U.S. patent application number 10/397214 was filed with the patent office on 2005-07-21 for methods of treatment of periodontal disease.
Invention is credited to Rosen, Vicki A., Wang, Elizabeth, Wozney, John M..
Application Number | 20050159348 10/397214 |
Document ID | / |
Family ID | 27574157 |
Filed Date | 2005-07-21 |
United States Patent
Application |
20050159348 |
Kind Code |
A9 |
Wang, Elizabeth ; et
al. |
July 21, 2005 |
Methods of treatment of periodontal disease
Abstract
Purified BMP-2 and BMP-4 proteins and processes for producing
them are disclosed. The proteins may be used in the treatment of
bone and cartilage defects and in wound healing and related tissue
repair.
Inventors: |
Wang, Elizabeth; (Carlisle,
MA) ; Wozney, John M.; (Hudson, MA) ; Rosen,
Vicki A.; (Brookline, MA) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER
LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 0009916 A1 |
January 15, 2004 |
|
|
Family ID: |
27574157 |
Appl. No.: |
10/397214 |
Filed: |
March 27, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10397214 |
Mar 27, 2003 |
|
|
|
09804625 |
Mar 9, 2001 |
|
|
|
09804625 |
Mar 9, 2001 |
|
|
|
08925779 |
Sep 9, 1997 |
|
|
|
6245889 |
|
|
|
|
08925779 |
Sep 9, 1997 |
|
|
|
07721847 |
Jun 14, 1991 |
|
|
|
6150328 |
|
|
|
|
07721847 |
Jun 14, 1991 |
|
|
|
07493272 |
Mar 14, 1990 |
|
|
|
07721847 |
Jun 14, 1991 |
|
|
|
07655579 |
Mar 18, 1991 |
|
|
|
5618924 |
|
|
|
|
07493272 |
|
|
|
|
07406217 |
Sep 12, 1989 |
|
|
|
07493272 |
|
|
|
|
07378537 |
Jul 11, 1989 |
|
|
|
5166058 |
|
|
|
|
07655579 |
|
|
|
|
07179100 |
Apr 8, 1988 |
|
|
|
5013649 |
|
|
|
|
07378537 |
|
|
|
|
07179100 |
Apr 8, 1988 |
|
|
|
5013649 |
|
|
|
|
07179100 |
Apr 8, 1988 |
|
|
|
06880776 |
Jul 1, 1986 |
|
|
|
07179100 |
Apr 8, 1988 |
|
|
|
06943332 |
Dec 17, 1986 |
|
|
|
07179100 |
Apr 8, 1988 |
|
|
|
07028285 |
Mar 20, 1987 |
|
|
|
Current U.S.
Class: |
514/8.8 ;
530/350 |
Current CPC
Class: |
A61L 24/043 20130101;
Y10S 514/801 20130101; C07K 14/51 20130101; C08L 89/00 20130101;
Y10S 930/12 20130101; Y10S 514/90 20130101; A61K 38/00 20130101;
A61L 27/227 20130101; A61L 24/043 20130101 |
Class at
Publication: |
514/012 ;
530/350 |
International
Class: |
A61K 038/17; C07K
014/47 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 30, 1987 |
WO |
PCT/US87/01537 |
Claims
What is claimed is:
1. An osteogenic protein comprising an amino acid sequence selected
from the group consisting of: (a) amino acids #32-#129 of FIG. 1
(SEQ ID NO: 2); (b) amino acids #299-#396 of FIG. 2 (SEQ ID NO: 4);
and (c) amino acids #311-#408 of FIG. 3 (SEQ ID NO: 6).
2. An osteogenic protein selected from the group consisting of: (a)
a purified BMP-2 protein produced by the steps of (i) culturing a
cell transformed with (a) a cDNA comprising the nucleotide sequence
from nucleotide #356 to #1543 as shown in FIG. 2 (SEQ ID NO: 3);
and (b) sequences which hybridize to sequence (a) under stringent
conditions and encode a protein having cartilage and/or bone
induction activity (ii) recovering and purifying from said culture
medium a protein comprising the 97 amino acid sequence from amino
acid #299 to amino acid #396 as shown in FIG. 2 (SEQ ID NO: 4); and
(b) a purified BMP-4 protein produced by the steps of (i) culturing
a cell transformed with (a) a cDNA comprising the nucleotide
sequence from nucleotide #403 to #1626 as shown in FIG. 3 (SEQ ID
NO: 5); and (b) sequences which hybridize to sequence (a) under
stringent conditions and encode a protein having cartilage and/or
bone induction activity; (ii) recovering from said culture medium a
protein comprising the 97 amino acid sequence from amino acid #311
to amino acid #408 as shown in FIG. 3 (SEQ ID NO: 6).
3. A BMP-2 protein comprising amino acids #283-#396 of FIG. 2 (SEQ
ID NO: 4).
4. The protein of claim 3 wherein said protein is a disulfide
linked diner wherein at least one of the subunits of said dimer
comprises amino acid #283-#396 of FIG. 2 (SEQ ID NO: 4).
5. A purified BMP-2 protein produced by the steps of (a) culturing
a cell transformed with a cDNA comprising the nucleotide sequence
from nucleotide #356 to #1543 as shown in FIG. 2 (SEQ ID NO: 3);
and (b) recovering and purifying from said culture medium a protein
comprising the 97 amino acid sequence from amino acid #299 to amino
acid #396 as shown in FIG. 2 (SEQ ID NO: 4).
6. A BMP-4 protein comprising amino acids #293-#408 of FIG. 3 (SEQ
ID NO: 6).
7. The protein of claim 6 wherein said protein is a disulfide
linked dimer wherein at least one of the subunits of said dimer
comprises amino acid #293-#408 of FIG. 3 (SEQ ID NO: 6).
8. A purified BMP-4 protein produced by the steps of (a) culturing
a cell transformed with a cDNA comprising the nucleotide sequence
from nucleotide #403 to #1626 as shown in FIG. 3 (SEQ ID NO: 5);
and (b) recovering form said culture medium a protein comprising
the 97 amino acid sequence from amino acid #311 to amino acid #408
as shown in FIG. 3 (SEQ ID NO: 6).
9. A protein of claim 1 further characterized by the ability to
induce the formation of cartilage and/or bone.
10. A pharmaceutical composition comprising an effective amount of
a BMP-2 protein in admixture with a pharmaceutically acceptable
vehicle.
11. A pharmaceutical composition comprising an effective amount of
a BMP-4 protein in admixture with a pharmaceutically acceptable
vehicle.
12. A composition for bone and/or cartilage formation comprising an
effective amount of a BMP-2 protein in a pharmaceutically
acceptable vehicle.
13. A composition for bone and/or cartilage formation comprising an
effective amount of a BMP-4 protein in a pharmaceutically
acceptable vehicle.
14. A composition of claim 12 further comprising a matrix for
supporting said composition and providing a surface for bone and/or
cartilage growth.
15. A composition of claim 13 further comprising a matrix for
supporting said composition and providing a surface for bone and/or
cartilage growth.
16. The composition of claim 14 wherein said matrix comprises a
material selected from the group consisting of hydroxyapatite,
collagen, polylactic acid and tricalcium phosphate.
17. The composition of claim 15 wherein said matrix comprises a
material selected from the group consisting of hydroxyapatite,
collagen, polylactic acid and tricalcium phosphate.
18. A method for inducing bone and/or cartilage formation in a
patient in need of same comprising administering to said patient an
effective amount of the composition of claim 11.
19. A method for inducing bone and/or cartilage formation in a
patient in need of same comprising administering to said patient an
effective amount of the composition of claim 11.
20. A pharmaceutical composition for wound healing and tissue
repair said composition comprising an effective amount of a BMP-2
protein in a pharmaceutically acceptable vehicle.
21. A pharmaceutical composition for wound healing and tissue
repair said composition comprising an effective amount of a BMP-4
protein in a pharmaceutically acceptable vehicle.
22. A method for treating wounds and/or tissue repair in a patient
in need of same comprising administering to said patient an
effective amount of the composition of claim 21.
23. A method for treating wounds and/or tissue repair in a patient
in need of same comprising administering to said patient an
effective amount of the composition of claim 22.
Description
[0001] This application is a continuation-in-part of U.S. Ser. Nos.
493,272 filed Mar. 14, 1990 (which is a CIP of 406,217 filed Sep.
12, 1989); 378,537 filed Jul. 11, 1989; and 655,579 filed Feb. 14,
1991 which is a divisional of U.S. Ser. No. 179,100 filed Apr. 8,
1988 (now U.S. Pat. No. 5,013,649) which is a continuation-in-part
of U.S. Ser. Nos. 028,285 filed Mar. 20, 1987 now abandoned;
943,332 filed Dec. 17, 1986 now abandoned; and 880,776 filed Jul.
1, 1986 now abandoned.
[0002] The present invention relates to a novel family of purified
proteins designated BMP-2 and BMP-4 proteins and processes for
obtaining and producing them. These proteins may be used to induce
bone and/or cartilage formation and in wound healing and tissue
repair.
[0003] BMP-2 and BMP-4 proteins have previously been referred to
collectively as BMP-2 proteins (BMP-2 previously referred to as
BMP-2A or BMP-2 Class I and BMP-4 as BMP-2B or BMP-2 Class II).
[0004] Human BMP-2 proteins are characterized by an amino acid
sequence comprising amino acid #299 (His, Pro, Leu . . . )--#396
(Arg) of FIG. 2 (SEQ ID NO: 4). Human BMP-2 proteins are further
characterized as dimers of BMP-2 subunits. Mature BMP-2 is
characterized by comprising amino acid #283 (Gln, Ala, Lys . . .
)--#396 (Arg) of FIG. 2. Mature BMP-2 is further characterized as a
disulfide linked dimer wherein each subunit comprises amino acids
#283-#396 of FIG. 2 (SEQ ID NO: 4).
[0005] Human BMP-2 may be produced by culturing a cell transformed
with a DNA sequence comprising the nucleotide coding sequence from
nucleotide #356 to #1543 as shown in FIG. 2 (SEQ ID NO: 3) and
recovering and purifying from the culture medium a protein
comprising amino acid #299 to #396 as shown in FIG. 2 (SEQ ID NO:
4), substantially free from other proteinaceous materials with
which it is co-produced. Human BMP-2 is characterized by the
ability to induce bone formation. Human BMP-2 is further
characterized by the ability to induce cartilage formation. Human
BMP-2 may be further characterized by the ability to demonstrate
cartilage and/or bone formation activity in the rat bone formation
assay described below. In preferred embodiments, the proteins of
the invention demonstrate activity in this assay at a concentration
of 10 .mu.g-500 .mu.g/gram of bone. BMP-2 proteins may be
characterized by the ability of 1 .mu.g of the protein to score at
least +2 in the rat bone formation assay of Example III using the
modified scoring method described in Example VII.
[0006] The bovine BMP-2 protein is a member of the family of BMP-2
proteins of the invention. Bovine BMP-2 proteins comprise the amino
acid sequence represented by amino acid #32 to amino acid #129 of
FIG. 1 (SEQ ID NO: 2). These proteins are capable of inducing the
formation of cartilage and/or bone. Bovine BMP-2 may be further
characterized by the ability to demonstrate cartilage and/or bone
formation activity in the rat bone formation assay described below.
