U.S. patent application number 11/021367 was filed with the patent office on 2005-07-21 for nucleic acid analysis techniques.
This patent application is currently assigned to Affymetrix, INC.. Invention is credited to Barone, Anthony D., Chaoqiang, Lai, Chee, Mark, Cronin, Maureen T., Gunderson, Kevin, Lee, Danny H., Lockhart, David J., Matsuzaki, Hajime, McGall, Glenn H., Tran, Huu M., Wodicka, Lisa.
Application Number | 20050158772 11/021367 |
Document ID | / |
Family ID | 34067570 |
Filed Date | 2005-07-21 |
United States Patent
Application |
20050158772 |
Kind Code |
A1 |
Lockhart, David J. ; et
al. |
July 21, 2005 |
Nucleic acid analysis techniques
Abstract
The present invention provides a simplified method for
identifying differences in nucleic acid abundances (e.g.,
expression levels) between two or more samples. The methods involve
providing an array containing a large number (e.g. greater than
1,000) of arbitrarily selected different oligonucleotide probes
where the sequence and location of each different probe is known.
Nucleic acid samples (e.g. mRNA) from two or more samples are
hybridized to the probe arrays and the pattern of hybridization is
detected. Differences in the hybridization patterns between the
samples indicates differences in expression of various genes
between those samples. This invention also provides a method of
end-labeling a nucleic acid. In one embodiment, the method involves
providing a nucleic acid, providing a labeled oligonucleotide and
then enzymatically ligating the oligonucleotide to the nucleic
acid. Thus, for example, where the nucleic acid is an RNA, a
labeled oligoribonucleotide can be ligated using an RNA ligase. In
another embodiment, the end labeling can be accomplished by
providing a nucleic acid, providing labeled nucleoside
triphosphates, and attaching the nucleoside triphosphates to the
nucleic acid using a terminal transferase.
Inventors: |
Lockhart, David J.;
(Mountain View, CA) ; Chee, Mark; (Palo Alto,
CA) ; Gunderson, Kevin; (Santa Clara, CA) ;
Chaoqiang, Lai; (Sunnyvale, CA) ; Wodicka, Lisa;
(Santa Clara, CA) ; Cronin, Maureen T.; (Los
Altos, CA) ; Lee, Danny H.; (RTP, NC) ; Tran,
Huu M.; (Milpitas, CA) ; Matsuzaki, Hajime;
(Palo Alto, CA) ; McGall, Glenn H.; (Palo Alto,
CA) ; Barone, Anthony D.; (San Jose, CA) |
Correspondence
Address: |
AFFYMETRIX, INC
ATTN: CHIEF IP COUNSEL, LEGAL DEPT.
3380 CENTRAL EXPRESSWAY
SANTA CLARA
CA
95051
US
|
Assignee: |
Affymetrix, INC.
Santa Clara
CA
|
Family ID: |
34067570 |
Appl. No.: |
11/021367 |
Filed: |
December 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11021367 |
Dec 23, 2004 |
|
|
|
09880727 |
Jun 13, 2001 |
|
|
|
6858711 |
|
|
|
|
09880727 |
Jun 13, 2001 |
|
|
|
08882649 |
Jun 25, 1997 |
|
|
|
6344316 |
|
|
|
|
08882649 |
Jun 25, 1997 |
|
|
|
PCT/US97/01603 |
Jan 22, 1997 |
|
|
|
60010471 |
Jan 23, 1996 |
|
|
|
60035170 |
Jan 9, 1997 |
|
|
|
Current U.S.
Class: |
435/6.14 |
Current CPC
Class: |
G16B 30/10 20190201;
G16B 25/20 20190201; C07H 19/052 20130101; C12Q 1/6837 20130101;
C07H 21/00 20130101; C40B 40/00 20130101; C07H 19/12 20130101; C12Q
1/6809 20130101; G16B 30/00 20190201; C12Q 2600/156 20130101; G16B
25/00 20190201; C12Q 1/6809 20130101; C12Q 2525/161 20130101; C12Q
1/6809 20130101; C12Q 2565/501 20130101; C12Q 2561/125 20130101;
C12Q 1/6837 20130101; C12Q 2561/125 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
1. A method of identifying differences in nucleic acid levels
between two or more nucleic acid samples, said method comprising
the steps of: (a) providing one or more oligonucleotide arrays said
arrays comprising probe oligonucleotides attached to a surface; (b)
hybridizing said nucleic acid samples to said one or more arrays to
form hybrid duplexes between nucleic acids in said nucleic acid
samples and probe oligonucleotides in said one or more arrays that
are complementary to said nucleic acids or subsequences thereof;
(c) contacting said one or more arrays with a nucleic acid ligase;
and (d) determining differences in hybridization between said
nucleic acid samples wherein said differences in hybridization
indicate differences in said nucleic acid levels.
2-49. (canceled)
50. A method for producing a detectably labeled nucleic acid, said
method comprising: enzymatically generating by template dependent
polymerization an oligonucleotide tagged nucleic acid, wherein said
oligonucleotide tagged nucleic acid comprises an oligonucleotide
tag; and contacting said oligonucleotide tagged nucleic acid with a
labeled oligonucleotide complementary to said oligonucleotide tag
under conditions sufficient for said labeled oligonucleotide to
hybridize to said oligonucleotide tag; whereby a detectably labeled
nucleic acid is produced.
51. The method according to claim 50, wherein said detectably
labeled nucleic acid is directly detectable.
52. The method according to claim 51, wherein said directly
detectable label is fluorescent.
53. A method for producing a detectably labeled population of
target nucleic acids from an initial nucleic acid sample, said
method comprising: enzymatically generating a population of
oligonucleotide tagged target nucleic acids from an initial nucleic
acid sample, wherein said oligonucleotide tagged target nucleic
acids in said population comprise the same oligonucleotide tag; and
contacting said population of oligonucleotide tagged target nucleic
acids with labeled oligonucleotides complementary to said
oligonucleotide tag of each oligonucleotide tagged target nucleic
acid under hybridization conditions; whereby a detectably labeled
population of target nucleic acids is produced.
54. The method according to claim 53, wherein said nucleic acid
sample is an mRNA sample.
55. The method according to claim 54, wherein a primer that
comprises an oligo dT domain and said oligonucleotide tag is
employed in said enzymatically generating step.
56. The method according to claim 54, wherein said primer further
comprises an RNA polymerase promoter domain.
57. The method according to claim 54, wherein said population of
detectably labeled target nucleic acids is labeled with a
fluorescent label.
58. A method of detecting the presence of a nucleic acid analyte in
a target sample, said method comprising: (a) enzymatically
generating an oligonucleotide tagged target nucleic acid from said
nucleic acid analyte, wherein said oligonucleotide tagged target
nucleic acid comprises an oligonucleotide tag; and (b) producing a
hybridized complex that comprises: (i) said tagged target nucleic
acid; (ii) an oligonucleotide label; and (iii) a probe nucleic
acid; (c) detecting the presence of said hybridized complex; and
(d) relating the presence of said hybridized complex to the
presence of said nucleic acid analyte in said sample; whereby the
presence of said nucleic acid analyte in said sample is
detected.
59. The method according to claim 58, wherein said probe is stably
associated with the surface of a solid support.
60. The method according to claim 58, wherein said probe is present
on an array.
61. The method according to claim 58, wherein said labeled
oligonucleotide is fluorescently labeled.
62. The method according to claim 58, wherein a primer comprising
an oligo dT region and said oligonucleotide tag is employed in said
enzymatically generating step.
63. The method according to claim 62, wherein said primer further
comprises an RNA polymerase promoter.
64. The method according to claim 58, wherein said method further
comprises transmitting data obtained from at least one of said
detecting and related steps to a remote location.
65. A method for obtaining an expression profile for at least a
representative number of genes in a cell, said method comprising:
(a) enzymatically generating a population of oligonucleotide tagged
nucleic acids from an mRNA sample derived from said cell, wherein
each oligonucleotide tagged nucleic acid comprises an
oligonucleotide tag; (b) producing at least one hybridized complex
comprising: (i) a tagged target nucleic acid; (ii) a labeled
oligonucleotide; and (iii) a probe nucleic acid stably associated
with the surface of a solid support; (c) detecting the presence of
said at least one hybridized complex on said array surface; and (d)
deriving an expression profile for said cell from said detected at
least one hybridized complex; whereby said expression profile for
at least a representative number of genes in said cell is
obtained.
66. The method according to claim 65, wherein a primer comprising
an oligo dT domain and said oligonucleotide tag is employed in said
enzymatically generating step.
67. The method according to claim 66, wherein said primer further
comprises an RNA polymerase promoter.
68. The method according to claim 65, wherein said labeled
oligonucleotide is fluorescently labeled.
69. The method according to claim 65, wherein said method further
comprises transmitting data obtained from at least one of said
detecting and deriving steps to a remote location.
70. A method for comparing the expression profiles of at least two
distinct samples, said method comprising: (a) enzymatically
generating: (i) a first population of oligonucleotide tagged
nucleic acids from an mRNA sample derived from a first sample,
wherein each oligonucleotide tagged nucleic acid of said first
population comprises a first oligonucleotide tag; and (ii) a second
population of oligonucleotide tagged nucleic acids from an mRNA
sample derived from a second sample, wherein each oligonucleotide
tagged nucleic acid of said second population comprises a second
oligonucleotide tag that differs from said first oligonucleotide
tag; (b) hybridizing said first and second populations of
oligonucleotide tagged target nucleic acids to an array of probe
nucleic acids stably associated with the surface of a solid
support, wherein said hybridizing occurs in the presence of: (i)
first labeled oligonucleotide complementary to said first
oligonucleotide tag of said first population; and (ii) second
labeled oligonucleotide complementary to said second
oligonucleotide tag of said second population; whereby hybridized
complexes comprising said oligonucleotide tagged target nucleic
acids, probe nucleic acids and labeled oligonucleotides are
produced on the surface of said array; (c) detecting the presence
of said hybridized complexes on said array surface; (d) deriving an
expression profile for each of said cells from said detected
hybridized complexes; and (e) comparing the derived expression
profiles of each of said cells; whereby the expression profiles of
said at least two distinct cells are compared.
71. The method according to claim 70, wherein said first and second
labels are distinguishable.
72. The method according to claim 70, wherein said first and second
labels are fluorescent.
73. The method according to claim 70, wherein a primer comprising
an oligo dT domain and said oligonucleotide tag is employed in said
enzymatically generating step.
74. The method according to claim 73, wherein said primer further
comprises an RNA polymerase promoter.
75. A kit for use in obtaining an expression profile for at least a
representative number of genes in a cell, said kit comprising: (a)
a first primer comprising an hybridization domain and an
oligonucleotide tag; and (b) a first labeled oligonucleotide
complementary to said oligonucleotide tag.
76. The kit according to claim 75, wherein said primer further
comprises an RNA polymerase promoter.
77. The kit according to claim 75, wherein said hybridization
domain is an oligo dT domain.
78. The kit according to claim 75, wherein said hybridization
domain is a domain of random sequence.
79. The kit according to claim 75, wherein said kit further
comprises an array of probe nucleic acids stably associated with
the surface of a solid support.
80. The kit according to claim 75, wherein said kit further
comprises: (a) a second primer comprising an hybridization domain
and a second oligonucleotide tag having a sequence different from
said first oligonucleotide tag; and (b) a second labeled
oligonucleotide, wherein the label of said second labeled
oligonucleotide is distinguishable from the label of said first
labeled oligonucleotide.
81. The kit according to claim 78, wherein said second primer
further comprises an RNA polymerase promoter.
82. The kit according to claim 75, wherein said kit further
comprises an RNA polymerase.
83. The kit according to claim 75, wherein said first labeled
oligonucleotide is labeled with a fluorescent label.
84. The kit according to claim 75, wherein said kit further
comprises a computer readable storage medium on which is recorded
an algorithm for designing oligonucleotide tag sequences.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This is a continuation-in-part of U.S. Ser. No. 60/010,471
filed on Jan. 23, 1996 and a continuation-in-part of provisional
patent application for "Labeling of Nucleic Acids" naming Lockhart,
Cronin, Lee, Tran, Matsuzaki, McGall and Barone as inventors, filed
on Jan. 9, 1997, both of which are herein incorporated by reference
for all purposes.
BACKGROUND OF THE INVENTION
[0002] A portion of the disclosure of this patent document contains
material which is subject to copyright protection. The copyright
owner has no objection to the xerographic reproduction by anyone of
the patent document or the patent disclosure in exactly the form it
appears in the Patent and Trademark Office patent file or records,
but otherwise reserves all copyright rights whatsoever.
[0003] Many disease states are characterized by differences in the
expression levels of various genes either through changes in the
copy number of the genetic DNA or through changes in levels of
transcription (e.g. through control of initiation, provision of RNA
precursors, RNA processing, etc.) of particular genes. For example,
losses and gains of genetic material play an important role in
malignant transformation and progression. These gains and losses
are thought to be "driven" by at least two kinds of genes.
Oncogenes are positive regulators of tumorigenesis, while tumor
suppressor genes are negative regulators of tumorigenesis
(Marshall, Cell, 64: 313-326 (1991); Weinberg, Science, 254:
1138-1146 (1991)). Therefore, one mechanism of activating
unregulated growth is to increase the number of genes coding for
oncogene proteins or to increase the level of expression of these
oncogenes (e.g. in response to cellular or environmental changes),
and another is to lose genetic material or to decrease the level of
expression of genes that code for tumor suppressors. This model is
supported by the losses and gains of genetic material associated
with glioma progression (Mikkelson et al. J. Cell. Biochem. 46: 3-8
(1991)). Thus, changes in the expression (transcription) levels of
particular genes (e.g. oncogenes or tumor suppressors), serve as
signposts for the presence and progression of various cancers.
[0004] Similarly, control of the cell cycle and cell development,
as well as diseases, are characterized by the variations in the
transcription levels of particular genes. Thus, for example, a
viral infection is often characterized by the elevated expression
of genes of the particular virus. For example, outbreaks of Herpes
simplex, Epstein-Barr virus infections (e.g. infectious
mononucleosis), cytomegalovirus, Varicella-zoster virus infections,
parvovirus infections, human papillomavirus infections, etc. are
all characterized by elevated expression of various genes present
in the respective virus. Detection of elevated expression levels of
characteristic viral genes provides an effective diagnostic of the
disease state. In particular, viruses such as herpes simplex, enter
quiescent states for periods of time only to erupt in brief periods
of rapid replication. Detection of expression levels of
characteristic viral genes allows detection of such active
proliferative (and presumably infective) states.
[0005] The use of "traditional" hybridization protocols for
monitoring or quantifying gene expression is problematic. For
example two or more gene products of approximately the same
molecular weight will prove difficult or impossible to distinguish
in a Northern blot because they are not readily separated by
electrophoretic methods. Similarly, as hybridization efficiency and
cross-reactivity varies with the particular subsequence (region) of
a gene being probed it is difficult to obtain an accurate and
reliable measure of gene expression with one, or even a few, probes
to the target gene.
[0006] The development of VLSIPS.TM. technology provided methods
for synthesizing arrays of many different oligonucleotide probes
that occupy a very small surface area. See U.S. Pat. No. 5,143,854
and PCT patent publication No. WO 90/15070. U.S. Patent application
Serial No. 082,937, filed Jun. 25, 1993, describes methods for
making arrays of oligonucleotide probes that can be used to provide
the complete sequence of a target nucleic acid and to detect the
presence of a nucleic acid containing a specific nucleotide
sequence.
[0007] Previous methods of measuring nucleic acid abundance
differences or changes in the expression of various genes (e.g.,
differential diaplay, SAGE, cDNA sequencing, clone spotting, etc.)
require assumptions about, or prior knowledge regarding the target
sequences in order to design appropriate sequence-specific probes.
Other methods, such as subtractive hybridization, do not require
prior sequence knowledge, but also do not directly provide sequence
information regarding differentially expressed nucleic acids.
SUMMARY OF THE INVENTION
[0008] The present invention, in one embodiment, provides methods
of monitoring the expression of a multiplicity of preselected genes
(referred to herein as "expression monitoring"). In another
embodiment this invention provides a way of identifying differences
in the compositions of two or more nucleic acid (e.g., RNA or DNA)
samples. Where the nucleic acid abundances reflect expression
levels in biological samples from which the samples are derived,
the invention provides a method for identifying differences in
expression profiles bewteen two or more samples. These "generic
difference screening methods" are rapid, simple to apply, require
no a priori assumptions regarding the particular sequences whose
expression may differ between the two samples, and provide direct
sequence information regarding the nucleic acids whose abundances
differ between the samples.
[0009] In one embodiment, this invention provides a method of
identifying differences in nucleic acid levels between two or more
nucleic acid samples. The method involves the steps of: (a)
providing one or more oligonucleotide arrays said arrays comprising
probe oligonucleotides attached to a surface; (b) hybridizing said
nucleic acid samples to said one or more arrays to form hybrid
duplexes between nucleic acids in said nucleic acid samples and
probe oligonucleotides in said one or more arrays that are
complementary to said nucleic acids or subsequences thereof; (c)
contacting said one or more arrays with a nucleic acid ligase; and
(d) determining differences in hybridization between said nucleic
acid samples wherein said differences in hybridization indicate
differences in said nucleic acid levels.
[0010] In another embodiment, the method of identifying differences
in nucleic acid levels between two or more nucleic acid samples
involves the steps of: (a) providing one or more oligonucleotide
arrays comprising probe oligonucleotides wherein said probe
oligonucleotides comprise a constant region and a variable region;
(b) hybridizing said nucleic acid samples to said one or more
arrays to form hybrid duplexes between nucleic acids in said
nucleic acid samples and said variable regions that are
complementary to said nucleic acids or subsequences thereof; and
(c) determining differences in hybridization between said nucleic
acid samples wherein said differences in hybridization indicate
differences in said nucleic acid levels.
[0011] In yet another embodiment, the method of identifying
differences in nucleic acid levels between two or more nucleic acid
samples involves the steps of: (a) providing one or more high
density oligonucleotide arrays; (b) hybridizing said nucleic acid
samples to said one or more arrays to form hybrid duplexes between
nucleic acids in said nucleic acid samples and probe
oligonucleotides in said one or more arrays that are complementary
to said nucleic acids or subsequences thereof; and (c) determining
the differences in hybridization between said nucleic acid samples
wherein said differences in hybridization indicate differences in
said nucleic acid levels.
[0012] In still yet another embodiment, the method of identifying
differences in nucleic acid levels between two or more nucleic acid
samples involves the steps of: (a) providing one or more
oligonucleotide arrays each comprising probe oligonucleotides
wherein said probe oligonucleotides are not chosen to hybridize to
nucleic acids derived from particular preselected genes or mRNAs;
(b) hybridizing said nucleic acid samples to said one or more
arrays to form hybrid duplexes between nucleic acids in said
nucleic acid samples and probe oligonucleotides in said one or more
arrays that are complementary to said nucleic acids or subsequences
thereof; and (d) determining differences in hybridization between
said nucleic acid samples wherein said differences in hybridization
indicate differences in said nucleic acid levels.
[0013] In another embodiment, the methods of identifying
differences in nucleic acid levels between two or more nucleic acid
samples involves the steps of: (a) providing one or more
oligonucleotide arrays each comprising probe oligonucleotides
wherein said probe oligonucleotides comprise a nucleotide sequences
or subsequences selected according to a process selected from the
group consisting of a random selection, a haphazard selection, a
nucleotide composition biased selection, and all possible
oligonucleotides of a preselected length; (b) hybridizing said
nucleic acid samples to said one or more arrays to form hybrid
duplexes between nucleic acids in said nucleic acid samples and
probe oligonucleotides in said one or more arrays that are
complementary to said nucleic acids or subsequences thereof; and
(c) determining differences in hybridization between said nucleic
acid samples wherein said differences in hybridization indicate
differences in said nucleic acid levels.
[0014] In another embodiment, the methods of identifying
differences in nucleic acid levels between two or more nucleic acid
samples involve the steps of: (a) providing one or more
oligonucleotide arrays each comprising probe oligonucleotides
wherein said probe oligonucleotides comprise a nucleotide sequence
or subsequences selected according to a process selected from the
group consisting of a random selection, a haphazard selection, a
nucleotide composition biased selection, and all possible
oligonucleotides of a preselected length; (b) providing software
describing the location and sequence of probe oligonucleotides on
said array; (c) hybridizing said nucleic acid samples to said one
or more arrays to form hybrid duplexes between nucleic acids in
said nucleic acid samples and probe oligonucleotides in said one or
more arrays that are complementary to said nucleic acids or
subsequences thereof; and (d) operating said software such that
said hybridizing indicates differences in said nucleic acid
levels.
[0015] This invention also provides methods of simultaneously
monitoring the expression of a multiplicity of genes. In one
embodiment these methods involve (a) providing a pool of target
nucleic acids comprising RNA transcripts of one or more of said
genes, or nucleic acids derived from said RNA transcripts; (b)
hybridizing said pool of nucleic acids to an oligonucleotide array
comprising probe oligonucleotides immobilized on a surface; (c)
contacting said oligonucleotide array with a ligase; and (d)
quantifying the hybridization of said nucleic acids to said array
wherein said quantifying provides a measure of the levels of
transcription of said genes.
[0016] Still yet another method of identifying differences in
nucleic acid levels between two or more nucleic acid samples
involves the steps of: (a) providing one or more arrays of
oligonucleotides each array comprising pairs of probe
oligonucleotides where the members of each pair of probe
oligonucleotides differ from each other in preselected nucleotides;
(b) hybridizing said nucleic acid samples to said one or more
arrays to form hybrid duplexes between nucleic acids in said
nucleic acid samples and probe oligonucleotides in said one or more
arrays that are complementary to said nucleic acids or subsequences
thereof; (c) determining the differences in hybridization between
said nucleic acid samples wherein said differences in hybridization
indicate differences in said nucleic acid levels.
[0017] Another method of simultaneously monitoring the expression
of a multiplicity of genes, involves the steps of: (a) providing
one or more oligonucleotide arrays comprising probe
oligonucleotides wherein said probe oligonucleotides comprise a
constant region and a variable region; (b) providing a pool of
target nucleic acids comprising RNA transcripts of one or more of
said genes, or nucleic acids derived from said RNA transcripts; (c)
hybridizing said pool of nucleic acids to an array of
oligonucleotide probes immobilized on a surface; and (d)
quantifying the hybridization of said nucleic acids to said array
wherein said quantifying provides a measure of the levels of
transcription of said genes.
[0018] This invention additionally provides methods of making a
nucleic acid array for identifying differences in nucleic acid
levels between two or more nucleic acid samples. In one embodiment
the method involves the steps of: (a) providing an oligonucleotide
array comprising probe oligonucleotides wherein said probe
oligonucleotides comprise a constant region and a variable region;
(b) hybridizing one or more of said nucleic acid samples to said
arrays to form hybrid duplexes of said variable region and nucleic
acids in said nucleic acid samples comprising subsequences
complementary to said variable region; (c) attaching the sample
nucleic acids comprising said hybrid duplexes to said array of
probe oligonucleotides; and (d) removing unattached nucleic acids
to provide a high density oligonucleotide array bearing sample
nucleic acids attached to said array.
[0019] In another embodiment the method of making a nucleic acid
array for identifying differences in nucleic acid levels between
two or more nucleic acid samples, involves the steps of: (a)
providing a high density array; (b) contacting said array one or
more of said two or more nucleic acid samples whereby nucleic acids
of said one of said two or more nucleic acid samples form hybrid
duplexes with probe oligonucleotides in said arrays; (c) attaching
the sample nucleic acids comprising said hybrid duplexes to said
array of probe oligonucleotides; and (d) removing unattached
nucleic acids to provide a high density oligonucleotide array
bearing sample nucleic acids attached to said array.
[0020] This invention additionally provides kits for practice of
the methods described herein. One kit comprises a container
containing one or more oligonucleotide arrays said arrays
comprising probe oligonucleotides attached to a surface; and a
container containing a ligase. Another kit comprises a container
containing one or more oligonucleotide arrays said arrays
comprising probe oligonucleotides wherein said probe
oligonucleotides comprise a constant region and a variable region.
This kit optionally includes a constant oligonucletide
complementary to said constant region or a subsequence thereof.
[0021] Preferred high density oligonucleotide arrays of this
invention comprise more than 100 different probe oligonucleotides
wherein: each different probe oligonucleotide is localized in a
predetermined region of the array; each different probe
oligonucleotide is attached to a surface through a terminal
covalent bond; and the density of said probe different
oligonucleotides is greater than about 60 different
oligonucleotides per 1 cm.sup.2. The high density arrays can be
used in all of the array-based methods discussed herein. High
density arrays used for expressio monitoring will typically include
oligonucleotide probes selected to be complementary to a nucleic
acid derived from one or more preselected genes. In contrast,
generic difference screening arrays may contain probe
oligonucleotides selected randomly, haphazardly, arbitrarily, or
including sequences or subsequences comprising all possible nucleic
acid sequences of a particular (preselected) length.
[0022] In a preferred embodiment, pools of oligonucleotides or
oligonucleotide subsequences comprising all possible nucleic acids
of a particular length are selected from the group consisting of
all possible 6 mers, all possible 7 mers, all possible 8 mers, all
possible 9 mers, all possible 10 mers, all possible 11 mers, and
all possible 12 mers.
[0023] This invention also provides methods of labeling a nucleic
acid. In one embodiment, this method involves the steps of: (a)
providing a nucleic acid; (b) amplifying said nucleic acid to form
amplicons; (c) fragmenting said amplicons to form fragments of said
amplicons; and (d) coupling a labeled moiety to at least one of
said fragments.
[0024] In another embodiment, the methods involve the steps of: (a)
providing a nucleic acid; (b) transcribing said nucleic acid to
formed a transcribed nucleic acid; (c) fragmenting said transcribed
nucleic acid to form fragments of said transcribed nucleic acid;
and (d) coupling a labeled moiety to at least one of said
fragments.
[0025] In yet another embodiment, the methods involve the steps of:
(a) providing at least one nucleic acid coupled to a support; (b)
providing a labeled moiety capable of being coupled with a terminal
transferase to said nucleic acid; (c) providing said terminal
transferase; and (d) coupling said labeled moiety to said nucleic
acid using said terminal transferase.
[0026] In still another embodiment, the methods involve the steps
of: (a) providing at least two nucleic acids coupled to a support;
(b) increasing the number of monomer units of said nucleic acids to
form a common nucleic acid tail on said at least two nucleic acids;
(c) providing a labeled moiety capable of recognizing said common
nucleic acid tails; and (d) contacting said common nucleic acid
tails and said labeled moiety.
[0027] In still yet another embodiment, the methods involve the
steps of: (a) providing at least one nucleic acid coupled to a
support; (b) providing a labeled moiety capable of being coupled
with a ligase to said nucleic acid; (c) providing said ligase; and
(d) coupling said labeled moiety to said nucleic acid using said
ligase.
[0028] This invention also provides compounds of the formulas
described herein.
[0029] Definitions.
[0030] An array of oligonucleotides as used herein refers to a
multiplicity of different (sequence) oligonucleotides attached
(preferably through a single terminal covalent bond) to one or more
solid supports where, when there is a multiplicity of supports,
each support bears a multiplicity of oligonucleotides. The term
"array" can refer to the entire collection of oligonucleotides on
the support(s) or to a subset thereof. The term "same array" when
used to refer to two or more arrays is used to mean arrays that
have substantially the same oligonucleotide species thereon in
substantially the same abundances. The spatial distribution of the
oligonucleotide species may differ between the two arrays, but, in
a preferred embodiment, it is substantially the same. It is
recognized that even where two arrays are designed and synthesized
to be identical there are variations in the abundance, composition,
and distribution of oligonucleotide probes. These variations are
preferably insubstantial and/or compensated for by the use of
controls as described herein.
[0031] The phrase "massively parallel screening" refers to the
simultaneous screening of at least about 100, preferably about
1000, more preferably about 10,000 and most preferably about
1,000,000 different nucleic acid hybridizations.
[0032] The terms "nucleic acid" or "nucleic acid molecule" refer to
a deoxyribonucleotide or ribonucleotide polymer in either single-
or double-stranded form, and unless otherwise limited, would
encompass known analogs of natural nucleotides that can function in
a similar manner as naturally occurring nucleotides.
