O)--CH(CH.sub.3).sub.2,
--C(O)-phenyl, --C(O)--CH.sub.2--O-phenyl,
--C(O)--CH-p-(tert-butyl)phenyl,
--C(O)--CH.sub.2--O-p-(tert-butyl)phenyl,
--C(O)--CH.sub.2--O-p-(isopropy- l)phenyl,
.dbd.CH--N(CH.sub.3).sub.2, .dbd.CH--N(butyl).sub.2 and 37
[0212] A compound of the formula (Ia), including the said
preferences, is furthermore preferred in which the protecting group
for V.sub.a or W.sub.a, as a protected hydroxyl group or as a
protected amino group, is a trityl-type protecting group. This
trityl-type protecting group is preferably selected from the
following group: trityl, 4-monomethoxytrityl, 4,4'-dimethoxytrityl
and 4,4',4"-tris-tert-butyltrit- yl.
[0213] The compounds of the formula (Ia) can be prepared in a
manner known per se.
[0214] The invention also provides a process for preparing a
compound of the formula (Ia), 38
[0215] in which V.sub.a, W.sub.a, A and B' are defined as above,
including the said preferences, and
[0216] (a) R.sub.4 is H, --CH.sub.3, --CH.sub.2CH.sub.3,
--CH.sub.2OH or --CH.sub.2--O--C.sub.1-C.sub.4alkyl, and n is 0,
which comprises reacting a compound of the formula (A) 39
[0217] in which V.sub.a and W.sub.a are, independently of each
other, a protected hydroxyl or amino group, and B' is defined as
above, with exocyclic amino groups in B' being protected by
protecting groups,
[0218] with a compound of the formula (B)
X--CH.sub.2-A (B),
[0219] in which X is Cl, Br, I, tosyl-O or mesyl-O, and A is
defined as above, with primary and secondary amino groups and
primary hydroxyl groups in A being protected by protecting groups;
or
[0220] (b) R.sub.4 is H, --CH.sub.3, --CH.sub.2CH.sub.3,
--CH.sub.2OH or --CH.sub.2--O--C.sub.1-C.sub.4alkyl and n is 1 or
2, which comprises reacting a compound of the formula (A) 40
[0221] in which V.sub.a and W.sub.a are, independently of each
other, a protected hydroxyl or amino group, and B is defined as
above, with exocyclic amino groups in B' being protected by the
protecting groups,
[0222] with a compound of the formula (C)
X--CH.sub.2--C(H)(R.sub.4)--[O--CH.sub.2--C(H)(R.sub.4)].sub.(n-1)--O--CH.-
sub.2-A (C)
[0223] in which X is Cl, Br, I, tosyl-O or mesyl-O, and R.sub.4 and
A are defined as above, with primary and secondary amino groups and
primary hydroxyl groups in A being protected by protecting groups;
or
[0224] (c) R.sub.4 is H and n is 1 or 2,
[0225] which comprises reacting a compound of the formula (D)
41
[0226] in which V.sub.a and W.sub.a are, independently of each
other, a protected hydroxyl or amino group, B' is defined as above,
with exocyclic amino groups in B' being protected by protecting
groups, and L is a leaving group,
[0227] with a compound of the formula (E)
HO--(CH.sub.2--CH.sub.2).sub.n-1--O--CH.sub.2-A (E)
[0228] in which A is defined as above, and with primary and
secondary amino groups and primary hydroxyl groups in A being
protected by protecting groups; or
[0229] (d) R.sub.4 is H, n is 0, and A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2),
[0230] which comprises reacting a compound of the formula (D)
42
[0231] which is defined as above,
[0232] with a compound of the formula (F)
NH(R.sub.1)(R.sub.2) (F)
[0233] in which R.sub.1, R.sub.2 or the group --N(R.sub.1)(R.sub.2)
are defined as above, and with functional groups in R.sub.1 or
R.sub.2 being protected if necessary; or
[0234] (e) R.sub.4 is H, n is 0 and A is a radical of the formula
--C(H)(R.sub.3)--N(R.sub.1)(R.sub.2),
[0235] which comprises reacting a compound of the formula (D)
43
[0236] which is defined as above,
[0237] with an azide and subsequent reduction, if necessary using a
catalyst, for example SnCl.sub.2, to give a compound of the formula
(G) 44
[0238] and, if necessary, subjecting the compound of the formula
(G) to further derivatization;
[0239] with, in cases (a) to (e), protected groups subsequently
being deprotected if necessary.
[0240] The compounds of the formulae (A), (B), (C), (E) and (F) are
known and are commercially available or can be prepared using
methods which are known per se.
[0241] A compound of the formula (D) can be prepared, for example,
by reacting a compound of the formula (A), which is defined as
above, with a compound of the formula (H)
X--CH.sub.2--C(O)OR.sub.10 (H),
[0242] in which R.sub.10 is C.sub.1-C.sub.4alkyl and X is Cl, Br,
I, tosyl-O or mesyl-O, in a solvent, reducing the ester function of
the resulting compound, preferably with NaBH.sub.4, to give a
primary alcohol of the formula (K) 45
[0243] in which V.sub.a, W.sub.a and B' are defined as above, and
converting the primary alcohol group of the compound of the formula
(K), in a manner known per se, into a leaving group L, preferably
tosyl-O or mesyl-O, thereby obtaining a compound of the formula (D)
46
[0244] Reactions of the type described, and suitable reaction
conditions, are known to the skilled person (cf., for example,
Martin, P., Helv. Chem. Acta, 78 (1995), 486 ff.; Lesnik, E. A. et
al., Biochemistry, 32 (1993), 7832 ff.; Inoue, H. et al., Nucl.
Acids Res. 15 (1987) 6131 ff.; Manoharan, M. et al., Tetrahedron
Lett. 32 (1991), 7171 ff.; Keller, T. H. et al., Helv. Chimia Acta
76 (1993), 884ff; Sproat, B. S. et al., Nucl. Acids Res. 17 (1989),
3373ff.; International Applications WO 94/02501; WO 95/16696; WO
91/06556; WO 93/07883; WO 91/15499; DE 91-4110085; WO 95/06659; the
entire content of these publications is hereby incorporated by
reference).
[0245] In the reactions described, the reaction temperature is
between -50.degree. C. and 200.degree. C., preferably between
-10.degree. C. and 90.degree. C.
[0246] The compounds of the formula (Ia) are isolated and purified
using methods which are known per se, for example precipitation,
crystallization, filtration and chromatographic methods.
[0247] A compound of the formula (Ia) is suitable, in particular,
as a synthesis building block or intermediate for preparing an
oligonucleotide derivative according to the invention.
[0248] Accordingly, the invention also provides a process for
preparing an oligonucleotide according to the invention, which
process comprises the following steps:
[0249] (i) converting a compound of the formula (Ia) into a form
which is suitable for oligonucleotide synthesis,
[0250] (ii) using the compound of the formula (Ia), which is
present in a suitable form, in oligonucleotide synthesis.
[0251] The invention also provides the use of a compound of the
formula (Ia) according to the invention as a nucleoside building
block in oligonucleotide synthesis, if desired after converting it
into a form which is suitable for oligonucleotide synthesis.
[0252] Within the context of the present invention, the expression
"conversion into a form which is suitable for oligonucleotide
synthesis" denotes, in particular, that the 5' and/or 3' hydroxyl
group of a protected or unprotected compound of the formula (Ia)
is/are converted into (a) radical(s) which is/are capable, in
association with the subsequent oligonucleotide synthesis, of
forming (an) internucleosidic bridging group(s), in particular (a)
bridging group(s) of the abovementioned type. Methods for
converting the 3' or 5' hydroxyl group(s) into such radicals are
known (cf., for example, the abovementioned publications by De
Mesmaeker, A., and Crooke, S. T.; the entire content of these
publications is hereby incorporated by reference).
[0253] The compounds of the formula (Ia), which can be present in
suitable form, are employed as nucleoside building blocks in the
synthesis of the oligonucleotide derivatives according to the
invention. The oligonucleotides according to the invention can be
prepared, in a manner known per se, in accordance with a variety of
methods, in DNA synthesis equipment which can be automated and
which can be obtained commercially in conjunction with method
protocols. For example, in the case of a phosphodiester group as
the internucleosidic bridging group, the phosphotriester method,
the phosphite triester method or the H-phosphonate method, which
are familiar to the skilled person, can be used (cf., for example,
Eckstein, F., "Oligonucleotides and Analogues, A Practical
Approach", IRL Press (1991); the entire content of this publication
is hereby incorporated by reference).
[0254] In the case of the phosphite triester method, the approach
can, for example, be to react, for example, a nucleoside building
block of the formula (Ia), in which V, and W, are in each case
--OH, with a protecting group reagent, for example
4,4'-dimethoxytriphenylmethyl chloride, to give a nucleoside of the
formula (Ib) 47
[0255] in which V.sub.a is a protected hydroxyl group and A, B' and
R.sub.4 are defined as above for the compound of the formula (Ia)
including the said preferences, and to bind the compound of the
formula Ib with the aid of a linker, for example succinic
anhydride, to a solid support material, for example to "Controlled
Pore Glassu (CPG), which contains long-chain alkylamino groups. In
a separate procedure, the hydroxyl group of another nucleoside
building block of the formula (Ib) is derivatized, for example
using R.sup.xO--P[N(i-propyl).sub.2)].sub.2 to give a
phosphoramidite of the formula (Ic) 48
[0256] in which R.sup.x is a customary protecting group, for
example .beta.-cyanoethyl. Such a compound of the formula (Ic) is
another important intermediate and constitutes another part of the
subject-matter of the present invention.
[0257] Protecting groups which are mentioned above for the radical
V.sub.a as protected hydroxyl group in compounds of the formula
(Ia) are also preferred protecting groups for the radical V.sub.a
in compounds of the formula (Ib) or (Ic). Thus, in compounds of the
formula (Ib) or (Ic), an hydroxyl group which is protected with a
trityl-type group is preferred as radical V.sub.a, with the
trityl-type group being selected, in particular, from trityl (Tr),
4-monomethoxytrityl (MMTr), preferably 4,4'-dimethoxytrityl (DMTr)
and, likewise preferably, 4,4',4"-tris-tert-butyltrityl (TTTr).