In preferred embodiments, the proteins of the invention demonstrate
activity in this assay at a concentration of 10 .mu.g-500
.mu.g/gram of bone. These proteins may be characterized by the
ability of 1 .mu.g of the protein to score at least +2 in the rat
bone formation assay described in Example III using the modified
scoring method as described in Example VII.
[0007] Human BMP-4 proteins are characterized by an amino acid
sequence comprising amino acids #311 (His, Ser, Leu . . . )--#408
(Arg) as shown in FIG. 3 (SEQ ID NO: 6). Mature BMP-4 comprises
amino acids #293 (Ser, Pro, Lys . . . )--#408 (Arg) of FIG. 3.
BMP-4 proteins are further characterized as dimers of BMP-4
subunits. Mature BMP-4 is further characterized as a disulfide
linked dimer wherein each subunit comprises amino acids #293-#408
of FIG. 3 (SEQ ID NO: 6).
[0008] BMP-4 may be produced by culturing a cell transformed with a
DNA sequence comprising the nucleotide coding sequence from
nucleotide #403 to nucleotide #1626 substantially as shown in FIG.
3 (SEQ ID NO: 5) and recovering and purifying from the culture
medium a protein containing the amino acid sequence from amino acid
#311 to #408 as shown in FIG. 3 (SEQ ID NO: 6) substantially free
from other proteinaceous materials with which it is co-produced.
BMP-4 proteins are capable of inducing the formation of bone. BMP-4
proteins are capable of inducing formation of cartilage. BMP-4
proteins are further characterized by the ability to demonstrate
cartilage and/or bone formation activity in the rat bone formation
assay described below. In preferred embodiments, the proteins of
the invention demonstrate activity in this assay at a concentration
of 10 .mu.g-500 .mu.g/gram of bone. These proteins may be
characterized by the ability of 1 .mu.g of the protein to score at
least +2 in the rat bone formation assay of Example III using the
modified scoring method described in Example VII.
[0009] Another aspect of the invention provides pharmaceutical
compositions containing a therapeutically effective amount of a
BMP-2 or BMP-4 protein in a pharmaceutically acceptable vehicle or
carrier. These compositions of the invention may be utilized in the
formation of cartilage. These compositions may further be utilized
in the formation of bone. They may also be used for wound healing
and tissue repair. In further embodiments the compositions of the
invention may be utilized for neuronal survival.
[0010] Further compositions of the invention may comprise a
therapeutically effective amount of BMP-2 and BMP-4 in a
pharmaceutically acceptable vehicle. Compositions of the invention
may further include, in addition to a BMP-2 or BMP-4 protein, at
least one other therapeutically useful agent such as the BMP
proteins BMP-1, BMP-3, BMP-5, BMP-6, BMP-7, and BMP-8 disclosed
respectively in co-owned U.S. patent application Ser. No. 655,578,
Ser. No. 179,197, Ser. No. 370,547, Ser. No. 370,544 Ser. No.
370,549, and Ser. No. 525,357. The compositions of the invention
may comprise, in addition to a BMP-2 or BMP-4 protein, other
therapeutically useful agents including growth factors such as
epidermal growth factor (EGF), fibroblast growth factor (FGF), and
transforming growth factor (TGF-.alpha. and TGF-.beta.). The
compositions may also include an appropriate matrix for instance,
for supporting the composition and providing a surface for bone
and/or cartilage growth. The matrix may provide slow release of the
BMP protein and/or the appropriate environment for presentation of
the BMP protein.
[0011] The BMP-2 and BMP-4 compositions may be employed in methods
for treating a number of bone and/or cartilage defects, periodontal
disease and various types of wounds. These methods, according to
the invention, entail administering to a patient needing such bone
and/or cartilage formation wound healing or tissue repair, an
effective amount of a BMP-2 or BMP-4 protein. These methods may
also entail the administration of a protein of the invention in
conjunction with at least one of the novel BMP proteins disclosed
in the co-owned applications described above. In addition, these
methods may also include the administration of a BMP-2 or BMP-4
protein with other growth factors.
[0012] Still a further aspect of the invention are DNA sequences
encoding a BMP-2 or BMP-4 protein. Such sequences include the
sequence of nucleotides in a 5' to 3' direction illustrated in
FIGS. 1 through 3 (SEQ ID NO: 1, 3, and 5) or DNA sequences which
hybridize under stringent conditions with the DNA sequences of
FIGS. 1-3 and encode a protein having the ability to induce the
formation of cartilage and/or bone. Finally, allelic or other
variations of the sequences of FIGS. 1 through 3, whether such
nucleotide changes result in changes in the peptide sequence or
not, are also included in the present invention.
[0013] A further aspect of the invention entails a vector
comprising a DNA sequence as described above in operative
association with an expression control sequence therefor. Such
vector may be employed in a novel process for producing a BMP-2 or
BMP-4 protein of the invention in which a cell line transformed
with a DNA sequence encoding a BMP-2 or BMP-4 protein in operative
association with an expression control sequence therefor, is
cultured in a suitable culture medium and a BMP-2 or BMP-4 protein
is recovered and purified therefrom. This claimed process may
employ a number of known cells both prokaryotic and eukaryotic as
host cells for expression of the polypeptide.
[0014] Other aspects and advantages of the present invention will
be apparent upon consideration of the following detailed
description and preferred embodiments thereof.
BRIEF DESCRIPTION OF THE DRAWING
[0015] FIG. 1 comprises partial DNA and derived amino acid sequence
of bovine BMP-2 from bacteriophage lambda bP-21, ATCC #40310
further described below.
[0016] FIG. 2 sets forth the DNA and derived amino acid sequence of
human BMP-2 from lambda U2OS-39, ATCC #40345 further described
below.
[0017] FIG. 3 sets forth the DNA and derived amino acid sequence of
human BMP-4 from lambda U2OS-3, ATCC #40342 further described
below.
DETAILED DESCRIPTION OF THE INVENTION
[0018] BMP-2 proteins are characterized by an amino acid sequence
comprising amino acid #299-#396 of FIG. 2 (SEQ ID NO: 4). BMP-2
proteins are further characterized as dimers of BMP-2 subunits.
Mature BMP-2 comprises amino acids #283-#396 of FIG. 2. Mature
BMP-2 is further characterized as a disulfide linked homodimer
wherein each subunit comprises amino acids #283-#396 of FIG. 2 (SEQ
ID NO: 4).
[0019] The purified human BMP-2 proteins of the present invention
are produced by culturing a host cell transformed wth a DNA
sequence comprising the DNA coding sequence of FIG. 2 (SEQ ID NO:
3) from nucleotide #356 to nucleotide #1543 and recovering and
purifying from the culture medium a protein which contains the 97
amino acid sequence or a substantially homologous sequence as
represented by amino acid #299 to #396 of FIG. 2 (SEQ ID NO: 4).
The BMP-2 proteins recovered from the culture medium are purified
by isolating them from other proteinaceous materials with which
they are co-produced and from other contaminants present.
[0020] BMP-4 proteins are characterized by an amino acid sequence
comprising amino acids #311-#408 as shown in FIG. 3 (SEQ ID NO: 6).
BMP-4 proteins are further characterized as dimers of BMP-4
subunits. Mature BMP-4 comprises amino acids #293-#408 of FIG. 3.
Mature BMP-4 is further characterized as a disulfide linked
homodimer each subunit comprising amino acids #293-#408 of FIG. 3
(SEQ ID NO: 6).
[0021] The purified BMP-4 proteins are produced by culturing a host
cell transformed with a DNA sequence comprising the DNA coding
sequence of FIG. 3 (SEQ ID NO: 5) from nucleotide #403 to
nucleotide #1626 and recovering and purifying from the culture
medium a protein comprising the amino acid sequence from amino acid
#311 to #408 of FIG. 3 (SEQ ID NO: 6). The BMP-4 proteins recovered
from the culture medium are purified by isolating them from other
proteinaceous materials with which they are co-produced and from
other contaminants present.
[0022] BMP-2 and BMP-4 proteins are characterized by the ability to
induce the formation of bone. They are further characterized by the
ability to induce the formation of cartilage. BMP-2 and BMP-4
proteins may be further characterized by the ability to demonstrate
cartilage and/or bone formation activity in the rat bone formation
assay described below. In preferred embodiments, the proteins of
the invention demonstrate activity in this rat bone formation assay
at a concentration of 10 .mu.g-500 .mu.g/gram of bone. These
proteins may be characterized by the ability of 1 .mu.g of the
protein to score at least +2 in the rat bone formation assay using
the modified scoring method described in Example VII.
[0023] The BMP-2 and BMP-4 proteins provided herein also include
factors encoded by the sequences similar to those of FIGS. 1-3 (SEQ
ID NO: 1, 3, 5), but into which modifications are naturally
provided (e.g. allelic variations in the nucleotide sequence which
may result in amino acid changes in the polypeptide) or
deliberately engineered. For example, synthetic polypeptides may
wholly or partially duplicate continuous sequences of the amino
acid residues of FIGS. 1-3. These sequences, by virtue of sharing
primary, secondary, or tertiary structural and conformational
characteristics with bone growth factor polypeptides of FIGS. 1-3
may possess bone growth factor biological properties in common
therewith. Thus, they may be employed as biologically active
substitutes for naturally-occurring BMP-2 and BMP-4 polypeptides in
therapeutic processes.
[0024] Other specific mutations of the sequences of BMP-2 and BMP-4
proteins described herein involve modifications of at least one of
the glycosylation sites. The absence of glycosylation or only
partial glycosylation results from amino acid substitution or
deletion at asparagine-linked glycosylation recognition sites
present in the sequences of BMP-2 and BMP-4 proteins shown in FIGS.
1-3. The asparagine-linked glycosylation recognition sites comprise
tripeptide sequences which are specifically recognized by
appropriate cellular glycosylation enzymes. These tripeptide
sequences are either asparagine-X-threonine or asparagine-X-serine,
where X is usually any amino acid. A variety of amino acid
substitutions or deletions at one or both of the first or third
amino acid positions of a glycosylation recognition site (and/or
amino acid deletion at the second position) results in
non-glycosylation at the modified tripeptide sequence.
[0025] The present invention also encompasses the novel DNA
sequences, free of association with DNA sequences encoding other
proteinaceous materials, and coding on expression for BMP-2 and
BMP-4 proteins. These DNA sequences include those depicted in FIGS.
1-3 in a 5' to 3' direction and those sequences which hybridize
under stringent hybridization conditions [see, T. Maniatis et al,
Molecular Cloning (A Laboratory Manual), Cold Spring Harbor
Laboratory (1982), pages 387 to 389] to the DNA sequences of FIGS.
1-3 and encode a protein having cartilage and/or bone inducing
activity.
[0026] Similarly, DNA sequences which code for BMP-2 and BMP-4
polypeptides coded for by the sequences of FIGS. 1-3, but which
differ in codon sequence due to the degeneracies of the genetic
code or allelic variations (naturally-occurring base changes in the
species population which may or may not result in an amino acid
change) also encode the novel factors described herein. Variations
in the DNA sequences of FIGS. 1-3 which are caused by point
mutations or by induced modifications (including insertion,
deletion, and substitution) to enhance the activity, half-life or
production of the polypeptides encoded thereby are also encompassed
in the invention.