[0033] An oligonucleotide is a single-stranded nucleic acid ranging
in length from 2 to about 1000 nucleotides, more typically from 2
to about 500 nucleotides in length.
[0034] As used herein a "probe" is defined as an oligonucleotide
capable of binding to a target nucleic acid of complementary
sequence through one or more types of chemical bonds, usually
through complementary base pairing, usually through hydrogen bond
formation. As used herein, an oligonucleotide probe may include
natural (i.e. A, G, C, or T) or modified bases (7-deazaguanosine,
inosine, etc.). In addition, the bases in oligonucleotide probe may
be joined by a linkage other than a phosphodiester bond, so long as
it does not interfere with hybridization. Thus, oligonucleotide
probes may be peptide nucleic acids in which the constituent bases
are joined by peptide bonds rather than phosphodiester
linkages.
[0035] The term "target nucleic acid" refers to a nucleic acid
(often derived from a biological sample and hence referred to also
as a sample nucleic acid), to which the oligonucleotide probe
specifically hybridizes. It is recognized that the target nucleic
acids can be derived from essentially any source of nucleic acids
(e.g., including, but not limited to chemical syntheses,
amplification reactions, forensic samples, etc.) It is either the
presence or absence of one or more target nucleic acids that is to
be detected, or the amount of one or more target nucleic acids that
is to be quantified. The target nucleic acid(s) that are detected
preferentially have nucleotide sequences that are complementary to
the nucleic acid sequences of the corresponding probe(s) to which
they specifically bind (hybridize). The term target nucleic acid
may refer to the specific subsequence of a larger nucleic acid to
which the probe specifically hybridizes, or to the overall sequence
(e.g., gene or mRNA) whose abundance (concentration) and/or
expression level it is desired to detect. The difference in usage
will be apparent from context.
[0036] A "ligatable oligonucleotide" or "ligatable probe" or
"ligatable oligonucleotide probe" refers to an oligonucleotide that
is capable of being ligated to another oligonucleotide by the use
of a ligase (e.g., T4 DNA ligase). The ligatable oligonucleotide is
preferably a deoxyribonucleotide. The nucleotides comprising the
ligatable oligonucleotide are preferably the "standard"
nucleotides; A, G, C, and T or U. However derivatized, modified, or
alternative nucleotides (e.g., inosine) can be present as long as
their presence does not interfere with the ligation reaction. The
ligatable probe may be labeled or otherwise modified as long as the
label does not interfere with the ligation reaction. Similarly the
internucleotide linkages can be modified as long as the
modification does not interfere with ligation. Thus, in some
instances, the ligatable oligonucleotide can be a peptide nucleic
acid.
[0037] "Subsequence" refers to a sequence of nucleic acids that
comprises a part of a longer sequence of nucleic acids.
[0038] A "wobble" refers to a degeneracy at a particular position
in an oligonucleotide. A fully degenerate or "4 way" wobble refers
to a collection of nucleic acids (e.g., oligonucleotide probes
having A, G, C, or T for DNA or A, G, C, or U for RNA at the wobble
position.) A wobble may be approximated by the replacement of the
nucleotide with inosine which will base pair with A, G, C, or T or
U. Typically oligonucleotides containing a fully degenerate wobble
produced during chemical synthesis of an oligonucleotide is
prepared by using a mixture of four different nucleotide monomers
at the particular coupling step in which the wobble is to be
introduced.
[0039] The term "cross-linking" when used in reference to
cross-linking nucleic acids refers to attaching nucleic acids such
that they are not separated under typical conditions that are used
to denature complementary nucleic acid sequences. Crosslinking
preferably involves the formation of covalent linkages between the
nucleic acids. Methods of cross-linking nucleic acids are described
herein.
[0040] The phrase "coupled to a support" means bound directly or
indirectly thereto including attachment by covalent binding,
hydrogen bonding, ionic interaction, hydrophobic interaction, or
otherwise.
[0041] "Amplicons" are the products of the amplification of nucleic
acids by PCR or otherwise.
[0042] "Transcribing a nucleic acid" means the formation of a
ribonucleic acid from a deoxyribonucleic acid and the converse (the
formation of a deoxyribonucleic acid from a ribonucleic acid). A
nucleic acid can be transcribed by DNA-dependent RNA polymerase,
reverse transcriptase, or otherwise.
[0043] A labeled moiety means a moiety capable of being detected by
the various methods discussed herein or known in the art.
[0044] The term "complexity" is used here according to standard
meaning of this term as established by Britten et al. Methods of
Enzymol. 29:363 (1974). See, also Cantor and Schimmel Biophysical
Chemistry: Part III at 1228-1230 for further explanation of nucleic
acid complexity.
[0045] "Bind(s) substantially" refers to complementary
hybridization between a probe nucleic acid and a target nucleic
acid and embraces minor mismatches that can be accommodated by
reducing the stringency of the hybridization media to achieve the
desired detection of the target polynucleotide sequence.
[0046] The phrase "hybridizing specifically to", refers to the
binding, duplexing, or hybridizing of a molecule preferentially to
a particular nucleotide sequence under stringent conditions when
that sequence is present in a complex mixture (e.g., total
cellular) DNA or RNA. The term "stringent conditions" refers to
conditions under which a probe will hybridize preferrentially to
its target subsequence, and to a lesser extent to, or not at all
to, other sequences. Stringent conditions are sequence-dependent
and will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. Generally, stringent
conditions are selected to be about 5.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength and pH. The T.sub.m is the temperature
(under defined ionic strength, pH, and nucleic acid concentration)
at which 50% of the probes complementary to the target sequence
hybridize to the target sequence at equilibrium. (As the target
sequences are generally present in excess, at T.sub.m, 50% of the
probes are occupied at equilibrium). Typically, stringent
conditions will be those in which the salt concentration is at
least about 0.01 to 1.0 M Na ion concentration (or other salts) at
pH 7.0 to 8.3 and the temperature is at least about 30.degree. C.
for short probes (e.g., 10 to 50 nucleotides). Stringent conditions
may also be achieved with the addition of destabilizing agents such
as formamide.
[0047] The term "perfect match probe" refers to a probe that has a
sequence that is perfectly complementary to a particular target
sequence. The test probe is typically perfectly complementary to a
portion (subsequence) of the target sequence. The perfect match
(PM) probe can be a "test probe", a "normalization control" probe,
an expression level control probe and the like. A perfect match
control or perfect match probe is, however, distinguished from a
"mismatch control" or "mismatch probe." In the case of expression
monitoring arrays, perfect match probes are typically preselected
(designed) to be complementary to particular sequences or
subsequences of target nucleic acids (e.g., particular genes). In
contrast, in generic difference screening arrays, the particular
target sequences are typically unknown. In the latter case, prefect
match probes cannot be preselected. The term perfect match probe in
this context is to distinguish that probe from a corresponding
"mismatch control" that differs from the perfect match in one or
more particular preselected nucleotides as described below.
[0048] The term "mismatch control" or "mismatch probe", in
expression monitoring arrays, refers to probes whose sequence is
deliberately selected not to be perfectly complementary to a
particular target sequence. For each mismatch (MM) control in a
high-density array there preferably exists a corresponding perfect
match (PM) probe that is perfectly complementary to the same
particular target sequence. In "generic" (e.g., random, arbitrary,
haphazard, etc.) arrays, since the target nucleic acid(s) are
unknown perfect match and mismatch probes cannot be a priori
determined, designed, or selected. In this instance, the probes are
preferably provided as pairs where each pair of probes differ in
one or more preselected nucleotides. Thus, while it is not known a
priori which of the probes in the pair is the perfect match, it is
known that when one probe specifically hybridizes to a particular
target sequence, the other probe of the pair will act as a mismatch
control for that target sequence. It will be appreciated that the
perfect match and mismatch probes need not be provided as pairs,
but may be provided as larger collections (e.g., 3, 4, 5, or more)
of probes that differ from each other in particular preselected
nucleotides. While the mismatch(s) may be located anywhere in the
mismatch probe, terminal mismatches are less desirable as a
terminal mismatch is less likely to prevent hybridization of the
target sequence. In a particularly preferred embodiment, the
mismatch is located at or near the center of the probe such that
the mismatch is most likely to destabilize the duplex with the
target sequence under the test hybridization conditions. In a
particularly preferred embodiment, perfect matches differ from
mismatch controls in a single centrally-located nucleotide.
[0049] The terms "background" or "background signal intensity"
refer to hybridization signals resulting from non-specific binding,
or other interactions, between the labeled target nucleic acids and
components of the oligonucleotide array (e.g., the oligonucleotide
probes, control probes, the array substrate, etc.). Background
signals may also be produced by intrinsic fluorescence of the array
components themselves. A single background signal can be calculated
for the entire array, or a different background signal may be
calculated for each region of the array. In a preferred embodiment,
background is calculated as the average hybridization signal
intensity for the lowest 1% to 10% of the probes in the array, or
region of the array. In expression monitoring arrays (i.e., where
probes are preselected to hybridize to specific nucleic acids
(genes)), a different background signal may be calculated for each
target nucleic acid. Where a different background signal is
calculated for each target gene, the background signal is
calculated for the lowest 1% to 10% of the probes for each gene. Of
course, one of skill in the art will appreciate that where the
probes to a particular gene hybridize well and thus appear to be
specifically binding to a target sequence, they should not be used
in a background signal calculation. Alternatively, background may
be calculated as the average hybridization signal intensity
produced by hybridization to probes that are not complementary to
any sequence found in the sample (e.g. probes directed to nucleic
acids of the opposite sense or to genes not found in the sample
such as bacterial genes where the sample is of mammalian origin).
Background can also be calculated as the average signal intensity
produced by regions of the array that lack any probes at all.
[0050] The term "quantifying" when used in the context of
quantifying nucleic acid abundances or concentrations (e.g.,
transcription levels of a gene) can refer to absolute or to
relative quantification. Absolute quantification may be
accomplished by inclusion of known concentration(s) of one or more
target nucleic acids (e.g. control nucleic acids such as BioB or
with known amounts the target nucleic acids themselves) and
referencing the hybridization intensity of unknowns with the known
target nucleic acids (e.g. through generation of a standard curve).
Alternatively, relative quantification can be accomplished by
comparison of hybridization signals between two or more genes, or
between two or more treatments to quantify the changes in
hybridization intensity and, by implication, transcription
level.
[0051] The "percentage of sequence identity" or "sequence identity"
is determined by comparing two optimally aligned sequences or
subsequences over a comparison window or span, wherein the portion
of the polynucleotide sequence in the comparison window may
optionally comprise additions or deletions (i.e., gaps) as compared
to the reference sequence (which does not comprise additions or
deletions) for optimal alignment of the two sequences. The
percentage is calculated by determining the number of positions at
which the identical subunit (e.g. nucleic acid base or amino acid
residue) occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison and multiplying the
result by 100 to yield the percentage of sequence identity.
Percentage sequence identity when calculated using the programs GAP
or BESTFIT (see below) is calculated using default gap weights.
[0052] Methods of alignment of sequences for comparison are well
known in the art. Optimal alignment of sequences for comparison may
be conducted by the local homology algorithm of Smith and Waterman,
Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm
of Needleman and Wunsch J. Mol. Biol. 48: 443 (1970), by the search
for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci.
USA 85: 2444 (1988), by computerized implementations of these
algorithms (including, but not limited to CLUSTAL in the PC/Gene
program by Intelligenetics, Moutain View, Calif., GAP, BESTFIT,
FASTA, and TFASTA in the Wisconsin Genetics Software Package,
Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.,
USA), or by inspection. In particular, methods for aligning
sequences using the CLUSTAL program are well described by Higgins
and Sharp in Gene, 73: 237-244 (1988) and in CABIOS 5: 151-153
(1989)).
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] FIG. 1 shows a schematic of expression monitoring using
oligonucleotide arrays. Extracted poly (A).sup.+ RNA is converted
to cDNA, which is then transcribed in the presence of labeled
ribonucleotide triphosphates. L is either biotin or a dye such as
fluorescein. RNA is fragmented with heat in the presence of
magnesium ions. Hybridizations are carried out in a flow cell that
contains the two-dimensional DNA probe arrays. Following a brief
washing step to remove unhybridized RNA, the arrays are scanned
using a scanning confocal microscope. Alternatives in which
cellular mRNA is directly labeled without a cDNA intermediate are
described in the Examples. Image analysis software converts the
scanned array images into text files in which the observed
intensities at specific physical locations are associated with
particular probe sequences.
[0054] FIG. 2A shows a fluorescent image of a high density array
containing over 16,000 different oligonucleotide probes. The image
was obtained following hybridization (15 hours at 40.degree. C.) of
biotin-labeled randomly fragmented sense RNA transcribed from the
murine B cell (T10) cDNA library, and spiked at the level of
1:3,000 (50 pM equivalent to about 100 copies per cell) with 13
specific RNA targets. The brightness at any location is indicative
of the amount of labeled RNA hybridized to the particular
oligonucleotide probe. FIG. 2B shows a small portion of the array
(the boxed region of FIG. 2A) containing probes for IL-2 and IL-3
RNAs. For comparison, FIG. 2C shows shown the same region of the
array following hybridization with an unspiked T10 RNA samples (T10
cells do not express IL-2 and IL-3). The variation in the signal
intensity was highly reproducible and reflected the sequence
dependence of the hybridization efficiencies. The central cross and
the four corners of the array contain a control sequence that is
complementary to a biotin-labeled oligonucleotide that was added to
the hybridization solution at a constant concentration (50 pM). The
sharpness of the images near the boundaries of the features was
limited by the resolution of the reading device (11.25 .mu.m) and
not by the spatial resolution of the array synthesis. The pixels in
the border regions of each synthesis feature were systematically
ignored in the quantitative analysis of the images.
[0055] FIG. 3 provides a log/log plot of the hybridization
intensity (average of the PM-MM intensity differences for each
gene) versus concentration for 11 different RNA targets. The
hybridization signals were quantitatively related to target
concentration. The experiments were performed as described in the
Examples herein and in FIG. 2. The ten 10 cytokine RNAs (plus bioB)
were spiked into labeled T10 RNA at levels ranging from 1:300,000
to 1:3,000. The signals continued to increase with increased
concentration up to frequencies of 1:300, but the response became
sublinear at the high levels due to saturation of the probe sites,
The linear range can be extended to higher concentrations by using
shorter hybridization times. RNAs from genes expressed in T10 cells
(IL-10, .beta.-actin and GAPDH) were also detected at levels
consistent with results obtained by probing cDNA libraries.
[0056] FIG. 4 shows cytokine mRNA levels in the murine 2D6 T helper
cell line at different times following stimulation with PMA and a
calcium ionophore. Poly (A).sup.+ RNA was extracted at 0, 2, 6, and
24 hours following stimulation and converted to double stranded
cDNA containing an RNA polymerase promoter. The cDNA pool was then
transcribed in the presence of biotin labeled ribonucleotide
triphosphates, fragmented, and hybridized to the oligonucleotide
probe arrays for 2 and 22 hours. The fluorescence intensities were
converted to RNA frequencies by comparison with the signals
obtained for a bacterial RNA (biotin synthetase) spiked into the
samples at known amounts prior to hybridization. A signal of 50,000
corresponds to a frequency of approximately 1:100,000 to a
frequency of 1:5,000, and a signal of 100 to a frequency of
1:50,000. RNAs for IL-2, IL-4, IL-6, and IL-12p40 were not detected
above the level of approximately 1:200,000 in these experiments.
The error bars reflect the estimated uncertainty (25 percent) in
the level for a given RNA relative to the level for the same RNA at
a different time point. The relative uncertainty estimate was based
on the results of repeated spiking experiments, and on repeated
measurements of IL-10, .beta.-actin and GAPDH RNAs in preparations
from both T10 and 2D6 cells (unstimulated). The uncertainty in the
absolute frequencies includes message-to-message differences in the
hybridization efficiency as well as differences in the mRNA
isolation, cDNA synthesis, and RNA synthesis and labeling steps.
The uncertainty in the absolute frequencies is estimated to be a
factor of three.
[0057] FIG. 5 shows a fluorescence image of an array containing
over 63,000 different oligonucleotide probes for 118 genes. The
image was obtained following overnight hybridization of a labeled
murine B cell RNA sample. Each square synthesis region is
50.times.50 .mu.m and contains 107 to 108 copies of a specific
oligonucleotide. The array was scanned at a resolution of 7.5 .mu.m
in approximately 15 minutes. The bright rows indicate RNAs present
at high levels. Lower level RNAs were unambiguously detected based
on quantitative evaluation of the hybridization patterns. A total
of 21 murine RNAs were detected at levels ranging from
approximately 1:300,000 to 1:100. The cross in the center, the
checkerboard in the corners, and the MUR-I region at the top
contain probes complementary to a labeled control oligonucleotide
that was added to all samples.
[0058] FIG. 6 shows an example of a computer system used to execute
the software of an embodiment of the present invention.
[0059] FIG. 7 shows a system block diagram of a typical computer
system used to execute the software of an embodiment of the present
invention.
[0060] FIG. 8 shows the high level flow of a process of monitoring
the expression of a gene by comparing hybridization intensities of
pairs of perfect match and mismatch probes.
[0061] FIG. 9 shows the flow of a process of determining if a gene
is expressed utilizing a decision matrix.
[0062] FIGS. 10A and 10B show the flow of a process of determining
the expression of a gene by comparing baseline scan data and
experimental scan data.
[0063] FIG. 11 shows the flow of a process of increasing the number
of probes for monitoring the expression of genes after the number
of probes has been reduced or pruned.
[0064] FIGS. 12a and 12b illustrate the probe
oligonucleotide/ligation reaction system. FIG. 12 generally
illustrates the various components of the probe
oligonucleotide/ligation reaction system. FIG. 12b illustrates
discrimination of non-perfectly complementary
target:oligonucleotide hybrids using the probe
oligonucleotide/ligation reaction system.
[0065] FIGS. 13a, 13b, 13c, and 13d illustrate the various
components of ligation/hybridization reactions and illustrates
various ligation strategies. FIG. 13a illustrates various
components of the ligation/hybridization reaction some of which are
optional in various embodiments. FIG. 13b illustrates a ligatiion
strateby that discriminates mismatches at the terminus of the probe
oligonucleotide. FIG. 13c illustrates a ligation strategy that
discriminates mismatches at the terminus of the sample
oligonucleotide. FIG. 13d illustrates a method for improving the
discrimination at both the probe terminus and the sample
terminus.
[0066] FIGS. 14a, 14b, 14c, and 14d illustrates a ligation
discrimination used in conjunction with a restriction digest of the
sample nucleic acid. FIG. 14a shows the recognition site and
cleavage pattern of SacI (a 6 cutter) and Hsp92 II (4 cutter). FIG.
14b illustrates the effect of SacI cleavage on a (target) nucleic
acid sample. FIG. 14c illustrates a 6 Mb genome (i.e., E. coli)
digested with SacI and SphI generating .about.1 kb genomic
fragments with a 5.degree. C. FIG. 14d illustrates the
hybridization/ligation of these fragments to a generic difference
screening chip and their subsequent use as probes to hybridize to
the appropriate ncuelic acid (Format I) or the fragments are
labeled, hybridized/ligated to the oligonucletide aray and directly
analyzed (Format II).
[0067] FIGS. 15a, 15b, 15c, 15d, and 15e illustrate the analysis of
differntial diaplay DNA fragments on a generic difference screenign
array. FIG. 15a shows first strand cDNA synthesis by reverse
transcripton of poly(a) mRNA using an anchored poly(T) primer. FIG.
15b illustrates upstream primers for PCR reaction containing an
engineered restriction site and degenerate bases (N=A,G,C,T) at the
3' end. FIG. 15c shows randomly primed PCR of first strand cDNA.
FIG. 15d shows restriction digest of PCR products, and FIG. 15e
shows sorting of PCR products on a generic gligation array by their
5'end.
[0068] FIGS. 16a, 16b, and 16c illustrate the differences between
replicate 1 and replicate 2 for sample 1 and sample 2 nucleic
acids. FIG. 16a shows the differences between replicate 1 and
replicate 2 for sample 1, the normal cell line. FIG. 16b shows the
differences between replicate 1 and replicate 2 for sample 2, the
tumor cell line). FIG. 16c plots the differences between sample 1
and 2 averaged over the two replicates.
[0069] FIGS. 17a, 17b, and 17c illustrates the data of FIGS. 16A,
16b, and 16c filtered. FIG. 17a shows the relative change in
hybridization intensities of replicate 1 and 2 of sample 1 for the
difference of each oligonucleotide pair. FIG. 17b shows the ratio
of replicate 1 and 2 of sample 2 for the difference of each
oligoncleotide pair, normalized, filtered, and plotted the same way
as in FIG. 17A. FIG. 17c shows the ratio of sample 1 and sample 2
averaged over two replicates for the difference of each
oligonucleotide pair. The ratio is calculated as in FIG. 17A, but
based on the absolute value of [(X.sub.21k1+X.sub.22k2)/2]/-
[(X.sub.11k1+X.sub.12k2)/2] and
[(X.sub.11k1+X.sub.11k2)/2]/[(X.sub.21k1+X- .sub.11k2)/2] after
normalization as in FIG. 16c.
[0070] FIG. 18 illustrates post-fragmentation labeling using a CIAP
treatment.
[0071] FIG. 19 provides a schematic illustration of
pos-hebridization end labeling on a high density oligonucleotide
array.
[0072] FIG. 20 provides a schematic illustration end-labeling
utilizing pre-reaction of a high density array prior to
hybridization and end labeling.
[0073] FIG. 21 illustrates the results of a measure of
post-hybridization TdTase end labeling call accuracy.
[0074] FIG. 22 illustrates oligo dT labeling on a high density
oligonucleotide array.
[0075] FIG. 23 illustrates various labeling reagents suitable for
use in the methods disclosed herein. FIG. 23a shows various
labeling reagents. FIG. 23b shows still other labeling reagents.
FIG. 23c shows non-ribose or non-2'-deoxyribose-containing labels.
FIG. 23d shows sugar-modified nucleotide analogue labels 23d.
[0076] FIG. 24 illustrates resequencing of a target DNA molecule
with a set of generic n-mer tiling probes.
[0077] FIG. 25 illustrates four tiling arrrays present on a 4-mer
generic array.
[0078] FIG. 26 illustrates base calling at the 8th position in the
target.
[0079] FIG. 27 illustrates a base vote table.
[0080] FIG. 28 illustrates the effect of applying correctness score
transform to HIV data.
[0081] FIG. 29 illustrates mutation detection by intensity
comparisons.
[0082] FIG. 30 illustrates bubble formation detection of mutation
in the HIV genome.
[0083] FIG. 31 illustrates induced difference nearest neighbor
probe scoring.
[0084] FIG. 32 illustrates mutations found in an HIV PCR target (B)
using a generic ligation GeneChip.TM. and induced difference
analysis.
[0085] FIG. 33 illustrates mutation detection using comparisons
between a reference target and a sample target.
DETAILED DESCRIPTION
[0086] I. Expression Monitoring and Generic Difference
Screening.
[0087] This invention provides methods of expression monitoring and
generic difference screening. The term expression monitoring is
used to refer to the determination of levels of expression of
particular, typically preselected, genes. In a preferred
embodiment, the expression monitoring methods of this invention
utilize high density arrays of oligonucleotides selected to be
complementary to predetermined subsequences of the gene or genes
whose expression levels are to be detected. Nucleic acid samples
are hybridized to the arrays and the resulting hybridization signal
provides an indication of the level of expression of each gene of
interest. Because of the high degree of probe redundancy (typically
there are multiple probes per gene) the expression monitoring
methods provide an essentially accurate absolute measurement and do
not require comparison to a reference nucleic acid.
[0088] In another embodiment, this invention provides generic
difference screening methods, that identify differences in the
abundance (concentration) of particular nucleic acids in two or
more nucleic acid samples. The generic difference screening methods
involve hybridizing two or more nucleic acid samples to the same
array high density oligonucleotide array, or to different high
density oligonucleotide arrays having the same oligonucleotide
probe composition, and optionally the same oligonucleotide spatial
distribution. The resulting hybridizations are then compared
allowing determination which nucleic acids differ in abundance
(concentration) between the two or more samples.
[0089] Where the concentrations of the nucleic acids comprising the
samples reflects transcription levels genes in a sample from which
the nucleic acids are derived, the generic difference screening
methods permit identification of differences in transcription (and
by implication in expression) of the nucleic acids comprising the
two or more samples. The differentially (e.g., over- or under)
expressed nucleic acids thus identified can be used (e.g., as
probes) to determine and/or isolate those genes whose expression
levels differs between the two or more samples.
[0090] The generic difference screening methods are advantageous in
that, in contrast to the expression monitoring methods, they
require no a priori assumptions about the probe oligonucleotide
composition of the array. To the contrary, the sequences of the
probe oligonucleotides may be random, haphazard, or any arbitrary
subset of oligonucleotide probes. Where the oligonucleotide probes
are short enough (e.g., less than or equal to a 12 mer) the array
may contain every possible nucleic acid of that length. Despite the
fact that the generic difference screening arrays might be
arbitrary or random, since the sequence of each probe in the array
is known the generic difference screening methods still provide
direct sequence information regarding the differentially expressed
nucleic acids in the samples.
[0091] The expression monitoring and generic difference screening
methods of this invention involve providing an array containing a
large number (e.g. greater than 1,000) of arbitrarily selected
different oligonucleotide probes (probe oligonucleotides) where the
sequence and location in the array of each different probe is
known. Nucleic acid samples (e.g. mRNA) are hybridized to the probe
arrays and the pattern of hybridization is detected.
[0092] It is demonstrated herein and in copending applications U.S.
patent Ser. No. 08/529,115 filed on Sep. 15, 1995 and
PCT/US96/14839 that hybridization with high density oligonucleotide
probe arrays provides an effective means of detecting and/or
quantifying the expression of particular nucleic acids in complex
nucleic acid populations. The expression monitoring and difference
screening methods of this invention may be used in a wide variety
of circumstances including detection of disease, identification of
differential gene expression between two samples (e.g., a
pathological as compared to a healthy sample), screening for
compositions that upregulate or downregulate the expression of
particular genes, and so forth.
[0093] In one preferred embodiment, the methods of this invention
are used to monitor the expression (transcription) levels of
nucleic acids whose expression is altered in a disease state. For
example, a cancer may be characterized by the overexpression of a
particular marker such as the HER2 (c-erbB-2/neu) proto-oncogene in
the case of breast cancer. Similarly, overexpression of receptor
tyrosine kinases (RTKs) is associated with the etiology of a number
of tumors including carcinomas of the breast, liver, bladder,
pancreas, as well as glioblastomas, sarcomas and squamous
carcinomas (see Carpenter, Ann. Rev. Biochem., 56: 881-914 (1987)).
Conversely, a cancer (e.g., colerectal, lung and breast) may be
characterized by the mutation of or underexpression of a tumor
suppressor gene such as P53 (see, e.g., Tominaga et al. Critical
Rev. in Oncogenesis, 3: 257-282 (1992)).
[0094] Where the particular genes of interest are known, the high
density arrays will preferably contain probe oligonucleotides
selected to be complementary to the sequences or subsequences of
those genes of interest. High probe redundancy for each gene of
interest can be achieved and absolute expression levels of each
gene can be determined.
[0095] Conversely, where it is unknown which genes differ in
expression between the healthy and disease state the generic
difference screening methods of this invention are particularly
appropriate. Hybridization of the healthy and pathological nucleic
acids to the generic difference screening arrays disclosed herein
and comparison of the hybridization patterns identifies those genes
whose regulation is altered in the pathological state.
[0096] Similarly, the expression monitoring and generic difference
screening methods of this invention can be used to monitor
expression of various genes in response to defined stimuli, such as
a drug, cell activation, etc. The methods are particularly
advantageous because they permit simultaneous monitoring of the
expression of large numbers of genes. This is especially useful in
drug research if the end point description is a complex one, not
simply asking if one particular gene is overexpressed or
underexpressed. Thus, where a disease state or the mode of action
of a drug is not well characterized, the methods of this invention
allow rapid determination of the particularly relevant genes.
Again, where the gene of interest is known or suspected, expression
monitoring methods will preferably be used, while generic screening
methods will be used when the particular genes of interest are
unknown.