[0258] After the protecting group on the radical V.sub.a, for
example the DMTr- or the TTTr group, of the support-bound material
has been eliminated, this material is coupled, with elimination of
--N(i-C.sub.3H.sub.7).sub.2 to the compound of the formula (Ic),
any free hydroxyl groups which may be present are blocked
("capping") and the phosphite which has been formed is then
oxidized, thereby leading, for example, to the phosphate or
phosphorothioate. After the dimer has been deprotected, the
reaction cycle is repeated with a compound of the formula (Ic)
until an oligomer having the desired number of monomer units has
been synthesized, and the product is then detached from the support
material. In this way, an oligonucleotide derivative according to
the invention is obtained which is synthesized entirely from
nucleoside building blocks of the formula (Ia) having
phosphodiester groups or phosphorothioate groups, depending on the
oxidation conditions, as the internucleosidic bridging group.
Depending on the use of appropriate nucleoside building blocks in
the individual reaction cycles, oligonucleotides according to the
invention of any arbitrary sequence can be prepared in an analogous
manner, in particular those oligonucleotides according to the
invention which, in addition to one or more nucleoside building
block(s) of the formula (Ia), contain other nucleoside building
blocks, in particular those of the abovementioned type.
[0259] Oligonucleotide derivatives according to the invention which
do not contain, or which do not exclusively contain, phosphodiester
groups or phosphorothioate groups as the internucleosidic bridging
groups can be prepared in a manner known per se (cf., for example,
the abovementioned publications of De Mesmaeker, A., or Crooke, S.
T.).
[0260] As mentioned above, the oligonucleotide derivatives
according to the invention possess a number of advantageous
properties. These include, in particular, a high binding affinity
for a target nucleic acid and a high resistance to nucleases.
Furthermore, they are capable of a sequence-specific effect, are
taken up satisfactorily by a cell and have adequate
bioavailability. These properties make the oligonucleotides
according to the invention particularly suitable for pharmaceutical
applications, in particular for modulating the expression of a
protein. Another preferred pharmaceutical application is modulation
of the expression of an RNA molecule, in particular at the
transcription step.
[0261] An oligonucleotide derivative according to the invention can
be used, in particular, as an antisense oligonucleotide. The
expression "antisense" is known to the skilled person and, in the
context of the present invention, characterizes, in particular, the
relationship between an oligonucleotide derivative according to the
invention and the sequence, which is complementary to it, of a
target nucleic acid, namely that the oligonucleotide derivative and
the complementary sequence are able to hybridize to each other. The
identification of a suitable antisense oligonucleotide is a
multi-step process. First of all, a target nucleic acid is
identified which underlies the protein whose expression
characterizes a pathological state in a mammalian subject,
including man, and is to be modulated. A suitable target nucleic
acid is, in particular, the RNA which is transcribed from the gene
which encodes the protein of interest, such as pre-mRNA or,
preferably, the (mature) mRNA. In principle, modulation of
expression with the aid of an antisense oligonucleotide can also
take place at the chromosomal level. Within the target nucleic
acid, a sequence or sequences is/are identified which interact, in
particular by means of hybridization, with the oligonucleotide
derivative according to the invention such that expression of the
protein of interest is modulated. An oligonucleotide derivative
according to the invention must possess a complementarity to the
target nucleic acid which is adequate, due to sufficiently powerful
and sufficiently specific hybridization, to achieve the desired
effect.
[0262] Consequently, the invention also provides the use of an
oligonucleotide derivative according to the invention, including
the said preferences, as an antisense oligonucleotide. In this
context, oligonucleotide derivatives according to the invention are
preferred which have, as the nucleic acid base B, a radical of the
formula (V1), (V2), (V3), (V4) or (V5), which are defined
above.
[0263] Oligonucleotide derivatives according to the invention are
also able specifically to recognize a double-stranded DNA sequence
and to form, with a high degree of affinity, a triple helix
("triplex") with this DNA sequence. Triplex-forming
oligonucleotides, which can also be modified, are able selectively
to modulate the transcription of a gene into an RNA, and
consequently to modulate the expression of a protein, and are
familiar to the skilled person (cf., for example, the above-listed
publications by Cohen, J. S. et al.; Stull, R. et al.; or Plum, G.
E. et al.).
[0264] Consequently, the invention also provides the use of an
oligonucleotide derivative according to the invention, including
the said preferences, as a triplex-forming oligonucleotide. In this
context, the radicals of the formulae (V1) to (V14), in particular
the radicals of the formulae (V1 to V5) which are defined as above,
are preferred, in particular, as the nucleic acid base B.
[0265] Consequently, according to the invention, oligonucleotide
derivatives are preferred which are capable of modulating the
expression of a protein or of an RNA molecule, for example an
mRNA.
[0266] Within the context of the present invention, "modulation" of
the expression of a protein or an RNA molecule denotes, in
particular, a partial or complete inhibition of the expression, or
in particular of translation or transcription. Such an inhibition,
in particular due to partial or complete degradation of the target
nucleic acid, due to the process for translating the target nucleic
acid being completely or partially inhibited, or due to the
transcription process being completely or partially inhibited, can
be determined by means of known methods, for example by means of
the Northern blot technique at the level of the target nucleic
acid, or by means of the Western blot technique at the protein
level (cf., for example, Sambrook, J., Fritsch, E. F. and Maniatis,
T.: "Molecular Cloning: A Laboratory Manual", 2nd Edition, Cold
Spring Harbor Laboratory Press, 1989; the entire contents of this
publication is hereby incorporated by reference). In this
connection, the expression "hybridization" in particular denotes
binding by way of hydrogen bonds, known as "Watson-Crick
base-pairing", between complementary bases of an oligonucleotide
derivative according to the invention, on the one hand, and of a
target nucleic acid, on the other hand. Guanine and cytosine are an
example of complementary bases between which three hydrogen bonds
are formed. Adenine and thymine, or adenine and uracil, are
examples of complementary bases between which two hydrogen bonds
are formed in each case. "Specific hybridization" denotes that a
sufficient degree of complementarity exists between the
oligonucleotide derivative according to the invention and the
target nucleic acid to enable specific binding between the
oligonucleotide derivative and the nucleic acid to be achieved. In
this context, it is not absolutely necessary, for achieving
specific hybridization, for 100% complementarity to exist between
the oligonucleotide derivative according to the invention and the
target nucleic acid. An oligonucleotide derivative according to the
invention hybridizes "specifically" with a target nucleic acid when
the binding of the oligonucleotide to the target nucleic acid
impairs the function of the latter and, furthermore, an adequate
degree of complementarity is present in order to avoid non-specific
binding of the oligonucleotide derivative according to the
invention to a nucleic acid other than the target nucleic acid when
specific binding is required, for example under physiological
conditions in association with an in-vivo application, such as a
therapeutic treatment.
[0267] Specific hybridization can be determined, for example, by
means of an in-vitro hybridization assay between an oligonucleotide
derivative according to the invention and a target nucleic acid.
Appropriate reaction conditions are known (cf., for example,
Sambrook, J., Fritsch, E. F. and Maniatis, T.: "Molecular Cloning:
A Laboratory Manual", 2nd Edition, Cold Spring Harbor Laboratory
Press, 1989, Vol. 2, 9.47 to 9.58; the entire content of this
publication is hereby incorporated by reference).
[0268] By means of selecting a suitable base sequence, an
oligonucleotide derivative according to the invention can, in
principle, be directed against any target nucleic acid of interest.
The present invention can consequently be applied independently of
a particular base sequence per se of the oligonucleotide derivative
according to the invention and consequently independently of the
underlying target nucleic acid.
[0269] The present invention is preferably applicable to an
oligonucleotide which has been found to be capable of modulating
the expression of a protein or of an RNA molecule. Such an
oligonucleotide is then modified in accordance with the invention,
as explained below, by way of example, with the aid of a preferred
embodiment.
[0270] Antisense oligonucleotides which are directed against human
c-raf RNA, in particular an antisense oligonucleotide which is
complementary to the region which extends from base position 2484
to base position 2503 of human c-raf mRNA (in accordance with T. I.
Bonner et al., Nucleic Acids Res. 14 (1986), 1009-1015), have
already been described (B. P. Monia et al., Nature Medicine 2
(1996), 668-675; K.-H. Altmann et al., Chimia 50 (1996), 168-176).
Within the context of the present invention, it was observed that
such an antisense oligonucleotide (designated ISIS 5132 in the said
publications of B. P. Monia et al. and K.-H. Altmann et al.) is
particularly effective when it is present in a form which has been
modified in accordance with the invention, i.e. when it exists as
an oligonucleotide derivative in which at least one nucleoside
building block of the said antisense oligonucleotide has been
replaced by a nucleoside building block of the said formula
(I).
[0271] Consequently, another preferred embodiment of the present
invention relates to an oligonucleotide derivative according to the
invention which is essentially complementary to the region which
extends from base position 2484 to base position 2503 of human
c-raf mRNA (in accordance with T. I. Bonner et al., Nucleic Acids
Res. 14 (1986), 1009-1015). The base sequence of the nucleoside
building blocks of the said region of human c-raf mRNA is
2 5'-AAUGCAUGUCACAGGCGGGA-3'. (SEQ. ID. NO. 1)
[0272] Within the context of the present invention, "essentially
complementary" denotes that the oligonucleotide derivative
according to the invention possesses a sufficiently high
complementarity to the target strand so that it is capable of
hybridizing specifically with the said region of human c-raf
mRNA.
[0273] However, an oligonucleotide derivative according to the
invention whose base sequence possesses one or more, for example 1,
2 or 3, base mispairings ("mismatches") in relation to the base
sequence of the said region of the target nucleic acid c-raf mRNA
is also regarded, within the context of the present invention, as
being "essentially complementary" to the target nucleic acid as
long as such an oligonucleotide derivative is able to hybridize
specifically with the said region of the target nucleic acid.
[0274] Particularly preferably, the oligonucleotide derivative
according to the invention has the following base sequence
3 5'-TCCCGCCTGTGACATGCATT-3' (SEQ. ID. NO. 2)
[0275] or a base sequence which is analogous thereto, with the
oligonucleotide derivative comprising at least one nucleotide
building block which corresponds to the said formula (I). Such an
oligonucleotide consequently consitutes another preferred part of
the subject-matter of the present invention. Within the context of
the present invention, "analogous base sequence" denotes a base
sequence in which one or more nucleic acid bases of the base
sequence according to SEQ.ID.NO.2 has/have been replaced by
corresponding analogous nucleic acid bases, for example cytosine by
5-methylcytosine, or adenine by 2-aminoadenine, or by an inert base
like hypoxanthine. Such analogous or inert bases are known to the
skilled person and are mentioned above.