[0027] Another aspect of the present invention provides a novel
method for producing BMP-2 and BMP-4 proteins. The method of the
present invention involves culturing a suitable cell line, which
has been transformed with a DNA sequence coding on expression for a
BMP-2 or BMP-4 protein, under the control of known regulatory
sequences. The transformed host cells are cultured and the BMP-2 or
BMP-4 proteins recovered and purified from the culture medium. The
purified proteins are substantially free from other proteins with
which they are co-produced as well as from other contaminants.
Suitable cells or cell lines may be mammalian cells, such as
Chinese hamster ovary cells (CHO). The selection of suitable
mammalian host cells and methods for transformation, culture,
amplification, screening and product production and purification
are known in the art. See, e.g., Gething and Sambrook, Nature,
293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell.
Biol., 5(7):1750-1759 (1985) or Howley et al, U.S. Pat. No.
4,419,446. Another suitable mammalian cell line, which is described
in the accompanying examples, is the monkey COS-1 cell line. The
mammalian cell CV-1 may also be suitable.
[0028] Bacterial cells may also be suitable hosts. For example, the
various strains of E. coli (e.g., HB101, MC1061) are well-known as
host cells in the field of biotechnology. Various strains of B.
subtilis, Pseudomonas, other bacilli and the like may also be
employed in this method.
[0029] Many strains of yeast cells known to those skilled in the
art may also be available as host cells for expression of the
polypeptides of the present invention. Additionally, where desired,
insect cells may be utilized as host cells in the method of the
present invention. See, e.g. Miller et al, Genetic Engineering,
8:277-298 (Plenum Press 1986) and references cited therein.
[0030] Another aspect of the present invention provides vectors for
use in expression of these novel BMP-2 and BMP-4 polypeptides.
Preferably the vectors contain the full novel DNA sequences
described above which encode the novel factors of the invention.
Additionally the vectors also contain appropriate expression
control sequences permitting expression of the BMP-2 and BMP-4
protein sequences. Alternatively, vectors incorporating modified
sequences as described above are also embodiments of the present
invention and useful in the production of the BMP-2 and BMP-4
proteins. The vectors may be employed in the method of transforming
cell lines and contain selected regulatory sequences in operative
association with the DNA coding sequences of the invention which
are capable of directing the replication and expression thereof in
selected host cells. Useful regulatory sequences for such vectors
are known to one of skill in the art and may be selected depending
upon the selected host cells. Such selection is routine and does
not form part of the present invention.
[0031] A protein of the present invention, which induces cartilage
and/or bone growth in circumstances where bone is not normally
formed, has application in the healing of bone fractures and
cartilage defects in humans and other animals. Such a preparation
employing a BMP-2 or BMP-4 protein may have prophylactic use in
closed as well as open fracture reduction and also in the improved
fixation of artificial joints. De novo bone formation induced by an
osteogenic agent contributes to the repair of congenital, trauma
induced, or oncologic resection induced craniofacial defects, and
also is useful in cosmetic plastic surgery. A BMP-2 or BMP-4
protein may be used in the treatment of periodontal disease, and in
other tooth repair processes. Such agents may provide an
environment to attract bone-forming cells, stimulate growth of
bone-forming cells or induce differentiation of progenitors of
bone-forming cells. BMP-2 and BMP-4 polypeptides of the invention
may also be useful in the treatment of osteoporosis. A variety of
osteogenic, cartilage-inducing and bone inducing factors have been
described. See, e.g. European patent applications 148,155 and
169,016 for discussions thereof.
[0032] The proteins of the invention may also be used in wound
healing and related tissue repair. The types of wounds include, but
are not limited to burns, incisions and ulcers. (See, e.g. PCT
Publication WO84/01106 for discussion of wound healing and related
tissue repair).
[0033] The proteins of the invention may increase neuronal survival
and therefore be useful in transplantation and treatment of
conditions exhibiting a decrease in neuronal survival.
[0034] A further aspect of the invention is a therapeutic method
and composition for repairing fractures and other conditions
related to cartilage and/or bone defects or periodontal diseases.
In addition, the invention comprises therapeutic methods and
compositions for wound healing and tissue repair. Such compositions
comprise a therapeutically effective amount of a BMP-2 or BMP-4
protein of the invention in admixture with a pharmaceutically
acceptable vehicle, carrier or matrix.
[0035] It is expected that the proteins of the invention may act in
concert with or perhaps synergistically with other related proteins
and growth factors. Further therapeutic methods and compositions of
the invention therefore comprise a therapeutic amount of a BMP-2 or
BMP-4 protein of the invention with a therapeutic amount of at
least one of the other BMP proteins disclosed in co-owned and
concurrently filed U.S. applications described above. Such
combinations may comprise separate molecules of the BMP proteins or
heteromolecules comprised of different BMP moieties. For example, a
BMP-2 or BMP-4 subunit may be linked to a BMP-1, BMP-3, BMP-5,
BMP-6, BMP-7 or BMP-8 subunit. Such linkage may comprise disulfide
bonds. A method and composition of the invention may comprise a
disulfide linked dimer comprising a BMP-2 or BMP-4 protein subunit
and another "BMP" protein subunit described above. One may comprise
a heterodimer of BMP-2 and BMP-4 moieties. Another embodiment may
comprise a heterodimer of BMP-2 and BMP-7 subunits.
[0036] In further compositions, BMP-2 and BMP-4 proteins may be
combined with other agents beneficial to the treatment of the bone
and/or cartilage defect, wound, or tissue in question. These agents
include various growth factors such as epidermal growth factor
(EGF), platelet derived growth factor (PDGF), transforming growth
factors (TGF-a and TGF-b), and insulin-like growth factor (IGF).
The preparation and formulation of such physiologically acceptable
protein compositions, having due regard to pH, isotonicity,
stability and the like, is within the skill of the art. The
therapeutic compositions are also presently valuable for veterinary
applications due to the lack of species specificity in BMP
proteins. Particularly domestic animals and thoroughbred horses in
addition to humans are desired patients for such treatment with
BMP-2 and BMP-4 of the present invention.
[0037] BMP-2 may be used individually in a pharmaceutical
composition. BMP-2 may also be used in combination with BMP-4
and/or one or more of the other BMP proteins disclosed in co-owned
and co-pending U.S. applications as discussed above. BMP-4 may be
used individually in pharmaceutical composition. In addition, it
may be used in combination with other BMP proteins as described
above.
[0038] The therapeutic method includes administering the
composition topically, systematically, or locally as an implant or
device. When administered the therapeutic composition for use in
this invention is, of course, in a pyrogen-free, physiologically
acceptable form. Further, the composition may desirably be
encapsulated or injected in a viscous form for delivery to the site
of bone, cartilage or tissue damage. Topical administration may be
suitable for wound healing and tissue repair. Therapeutically
useful agents other than the BMP-2 and BMP-4 proteins which may
also optionally be included in the composition as described above,
may alternatively or additionally, be administered simultaneously
or sequentially with the BMP composition in the methods of the
invention. Preferably for bone and/or cartilage formation, the
composition would include a matrix capable of delivering BMP-2,
BMP-4 or other BMP proteins to the site of bone and/or cartilage
damage, providing a structure for the developing bone and cartilage
and optimally capable of being resorbed into the body. Such
matrices may be formed of materials presently in use for other
implanted medical applications.
[0039] The choice of matrix material is based on biocompatibility,
biodegradability, mechanical properties, cosmetic appearance and
interface properties. The particular application of the BMP-2 and
BMP-4 compositions will define the appropriate formulation.
Potential matrices for the compositions may be biodegradable and
chemically defined calcium sulfate, tricalciumphosphate,
hydroxyapatite, polylactic acid, polyglycolic acid and
polyanhydrides. Other potential materials are biodegradable and
biologically well defined, such as bone or dermal collagen. Further
matrices are comprised of pure proteins or extracellular matrix
components. Other potential matrices are nonbiodegradable and
chemically defined, such as sintered hydroxyapatite, bioglass,
aluminates, or other ceramics. Matrices may be comprised of
combinations of any of the above mentioned types of material, such
as polylactic acid and hydroxyapatite or collagen and
tricalciumphosphate. The bioceramics may be altered in composition,
such as in calcium-aluminate-phosphate and processing to alter pore
size, particle size, particle shape, and biodegradability.
[0040] The dosage regimen will be determined by the attending
physician considering various factors which modify the action of
the BMP-2 and BMP-4 proteins, e.g. amount of bone weight desired to
be formed, the site of bone damage, the condition of the damaged
bone, the size of a wound, type of damaged tissue, the patient's
age, sex, and diet, the severity of any infection, time of
administration and other clinical factors. The dosage may vary with
the type of matrix used in the reconstitution and the types of BMP
proteins in the composition. The addition of other known growth
factors, such as IGF I (insulin like growth factor I), to the final
composition, may also effect the dosage. Progress can be monitored
by periodic assessment of bone growth and/or repair, for example,
x-rays, histomorphometric determinations and tetracycline
labeling.
[0041] The following examples illustrate practice of the present
invention in recovering and characterizing bovine BMP-2 protein and
employing it to recover the human proteins BMP-2 and BMP-4, and in
expressing the proteins via recombinant techniques.
EXAMPLE I
[0042] Isolation of Bovine Bone Inductive Factor
[0043] Ground bovine bone powder (20-120 mesh, Helitrex) is
prepared according to the procedures of M. R. Urist et al., Proc.
Natl Acad. Sci USA, 70:3511 (1973) with elimination of some
extraction steps as identified below. Ten kgs of the ground powder
is demineralized in successive changes of 0.6N HCl at 4.degree. C.
over a 48 hour period with vigorous stirring. The resulting
suspension is extracted for 16 hours at 4.degree. C. with 50 liters
of 2M CaCl.sub.2 and 10 mM ethylenediamine-tetraacetic acid [EDTA],
and followed by extraction for 4 hours in 50 liters of 0.5M EDTA.
The residue is washed three times with distilled water before its
resuspension in 20 liters of 4M guanidine hydrochloride [GuCl], 20
mM. Tris (pH 7.4), 1 mM N-ethylmaleimide, 1 mM iodoacetamide, 1 mM
phenylmethylsulfonyl fluorine as described in Clin. Orthop. Rel.
Res., 171: 213 (1982). After 16 to 20 hours the supernatant is
removed and replaced with another 10 liters of GuCl buffer. The
residue is extracted for another 24 hours.
[0044] The crude GuCl extracts are combined, concentrated
approximately 20 times on a Pellicon apparatus with a 10,000
molecular weight cut-off membrane, and then dialyzed in 50 mM Tris,
0.1M NaCl, 6M urea (pH 7.2), the starting buffer for the first
column. After extensive dialysis the protein is loaded on a 4 liter
DEAE cellulose column and the unbound fractions are collected.
[0045] The unbound fractions are concentrated and dialyzed against
50 mM NaAc, 50 mM NaCl (pH 4.6) in 6M urea. The unbound fractions
are applied to a carboxymethyl cellulose column. Protein not bound
to the column is removed by extensive washing with starting buffer,
and the material containing protein having bone and/or cartilage
formation activity as measured by the Rosen-modified Sampath-Reddi
assay (described in Example III below) desorbed from the column by
50 mM NaAc, 0.25 mM NaCl, 6M urea (pH 4.6). The protein from this
step elution is concentrated 20- to 40-fold, then diluted 5 times
with 80 mM KPO.sub.4, 6M urea (pH 6.0). The pH of the solution is
adjusted to 6.0 with 500 mM K.sub.2HP0.sub.4. The sample is applied
to an hydroxylapatite column (LKB) equilibrated in 80 mM KPO.sub.4,
6M urea (pH 6.0) and all unbound protein is removed by washing the
column with the same buffer. Protein having bone and/or cartilage
formation activity is eluted with 100 mM KPO.sub.4 (pH 7.4) and 6M
urea.