[0097] Using the generic difference screening methods disclosed
herein, lack of knowledge regarding the particular genes does not
prevent identification of useful therapeutics. For example, if the
hybridization pattern on a particular high density array for a
healthy cell is known and significantly different from the pattern
for a diseased cell, then libraries of compounds can be screened
for those that cause the pattern for a diseased cell to become like
that for the healthy cell. This provides a very detailed measure of
the cellular response to a drug.
[0098] Generic difference screening methods thus provide a powerful
tool for gene discovery and for elucidating mechanisms underlying
complex cellular responses to various stimuli. For example, in one
embodiment, generic difference screening can be used for
"expression fingerprinting". Suppose it is found that the mRNA from
a certain cell type displays a distinct overall hybridization
pattern that is different under different conditions (e.g. when
harboring mutations in particular genes, in a disease state). Then
this pattern of expression (an expression fingerprint), if
reproducible and clearly differentiable in the different cases can
be used as a very detailed diagnostic. It is not even required that
the pattern be fully interpretable, but just that it is specific
for a particular cell state (and preferably of diagnostic and/or
prognostic relevance).
[0099] Both expression monitoring methods and generic difference
screening may also be used in drug safety studies. For example, if
one is making a new antibiotic, then it should not significantly
affect the expression profile for mammalian cells. The
hybridization pattern could be used as a detailed measure of the
effect of a drug on cells. In other words, as a toxicological
screen.
[0100] The expression monitoring and generic difference screening
methods of this invention are particularly well suited for gene
discovery. For example, as explained above, the generic difference
screening methods identify differences in abundances of nucleic
acids in two or more samples. These differences may indicate
changes in the expression levels of previously unknown genes. The
sequence information provided by a difference screening array can
be utilized, as described herein, to identify the unknown gene.
[0101] The expression monitoring methods can be used in gene
discovery by exploiting the fact that many genes that have been
discovered to date have been classified into families based on
commonality of the sequences. Because of the extremely large number
of probes it is possible to place in the high density array, it is
possible to include oligonucleotide probes representing known or
parts of known members from every gene class. In utilizing such a
"chip" (high density array) genes that are already known would give
a positive signal at loci containing both variable and common
regions. For unknown genes, only the common regions of the gene
family would give a positive signal. The result would indicate the
possibility of a newly discovered gene.
[0102] The expression monitoring and generic difference screening
methods of this invention thus also allow the development of
"dynamic" gene databases. The Human Genome Project and commercial
sequencing projects have generated large static databases which
list thousands of sequences without regard to function or genetic
interaction. Analyses using the methods of this invention produces
"dynamic" databases that define a gene's function and its
interactions with other genes. Without the ability to monitor the
expression of large numbers of genes simultaneously, or the abilito
to detect differences in abundances of large numbers of "unknown"
nucleic acids simultaneously, the work of creating such a database
is enormous.
[0103] The tedious nature of using DNA sequence analysis for
determining an expression pattern involves preparing a cDNA library
from the RNA isolated from the cells of interest and then
sequencing the library. As the DNA is sequenced, the operator lists
the sequences that are obtained and counts them. Thousands of
sequences would have to be determined and then the frequency of
those gene sequences would define the expression pattern of genes
for the cells being studied.
[0104] By contrast, using an expression monitoring, or generic
difference screening, array to obtain the data according to the
methods of this invention is relatively fast and easy. For example
to in one embodiment, cells may be stimulated to induce expression.
The RNA is obtained from the cells and then either labeled directly
or a cDNA copy is created. Fluorescent molecules may be
incorporated during the DNA polymerization. Either the labeled RNA
or the labeled cDNA is then hybridized to a high density array in
one overnight experiment. The hybridization provides a quantitative
assessment of the levels of every single one of the hybridized
nucleic acids with no additional sequencing. In addition the
methods of this invention are much more sensitive allowing a few
copies of expressed genes per cell to be detected. This procedure
is demonstrated in the examples provided herein. These uses of the
methods of this invention are intended to be illustrative and in no
manner limiting.
[0105] II. High Density Arrays for Generic Difference Screening and
Expression Monitoring.
[0106] As indicated above, this invention provides methods of
monitoring (detecting and/or quantifying) the expression levels of
a large number of nucleic acids and/or determining differences in
nucleic acid concentrations (abundances) between two or more
samples. The methods involve hybridization of one or more a nucleic
acid samples (target nucleic acids) to one or more high density
arrays of nucleic acid probes and then quantifying the amount of
target nucleic acids hybridized to each probe in the array.
[0107] While nucleic acid hybridization has been used for some time
to determine the expression levels of various genes (e.g., Northern
Blot), it was a surprising discovery of this invention that high
density arrays are suitable for the quantification of the small
variations in abundance (e.g., transcription and, by implication,
expression) of a nucleic acid (e.g., gene) in the presence of a
large population of heterogenous nucleic acids. The signal (e.g.,
particular gene or gene product, or differentially abundant nucleic
acid) may be present at a concentration of less than about 1 in
1,000, and is often present at a concentration less than 1 in
10,000 more preferably less than about 1 in 50,000 and most
preferably less than about 1 in 100,000, 1 in 300,000, or even 1 in
1,000,000.
[0108] The oligonucleotide arrays can have oligonucleotides as
short as 10 nucleotides, more preferably 15 oligonucleotides and
most preferably 20 or 25 oligonucleotides are used to specifically
detect and quantify nucleic acid expression levels. Where ligation
discrimination methods are used, the oligonculeotide arrays can
contain shorter oligonucleotides. In this instance, oligonucleotide
arrays comprising oligonucleotides ranging in length from 6 to 15
nucleotides, more preferably from about 8 to about 12 nucleotides
in length are preferred. Of course arrays containing longer
oligonucleotides, as described herein, are also suitable.
[0109] The expression monitoring arrays, which are designed to
detect particular preselected genes, provide for simultaneous
monitoring of at least about 10, preferably at least about 100,
more preferably at least about 1000, still more preferably at least
about 10,000, and most preferably at least about 100,000 different
genes.
[0110] A) Advantages of Oligonucleotide Arrays.
[0111] In one preferred embodiment, the high density arrays used in
the methods of this invention comprise chemically synthesized
oligonucleotides. The use of chemically synthesized oligonucleotide
arrays, as opposed to, for example, blotted arrays of genomic
clones, restriction fragments, oligonucleotides, and the like,
offers numerous advantages. These advantages generally fall into
four categories:
[0112] 1) Efficiency of production;
[0113] 2) Reduced intra- and inter-array variability;
[0114] 3) Increased information content; and
[0115] 4) Improved signal to noise ratio.
[0116] I) Efficiency of Production.
[0117] In a preferred embodiment, the arrays are synthesized using
methods of spatially addressed parallel synthesis (see, e.g.,
Section V, below). The oligonucleotides are synthesized chemically
in a highly parallel fashion covalently attached to the array
surface. This allows extremely efficient array production. For
example, arrays containing any collection of tens (or even
hundreds) of thousands of specifically selected 20 mer
oligonucleotides are synthesized in fewer than 80 synthesis cycles.
The arrays are designed and synthesized based on sequence
information alone. Thus, unlike blotting methods, the array
preparation requires no handling of biological materials. There is
no need for cloning steps, nucleic acid purifications or
amplifications, cataloging of clones or amplification products, and
the like. The preferred chemical synthesis of high density
oligonucleotide arrays in this invention is thus more efficient
than blotting methods and permits the production of highly
reproducible high-density arrays.
[0118] 2) Reduced Intra- and Inter-Array Variability.
[0119] The use of chemically synthesized high-density
oligonucleotide arrays in the methods of this invention improves
intra- and inter-array variability. The oligonucleotide arrays
preferred for this invention are made in large batches (presently
49 arrays per wafer with multiple wafers synthesized in parallel)
in a highly controlled reproducible manner. This makes them
suitable as general diagnostic and research tools permitting direct
comparisons of assays performed at tifferent times and
locations.
[0120] Because of the precise control obtainable during the
chemical synthesis the arrays of this invention show less than
about 25%, preferably less than about 20%, more preferably less
than about 15%, still more preferably less than about 10%, even
more preferably less than about 5%, and most preferably less than
about 2% variation between high density arrays (within or between
production batches) having the same probe composition. Array
variation is assayed as the variation in hybridization intensity
(against a labeled control target nucleic acid mixture) in one or
more oligonucleotide probes between two or more arrays. More
preferably, array variation is assayed as the variation in
hybridization intensity (against a labeled control target nucleic
acid mixture) measured for one or more target genes between two or
more arrays.
[0121] In addition to reducing inter- and intra-array variability,
chemically synthesized arrays also reduce variations in relative
probe frequency inherent in spotting methods, particularly spotting
methods that use cell-derived nucleic acids (e.g., cDNAs). Many
genes are expressed at the level of thousands of copies per cell,
while others are expressed at only a single copy per cell. A cDNA
library will reflect this very large bias as will a cDNA library
made from this material. While normalization (adjustment of the
amount of each different probe e.g., by comparison to a reference
cDNA) of the library will reduce the representation of
over-expressed sequences to some extent, normalization has been
shown to lessen the odds of selecting highly expressed cDNAs by
only about a factor of 2 or 3. In contrast, chemical synthesis
methods can insure that all oligonucleotide probes are represented
in approximately equal concentrations. This decreases the
inter-gene (intra-array) variability and permits direct comparison
between bbybridization signals for different oligonoucleotide
probes.
[0122] 3) Increased Information Content.
[0123] i) Advantages for Expression Monitoring.
[0124] The use of high density oligonucleotide arrays for
expression monitoring provides a number of advantages not found
with other methods. For example, the use of large numbers of
different probes that specifically bind to the transcription
product of a particular target gene provides a high degree of
redundancy and internal control that permits optimization of probe
sets for effective detection of particular target genes and
minimizes the possibility of errors due to cross-reactivity with
other nucleic acid species.
[0125] Apparently suitable probes often prove ineffective for
expression monitoring by hybridization. For example, certain
subsequences of a particular target gene may be found in other
regions of the genome and probes directed to these subsequences
will cross-hybridize with the other regions and not provide a
signal that is a meaningful measure of the expression level of the
target gene. Even probes that show little cross reactivity may be
unsuitable because they generally show poor hybridization due to
the formation of structures that prevent effective hybridization.
Finally, in sets with large numbers of probes, it is difficult to
identify hybridization conditions that are optimal for all the
probes in a set. Because of the high degree of redundancy provided
by the large number of probes for each target gene, it is possible
to eliminate those probes that function poorly under a given set of
hybridization conditions and still retain enough probes to a
particular target gene to provide an extremely sensitive and
reliable measure of the expression level (transcription level) of
that gene.
[0126] In addition, the use of large numbers of different probes to
each target gene makes it possible to monitor expression of
families of closely-related nucleic acids. The probes may be
selected to hybridize both with subsequences that are conserved
across the family and with subsequences that differ in the
different nucleic acids in the family. Thus, hybridization with
such arrays permits simultaneous monitoring of the various members
of a gene family even where the various genes are approximately the
same size and have high levels of homology. Such measurements are
difficult or impossible with traditional hybridization methods.
[0127] ii) General Advantages.
[0128] Because the high density arrays contain such a large number
of probes it is possible to provide numerous controls including,
for example, controls for variations or mutations in a particular
gene, controls for overall hybridization conditions, controls for
sample preparation conditions, controls for metabolic activity of
the cell from which the nucleic acids are derived and mismatch
controls for non-specific binding or cross hybridization.
[0129] Effective detection and quantitation of gene transcription
in complex mammalian cell message populations can be determined
with relatively short oligonucleotides and with relative few (e.g.,
fewer than 40, preferably fewer than 30, more preferably fewer than
25, and most preferably fewer than 20, 15, or even 10)
oligonucleotide probes per gene. There are a large number of probes
which hybridize both strongly and specifically for each gene. This
does not mean that a large number of probes is required for
detection, but rather that there are many from which to choose and
that choices can be based on other considerations such as sequence
uniqueness (gene families), checking for splice variants, or
genotyping hot spots (things not easily done with cDNA spotting
methods).
[0130] In use, sets of four arrays for expression monitoring are
made that contain approximately 400,000 probes each. Sets of about
40 probes (20 probe pairs) are chosen that are complementary to
each of about 40,000 genes for which there are ESTs in the public
database. This set of ESTs covers roughly one-third to one-half of
all human genes and these arrays will allow the levels of all of
them to be monitored in a parallel set of overnight
hybridizations.
[0131] 4) Improved Signal to Noise Ratio.
[0132] Blotted nucleic acids sometimes rely on ionic,
electrostatic, and hydrophobic interactions to attach the blotted
nucleic acids to the substrate. Bonds are formed at multiple points
along the nucleic acid restricting degrees of freedom and
interfering with the ability of the nucleic acid to hybridize to
its complementary target. In contrast, the preferred arrays of this
invention are chemically synthesized. The oligonucleotide probes
are attached to the substrate by a single terminal covalent bond.
The probes have more degrees of freedom and are capable of
participating in complex interactions with their complementary
targets. Consequently, the probe arrays of this invention show
significantly higher hybridization efficiencies (10 times, 100
times, and even 1000 times more efficient) than blotted arrays.
Less target oligonucleotide is used to produce a given signal
thereby dramatically improving the signal to noise ratio.
Consequently the methods of this invention permit detection of only
a few copies of a nucleic acid in extremely complex nucleic acid
mixtures.
[0133] B) Preferred High Density Arrays
[0134] Preferred high density arrays of this invention comprise
greater than about 100, preferably greater than about 1000, more
preferably greater than about 16,000 and most preferably greater
than about 65,000 or 250,000 or even greater than about 1,000,000
different oligonucleotide probes. The oligonucleotide probes range
from about 5 to about 50 or about 5 to about 45 nucleotides, more
preferably from about 10 to about 40 nucleotides and most
preferably from about 15 to about 40 nucleotides in length. In
particular preferred embodiments, the oligonucleotide probes are 20
or 25 nucleotides in length, while in other preferred embodiments
(particularly where ligation discrimination reactions are used) the
oligonucleotide probes are preferably shorter (e.g., 6 to 20 more
preferably 8 to 15 nucleotides in length). It was a discovery of
this invention that relatively short oligonucleotide probes
sufficient to specifically hybridize to and distinguish target
sequences. Thus in one preferred embodiment, the oligonucleotide
probes are less than 50 nucleotides in length, generally less than
46 nucleotides, more generally less than 41 nucleotides, most
generally less than 36 nucleotides, preferably less than 31
nucleotides, more preferably less than 26 nucleotides, and most
preferably less than 21 nucleotides in length. The probes can also
be less than 16 nucleotides, less than 13 nucleotides in length,
less than 9 nucleotides in length and less than 7 nucleotides in
length. It is also recognized that the oligonucleotide probes can
be relatively long, ranging in length up to about 1000 nucleotides,
more typically up to about 500 nucleotides in length.
[0135] The location and, in some embodiments, sequence of each
different oligonucleotide probe in the array is known. Moreover,
the large number of different probes occupies a relatively small
area providing a high density array having a probe density of
generally greater than about 60, more generally greater than about
100, most generally greater than about 600, often greater than
about 1000, more often greater than about 5,000, most often greater
than about 10,000, preferably greater than about 40,000 more
preferably greater than about 100,000, and most preferably greater
than about 400,000 different oligonucleotide probes per cm.sup.2.
The small surface area of the array (often less than about 10
cm.sup.2, preferably less than about 5 cm.sup.2 more preferably
less than about 2 cm.sup.2, and most preferably less than about 1.6
cm.sup.2) permits the use of small sample volumes and extremely
uniform hybridization conditions (temperature regulation, salt
content, etc.) while the extremely large number of probes allows
massively parallel processing of hybridizations.
[0136] Finally, because of the small area occupied by the high
density arrays, hybridization may be carried out in extremely small
fluid volumes (e.g., 250 .mu.l or less, more preferably 100 .mu.l
or less, and most preferably 10 .mu.l or less). In addition,
hybridization conditions are extremely uniform throughout the
sample, and the hybridization format is amenable to automated
processing.
[0137] III. Monitoring Gene Expression and Generic Difference
Screening.
[0138] As explained above, this invention provides methods for
monitoring gene expression (expression monitoring) and for
identifying differences in abundance (concentration) of nucleic
acids in two or more nucleic acid samples (generic difference
screening). Generally the methods of monitoring gene expression of
this invention involve (1) providing a pool of target nucleic acids
comprising RNA transcript(s) of one or more target gene(s), or
nucleic acids derived from the RNA transcript(s); (2) hybridizing
the nucleic acid sample to a high density array of probes
(including control probes); and (3) detecting the hybridized
nucleic acids and calculating a relative expression (transcription)
level. These methods preferably involve the use of high density
oligonucleotide arrays containing probes to specifically
preselected genes.
[0139] In contrast, the arrays used in the generic difference
screening methods of this invention do not require that specific
target genes be identified. To the contrary, the methods are
designed to detect changes or differences in expression of various
genes where the particular gene to be identified is unknown prior
to performing the difference screening.
[0140] The methods of generic difference screening typically
involve the steps of: 1) providing one or more high density
oligonucleotide arrays (preferably including probes pairs differing
in one or more nucleotides); 2) providing two or more nucleic acid
samples; 3) hybridizing the nucleic acid samples to one or more
arrays to form hybrid duplexes between nucleic acids in the nucleic
acid samples and probe oligonucleotides in the array(s); 3)
detecting the hybridization of the nucleic acids to the arrays; and
4) determining the differences in hybridization between the nucleic
acid samples.
[0141] The provision of a nucleic acid sample, the hybridization of
the sample to the arrays, and detection of the hybridized nucleic
acid(s) is performed in essentially the same manner in expression
monitoring and in generic difference screening methods. As
disclosed herein, in preferred embodiments, the methods are
distinguished, in part, by oligonucleotide probe selection, in the
use of at least two nucleic acid samples in generic difference
screening, and in subsequent analysis.
[0142] A) Providing a Nucleic Acid Sample.
[0143] In order to measure the nucleic acid concentration in a
sample, it is desirable to provide a nucleic acid sample for such
analysis. Where it is desired that the nucleic acid concentration,
or differences in nucleic acid concentration between different
samples, reflect transcription levels or differences in
transcription levels of a gene or genes, it is desirable to provide
a nucleic acid sample comprising mRNA transcript(s) of the gene or
genes, or nucleic acids derived from the mRNA transcript(s). As
used herein, a nucleic acid derived from an mRNA transcript refers
to a nucleic acid for whose synthesis the mRNA transcript or a
subsequence thereof has ultimately served as a template. Thus, a
cDNA reverse transcribed from an mRNA, an RNA transcribed from that
cDNA, a DNA amplified from the cDNA, an RNA transcribed from the
amplified DNA, etc. are all derived from the mRNA transcript and
detection of such derived products is indicative of the presence
and/or abundance of the original transcript in a sample. Thus,
suitable samples include, but are not limited to, mRNA transcripts
of the gene or genes, cDNA reverse transcribed from the mRNA, cRNA
transcribed from the cDNA, DNA amplified from the genes, RNA
transcribed from amplified DNA, and the like.
[0144] In a particularly preferred embodiment, where it is desired
to quantify the transcription level (and thereby expression) of a
one or more genes in a sample, the nucleic acid sample is one in
which the concentration of the mRNA transcript(s) of the gene or
genes, or the concentration of the nucleic acids derived from the
mRNA transcript(s), is proportional to the transcription level (and
therefore expression level) of that gene. Similarly, it is
preferred that the hybridization signal intensity be proportional
to the amount of hybridized nucleic acid. While it is preferred
that the proportionality be relatively strict (e.g., a doubling in
transcription rate results in a doubling in mRNA transcript in the
sample nucleic acid pool and a doubling in hybridization signal),
one of skill will appreciate that the proportionality can be more
relaxed and even non-linear. Thus, for example, an assay where a 5
fold difference in concentration of the target mRNA results in a 3
to 6 fold difference in hybridization intensity is sufficient for
most purposes. Where more precise quantification is required
appropriate controls can be run to correct for variations
introduced in sample preparation and hybridization as described
herein. In addition, serial dilutions of "standard" target mRNAs
can be used to prepare calibration curves according to methods well
known to those of skill in the art. Of course, where simple
detection of the presence or absence of a transcript or large
differences of changes in nucleic acid concentration is desired, no
elaborate control or calibration is required.
[0145] In the simplest embodiment, such a nucleic acid sample is
the total mRNA or a total cDNA isolated and/or otherwise derived
from a biological sample. The term "biological sample", as used
herein, refers to a sample obtained from an organism or from
components (e.g., cells) of an organism. The sample may be of any
biological tissue or fluid. Frequently the sample will be a
"clinical sample" which is a sample derived from a patient. Such
samples include, but are not limited to, sputum, blood, blood cells
(e.g., white cells), tissue or fine needle biopsy samples, urine,
peritoneal fluid, and pleural fluid, or cells therefrom. Biological
samples may also include sections of tissues such as frozen
sections taken for histological purposes.
[0146] The nucleic acid (either genomic DNA or mRNA) may be
isolated from the sample according to any of a number of methods
well known to those of skill in the art. One of skill will
appreciate that where alterations in the copy number of a gene are
to be detected genomic DNA is preferably isolated. Conversely,
where expression levels of a gene or genes are to be detected,
preferably RNA (mRNA) is isolated.
[0147] Methods of isolating total mRNA are well known to those of
skill in the art. For example, methods of isolation and
purification of nucleic acids are described in detail in Chapter 3
of Laboratory Techniques in Biochemistry and Molecular Biology:
Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic
Acid Preparation, P. Tijssen, ed. Elsevier, N.Y. (1993) and Chapter
3 of Laboratory Techniques in Biochemistry and Molecular Biology:
Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic
Acid Preparation, P. Tijssen, ed. Elsevier, N.Y. (1993)).
[0148] In a preferred embodiment, the total nucleic acid is
isolated from a given sample using, for example, an acid
guanidinium-phenol-chloroform extraction method and polyA.sup.+
mRNA is isolated by oligo dT column chromatography or by using
(dT).sub.n magnetic beads (see, e.g., Sambrook et al., Molecular
Cloning: 4 Laboratory Manual (2nd ed.), Vols. 1-3, Cold Spring
Harbor Laboratory, (1989), or Current Protocols in Molecular
Biology, F. Ausubel et al., ed. Greene Publishing and
Wiley-Interscience, New York (1987)).
[0149] Frequently, it is desirable to amplify the nucleic acid
sample prior to hybridization. One of skill in the art will
appreciate that whatever amplification method is used, if a
quantitative result is desired, care must be taken to use a method
that maintains or controls for the relative frequencies of the
amplified nucleic acids.
[0150] Methods of "quantitative" amplification are well known to
those of skill in the art. For example, quantitative PCR involves
simultaneously co-amplifying a known quantity of a control sequence
using the same primers. This provides an internal standard that may
be used to calibrate the PCR reaction. The high density array may
then include probes specific to the internal standard for
quantification of the amplified nucleic acid.
[0151] One preferred internal standard is a synthetic AW106 cRNA.
The AW106 cRNA is combined with RNA isolated from the sample
according to standard techniques known to those of skill in the
art. The RNA is then reverse transcribed using a reverse
transcriptase to provide copy DNA. The cDNA sequences are then
amplified (e.g., by PCR) using labeled primers. The amplification
products are separated, typically by electrophoresis, and the
amount of radioactivity (proportional to the amount of amplified
product) is determined. The amount of mRNA in the sample is then
calculated by comparison with the signal produced by the known
AW106 RNA standard. Detailed protocols for quantitative PCR are
provided in PCR Protocols, A Guide to Methods and Applications,
Innis et al., Academic Press, Inc. N.Y., (1990).
[0152] Other suitable amplification methods include, but are not
limited to polymerase chain reaction (PCR) (Innis, et al., PCR
Protocols. A guide to Methods and Application. Academic Press, Inc.
San Diego, (1990)), ligase chain reaction (LCR) (see Wu and
Wallace, Genomics, 4: 560 (1989), Landegren, et al., Science, 241:
1077 (1988) and Barringer, et al., Gene, 89: 117 (1990),
transcription amplification (Kwoh, et al., Proc. Natl. Acad. Sci.
USA, 86: 1173 (1989)), and self-sustained sequence replication
(Guatelli, et al., Proc. Nat. Acad. Sci. USA, 87: 1874 (1990)).
[0153] In a particularly preferred embodiment, the sample mRNA is
reverse transcribed with a reverse transcriptase and a primer
consisting of oligo dT and a sequence encoding the phage T7
promoter to provide single stranded DNA template. The second DNA
strand is polymerized using a DNA polymerase. After synthesis of
double-stranded cDNA, T7 RNA polymerase is added and RNA is
transcribed from the cDNA template. Successive rounds of
transcription from each single cDNA template results in amplified
RNA. Methods of in vitro polymerization are well known to those of
skill in the art (see, e.g., Sambrook, supra.) and this particular
method is described in detail by Van Gelder, et al., Proc. Natl.
Acad. Sci. USA, 87: 1663-1667 (1990) who demonstrate that in vitro
amplification according to this method preserves the relative
frequencies of the various RNA transcripts. Moreover, Eberwine et
al. Proc. Natl. Acad. Sci. USA, 89: 3010-3014 provide a protocol
that uses two rounds of amplification via in vitro transcription to
achieve greater than 10.sup.6 fold amplification of the original
starting material thereby permitting expression monitoring even
where biological samples are limited.
[0154] It will be appreciated by one of skill in the art that the
direct transcription method described above provides an antisense
(aRNA) pool. Where antisense RNA is used as the target nucleic
acid, the oligonucleotide probes provided in the array are chosen
to be complementary to subsequences of the antisense nucleic acids.
Conversely, where the target nucleic acid pool is a pool of sense
nucleic acids, the oligonucleotide probes are selected to be
complementary to subsequences of the sense nucleic acids. Finally,
where the nucleic acid pool is double stranded, the probes may be
of either sense as the target nucleic acids include both sense and
antisense strands.
[0155] The protocols cited above include methods of generating
pools of either sense or antisense nucleic acids. Indeed, one
approach can be used to generate either sense or antisense nucleic
acids as desired. For example, the cDNA can be directionally cloned
into a vector (e.g., Stratagene's p Bluscript II KS (+) phagemid)
such that it is flanked by the T3 and T7 promoters. In vitro
transcription with the T3 polymerase will produce RNA of one sense
(the sense depending on the orientation of the insert), while in
vitro transcription with the T7 polymerase will produce RNA having
the opposite sense. Other suitable cloning systems include phage
lambda vectors designed for Cre-loxP plasmid subcloning (see e.g.,
Palazzolo et al., Gene, 88: 25-36 (1990)).
[0156] In a particularly preferred embodiment, a high activity RNA
polymerase (e.g. about 2500 units/mL for T7, available from
Epicentre Technologies) is used.
[0157] B) Labeling Nucleic Acids.
[0158] i) Labeling Methods/Strategies.
[0159] In a preferred embodiment, the hybridized nucleic acids are
detected by detecting one or more labels attached to the sample
nucleic acids. The labels may be incorporated by any of a number of
means well known to those of skill in the art. However, in a
preferred embodiment, the label is simultaneously incorporated
during the amplification step in the preparation of the sample
nucleic acids. For example, polymerase chain reaction (PCR) with
labeled primers or labeled nucleotides will provide a labeled
amplification product. The nucleic acid (e.g., DNA) is be amplified
in the presence of labeled deoxynucleotide triphosphates (dNTPs).
The amplified nucleic acid can be fragmented, exposed to an
oligonoucleotide array, and the extent of hybridization determined
by the amount of label now associated with the array. In a
preferred embodiment, transcription amplification, as described
above, using a labeled nucleotide (e.g. fluorescein-labeled UTP
and/or CTP) incorporates a label into the transcribed nucleic
acids.
[0160] Alternatively, a label may be added directly to the original
nucleic acid sample (e.g., mRNA, polyA mRNA, cDNA, etc.) or to the
amplification product after the amplification is completed. Such
labeling can result in the increased yield of amplification
products and reduce the time required for the amplification
reaction. Means of attaching labels to nucleic acids include, for
example nick translation or end-labeling (e.g. with a labeled RNA)
by kinasing of the nucleic acid and subsequent attachment
(ligation) of a nucleic acid linker joining the sample nucleic acid
to a label (e.g., a fluorophore). End labeling is discussed in more
detail below in Section III(B)(iii).