[0276] The length of such an oligonucleotide derivative according
to the invention preferably corresponds to the length of the said
region of human c-raf mRNA, that is to 20 nucleoside building
blocks.
[0277] Those oligonucleotide derivatives which are directed against
c-raf mRNA are further preferred which correspond to the particular
and preferred embodiments, which are mentioned herein, of the
oligonucleotide derivatives according to the invention, in
particular those which possess additional modifications and/or a
chimeric structure.
[0278] Preferably, such an oligonucleotide derivative according to
the invention is able to modulate expression of the human c-raf
protein.
[0279] The invention furthermore relates to a pharmaceutical
composition which comprises an oligonucleotide derivative according
to the invention, or a pharmaceutically tolerated salt thereof, in
a pharmaceutically effective quantity, if desired together with a
pharmaceutically tolerated excipient and/or auxiliary substance.
Pharmaceutical compositions according to the invention (and also
oligonucleotide derivatives according to the invention) can be
used, for example, for the therapeutic or prophylactic treatment of
hyperplastic or neoplastic states, for example cancer or
restenosis.
[0280] Pharmaceutical compositions which are preferred in
accordance with the invention comprise preferred oligonucleotide
derivatives as described above.
[0281] The pharmaceutical compositions according to the invention
are preferably present in the form of preparations which can be
administered parenterally or of infusion solutions. Aqueous
solutions of the active substance in water-soluble form, for
example in the form of one of the abovementioned water-soluble
salts, in the presence or absence of salts, such as NaCl, and/or
pharmaceutically tolerated excipient materials, such as sugar
alcohols, for example mannitol, are suitable, in particular, for
parenteral administration, for example for intravenous or
intraperitoneal administration. Aqueous suspensions for injection
which comprise viscosity-increasing substances, such as sodium
carboxymethyl cellulose, sorbitol and/or dextran, are also suitable
for parenteral administration. These preparations or solutions are
preferably isotonic aqueous solutions or suspensions. The active
substance can be present, for example, in the form of a
lyophilisate, if necessary together with a pharmaceutically
tolerated excipient material, which lyophilisate is brought into
solution, before its use for parenteral administration, by adding a
suitable solvent. These solutions which are suitable for parenteral
administration can also be employed as infusion solutions. The
pharmaceutical compositions according to the invention can be
sterilized and/or comprise auxiliary substances, for example
preservatives, stabilizers, wetting agents and/or emulsifying
agents, solubilizing agents, salts for regulating the osmotic
pressure and/or buffers.
[0282] The pharmaceutical preparations, which, if desired, can
comprise additional pharmacologically (or pharmaceutically) active
compounds, for example antibiotics, are prepared in a manner known
per se, for example by means of conventional solubilizing or
lyophilizing methods, and comprise from about 0.0001% by weight to
about 95% by weight, preferably from about 0.1% by weight, to about
90% by weight, in particular from about 0.5% by weight to about 30%
by weight, for example from 1% by weight to 5% by weight, of active
compound(s). Dosage forms in the form of individual doses comprise,
for example, from about 0.001% by weight to about 20% by weight, of
active compound(s); dosage forms which are not in the form of
individual doses comprise, for example, from about 0.001% by weight
to about 10% by weight of active compound(s). Dose units preferably
comprise from about 0.0005 mg to about 0.5 mg, preferably from
about 0.005 mg to about 40 mg of active compound(s), depending on
the nature of the mammalian subject, including man, to be treated,
on the disease to be treated and on the condition of the patient,
in particular its/his/her body weight, its/his/her age and
its/his/her individual state of health, and also on individual
pharmacokinetics contributing factors and the route of
administration.
[0283] In order to improve activity, the pharmaceutical
compositions according to the invention can comprise cationic
lipids.
[0284] Pharmaceutical compositions according to the invention are
also preferred which additionally comprise a customary cytostatic
agent. Such combination preparations are preferably employed for
treating hyperplastic or neoplastic states such as cancer.
[0285] The present invention furthermore relates to an
oligonucleotide derivative according to the invention, including
the abovementioned preferences, or a pharmaceutically tolerated
salt thereof, for use in the prophylactic or therapeutic treatment
of a mammalian subject including man.
[0286] The present invention furthermore relates to the use of an
oligonucleotide derivative according to the invention, including
the abovementioned preferences, or of a pharmaceutically tolerated
salt thereof, for preparing a pharmaceutical composition for the
prophylactic or therapeutic treatment of a pathological state in a
mammalian subject, including man, which is characterized by the
expression of a protein or an RNA molecule.
[0287] Over and above this, the present invention relates to a
process for the prophylactic or therapeutic treatment of a
pathological state in a mammalian subject, including man, which
state is characterized by the expression of a protein or an RNA
molecule, which comprises administering a pharmaceutical
composition according to the invention to the mammalian
subject.
[0288] Moreover, the invention relates to a process for modulating
the expression of a protein or an RNA molecule in a cell, which
comprises bringing the cell, or a tissue or body fluid which
contains this cell, into contact with an oligonucleotide derivative
according to the invention, including the abovementioned
preferences, or with a pharmaceutical composition according to the
invention. Such a process for modulating the expression of a
protein or an RNA molecule in a cell can be advantageously applied
both in vitro and in vivo.
[0289] The oligonucleotide derivatives according to the invention,
including the above-mentioned preferences, are also suitable for
use as diagnostic agents and can be employed, for example, in a
manner known per se, as gene probes for detecting genetically
determined diseases or viral infections by means of selective
interaction at the level of single-stranded or double-stranded
target nucleic acids. In particular, a diagnostic application is
possible in vivo as well as in vitro, due to the increased
stability towards nucleases. The diagnosis can take place, for
example, on isolated tissue samples, blood plasma, blood serum or
other body fluids, and, in the case of in-vivo diagnosis, on
tissues, cells or body fluids in the patient to be investigated as
well.
[0290] Another aspect of the present invention consequently relates
to an oligonucleotide derivative according to the invention,
including the abovementioned preferences, for use in a diagnostic
method. As mentioned above, the oligonucleotide derivatives
according to the invention are suitable both for in-vivo and for
in-vitro diagnostic methods.
[0291] Compounds of the formula (Ia) according to the invention,
including the preferred embodiments, can furthermore be employed as
pharmaceutical active compounds, for example for the therapeutic or
prophylactic treatment of infectious diseases, in particular of
viral infectious diseases. Consequently, the invention also
provides a compound of the formula (Ia) according to the invention,
including the preferred embodiments, for use in the therapeutic
treatment of a mammalian subject including man. The invention also
provides a pharmaceutical composition which comprises a
therapeutically effective quantity of a compound of the formula
(Ia) according to the invention, including the said preferences, or
a pharmaceutically tolerated salt thereof, if necessary together
with a pharmaceutically tolerated excipient and/or auxiliary
substance.
[0292] It is to note that the entire content of the references,
patents and publications cited in this application is hereby
incorporated by reference.
[0293] The following examples clarify the invention but do not
restrict it. Examples are in particular directed to preferred
embodiments of the present invention.
EXAMPLES
[0294] The .sup.1H NMR spectra are based on the numbering of the
carbon atoms in the following cyclic carbon skeletons:
[0295] Starting Compounds: 49
[0296] Nucleosides (Examples): 50
[0297] Abbreviations which are used in the text and in the
formulae:
[0298] DMF dimethylformamide
[0299] TIPS-Cl.sub.2 tetraisopropyldisiloxane dichloride
[0300] Bn benzyl
[0301] BOM-Cl benzyloxymethyl chloride
[0302] DMT-OTf 4,4'-dimethoxytrityl triflate
[0303] THF tetrahydrofuran
[0304] Cl.sub.2Bn 2,4-dichlorobenzyl
[0305] Ms mesylate
[0306] Z benzyl carbamate
[0307] A) Preparation of Nucleoside Building Blocks According to
the Invention
Example A1
[0308] 11.05 g of NaH (55% in oil) are added in several portions,
at -5.degree. C., to a solution of starting compound (E1)
(obtainable according to W. T. Markiewicz, J. Chem. Research (S)
(1979), p. 24, and P. Martin, Helv. Chimia Acta 8 (1995), pp.
486-504; the entire content of these publications is hereby
incorporated by reference) in 850 ml of DMF. After 30 min., a
further 5.8 g of NaH are added. After a further 30 min., 150 ml of
a sat. solution of ammonium acetate are slowly added dropwise.
Ethyl acetate (200 ml) and water (100 ml) are then added dropwise.
The aqueous phase is extracted 3.times. with ethyl acetate. The
combined organic extracts are dried with MgSO.sub.4 and
concentrated by evaporation. The residue is recrystallized from
hexane. The compound (A1) is obtained. 51
[0309] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.55 [s, H--C(6)];
7.2-7.4 [m, Ar.-Bom]; 5.75 [s,H--C(1')]; 5.5 [AB, CH.sub.2]; 4.7
[s, CH.sub.2]; 4.5 [dd, CH.sub.2--OC(2')]; 3.7 [s, COOCH.sub.3];
1.9 [s, CH.sub.3(T)]; 1.0 [m, Tips].
[0310] MS: 693 (M+H).sup.+.
Example A2
[0311] 30 g of compound (A1) are dissolved in 430 ml of
THF/methanol (8/2). The solution is cooled down to 5.degree. C.
3.78 g of LiBH.sub.4 are then added in small portions. After 30
minutes at 5.degree. C., a sat. aqueous solution of NH.sub.4Cl is
added dropwise. The reaction mixture is then concentrated by
evaporation and the residue subsequently diluted with 100 ml of
water. After extraction with dichloromethane, the organic phase is
dried with MgSO.sub.4 and concentrated by evaporation. For removing
salts, the residue is filtered through a small frit containing
silica gel (ethyl acetate/hexane 4/6). The compound (A2) is
obtained. 52
[0312] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.55 [s, H--C(6)];
7.2-7.4 [m, Ar.-Bom]; 5.7 [s,H--C(1')]; 5.5 [AB, CH.sub.2]; 4.7 [s,
CH.sub.2]; 1.9 [s, CH.sub.3(T)]; 1.0 [m, Tips].
[0313] MS: 665 (M+H).sup.+.