[0046] The protein is concentrated approximately 10 times, and
solid NaCl added to a final concentration of 0.15M. This material
is applied to a heparin--Sepharose column equilibrated in 50 mM
KPO.sub.4, 150 mM NaCl, 6M urea (pH 7.4). After extensive washing
of the column with starting buffer, a protein with bone and/or
cartilage inductive activity is eluted by 50 mM KPO.sub.4, 700 mM
NaCl, 6M urea (pH 7.4). This fraction is concentrated to a minimum
volume, and 0.4 ml aliquots are applied to Superose 6 and Superose
12 columns connected in series, equilibrated with 4M GuCl, 20 mM
Tris (pH 7.2) and the columns developed at a flow rate of 0.25
ml/min. The protein demonstrating bone and/or cartilage inductive
activity has a relative migration on SDS-PAGE corresponding to
approximately 30,000 dalton protein.
[0047] The above fractions from the superose columns are pooled,
dialyzed against 50 mM NaAc, 6M urea (pH 4.6), and applied to a
Pharmacia MonoS HR column. The column is developed with a gradient
to 1.0M NaCl, 50 mM NaAc, 6M urea (pH 4.6). Active bone and/or
cartilage formation fractions are pooled and brought to pH 3.0 with
10% trifluoroacetic acid (TFA). The material is applied to a
0.46.times.25 cm Vydac C4 column in 0.1% TFA and the column
developed with a gradient to 90% acetonitrile, 0.1% TFA (31.5%
acetonitrile, 0.1% TFA to 49.5% acetonitrile, 0.1% TFA in 60
minutes at 1 ml per minute). Active material is eluted at
approximately 40-44% acetonitrile. Aliquots of the appropriate
active fractions are iodinated by one of the following methods: P.
J. McConahey et al, Int. Arch. Allergy, 29:185-189 (1966); A. E.
Bolton et al, Biochem J., 133:529 (1973); and D. F. Bowen-Pope, J.
Biol. Chem., 237:5161 (1982). The iodinated proteins present in
these fractions are analyzed by SDS gel electrophoresis and urea
Triton X100 isoelectric focusing. At this stage, the protein having
bone and/or cartilage forming activity is estimated to be
approximately 10-50% pure.
EXAMPLE II
[0048] Characterization of Bovine Bone Inductive Factor
[0049] A. Molecular Weight
[0050] Approximately 20 ug protein from Example I is lyophilized
and redissolved in 1.times. SDS sample buffer. After 15 minutes of
heating at 37.degree. C., the sample is applied to a 15% SDS
polyacrylamide gel and then electrophoresed with cooling. The
molecular weight is determined relative to prestained molecular
weight standards (Bethesda Research Labs). Immediately after
completion, the gel lane containing bone and/or cartilage forming
material is sliced,into 0.3 cm pieces. Each piece is mashed and 1.4
ml of 0.1% SDS is added. The samples are shaken gently overnight at
room temperature to elute the protein. Each gel slice is desalted
to prevent interference in the biological assay. The supernatant
from each sample is acidified to pH 3.0 with 10% TFA, filtered
through a 0.45 micron membrane and loaded on a 0.46 cm.times.5 cm
C4 Vydac column developed with a gradient of 0.1% TFA to 0.1% TFA,
90% CH.sub.3CN. The appropriate bone and/or cartilage inductive
protein-containing fractions are pooled and reconstituted with 20
mg rat matrix and assayed. In this gel system, the majority of bone
and/or cartilage inductive fractions have the mobility of a protein
having a molecular weight of approximately 28,000-30,000
daltons.
[0051] B. Isoelectric Focusing
[0052] The isoelectric point of bone inductive factor activity is
determined in a denaturing isoelectric focusing system. The Triton
X100 urea gel system, (Hoeffer Scientific) is modified as follows:
1) 40% of the ampholytes used are Servalyte 3/10; 60% are Servalyte
7-9; and 2) the catholyte used is 40 mM NaOH. Approximately 20 ug
of protein from Example I is lyophilized, dissolved in sample
buffer and applied to the isoelectrofocusing gel. The gel is run at
20 watts, 10 C. for approximately 3 hours. At completion the lane
containing bone and/or cartilage inductive factor is sliced into
0.5 cm slices. Each piece is mashed in 1.0 ml 6M urea, 5 mM Tris
(pH 7.8) and the samples agitated at room temperature. The samples
are acidified, filtered, desalted and assayed as described above.
The major portion of activity as determined by the Rosen-modified
Sampath-Reddi assay migrates in a manner consistent with a pI of
about 8.8-9.2.
[0053] C. Subunit Characterization
[0054] The subunit composition of the isolated bovine bone protein
is also determined. Pure bone inductive factor is isolated from a
preparative 15% SDS gel as described above. A portion of the sample
is then reduced with 5 mM DTT in sample buffer and
re-electrophoresed on a 15% SDS gel. The approximately 28-30 kd
protein yields two major bands at approximately 18-20 kd and
approximately 16-18 kd, as well as a minor band at approximately
28-30 kd. The broadness of the two bands indicates heterogeneity
caused most probably by glycosylation, other post translational
modification, proteolytic degradation or carbamylation.
EXAMPLE III
[0055] Rosen Modified Sampath-Reddi Assay
[0056] A modified version of the rat bone formation assay described
in Sampath and Reddi, Proc. Natl. Acad. Sci. U.S.A., 80:6591-6595
(1983) is used to evaluate bone and/or cartilage activity of the
bovine protein obtained in Example I and the BMP-2 proteins of the
invention. This modified assay is herein called the Rosen-modified
Sampath-Reddi assay. The ethanol precipitation step of the
Sampath-Reddi procedure is replaced by dialyzing (if the
composition is a solution) or diafiltering (if the composition is a
suspension) the fraction to be assayed against water. The solution
or suspension is then redissolved in 0.1% TFA, and the resulting
solution added to 20 mg of rat matrix. A mock rat matrix sample not
treated with the protein serves as a control. This material is
frozen and lyophilized and the resulting powder enclosed in #5
gelatin capsules. The capsules are implanted subcutaneously in the
abdominal thoracic area of 21-49 day old male Long Evans rats. The
implants are removed after 7-14 days. Half of each implant is used
for alkaline phosphatase analysis [See, A. H. Reddi et al., Proc.
Natl Acad Sci., 69:1601 (1972)].
[0057] The other half of each implant is fixed and processed for
histological analysis. 1 .mu.m glycolmethacrylate sections are
stained with Von Kossa and acid fuschin to score the amount of
induced bone and cartilage formation present in each implant. The
terms +1 through +5 represent the area of each histological section
of an implant occupied by new bone and/or cartilage cells and
matrix. A score of +5 indicates that greater than 50% of the
implant is new bone and/or cartilage produced as a direct result of
protein in the implant. A score of +4, +3, +2 and +1 would indicate
that greater than 40%, 30%, 20% and 10% respectively of the implant
contains new cartilage and/or bone.
[0058] The rat matrix samples containing at least 200 ng of bovine
protein obtained in Example I result in bone and/or cartilage
formation that filled more than 20% of the implant areas sectioned
for histology. This protein therefore scores at least +2 in the
Rosen-modified Sampath-Reddi assay. The dose response of the matrix
samples indicates that the amount of bone and/or cartilage formed
increases with the amount of protein in the sample. The control
sample did not result in any bone and/or cartilage formation. The
purity of the protein assayed is approximately 10-15% pure.
[0059] The bone and/or cartilage formed is physically confined to
the space occupied by the matrix. Samples are also analyzed by SDS
gel electrophoresis and isoelectric focusing as described above,
followed by autoradiography. Analysis reveals a correlation of
activity with protein bands at 28-30 kd and a pI of approximately
8.8-9.2. To estimate the purity of the protein in a particular
fraction an extinction coefficient of 1 OD/mg-cm is used as an
estimate for protein and the protein is run on SDS PAGE followed by
silver staining or radioiodination and autoradiography.
EXAMPLE IV
[0060] Bovine BMP-2
[0061] The protein composition of Example IIA of molecular weight
28-30 kd is reduced as described in Example IIC and digested with
trypsin. Eight tryptic fragments are isolated by standard
procedures having the following amino acid sequences:
1 Fragment 1: A A F L G D I A L D E E D L G Fragment 2: A F Q V Q Q
A A D L Fragment 3: N Y Q D M V V E G Fragment 4: S T P A Q D V S R
Fragment 5: N Q E A L R Fragment 6: L S E P D P S Ii T L E E
Fragment 7: F D A Y Y Fragment 8: L K P S N ? A T I Q S I V E
[0062] Two probes consisting of pools of oligonucleotides (or
unique oligonucleotides) are designed according to the method of R.
Lathe, J. Mol. Biol., 183(1):1-12 (1985) on the basis of the amino
acid sequence of Fragment 3 and synthesized on an automated DNA
synthesizer as described above.
2 Probe #1: A C N A C C A T [A/G] T C [T/C] T G [A/G] A T Probe #2:
C A [A/G] G A [T/C] A T G G T N G T N G A
[0063] Because the genetic code is degenerate (more than one codon
can code for the same amino acid), the number of oligonucleotides
in a probe pool is reduced based on the frequency of codon usage in
eukaryotes, the relative stability of G:T base pairs, and the
relative infrequency of the dinucleotide CpG in eukaryotic coding
sequences [See J. J. Toole et al, Nature, 312:342-347 (1984)].
Bracketed nucleotides are alternatives. "N" means either A, T, C or
G. These probes are radioactively labeled and employed to screen a
bovine genomic library. The library is constructed as follows:
Bovine liver DNA is partially digested with the restriction
endonuclease enzyme Sau 3A and sedimented through a sucrose
gradient. Size fractionated DNA in the range of 15-30 kb is then
ligated to the vector lambda J' Bam H1 arms [Mullins et al.,
Nature, 308:856-858 (1984)]. The library is plated at 8000
recombinants per plate. Duplicate nitrocellulose replicas of the
plaques are made and amplified according to a modification of the
procedure of Woo et al, Proc. Natl. Acad. Sci. USA, 75:3688-91
(1978). Probe #1 is hybridized to the set of filters in 3M
tetramethylammonium chloride (TMAC), 0.1M sodium phosphate pH 6.5,
1 mM EDTA, 5.times. Denhardts, 0.6% SDS, 100 ug/ml salmon sperm DNA
at 48 degrees C., and washed in 3M TMAC, 50 mM Tris pH 8.0 at 50
degrees C. These conditions minimize the detection of mismatches to
the 17 mer probe pool [see, Wood et al, Proc. Natl. Acad. Sci,
U.S.A., 82:1585-1588 (1985)].
[0064] 400,000 recombinants are screened by this procedure. One
duplicate positive is plaque purified and the DNA is isolated from
a plate lysate of the recombinant bacteriophage designated lambda
bP-21. Bacteriophage bP-21 was deposited with the American Type
Culture Collection, 12301 Parklawn Drive, Rockville, Md. USA
(hereinafter the "ATCC") under accession number ATCC 40310 on Mar.