[0161] Detectable labels suitable for use in the present invention
include any composition detectable by spectroscopic, photochemical,
biochemical, immunochemical, electrical, optical or chemical means.
Useful labels in the present invention include biotin for staining
with labeled streptavidin conjugate, magnetic beads (e.g.,
Dynabeads.TM.), fluorescent dyes (e.g., fluorescein, texas red,
rhodamine, green fluorescent protein, and the like, see, e.g.,
Molecular Probes, Eugene, Oreg., USA), radiolabels (e.g., .sup.3H,
.sup.125I, .sup.35S, .sup.14C, or .sup.32P), enzymes (e.g., horse
radish peroxidase, alkaline phosphatase and others commonly used in
an ELISA), and colorimetric labels such as colloidal gold (e.g.,
gold particles in the 40-80 nm diameter size range scatter green
light with high efficiency) or colored glass or plastic (e.g.,
polystyrene, polypropylene, latex, etc.) beads. Patents teaching
the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752;
3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.
[0162] A fluorescent label is preferred because it provides a very
strong signal with low background. It is also optically detectable
at high resolution and sensitivity through a quick scanning
procedure. The nucleic acid samples can all be labeled with a
single label, e.g., a single fluorescent label. Alternatively, in
another embodiment, different nucleic acid samples can be
simultaneously hybridized where each nucleic acid sample has a
different label. For instance, one target could have a green
fluorescent label and a second target could have a red fluorescent
label. The scanning step will distinguish cites of binding of the
red label from those binding the green fluorescent label. Each
nucleic acid sample (target nucleic acid) can be analyzed
independently from one another.
[0163] Suitable chromogens which can be employed include those
molecules and compounds which absorb light in a distinctive range
of wavelengths so that a color can be observed or, alternatively,
which emit light when irradiated with radiation of a particular
wave length or wave length range, e.g., fluorescers.
[0164] A wide variety of suitable dyes are available, being primary
chosen to provide an intense color with minimal absorption by their
surroundings. Illustrative dye types include quinoline dyes,
triarylmethane dyes, acridine dyes, alizarine dyes, phthaleins,
insect dyes, azo dyes, anthraquinoid dyes, cyanine dyes,
phenazathionium dyes, and phenazoxonium dyes.
[0165] A wide variety of fluorescers can be employed either by
alone or, alternatively, in conjunction with quencher molecules.
Fluorescers of interest fall into a variety of categories having
certain primary functionalities. These primary functionalities
include 1- and 2-aminonaphthalene, p,p'-diaminostilbenes, pyrenes,
quaternary phenanthridine salts, 9-aminoacridines,
p,p'-diaminobenzophenone imines, anthracenes, oxacarbocyanine,
marocyanine, 3-aminoequilenin, perylene, bisbenzoxazole,
bis-p-oxazolyl benzene, 1,2-benzophenazin, retinol,
bis-3-aminopyridinium salts, hellebrigenin, tetracycline,
sterophenol, benzimidzaolylphenylamine, 2-oxo-3-chromen, indole,
xanthen, 7-hydroxycoumarin, phenoxazine, salicylate,
strophanthidin, porphyrins, triarylmethanes and flavin. Individual
fluorescent compounds which have functionalities for linking or
which can be modified to incorporate such functionalities include,
e.g., dansyl chloride; fluoresceins such as
3,6-dihydroxy-9-phenylxanthhydrol; rhodamineisothiocyanate;
N-phenyl 1-amino-8-sulfonatonaphthalene; N-phenyl
2-amino-6-sulfonatonaphthalene:
4-acetamido-4-isothiocyanato-stilbene-2,2'-disulfonic acid;
pyrene-3-sulfonic acid; 2-toluidinonaphthalene-6-sulfonate;
N-phenyl, N-methyl 2-aminoaphthalene-6-sulfonate; ethidium bromide;
stebrine; auromine-0,2-(9'-anthroyl)palmitate; dansyl
phosphatidylethanolamine; N,N'-dioctadecyl oxacarbocyanine;
N,N'-dihexyl oxacarbocyanine; merocyanine, 4(3'pyrenyl)butyrate;
d-3-aminodesoxy-equilenin; 12-(9'anthroyl)stearate;
2-methylanthracene; 9-vinylanthracene;
2,2'(vinylene-p-phenylene)bisbenzoxazole;
p-bis[2-(4-methyl-5-phenyl-oxaz- olyl)]benzene;
6-dimethylamino-1,2-benzophenazin; retinol; bis(3'-aminopyridinium)
1,10-decandiyl diiodide; sulfonaphthylhydrazone of hellibrienin;
chlorotetracycline; N(7-dimethylamino-4-methyl-2-oxo-3-c-
hromenyl)maleimide; N-[p-(2-benzimidazolyl)-phenyl]maleimide;
N-(4-fluoranthyl)maleimide; bis(homovanillic acid); resazarin;
4-chloro-7-nitro-2,1,3benzooxadiazole; merocyanine 540; resorufin;
rose bengal; and 2,4-diphenyl-3(2H)-furanone.
[0166] Desirably, fluorescers should absorb light above about 300
nm, preferably about 350 nm, and more preferably above about 400
nm, usually emitting at wavelengths greater than about 10 nm higher
than the wavelength of the light absorbed. It should be noted that
the absorption and emission characteristics of the bound dye can
differ from the unbound dye. Therefore, when referring to the
various wavelength ranges and characteristics of the dyes, it is
intended to indicate the dyes as employed and not the dye which is
unconjugated and characterized in an arbitrary solvent.
[0167] Fluorescers are generally preferred because by irradiating a
fluorescer with light, one can obtain a plurality of emissions.
Thus, a single label can provide for a plurality of measurable
events.
[0168] Detectable signal can also be provided by chemiluminescent
and bioluminescent sources. Chemiluminescent sources include a
compound which becomes electronically excited by a chemical
reaction and can then emit light which serves as the detectible
signal or donates energy to a fluorescent acceptor. A diverse
number of families of compounds have been found to provide
chemiluminescence under a variety or conditions. One family of
compounds is 2,3-dihydro-1,-4-phthalazinedione. The must popular
compound is luminol, which is the 5-amino compound. Other members
of the family include the 5-amino-6,7,8-trimethoxy- and the
dimethylamino[ca]benz analog. These compounds can be made to
luminesce with alkaline hydrogen peroxide or calcium hypochlorite
and base. Another family of compounds is the
2,4,5-triphenylimidazoles, with lophine as the common name for the
parent product. Chemiluminescent analogs include para-dimethylamino
and -methoxy substituents. Chemiluminescence can also be obtained
with oxalates, usually oxalyl active esters, e.g., p-nitrophenyl
and a peroxide, e.g., hydrogen peroxide, under basic conditions.
Alternatively, luciferins can be used in conjunction with
luciferase or lucigenins to provide bioluminescence.
[0169] Spin labels are provided by reporter molecules with an
unpaired electron spin which can be detected by electron spin
resonance (ESR) spectroscopy. Exemplary spin labels include organic
free radicals, transitional metal complexes, particularly vanadium,
copper, iron, and manganese, and the like. Exemplary spin labels
include nitroxide free radicals.
[0170] The label may be added to the target (sample) nucleic
acid(s) prior to, or after the hybridization. So called "direct
labels" are detectable labels that are directly attached to or
incorporated into the target (sample) nucleic acid prior to
hybridization. In contrast, so called "indirect labels" are joined
to the hybrid duplex after hybridization. Often, the indirect label
is attached to a binding moiety that has been attached to the
target nucleic acid prior to the hybridization. Thus, for example,
the target nucleic acid may be biotinylated before the
hybridization. After hybridization, an avidin-conjugated
fluorophore will bind the biotin bearing hybrid duplexes providing
a label that is easily detected. For a detailed review of methods
of labeling nucleic acids and detecting labeled hybridized nucleic
acids see Laboratory Techniques in Biochemistry and Molecular
Biology, Vol. 24: Hybridization With Nucleic Acid Probes, P.
Tijssen, ed. Elsevier, N.Y., (1993)).
[0171] Fluorescent labels are preferred and easily added during an
in vitro transcription reaction. In a preferred embodiment,
fluorescein labeled UTP and CTP are incorporated into the RNA
produced in an in vitro transcription reaction as described
above.
[0172] The labels can be attached directly or through a linker
moiety. In general, the site of label or linker-label attachment is
not limited to any specific position. For example, a label may be
attached to a nucleoside, nucleotide, or analogue thereof at any
position that does not interefere with detection or hybridization
as desired. For example, certain Label-ON Reagents from Clontech
(Palo Alto, Calif.) provide for labeling interspersed throughout
the phosphate backbone of an oligonucleotide and for terminal
labeling at the 3' and 5' ends. As shown for example herein, labels
can be attached at positions on the ribose ring or the ribose can
be modified and even eliminated as desired. The base mioeties of
useful labeling reagents can include those that are naturally
occurring or modified in a manner that does not interfere with the
purpose to which they are put. Modified bases include but are not
limited to 7-deaza A and G, 7-deaza-8-aza A and G, and other
heterocyclic moieties.
[0173] ii. End-Labeling Nucleic Acids.
[0174] In many applications it is useful to directly label nucleic
acid samples without having to go through an amplification,
transcription or other nucleic acid conversion step. This is
especially true for monitoring of mRNA levels where one would like
to extract total cytoplasmic RNA or poly A.sup.+ RNA (mRNA) from
cells and hybridize this material without any intermediate steps
that could skew the original distribution of mRNA
concentrations.
[0175] In general, end-labeling methods permit the optimization of
the size of the nucleic acid to be labeled. End-labeling methods
also decrease the sequence bias sometimes associated with
polymerase-facilitated labeling methods. End labeling can be
performed using terminal transferase (TdT).
[0176] End labeling can also be accomplished by ligating a labeled
oligonucleotide or analog thereof to the end of a target nucleic
acid or probe. Other end-labeling methods include the creation of a
labeled or unlabeled "tail" for the nucleic acid using ligase or
terminal transferase, for example. The tailed nucleic acid is then
exposed to a labeled moiety that will preferentially associate with
the tail. The tail and the moiety that preferentially associates
with the tail can be a polymer such as a nucleic acid, peptide, or
carbohydrate. The tail and its recognition moiety can be anything
that permits recognition between the two, and includes molecules
having ligand-substrate relationships such as haptens, epitopes,
antibodies, enzymes and their substrates, and complementary nucleic
acids and analogs thereof.
[0177] The labels associated with the tail or the tail recognition
moiety include detectable moieties. When the tail and its
recognition moiety are both labeled, the respective labels
associated with each can themselves have a ligand-substrate
relationship. The respective labels can also comprise energy
transfer reagents such as dyes having different spectroscopic
characteristics. The energy transfer pair can be chosen to obtain
the desired combined spectral characteristics. For example, a first
dye that absorbs at a wavelength shorter than that absorbed by the
second dye can, upon absorption at that shorter wavelength,
transfer energy to the second dye. The second dye then emits
electromagnetic radiation at a wavelength longer than would have
been emitted by the first dye alone. Energy transfer reagents can
be particularly useful in two-color labeling schemes such as those
set forth in a copending U.S. patent application, filed Dec. 23,
1996, Attorney Docket No. 2013.2, and which is a
continuation-in-part of U.S. Ser. No. 08/529,115, filed Sep. 15,
1995, and Int'l Appln. No. WO 96/14839, filed Sep. 13, 1996, which
is also a continuation-in-part of U.S. Ser. No. 08/670,118, filed
on Jun. 25, 1996, which is a division of U.S. Ser. No. 08/168,904,
filed Dec. 15, 1993, which is a continuation of U.S. Ser. No.
07/624,114, filed Dec. 6, 1990. U.S. Ser. No. 07/624,114 is a CIP
of U.S. Ser. No. 07/362,901, filed Jun. 7, 1990, incorporated
herein by reference.
[0178] This invention thus provides methods of labeling a nucleic
acid and reagents useful therefor. Many of the methods disclsoed
herein involve end-labeling. Those skilled in the art will
appreciate that the invention as disclosed is generally applicable
in the chemical and molecular-biological arts.
[0179] In one embodiment, the method involves providing a nucleic
acid, providing a labeled oligonucleotide and enzymatically
ligating the oligonucleotide to the nucleic acid. Thus, for
example, where the nucleic acid is an RNA, a labeled
riboligonucleotide can be ligated using an RNA ligase. RNA ligase
catalyzes the covalent joining of single-stranded RNA (or DNA, but
the reaction with RNA is more efficient) with a 5' phosphate group
to the 3'-OH end of another piece of RNA (or DNA). The specific
requirements for the use of this enzyme are provided in The
Enzymes, Volume XV, Part B, T4 RNA Ligase, Uhlenbeck and
Greensport, pages 31-58; and 5.66-5.69 in Sambrook et al.,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press,
Cold Spring Harbor, N.Y. (1982).
[0180] This invention thus provides a method to add a label to the
nucleic acid (e.g. extracted RNA) directly rather than
incorporating labeled nucleotides in a nucleic acid polymerization
step. This can be accomplished by adding a short labeled
oligonucleotide to the ends of a single stranded nucleic acid. The
method more fully labels a sample; a higher percentage of available
molecules will be labeled than by conventional techniques.
[0181] RNA can be randomly fragmented with heat in the presence of
Mg.sup.2+. This generally produces RNA fragments with 5' OH groups
and phosphorylated 3' ends. A phosphate group is added to the 5'
ends of the fragments using standard protocols with T4
Polynucleotide Kinase, or similar enzyme. To the pool of
5'-phosphorylated RNA fragments is added RNA ligase plus a short
RNA oligonucleotide with a 3' OH group and a label, either at the
5' end (such as fluorescein or other dye, or biotin for later
labeling with a streptavidin conjugate, or with dioxigenin for
later labeling with a labeled antibody) or with one or more labeled
bases. A riboA.sub.6 (deoxyribonucleic acid 6 mer poly A) labeled
with either fluorescein or biotin at the 5' end provides a
particularly preferred label. In another embodiment, the ligated
RNA oligonucleotide can have rioibnuclebtides near the ligation
end, but deoxyrigonucleotides further away. Of course, the RNA
oligonucleotide can be longer or shorter and can have a virtually
any sequence. However, the ligation reaction is most efficient with
A and least efficient with U at the 3' end of the acceptor. The
reaction is allowed to proceed under standard conditions.
Unincorporated RNA 6-mers can be removed by a simple size selection
step (e.g. electrophoresis, NAP column, etc.) if necessary
following the ligation reaction.
[0182] An advantage of this procedure is that extracted mRNA can be
used directly and that each fragment should be labeled once, not
any number of times depending on the sequence as is the case when
labeled bases are incorporated during polymerization reactions.
[0183] In another embodiment, fragmented DNA can also be
end-labeled using a different procedure with a different enzyme.
Terminal transferase will add deoxynucleoside triphosphates
(dNTPs), which can be labeled, to the 3' OH ends of single stranded
DNA. Single dNTPs can be added if modified nucleotides are used
(for example, dideoxynucleotide triphosphates), or multiple bases
can be added if desired. DNA can be fragmented either physically
(shearing) or enzymatically (nucleases), or chemically (e.g. acid
hydrolysis). Following fragmentation, depending on the method, 3'
OH ends may need to be produced. The DNA fragments are then labeled
using labeled dNTPs or ddNTPs in the presence of terminal
transferase.
[0184] Various other embodiments are illustrated by the Examples
provided herein and their associated figures.
[0185] C) Modifying Sample to Improve Signal to Noise Ratio.
[0186] The nucleic acid sample may be modified prior to
hybridization to the high density probe array in order to reduce
sample complexity thereby decreasing background signal and
improving sensitivity of the measurement. In one embodiment,
complexity reduction for expression monitoring methods is achieved
by selective degradation of background mRNA. This is accomplished
by hybridizing the sample mRNA (e.g., polyA.sup.+ RNA) with a pool
of DNA oligonucleotides that hybridize specifically with the
regions to which the probes in the expression monitoring array
specifically hybridize. In a preferred embodiment, the pool of
oligonucleotides consists of the same probe oligonucleotides as
found on the high density array.
[0187] The pool of oligonucleotides hybridizes to the sample mRNA
forming a number of double stranded (hybrid duplex) nucleic acids.
The hybridized sample is then treated with RNase A, a nuclease that
specifically digests single stranded RNA. The RNase A is then
inhibited, using a protease and/or commercially available RNase
inhibitors, and the double stranded nucleic acids are then
separated from the digested single stranded RNA. This separation
may be accomplished in a number of ways well known to those of
skill in the art including, but not limited to, electrophoresis,
and gradient centrifugation. However, in a preferred embodiment,
the pool of DNA oligonucleotides is provided attached to beads
forming thereby a nucleic acid affinity column. After digestion
with the RNase A, the hybridized DNA is removed simply by
denaturing (e.g., by adding heat or increasing salt) the hybrid
duplexes and washing the previously hybridized mRNA off in an
elution buffer.
[0188] The undigested mRNA fragments which will be hybridized to
the probes in the high density array or other solid support are
then preferably end-labeled with a fluorophore attached to an RNA
linker using an RNA ligase. This procedure produces a labeled
sample RNA pool in which the nucleic acids that do not correspond
to probes in the array are eliminated and thus unavailable to
contribute to a background signal.
[0189] Another method of reducing sample complexity involves
hybridizing the mRNA with deoxyoligonucleotides that hybridize to
regions that border on either side the regions to which the high
density array probes are directed. Treatment with RNAse H
selectively digests the double stranded (hybrid duplexes) leaving a
pool of single-stranded mRNA corresponding to the short regions
(e.g., 20 mer) that were formerly bounded by the
deoxyoligonucleotide probes and which correspond to the targets of
the high density array probes and longer mRNA sequences that
correspond to regions between the targets of the probes of the high
density array. The short RNA fragments are then separated from the
long fragments (e.g., by electrophoresis), labeled if necessary as
described above, and then are ready for hybridization with the high
density probe array.
[0190] In a third approach, sample complexity reduction involves
the selective removal of particular (preselected) mRNA messages. In
particular, highly expressed mRNA messages that are not
specifically probed by the probes in the high density array are
preferably removed. This approach involves hybridizing the
polyA.sup.+ mRNA with an oligonucleotide probe that specifically
hybridizes to the preselected message close to the 3' (poly A) end.
The probe may be selected to provide high specificity and low cross
reactivity. Treatment of the hybridized message/probe complex with
RNase H digests the double stranded region effectively removing the
polyA.sup.+ tail from the rest of the message. The sample is then
treated with methods that specifically retain or amplify
polyA.sup.+ RNA (e.g., an oligo dT column or (dT)n magnetic beads).
Such methods will not retain or amplify the selected message(s) as
they are no longer associated with a polyA.sup.+ tail. These highly
expressed messages are effectively removed from the sample
providing a sample that has reduced background mRNA.
[0191] IV. Hybridization Array Design.
[0192] A) Probe Composition.
[0193] One of skill in the art will appreciate that an enormous
number of array designs are suitable for the practice of this
invention. Generic difference screeing arrays, for example may
include random, haphazardly selected, or aribtrary probe sets.
Alternatively, the generic difference screening arrays may include
all possible oligonucleotides of a particular pre-selected length.
Conversely, other expression monitoring arrays typically include a
number of probes that specifically hybridize to the nucleic acid(s)
expression of which is to be detected. In a preferred embodiment,
the array will include one or more control probes.
[0194] 1) Test Probes.
[0195] In its simplest embodiment, the high density array includes
"test probes" (also referred to as probe oligonucleotides) more
than 5 bases long, preferably more than 10 bases long, and some
more than 40 baes long. In some embodiments, the probes are less
than 50 bases long. In some cases, these oligonucleotides range
from about 5 to about 45 or 5 to about 50 nucleotides long, more
preferably from about 10 to about 40 nucleotides long, and most
preferably from about 15 to about 40 nucleotides in length. In
other particularly preferred embodiments the probes are 20 or 25
nucleotides in length. In preselected expression monitoring arrays,
these probe oligonucleotides have sequences complementary to
particular subsequences of the genes whose expression they are
designed to detect. Thus, the test probes are capable of
specifically hybridizing to the target nucleic acid they are to
detect.
[0196] In high density oligonucleotide arrays, designed for generic
difference screening, the probe oligonucleotides need not be
selected to hybridize to particular preselected subsequences of
genes. To the contrary, preferred generic difference screening
arrays comprise probe oligonucleotides whose sequences are random,
arbitrary, or haphazard. Alternatively, the probe oligonucleotides
may include all possible nucleotides of a given length (e.g., all
possible 4 mers, all possible 5 mers, all possible 6 mers, all
possible 7 mers, all possible 8 mers, all possible 9 mers, all
possible 10 mers, all possible 11 mers, all possible 12 mers,
etc.)
[0197] A random oligonucleotide array is an array in which the pool
of nucleotide sequences of a particular length does not
significantly deviate from a pool of nucleotide sequences selected
in a random manner (i.e., blind, unbiased selection) from a
collection of all possible sequences of that length.
[0198] Arbitrary or haphazard nucleotide arrays of probe
oligonucleotides are arrays in which the probe oligonucleotide
selection is selected without identifying and/or preselecting
target nucleic acids. Arbitrary or haphazard nucleotide arrays may
approximate or even be random, however there in no assurance that
they meet a statistical definition of randomness.
[0199] The arrays may reflect some nucleotide selection based on
probe composition, and/or non-redundancy of probes, and/or coding
sequence bias as described herein. In a preferred embodiment,
however such "biased" probe sets are still not chosen to be
specific for any particular genes.
[0200] An array comprising all possible oligonucleotides of a
particular length refers to an array that contains oligonucleotides
having sequences corresponding to substantially every permutation
of a sequence. Thus since the probe oligonucleotides of this
invention preferably include up to 4 bases (A, G, C, T) or (A, G,
C, U) or derivatives of these bases, an array having all possible
nucleotides of length X contains substantially 4.sup.X different
nucleic acids (e.g., 16 different nucleic acids for a 2 mer, 64
different nucleic acids for a 3 mer, 65536 different nucleic acids
for an 8 mer, etc.). It will be appreciated that some small number
of sequences may be inadvertently absent from a pool of all
possible nucleotides of a particular length due to synthesis
problems, inadvertent cleavage, etc.). Thus, it will be appreciated
that an array comprising all possible nucleotides of length X
refers to an array having substantially all possible nucleotides of
length X. Substantially all possible nucleotides of length X
includes more than 90%, typically more than 95%, preferably more
than 98%, more preferably more than 99%, and most preferably more
than 99.9% of the possible number of different nucleotides.
[0201] The probe oligonucleotides described above can additionally
include a constant domain. A constant domain being a nucleotide
subsequence that is common to substantially all of the probe
oligonculeotides. Particularly preferred constant domains are
located at the terminus of the oligonucleotide probe closest to the
substrate (i.e., attached to the linker/anchor molecule). The
constant regions may comprise virtually any sequence. However, in
one embodiment, the constant regions comprise a sequence or
subsequence complementary to the sense or antisense strand of a
restriction site (a nucleic acid sequence recognized by a
restriction endonuclease).
[0202] The constant domain can be synthesized de novo on the array.
Alternatively, the constant region may be prepared in a separate
procedure and then coupled intact to the array. Since the constant
domain can be synthsized separately and then the intact constant
subsequences coupled to the high density array, the constant domain
can be virtually any length. Some constant domains range from 3
nucleotides to about 500 nucleotides in length, more typically from
about 3 nucleotides in length to about 100 nucleotides in length,
most typcically from 3 nucleotides in length to about 50
nucleotides in length. In particular embodiments, constant domains
range from 3 nucleotides to about 45 nucleotides in length, more
preferably from 3 nucleotides in length to about 25 nucleotides in
length and most preferably from 3 to about 15 or even 10
nucleotides in length. In other embodiments, preferred constant
regions range from about 5 nucleotides to about 15 nucleotides in
length.
[0203] In addition to test probes that bind the target nucleic
acid(s) of interest, the high density array can contain a number of
control probes. The control probes fall into three categories
referred to herein as 1) Normalization controls; 2) Expression
level controls; and 3) Mismatch controls.
[0204] 2) Normalization Controls.
[0205] Normalization controls are oligonucleotide probes that are
perfectly complementary to labeled reference oligonucleotides that
are added to the nucleic acid sample. The signals obtained from the
normalization controls after hybridization provide a control for
variations in hybridization conditions, label intensity, "reading"
efficiency and other factors that may cause the signal of a perfect
hybridization to vary between arrays. In a preferred embodiment,
signals (e.g., fluorescence intensity) read from all other probes
in the array are divided by the signal (e.g., fluorescence
intensity) from the control probes thereby normalizing the
measurements.
[0206] Virtually any probe may serve as a normalization control.
However, it is recognized that hybridization efficiency varies with
base composition and probe length. Preferred normalization probes
are selected to reflect the average length of the other probes
present in the array, however, they can be selected to cover a
range of lengths. The normalization control(s) can also be selected
to reflect the (average) base composition of the other probes in
the array, however in a preferred embodiment, only one or a few
normalization probes are used and they are selected such that they
hybridize well (i.e. no secondary structure) and do not match any
target-specific probes.
[0207] Normalization probes can be localized at any position in the
array or at multiple positions throughout the array to control for
spatial variation in hybridization efficiently. In a preferred
embodiment, the normalization controls are located at the corners
or edges of the array as well as in the middle.
[0208] 3) Expression Level Controls.
[0209] Expression level controls are probes that hybridize
specifically with constitutively expressed genes in the biological
sample. Expression level controls are designed to control for the
overall health and metabolic activity of a cell. Examination of the
covariance of an expression level control with the expression level
of the target nucleic acid indicates whether measured changes or
variations in expression level of a gene is due to changes in
transcription rate of that gene or to general variations in health
of the cell. Thus, for example, when a cell is in poor health or
lacking a critical metabolite the expression levels of both an
active target gene and a constitutively expressed gene are expected
to decrease. The converse is also true. Thus where the expression
levels of both an expression level control and the target gene
appear to both decrease or to both increase, the change may be
attributed to changes in the metabolic activity of the cell as a
whole, not to differential expression of the target gene in
question. Conversely, where the expression levels of the target
gene and the expression level control do not covary, the variation
in the expression level of the target gene is attributed to
differences in regulation of that gene and not to overall
variations in the metabolic activity of the cell.
[0210] Virtually any constitutively expressed gene provides a
suitable target for expression level controls. Typically expression
level control probes have sequences complementary to subsequences
of constitutively expressed "housekeeping genes" including, but not
limited to the .beta.-actin gene, the transferrin receptor gene,
the GAPDH gene, and the like.
[0211] 4) Mismatch Controls.
[0212] Mismatch controls may also be provided for the probes to the
target genes, for expression level controls or for normalization
controls. Mismatch controls are oligonucleotide probes identical to
their corresponding test or control probes except for the presence
of one or more mismatched bases. A mismatched base is a base
selected so that it is not complementary to the corresponding base
in the target sequence to which the probe would otherwise
specifically hybridize. One or more mismatches are selected such
that under appropriate hybridization conditions (e.g. stringent
conditions) the test or control probe would be expected to
hybridize with its target sequence, but the mismatch probe would
not hybridize (or would hybridize to a significantly lesser
extent). Preferred mismatch probes contain a central mismatch.
Thus, for example, where a probe is a 20 mer, a corresponding
mismatch probe will have the identical sequence except for a single
base mismatch (e.g., substituting a G, a C or a T for an A) at any
of positions 6 through 14 (the central mismatch).
[0213] In "generic" (e.g., random, arbitrary, haphazard, etc.)
arrays, since the target nucleic acid(s) are unknown perfect match
and mismatch probes cannot be a priori determined, designed, or
selected. In this instance, the probes are preferably provided as
pairs where each pair of probes differ in one or more preselected
nucleotides. Thus, while it is not known a priori which of the
probes in the pair is the perfect match, it is known that when one
probe specifically hybridizes to a particular target sequence, the
other probe of the pair will act as a mismatch control for that
target sequence. It will be appreciated that the perfect match and
mismatch probes need not be provided as pairs, but may be provided
as larger collections (e.g., 3, 4, 5, or more) of probes that
differ from each other in particular preselected nucleotides.