Example A3
[0314] 61 g of compound (A2) are dissolved in 1.5 l of
dichloromethane. 35 ml of triethylamine, 45.7 g of tosyl chloride
and 10 g of 4-dimethylaminopyridine are added at 20.degree. C. The
mixture is then stirred for 16 hours. The reaction mixture is
extracted twice with 0.7 l of water and twice with a sat. aqueous
solution of Na.sub.2CO.sub.3. The extract is dried with
Na.sub.2SO.sub.4 and concentrated by evaporation. For purification,
the residue is filtered rapidly through silica gel using hexane as
eluent. The compound (A3) is obtained. 53
[0315] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.8[2H, tosyl]; 7.55 [s,
H--C(6)]; 7.2-7.4 [m, 7H, tosyl+Ar.-Bom]; 5.6 [s,H--C(1')]; 5.5
[AB, Bom-CH.sub.2]; 4.7 [s, Bom-CH.sub.2]; 2.4[s, tosyl-CH.sub.3];
1.9 [s, CH.sub.3(T)]; 1.0 [m, Tips].
[0316] MS: 819 (M+H).sup.+.
Example A4
[0317] 30 g of compound (A3) are dissolved in 500 ml of DMF. The
solution is cooled down to 0.degree. C. Dimethylamine gas is then
passed into the solution for 5 min. and the mixture is stirred in a
sealed vessel at RT for 24 h. The reaction mixture is then poured
onto water and this mixture is then extracted with ethyl acetate.
The organic phase is dried with MgSO.sub.4 and concentrated by
evaporation. The compound (A4) is obtained. 54
[0318] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.55 [s, H--C(6)];
7.2-7.4 [m, Ar.-Bom]; 5.7 [s.sub.3H--C(1')]; 5.5 [AB,
Bom-CH.sub.2]; 4.7 [s, Bom-CH.sub.2]; 2.3[s, N(CH.sub.3).sub.2];
1.9 [s, CH.sub.3(T)]; 1.0 [m, Tips].
[0319] MS: 692 (M+H).sup.+.
Example A5
[0320] 39.5 g of compound (A4) are dissolved in 700 ml of THF. 126
ml of a 1 M solution of nBu.sub.4NF in THF are added dropwise at
room temperature and the reaction mixture is stirred at RT for 3
hours. Concentrating the solution by evaporation, and subsequent
chromatography on silica gel (methanol/dichloromethane), yields
compound (A5). 55
[0321] .sup.1H NMR (250 MHz, MeOH): 7.85 [s, H--C(6)]; 7.1-7.3 [m,
Ar.-Bom]; 5.8 [d,H--C(1')]; 5.4 [s, Bom-CH.sub.2], 4.5 [s,
Bom-CH.sub.2]; 2.3[s, N(CH.sub.3).sub.2]; 1.8 [s, CH.sub.3(T)].
[0322] MS: 450 (M+H).sup.+.
Example A6
[0323] 21 g of compound (A5) are dissolved in 400 ml of methanol
and hydrogenated over 2 g of Pd/C (10%) at 25.degree. C. and under
standard pressure for 3.5 hours. After filtration, the residue is
extracted with a solution of NaHCO.sub.3 and the organic phase is
filtered through Hyflo Super Cel (from Fluka). The methanol is
evaporated and the compound is dissolved in THF, and this solution
is dried with Na.sub.2SO.sub.4 and concentrated by evaporation. The
compound (A6) is obtained. 56
[0324] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.3 [s, H--C(6)]; 5.5
[d,H--C(1')]; 2.3[s, N(CH.sub.3).sub.2]; 1.9 [s, CH.sub.3(T)].
[0325] MS: 330 (M+H).sup.+.
Example A7
[0326] 1.08 g of compound (A6) are taken up twice in pyridine and
concentrated by evaporation. The compound is taken up again in 20
ml of pyridine/dichloromethane (1/1) and 1.78 g of DMT-OTf are
added. After having been stirred at room temperature for 1 hour,
the reaction mixture is diluted with 20 ml of dichloromethane and
the whole is poured onto 50 ml of NaHCO.sub.3 solution. The organic
phase is dried with Na.sub.2SO.sub.4 and concentrated by
evaporation. The residue is chromatographed through silica gel
(methanol/dichloromethane/triethylamin- e 9:89:2). The compound
(A7) is obtained. 57
[0327] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.70 [s, H--C(6)]; 6.0
[d, H--C(1')]; 3.8 (s, OCH.sub.3); 2.3 (s, CH.sub.3); 1.4 (s,
CH.sub.3).
[0328] MS: 632 (M+H).sup.+.
Example A8
[0329] 6.57 g of compound (A7) are added to an initially introduced
mixture of 4.3 g of diisopropylammonium tetrazolide, 6.9 g of
2-cyanoethyl-N,N,N'-N'-tetraisopropylphosphorodiamidite and 30 ml
of dichloromethane. The reaction mixture is stirred at 40.degree.
C. for 1 hour and then poured onto a saturated aqueous solution of
NaHCO.sub.3. The organic phase is dried with Na.sub.2SO.sub.4 and
concentrated by evaporation. The residue is chromatographed through
silica gel (methanol/methylene chloride 5:95 containing 2% added
triethylamine). The resulting foam is dissolved in 80 ml of ether
and this solution is added dropwise, for precipitation, to pentane
at 0.degree. C. The compound (A8) (diastereoisomers, 1:1) is
obtained. 58
[0330] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.7 [s, H--C(6)] and 7.6
[s, H--C(6)]; 6.1 [d, H--C(1)]; 6.0 [d, H--C(1')];
[0331] .sup.31P NMR(CDCl.sub.3): 150.186 and 150.012
[0332] MS: 832 (M+H).sup.+
Example A9
[0333] 3.5 g of compound (A3) are slurried in 30 ml of
dimethylformamide and the mixture is cooled down to 0.degree. C.
Gaseous methylamine is then passed in for 5 min., the reaction
vessel is sealed, and the solution is stirred at RT for 3.5 hours.
The reaction mixture is then poured onto water and this mixture is
extracted with ethyl acetate. The organic phase is dried with
MgSO.sub.4 and concentrated by evaporation. The compound (A9) is
obtained. 59
[0334] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.55 [s, H--C(6)];
7.2-7.4 [m, Ar.-Bom]; 5.7 [s,H--C(1')]; 5.5 [AB, Bom-CH.sub.2]; 4.7
[s, Bom-CH.sub.2; 2.45[s, NCH]; 1.9 [s, CH.sub.3(T)]; 1.0 [m,
Tips].
[0335] MS: 678 (M+H).sup.+.
Example A10
[0336] 2.63 g of compound (A9) are dissolved in 30 ml of pyridine
and the solution is cooled down to 0.degree. C. 0.6 ml of
trifluoroacetic anhydride is then added dropwise and the mixture is
stirred at 23.degree. C. for 1 h. The reaction mixture is then
concentrated by evaporation and the residue is taken up in ethyl
acetate; the solution is extracted three times with water and then
dried with Na.sub.2SO.sub.4 and concentrated by evaporation. The
compound (A10) is obtained after concentrating by evaporation and
then chromatographing the residue on silica gel (ethyl
acetate/hexane 3/7). 60
[0337] .sup.1H NMR (250 MHz, CDCl.sub.3, 2 rotamers): 7.55 [2s,
H--C(6)]; 7.2-7.4 [m, Ar.-Bom]; 5.7 [2s,H--C(1')]; 5.5 [AB,
Bom-CH.sub.2]; 4.7 (s, Bom-CH.sub.2]; 3.2[2s, NCH.sub.3]; 1.9 [s,
CH.sub.3(T)]; 1.0 [m, Tips].
[0338] .sup.19F NMR (CDCl.sub.3): -68.75-70.38 (2s, CF.sub.3).
[0339] MS: 774 (M+H).sup.+.
Example A11
[0340] Compound (A10) is converted into the phosphoramidite (A11)
(diastereoisomers, 1:1; 2 rotamers in each case) in analogy with
the protocols described in Examples A5, A6, A7 and A8. 61
[0341] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.7 [2d, H--C(6)]; 6.1
[2dd, H--C(1)]; 3.2 [2dd, NCH.sub.3];
[0342] .sup.31P NMR(CDCl.sub.3): 150.346 150.246 150.053 and
149.671 [2d]
[0343] .sup.19F NMR (CDCl.sub.3): -68.60 -68.67 -70.24
(CF.sub.3).
[0344] MS: 914 (M+H).sup.+
Example A12
[0345] 6.0 g of compound (A3) are dissolved in 30 ml of DMF. After
adding 1.43 g of sodium azide, the mixture is stirred at 65.degree.
C. for 2 hours. The reaction mixture is then diluted with 50 ml of
ethyl acetate and the whole is poured onto 50 ml of water. The
organic phase is dried with Na.sub.2SO.sub.4 and concentrated. The
compound (A12) is obtained. 62
[0346] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.6 [s, H--C(6)]; 7.2-7.4
[m, Ar.-Bom]; 5.7 [s,H--C(1')]; 5.5 [AB, Bom-CH.sub.2]; 4.7 [s,
Bom-CH.sub.2]; 1.9 [s, CH.sub.3(T)]; 1.0 [m, Tips].
[0347] MS: 690 (M+H).sup.+.
Example A13
[0348] 4.8 g of compound (A12) are dissolved in 20 ml of methanol,
and 3.96 g of solid SnCl.sub.2 are added to this solution. The
reaction mixture is stirred at room temperature for 3 hours and
then poured onto a saturated aqueous solution of NaHCO.sub.3. The
methanol is evaporated and the residue is diluted with methylene
chloride. The organic phase is filtered through Hyflo. After
extracting with water, the organic phase is dried with MgSO.sub.4
and concentrated by evaporation. The residue is chromatographed
through silica gel (methanol/methylene chloride, 1/9). The compound
(A13) is obtained. 63
[0349] .sup.1H-NMR (250 MHz, CDCl.sub.3): 7.55 [s, H--C(6)];
7.2-7.4 [m, Ar.-Bom]; 5.7 [s,H--C(1')]; 5.5 [AB, Bom-CH.sub.2]; 4.7
[s, Bom-CH.sub.2]; 2.6 [bd s, NH.sub.2]; 1.9 [s, CH.sub.3(T)]; 1.0
[m, Tips].
[0350] MS: 664 (M+H).sup.+.