6, 1987. This deposit as well as the other deposits contained
herein meets the requirements of the Budapest Treaty on the
International Recognition of the Deposit of Microorganisms for the
Purposes of Patent Procedure and Regulations thereunder. The bP-21
clone encodes at least a portion of a bovine BMP-2 protein
designated bovine BMP-2 or bBMP-2.
[0065] The oligonucleotide hybridizing region of this BMP-2 clone
is localized to an approximately 1.2 kb Sac I restriction fragment
which is subcloned into M13 and sequenced by standard techniques.
The partial DNA sequence and derived amino acid sequence of this
Sac I fragment and the contiguous Hind III-Sac I restriction
fragment of bP-21 are shown below in FIG. 1 (SEQ ID NO: 1). The
BMP-2 peptide sequence from this clone is 129 amino acids in length
and is encoded by the DNA sequence from nucleotide #1 through
nucleotide #387 (SEQ ID NO: 1). The amino acid sequence
corresponding to the tryptic fragment isolated from the bovine bone
28 to 30 kd material is underlined in FIG. 1. The underlined
portion of the sequence corresponds to tryptic Fragment 3 above
from which the oligonucleotide probes for BMP-2 are designed. The
predicted amino acid sequence indicates that tryptic Fragment 3 is
preceded by a basic residue (K) as expected considering the
specificity of trypsin. The arginine residue encoded by the CGT
triplet is presumed to be the carboxy-terminus of the protein based
on the presence of a stop codon (TAG) adjacent to it.
EXAMPLE V
[0066] Human BMP-2 and BMP-4
[0067] The HindIII-SacI bovine genomic BMP-2 fragment described in
Example IV is subcloned into an M13 vector. A .sup.32P-labeled
single-stranded DNA probe is made from a template preparation of
this subclone. This probe is used to screen polyadenylated RNAs
from various cell and tissue sources. Polyadenylated RNAs from
various cell and tissue sources are electrophoresed on
formaldehyde-agarose gels and transferred to nitrocellulose by the
method of Toole et al., supra. The probe is then hybridized to the
nitrocellulose blot in 50% formamide, 5.times. SSC, 0.1% SDS, 40 mM
sodium phosphate pH 6.5, 100 ug/ml denatured salmon sperm DNA, and
5 mM vanadyl ribonucleosides at 42.degree. C. overnight and washed
at 65.degree. C. in 0.2.times. SSC, 0.1% SDS. A hybridizing band
corresponding to an mRNA species of approximately 3.8 kb is
detected in the lane containing RNA from the human osteosarcoma
cell line U-2 OS. cDNA is synthesized from U-2 OS polyadenylated
RNA and cloned into lambda GT10 by established. techniques (Toole
et al, supra). 20,000 recombinants from this library are plated on
each of 50 plates. Duplicate nitrocellolose replicas are made of
the plates.
[0068] The HindIII-SacI fragment is labeled with .sup.32P by nick
translation and used to screen the nitrocellulose filter replicas
of the above-described U-2 OS cDNA library by hybridization in
standard hybridization buffer at 65.degree. overnight followed by
washing in 1.times. SSC, 0.1% SDS at 65.degree.. Twelve duplicate
positive clones are picked and replated for secondaries. Duplicate
nitrocellulose replicas are made of the secondary plates and both
sets hybridized to the bovine genomic probe as the primary
screening was performed. One set of filters is then washed in
1.times. SSC, 0.1% SDS; the other in 0.1.times. SSC, 0.1% SDS at
65.degree..
[0069] Two classes of hBMP-2 cDNA clones are evident based on
strong (4 recombinants) or weak (7 recombinants) hybridization
signals under the more stringent washing conditions (0.1.times.
SSC, 0.1% SDS). All 11 recombinant bacteriophage are plaque
purified, small scale DNA preparations made from plate lysates of
each, and the inserts subcloned into pSP65 and into M13 for
sequence analysis. Sequence analysis of the strongly hybridizing
clones designated hBMP-2 (previously designated BMP-2A and BMP-2
Class I) indicates that they have extensive sequence homology with
the sequence given in FIG. 1 (SEQ ID NO: 1). These clones are
therefore cDNA encoding the human equivalent of the protein encoded
by the bBMP-2 gene whose partial sequence is given in FIG. 1.
Sequence analysis of the weakly hybridizing recombinants designated
hBMP-4 (previously designated BMP-2B and BMP-2 Class II) indicates
that they are also quite homologous with the sequence given in FIG.
1 (SEQ ID NO: 1) at the 3' end of their coding regions, but less so
in the more 5' regions. Thus they encode a human protein of
similar, though not identical, structure to that above.
[0070] Full length human BMP-2 cDNA clones are obtained in the
following manner. The 1.5 kb insert of one of the BMP-4 subclones
(II-10-1) is isolated and radioactively labeled by
nick-translation. One set of the nitrocellulose replicas of the U-2
OS cDNA library screened above (50 filters, corresponding to
1,000,000 recombinant bacteriophage) are rehybridized with this
probe under stringent conditions (hybridization at 65.degree. in
standard hybridization buffer; washing at 65.degree. in 0.2.times.
SSC, 0.1% SDS). All recombinants which hybridize to the bovine
genomic probe which do not hybridize to the BMP-4 probe are picked
and plaque purified (10 recombinants). Plate stocks are made and
small scale bacteriophage DNA preparations made. After subcloning
into M13, sequence analysis indicates that 4 of these represent
clones which overlap the original BMP-2 clone. One of these, lambda
U2OS-39, contains an approximately 1.5 kb insert and was deposited
with the ATCC on Jun. 16, 1987 under accession number 40345. The
DNA sequence (SEQ ID NO: 3) (compiled from lambda U20S-39 and
several other hBMP-2 cDNA recombinants) and derived amino acid
sequence (SEQ ID NO: 4) are shown below in FIG. 2. Lambda U2OS-39
is expected to contain all of the nucleotide sequence necessary to
encode the entire human counterpart of the protein BMP-2 encoded by
the bovine gene segment whose partial sequence is presented in FIG.
1. The BMP-2 protein encoded by the DNA sequence of FIG. 2 is
contemplated to contain the 97 amino acid sequence from amino acid
#299 to #396 or a sequence substantially homologous thereto. This
human cDNA hBMP-2 contains an open reading frame of 1188 bp,
encoding a protein of 396 amino acids. The protein is preceded by a
5' untranslated region of 342 bp with stop codons in all frames.
The 13 bp region preceding this 5' untranslated region represents a
linker used in the cDNA cloning procedure. This protein of 396
amino acids has a molecular weight of 45 kd based on this amino
acid sequence. It is contemplated that this sequence represents the
primary translation product. It is further contemplated that BMP-2
may correspond to the approximately 18-20 kd subunit of Example
IIC. The sequence corresponding to the sequence tryptic Fragment 3
of Example IV is underlined in FIG. 2. The "pre" portion of the
human BMP-2 protein is contemplated to comprise amino acid #1 to
amino acid #23 as shown in FIG. 2. The "pro" portion is
contemplated to comprise amino acid #24 to amino acid #282 of FIG.
2 (SEQ ID NO: 4). The mature portion is contemplated to comprise
amino acid #283 (Gln, Ala, Lys . . . ) to #396 (Arg) of FIG. 2.
[0071] BMP-2 proteins of the invention comprise at least the amino
acid sequence from amino acid #299 to #396, although further
included in the invention are protein species with a carboxy
terminus which is characterized by an amino acid upstream from
amino acid #396.
[0072] Full-length BMP-4 human cDNA clones are obtained in the
following manner. The 200 bp EcoRI-SacI fragment from the 5' end of
the BMP-4 recombinant II-10-1 is isolated from its plasmid
subclone, labeled by nick-translation, and hybridized to a set of
duplicate nitrocellulose replicas of the U-2 OS cDNA library (25
filters/set; representing 500,000 recombinants). Hybridization and
washing are performed under stringent conditions as described
above. 16 duplicate positives are picked and replated for
secondaries. Nitrocellulose filter replicas of the secondary plates
are made and hybridized to an oligonucleotide which was synthesized
to correspond to the sequence of II-10-1 and is of the following
sequence:
[0073] CGGGCGCTCAGGATACTCAAGACCAGTGCTG
[0074] Hybridization is in standard hybridization buffer AT
50.degree. C. with washing at 50.degree. in 1.times. SSC, 0.1% SDS.
14 recombinant bacteriophage which hybridize to this
oligonucleotide are plaque purified. Plate stocks are made and
small scale bacteriophage DNA preparations made. After sucloning 3
of these into M13, sequence analysis indicates that they represent
clones which overlap the original BMP-4 clone. One of these, lambda
U2OS-3, was deposited with the ATCC under accession number 40342 on
Jun. 16, 1987. U2OS-3 contains an insert of approximately 1.8 kb.
The DNA sequence (SEQ ID NO: 5) and derived amino acid sequence
(SEQ ID NO: 6) of U2OS-3 are shown below in FIG. 3. This clone is
expected to contain all of the nucleotide sequence necessary to
encode the entire human BMP-4 protein. The BMP-4 protein encoded by
FIG. 3 is contemplated to contain the 97 amino acid sequence from
amino acid #311 to #408 or a sequence substantially homologous
thereto. This cDNA contains an open reading frame of 1224 bp,
encoding a protein of 408 amino acids, preceded by a 5'
untranslated region of 394 bp with stop codons in all frames, and
contains a 3' untranslated region of 308 bp following the in-frame
stop codon. The 8 bp region preceding the 5' untranslated region
represents a linker used in the cDNA cloning procedure. This
protein of 408 amino acids has molecular weight of 47 kd and is
contemplated to represent the primary translation product. Mature
BMP-4 is contemplated to comprise amino acid #293 (Ser, Pro, Lys .
. . )--#408 (Arg) of FIG. 3. A sequence similar though not idential
to tryptic Fragment 3 of Example IV is underlined in FIG. 3 (SEQ ID
NO: 6). The underlined sequence Asn-Tyr-Gln-Glu-Met-Val-Val-Glu-Gly
differs from the tryptic fragment
Asn-Tyr-Gln-Asp-Met-Val-Val-Glu-Gly by one amino acid in position
four.
[0075] The sequences of BMP-2 and BMP-4, as shown in FIGS. 2 and 3,
have significant homology to the beta (B) and beta (A) subunits of
the inhibins. The inhibins are a family of hormones which are
presently being investigated for use in contraception. See, A. J.
Mason et al, Nature, 318:659-663 (1985). To a lesser extent they
are also homologous to Mullerian inhibiting substance (MIS), a
testicular glycoprotein that causes regression of the Mullerian
duct during development of the male embryo, and transforming growth
factor-beta (TGF-.beta.) which can inhibit or stimulate growth of
cells or cause them to differentiate. Furthermore, the sequences of
FIGS. 2 and 3 indicate that BMP-2 and BMP-4 have significant
homology to the Drosophila decapentaplegic (DPP-C) locus
transcript. See, J. Massague, Cell, 49:437-438 (1987); R. W.