[0214] In both expression monitoring and generic difference
screening arrays, mismatch probes provide a control for
non-specific binding or cross-hybridization to a nucleic acid in
the sample other than the target to which the probe is
complementary. Mismatch probes thus indicate whether a
hybridization is specific or not. For example, if the complementary
target is present the perfect match probes should be consistently
brighter than the mismatch probes. In addition, if all central
mismatches are present, the mismatch probes can be used to detect a
mutation. Finally, it was also a discovery of the present invention
that the difference in intensity between the perfect match and the
mismatch probe (I(PM)-I(MM)) provides a good measure of the
concentration of the hybridized material.
[0215] 5) Sample Preparation/Amplification/Quantitation
Controls.
[0216] The high density array may also include sample
preparation/amplification control probes. These are probes that are
complementary to subsequences of control genes selected because
they do not normally occur in the nucleic acids of the particular
biological sample being assayed. Suitable sample
preparation/amplification control probes include, for example,
probes to bacterial genes (e.g., Bio B) where the sample in
question is a biological from a eukaryote.
[0217] The RNA sample is then spiked with a known amount of the
nucleic acid to which the sample preparation/amplification control
probe is directed before processing. Quantification of the
hybridization of the sample preparation/amplification control probe
then provides a measure of alteration in the abundance of the
nucleic acids caused by processing steps (e.g. PCR, reverse
transcription, in vitro transcription, etc.).
[0218] Quantitation controls are similar. Typically they are
combined with the sample nucleic acid(s) in known amounts prior to
hybridization. They are useful to provdie a quantitiation reference
and permit determination of a standard curve for quantifing
hybridization amounts (concentrations).
[0219] B) Probe Selection and Optimization.
[0220] i) Generic Difference Screening Arrays
[0221] a) Assumption-Free Probe Selection.
[0222] As explained above, probe oligonculetide selection for
generic difference screening arrays can be random, arbitrary
haphazard, compositin biased, or include all possible
oligonculeotides of a particular length. Probe choice is thus
essentially assumption free. In some embodiments, however,
particular oligonucleotides may be excluded from the array or from
analysis. For example, probes that contain palindormic sequences or
probes that contain long stretches of all As, Cs, Gs, Ts, etc, may
be excluded. Probes for exclusion may be identified by hybridizing
a single array to the same sample multiple times and/or hybridizing
different copies of the array to the same sample. Probes that show
that show an unacceptable variation (variation above a particular
threshold value) in hybridization intensity against the same sample
may be excluded (either in array construction or in signal
analysis). The variation level at which a probe may be excluded is
a function of the sensitivity desired of the assay. The more
sensitive an assay is desired, the lower the exclusion threshold is
set. In a preferred embodiment, the probe is excluded when the
variation in hybridization intensity exceeds 2 times the background
signal and has a relative variation of more than 50%.
[0223] Alternatively such exclusion may be inherent in the
selective identification of differentially hybridizing sequences
where the difference between a test nucleic acid sample and a
reference nucleic acid sample is compared to the difference between
the reference nucleic acid sample and itself. This is described
more fully below in Section IX(B).
[0224] b) Exploitation of Codon Degeneracy.
[0225] In another embodiment, species-specific codon usage can be
exploited to utilize a longer (and hence more specific and stable)
probe without increasing the number of probe oligonucleotides
necessary to hybridize to all possible sequences. Amino acid codons
are conserved in the first and second position of their codons,
while the third position is highly redundant. Moreover each species
or organism favors particular codons to encode any particular amino
acid. The preferred codon for a particular amino acid in a
particular species being the codon that is used at the highest
frequency for that species. Codon preferences are well known to
those of skill in the art. They can also be readily determined by a
simple frequency analysis of the nucleotide sequences of a
particular organism or species.
[0226] Similarly, the di, tri-, tetra-nucleotide frequency biases
of an particular organism or species can be used to weight the
selection of oligonucleotide probes used in "composition biased"
generic difference screening array.
[0227] In one preferred embodiment, the probe oligonucleotides are
prepared having the first two nucleotides in each codon being fixed
but allowing the third nucleotide to vary (either by use of a 4 way
wobble or by the use of inosine or other non-specifically
hybridizing base). In a preferred embodiment, each codon of the
probe will have the general formula
3'-X.sup.1-X.sup.2-I-5'
[0228] where I is inosine or a 4-way wobble and X.sup.1 and X.sup.2
are A, G, C, T/U selected according to the preferred codon usage
for a particular species. Thus, for example, an array of 16 mers
that will hybridize to substantially all nucleic acids of a
particular species can be prepared where the probes have the
formula:
Support-I.sup.1-X.sup.2X.sup.3I.sup.4-X.sup.5X.sup.6I.sup.7-X.sup.8X.sup.9-
I.sup.10-X.sup.11X.sup.12-I.sup.13-X.sup.14X.sup.15I.sup.16-3'
[0229] with only 4.sup.10 different probe oligonucleotides.
Suitable codons for this probe are illustrated in Table 1.
1TABLE 1 Preferred sequences for generic coding sequence 16 mer
probe oligonucleotides. (Derived from standard tabel of amino acid
codons (the genetic code).) Codon 5 Codon 4 Codon 3 Codon 2 Codon 1
I.sup.1 X.sup.2 X.sup.3 I.sup.4 X.sup.5 X.sup.6 I.sup.7 X.sup.8
X.sup.9 I.sup.10 X.sup.11 X.sup.12 I.sup.13 X.sup.14 X.sup.15
I.sup.16 I G A I G A I G A I G A I G A I I A A I A A I A A I A A I
A A I I C T I C T I C T I C T I C T I I G C I G C I G C I G C I G C
I I C A I C A I C A I C A I C A I I A T I A T I A T I A T I A T I I
G G I G G I G G I G G I G G I I G T I G T I G T I G T I G T I I C C
I C C I C C I C C I C C I I T T I T T I T T I T T I T T I I A C I A
C I A C I A C I A C I I A T I A T I A T I A T I A T I I T C I T C I
T C I T C I T C I I T G I T G I T G I T G I T G I I C G I C G I C G
I C G I C G I I T A I T A I T A I T A I T A I
[0230] The affinity of the probes may be further enhanced by the
includsion of additional intosines, (or 4,-way, 3-way, or 2-way
wobbles, or other generic bases) to the 3' and 5' ends of the
oligonucleotide probes. These codon usage biased probes can be used
in conjunction with a ligase discrimination to further increase
obtainable sequence information. Thus, for example, where the
hybridization to an array comprising the above-described 16 mers
also includes a ligation with one or more ligatable
oligonucleotides of fixed length N, whose sequence is known, each
successful ligation provides 16+N nucleotides of sequence
information.
[0231] ii) Expression Monitoring Arrays.
[0232] In a preferred embodiment, oligonucleotide probes in the
expression monitoring high density array are selected to bind
specifically to the nucleic acid target to which they are directed
with minimal non-specific binding or cross-hybridization under the
particular hybridization conditions utilized. Because the high
density arrays of this invention can contain in excess of 1,000,000
different probes, it is possible to provide every probe of a
characteristic length that binds to a particular nucleic acid
sequence. Thus, for example, the high density array can contain
every possible 20 mer sequence complementary to an IL-2 mRNA.
[0233] There, may exist, however, 20 mer subsequences that are not
unique to the IL-2 mRNA. Probes directed to these subsequences are
expected to cross hybridize with occurrences of their complementary
sequence in other regions of the sample genome. Similarly, other
probes simply may not hybridize effectively under the hybridization
conditions (e.g., due to secondary structure, or interactions with
the substrate or other probes). Thus, in a preferred embodiment,
the probes that show such poor specificity or hybridization
efficiency are identified and may not be included either in the
high density array itself (e.g., during fabrication of the array)
or in the post-hybridization data analysis.
[0234] In addition, in a preferred embodiment, expression
monitoring arrays are used to identify the presence and expression
(transcription) level of genes which are several hundred base pairs
long or longer. For most applications it would be useful to
identify the presence, absence, or expression level of several
thousand to one hundred thousand genes. Because the number of
oligonucleotides per array is limited, in a preferred embodiment,
it is desired to include only a limited set of probes specific to
each gene whose expression is to be detected.
[0235] a) Hybridization and Cross-Hybridization Data.
[0236] Thus, in one embodiment, this invention provides for a
method of optimizing a probe set for detection of a particular
gene. Generally, this method involves providing a high density
array containing a multiplicity of probes of one or more particular
length(s) that are complementary to subsequences of the mRNA
transcribed by the target gene. In one embodiment the high density
array may contain every probe of a particular length that is
complementary to a particular mRNA. The probes of the high density
array are then hybridized with their target nucleic acid alone and
then hybridized with a high complexity, high concentration nucleic
acid sample that does not contain the targets complementary to the
probes. Thus, for example, where the target nucleic acid is an RNA,
the probes are first hybridized with their target nucleic acid
alone and then hybridized with RNA made from a cDNA library (e.g.,
reverse transcribed polyA.sup.+ mRNA) where the sense of the
hybridized RNA is opposite that of the target nucleic acid (to
insure that the high complexity sample does not contain targets for
the probes). Those probes that show a strong hybridization signal
with their target and little or no cross-hybridization with the
high complexity sample are preferred probes for use in the high
density arrays of this invention.
[0237] The high density array may additionally contain mismatch
controls for each of the probes to be tested. In a preferred
embodiment, the mismatch controls contain a central mismatch. Where
both the mismatch control and the target probe show high levels of
hybridization (e.g., the hybridization to the mismatch is nearly
equal to or greater than the hybridization to the corresponding
test probe), the test probe is preferably not used in the high
density array.
[0238] In a particularly preferred embodiment, optimal probes are
selected according to the following method: First, as indicated
above, an array is provided containing a multiplicity of
oligonucleotide probes complementary to subsequences of the target
nucleic acid. The oligonucleotide probes may be of a single length
or may span a variety of lengths. The high density array may
contain every probe of a particular length that is complementary to
a particular mRNA or may contain probes selected from various
regions of particular mRNAs. For each target-specific probe the
array also contains a mismatch control probe; preferably a central
mismatch control probe.
[0239] The oligonucleotide array is hybridized to a sample
containing target nucleic acids having subsequences complementary
to the oligonucleotide probes and the difference in hybridization
intensity between each probe and its mismatch control is
determined. Only those probes where the difference between the
probe and its mismatch control exceeds a threshold hybridization
intensity (e.g. preferably greater than 10% of the background
signal intensity, more preferably greater than 20% of the
background signal intensity and most preferably greater than 50% of
the background signal intensity) are selected. Thus, only probes
that show a strong signal compared to their mismatch control are
selected.
[0240] The probe optimization procedure can optionally include a
second round of selection. In this selection, the oligonucleotide
probe array is hybridized with a nucleic acid sample that is not
expected to contain sequences complementary to the probes. Thus,
for example, where the probes are complementary to the RNA sense
strand a sample of antisense RNA is provided. Of course, other
samples could be provided such as samples from organisms or cell
lines known to be lacking a particular gene, or known for not
expressing a particular gene.
[0241] Only those probes where both the probe and its mismatch
control show hybridization intensities below a threshold value
(e.g. less than about 5 times the background signal intensity,
preferably equal to or less than about 2 times the background
signal intensity, more preferably equal to or less than about 1
times the background signal intensity, and most preferably equal or
less than about half background signal intensity) are selected. In
this way probes that show minimal non-specific binding are
selected. Finally, in a preferred embodiment, the n probes (where n
is the number of probes desired for each target gene) that pass
both selection criteria and have the highest hybridization
intensity for each target gene are selected for incorporation into
the array, or where already present in the array, for subsequent
data analysis. Of course, one of skill in the art, will appreciate
that either selection criterion could be used alone for selection
of probes.
[0242] b) Heuristic Rules.
[0243] Using the hybridization and cross-hybridization data
obtained as described above, graphs can be made of hybridization
and cross-hybridization intensities versus various probe properties
e.g., number of As, number of Cs in a window of 8 bases, palindomic
strength, etc. The graphs can then be examined for correlations
between those properties and the hybridization or
cross-hybridization intensities. Thresholds can be set beyond which
it looks like hybridization is always poor or cross hybridization
is always very strong. If any probe fails one of the criteria, it
is rejected from the set of probes and therefore, not placed on the
chip. This will be called the heuristic rules method.
[0244] One set of rules developed for 20 mer probes in this manner
is the following:
[0245] Hybridization rules:
[0246] 1) Number of As is less than 9.
[0247] 2) Number of Ts is less than 10 and greater than 0.
[0248] 3) Maximum run of As, Gs, or Ts is less than 4 bases in a
row.
[0249] 4) Maximum run of any 2 bases is less than 11 bases.
[0250] 5) Palindrome score is less than 6.
[0251] 6) Clumping score is less than 6.
[0252] 7) Number of As+Number of Ts is less than 14
[0253] 8) Number of As+number of Gs is less than 15
[0254] With respect to rule number 4, requiring the maximum run of
any two bases to be less than 11 bases guarantees that at least
three different bases occur within any 12 consecutive nucleotides.
A palindrome score is the maximum number of complementary bases if
the oligonucleotide is folded over at a point that maximizes self
complementarity. Thus, for example a 20 mer that is perfectly
self-complementary would have a palindrome score of 10. A clumping
score is the maximum number of three-mers of identical bases in a
given sequence. Thus, for example, a run of 5 identical bases will
produce a clumping score of 3 (bases 1-3, bases 2-4, and bases
3-5).
[0255] If any probe failed one of these criteria (1-8), the probe
was not a member of the subset of probes placed on the chip. For
example, if a hypothetical probe was 5'-AGCTTTTTTTCATGCATCTAT-3'
the probe would not be synthesized on the chip because it has a run
of four or more bases (i.e., run of six).
[0256] The cross hybridization rules developed for 20 mers were as
follows:
[0257] 1) Number of Cs is less than 8;
[0258] 2) Number of Cs in any window of 8 bases is less than 4.
[0259] Thus, if any probe failed any of either the hybridization
ruses (1-8) or the cross-hybridization rules (1-2), the probe was
not a member of the subset of probes placed on the chip. These
rules eliminated many of the probes that cross hybridized strongly
or exhibited low hybridization, and performed moderate job of
eliminating weakly hybridizing probes.
[0260] These heuristic rules may be implemented by hand
calculations, or alternatively, they may be implemented in software
as is discussed below in Section XII.
[0261] c) Neural Net.
[0262] In another embodiment, a neural net can be trained to
predict the hybridization and cross-hybridization intensities based
on the sequence of the probe or on other probe properties. The
neural net can then be used to pick an arbitrary number of the
"best" probes. One such neural net was developed for selecting
20-mer probes. This neural net was produced a moderate (0.7)
correlation between predicted intensity and measured intensity,
with a better model for cross hybridization than hybridization.
Details of this neural net are provided in Example 6.
[0263] d) ANOVA Model
[0264] An analysis of variance (ANOVA) model may be built to model
the intensities based on positions of consecutive base pairs. This
is based on the theory that the melting energy is based on stacking
energies of consecutive bases. The annova model was used to find
correlation between the a probe sequence and the hybridization and
cross-hybridization intensities. The inputs were probe sequences
broken down into consecutive base pairs. One model was made to
predict hybridization, another was made to predict cross
hybridization. The output was the hybridization or
crosshybridization intensity.
[0265] There were 304 (19*16) possible inputs, consisting of the 14
possible two base combinations, and the 19 positions that those
combinations could be found in. For example, the sequence aggctga .
. . has "ag" in the first position, "gg" in the second position,
"gc" in the third, "ct" in the fourth and so on.
[0266] The resulting model assigned a component of the output
intensity to each of the possible inputs, so to estimate the
intensity for a given sequence one simply adds the intensities for
each of it's 19 components.
[0267] e) Pruning (Removal) of Similar Probes.
[0268] One of the causes of poor signals in expression chips is
that genes other than the ones being monitored have sequences which
are very similar to parts of the sequences which are being
monitored. The easiest way to solve this is to remove probes which
are similar to more than one gene. Thus, in a preferred embodiment,
it is desirable to remove (prune) probes that hybridize to
transcription products of more than one gene.
[0269] The simplest pruning method is to line up a proposed probe
with all known genes for the organism being monitored, then count
the number of matching bases. For example, given a probe to gene 1
of an organism and gene 2 of an organism as follows:
2 probe from gene 1: aagcgcgatcgattatgctc .vertline.
.vertline..vertline..vertline..vertline..vertline..vertline..vertline.
gene 2: atctcggatcgatcggataagcgcgatcgattatgctcggcga
[0270] has 8 matching bases in this alignment, but 20 matching
bases in the following alignment:
3 probe from gene 1: aagcgcgatcgattatgctc
.vertline..vertline..vertline..vertline..vertline..ver-
tline..vertline..vertline..vertline..vertline..vertline..vertline..vertlin-
e..vertline..vertline..vertline..vertline..vertline..vertline..vertline.
gene 2: atctcggatcgatcggataagcgcgatcgattatgctcggcga
[0271] More complicated algorithms also exist, which allow the
detection of insertion or deletion mismatches. Such sequence
alignment algorithms are well known to those of skill in the art
and include, but are not limited to BLAST, or FASTA, or other gene
matching programs such as those described above in the definitions
section.
[0272] In another variant, where an organism has many different
genes which are very similar, it is difficult to make a probe set
that measures the concentration only one of those very similar
genes. One can then prune out any probes which are dissimilar, and
make the probe set a probe set for that family of genes.
[0273] f) Synthesis Cycle Pruning.
[0274] The cost of producing masks for a chip is approximately
linearly related to the number of synthesis cycles. In a normal set
of genes the distribution of the number of cycles any probe takes
to build approximates a Gausian distribution. Because of this the
mask cost can normally be reduced by 15% by throwing out about 3
percent of the probes. In a preferred embodiment, synthesis cycle
pruning simply involves eliminating (not including) those probes
those probes that require a greater number of synthesis cycles than
the maximum number of synthesis cycles selected for preparation of
the particular subject high density oligonucleotide array. Since
the typical synthesis of probes follows a regular pattern of bases
put down (acgtacgtacgt . . . ) counting the number of synthesis
steps needed to build a probe is easy. The listing shown in Table 1
povides typical code for counting the number of synthesis cycles a
probe will need.
4TABLE 1 Typical code for counting synthesis cycles required for
the chemical synthesis of a probe. static char base[] = "acgt"; //
a b c d e f g h i j k l m n o p q r s t u v w x y z static short
index[] = { 0, 0, 1, 0, 0, 0, 2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
0, 3, 0, 0, 0, 0, 0, 0}; short lookupIndex( char aBase ){ if(
isupper( aBase ) .vertline..vertline. !isalpha( aBase) ){
errorHwnd( "illegal base"); return -1; } if( strchr( base, aBase )
== NULL ){ errorHwnd( "non-dna base"); return 0; } return index[
aBase - `a`]; } static short
calculateMinNumberOfSynthesisStepsForComplement( char local *
buffer ){ short i, last, current, cycles = 1; char buffer1[40];
for( i =3D 0; buffer[i] != 0; i++ ){ switch( tolower(buffer[i]) ){
case `a`: buffer1[i] = `t`;break; case `c`: buffer1[i] = `g`;break;
case `g`: buffer1[i] = `c`;break; case `t`: buffer1[i] = `a`;break;
} } buffer1[i] = 0; if( buffer1[0] == 0 ) return 0; last =
lookupIndex( buffer1[0] ); for( i = 1; buffer1[i] != 0; i++ ){
current = lookupIndex( buffer1[i] ); if( current <= last )
cycles++; last = current; } return (short)((cycles -1) * 4 +
current +1); }
[0275] g) Combination of Selection Methods.
[0276] The heuristic rules, neural net and annova model provide
ways of pruning or reducing the number of probes for monitoring the
expression of genes. As these methods do not necessarily produce
the same results, or produce entirely independent results, it may
be advantageous to combine the methods. For example, probes may be
pruned or reduced if more than one method (e.g., two out of three)
indicate the probe will not likely produce good results. Then,
synthesis cycle pruning may be performed to reduce costs.
[0277] FIG. 11 shows the flow of a process of increasing the number
of probes for monitoring the expression of genes after the number
of probes has been reduced or pruned. In one embodiment, a user is
able to specify the number of nucleic acid probes that should be
placed on the chip to monitor the expression of each gene. As
discussed above, it is advantageous to reduce probes that will not
likely produce good results; however, the number of probes may be
reduced to substantially less than the desired number of
probes.
[0278] At step 402, the number of probes for monitoring multiple
genes is reduced by the heuristic rules method, neural net, annova
model, synthesis cycle pruning, or any other method, or combination
of methods. A gene is selected at step 404.
[0279] A determination is made whether the remaining probes for
monitoring the selected gene number greater than 80% (which may be
varied or user defined) of the desired number of probes. If yes,
the computer system proceeds to the next gene at step 408 which
will generally return to step 404.
[0280] If the remaining probes for monitoring the selected gene do
not number greater than 80% of the desired number of probes, a
determination is made whether the remaining probes for monitoring
the selected gene number greater than 40% (which may be varied or
user defined) of the desired number of probes. If yes, an "i" is
appended to the end of the gene name to indicate that after
pruning, the probes were incomplete at step 412.
[0281] At step 414, the number of probes is increased by loosening
the constraints that rejected probes. For example, the thresholds
in the heuristic rules may be increased by 1. Therefore, if
previously probes were rejected if they had four As in a row, the
rule may be loosened to five As in a row.
[0282] A determination is then made whether the remaining probes
for monitoring the selected gene number greater than 80% of the
desired number of probes at step 416. If yes, an "r" is appended to
the end of the gene name at step 412 to indicate that the rules
were loosened to generate the number of synthesized probes for that
gene.
[0283] At step 420, a check is made to see if the probes for
monitoring the selected gene only conflict with one or two other
genes. If yes, the full set of probes complementary to the gene (or
target sequence) are taken and pruned so that the probes remaining
are exactly complementary to the selected gene exclusively at step
422.
[0284] A determination is then made whether the remaining probes
for monitoring the selected gene number greater than 80% of the
desired number of probes at step 424. If yes, an "s" is appended to
the end of the gene name at step 426 to indicate that the only a
few genes were similar to the selected gene.
[0285] At step 428, the probes for monitoring the selected gene are
not reduced by conflicts at all. A determination is then made
whether the remaining probes for monitoring the selected gene
number greater than 80% of the desired number of probes at step
430. If yes, an "f" is appended to the end of the gene name at step
432 to indicate that the probes include the whole family of probes
perfectly complementary to the gene.
[0286] If there are still not 80% of the desired number of probes,
an error is reported at step 434. Any number of error handling
procedures may be undertaken. For example, an error message may be
generated for the user and the probes for the gene may not be
stored. Alternatively, the user may be prompted to enter a new
desired number of probes.
[0287] V. Synthesis of High Density Arrays
[0288] Methods of forming high density arrays of oligonucleotides,
peptides and other polymer sequences with a minimal number of
synthetic steps are known. The oligonucleotide analogue array can
be synthesized on a solid substrate by a variety of methods,
including, but not limited to, light-directed chemical coupling,
and mechanically directed coupling. See Pirrung et al., U.S. Pat.
No. 5,143,854 (see also PCT Application No. WO 90/15070) and Fodor
et al., PCT Publication Nos. WO 92/10092 and WO 93/09668 which
disclose methods of forming vast arrays of peptides,
oligonucleotides and other molecules using, for example,
light-directed synthesis techniques. See also, Fodor et al.,
Science, 251, 767-77 (1991). These procedures for synthesis of
polymer arrays are now referred to as VLSIPS.TM. procedures. Using
the VLSIPS.TM. approach, one heterogenous array of polymers is
converted, through simultaneous coupling at a number of reaction
sites, into a different heterogenous array. See, U.S. application
Ser. Nos. 07/796,243 and 07/980,523.
[0289] The development of VLSIPS.TM. technology as described in the
above-noted U.S. Pat. No. 5,143,854 and PCT patent publication Nos.
WO 90/15070 and 92/10092, is considered pioneering technology in
the fields of combinatorial synthesis and screening of
combinatorial libraries. More recently, patent application Ser. No.
08/082,937, filed Jun. 25, 1993 describes methods for making arrays
of oligonucleotide probes that can be used to check or determine a
partial or complete sequence of a target nucleic acid and to detect
the presence of a nucleic acid containing a specific
oligonucleotide sequence.
[0290] In brief, the light-directed combinatorial synthesis of
oligonucleotide arrays on a glass surface proceeds using automated
phosphoramidite chemistry and chip masking techniques. In one
specific implementation, a glass surface is derivatized with a
silane reagent containing a functional group, e.g., a hydroxyl or
amine group blocked by a photolabile protecting group. Photolysis
through a photolithogaphic mask is used selectively to expose
functional groups which are then ready to react with incoming
5'-photoprotected nucleoside phosphoramidites. The phosphoramidites
react only with those sites which are illuminated (and thus exposed
by removal of the photolabile blocking group). Thus, the
phosphoramidites only add to those areas selectively exposed from
the preceding step. These steps are repeated until the desired
array of sequences have been synthesized on the solid surface.
Combinatorial synthesis of different oligonucleotide analogues at
different locations on the array is determined by the pattern of
illumination during synthesis and the order of addition of coupling
reagents.
[0291] In the event that an oligonucleotide analogue with a
polyamide backbone is used in the VLSIPS.TM. procedure, it is
generally inappropriate to use phosphoramidite chemistry to perform
the synthetic steps, since the monomers do not attach to one
another via a phosphate linkage. Instead, peptide synthetic methods
are substituted. See, e.g., Pirrung et al. U.S. Pat. No.
5,143,854.
[0292] Peptide nucleic acids are commercially available from, e.g.,
Biosearch, Inc. (Bedford, Mass.) which comprise a polyamide
backbone and the bases found in naturally occurring nucleosides.
Peptide nucleic acids are capable of binding to nucleic acids with
high specificity, and are considered "oligonucleotide analogues"
for purposes of this disclosure.
[0293] In addition to the foregoing, additional methods which can
be used to generate an array of oligonucleotides on a single
substrate are described in co-pending application Ser. No.
07/980,523, filed Nov. 20, 1992, and Ser. No. 07/796,243, filed
Nov. 22, 1991 and in PCT Publication No. WO 93/09668. In the
methods disclosed in these applications, reagents are delivered to
the substrate by either (1).sub.y flowing within a channel defined
on predefined regions or (2) "spotting" on predefined regions.
However, other approaches, as well as combinations of spotting and
flowing, may be employed. In each instance, certain activated
regions of the substrate are mechanically separated from other
regions when the monomer solutions are delivered to the various
reaction sites.
[0294] A typical "flow channel" method applied to the compounds and
libraries of the present invention can generally be described as
follows. Diverse polymer sequences are synthesized at selected
regions of a substrate or solid support by forming flow channels on
a surface of the substrate through which appropriate reagents flow
or in which appropriate reagents are placed. For example, assume a
monomer "A" is to be bound to the substrate in a first group of
selected regions. If necessary, all or part of the surface of the
substrate in all or a part of the selected regions is activated for
binding by, for example, flowing appropriate reagents through all
or some of the channels, or by washing the entire substrate with
appropriate reagents. After placement of a channel block on the
surface of the substrate, a reagent having the monomer A flows
through or is placed in all or some of the channel(s). The channels
provide fluid contact to the first selected regions, thereby
binding the monomer A on the substrate directly or indirectly (via
a spacer) in the first selected regions.
[0295] Thereafter, a monomer B is coupled to second selected
regions, some of which may be included among the first selected
regions. The second selected regions will be in fluid contact with
a second flow channel(s) through translation, rotation, or
replacement of the channel block on the surface of the substrate;
through opening or closing a selected valve; or through deposition
of a layer of chemical or photoresist. If necessary, a step is
performed for activating at least the second regions. Thereafter,
the monomer B is flowed through or placed in the second flow
channel(s), binding monomer B at the second selected locations. In
this particular example, the resulting sequences bound to the
substrate at this stage of processing will be, for example, A, B,
and AB. The process is repeated to form a vast array of sequences
of desired length at known locations on the substrate.
[0296] After the substrate is activated, monomer A can be flowed
through some of the channels, monomer B can be flowed through other
channels, a monomer C can be flowed through still other channels,
etc. In this manner, many or all of the reaction regions are
reacted with a monomer before the channel block must be moved or
the substrate must be washed and/or reactivated. By making use of
many or all of the available reaction regions simultaneously, the
number of washing and activation steps can be minimized.