Example 14
[0351] Compound (A13) is converted into the phosphoramidite (A14)
(diastereoisomers, 1:1) in analogy with the protocols described in
Examples A10, A5, A6, A7 and A8. 64
[0352] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.7 [2d, H--C(6)]; 5.9
[m, H--C(1)]; 3.8 [s, OCH.sub.3];
[0353] .sup.31P NMR(CDCl.sub.3): 150.340 and 148.863
[0354] MS: 900 (M+H).sup.+
Example A15
[0355] 3.5 g of compound (A6) are dissolved in 70 ml of pyridine,
and 3.6 ml of Tips-Cl are added dropwise to the solution. The
reaction mixture is stirred at 40.degree. C. for 3 hours. After
evaporating off the solvent, the residue is taken up in
dichloromethane; the solution is washed with water and the organic
phase is dried with MgSO.sub.4 and concentrated by evaporation. The
residue is chromatographed through silica gel (methanol/methylene
chloride, 3/20). The compound (A15) is obtained. 65
[0356] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.6 [s, H--C(6)]; 5.7
[s,H--C(1')]; 1.9 [s, CH.sub.3(T)]; 1.0 [m, Tips].
[0357] MS: 571 (M+H).sup.+.
Example A16
[0358] 1.8 ml of POCl.sub.3 are added slowly to a solution of 12.23
g of triazole and 25.2 ml of triethylamine in 140 ml of methylene
chloride/acetonitrile (1/1). After 30 minutes, a solution of 4.5 g
of compound (A15) in 20 ml of methylene chloride/acetonitrile (1/1)
is added dropwise. The reaction mixture is stirred at 17.degree. C.
for 2 hours and then concentrated by evaporation. The residue is
extracted three times with 50 ml of water on each occasion and the
organic phase is dried with MgSO.sub.4. The compound (A16) is
obtained after evaporating. 66
[0359] .sup.1H NMR (250 MHz, CDCl.sub.3): 9.3 [s, triazolide]; 8.3
[s, H--C(6)]; 8.1 [s, triazolide]; 5.8 [s, H--C(1')]; 2.8
[m,NCH.sub.2]; 2.5 [s, CH.sub.3(T)]; 2.4 [s, N(CH.sub.3).sub.2];
1.0 [m, Tips].
[0360] MS: 623 (M+H).sup.+.
Example A17
[0361] 4.77 g of compound (A16) are dissolved in 100 ml of
dioxane/conc. ammonia (3/7) and the solution is stirred at
20.degree. C. for 3 hours. The reaction mixture is then
concentrated by evaporation and the residue is dissolved in THF.
The crude compound (A17) is obtained after drying (MgSO.sub.4) and
concentrating by evaporation. 67
[0362] MS: 571 (M+H).sup.+.
Example A18
[0363] 2.17 g of compound (A17) are dissolved in 12 ml of pyridine
and 0.75 g of benzoyl chloride is added dropwise. The reaction
mixture is stirred at 55.degree. C. for 3 hours and concentrated by
evaporation, and the residue is treated with a mixture of water and
methylene chloride. The organic phase is dried with MgSO.sub.4 and
concentrated by evaporation. Chromatography on silica gel
(methanol/methylene chloride 5/95) yields the compound (A18).
68
[0364] .sup.1H NMR (CDCl.sub.3): 8.3 [d, benzyl]; 7.8 [s, H--C(6)];
7.55 [t, benzyl]; 7.45 [t,benzyl] 5.7 [s, H--C(1')]; 2.45 [s,
N(CH.sub.3).sub.2]; 2.1 [s, CH.sub.3(T)]; 1.0 [m, tips].
[0365] MS: 675 (M+H).sup.+.
Example A19
[0366] Compound (A18) is converted into the phosphoramidite (A19)
(diastereoisomers, 1:1) in analogy with the protocols described in
Examples A5, A7 and A8. 69
[0367] .sup.1H NMR (250 MHz, CDCl.sub.3): 8.3 [d, benzoyl]; 7.9
[2s, H--C(6)]; 6.05 [2d, H--C(1)]; 2.3 [2d, N(CH.sub.3).sub.2]; 1.5
[s, CH.sub.3(T)].
[0368] .sup.31P NMR(CDCl.sub.3): 151.438
Example A20
[0369] The starting compound (E2), obtainable in accordance with W.
T. Markiewicz, see above, is converted into the product (A20) in
analogy with the protocols described in Examples A1 and A2. 70
[0370] .sup.1H NMR (250 MHz, CDCl.sub.3): 8.3 [s,H--C(8)]; 8.1 [s,
H--C(2)]; 6.05 [s, H--C(1')]; 5.8 [bd s,NH.sub.2]; 5.6
[m,H--C(3')]; 4.0 [m, CH.sub.2--O]; 3.8 [m, CH.sub.2--O]; 1.0
[m,Tips].
[0371] MS: 554 (M+H).sup.+.
Example A21
[0372] 6.41 g of compound (A20) are dissolved in 210 ml of
methanol, and 3.03 ml of N-methyl-2-dimethylpyrrolidine are added
to this solution. The reaction mixture is stirred at 23.degree. C.
for 3 hours. After that, 6 ml of water are added and the solution
is concentrated by evaporation. The residue is dissolved in
methylene chloride and the solution is extracted three times with
water. The organic phase is dried with MgSO.sub.4 and concentrated
by evaporation. The residue is chromatographed through silica gel
(methanol/methylene chloride 7/93). The compound (A21) is obtained.
71
[0373] .sup.1H NMR (250 MHz, CDCl.sub.3): 8.5 [s,H--C(8)]; 8.15 [s,
H--C(2)]; 6.1 [s, H--C(1')]; 5.6 [m,H--C(3')]; 4.0 [m,
CH.sub.2--O]; 3.8 [m, CH.sub.2--O]; 3.15 [s, CH.sub.3N]; 1.0
[m,Tips].
[0374] MS: 635 (M+H).sup.+.
Example A22
[0375] Compound (A21) is converted into the phosphoramidite (A22)
(diastereoisomers, 1:1) in analogy with the protocols described in
Examples A3, A4, A5, A7 and A8. 72
[0376] .sup.1H NMR (250 MHz, CDCl.sub.3): 8.5 [2s,H--C(8)]; 8.15
[2s, H--C(2)]; 6.1 [m, H--C(1')]; 3.15 [s, CH.sub.3N]; 1.0
[m,Tips].
[0377] .sup.31P NMR(CDCl.sub.3): 150.398 and 149.614
[0378] MS: 922 (M+H).sup.+
Example A23
[0379] 3.82 g of compound (A3) and 1.04 ml of N-methylpiperazine
are dissolved in 20 ml of DMF and the solution is warmed to
40.degree. C. After 3 hours, 1 ml of N-methylpiperazine is added to
it. After a further 2.5 hours, the reaction mixture is concentrated
by evaporation and the residue is then taken up in ether. After
washing with water, the organic phase is dried with MgSO.sub.4 and
concentrated by evaporation. The residue is chromatographed through
silica gel (methanol/methylene chloride 5/95). The compound (A23)
is obtained. 73
[0380] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.55 [s, H--C(6)];
7.2-7.4 [m, Ar.-Bom]; 5.7 [s,H--C(1')]; 5.0 [AB, Bom-CH.sub.2]; 4.7
[s, Bom-CH.sub.2]; 2.3[s, NCH.sub.3; 1.9 [s, CH.sub.3(T)]; 1.0 [m,
Tips].
[0381] MS: 747 (M+H).sup.+.
Example A24
[0382] Compound (A23) is converted into the phosphoramidite (A24)
(diastereoisomers, 1:1; 2 rotamers in each case) in analogy with
the protocols described in Examples A5, A6, A7 and A8. 74
[0383] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.6 [2d, H--C(6)]; 6.0
[2dd, H--C(1)]; 2.3 [d, NCH.sub.3];
[0384] .sup.31P NMR(CDCl.sub.3): 151.988; 151.805.
[0385] MS: 887 (M+H).sup.+
Example A25
[0386] 6.63 g of compound (A3) and 4 ml of
3-dimethylamino-1-propylamine are dissolved in 80 ml of DMF and the
solution is warmed to 40.degree. C. After 24 hours, the reaction
mixture is concentrated by evaporation. The residue is
chromatographed through silica gel (methanol/methylene
chloride/triethylamine 5/94/1 to 15/84/1). The compound (A25) is
obtained. 75
[0387] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.5 [s, H--C(6)]; 7.2-7.4
[m, Ar.-Bom]; 5.65 [s,H--C(1')]; 5.45 [AB, Bom-CH.sub.3]; 4.7 [s,
Bom-CH.sub.2]; 2.3[d, N(CH.sub.3).sub.2]; 1.9 [s, CH.sub.3(T)]; 1.0
[m, Tips].
[0388] MS: 749 (M+H).sup.+.
Example A26
[0389] Compound (A25) is converted into the phosphoramidite (A26)
(diastereoisomers, 1:1; 2 rotamers in each case) in analogy with
the protocols described in Examples A10, A5, A6, A7 and A8. 76
[0390] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.7 [2d, H--C(6)]; 6.0
[2dd, H--C(1)]; 2.3 [2dd, N(CH.sub.3).sub.2;
[0391] .sup.31P NMR(CDCl.sub.3): 151.594; 151.520; 151.473;
151.143.
[0392] .sup.19F NMR (CDCl.sub.3): -68.940; -69.019; -69.523;
-69.555 (2d, CF.sub.3).
[0393] MS: 985 (M+H).sup.+
Example A27
[0394] 38 mg of NaH (55% in oil) are added, in several portions, to
a solution of 500 mg of starting compound (E3), which can be
obtained in accordance with P. Martin, Helv. Chimica Acta 78
(1995), 486 (the entire content of this publication is hereby
incorporated by reference), in 20 ml of THF. After 30 min. at
70.degree. C., the reaction mixture is cooled down to 20.degree. C.
After that, 270 mg of (E4), which can be obtained in accordance
with G. T. Anderson et al. J. Org. Chem. 61 (1996), 125 (the entire
content of this publication is hereby incorporated by reference),
are added dropwise and the reaction mixture is stirred at
80.degree. C. After 24 hours, ethyl acetate and water are added
dropwise. The aqueous phase is extracted 2.times. with ethyl
acetate. The combined organic extracts are dried with MgSO.sub.4
and concentrated by evaporation. The compound (A27) is obtained
after chromatography through silica gel (ethyl acetate/hexane
3/7).
[0395] .sup.1H NMR (250 MHz, CDCl.sub.3; two rotamers): 7.6 [d,
H--C(6)]; 7.2-7.4 [m, Ar]; 5.8-6 [d,H--C(1')]; 5.45 [AB,
Bom-CH.sub.2]; 4.9-5.1 [2d, CH.sub.2(Z)].