Padgett et al, Nature, 325:81-84 (1987); R. L. Cate et al, Cell 45:
685-698 (1986). It is considered possible therefore that a BMP-2
protein is the human homolog of the protein made from this
transcript from this developmental mutant locus. BMP-2 and BMP-4
share sequence similarity with Vg1. Vg1 mRNA has been localized to
the vegetal hemisphere of Xenopus oocytes. During early
development, it is distributed throughout the endoderm, but the
mRNA is not detectable after blastula formation has occurred. The
Vg1 protein may be the signal used by the endoderm cells to commit
ectodermal cells to become the embryonic mesoderm.
[0076] The procedures described above may be employed to isolate
other related BMP-2 and BMP-4 proteins of interest by utilizing the
bovine BMP-2 and BMP-4 proteins as a probe source. Such other BMP-2
and BMP-4 proteins may find similar utility in, inter alia,
fracture repair, wound healing and tissue repair.
EXAMPLE VI
[0077] Expression of BMP-2 and BMP-4
[0078] In order to produce bovine, human or other mammalian BMP-2
and BMP-4 proteins, the DNA encoding the desired protein is
transferred into an appropriate expression vector and introduced
into mammalian cells or other preferred eukaryotic or prokaryotic
hosts by conventional genetic engineering techniques. The presently
preferred expression system for biologically active recombinant
human BMP-2 and BMP-4 is stably transformed mammalian cells.
[0079] One skilled in the art can construct mammalian expression
vectors by employing the sequence of FIGS. 1-3 (SEQ ID NO: 1, 3,
and 5), or other DNA sequences containing the coding sequences of
FIGS. 1-3, or other modified sequences and known vectors, such as
pCD [Okayama et al., Mol. Cell Biol., 2:161-170 (1982)] and pJL3,
pJL4 [Gough et al., EMBO J., 4:645-653 (1985)]. The BMP-2 and BMP-4
cDNA sequences can be modified by removing the non-coding
nucleotides on the 5' and 3' ends of the coding region. The deleted
non-coding nucleotides may or may not be replaced by other
sequences known to be beneficial for expression. The transformation
of these vectors into appropriate host cells can result in
expression of BMP-2 or BMP-4 proteins.
[0080] One skilled in the art could manipulate the sequences of
FIGS. 1-3 (SEQ ID NO: 1, 3, and 5) by eliminating or replacing the
mammalian regulatory sequences flanking the coding sequence with
bacterial sequences to create bacterial vectors for intracellular
or extracellular expression by bacterial cells. For example, the
coding sequences could be further manipulated (e.g. ligated to
other known linkers or modified by deleting non-coding sequences
there-from or altering nucleotides therein by other known
techniques). The modified BMP-2 or BMP-4 coding sequence could then
be inserted into a known bacterial vector using procedures such as
described in T. Taniguchi et al., Proc. Natl Acad. Sci. USA,
77:5230-5233 (1980). This exemplary bacterial vector could then be
transformed into bacterial host cells and BMP-2 protein or BMP-4
expressed thereby. For a strategy for producing extracellular
expression of BMP-2 or BMP-4 proteins in bacterial cells., see,
e.g. European patent application EPA 177,343.
[0081] Similar manipulations can be performed for the construction
of an insect vector [See, e.g. procedures described in published
European patent application 155,476] for expression in insect
cells. A yeast vector could also be constructed employing yeast
regulatory sequences for intracellular or extracellular expression
of the factors of the present invention by yeast cells. [See, e.g.,
procedures described in published PCT application WO86/00639 and
European patent application EPA 123,289].
[0082] A method for producing high levels of a BMP-2 or BMP-4
protein of the invention in mammalian cells involves the
construction of cells containing multiple copies of the
heterologous BMP-2 or BMP-4 gene. The heterologous gene is linked
to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR)
gene for which cells containing increased gene copies can be
selected for propagation in increasing concentrations of
methotrexate (MTX) according to the procedures of Kaufman and
Sharp, J. Mol. Biol., 159:601-629 (1982). This approach can be
employed with a number of different cell types.
[0083] For example, a plasmid containing a DNA sequence for a BMP-2
or BMP-4 of the invention in operative association with other
plasmid sequences enabling expression thereof and the DHFR
expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell.
Biol., 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO
cells, DUKX-BII, by calcium phosphate coprecipitation and
transfection, electroperation, protoplast fusion or lipofection.
DHFR expressing transformants are selected for growth in alpha
media with dialyzed fetal calf serum, and subsequently selected for
amplification by growth in increasing concentrations of MTX (e.g.
sequential steps in 0.02, 0.2, 1.0 and 5 uM MTX) as described in
Kaufman et al., Mol Cell Biol., 5:1750 (1983).
[0084] Transformants are cloned, and biologically active BMP-2 or
BMP-4 expression is monitored by the Rosen-modified Sampath-Reddi
rat bone formation assay described above in Example III. BMP-2 and
BMP-4 expression should increase with increasing levels of MTX
resistance. Similar procedures can be followed to produce other
related BMP-2 and BMP-4 proteins.
[0085] A. COS Cell Expression
[0086] As one specific example of producing a BMP-2 protein of the
invention, the insert of II-3 (a .lambda. GT10 derivative
containing the full length BMP-2 cDNA) is released from the vector
arms by digestion with EcoRI and subcloned into pSP65 (Promega
Biotec, Madison, Wis.) [Melton et al, Nucl. Acids Res. 12:7035-7056
(1984)] in both orientations yielding pBMP-2 #39-3 or pBMP-2 #39-4.
The insert is subcloned into the EcoRI site of the mammalian
expression vector, pMT2 CXM, described below, though derivitives
thereof may also be suitable. Plasmid DNA from this subclone is
transfected into COS cells by the DEAE-dextran procedure (Sompayrac
and Danna PNAS 78:7575-7578 (1981); Luthman and Magnusson, Nucl.
Acids Res. 11: 1295-1308 (1983)] and the cells are cultured.
Serum-free 24 hr. conditioned medium is collected from the cells
starting 40-70 hr. post-transfection. Recovery and purification of
the COS expressed BMP-2 proteins is described below in Example
VII.
[0087] The mammalian expression vector pMT2 CXM is a derivative of
p91023 (b) (Wong et al., Science 228:810-815, 1985) differing from
the latter in that it contains the ampicillin resistance gene in
place of the tetracycline resistance gene and further contains a
XhoI site for insertion of cDNA clones. The functional elements of
pMT2 CXM have been described (Kaufman, R. J., 1985, Proc. Natl.
Acad. Sci. USA 82:689-693) and include the adenovirus VA genes, the
SV40 origin of replication including the 72 bp enhancer, the
adenovirus major late promoter including a 5' splice site and the
majority of the adenovirus tripartite leader sequence present on
adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert,
the SV40 early polyadenylation site (SV40), and pBR322 sequences
needed for propagation in E. coli.
[0088] Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF,
which has been deposited with the American Type Culture Collection
(ATCC), Rockville, Md. (USA) under accession number ATCC 67122.
EcoRI digestion excises the cDNA insert present in pMT2-VWF,
yielding pMT2 in linear form which can be ligated and used to
transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid
pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then
constructed using loopout/in mutagenesis [Morinaga, et al.,
Biotechnology 84: 636 (1984). This removes bases 1075 to 1145
relative to the Hind III site near the SV40 origin of replication
and enhancer sequences of pMT2. In addition it inserts the
following sequence:
[0089] 5' PO.sub.-CATGGGCAGCTCGAG-3'
[0090] at nucleotide 1145. This sequence contains the recognition
site for the restriction endonuclease Xho I. A derivative of
pMT2CXM, termed pMT23, contains recognition sites for the
restriction endonucleases PstI, Eco RI, SalI and XhoI. Plasmid pMT2
CXM and pMT23 DNA may be prepared by conventional methods.
[0091] B. CHO Cell Expression
[0092] (1) BMP-2 Expression in CHO Cells
[0093] In order to achieve high levels of human BMP-2 protein
expression, the DNA sequence of FIG. 2 (SEQ ID NO: 3) encoding
BMP-2 is inserted into a eucaryotic expression vector, stably
introduced into CHO cells and amplified to high copy number by
methotrexate selection of DHFR [R. J. Kaufman, et al., EMBO J.
6:189 (1987)]. The transformed cells are cultured and the expressed
BMP-2 proteins are recovered and purified from the culture
media.
[0094] A BMP-2 protein of the invention is expressed in CHO cells
by releasing the insert of pBMP-2 #39-3 described above, from the
vector by digestion with EcoRI. The insert is subcloned into the
EcoRI cloning site of the mammalian expression vector, pMT2 CXM
described above, though derivitives thereof may also be
suitable.
[0095] A derivative of the BMP-2 cDNA sequence set forth in FIG. 2
(SEQ ID NO: 3) in which the 5' untranslated region is deleted is
made by removal of the sequences contained between the SalI site at
the 5' adapter (from the original cDNA cloning), and the SalI site
7 base pairs upstream of the initiator ATG, by digestion with SalI
and religation. This step is conveniently performed in either SP65
derivatives containing the full length BMP-2 cDNA, but can also be
performed in pMT2 derivatives. The 3' untranslated region is
removed using heteroduplex mutagenesis using the mutagenic
oligonucleotide
3 5' GAGGGTTGTGGGTGTCGCTAGTGAGTCGACTACAGcAAAATT Terminator SalI
[0096] The sequence contains the terminal 3' coding region of the
BMP-2 cDNA, followed immediately by a recognition site for
SalI.
[0097] The BMP-2 cDNA with deletions of the 5' and 3' untranslated
regions are excised from pSP65 with SalI, and subcloned into the
SalI site of pMT23 described above. Plasmid DNA from the subclones
is transfected into CHO cells by electroporation [Neuman et al,
EMBO J., 1:841-845 (1982)]. Two days later, cells are switched to
selective medium containing 10% dialyzed fetal bovine serum and
lacking nucleosides. Colonies expressing DHFR are counted 10-14
days later. Individual colonies or pools of colonies are expanded
and analyzed for expression of BMP-2 RNA and protein using standard
procedures and are subsequently selected for amplification by
growth in increasing concentrations of MTX. Stepwise selection of
the preferred pool, termed 2.DELTA.D, is carried out up to a
concentration of 2 .mu.M MTX. Individual cells from the pool are
then cloned and assayed for BMP-2 expression. Procedures for such
assay include Northern Blot analysis to detect the presence of RNA,
protein analysis including SDS-PAGE and analysis for cartilage
and/or bone formation activity using the ectopic rat bone formation
assay described above. The presently preferred clonally-derived
cell line is identified as 2.DELTA.D2I. This cell line secretes
BMP-2 proteins into the media containing 2 .mu.M MTX.
[0098] The CHO cell line 2.DELTA.D2I is grown in Dulbecco's
modified Eagle's medium (DMEM)/Ham's nutrient mixture F-12, 1:1
(vol/vol), supplemented with 10% fetal bovine serum. When the cells
are 80-100% confluent, the medium is replaced with serum-free
DMEM/F-12. Medium is harvested every 24 hours for 4 days. For
protein production and purification the cells are cultured
serum-free.
[0099] Currently, this cell line 2.DELTA.D2I is being subjected to
stepwise selection in increasing concentrations of MTX (10 .mu.M,
100 .mu.M, 1000 .mu.M) which may potentially yield cells which
produce even higher levels of BMP-2 protein expression.
[0100] cDNA genes inserted into the EcoRI and/or Xho I sites are
expressed as a bicistronic mRNA with DHFR in the second position.