[0297] One of skill in the art will recognize that there are
alternative methods of forming channels or otherwise protecting a
portion of the surface of the substrate. For example, according to
some embodiments, a protective coating such as a hydrophilic or
hydrophobic coating (depending upon the nature of the solvent) is
utilized over portions of the substrate to be protected, sometimes
in combination with materials that facilitate wetting by the
reactant solution in other regions. In this manner, the flowing
solutions are further prevented from passing outside of their
designated flow paths.
[0298] According to other embodiments the channels will be formed
by depositing an electron or photoresist such as those used
extensively in the semiconductor industry. Such materials include
polymethyl methacrylate (PMMA) and its derivatives, and electron
beam resists such as poly(olefin sulfones) and the like (more fully
described in Chapter 10 of Ghandi, VLSI Fabrication Principles,
Wiley (1983)). According to these embodiments, a resist is
deposited, selectively exposed, and etched, leaving a portion of
the substrate exposed for coupling. These steps of depositing
resist, selectively removing resist and monomer coupling are
repeated to form polymers of desired sequence at desired
locations.
[0299] The "spotting" methods of preparing compounds and libraries
of the present invention can be implemented in much the same manner
as the flow channel methods. For example, a monomer A, or a
coupled, or dimer, or trimer, or tetramer, etc, or a fully
syntheized material, can be delivered to and coupled with a first
group of reaction regions which have been appropriately activated.
Thereafter, a monomer B can be delivered to and reacted with a
second group of activated reaction regions. Unlike the flow channel
embodiments described above, reactants are delivered by directly
depositing (rather than flowing) relatively small quantities of
them in selected regions. In some steps, of course, the entire
substrate surface can be sprayed or otherwise coated with a
solution. In preferred embodiments, a dispenser moves from region
to region, depositing only as much monomer as necessary at each
stop. Typical dispensers include a micropipette to deliver the
monomer solution to the substrate and a robotic system to control
the position of the micropipette with respect to the substrate. In
other embodiments, the dispenser includes a series of tubes, a
manifold, an array of pipettes, or the like so that various
reagents can be delivered to the reaction regions
simultaneously.
[0300] VI. Hybridization.
[0301] Nucleic acid hybridization simply involves providing a
denatured probe and target nucleic acid under conditions where the
probe and its complementary target can form stable hybrid duplexes
through complementary base pairing. The nucleic acids that do not
form hybrid duplexes are then washed away leaving the hybridized
nucleic acids to be detected, typically through detection of an
attached detectable label. It is generally recognized that nucleic
acids are denatured by increasing the temperature or decreasing the
salt concentration of the buffer containing the nucleic acids, or
in the addition of chemical agents, or the rasiing of the pH. Under
low stringency conditions (e.g., low temperature and/or high salt
and/or high target concentration) hybrid duplexes (e.g., DNA:DNA,
RNA:RNA, or RNA:DNA) will form even where the annealed sequences
are not perfectly complementary. Thus specificity of hybridization
is reduced at lower stringency. Conversely, at higher stringency
(e.g., higher temperature or lower salt) successful hybridization
requires fewer mismatches.
[0302] One of skill in the art will appreciate that hybridization
conditions may be selected to provide any degree of stringency. In
a preferred embodiment, hybridization is performed at low
stringency in this case in 6.times.SSPE-T at about 40.degree. C. to
about 50.degree. C. (0.005% Triton X-100) to ensure hybridization
and then subsequent washes are performed at higher stringency
(e.g., 1.times.SSPE-T at 37.degree. C.) to eliminate mismatched
hybrid duplexes. Successive washes may be performed at increasingly
higher stringency (e.g., down to as low as 0.25.times.SSPE-T at
37.degree. C. to 50.degree. C.) until a desired level of
hybridization specificity is obtained. Stringency can also be
increased by addition of agents such as formamide. Hybridization
specificity may be evaluated by comparison of hybridization to the
test probes with hybridization to the various controls that can be
present (e.g., expression level control, normalization control,
mismatch controls, etc.).
[0303] In general, there is a tradeoff between hybridization
specificity (stringency) and signal intensity. Thus, in a preferred
embodiment, the wash is performed at the highest stringency that
produces consistent results and that provides a signal intensity
greater than approximately 10% of the background intensity. Thus,
in a preferred embodiment, the hybridized array may be washed at
successively higher stringency solutions and read between each
wash. Analysis of the data sets thus produced will reveal a wash
stringency above which the hybridization pattern is not appreciably
altered and which provides adequate signal for the particular
oligonucleotide probes of interest.
[0304] In a preferred embodiment, background signal is reduced by
the use of a detergent (e.g., C-TAB) or a blocking reagent (e.g.,
sperm DNA, cot-1 DNA, etc.) during the hybridization to reduce
non-specific binding. In a particularly preferred embodiment, the
hybridization is performed in the presence of about 0.1 to about
0.5 mg/ml DNA (e.g., herring sperm DNA). The use of blocking agents
in hybridization is well known to those of skill in the art (see,
e.g., Chapter 8 in P. Tijssen, supra.)
[0305] The stability of duplexes formed between RNAs or DNAs are
generally in the order of RNA:RNA>RNA:DNA>DNA:DNA, in
solution. Long probes have better duplex stability with a target,
but poorer mismatch discrimination than shorter probes (mismatch
discrimination refers to the measured hybridization signal ratio
between a perfect match probe and a single base mismatch probe).
Shorter probes (e.g., 8-mers) discriminate mismatches very well,
but the overall duplex stability is low.
[0306] Altering the thermal stability (T.sub.m) of the duplex
formed between the target and the probe using, e.g., known
oligonucleotide analogues allows for optimization of duplex
stability and mismatch discrimination. One useful aspect of
altering the T.sub.m arises from the fact that adenine-thymine
(A-T) duplexes have a lower T.sub.m than guanine-cytosine (G-C)
duplexes, due in part to the fact that the A-T duplexes have 2
hydrogen bonds per base-pair, while the G-C duplexes have 3
hydrogen bonds per base pair. In heterogeneous oligonucleotide
arrays in which there is a non-uniform distribution of bases, it is
not generally possible to optimize hybridization for each
oligonucleotide probe simultaneously. Thus, in some embodiments, it
is desirable to selectively destabilize G-C duplexes and/or to
increase the stability of A-T duplexes. This can be accomplished,
e.g., by substituting guanine residues in the probes of an array
which form G-C duplexes with hypoxanthine, or by substituting
adenine residues in probes which form A-T duplexes with 2,6
diaminopurine or by using the salt tetramethyl ammonium chloride
(TMACl or other alhylated ammonium salts) in place of NaCl.
[0307] Altered duplex stability conferred by using oligonucleotide
analogue probes can be ascertained by following, e.g., fluorescence
signal intensity of oligonucleotide analogue arrays hybridized with
a target oligonucleotide over time. The data allow optimization of
specific hybridization conditions at, e.g., room temperature (for
simplified diagnostic applications in the future).
[0308] Another way of verifying altered duplex stability is by
following the signal intensity generated upon hybridization with
time. Previous experiments using DNA targets and DNA chips have
shown that signal intensity increases with time, and that the more
stable duplexes generate higher signal intensities faster than less
stable duplexes. The signals reach a plateau or "saturate" after a
certain amount of time due to all of the binding sites becoming
occupied. These data allow for optimization of hybridization, and
determination of the best conditions at a specified
temperature.
[0309] Methods of optimizing hybridization conditions are well
known to those of skill in the art (see, e.g., Laboratory
Techniques in Biochemistry and Molecular Biology, Vol. 24:
Hybridization With Nucleic Acid Probes, P. Tijssen, ed. Elsevier,
N.Y., (1993)).
[0310] VII. Detection Methods
[0311] Methods for detection depend upon the label selected and are
known to those of skill in the art. Thus, for example, where a
colorimetric label is used, simple visualization of the label is
sufficient. Where a radioactive labeled probe is used, detection of
the radiation (e.g with photographic film or a solid state
detector) is sufficient.
[0312] As explained above, the use of a fluorescent label is
preferred because of its extreme sensitivity and simplicity.
Standard procedures are used to determine the positions where
interactions between a target sequence and a reagent take place.
For example, if a target sequence is labeled and exposed to an
array of different oligonucleotide probes, only those locations
where the oligonucleotides interact with the target (sample nucleic
acid(s)) will exhibit significant signal. In addition to using a
label, other methods may be used to scan the matrix to determine
where interaction takes place. The spectrum of interactions can, of
course, be determined in a temporal manner by repeated scans of
interactions which occur at each of a multiplicity of conditions.
However, instead of testing each individual interaction separately,
a multiplicity of sequence interactions may be simultaneously
determined on a matrix.
[0313] B. Scanning System
[0314] In a preferred embodiment, the hybridized array is excited
with a light source at the excitation wavelength of the particular
fluorescent label and the resulting fluorescence at the emission
wavelength is detected. In a particularly preferred embodiment, the
excitation light source is a laser appropriate for the excitation
of the fluorescent label.
[0315] Detection of the fluorescence signal preferably utilizes a
confocal microscope, more preferably a confocal microscope
automated with a computer-controlled stage to automatically scan
the entire high density array. The microscope may be equipped with
a phototransducer (e.g., a photomultiplier, a solid state array, a
ccd camera, etc.) attached to an automated data acquisition system
to automatically record the fluorescence signal produced by
hybridization to each oligonucleotide probe on the array. Such
automated systems are described at length in U.S. Pat. No.
5,143,854, PCT Application 20 92/10092, and copending U.S. Ser. No.
08/195,889 filed on Feb. 10, 1994. Use of laser illumination in
conjunction with automated confocal microscopy for signal detection
permits detection at a resolution of better than about 100 .mu.m,
more preferably better than about 50 .mu.m, and most preferably
better than about 25 .mu.m.
[0316] With the automated detection apparatus, the correlation of
specific positional labeling is converted to the presence on the
target of sequences for which the oligonucelotides have specificity
of interaction. Thus, the positional information is directly
converted to a database indicating what sequence interactions have
occurred. For example, in a nucleic acid hybridization application,
the sequences which have interacted between the substrate matrix
and the target molecule can be directly listed from the positional
information. A preferred detection system is described in PCT
publication no. WO90/15070; and U.S. Ser. No. 07/624,120. Although
the detection described therein is a fluorescence detector, the
detector can be replaced by a spectroscopic or other detector. The
scanning system can make use of a moving detector relative to a
fixed substrate, a fixed detector with a moving substrate, or a
combination. Alternatively, mirrors or other apparatus can be used
to transfer the signal directly to the detector. See, e.g., U.S.
Ser. No. 07/624,120.
[0317] The detection method will typically also incorporate some
signal processing to determine whether the signal at a particular
matrix position is a true positive or may be a spurious signal. For
example, a signal from a region which has actual positive signal
may tend to spread over and provide a positive signal in an
adjacent region which actually should not have one. This may occur,
e.g., where the scanning system is not properly discriminating with
sufficiently high resolution in its pixel density to separate the
two regions. Thus, the signal over the spatial region may be
evaluated pixel by pixel to determine the locations and the actual
extent of positive signal. A true positive signal should, in
theory, show a uniform signal at each pixel location. Thus,
processing by plotting number of pixels with actual signal
intensity should have a clearly uniform signal intensity. Regions
where the signal intensities show a fairly wide dispersion, may be
particularly suspect and the scanning system may be programmed to
more carefully scan those positions.
[0318] More sophisticated signal processing techniques can be
applied to the initial determination of whether a positive signal
exists or not. See, e.g., U.S. Ser. No. 07/624,120 and discussion
below in Section XII.
[0319] VIII. Ligation-Enhanced Signal Detection.
[0320] A) General Ligation Reaction.
[0321] Ligation reactions can be used to discriminate between fully
complementary hybrids and those that differ by one or more base
pairs, particularly in cases where the mismatch is near the 5'
terminus of the probe oligonucleotide. Use of a ligation reaction
in signal detection increases the stability of the hybrid duplex,
improves hybridization specificity (particularly for shorter probe
oligonucleotides e.g., 5 to 12 mers), and optionally, provides
additional sequence information.
[0322] Various components for use of ligation reaction(s) in
combination with generic difference arrays are illustrated in FIG.
13a. In its simplest embodiment, the probe oligonucleotide/ligation
reaction system includes an array of olignucleotide probes. As
discussed above, the oligonculcleotide probes can be randomly
selected, haphazardly selected, composition biased, inclusive of
all possible oligonucleotides of a particular length, and so forth.
The oligonucleotide probes can optionally include a predetermined
"constant" region (see FIG. 13a) which has substantially the same
sequence for substantially all of the probe oligonucleotides on the
array.
[0323] Where the probe comprises a constant region it also
preferably comprises a "variable region" (see FIG. 13a) which can
be randomly selected, haphazardly selected, composition biased,
inclusive of all possible oligonucleotides of a particular length,
and so forth. When constant and variable regions are present, a
sample nucleic acid that hybridizes to the oligonucleotide probe
typically hybridizes to at least the variable region and optionally
to the constant region as well.
[0324] The probe oligonucleotide/ligation reaction system also
optionally includes a nucleic acid that is complementary to the
constant region. This complement may be a subsequence of a sample
nucleic acid or a separate oligonucleotide. When the complement to
the constant region is a separate oligonucleotide, hybridization to
the constant region provides a ligation site (see FIG. 13a,
ligation site A). The hybridized complement to the constant region
can optionally be permanently crosslinked to the constant region by
the use of cross-linking reagents (e.g., psoralens). The sample
nucleic acid, and/or the ligatable oligonucleotide can optionally
be labeled. Where both are labeled, the labels can be the same or
distinguishable.
[0325] The probe oligonucleotide/ligation reaction system
optionally includes a ligatable oligonoucleotide that can be
ligated to free terminus of the variable region (see FIG. 13a,
ligation site B). The ligatable oligonucleotide can be a single
oligonculeotide of known nucleotide sequence, a collection of
nucleic acids of known sequence, or a pool of all possible
oligonculeotides of a particular length.
[0326] These various components of the probe
oligonucleotide/ligation reaction system can be combined in a
variety of ways to increases the stability of the hybrid duplex,
and/or improve hybridization specificity (particularly for shorter
probe oligonucleotides e.g., 5 to 12 mers), and/or provides
sequence information. Various uses of the probe
oligonucleotide/ligation reaction system are described in detail
below.
[0327] While FIG. 13a illustrates ligation components in solid
phase, similar approaches and components can be used in solution
phase. It will be appreciated that the order of the constant region
and variable region can be altered. In addition, a probe
oligonucleotide may comprise multiple constant regions and/or
multiple variable regions. In addition, while FIG. 13a illustrates
the probe oligonucleotide attached to a solid support by a 3'
terminus, the probe can also be reversed and attached via the 5'
terminus.
[0328] It will be appreciated that sequences or subsequences of the
probe oligonucleotide where variable regions are present or absent
can act as a primer site for initiation of polymerization using the
remainder of the probe oligonucleotide and/or the ligation
oligonucleotide and/or the sample nucleic acid as a polymerization
template.
[0329] B) Ligation Reactions to Discriminate Mismatches at Probe
Termini, Target Termini, or Both Termini
[0330] In one embodiment, a simple ligation reaction discriminated
mismatches at or near the terminus of the probe oligonculeotide
(see FIG. 13b). Typically, the nucleic acid fragments comprising
the sample nucleic acid are longer than the probe oligonucleotides
in the array. So that, when hybridized, the target nucleic acid
typically has an overhang. When the array comprises probe
oligonucleotides attached through their 3' termini, the hybridized
target (sample) nucleic acid provides a 3' overhang. In this
embodiment, the target nucleic acid is not necessarily labelled
(see, e.g., FIG. 13b).
[0331] When the array of oligonucleotides is combined with the
target nucleic acid to form target-oligonucleotide hybrid
complexes, the target-oligonucleotide hybrid complexes are
contacted with a ligase and a labelled, ligatable oligonucleotide
or, alternatively, with a pool of labelled, ligatable probes. While
the hybridization of the sample nucleic acids and the ligatable
probes can be performed sequentially, in a preferred embodiment
both hybridization and ligation are performed simultaneously (i.e.,
the target, ligatable oligonucleotide, and ligate are all added
together). The pool may comprise particular preselected probes or
may be a collection of all possible probes of a particular length
(e.g., 3 mer up to 12 mer) (see, e.g., FIG. 13b).
[0332] The ligation reaction of the labelled, ligatable probes to
the phosphorylated 5' end of the oligonucleotide probes on the
substrate will occur, in the presence of the ligase, predominantly
when the target:oligonucleotide hybrid has formed with correct
base-pairing near the 5' end of the oligonucleotide probe and where
there is a suitable 3' overhang of the target nucleic acid to serve
as a template for hybridization and ligation (see FIG. 12). After
the ligation reaction, the substrate is washed (multiple times if
necessary) under conditions suitable to remove the target nucleic
acid and the labeled, unligated probes (e.g., above 40.degree. C.
to 50.degree. C., or under otherwise highly stringent
conditions).
[0333] Thereafter, a fluorescence image (e.g., a quantitative
fluorescent image) of the hybridization pattern is obtained as
described above in Section VII(B). Labeled oligonucleotide probes,
i.e., the oligonucleotide probes which are complementary to the
target nucleic acid, are identified. The presence, absence, and/or
intensity of the hybridization signal provides information
regarding the presence and level of the nucleic acid sequence or
subsequence in the nucleic acid sample as described above.
[0334] Any enzyme that catalyzes the formation of a phosphodiester
bond at the site of a single-stranded break in duplex DNA can be
used to enhance discrimination between fully complementary hybrids
and those that differ by one or more base pairs. Such ligases
include, but are not limited to, T4 DNA ligase, ligases isolated
from E. coli and ligases isolated from other bacteria and
bacteriophages. The concentration of the ligase will vary depending
on the particular ligase used, the concentration of target and
buffer conditions, but will typically range from about 50 units/ml
to about 5,000 units/ml. Moreover, the time in which the array of
target:oligonucleotide hybridization complexes is in contact with
the ligase will vary. Typically, the ligase treatment is carried
out for a period of time ranging from minutes to hours. Methods of
performing ligase discrimination can be found in copending U.S.
Ser. No. 08/533,582, filed on Oct. 18, 1995 and in Jackson et al.
(1996) Nature Biotechnology, 14: 1685-1691.
[0335] It will be appreciated that the method described above
primarily descriminates mismatches at or near the 5' terminus of
the surface bound probe oligonucleotide and does little to
discriminate mismatches at, or near, the 5' terminus of the target
(sample) nucleic acid (see FIG. 13b).
[0336] In another embodiment, a ligation can be used to
discriminate mismatches at, or near, the end of the sample nucleic
acid (FIG. 13c). In this instance, the probe oligonucleotides
comprise a constant region and a variable region (e.g., the
variable regions can include all possible 8 mers as illustrated in
FIG. 13c). A constant oligonucleotide (complementary to the
constant region or a subsequence thereof) is hybridized to the
constant region and cross-linked (e.g., covalently bound) at that
location. The remainder of the probe oligonucleotide (e.g., the
variable region or subsequences thereof and optionally a
subsequence of the constant region) forms a 5' overhang to which
the nucleic acid sample can hybridize. Where there are no
mismatches at or near the terminus of the sample oligonucleotide, a
ligation event then joins the sample oligonucleotide to the
constant oligonucleotide. Free nucleic acids are washed away
leaving bound hybridized sample oligonucleotides which can then be
detected.
[0337] In still another embodiment, a double ligation (illustrated
in FIG. 13d) can be used to discriminate mismatches at or near the
ends of both the probe oligonucleotide and the target nucleic acid.
In this approach, the probe oligonucleotides each comprise a
constant region and a variable region as described above in
VIII(A). The surface bound oligonucleotide probes are hybridized to
a constant oligonucleotide having a sequence which is complementary
to the constant region of the oligonucleotide probes. The sample
(target) nucleic acids are contacted to the hybrid duplex in the
presence of a ligase. Where there is no terminal mismatch between
the sample nucleic acid and the variable region, the ligation is
successful resulting in the ligation of the constant
oligonucleotide to the sample nucleic acid (see "first ligation" in
FIG. 13d). This ligation thus discriminates mismatches at the
terminus of the sample nucleic acid.
[0338] The hybridized duplex is contacted with a pool of labeled
ligatable oligonucleotides. Where a ligatable probe is
complementary to the overhange produced by the hybridized sample
nucleic acid and there are no mismatches at or near the free
terminus of the variable region of the probe oligonucleotide a
second ligation will attach the labeled ligatable probe (see FIG.
13d). The second ligation thus discriminates against mismatches
near the free terminus of the probe oligonucleotide. It will be
appreciated that the various hybridization and ligation reactions
may be carried out sequentially or simultaneously, and in a
preferred embodiment are carried out simultaneously.
[0339] As with the previously described method, any enzyme that
catalyzes the formation of a phosphodiester bond at the site of a
single-strand break in duplex DNA can be used to enhance
discrimination between fully complementary hybrids and those that
differ by one or more base pairs. Such ligases include, but are not
limited to, T4 DNA ligase, ligases isolated from E. coli and
ligases isolated from other bacteria or bacteriophages. The
concentration of the ligase will vary depending on the particular
ligase used, the concentration of target and buffer conditions, but
will typically range from about 50 units/ml to about 5,000
units/ml. Moreover, the time in which the array of target
oligonucleotide:oligonucleotide probe hybrid complexes is in
contact with the ligase will vary. Typically, the ligase treatment
is carried out for a period of time ranging from from minutes to
hours. In addition, it will be readily apparent to those of skill
that the two ligation reactions can either be done sequentially or,
alternatively, simultaneously in a single reaction mix that
contains: target oligonucleotides; constant oligonucleotides; a
pool of labeled, ligatable probes; and a ligase.
[0340] In this dual ligation method, the first ligation reaction
generally occurs only if the 5' end of the target oligonucleotide
(i.e., the last 3-4 bases) matches the variable region of the
oligonucleotide probe. Similarly, the second ligation reaction,
which adds a label to the probe, generally occurs efficiently only
if the first ligation reaction was successful and if the ligated
target is complementary to the 5' end of the probe. Thus, this
method provides for specificity at both ends of the variable
region. Moreover, this method is advantageous in that it allows a
shorter variable probe region to be used; increases probe:target
specificity and removes the necessity of labeling the target. Dual
ligation methods of this sort are described in detail in copending
U.S. Ser. No. 08/533,582, filed on Oct. 18, 1995.
[0341] In another embodiment, after hybridization of the nucleotide
complementary to the constant region of the probe oligonculeotides,
the hybrid duplex formed thereby can be permanently cross-linked so
as to prevent subsequent denaturation of the hybrid duplex. When
the sample nucleic acid is ligated to the overhang thus formed it
is also permanently attached to the solid support. In this
embodiment, the use of a ligatable oligonucleotide is optional. The
sample nucleic acid may itself be labeled thereby permitting
detection of the ligated sample nucleic acids.
[0342] Methods for cross-linking nucleic acids are well known to
those of skill in the art. Such methods include, but are not
limited to, baking, exposure to UV, exposure to ionizing radiation,
and contact with chemical cross-linking reagents. In a particularly
preferred embodiment, cross-linking is accomplished by the
formation of covalent bonds with chemical cross-linking reagents.
Preferred cross-linking reagents include bifunctional cross-linking
reagents and cross-linking is accomplished by chemical or
photoactivation of the cross-linking reagent with the nucleic
acids. The reagents may be applied after formation hybrid duplexes,
but in a preferred embodiment, the cross-linker is initially
attached to either the probe or complementary (to the constant
region) nucleic acids before hybridization.
[0343] The cross-linking reagent can be any bifunctional molecule
which covalently cross-links the tester nucleic acid to a
hybridized driver nucleic acid. Generally the cross-linking agent
will be a bifunctional photoreagent which will be monoadducted to
the tester or driver nucleic acids leaving a second photochemically
reactive residue which can bind covalently to the corresponding
hybridized nucleic acid upon photoexcitation. The cross-linking
molecule may also be a mixed chemical and photochemical
bifunctional reagent which will be non-photochemically bound to the
probe or tester nucleic acids via a chemical reaction such as
alkylation, condensation, or addition, followed by photochemical
binding to the corresponding hybridized nucleic acid. Bifunctional
chemical cross-linking molecules activated either catalytically or
by high temperature following hybridization may also be
employed.
[0344] Examples of bifunctional photoreagents include
furocoumarins, benzodipyrones, and bis azides such as bis-azido
ethidium bromide. Examples of mixed bifunctional reagents with both
chemical and photochemical binding moieties include
haloalkyl-furocoumarins, haloalkyl benzodipyrones,
haloalkyl-courmarins and various azido nucleoside
triphosphates.
[0345] Particularly preferred cross-linkers include linear
furocoumarins (psoralens) such as 8-methoxypsoralin,
5-methoxypsoralin and 4,5',8-trimethylpsoralin, and the like. Other
suitable cross-linkers include cis-benzodipyrone and
trans-benzodipyrone. The cross-linker known commercially as Sorlon
is also suitable. For a detailed description of the cross-linking
of hybridized nucleic acids see WO 85/02628.
[0346] The foregoing enhancement discrimination methods involving
the use of ligation reactions can be used in all instances where
improved discrimination between fully complementary hybrids and
those that differ by one or more base pairs would be helpful. More
particularly, such methods can be used to more accurately determine
the sequence (e.g., de novo sequencing), monitor expression,
monitor mutations, or resequence the target nucleic acid (i.e.,
such methods can be used in conjunction with a second sequencing
procedure to provide independent verification). The foregoing is
intended to illustrate, and not restrict, the way in which an array
of target:oligonucleotide hybrid complexes can be treated with a
ligase and a pool of labeled, ligatable probes to improve
hybridization signals on high density oligonucleotide arrays.
[0347] B) Ligation Reaction to Add Sequence Information.
[0348] i) Extended Sequence Information from Simple Ligation.
[0349] The ligation reactions described above can also be used to
increase the sequence information obtained regarding the hybridized
nucleic acid. It will be appreciated that the nucleotide sequence
of each probe oligonucleotide on the high density oligonucleotide
array is known. Specific hybridization to a sample nucleic acid
indicates that the hybridized sample nucleic acid has a sequence or
subsequence complementary to the hybridized probe oligonucleotide.
Thus a hybridization event provides sequence information that can
be used to identify the nucleic acids (e.g., gene transcripts)
present in the hybridized sample. Generally speaking, the sequence
information obtained is governed by the length of the probe
oligonucleotide. Thus, where the probe oligonucleotide is an 8 mer,
8 nucleotides of sequence information is obtained.
[0350] However, the ligation discrimination reactions described
above can be used to provide additional sequence information. In
this embodiment, rather than every possible ligatable
oligonucleotide of a given length, the array and sample nucleic
acids are hybridized to predetermined ligatable oligonucleotides in
which the nucleotides at one or more positions are known.
Successful hybridization and ligation of the label oligonucleotide
thus indicates that the hybridized sample nucleic acid has
nucleotides complementary to the ligatable oligonucleotide in
addition to the probe oligonucleotide.
[0351] Thus, for example, where the probe oligonucleotide is an 8
mer and specific 6 mer ligatable probes are used, the resulting
hybridization will provide 14 nucleotides worth of sequence
information.
[0352] Where different ligatable oligonucleotides are used in this
context, it is desirable to distinguish between the various ligated
oligonucleotides. This can be accomplished by sequential ligations
with each different species of ligatable probe followed by reading
of the array. Alternatively, each species of ligatable
oligonucleotide can be labeled with a different detection label
allowing simultaneous ligation and subsequent detection of the
various different labels.
[0353] ii) Use of a Generic Ligation GeneChip for Interrogating
Sequences Adjacent to Restriction Sites in a Complex (Target)
Sample Nucleic Acid.
[0354] The generic difference arrrays can be used to fingerprint
complex DNA clones or to monitor the complex pattern of gene
expression from a given source. In fingerprinting a nucleic acid
sequence (e.g, an 8 bp sequence) adjacent to a given restriction
enzyme site is sequenced.