[0396] MS: 914 (M+H).sup.+. 77
Example A28
[0397] 300 mg of compound (A27) are dissolved in 20 ml of
methanol/THF (1/1) and hydrogenated over 60 mg of Pd/C (20%), at
25.degree. C. and under standard pressure, overnight. 1 eq. (330
.mu.L, 1 N) of HCl is added dropwise to the reaction mixture, which
is left to stir for 2 hours. After filtration, the residue is
washed with a solution of NaHCO.sub.3 and the organic phase is
filtered through Hyflo. The filtrate is concentrated by evaporation
and the residue is dissolved in THF; this solution is dried with
Na.sub.2SO.sub.4 and concentrated by evaporation. The compound
(A28) is obtained. 78
[0398] .sup.1H NMR (250 MHz, CD.sub.3OD): 7.8 [d, H--C(6)]; 5.8
[d,H--C(1')]; 4.3 [m, H--C(3')]; 1.8 [s, CH.sub.3(T)].
[0399] MS: 342 (M+H).sup.+.
Example A29
[0400] The starting compound (E5), which can be obtained in
accordance with W. T. Markiewicz, see above, is converted into the
product (A29) in analogy with the protocols described in Examples
A1, A2, A3 and A4. 79
[0401] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.8 [s,H--C(8)]; 5.9 [s,
H--C(1')]; 5.5 [bd s,NH.sub.2]; 4.75 [bd s,NH.sub.2]; 4.6
[m,H--C(3')]; 2.6 [t, CH.sub.2--N]; 2.3 [s, N(CH.sub.3).sub.2]; 1.0
.mu.m,Tips].
[0402] MS: 596 (M+H).sup.+.
Example A30
[0403] Compound (A29) is converted into the product (A30) in
analogy with the protocols described in Example A5. 80
[0404] .sup.1H NMR (250 MHz, D.sub.2O): 7.9 [s,H--C(8)]; 5.9 [d,
H--C(1')]; 4.6 [m,H--C(3')]; 2.5 [t, CH.sub.2--N]; 2.3 [s,
N(CH.sub.3).sub.2].
[0405] MS: 354 (M+H).sup.+.
Example A31
[0406] 2.76 g of compound (A30) are dissolved in 48 ml of phosphate
buffer (pH 7) and 24 ml of methanol, and 1000 units of adenosine
deaminase are added to this solution. The reaction mixture is
stirred at 23.degree. C. for 6 days with the pH being kept constant
at 7 and a further 1000 units of deaminase being added each day.
Methanol and half of the water are evaporated off. The residue is
transferred into methanol; this mixture is then filtered. The
compound (A31) is obtained after drying. 81
[0407] .sup.1H NMR (250 MHz, DMSO): 7.9 [s,H--C(8)]; 5.75 [d,
H--C(1')]; 4.3 [m,H--C(2')]; 4.25 [m,H--C(3')]; 3.9 [m,H--C(4')];
3.5-3.6 [m,2H--C(5')]; 2.3 [s, N(CH.sub.3).sub.2].
[0408] MS: 355 (M+H).sup.+.
Example A32
[0409] 2.51 g of compound (A31) are suspended in 130 ml of
methanol. After 4.7 ml of N,N-dimethylformamide dimethyl acetal
have been added, the mixture is stirred at 20.degree. C. for 7
hours. The reaction mixture is then filtered and the organic phase
is concentrated. The compound (A32) is obtained). 82
Example A33
[0410] Compound (A32) is converted into the phosphoramidite (A33)
(diastereoisomers, 1:1; 2 rotamers in each case) in analogy with
the protocols described in Examples A7 and A8. 83
[0411] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.9 [d,H--C(8)]; 6.1 [2d,
H--C(1')]; 2.3 [2s, N(CH.sub.3).sub.2].
[0412] .sup.31P NMR(CDCl.sub.3): 151.658.
[0413] MS: 912 (M+H).sup.+
Example A34
[0414] 1.53 g of compound (A29) are dissolved in 30 ml of
dichloromethane/pyridine (1/1). 2.5 g of tert-butylphenoxyacetic
anhydride and 31 mg of dimethylaminopyridine are added to this
solution at 20.degree. C. The mixture is then stirred for 24 hours.
The reaction mixture is washed twice with water and twice with a
sat. aqueous solution of Na.sub.2CO.sub.3 solution. The extract is
dried with Na.sub.2SO.sub.4 and concentrated by evaporation. For
purification, the residue is chromatographed through silica gel
using methanol/dichloromethane (4/96) as the eluent. The compound
(A34) is obtained. 84
[0415] .sup.1H NMR (250 MHz, CDCl.sub.3): 9.3 [bd s,CONH]; 9.0 [bd
s,CONH]; 8,25 [s,H--C(8)]; 6.1 [s, H--C(1')]; 4.9 [bd
s,CH.sub.2CON]; 4.7 [bd s,CH.sub.2CON]; 2.3 [s, N(CH.sub.3).sub.2];
1.0 [m,Tips].
[0416] MS: 976 (M+H).sup.+.
Example A35
[0417] Compound (A34) is converted into the phosphoramidite (A35)
(diastereoisomers, 1:1; 2 rotamers in each case) in analogy with
the protocols described in Examples A5, A7 and A8. 85
[0418] .sup.1H NMR (250 MHz, CDCl.sub.3): 7.8 [d,H--C(8)]; 6.1 [2d,
H--C(1')]; 2.2 [2s, N(CH.sub.3).sub.2]. .sup.31P NMR(CDCl.sub.3):
151.630; 151.567.
[0419] MS: 1236 (M+H).sup.+
Example A36
[0420] 1.42 g of compound (A13) are dissolved in 50 ml of THF, and
this solution is treated, at 0.degree. C., with 4.7 ml of a 1 molar
solution of tetrabutylammonium fluoride. After 2 hours, aqueous
working-up takes place. The organic phase is dried with MgSO.sub.4
and concentrated by evaporation. The residue is chromatographed
through silica gel (methanol/methylene chloride 5/95). The compound
(A36) is obtained. 86
[0421] .sup.1H NMR (400 MHz, CDCl.sub.3): 7.60 [s, H--C(6)];
7.40-7.24 [m, 5H, BOM-Ar]; 5.75 [dd, H--C(1')]; 5.50 [s, 2H,
BOM-CH.sub.2]; 4.70 [s, 2H, BOM-CH.sub.2]; 4.31 [m, H--C(3')]; 4.04
[m, 2H, H--C(2', 4')]; 4.0-3.80 [m, H.sub.2C(5')]; 3.7-3.47 (m, 4H,
OCH.sub.2CH.sub.2N]; 3.02 [d, H--O(3')]; 2.53 [d, H--O(5')]; 1.92
[s, H.sub.3C(T)].
[0422] .sup.19F NMR (CDCl.sub.3): -76.20
[0423] MS: 518 (M+H).sup.+.
Example A37
[0424] 10.54 g of compound (A36) are dissolved in 100 ml of
pyridine. 2.14 g of triphenylphosphine and 2.07 g of iodine are in
each case added four times at intervals of 30 minutes and at RT.
The reaction has ended after 6 hours at RT. The reaction mixture is
diluted with ethyl acetate and this latter mixture is washed with a
sat. solution of ammonium chloride. The combined organic phases are
dried over Na.sub.2SO.sub.4 and concentrated by evaporation. The
residue is chromatographed through silica gel (methanol/methylene
chloride 5/95). The compound (A37) is obtained. 87
[0425] .sup.1H NMR (400 MHz, CDCl.sub.3): 7.78 [t, H--N,
NHCOCF.sub.3]; 7.23-7.73 [m, H--C, 5H, (BOM-Ar)]; 7.55 [s,
H--C(6)]; 5.80 [d, H--C(1')]; 5.50 [s, H--C, 2H, (BOM-CH.sub.2)];
4.70 [s, H--C, 2H (BOM-CH.sub.2)]; 3.42-4.05 [m, H--C, 9H, H--C(2',
3', 4', 5', 5', CH.sub.2CH.sub.2)]; 1.95 (s, 3H, CH.sub.3M].
[0426] MS: 628 (M+H).sup.+.
Example A38
[0427] 12.78 g of compound (A37) are dissolved in 100 ml of DMF,
1.99 g of sodium azide are added and the mixture is heated at
50.degree. C. for 14 hours. The reaction mixture is cooled down to
RT and diluted with ethyl acetate and this latter mixture is washed
with a sat. solution of ammonium chloride. The combined organic
phases are dried over Na.sub.2SO.sub.4 and concentrated by
evaporation. The residue is chromatographed through silica gel
(methanol/methylene chloride 5/95). The compound (A38) is obtained.
88
[0428] .sup.1H NMR (400 MHz, CDCl.sub.3): 7.83 [t, H--N,
NHCOCF.sub.3]; 7.70-7.25 [m, H--C, 5H, (BOM-Ar)]; 7.45 [s,
H--C(6)]; 5.79 [d, H--C(1')]; 5.50 [s, H--C, 2H, (BOM-CH.sub.2)];
4.70 [s, H--C, 2H (BOM-CH.sub.2)]; 3.83 [dd, H--C(2')]; 3.80 [dd,
H--C(5')]; 3.60 [dd, H--C(5')]; 3.69-3.43 [m, 4H,
OCH.sub.2CH.sub.2N]; 1.94 [s, 3H, CH.sub.3(T))];
[0429] .sup.19F NMR (CDCl.sub.3): -76.09.
[0430] MS: 543 (M+H).sup.+.
Example A39
[0431] 10.74 g of compound (A38) are dissolved in 60 ml of
methanol, and 2.1 g of palladium on charcoal (10%) are added to
this solution. The mixture is stirred at room temperature and under
an H.sub.2 atmosphere. After 1 hour, the palladium catalyst is
filtered off and the reaction mixture is concentrated. Compound
(A39) is obtained. 89
[0432] .sup.1H NMR (400 MHz, CD.sub.3OD+CDCl.sub.3): 7.47 [s,
H--C(6)]; 7.35-7.20 [m, H--C, 5H, (BOM-Ar)]; 5.77 [d, H--C(1')];
5.48 [s, H--C, 2H, (BOM-CH.sub.2)]; 4.65 [s, H--C, 2H
(BOM-CH.sub.2)]; 4.08 [dd, H--C(3')]; 4.03 [dd, H--C(2')]; 3.90 [m,
H--C(5')]; 3.90-3.43 [m, 4H, OCH.sub.2CH.sub.2N]; 3.08-2.87 (m, 2H,
H.sub.2C(5')]; 1.90 [s, 3H, CH.sub.3(T)];
[0433] MS: 517 (M+H).sup.+.