In this configuration, translation of the upstream (BMP-2) open
reading frame is more efficient than the downstream (DHFR) cDNA
gene [Kaufman et al, EMBO J. 6:187-193 (1987). The amount of DHFR
protein expressed is nevertheless sufficient for selection of
stable CHO cell lines.
[0101] Characterization of the BMP-2 polypeptides through pulse
labeling with [35S] methionine or cysteine and polyacrylamide gel
electrophoresis indicates that multiple molecular size forms of
BMP-2 proteins, further described below, are being expressed and
secreted from the stable CHO lines.
[0102] (2) BMP-4 Expression in CHO Cells
[0103] In order to achieve high levels of human BMP-4 protein
expression, the DNA sequence of FIG. 3 (SEQ ID NO: 5) encoding
BMP-4 is inserted into a eucaryotic expression vector, stably
introduced into CHO cells and amplified to high copy number by
methotrexate selection of DHFR [R. J. Kaufman, et al., EMBO J.
6:189 (1987)]. The transformed cells are cultured and the expressed
BMP-4 proteins are recovered and purified from the culture
media.
[0104] As described above, numerous expression vectors known in the
art may be utilized in the expression of BMP proteins of the
invention. The vector utilized in the following example is
pEMC2.beta.1 derived from pMT21 though other vectors may be
suitable in practice of the invention.
[0105] pMT21 is derived from pMT.sub.2 which is derived from
pMT2-VWF, deposited with the American Type Culture Collection
(ATCC), Rockville, Md. (USA) under accession number ATCC 67122
under the provisions of the Budapest Treaty. EcoRI digestion
excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear
form which can be ligated and used to transform E. Coli HB 101 or
DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by
conventional methods.
[0106] pMT21 was derived from pMT2 through the following two
modifications. First, 76 bp of the 5' untranslated region of the
DHFR cDNA including a stretch of 19 G residues from G/C tailing for
cDNA cloning was deleted. In this process, a XhoI site was inserted
to obtain the following sequence immediately upstream from
DHFR:
4 5'-CTGCAGGCGAGCCTGAATTCCTCGAGCCATCATG-3' PstI Eco RI XhoI
[0107] Second, a unique ClaI site was introduced by digestion with
EcoRV and XbaI, treatment with Klenow fragment of DNA polymerase I,
and ligation to a ClaI linker (CATCGATG). This deletes a 250 bp
segment from the adenovirus virus associated RNA (VAI) region but
does not interfere with VAI RNA gene expression or function. pMT21
was digested with EcoRI and XhoI, and used to derive the vector
pEMC2B1.
[0108] A portion of the EMCV leader was obtained from pMT2-ECAT1
[S. K. Jung, et al, J. Virol 63:1651-1660 (1989)] by digest with
Eco RI and PstI, resulting in a 2752 bp fragment. This fragment was
digested with TaqI yielding an Eco RI-TaqI fragment of 508 bp which
was purified by electrophoresis on low melting agarose gel. A 68 bp
adapter and its complementary strand were synthesized with a 5'
TaqI protruding end and a 3' XhoI protruding end which has the
following sequence:
5
5'-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACAC-
GATTGC-3' TaqI XhoI
[0109] This sequence matches the EMC virus leader sequence from
nucleotide 763 to 827. It also changes the ATG at position 10
within the EMC virus leader to an ATT and is followed by a XhoI
site. A three way ligation of the pMT21 Eco RI-XhoI fragment, the
EMC virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide
adapter TaqI-XhoI adapter resulted in the vector pEMC2B1.
[0110] This vector contains the SV40 origin of replication and
enhancer, the adenovirus major late promoter, a cDNA copy of the
majority of the adenovirus tripartite leader sequence, a small
hybrid intervening sequence, an SV40 polyadenylation signal and the
dadenovirus VA I gene, DHFR and B-lactamase markers and an EMC
sequence, in appropriate relationships to direct the high level
expression of the desired cDNA in mammalian cells.
[0111] A derivative of the BMP-4 cDNA sequence set forth in FIG. 3
in which the 3' untranslated region is removed is made via
heteroduplex mutagenesis with the mutagenic oligonucleotide:
6 5' GGATGTGGGTGCCGCTGACTCTAGAGTCGACGGAATTC 3'. Terminator
EcoRI
[0112] This deletes all of the sequences 3' to the translation
terminator codon of the BMP-4 cDNA, juxtaposing this terminator
codon and the vector polylinker sequences. This step is performed
in an SP65 vector though may be conveniently performed in MT2
derivatives containing the BMP-4 cDNA. The 5' untranslated region
is removed using the restriction endonuclease BsmI, which cleaves
within the eighth codon of BMP-4 cDNA. Reconstruction of the first
eight codons is accomplished by ligation to oliognucleotides:
7 EcoRI Initiator EsmI 5' AATTCACCATGATTCCTGGTAACCGAATGCT 3' and 3'
GTGGTACTAAGGACCATTGGCTTAC 5'
[0113] These oligonucleotides form a duplex which has a BsmI
complementary cohesive end capable of ligation to the BsmI
restricted BMP-4 cDNA, and it has an EcoRI complementary cohesive
end capable of ligation to the EcoRI restricted vector MT2. Thus
the cDNA for BMP-4 with the 5' and 3' untranslated regions deleted,
and retaining the entire encoding sequence is contained within an
EcoRI restriction fragment of approximately 1.2 kb.
[0114] The BMP-4 containing plasmid designated pXMBMP-4DUT is
digested with EcoRI in order to release the BMP-4 cDNA containing
insert from the vector. This insert is subcloned into the EcoRI
site of the mammalian expression vector pEMC2.beta.1 described
above. Plasmid DNA from the subclones is transfected into CHO cells
by electroporation [Neuman et al, EMBO J., 1:841-845 (1982)]. Two
days later, cells are switched to selective medium containing 10%
dialyzed fetal bovine serum and lacking nucleosides. Colonies
expressing DHFR are counted 10-14 days later. Individual colonies
or pools of colonies are expanded and analyzed for expression of
BMP-4 RNA and protein using standard procedures and are
subsequently selected for amplification by growth in increasing
concentrations of MTX. Stepwise selection of the preferred pool,
termed 4.DELTA.ED, is carried out up to a concentration of 2 .mu.M
MTX. Individual cells from the pool are then cloned and assayed for
BMP-4 expression. Procedures for such assay include Northern Blot
analysis to detect the presence of mRNA, protein analysis including
SDS-PAGE and analysis for cartilage and/or bone formation activity
using the ectopic rat bone formation assay described above.
[0115] 4.DELTA.ED is grown in Dulbecco's modified Eagle's medium
(DMEM)/Ham's nutrient mixture F-12, 1:1 (vol/vol), supplemented
with 10% fetal bovine serum. When the cells are 80-100% confluent,
the medium is replaced with serum-free DMEM/F-12. Medium is
harvested every 24 hours for 4 days. For protein production and
purification the cells are cultured serum-free.
[0116] cDNA genes inserted into the EcoRI and/or Xho I sites are
expressed as a bicistronic mRNA with DHFR in the second position.
In this configuration, translation of the upstream (BMP-4) open
reading frame is more efficient than the downstream (DHFR) cDNA
gene [Kaufman et al, EMBO J. 6:187-193 (1987). The amount of DHFR
protein expressed is nevertheless sufficient for selection of
stable CHO cell lines.
[0117] Characterization of the BMP-4 polypeptides through pulse
labeling with [35S] methionine or cysteine and polyacrylamide gel
electrophoresis indicates that multiple molecular size forms of
BMP-4 proteins, further described below, are being expressed and
secreted from the stable CHO lines.
EXAMPLE VII
[0118] Characterization and Biological Activity of Expressed BMP-2
and BMP-4
[0119] To measure the biological activity of the expressed BMP-2
and BMP-4 proteins obtained in Example VI above, the proteins are
recovered from the cell culture and purified by isolating the BMP-2
and BMP-4 proteins from other proteinaceous materials with which
they are co-produced as well as from other contaminants. The
purified protein is assayed in accordance with the rat bone
formation assay described in Example III using a modified scoring
method described below.
[0120] A. COS Expressed Protein
[0121] The COS expressed material of Example VI may be partially
purified on a Heparin Sepharose column. 4 ml of the collected post
transfection conditioned medium supernatant from one 100 mm culture
dish is concentrated approximately 10 fold by ultrafiltration on a
YM 10 membrane and then dialyzed against 20 mM Tris, 0.15 M NaCl,
pH 7.4 (starting buffer). This material is then applied to a 1.1 ml
Heparin Sepharose column in starting buffer. Unbound proteins are
removed by an 8 ml wash of starting buffer, and bound proteins,
including BMP-2 polypeptides, are desorbed by a 3-4 ml wash of 20
mM Tris, 2.0 M NaCl, pH 7.4.
[0122] The proteins bound by the Heparin column are concentrated
approximately 10-fold on a Centricon 10 and the salt reduced by
diafiltration with 0.1% trifluoroacetic acid. The appropriate
amount of this solution is mixed with 20 mg of rat matrix and then
assayed for in vivo bone and/or cartilage formation activity by the
Rosen-modified Sampath-Reddi assay. A mock transfection supernatant
fractionation is used as a control.
[0123] The implants containing rat matrix to which specific amounts
of human BMP-2 or BMP-4 have been added are removed from rats after
seven days and processed for histological evaluation.
Representative sections from each implant are stained for the
presence of new bone mineral with von Kossa and acid fuschin, and
for the presence of cartilage-specific matrix formation using
toluidine blue. The types of cells present within the section, as
well as the extent to which these cells display phenotype are
evaluated and scored as described in Example III.
[0124] Addition of the expressed human BMP-2 or BMP-4 to the matrix
material results in formation of cartilage-like nodules at 7 days
post implantation. The chondroblast-type cells are recognizable by
shape and expression of metachromatic matrix. The amount of
activity observed for human BMP-2 or BMP-4 indicates that it may be
dependent upon the amount of human BMP-2 or BMP-4 protein added to
the matrix sample.
[0125] Similar levels of activity are seen in the Heparin Sepharose
fractionated COS cell extracts. Partial purification is
accomplished in a similar manner as described above except that 6 M
urea is included in all the buffers.
[0126] B. CHO Expressed Protein
[0127] (1) BMP-2
[0128] To measure the biological activity of the BMP-2 proteins
expressed in accordance with Example VIB above, 0.5 liters of
conditioned media is directly adsorbed to 1 ml Heparin Sepharose
(Pharmacia) column. The resin is washed with 0.15 M NaCl, 6.0 M
urea, 20 mM Tris, pH 7.4 and then developed with a linear gradient
to 1.0 M NaCl, 6.0 M urea, 50 mM Tris, pH 7.4. Fractions are
assayed by the rat ectopic cartilage and bone formation assay
described in Example III. The highest specific activity fractions
are pooled and concentrated by ultrafiltration on a YM-10 (Amicon)
membrane. Conditioned medium from CHO cells not transfected with
the BMP-2 gene is prepared similarly, except that a step gradient
to 1 M NaCl is used. Protein concentration is determined by amino
acid analysis.
[0129] Further purification is achieved by preparative
NaDodSO.sub.4/PAGE [Laemmli, Nature 227: 680-685 (1970)].