[0355] In fingerprinting, a restriction enzyme is used which
cleaves the target at a frequency dependent on the length of the
recognition sequence. The restriction digest thus generate nucleic
acid fragments approximately uniformly distributed along the
genomic DNA. For instance, a 4-cutter like Hsp92 II would cut a
target about once every several hundered basepairs, whereas a
6-cutter, like SacI would cut a target about once every several
thousand (4,000) basepairs. With restriction enzyme fragments, the
individual fragments are typically non-overlapping and average
several thousand basepairs in length. For the purposes of
fingerprinting, with a 6-cutter restriction enzyme it is possible
to examine (2000-3000 fragments X 4000 bases/fragment=8-12 million
basepairs per target. This indicates that it is possible to
routinely sort an 8-12 million basepair target in a high density
array to measure expression differences or to monitor gene
expression (see, e.g., FIG. 14c) thereby providing a characteristic
expression "fingerprint" or abundance difference fingerprint for
each restriction digest of the sample nucleic acid. The
fingerprinting methods thus provide means to subsample a nucleic
acid population in a roughly uniform and reproducible manner and
determine expression profiles and/or abundance differences for
target nucleic acid thus subsampled.
[0356] In general, the method involves providing a high density
generic difference screening array where the probe oligonucleotides
comprise a constant region and a variable region as described
above. In this instance, however, the last few bases of the
constant region (anchor sequence) are selected to complement the 5'
end of the restriction recognition site (see, e.g., FIGS. 14a and
14b) and the complementary anchor sequence is shortened by the
apprpriate number of bases. The variable region can be randomly
selected, haphazardly selected, composition biased as described
above. However, in a preferred embodiment, the variable region
include all possible nucleic acids of a particular length (e.g.,
all possible 3 mers, all possible 4 mers . . . all possible 12
mers), more preferably all possible 8 mers.
[0357] The sample nucleic acids are prepared by fragmentation using
a restriction enzyme. Preferred restriction enzymes leaving only 0,
1, or 2 bases at the 5' end provide a greater specificity of
ligation (i.e., SacI leaves just a 5.degree. C. and Hsp92 II leaves
no recognition site bases at the 5' end). However, restriction
enzymes leaving more bases at the 5' end can be used. Several
restriction enzymes can be used simultaneously if they all leave
the same recognition base at the 5' end. For instance, Aat II,
SacI, SphI, HhaI Bsp1286I, ApaI, Kpn I, Ban II, all leave just a C
at the 5' end making these compatible enzymes. Restriction enzymes
and their characteristic recognition/cleavage sites are well known
to those of skill in the art (see, e.g., CloneTech catalogue,
Clonetech Laboratories Inc. Palo Alto, Calif.).
[0358] The digested target is then hybridized and ligated to the
high density array, preferably in the presence of a complement to
the constant region, using standard conditions (e.g., 30.degree.
C., o/n, 800 U T4 ligase, T4 ligase buffer). The hybridization in
effect sorts (locates and/or localizes) the sample nucleic acids
the position of the sample nuclei acids being determined by the
sequence of the bases adjacent to the restriction site at the 5'
end. The hybridization data can be used directly in an expression
monitoring method as described above, or the same procedure can be
performed on two or more sample nucleic acids for generic
difference screening.
[0359] In a preferred embodiment, one of two formats are used. In
Format 1, the ligated fragment (e.g, the sample nucleic acid and,
optionally, the complement to the constant region) is locked into
place in the high density array by its attachment (e.g., by
cross-linking) to the complement (e.g., by the use of a psoralen).
The complementary strand to the fragment can be denatured and
washed off of the array with a dilute base (e.g., 1 N NaOH). These
cross-linked fragments can then be used as probes in a second round
of hybridization to one or more nucleic acid samples. Differential
nucleic acid abundances (e.g., differential gene expression) can
then be monitored by comparing the hybriidzation pattern between
different nucleic acids hybridized simultaneously or sequentially
to the same array or separate arrays.
[0360] In a second format (format II), particularly where the
sample nucleic acid is a deoxynucleic acid sample, the DNA is
restriction digested as described above, and then directly
hybridized/ligated to the generic difference array. Sites where
intensity differences occur indicate a difference in nucleic acid
abundance. The differentially abundant (e.g., differentially
expressed) nucleic acid can be cloned by designing primers specific
to that nucleic acid based upon the sequence information derived
from the location of the probe in the array and the sequence of the
recognition site. For an 8 mer (variable region) and a 6 base
restrictino enzyme, this gives a 14 mer primer sequence. For short
genomes, a 14 mer primer may be used to isolate the clone. Longer
genomes become more tractable as the length of the primary probes
(variable region) increases beyond 8 mers.
[0361] The restriction enzyme digested sample nucleic acid is
preferably labeled and ligated to the high density array in
fingerprinting method and in format II (see discussion above and
FIG. 14d). In the case of format I assays the ligated target
sequence is preferably not labeled and instead, serves as a
hybridization probe in a second round of hybridization of labeled
sample nucleic acids to the high density array.
[0362] To insure that sites which have not been cleaved by the
given restriction enzymes do not ligate to the high density aray,
alkaline phsophatase can be used to treat the sample nucleic acids
before restriction enzyme digestion.
[0363] iii) Analyis of Differential Display Fragments on a Generic
Difference Array.
[0364] The principle behind differential display is to generat a
set of randomly primed amplification (e.g., PCR) fragments from a
first strand cDNA population transcribed from RNA using anchor
primers of the form:
[0365] (T).sub.nVA, (T).sub.nVG, (T).sub.nVC, and (T).sub.nVT
[0366] in which V is A, G, or C, and n ranges from about 6 to about
30, preferably from about 8 to about 20 and more preferably about
10 to about 16 with n=14 being most preferred. Depending on what
random primer and anchoring primer and anchoring proimer is chosen,
different sets of cDNA transcripts are represented in a particular
nucleic acid fragment set. These amplification fragments are
analyzed by sorting the fragments on a generic screening
oligonculeotide array where they hybridize based on the sequence at
the 5' end of the fragement.
[0367] The method is illustrated in FIGS. 16a through 16e. First
strand cDNA is synthesized by reverse transcriptio of poly(A) mRNA
using an anchored poly(t) primer according to standard methods
(FIG. 16a). The first strand DNA acts as a template for
amplification (e.g, via PCR) using upstream primers comprising an
engineered restriction site and one or more degenerate bases
(N=A,C,G,T) at the 3' end. Randomly primed PCR is then performed
using the upstream primers the anchor primers and a random primer
(e.g., anchor primers (T).sub.14VA, (T).sub.14VG, (T).sub.14VC,
(T).sub.14VT and random primer e.g., SacI site: 5'-CATGAGCTCNN).
The resulting amplification fragments are then digested with a
restriction endonuclease corresponding to the engineered
restriction sites. The resulting sample nucleic acids are then
hybridized to a generic difference screening array as described
above.
[0368] The method is preferably performed to two or more nucleic
acid samples thereby allowing use of the generic difference
screening methods of this invention. In one embodiment, the probe
oligonucleotides comprise a constant region complementary to the
remaining restriction site on the sample nucleic acids if present.
The remaining analysis proceeds as described above.
[0369] The method allows analysis of several thousand or even more
"bands" (nucleic acids) simultaneously. furthermore, sequence
information is also provided on the differentially abundant nucleic
acid. For example where the cleavage is with Sac I, providing a 9
base tail (CATGAGCTC) the array can comprise probe oligonucleotides
haveing a complementary 9 base constant region and variable regions
comprising all possible 9 mers. This provides 17 nucletides of
sequence information for each hybridization (9 mer constant+8 mer
variable).
[0370] iv) Use of Ligation to Extract Additional Sequence
Information from Restriction Selected Nucleic Acid
Hybridizations.
[0371] Ligation reactions can also be used in combination with
restriction digests to subsample the sample nucleic acids at
approximately uniform intervals and simultaneously provide
additional sequence information using a ligation reaction. In this
embodiment, a high density array is provided in which the probe
oligonucleotides comprise a nucleic acid sequence complementary to
the sense or antisense strand of a restriction site (see, e.g.,
FIG. 14). The sample nucleic acids are digested randomly with a
DNAse or specifically with a restriction endonuclease (e.g., Sau
3A). The digested oligoncleotides are then hybridized to the high
density array. Only those nucleic acids having termini
complementary to the constant regions will bind to the probe
oligonucleotides. Thus, the restriction fragments will be
preferentially selected.
[0372] The array is also hybridized with a pool of ligatable
oligonucleotides comprising all possible oligonucleotides of a
particular length (e.g., a 6 mer) in the presence of a ligase
thereby ligating the complementary ligatable oligonucleotides to
the terminus of the probe oligonucleotide. This produces probe
oligonucleotides increased in length by the length of the ligatable
oligonucleotide and complementary to nucleic acids known to be
present in the nucleic acid sample.
[0373] The DNA is then stripped off of the array and the elongated
probes are used to perform generic difference screening of the
nucleic acid samples as described above. When probes corresponding
to nucleic acid differentially expressed in the various samples are
identified, the known probe sequence can be used to identify the
nucleic acids that are differentially expressed in the samples.
[0374] In one embodiment, this is accomplished by producing 4
primer oligonucleotides comprising the constant region plus the
known variable region and an additional nucleotide (A, G, C, or T)
on one end. The genomic clone is then digested with a second
restriction enzyme and ligated to an adaptor sequence. Using the 4
primer olgionucleotides and the adapter sequence as primers the
genomic sequence of interest can be amplified (e.g., using PCR)
from the genomic clones. The PCR amplfiied sequence can then be
used to probe (e.g., in a Southern blot) the cDNA library to obtain
the whole cDNA of interest.
[0375] For example, in one embodiment, a 10 mer high denity array
is designed so that it comprises all possible combination of 10 mer
oligonucleotides (i.e., 4.sup.10=1048576 nucleic acids) and, at the
beginning of each oligonucleotide, a constant sequence (e.g,
3'-TAGT-5'), the first 4 bases of which are complementary to the
recognition sequence of a restriction enzyme (e.g., Sau 3A plus one
base T).
[0376] Complete digestion of a large genomic clone or a simplified
cDNA library (e.g., a cDNA library that only includes parts of the
5' end or 3' end of whole mRNA) with, for example, a 4 cutter
enzyme (illustrated herein by Sau 3A) generates DNA fragments with
a 5' overhang sequence (for Sau 3A, the overhange is GATC). The
recognition site exists at approximately every 500 bp.
[0377] When the DNA fragments are hybridized with the 10 mer chip
in the presence of all possible combinations of a ligatable
oligonucleotide of a particular length (e.g., a 6 mer) and a T4 DNA
ligase the ligatable oligonucleotide is ligated onto the probe
oligonucletide.
[0378] The DNA is then stripped off the the chip and generic
difference screening is performed as described above. This permits
identification of probe olgioonculeotides that hyridize to nucleic
acids that are present at different levels in the tested
samples.
[0379] Based on the 14 bp sequence in this example (5 mer constant
region bases plus 10 mers) from the probes of interest in the
array, four 16 base primers are produced by adding one base (A, G,
C, or T) at the end. Using these primers and adaptor sequences as
primers, the genomic sequence of interest can be amplified. The
amplified sequence can then be used to probe a cDNA library to
obtain the whole cDNA of interest as described above.
[0380] IX. Signal Evaluation.
[0381] A) Signal Evaluation for Expression Monitoring.
[0382] One of skill in the art will appreciate that methods for
evaluating the hybridization results vary with the nature of the
specific probe nucleic acids used as well as the controls provided.
In the simplest embodiment, simple quantification of the
fluorescence intensity for each probe is determined. This is
accomplished simply by measuring probe signal strength at each
location (representing a different probe) on the high density array
(e.g., where the label is a fluorescent label, detection of the
amount of fluorescence (intensity) produced by a fixed excitation
illumination at each location on the array). Comparison of the
absolute intensities of an array hybridized to nucleic acids from a
"test" sample with intensities produced by a "control" sample
provides a measure of the relative abundance of the nucleic acids
that hybridize to each of the probes.
[0383] One of skill in the art, however, will appreciate that
hybridization signals will vary in strength with efficiency of
hybridization, the amount of label on the sample nucleic acid and
the amount of the particular nucleic acid in the sample. Typically
nucleic acids present at very low levels (e.g., <1 pM) will show
a very weak signal. At some low level of concentration, the signal
becomes virtually indistinguishable from background. In evaluating
the hybridization data, a threshold intensity value may be selected
below which a signal is not counted as being essentially
indistinguishable from background.
[0384] Where it is desirable to detect nucleic acids expressed at
lower levels, a lower threshold is chosen. Conversely, where only
high expression levels are to be evaluated a higher threshold level
is selected. In a preferred embodiment, a suitable threshold is
about 10% above that of the average background signal.
[0385] In addition, the provision of appropriate controls permits a
more detailed analysis that controls for variations in
hybridization conditions, cell health, non-specific binding and the
like. Thus, for example, in a preferred embodiment, the
hybridization array is provided with normalization controls as
described above in Section IV(A)(2). These normalization controls
are probes complementary to control sequences added in a known
concentration to the sample. Where the overall hybridization
conditions are poor, the normalization controls will show a smaller
signal reflecting reduced hybridization. Conversely, where
hybridization conditions are good, the normalization controls will
provide a higher signal reflecting the improved hybridization.
Normalization of the signal derived from other probes in the array
to the normalization controls thus provides a control for
variations in array synthesis or in hybridization conditions.
Typically, normalization is accomplished by dividing the measured
signal from the other probes in the array by the average signal
produced by the normalization controls. Normalization may also
include correction for variations due to sample preparation and
amplification. Such normalization may be accomplished by dividing
the measured signal by the average signal from the sample
preparation/amplfication control probes (e.g., the BioB probes).
The resulting values may be multiplied by a constant value to scale
the results.
[0386] As indicated above, the high density array can include
mismatch controls or, in the case of generic difference screening
arrays, pairs of related oligonucleotie probes differing in one or
more preselected nucleotides. In preferred expression monitoring
arrays, there is a mismatch control having a central mismatch for
every probe (except the normalization controls) in the array. It is
expected that after washing in stringent conditions, where a
perfect match would be expected to hybridize to the probe, but not
to the mismatch, the signal from the mismatch controls should
primarily reflect non-specific binding or the presence in the
sample of a nucleic acid that hybridizes with the mismatch. In
expression monitoring analyses, where both the probe in question
and its corresponding mismatch control both show high signals, or
the mismatch shows a higher signal than its corresponding test
probe, the signal from those probes is preferably ignored. The
difference in hybridization signal intensity between the target
specific probe and its corresponding mismatch control is a measure
of the discrimination of the target-specific probe. Thus, in a
preferred embodiment, the signal of the mismatch probe is
subtracted from the signal from its corresponding test probe to
provide a measure of the signal due to specific binding of the test
probe. Similar, as discussed below, in generic difference
screening, the difference between probe pairs is calculated.
[0387] The concentration of a particular sequence can then be
determined by measuring the signal intensity of each of the probes
that bind specifically to that nucleic acid and normalizing to the
normalization controls. Where the signal from the probes is greater
than the mismatch, the mismatch is subtracted. Where the mismatch
intensity is equal to or greater than its corresponding test probe,
the signal is ignored. The expression level of a particular gene
can then be scored by the number of positive signals (either
absolute or above a threshold value), the intensity of the positive
signals (either absolute or above a selected threshold value), or a
combination of both metrics (e.g., a weighted average).
[0388] It is a surprising discovery of this invention, that
normalization controls are often unnecessary for useful
quantification of a hybridization signal. Thus, where optimal
probes have been identified in the two step selection process as
described above, in Section IV(B)(ii)(a), the average hybridization
signal produced by the selected optimal probes provides a good
quantified measure of the concentration of hybridized nucleic
acid.
[0389] B) Signal Evaluation for Generic Difference Screening.
[0390] Signal evaluation for generic difference screening is
performed in essentially the same manner as expression monitoring
described above. However, data is evaluated on a probe-by-probe
basis rather than a gene by gene basis.
[0391] In a preferred embodiment, for each probe oligonucleotide
the signal intensity difference between the members of each probe
pair (K) is calculated as:
X.sub.ijk1-X.sub.ijk2
[0392] where X is the hybridization intensity of the probe, i
indicates which sample (in this case sample 1 or 2), and j
indicates which replicate for each sample (in the case of Example 7
where there were two replicates for each nucleic acid sample, j is
1 or 2), K is the probe pair ID number (in the case of Example 7, 1
. . . 34,320), and 1 indicates one member of the probe pair, while
2 indicates the other member of the probe pair.
[0393] The differences between the signal intensity difference for
each probe pair between the replicates for each sample is then
calculated. Thus, for example, the differences between replicate 1
and 2 of sample 1 (e.g, a normal the normal cell line) and between
replicate 1 and replicate 2 of sample 2 (e.g., athe tumor cell
line) for each probe is calculated as
[0394] (X.sub.11k1-X.sub.11k2)-(X.sub.12k1-X.sub.12k2)
[0395] for k-1 to the total number of probes.
[0396] The replicates can be normalized to each other as:
[0397] (X.sub.11k1-X.sub.11k2)/(X.sub.12k1-X.sub.12k2) for sample 1
or
[0398] (X.sub.21k1-X.sub.21k2) (X.sub.22k1-X.sub.22k2) for sample
2
[0399] for all probe pairs (i.e., after normalization, the average
ratio should approximate 1).
[0400] Finally, the the differences between sample 1 and 2 averaged
over the two replicates is calculated. This value is calculated
as
[0401] ((X.sub.21k1+X.sub.22k2)/2)-((X.sub.11k1+X.sub.12k2)/2)
[0402] after normalization between the two samples based on the
average ratio of
[0403] [(X.sub.21k1+X.sub.22k2)/2]/[(X.sub.11k1+X.sub.12k2)/2]
[0404] This data is plotted as a function of probe number (ID) and
probes having differentially hybridized nucleic acids are readily
discernable (see, e.g., FIG. 16c).
[0405] However, the data may also be filtered to reduce background
signal. In this instance, after normalization between replicates
(see above), the ratio is calculated as follows: If the absolute
value of (X.sub.11k1-X.sub.11k2)/(X.sub.12k1-X.sub.12k2)>1, then
the ratio=(X.sub.11k1-X.sub.11k2)/(X.sub.12k1-X.sub.12k2) else the
ratio=(X.sub.12k1-X.sub.12k2)/(X.sub.11k1-X.sub.11k2) (the
inverse).
[0406] The ratio of replicate 1 and 2 of sample 2 for the
difference of each oligonucleotide pair, is calculated in the same
way, but based on the absolute value of
[0407] (X.sub.21k1-X.sub.21k2)/(X.sub.22k1-X.sub.22k2) and
[0408] (X.sub.22k1-X.sub.22k2)/(X.sub.21k1-X.sub.21k2)
[0409] Finally, as above, the ratio of sample 1 and sample 2
averaged over two replicates for the difference of each
oligonucleotide pairis calculated as in FIG. 17a, but based on the
absolute value of
[0410] [(X.sub.21k1+X.sub.22k2)/2]/[(X.sub.11k1+X.sub.12k2)/2]
and
[0411] [(X.sub.11k1+X.sub.12k2)/2][(X.sub.21k1+X.sub.22k2)/2]
[0412] after normalization as described above.
[0413] The oligonucleotide pairs that show the greatest
differential hybridization between the two samples can be
identified by sorting the observed hybridization ratio and
difference values. The oligonucleotides that show the largest
change (increase or decrease) can be readily seen from the ratio
plot (see, e.g. FIG. 17c).
[0414] X. Identification of Gene Whose Expression is Altered.
[0415] As indicated above, the nucleic acid sequences of the probe
oligonucleotides comprising the high density arrays are known. The
sequences of the probes showing the largest hybridization
differences (and families of such differences) can be used to
identify the differentially expressed genes in the compared samples
by any of a number of means.
[0416] Thus, for example, sequences of the differentially
hybridizing probes may be used to search a nucleic acid database
(e.g., by a BLAST, or related search of the fragments against all
known sequences). Alternatively, some sequence reconstruction using
the families of probes that change by similar amounts can also be
done. The database search for known genes that include sequences
complementary (or nearly complementary) to the probes that change
the most is not difficult and because it is generally easier than
sequence reconstruction is the preferred method for identifying the
differentially expressed sequences.
[0417] In another embodiment, the differential hybridization
pattern indicates that there are significant differences in the
overall expression profile(s) between the tested samples, and
identifies probes that are specific for the differences. These
probes can be used as specific affinity reagents to extract from
the samples the parts that differ. This can be accomplished in
several ways:
[0418] In one approach, the material hybridized to the probes that
show the greatest differences between samples can be
micro-extracted from the high density array. For example, the
hybridized nucleic acids can be removed using small capillaries.
Alternatively probes that are anchored to the chip with a
photolabile linker can be released by selective irradiation at the
desired parts of the high-density array.
[0419] In another approach, because the sequence of all the probes
on the high-density array is known, and the probes that hybridize
differentially have been identified, the latter can be used as
affinity reagents to extract the nucleic acids that differentially
hybridize in the test samples. Once the differentially hybridizing
probes are identified in the array, the probe (or probes) can be
synthesized on beads (or other solid support) and hybridized to the
samples (not necessarily fragmented for this step--full length
clones may be desirable). The material that is extracted can be
cloned and/or sequenced, according to standard methods known to
those of skill in the art, to obtain the desired information about
the differentially expressed species (e.g. clones can be screened
with labeled oligonucleotides to determine ones with appropriate
inserts, and/or randomly chosen and sequenced).
[0420] In still another approach, the sequence of the hybridized
probes of interest can be used to generate amplification primers
(e.g., reverse transcription and/or PCR primers). The
differentially expressed sequence can then be amplified and used as
a probe to probe a genomic or cDNA library using sequence sprecific
primers determined from the array in combination with specific
sequences added during a reverse transcriptase cDNA step as
described above (e.g., primer based on poly A or added 3'
sequence). Examples of appropriate cloning and sequencing
techniques, and instructions sufficient to direct persons of skill
through many cloning exercises are found in Berger and Kimmel,
Guide to Molecular Cloning Techniques, Methods in Enzymology volume
152 Academic Press, Inc., San Diego, Calif.; Sambrook et al. (1989)
Molecular Cloning--A Laboratory Manual (2nd ed.) Vol. 1-3; and
Current Protocols in Molecular Biology, F. M. Ausubel et al., eds.,
Current Protocols, a joint venture between Greene Publishing
Associates, Inc. and John Wiley & Sons, Inc., (1994 Supplement)
(Ausubel). Product information from manufacturers of biological
reagents and experimental equipment also provide information useful
in known biological methods. Such manufacturers include the SIGMA
chemical company (Saint Louis, Mo.), R&D systems (Minneapolis,
Minn.), Pharmacia LKB Biotechnology (Piscataway, N.J.), CLONTECH
Laboratories, Inc. (Palo Alto, Calif.), Chem Genes Corp., Aldrich
Chemical Company (Milwaukee, Wis.), Glen Research, Inc., GIBCO BRL
Life Technologies, Inc. (Gaithersberg, Md.), Fluka
Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland),
Invitrogen, San Diego, Calif., and Applied Biosystems (Foster City,
Calif.), as well as many other commercial sources known to one of
skill.
[0421] In short, using the above-described method, differentially
expressed genes can be identified without prior assumptions about
which genes to monitor and without prior knowledge of sequence.
Once identified (and sequenced if not a previously sequenced gene),
the new sequences can be included in a high density array designed
to detect and quantify specific genes in the same way as described
in copending applications No. 08/529,115 filed on Sep. 15, 1995 and
PCT/US96/14839. Thus, the two approaches are complementary in that
one can be used to broadly search for expression differences of
perhaps unknown genes, while the other is used to more specifically
monitor those genes that have been chosen as important or those
genes that have been previously at least partially sequenced.
[0422] XI. Kits for Expression Monitoring and Generic Difference
Screening.
[0423] In another embodiment, this invention provides kits for
expression monitoring and/or generic difference screening. The kits
include, but are not limited to a a container or containers
containing one or more high density oligonucleotide arrays of this
invention. Preferred kits for generic difference screening include
at least two high density arrays. The kits can also include a label
or labels for labeling one or more nucleic acid samples. In
addition, the kits can include one or more ligatable
oligonucleotides. In certain embodiments, the kit contains pools of
different ligatable oligonucleotides, preferably pools of every
possible oligonucleotide of a particular length (e.g., all possible
6 mers) or sets of specific ligatable oligonucleotides. One of
skill in the art will appreciate that the kits may include any
other of the various blocking reagents, labels, devices (e.g,
trays, microscope filters, syringes, etc.) buffers, and the like
useful for performing the hybridizations and ligation reactions
described herein. In addition, the kits may include software
provided on a storage medium (e.g., optical or magnetic disk) for
the selection of probes and/or the analysis of hybridization data
as described herein. In addition, the kits may contain
instructional materials teaching the use of the kit in the various
methods of this invention (e.g., in practice of various expression
monitoring methods or generic difference screening methods
described herein).
[0424] XII. Computer-Implemented Expression Monitoring.
[0425] The methods of monitoring gene expression of this invention
may be performed utilizing a computer. The computer typically runs
a software program that includes computer code incorporating the
invention for analyzing hybridization intensities measured from a
substrate or chip and thus, monitoring the expression of one or
more genes or screening for differences in nucleic acid abundances.
Although the following will describe specific embodiments of the
invention, the invention is not limited to any one embodiment so
the following is for purposes of illustration and not
limitation.
[0426] FIG. 6 illustrates an example of a computer system used to
execute the software of an embodiment of the present invention. As
shown, shows a computer system 100 includes a monitor 102, screen
104, cabinet 106, keyboard 108, and mouse 110. Mouse 110 may have
one or more buttons such as mouse buttons 112. Cabinet 106 houses a
CD-ROM drive 114, a system memory and a hard drive (both shown in
FIG. 7) which may be utilized to store and retrieve software
programs incorporating computer code that implements the invention,
data for use with the invention, and the like. Although a CD-ROM
116 is shown as an exemplary computer readable storage medium,
other computer readable storage media including floppy disks, tape,
flash memory, system memory, and hard drives may be utilized.
Cabinet 106 also houses familiar computer components (not shown)
such as a central processor, system memory, hard disk, and the
like.
[0427] FIG. 7 shows a system block diagram of computer system 100
used to execute the software of an embodiment of the present
invention. As in FIG. 6, computer system 100 includes monitor 102
and keyboard 108. Computer system 100 further includes subsystems
such as a central processor 120, system memory 122, I/O controller
124, display adapter 126, removable disk 128 (e.g., CD-ROM drive),
fixed disk 130 (e.g., hard drive), network interface 132, and
speaker 134. Other computer systems suitable for use with the
present invention may include additional or fewer subsystems. For
example, another computer system could include more than one
processor 120 (i.e., a multi-processor system) or a cache
memory.
[0428] Arrows such as 136 represent the system bus architecture of
computer system 100. However, these arrows are illustrative of any
interconnection scheme serving to link the subsystems. For example,
a local bus could be utilized to connect the central processor to
the system memory and display adapter. Computer system 100 shown in
FIG. 7 is but an example of a computer system suitable for use with
the present invention. Other configurations of subsystems suitable
for use with the present invention will be readily apparent to one
of ordinary skill in the art.
[0429] FIG. 8 shows a flowchart of a process of monitoring the
expression of a gene. The process compares hybridization
intensities of pairs of perfect match and mismatch probes that are
preferably covalently attached to the surface of a substrate or
chip. Most preferably, the nucleic acid probes have a density
greater than about 60 different nucleic acid probes per 1 cm.sup.2
of the substrate. Although the flowcharts show a sequence of steps
for clarity, this is not an indication that the steps must be
performed in this specific order. One of ordinary skill in the art
would readily recognize that many of the steps may be reordered,
combined, and deleted without departing from the invention.
[0430] Initially, nucleic acid probes are selected that are
complementary to the target sequence (or gene). These probes are
the perfect match probes. Another set of probes is specified that
are intended to be not perfectly complementary to the target
sequence. These probes are the mismatch probes and each mismatch
probe includes at least one nucleotide mismatch from a perfect
match probe. Accordingly, a mismatch probe and the perfect match
probe from which it was derived make up a pair of probes. As
mentioned earlier, the nucleotide mismatch is preferably near the
center of the mismatch probe.
[0431] The probe lengths of the perfect match probes are typically
chosen to exhibit high hybridization affinity with the target
sequence. For example, the nucleic acid probes may be all 20-mers.