Example A40
[0434] 2.18 g of the carboxylic acid (E6), which can be obtained in
accordance with A. De Mesmaeker et al., Angewandte Chemie 33
(1994), 226 (the entire content of this publication is hereby
incorporated by reference), 1.75 g of compound (A39), 2.18 g of
0-(benzotriazol-1-yl)-N,N- ,N',N'-tetramethyluronium
tetrafluoroborate, 458 mg of N-hydroxybenzotriazole and 5.8 ml of
N,N-diisopropyl-N-ethylamine are dissolved in 55 ml of
N,N-dimethylformamide. The reaction mixture is stirred at room
temperature for 16 h and then diluted with ethyl acetate and this
latter mixture is washed with a sat. solution of ammonium chloride.
The combined organic phases are dried over Na.sub.2SO.sub.4 and
concentrated by evaporation. The residue is chromatographed through
silica gel (methanol/methylene chloride 5/95). The compound (A40)
is obtained. 90
[0435] .sup.1H NMR (400 MHz, CDCl.sub.3)(upper sugar=', lower
sugar="): 7.97 [t, 1H, H--NCOCF.sub.3]; 7.47 [s, H--C(6)];
7.45-7.20 [m, 10H, BOM-Ar]; 7.10 [s, H--C(6)]; 6.7 [dt, H--N(5")];
6.1 [dd, H--C(1')]; 5.49 [s, 4H, CH.sub.2-BOM]; 4.66 [d, 4H,
CH.sub.2-BOM]; 4.23 [dd, H--C(2")]; 4.12 [m, H--C(3")]; 4.00 [m,
H--C(4")]; 2.83 [m, H--C(3')]; 2.35-2.15 [m, 2H, H.sub.2C(3')];
1.94 (s, 3H, CH.sub.3(T)]; 1.63 [s, 3H, CH.sub.3(T)].
[0436] MS: 1142 (M+H).sup.+.
Example A41
[0437] 3.87 g of compound (A40) are dissolved in 50 ml of methanol.
2 ml of concentrated aqueous hydrochloric acid are added and the
mixture is treated with 3.61 g of Pd--C (10%). After stirring for
16 hours at room temperature and under a hydrogen atmosphere, the
palladium catalyst is filtered off. After the reaction mixture has
been concentrated, the crude product is purified on silica gel
(methanol/methylene chloride 15/85). The compound (A41) is
obtained. 91
[0438] .sup.1H NMR (400 MHz, CD.sub.3OD): 8.00 [s, H--C(6)]; 7.48
[s, H--C(6)]; 6.05 (dd, H--C(1']; 5.75 [d, H--C(1")]; 4.1 [dd,
H--C(2")]; 3.9 [m, H--C(2")]; 2.7 [m, H--C(4')]; 2.5-2.15 [m, 2H,
H.sub.2C(3')]; 1.90 [d, 3H, CH.sub.3(T)]; 1.88 [s, 3H,
CH.sub.3(T)].
[0439] MS: 664 (M+H).sup.+.
Example A42
[0440] 2.41 g of compound (A41) are dissolved in 15 ml of pyridine
and the solution is treated with 1.48 g of dimethoxytrityl
chloride. The reaction mixture is stirred at room temperature for
16 h and then diluted with ethyl acetate and this latter mixture is
washed with a sat. solution of ammonium chloride. The combined
organic phases are dried over NaSO.sub.4 and concentrated by
evaporation. The residue is chromatographed through silica gel
(methanol/methylene chloride 10/90). The compound (A42) is
obtained. 92
[0441] .sup.1H NMR (400 MHz, CDCl.sub.3): 7.68 [s, H--C(6)]; 7.11
[s, H--C(6)]; 7.45-6.8 [m, 13H, DMTr-Ar]; 6.10 [dd, H--C(1')]; 5.32
[d, H--C(1")]; 4.34 [dd, H--C(2")]; 4.25 [m, H--C(3")]; 3.78 [s,
6H, DMTr-OCH.sub.3]; 2.90 [m, H--C(3')]; 2.40-2.17 [m, 2H,
H--C(2')]; 1.90 [s, 3H, CH.sub.3(T)]; 1.43 [s, 3H,
CH.sub.3(T)].
[0442] MS: 966 (M+H).sup.+.
Example A43
[0443] 552 mg of compound (A42) are dissolved in 12.5 ml of
methylene chloride, and 259 mg of 2-cyanoethyl
N,N,N',N'-tetraisopropylphosphorodia- midite and 196 mg of
diisopropylammonium tetrazolide are added. The reaction mixture is
stirred at room temperature for 16 h and then diluted with ethyl
acetate and this latter mixture is washed with a sat. solution of
sodium carbonate. The combined organic phases are dried over
Na.sub.2SO.sub.4 and concentrated by evaporation. The residue is
chromatographed through silica gel (ethyl acetate/tetrahydrofuran
3:1). The compound A(43) is obtained. 93
[0444] .sup.1H NMR (400 MHz, CDCl.sub.3): 7.65 [d, H--C(6)]; 7.08
[d, H--C(6)]; 7.45-6.8 [m, 13H, DMTr-Ar]; 6.10 [dd, H--C(1')]; 5.35
[d, H--C(1")]; 4.55 [dt, H--C(2")]; 4.25 [m, H--C(3")]; 1.90 [s,
3H, CH.sub.3(T)]; 1.48 [s, 3H, CH.sub.3(T)].
[0445] MS: 1166 (M+H).sup.+.
Example B
Preparation of Oligonucleotide Derivatives According to the
Invention
[0446] Oligonucleotides are bonded to a solid support (controlled
pore glass, CPG) using the novel 5'-dimethoxytritylated and
3'-activated
[3'-(.beta.-cyanoethoxy-di(i-propylamino)phosphoramidite)]
nucleosides or nucleotide dimers, or such natural activated
nucleosides, and the synthesis is carried out on a DNA synthesizer
(Applied Biosystems, Model 380 B, standard phosphoramidite
chemistry and iodoxidation) in accordance with the manufacturer's
standard protocols (cf. also uOligonucleotide Synthesis, A
Practical Approach" M. J Gait; IRL Press 1984 (Oxford-Washington
D.C.); the entire content of this publication is hereby
incorporated by reference). If necessary, functional groups of the
nucleosides which are used are protected in an appropriate manner.
After the coupling of the last nucleoside building block, the
5'-protected oligonucleotide is released from the support, with the
simultaneous elimination of all the remaining protecting groups, by
treating with concentrated aqueous ammonia overnight, and
subsequently purifying by means of reverse-phase HPLC using 50 mM
ammonium acetate buffer (pH 7)/acetonitrile. The 5'-dimethoxytrityl
protecting group is then eliminated by a 20-minute treatment with
80% aqueous acetic acid and the oligonucleotide is precipitated
with ethanol and isolated by centrifugation. The purity of the
oligonucleotide is examined by gel electrophoresis (polyacrylamide)
and its identity is checked by means of matrix-assisted laser
desorption time-of-flight mass spectroscopy (MALDI-TOF MS).
Example C
Properties of Oligonucleotide Derivatives According to the
Invention
Example C1
Affinity; Interaction of Oligonucleotide Derivatives According to
the Invention (as Antisense Oligonucleotides) with Complementary
(Sense) Oligoribonucleotide Sequences
[0447] The interaction of the oligonucleotides with the
corresponding base-complementary oligomers of the natural
ribonucleotides is characterized by plotting UV melting curves and
by the T.sub.m values which are ascertained therefrom. This
standard method is described, for example, in Marky, L. A.,
Breslauer, K. J., Biopolymers 26: 1601-1620 (1987) (the entire
content of this publication is hereby incorporated by
reference).
[0448] A solution of the oligonucleotides and the corresponding
base-complementary natural oligoribonucleotides is prepared in 10
mM phosphate buffer, 100 mM NaCl, 0.1 mM EDTA, pH=7.0
(c=4.10.sup.-6 M/oligonucleotide) and the change in the extinction
at 260 nm is plotted as a function of temperature (0.degree. C. to
95.degree. C.). The T.sub.m value, and from that the
.DELTA.Tm(.degree. C.)/modification (i.e. .DELTA.Tm per novel
modified nucleoside building block) value, are determined from the
resulting melting curves (Table 3; capital letters in the depicted
sequences denote deoxyribonucleotides; lower case letters denote
2'-modified nucleoside building blocks; the depicted sequences only
contain phosphodiester bonds).
4TABLE 3 Affinity: 94 Mass./ X calc. /Exp. Tm(.degree. C.)
.DELTA.Tm(.degree. C.)/Mod. (a) 5'-TTTTtCTCTCTCTCT-3' (vs. RNA)
(SEQ.ID.NO:3) H 51.9 0 95 4511 4505 53.7 +1.8 96 4497 4493 53.7
+1.8 (b) 5'-TTTTtCtCtCtCtCT-3' (vs. RNA) (SEQ.ID.NO.4) H 51.9 0 97
4859 4860 60.2 +1.7 98 4789 4787 59.3 +1.5 (c)
5'-tCCAGGtGtCCGCAC-3' (vs. RNA) (SEQ.ID.NO.5) H 61.7 0 99 5181 5180
66.7 +1.2 100 5126 5126 66.5 .degree.1.3 (d) Further examples of
oligonucleotides which have been modified in accordance with the
invention: Sequence Modification Mass Mass type type calculated
found .DELTA.Tm(.degree. C.)/mod B DMAE 4859 4860 +1.7 C DMAE 4861
4853 +0.7 D DMAE/MOE 5301 5292 +1.8 E DMAE 5715 5714 +0.37 F DMAE
5367 5366 +0.34 C MMAE 4796 4784 +0.36 B AE 4721 4717 +1.38 C AE
4721 4723 +0.5 D AE/MOE 5161 5163 +1.5 B APAE 5137 5137 +1.0 C APAE
5137 5143 +1.0 B PIPE 5137 5132 +2.0 C PIPE 5137 5139 +0.6 G DMAE
4803 4806 +0.8 H DMAE 5151 5139 +2.3 I DMAE 5064 5068 +1.0 J
DMAE/MOE 5448 5437 +2.5 K DMAE 5181 5180 +1.2 K MMAE 5126 5126 +1.2
Clarification of Table (d): Sequence type A: TTTTtCTCTCTCTCT
(SEQ.ID.NO.3) B: TTTTtCtCtCtCtCT (SEQ.ID.NO.4) C: tttttCTCTCTCTCT
(SEQ.ID.NO.6) D: TTTTtCtCtCtCtCT C = 2'-MOE-.sup.meC (SEQ.ID.NO.7)
E: tttttctctctctcT (SEQ.ID.NO.8) F: TTTTtctctctctcT (SEQ.ID.NO.9)
G: AGAGAGAGAGaAAAA (SEQ.ID.NO.10) H: AGaGaGaGaGaAAAA (SEQ.ID.NO.11)
I: AGAGAGAGAGaaaaA (SEQ.ID.NO.12) J: AGaGaGaGaGaAAAA G = 2'-MOE-G
(SEQ.ID.NO.13) K: AGGtGtCCGCAtC (SEQ.ID.NO.14) Modification type
101 102 103 (.sup.meC: base = 5-methylcytosine) DMEA: 104
2'-dimethylamino- ethoxy MMEA: 105 2'-monomethylamino- ethoxy AE:
106 2'-aminoethoxy MOE: 107 2'-methoxyethoxy APAE 108
2'-(3-N,N-dimeethylamino-1- propyl)aminoethoxy PIPE 109
2'-piperazinethoxy
Example C2
Nuclease Resistance of Oligonucleotide Derivatives According to the
Invention
[0449] The nuclease resistance of oligonucleotide derivatives
according to the invention is investigated using snake venom
phosphodiesterase (SVP), a non-specific endonuclease. For this, the
oligonucleotides which are described below are labelled at the 5'
end with .sup.[32]P and incubated with SVP. The resulting digestion
products are analyzed, in a customary manner, by means of
polyacrylamide gel electrophoresis and quantified using a Molecular
Dynamics Phosphorimager, and the respective half lives are
determined (Table 4; capital letters in the depicted sequences
denote deoxyribonucleotides; the depicted sequences only contain
phosphodiester bonds).