Approximately 300 .mu.g of protein is applied to a 1.5-mm-thick
12.5% gel: recovery is estimated by adding
L-[.sup.35S]methionine-labeled BMP-2 purified over
heparin-Sepharose as described above. Protein is visualized by
copper staining of an adjacent lane [Lee, et al., Anal. Biochem.
166:308-312 (1987)]. Appropriate bands are excises and extracted in
0.1% NaDodSO.sub.4/20 mM Tris, pH 8.0. The supernatant is acidified
with 10% CF.sub.3COOH to pH 3 and the proteins are desalted on
5.0.times.0.46 cm Vydac C.sub.4 column (The Separations Group,
Hesperia, Calif.) developed with a gradient of 0.1% CF.sub.3COOH to
90% acetonitrile/0.1% CF.sub.3COOH.
[0130] The pooled material is analyzed by SDS-PAGE using a 12%
acrylamide (U. K. Laemmli, Nature 227:680 (1970)] stained with
silver [R. R. Oakley, et al. Anal. Biochem. 105:361 (1980)] and by
immunoblot [H. Towbin, et al. Proc. Natl. Acad. Sci. USA 76:4350
(1979)] of 13.5% gel. SDS-PAGE reveals that multiple molecular size
forms of BMP-2 proteins are being expressed and secreted from the
stable CHO lines. Under non-reduced conditions, the major protein
species is represented by a broad band at 30,000 daltons. Lower
molecular weight species are seen as well as higher species, most
notably 82,000 daltons and 113,000 daltons.
[0131] The 30,000 dalton band reacts with a rabbit antiserum
directed against an E. coli produced fragment of BMP-2 amino acids
#130-#396 as shown in FIG. 2 (SEQ ID NO: 4), with which it was
incubated followed by .sup.125I-Protein A. Under reduced conditions
the 30,000 dalton material shifts to the 16,000-20,000 range with
several species within this range observed. Each band is recognized
by a turkey-derived anti-peptide antibody directed against amino
acids #350-#365 as shown in FIG. 2 with which it is incubated
followed by .sup.125I-rabbit anti-turkey IgG, as well as the
anti-BMP-2 antibody described above. The peptide antibody is
generated by coupling to bovine serum albumin with glutaraldehyde
[J. P. Briand, et al. J. Immunol. Meth. 78:59 (1985)] in the
presence of 100 ug/ml albumin. The broadness of the 30,000 dalton
band and the mutiplicity of its subunits are contemplated to arise
from differences in carbohydrate in the potential N-gylcosylation
site or from N-terminal heterogeneity.
[0132] A major N-terminal amino acid sequence beginning at amino
acid #283 (Gln, Ala, Lys . . . ) as shown in FIG. 2 is obtained
from the 30,000 dalton band isolated under non-reducing conditions.
The calculated subunit molecular weight of a protein of amino acids
283-396 is approximately 13,000 daltons. Preliminary experiments
indicate that over 90% of the biological activity in the total
protein pool is eluted from a non-reduced SDS-PAGE at a relative
mass of 30,000 daltons. It is contemplated therefore that a dimer
of amino acids #283-396 of BMP-2, (referred to as a mature BMP-2)
accounts for the majority of the biological activity in the mixture
of expressed BMP-2 proteins. It is further contemplated that
processing of BMP-2 to the mature forms involves dimerization of
the proprotein (amino acids #24 Leu, Val, Pro . . . to #396) and
removal of the N-terminal region in a manner analogous to the
processing of the related protein TGF-.beta. [L. E. Gentry, et al.
Molec. & Cell Biol. 8:4162 (1988); R. Dernyck, et al. Nature
316:701 (1985)].
[0133] Immunoblot analysis using antibodies directed against a
portion of the mature region (amino acids #350-365) and an antibody
directed against the pro region (amino acids #103-116) of the
82,000 and 113,000 higher molecular weight species of BMP-2 under
both non-reduced and reduced conditions suggests that these species
may represent intermediate forms in the processing of the BMP-2
dimer. A 66,000 dalton species is present under reduced conditions.
The 113,000 dalton species is contemplated to comprise proprotein
dimers of 113,000 daltons (2 subunits of 66,000 daltons) and the
82,000 dalton species is contemplated to comprise a proprotein
subunit linked to a mature BMP-2 subunit (66,000 daltons plus
18,000 daltons). Based on these analyses, approximately 50% of the
total protein is active mature BMP-2.
[0134] The pool of protein containing recombinant human BMP-2 is
assayed in accordance with the rat cartilage and bone formation
assay described in Example III using a modified scoring method as
follows, three non-adjacent sections are evaluated from each
implant and averaged. "+/-" indicates tentative identification of
cartilage or bone; "+1" indicates >10% of each section being new
cartilage or bone; "+2", >25%; "+3", >50%; "+4", -75%; "+5",
>80%. A "-" indicates that the implant is not recovered. The
scores of the individual implants (in triplicate) are tabulated to
indicate assay variability. BMP-2 protein is implanted
subcutaneously in rats for times ranging from 5-21 days and the
resulting implants evaluated histologically for the presence of
newly formed cartilage and bone. Additionally, the level of
alkaline phosphatase, synthesized by both cartilage and bone cells
is measured.
[0135] Addition of partially purified CHO expressed human BMP-2 to
the matrix material induces both new cartilage and new bone
formation. Implantation of amounts of 0.46-115.3 .mu.g of protein
tested for times ranging from 5-21 days results in the induction of
new cartilage and bone formation. Induction of cartilage formation
is evident by day 7 and induction of bone formation is evident by
day 14 for the lowest dose. The time at which bone formation occurs
is related to the amount of BMP-2 implanted. At high doses bone can
be observed at five days.
[0136] The development of cartilage and bone with time of a 12.0
microgram dosage of protein containing BMP-2 is summarized below.
Amounts of new cartilage and bone are evaluated semi-quantitatively
and scored on a scale of 0 to 5. Individual implants are listed to
illustrate assay variability. At 5 days, many immature and some
hypertrophic cartilage cells are present in the BMP-containing
implant, but no mineralizing cartilage is detected. After 7 days
chondrogenesis progresses so that most of the cartilage cells are
hypertrophic and surrounded by mineralized matrix. Osteoblasts
appear to be actively secreting osteoid, which is not yet
mineralized. Day 7 implants have the greatest alkaline phosphatase
content reflecting production by both chondrocytes and osteoblasts.
Vascular elements, including giant cells and bone marrow
precursors, are seen and are most abundant in areas where calcified
cartilage is undergoing remodeling.
[0137] The decline of alkaline phosphatase activity on day 10
signals the end of chondrogenesis in the implants. At 14 days the
removal of calcified cartilage is nearly complete and bone is
widespread. Osteoblasts and osteoclasts are abundant and appear to
be actively engaged in the organization of newly formed trabecular
bone. The levels of alkaline phosphatase reflect osteoblast
activity at this stage in the maturation process. The vascularity
of the implants has increased markedly, and hematopoietic cell
maturation is tentatively observed.
[0138] At 21 days, implants show increased maturity over the
previous time point. The bone is highly organized with mature
marrow spaces, and bone-forming cells embedded in mineralized bone
matrix are apparent. At 21 days, all remnants of matrix carrier
have been removed in contrast to the control implants with no BMP,
where matrix remains intact.
[0139] NaDodSO.sub.4/PAGE is used to purify each of the three BMP-2
species to homogeneity. The overall recovery of BMP-2 protein after
electrophoresis, desalting, and concentration is approximately 30%
and 87% of the BMP-2 is the 30,000 dalton form. All three forms of
BMP-2 show in vivo activity when assayed for cartilage and bone
induction. The 30,000 and 82,000 dalton species were equivalent in
this assay while the 113,000 dalton species showed significantly
less activity.
[0140] (2) BMP-4
[0141] To measure the biological activity of BMP-4 expressed in
accordance with Example VIB above BMP-4 is collected from the
conditioned medium by batch adsorbing BMP-4 to heparin sepharose
CL-6-B using swelled heparin sepharose per liter conditined media
(CM) and stirring overnight at 4.degree. C. The heparin sepharose
is collected by filtering the CM through a fitted glass filter and
washed with cold (4.degree. C.) 50 mM Tris pH 7.4. A Pharmacia
column is packed with the heparin sepharose using 50 mM Tris buffer
and washed with buffer to the baseline. Elution is carried out with
the following gradient of sodium chloride:
8 Buffer A: 50 mM Tris pH 7.4 Buffer B: 50 mM Tris pH 7.4, 1 M
NaCl
[0142] BMP-4 containing fractions are located using Western blots
probed with antipeptide antibody W10 (an anti-peptide polyclonal
antibody recognizing the carboxy terminus of BMP-2). The BMP-4
containing fractions are pooled, the NaCl concentration is adjusted
to 0.8M, and the pool is loaded onto a Butyl Toyopearl hydrophobic
interaction column. Gradient elution from the hydrophobic
interaction column is carried out using a sodium chloride and
ethanol gradient:
9 Buffer A: 50 mM Tris pH 7,4, 0.8 M NaCl Buffer B: 50 mM Tris pH
7,4, 10% Ethanol
[0143] BMP-4 elutes at approximately 0.37M NaCl, 5.4% ethanol. The
BMP-4 containing fractions are pooled and concentrated. Yields are
approximately 33 .mu.g/liter CM of >95% pure material.
[0144] SDS-PAGE and silver stain analysis reveals that BMP-4
typically migrates as a single band at approximately 35 kD
(non-reduced) and reduces to a single bend at approximately 22 kD.
BMP-4 is, therefore, a dimer of approximate molecular weight 35 kD
which reduces to a monomer of approximate molecular weight 20 kD.
Monomers of 18 and 22 kD have been detected. Monomer can also be
seen reducing from a high molecular weight region (>67 kD) where
it is assumed to be associated with an unprocessed BMP-4 molecule.
The 2D pattern indicates that heterodimers are formed between the
various molecular weight monomeric species.
[0145] BMP-4 is sensitive to N-glycanase, Endoglycosidase H, and
Endoglycosidase F digestion, indicating the presence of N linked
high mannose sugars. In a western format, ConA and WGA bind BMP-4,
again indicating the presence of N-linked high mannose glycans.
Lentil Lectin, which indicates the presence of .alpha.-D mannosyl
or .alpha.-D glycosyl linkages, also binds BMP-4.
[0146] N-terminal sequence analysis reveals a single amino terminus
at serine #293. Indicating a cleavage site at amino acid 293. This
amino terminus is analogous to the Gln, Ala, Lys . . . of BMP-2.
Mature BMP-4 is, therefore, a dimer of amino acids #293-#408 as
shown in FIG. 3 (SEQ ID NO: 4).
[0147] Presently, experiments indicate a minimum dose of 156 ng
reproducibly induces cartilage formation with BMP-4 in the rat
ectopic assay which is comparable to BMP-2. Bone that is formed by
BMP-4 is highly calcified, organized, and histologically similar to
that formed by BMP-2, as described above. The time course of the
appearance and the subsequent remodelling into bone is similar for
BMP-4 and BMP-2.
[0148] The foregoing descriptions detail presently preferred
embodiments of the present invention. Numerous modifications and
variations in practice thereof are expected to occur to those
skilled in the art upon consideration of these descriptions. Those
modifications and variations are believed to be encompassed within
the claims appended hereto.
Sequence CWU 0
0
* * * * *