5TABLE 4 Nuclease resistance (a) 5'-TCC AGG TGT CCG ttt C-3'
(SEQ.ID.NO.15) 110 X Half life (min.) H 8.5 111 more than 1400 112
more than 1400
Example C3
Affinity; Interaction of Oligonucleotide Derivatives According to
the Invention (as Triplex-Forming Oligonucleotides) with
Double-Stranded DNA
[0450] The interaction of oligonucleotide derivatives according to
the invention with the corresponding natural double-stranded DNA
(target double strand) is determined, as a dissociation of the
third strand from the double strand, by plotting UV melting curves
(260 nm) in buffer (180 mM KCl, 10 mM PO.sub.4, pH 7.0, 20 mM
Na.sup.+, 0.1 mM EDTA) and by means of the Tm values which are
ascertained therefrom. The triplex-forming oligonucleotides and the
double-stranded DNA which are used, and the ascertained Tm values,
are presented in Table 5 (capital letters in the depicted sequences
denote deoxyribonucleotides; the depicted sequences only contain
phosphodiester bonds).
6TABLE 5 Affinity (a) Target double strand (21-mer):
5'-d(GCTAAAAAGAGAGAGAGATCG)-3' (SEQ.ID.No.16)
3'-d(CGATTTTTCTCTCTCTCTAGC)-5' (SEQ.ID.NO.17) (Tm of the target
double strand: 62.4 +/- 1.0.degree. C.) (b) Oligonucleotide
sequence (third strand): 5'-TTTTtCtCtCtCtCT-3' (SEQ.ID.NO.4) 113 X
Tm(.degree. C.) (a) .DELTA.Tm(.degree. C.)/Mod. H 17.4 0 114 28.7
+2.24 115 35.6 +3.62 116 35.2 +3.56
Example C4
Inhibition of c-Raf Kinase mRNA in T24 Cells
[0451] (i) Treatment of Cells in Culture with Antisense
Oligonucleotides:
[0452] Cells growing on 10-cm plates at a density of 50-70%
confluency are treated with the respective antisense
oligonucleotides in the presence of cationic lipid (CL) (Lipofectin
reagent, Gibco BRL). Alternatively, the electroporation technique
is used (EP), as described in R. Griffey et al. J. Med. Chem. 39,
5100 (1996).
[0453] (ii) Northern Blot Analysis:
[0454] For determination of mRNA levels by northern blot, total RNA
is prepared from cells by the guanidinium isothiocyanate procedure
24 h after initiation of antisense oligonucleotide treatment. Total
RNA is isolated by centrifugation of the cell lysates over a cesium
chloride cushion. After northern blot analysis, RNA is quantified
and normalized to G3PDH mRNA levels, using a Molecular Dynamics
Phosphorimager. The results are shown in Table 6.
7TABLE 6 Sequence structure of tested oligonucleotides and T.sub.m
and IC50 values (small bolded: DMAE-modification, see Example 3(d)
above; underlined: MOE, see Example 3(d) above; o: phosphodiester
linkage; s: phosphorothioate linkage; IC50: oligonucleotide
concentration (nM) for 50% downregulation of the c-Raf mRNA;
T.sub.m: melting point, see Example 3 above) SEQ. Tm IC50 IC50 ID.
NO. oligonucleotide structure (.degree. C.) (CL) (EP) 18
TscsCscsGsCsCsTsGsTsGsAsCsAstsGscsAstsT 66.4 200 350 19
TocoCocoGoCsCsTsGsTsGsAsCsAstoGocoAotoT 74.5 50 240 20
tscscscsGsCsCsTsGsTsGsAsCsAstsGscsastsT 66.4 50 200 21
tocococoGoCsCsTsGsTsGsAsCsAstoGocoaotoT 67.1 300 105 22
TscsCscsGsCsCsTsGsTsGsAsCsAstsGscsAstsT 68.6 50 230
Example C5
Antitumor Activity of Modified Antisense Oligonucleotides
[0455] Male Balb/c nu/nu mice (CIBA animal farm, Sisseln,
Switzerland) are kept under sterile conditions with free access to
food and water. For in vivo experiments, tumors are established
after subcutaneous injection of cells (ATCC, Rockville, Md., USA)
in carrier mice. The resulting tumors are serially passaged for a
minimum of three consecutive transplantations prior to start of
treatment. Fragments (approx. 25 mg) of the human lung
adenocarcinoma A549 (ATCC No. CCL 185) are implanted s.c. into the
left flank of animals with a 13-gauge trocar needle under Forene
(Abbott, Switzerland) anaesthesia. Treatments are started when the
tumor reaches a mean tumor volume of 100 to 150 mm.sup.3.
[0456] Tumor growth is monitored twice or three times weekly and 24
hours after the last treatment by measuring perpendicular
diameters. Tumor volumes are calculated as previously described
(Evans et al; Br. J. Cancer, 45: 466-468,1982). The antisense
oligonucleotides are administered daily intravenously at the
indicated doses in saline for a total of 21 days; each experimental
value is averaged from at least five animals. Antitumor activity is
expressed as T/C % (mean increase of tumor volumes of treated
animals divided by the mean increase of tumor volumes of control
animals multiplied by 100). The results are shown in Table 7.
8 TABLE 7 Group Dose mg/kg T/C % Placebo 10 ml/kg 100 SEQ. ID. NO.
19 6.0 9 SEQ. ID. NO. 19 0.6 12 SEQ. ID. NO. 19 0.06 15 SEQ. ID.
NO. 19 0.006 42
Example C6
Influence of the Antisense Oligonucleotide Concentration on
Clotting Time
[0457] The influence of the antisense oligonucleotide concentration
on clotting time is determined by using an activated partial
thromboplastin time (APTT) method, which is an in vitro diagnostic
test designed to identify deficiencies in the intrinsic coagulation
pathway (see also K.-H. Altmann et al., Chimia 50 (1996), 168-176),
incorporated by reference).
[0458] Briefly, 50 .mu.l of human plasma containing a known
concentration of oligonucleotide is activated by incubation with 50
.mu.l of bovine-cephalin reagent before coagulation is initiated by
the addition of CaCl.sub.2 (50 .mu.l, 20 mM). The time taken for
coagulation to occur is measured using an Instrumentation
Laboratory ACL 300R coagulometer. As the results show, the effect
of the antisense oligonucleotide-derivative SEQ.ID.NO.19 on the
clotting time is not very pronounced, indicating the beneficial
properties of oligonucleotides according to the present invention
on non-specific side effects:
[0459] Oligonucleotide SEQ.ID.NO.19: APTT doubled by 123.6 .mu.M.
Sequence CWU 1
1
22 1 20 RNA Homo sapiens 1 aaugcauguc acaggcggga 20 2 20 DNA
Artificial Sequence Mammalian 2 tcccgcctgt gacatgcatt 20 3 15 DNA
Artificial Sequence Mammalian 3 tttttctctc tctct 15 4 15 DNA
Artificial Sequence Mammalian 4 tttttctctc tctct 15 5 16 DNA
Artificial Sequence Mammalian 5 tccaggtgtc cgcatc 16 6 15 DNA
Artificial Sequence Mammalian 6 tttttctctc tctct 15 7 15 DNA
Artificial Sequence Mammalian 7 tttttctctc tctct 15 8 15 DNA
Artificial Sequence Mammalian 8 tttttctctc tctct 15 9 15 DNA
Artificial Sequence Mammalian 9 tttttctctc tctct 15 10 15 DNA
Artificial Sequence Mammalian 10 agagagagag aaaaa 15 11 15 DNA
Artificial Sequence Mammalian 11 agagagagag aaaaa 15 12 15 DNA
Artificial Sequence Mammalian 12 agagagagag aaaaa 15 13 15 DNA
Artificial Sequence Mammalian 13 agagagagag aaaaa 15 14 13 DNA
Artificial Sequence Mammalian 14 aggtgtccgc atc 13 15 16 DNA
Artificial Sequence Mammalian 15 tccaggtgtc cgtttc 16 16 21 DNA
Artificial Sequence Mammalian-Target DNA 16 gctaaaaaga gagagagatc g
21 17 21 DNA Artificial Sequence Mammalian-Opposite strand of
target DNA SEQ ID NO 16 17 cgatctctct ctctttttag c 21 18 20 DNA
Artificial Sequence Mammalian 18 tcccgcctgt gacatgcatt 20 19 20 DNA
Artificial Sequence Mammalian 19 tcccgcctgt gacatgcatt 20 20 20 DNA
Artificial Sequence Mammalian 20 tcccgcctgt gacatgcatt 20 21 20 DNA
Artificial Sequence Mammalian 21 tcccgcctgt gacatgcatt 20 22 20 DNA
Artificial Sequence Mammalian 22 tcccgcctgt gacatgcatt 20
* * * * *