However, probes of varying lengths may also be synthesized on the
substrate for any number of reasons including resolving
ambiguities.
[0432] The target sequence is typically fragmented, labeled and
exposed to a substrate including the nucleic acid probes as
described earlier. The hybridization intensities of the nucleic
acid probes is then measured and input into a computer system. The
computer system may be the same system that directs the substrate
hybridization or it may be a different system altogether. Of
course, any computer system for use with the invention should have
available other details of the experiment including possibly the
gene name, gene sequence, probe sequences, probe locations on the
substrate, and the like.
[0433] Referring to FIG. 8, after hybridization, the computer
system receives input of hybridization intensities of the multiple
pairs of perfect match and mismatch probes at step 202. The
hybridization intensities indicate hybridization affinity between
the nucleic acid probes and the target nucleic acid (which
corresponds to a gene). Each pair includes a perfect match probe
that is perfectly complementary to a portion of the target nucleic
acid and a mismatch probe that differs from the perfect match probe
by at least one nucleotide.
[0434] At step 204, the computer system compares the hybridization
intensities of the perfect match and mismatch probes of each pair.
If the gene is expressed, the hybridization intensity (or affinity)
of a perfect match probe of a pair should be recognizably higher
than the corresponding mismatch probe. Generally, if the
hybridizations intensities of a pair of probes are substantially
the same, it may indicate the gene is not expressed. However, the
determination is not based on a single pair of probes, the
determination of whether a gene is expressed is based on an
analysis of many pairs of probes. An exemplary process of comparing
the hybridization intensities of the pairs of probes will be
described in more detail in reference to FIG. 9.
[0435] After the system compares the hybridization intensity of the
perfect match and mismatch probes, the system indicates expression
of the gene at step 206. As an example, the system may indicate to
a user that the gene is either present (expressed), marginal or
absent (unexpressed).
[0436] FIG. 9 shows a flowchart of a process of determining if a
gene is expressed utilizing a decision matrix. At step 252, the
computer system receives raw scan data of N pairs of perfect match
and mismatch probes. In a preferred embodiment, the hybridization
intensities are photon counts from a fluorescein labeled target
that has hybridized to the probes on the substrate. For simplicity,
the hybridization intensity of a perfect match probe will be
designed "I.sub.pm" and the hybridization intensity of a mismatch
probe will be designed "I.sub.mm."
[0437] Hybridization intensities for a pair of probes is retrieved
at step 254. The background signal intensity is subtracted from
each of the hybridization intensities of the pair at step 256.
Background subtraction may also be performed on all the raw scan
data at the same time.
[0438] At step 258, the hybridization intensities of the pair of
probes are compared to a difference threshold (D) and a ratio
threshold (R). It is determined if the difference between the
hybridization intensities of the pair (I.sub.pm-I.sub.mm) is
greater than or equal to the difference threshold AND the quotient
of the hybridization intensities of the pair (I.sub.pm/I.sub.mm) is
greater than or equal to the ratio threshold. The difference
thresholds are typically user defined values that have been
determined to produce accurate expression monitoring of a gene or
genes. In one embodiment, the difference threshold is 20 and the
ratio threshold is 1.2.
[0439] If I.sub.pm-I.sub.mm>=D and I.sub.pm/I.sub.mm>=R, the
value NPOS is incremented at step 260. In general, NPOS is a value
that indicates the number of pairs of probes which have
hybridization intensities indicating that the gene is likely
expressed. NPOS is utilized in a determination of the expression of
the gene.
[0440] At step 262, it is determined if I.sub.mm-I.sub.pm>=D and
I.sub.mm/I.sub.pm>=R. If this expression is true, the value NNEG
is incremented at step 264. In general, NNEG is a value that
indicates the number of pairs of probes which have hybridization
intensities indicating that the gene is likely not expressed. NNEG,
like NPOS, is utilized in a determination of the expression of the
gene.
[0441] For each pair that exhibits hybridization intensities either
indicating the gene is expressed or not expressed, a log ratio
value (LR) and intensity difference value (IDIF) are calculated at
step 266. LR is calculated by the log of the quotient of the
hybridization intensities of the pair (I.sub.pm/I.sub.mm). The IDIF
is calculated by the difference between the hybridization
intensities of the pair (I.sub.pm-I.sub.mm). If there is a next
pair of hybridization intensities at step 268, they are retrieved
at step 254.
[0442] At step 272, a decision matrix is utilized to indicate if
the gene is expressed. The decision matrix utilizes the values N,
NPOS, NNEG, and LR (multiple LRs). The following four assignments
are performed:
[0443] P1=NPOS/NNEG
[0444] P2=NPOS/N
[0445] P3=(10*SUM(LR))/(NPOS+NNEG)
[0446] These P values are then utilized to determine if the gene is
expressed.
[0447] For purposes of illustration, the P values are broken down
into ranges. If P1 is greater than or equal to 2.1, then A is true.
If P1 is less than 2.1 and greater than or equal to 1.8, then B is
true. Otherwise, C is true. Thus, P1 is broken down into three
ranges A, B and C. This is done to aid the readers understanding of
the invention.
[0448] Thus, all of the P values are broken down into ranges
according to the following:
[0449] A=(P1>=2.1)
[0450] B=(2.1>P1>=1.8)
[0451] C=(P1<1.8)
[0452] X=(P2>=0.35)
[0453] Y=(0.35>P2>=0.20)
[0454] Z=(P2<0.20)
[0455] Q=(P3>=1.5)
[0456] R=(1.5>P3>=1.1)
[0457] S.dbd.(P3<1.1)
[0458] Once the P values are broken down into ranges according to
the above boolean values, the gene expression is determined.
[0459] The gene expression is indicated as present (expressed),
marginal or absent (not expressed). The gene is indicated as
expressed if the following expression is true: A and (X or Y) and
(Q or R). In other words, the gene is indicated as expressed if
P1>=2.1, P2>=0.20 and P3>=1.1. Additionally, the gene is
indicated as expressed if the following expression is true: B and X
and Q.
[0460] With the forgoing explanation, the following is a summary of
the gene expression indications:
5 Present A and (X or Y) and (Q or R) B and X and I Marginal A and
X and S B and X and R B and Y and (Q or R) Absent All others cases
(e.g., any C combination)
[0461] In the output to the user, present may be indicated as "P,"
marginal as "M" and absent as "A" at step 274.
[0462] Once all the pairs of probes have been processed and the
expression of the gene indicated, an average of ten times the LRs
is computed at step 275. Additionally, an average of the IDIF
values for the probes that incremented NPOS and NNEG is calculated.
These values may be utilized for quantitative comparisons of this
experiments with other experiments.
[0463] Quantitative measurements may be performed at step 276. For
example, the current experiment may be compared to a previous
experiment (e.g., utilizing values calculated at step 270).
Additionally, the experiment may be compared to hybridization
intensities of RNA (such as from bacteria) present in the
biological sample in a known quantity. In this manner, one may
verify the correctness of the gene expression indication or call,
modify threshold values, or perform any number of modifications of
the preceding.
[0464] For simplicity, FIG. 9 was described in reference to a
single gene. However, the process may be utilized on multiple genes
in a biological sample. Therefore, any discussion of the analysis
of a single gene is not an indication that the process may not be
extended to processing multiple genes.
[0465] FIGS. 10A and 10B show the flow of a process of determining
the expression of a gene by comparing baseline scan data and
experimental scan data. For example, the baseline scan data may be
from a biological sample where it is known the gene is expressed.
Thus, this scan data may be compared to a different biological
sample to determine if the gene is expressed. Additionally, it may
be determined how the expression of a gene or genes changes over
time in a biological organism.
[0466] At step 302, the computer system receives raw scan data of N
pairs of perfect match and mismatch probes from the baseline. The
hybridization intensity of a perfect match probe from the baseline
will be designed "I.sub.pm" and the hybridization intensity of a
mismatch probe from the baseline will be designed "I.sub.mm." The
background signal intensity is subtracted from each of the
hybridization intensities of the pairs of baseline scan data at
step 304.
[0467] At step 306, the computer system receives raw scan data of N
pairs of perfect match and mismatch probes from the experimental
biological sample. The hybridization intensity of a perfect match
probes from the experiment will be designed "J.sub.pm" and the
hybridization intensity of a mismatch probe from the experiment
will be designed "J.sub.mm." The background signal intensity is
subtracted from each of the hybridization intensities of the pairs
of experimental scan data at step 308.
[0468] The hybridization intensities of an I and J pair may be
normalized at step 310. For example, the hybridization intensities
of the I and J pairs may be divided by the hybridization intensity
of control probes as discussed above in Section IV(A).
[0469] At step 312, the hybridization intensities of the I and J
pair of probes are compared to a difference threshold (DDIF) and a
ratio threshold (RDIF). It is determined if the difference between
the hybridization intensities of the one pair (J.sub.pm-J.sub.mm)
and the other pair (I.sub.pm-I.sub.mm) are greater than or equal to
the difference threshold AND the quotient of the hybridization
intensities of one pair (J.sub.pm-J.sub.mm) and the other pair
(I.sub.pm-I.sub.mm) are greater than or equal to the ratio
threshold. The difference thresholds are typically user defined
values that have been determined to produce accurate expression
monitoring of a gene or genes.
[0470] If (J.sub.pm-J.sub.mm)-(I.sub.pm-I.sub.mm)>=DDIF and
(J.sub.pm-J.sub.mm)/(I.sub.pm-I.sub.mm)>=RDIF, the value NINC is
incremented at step 314. In general, NINC is a value that indicates
the experimental pair of probes indicates that the gene expression
is likely greater (or increased) than the baseline sample. NINC is
utilized in a determination of whether the expression of the gene
is greater (or increased), less (or decreased) or did not change in
the experimental sample compared to the baseline sample.
[0471] At step 316, it is determined if
(J.sub.pm-J.sub.mm)-(I.sub.pm-I.su- b.mm)>=DDIF and
(J.sub.pm-J.sub.mm)/(I.sub.pm/I.sub.mm)>=RDIF. If this
expression is true, NDEC is incremented. In general, NDEC is a
value that indicates the experimental pair of probes indicates that
the gene expression is likely less (or decreased) than the baseline
sample. NDEC is utilized in a determination of whether the
expression of the gene is greater (or increased), less (or
decreased) or did not change in the experimental sample compared to
the baseline sample.
[0472] For each of the pairs that exhibits hybridization
intensities either indicating the gene is expressed more or less in
the experimental sample, the values NPOS, NNEG and LR are
calculated for each pair of probes. These values are calculated as
discussed above in reference to FIG. 9. A suffix of either "B" or
"E" has been added to each value in order to indicate if the value
denotes the baseline sample or the experimental sample,
respectively. If there are next pairs of hybridization intensities
at step 322, they are processed in a similar manner as shown.
[0473] Referring now to FIG. 10B, an absolute decision computation
is performed for both the baseline and experimental samples at step
324. The absolute decision computation is an indication of whether
the gene is expressed, marginal or absent in each of the baseline
and experimental samples. Accordingly, in a preferred embodiment,
this step entails performing steps 272 and 274 from FIG. 9 for each
of the samples. This being done, there is an indication of gene
expression for each of the samples taken alone.
[0474] At step 326, a decision matrix is utilized to determine the
difference in gene expression between the two samples. This
decision matrix utilizes the values, N, NPOSB, NPOSE, NNEGB, NNEGE,
NINC, NDEC, LRB, and LRE as they were calculated above. The
decision matrix performs different calculations depending on
whether NINC is greater than or equal to NDEC. The calculations are
as follows.
[0475] If NINC>=NDEC, the following four P values are
determined:
[0476] P1=NINC/NDEC
[0477] P2=NINC/N
[0478] P3=((NPOSE-NPOSB)-(NNEGE-NNEGB))/N
[0479] P4=10*SUM(LRE-LRB)/N
[0480] These P values are then utilized to determine the difference
in gene expression between the two samples.
[0481] For purposes of illustration, the P values are broken down
into ranges as was done previously. Thus, all of the P values are
broken down into ranges according to the following:
[0482] A=(P1>=2.7)
[0483] B=(2.7>P1>=1.8)
[0484] C=(P1<1.8)
[0485] X=(P2>=0.24)
[0486] Y=(0.24>P2>=0.16)
[0487] Z=(P2<0.160)
[0488] M=(P3>=0.17)
[0489] N=(0.17>P3>=0.10)
[0490] O.dbd.(P3<0.10)
[0491] Q=(P4>=1.3)
[0492] R=(1.3>P4>=0.9)
[0493] S.dbd.(P4<0.9)
[0494] Once the P values are broken down into ranges according to
the above boolean values, the difference in gene expression between
the two samples is determined.
[0495] In this case where NINC>=NDEC, the gene expression change
is indicated as increased, marginal increase or no change. The
following is a summary of the gene expression indications:
6 Increased A and (X or Y) and (Q or R) and (M or N or O) A and (X
or Y) and (Q or R or 5) and (M or N) B and (X or Y) and (Q or R)
and (M or N) A and X and (Q or R or S) and (M or N or O) Marginal A
or Y or S or O Increase B and (X or Y) and (Q or R) and O B and (X
or Y) and S and (M or N) C and (X or Y) and (Q or R) and (M or N)
No Change All others cases (e.g., any Z combination)
[0496] In the output to the user, increased may be indicated as
"I," marginal increase as "MI" and no change as "NC."
[0497] If NINC<NDEC, the following four P values are
determined:
[0498] P1=NDEC/NINC
[0499] P2=NDEC/N
[0500] P3=((NNEGE-NNEGB)-(NPOSE-NPOSB))/N
[0501] P4=10*SUM(LRE-LRB)/N
[0502] These P values are then utilized to determine the difference
in gene expression between the two samples.
[0503] The P values are broken down into the same ranges as for the
other case where NINC>=NDEC. Thus, P values in this case
indicate the same ranges and will not be repeated for the sake of
brevity. However, the ranges generally indicate different changes
in the gene expression between the two samples as shown below.
[0504] In this case where NINC<NDEC, the gene expression change
is indicated as decreased, marginal decrease or no change. The
following is a summary of the gene expression indications:
7 Decreased A and (X or Y) and (Q or R) and (M or N or O) A and (X
or Y) and (Q or R or S) and (M or N) B and (X or Y) and (Q or R)
and (M or N) A and X and (Q or R or S) and (M or N or O) Marginal A
or Y or S or O Decrease B and (X or Y) and (Q or R) and O B and (X
or Y) and S and (M or N) C and (X or Y) and (Q or R) and (M or N)
No Change All others cases (e.g. any Z combination)
[0505] In the output to the user, decreased may be indicated as
"D," marginal decrease as "MD" and no change as "NC."
[0506] The above has shown that the relative difference between the
gene expression between a baseline sample and an experimental
sample may be determined. An additional test may be performed that
would change an I, MI, D, or MD (i.e., not NC) call to NC if the
gene is indicated as expressed in both samples (e.g., from step
324) and the following expressions are all true:
[0507] Average(IDIFB)>=200
[0508] Average(IDIFE)>=200
[0509] 1.4>=Average(IDIFE)/Average(IDIFB)>=0.7
[0510] Thus, when a gene is expressed in both samples, a call of
increased or decreased (whether marginal or not) will be changed to
a no change call if the average intensity difference for each
sample is relatively large or substantially the same for both
samples. The IDIFB and IDIFE are calculated as the sum of all the
IDIFs for each sample divided by N.
[0511] At step 328, values for quantitative difference evaluation
are calculated. An average of
((J.sub.pm-J.sub.mm)-(I.sub.pm-I.sub.mm)) for each of the pairs is
calculated. Additionally, a quotient of the average Of
J.sub.pm-J.sub.mm and the average of I.sub.pm-I.sub.mm is
calculated. These values may be utilized to compare the results
with other experiments in step 330.
EXAMPLES
[0512] The following examples are offered to illustrate, but not to
limit the present invention.
Example 1
First Generation Oligonucleotide Arrays Designed to Measure mRNA
Levels for a Small Number of Murine Cytokines
[0513] A) Preparation of Labeled RNA.
[0514] 1) From Each of the Preselected Genes.
[0515] Fourteen genes (IL-2, IL-3, Il-4, IL-6, Il-10, IL-12p40,
GM-CSF, IFN-.gamma., TNF-.alpha., CTLA8, .beta.-actin, GAPDH, IL-11
receptor, and Bio B) were each cloned into the p Bluescript II KS
(+) phagemid (Stratagene, La Jolla, Calif., USA). The orientation
of the insert was such that T3 RNA polymerase gave sense
transcripts and T7 polymerase gave antisense RNA.
[0516] Labeled ribonucleotides in an in vitro transcription (IVT)
reaction. Either biotin- or fluorescein-labeled UTP and CTP (1:3
labeled to unlabeled) plus unlabeled ATP and GTP were used for the
reaction with 2500 units of T7 RNA polymerase (Epicentre
Technologies, Madison, Wis., USA). In vitro transcription was done
with cut templates in a manner like that described by Melton et
al., Nucleic Acids Research, 12: 7035-7056 (1984). A typical in
vitro transcription reaction used 5 .mu.g DNA template, a buffer
such as that included in Ambion's Maxiscript in vitro Transcription
Kit (Ambion Inc., Huston, Tex., USA) and GTP (3 mM), ATP (1.5 mM),
and CTP and fluoresceinated UTP (3 mM total, UTP: Fl-UTP 3:1) or
UTP and fluoresceinated CTP (2 mM total, CTP: Fl-CTP, 3:1).
Reactions done in the Ambion buffer had 20 mM DTT and RNase
inhibitor. The reaction was run from 1.5 to about 8 hours.
[0517] Following the reaction, unincorporated nucleotide
triphosphates were removed using a size-selective membrane
(microcon-100) or Pharmacia microspin S-200 column. The total molar
concentration of RNA was based on a measurement of the absorbance
at 260 nm. Following quantitation of RNA amounts, RNA was
fragmented randomly to an average length of approximately 50-100
bases by heating at 94.degree. C. in 40 mM Tris-acetate pH 8.1, 100
mM potassium acetate, 30 mM magnesium acetate for 30-40 minutes.
Fragmentation reduces possible interference from RNA secondary
structure, and minimizes the effects of multiple interactions with
closely spaced probe molecules.
[0518] 2) From cDNA Libraries.
[0519] Labeled RNA was produced from one of two murine cell lines;
T10, a B cell plasmacytoma which was known not to express the genes
(except IL-10, actin and GAPDH) used as target genes in this study,
and 2D6, an IL-12 growth dependent T cell line (Th.sub.1 subtype)
that is known to express most of the genes used as target genes in
this study. Thus, RNA derived from the T10 cell line provided a
good total RNA baseline mixture suitable for spiking with known
quantities of RNA from the particular target genes. In contrast,
mRNA derived from the 2D6 cell line provided a good positive
control providing typical endogenously transcribed amounts of the
RNA from the target genes.
[0520] i) The T10 Murine B Cell Line.
[0521] The T10 cell line (B cells) was derived from the IL-6
dependent murine plasmacytoma line T1165 (Nordan et al. (1986)
Science 233: 566-569) by selection in the presence of IL-11. To
prepare the directional cDNA library, total cellular RNA was
isolated from T10 cells using RNAStat60 (Tel-Test B), and poly
(A).sup.+ RNA was selected using the PolyAtract kit (Promega,
Madison, Wis., USA). First and second strand cDNA was synthesized
according to Toole et al., (1984) Nature, 312: 342-347, except that
5-methyldeoxycytidine 5'triphosphate (Pharmacia LKB, Piscataway,
N.J., USA) was substituted for DCTP in both reactions.
[0522] To determine cDNA frequencies T10 libraries were plated, and
DNA was transfered to nitrocellulose filters and probed with
.sup.32P-labeled .beta.-actin, GAPDH and IL-10 probes. Actin was
represented at a frequency of 1:3000, GAPDH at 1;1000, and IL-10 at
1:35,000. Labeled sense and antisense T10 RNA samples were
synthesized from NotI and SfiI cut CDNA libraries in in vitro
transcription reactions as described above.
[0523] ii) The 2D6 Murine Helper T Cells Line.
[0524] The 2D6 cell line is a murine IL-12 dependent T cell line
developed by Fujiwara et al. Cells were cultured in RPMI 1640
medium with 10% heat inactivated fetal calf serum (JRH
Biosciences), 0.05 mM P-mercaptoethanol and recombinant murine
IL-12 (100 units/mL, Genetics Institute, Cambridge, Mass., USA).
For cytokine induction, cells were preincubated overnight in IL-12
free medium and then resuspended (10.sup.6 cells/ml). After
incubation for 0, 2, 6 and 24 hours in media containing 5 nM
calcium ionophore A23187 (Sigma Chemical Co., St. Louis Mo., USA)
and 100 nM 4-phorbol-12-myristate 13-acetate (Sigma), cells were
collected by centrifugation and washed once with phosphate buffered
saline prior to isolation of RNA.
[0525] Labeled 2D6 mRNA was produced by directionally cloning the
2D6 cDNA with .alpha.ZipLox, NotI-SalI arms available from GibcoBRL
in a manner similar to T10. The linearized pZ11 library was
transcribed with T7 to generate sense RNA as described above.
[0526] iii) RNA Preparation.
[0527] For material made directly from cellular RNA, cytoplasmic
RNA was extracted from cells by the method of Favaloro et al.,
(1980) Meth. Enzym., 65: 718-749, and poly (A).sup.+ RNA was
isolated with an oligo dT selection step (PolyAtract, Promega,).
RNA was amplified using a modification of the procedure described
by Eberwine et al. (1992) Proc. Natl. Acad. Sci. USA, 89: 3010-3014
(see also Van Gelder et al. (1990) Science 87: 1663-1667). One
microgram of poly (A)+ RNA was converted into double-stranded cDNA
using a cDNA synthesis kit (Life Technologies) with an oligo dT
prime incorporating a T7 RNA polymerase promoter site. After second
strand synthesis, the reaction mixture was extracted with
phenol/chloroform and the double-stranded DNA isolated using a
membrane filtration step (Mircocon-100, Amicon, Inc. Beverly,
Mass., USA). Labeled cRNA was made directly from the cDNA pool with
an IVT step as described above. The total molar concentration of
labeled CRNA was determined from the absorbance at 260 and assuming
an average RNA size of 1000 ribonucleotides. RNA concentration was
calculated using the conventional conversion that 1 OD is
equivalent to 40 .mu.g of RNA, and that 1 .mu.g of cellular mRNA
consists of 3 pmoles of RNA molecules.
[0528] Cellular mRNA was also labeled directly without any
intermediate cDNA or RNA synthesis steps. Poly (A).sup.+ RNA was
fragmented as described above, and the 5' ends of the fragments
were kinased and then incubated ovenight with a biotinylated
oligoribonucleotide (5'-biotin-AAAAAA-3') in the presence of T4 RNA
ligase (Epicentre Technologies). Alternatively, mRNA was labeled
directly by UV-induced crosslinking to a psoralen derivative linked
to biotin (Schleicher & Schuell).
[0529] B) High Density Array Preparation
[0530] A high density array of 20 mer oligonucleotide probes was
produced using VLSIPS technology. The high density array included
the oligonucleotide probes as listed in Table 2. A central mismatch
control probe was provided for each gene-specific probe resulting
in a high density array containing over 16,000 different
oligonucleotide probes.
8TABLE 2 High density array design. For every probe there was also
a mismatch control having a central 1 base mismatch. Probe Type
Target Nucleic Acid Number of Probes Test Probes: IL-2 691 IL-3 751
IL-4 361 IL-6 691 IL-10 481 IL-12p40 911 GM-CSF 661 IFN-.gamma. 991
TNF-.alpha. 641 mCTLA8 391 IL-11 receptor 158 House Keeping Genes:
GAPDH 388 .beta.-actin 669 Bacterial gene (sample Bio B 286
preparation/amplification control)
[0531] The high density array was synthesized on a planar glass
slide.
[0532] C) Array Hybridization and Scanning.
[0533] The RNA transcribed from cDNA was hybridized to the high
density oligonucleotide probe array(s) at low stringency and then
washed under more stringent conditions. The hybridization solutions
contained 0.9 M NaCl, 60 mM NaH.sub.2PO.sub.4, 6 mM EDTA and 0.005%
Triton X-100, adjusted to pH 7.6 (referred to as 6.times.SSPE-T).
In addition, the solutions contained 0.5 mg/ml unlabeled, degraded
herring sperm DNA (Sigma Chemical Co., St. Louis, Mo., USA). Prior
to hybridization, RNA samples were heated in the hybridization
solution to 9.degree. C. for 10 minutes, placed on ice for 5
minutes, and allowed to equilibrate at room temperature before
being placed in the hybridization flow cell, Following
hybridization, the solution was removed, the arrays were washed
with 6.times.SSPE-T at 22.degree. C. for 7 minutes, and then washed
with 0.5.times.SSPE-T at 40.degree. C. for 15 minutes. When
biotin-labeled RNA was used, the hybridized RNA was stained with a
streptavidin-phycoerythri- n conjugate (Molecular Probes, Inc.,
Eugene, Oreg., USA) prior to reading. Hybridized arrays were
stained with 2 .mu.g/ml streptavidin-phycoerythrin in
6.times.SSPE-T at 40.degree. C. for 5 minutes.
[0534] The arrays were read using scanning confocal microscope
(Molecular Dynamics, Sunnyvale, Calif., USA) modified for the
purpose. The scanner uses an argon ion laser as the excitation
source, and the emission was detected with a photomultiplier tube
through either a 530 nm bandpass filter (fluorescein) or a 560 nm
longpass filter (phycoerythrin).
[0535] Nucleic acids of either sense or antisense orientations were
used in hybridization experiments. Arrays with for either
orientation (reverse complements of each other) were made using the
same set of photolithographic masks by reversing the order of the
photochemical steps and incorporating the complementary
nucleotide.
[0536] D) Quantitative Analysis of Hybridization Patterns and
Intensities.
[0537] The quantitative analysis of the hybridization results
involved counting the instances in which the perfect match probe
(PM) was brighter than the corresponding mismatch probe (MM),
averaging the differences (PM minus MM) for each probe family
(i.e., probe collection for each gene), and comparing the values to
those obtained in a side-by-side experiment on an identically
synthesized array with an unspiked sample (if applicable). The
advantage of the difference method is that signals from random
cross hybridization contribute equally, on average, to the PM and
MM probes while specific hybridization contributes more to the PM
probes. By averaging the pairwise differences, the real signals add
constructively while the contributions from cross hybridization
tend to cancel.
[0538] The magnitude of the changes in the average of the
difference (PM-MM) values was interpreted by comparison with the
results of spiking experiments as well as the signal observed for
the internal standard bacterial RNA spiked into each sample at a
known amount. Analysis was performed using algorithms and software
described herein.
[0539] E) Optimization of Probe Selection
[0540] In order to optimize probe selection for each of the target
genes, the high density array of oligonucleotide probes was
hybridized with the mixture of labeled RNAs transcribed from each
of the target genes. Fluorescence intensity at each location on the
high density array was determined by scanning the high density
array with a laser illuminated scanning confocal fluorescence
microscope connected to a data acquisition system.
[0541] Probes were then selected for further data analysis in a
two-step procedure. First, in order to be counted, the difference
in intensity between a probe and its corresponding mismatch probe
had to exceed a threshold limit (50 counts, or about half
background, in this case). This eliminated from consideration
probes that did not hybridize well and probes for which the
mismatch control hybridizes at an intensity comparable to the
perfect match.
[0542] The high density array was hybridized to a labeled RNA
sample which, in principle, contains none of the sequences on the
high density array. In this case, the oligonucleotide probes were
chosen to be complementary to the sense RNA. Thus, an anti-sense
RNA population should have been incapable of hybridizing to any of
the probes on the array. Where either a probe or its mismatch
showed a signal above a threshold value (100 counts above
background) it was not included in subsequent analysis.
[0543] Then, the signal for a particular gene was counted as the
average difference (perfect match--mismatch control) for the
selected probes for each gene.
[0544] E) Results: The High Density Arrays Provide Specific and
Sensitive Detection of Target Nucleic Acids.
[0545] As explained above, the initial arrays contained more than
16,000 probes that were complementary to 12 murine mRNAs--9
cytokines, 1 cytokine receptor, 2 constitutively expressed genes
(5-actin and glyceraldehyde 3-phosphate dehydrogenase)--1 rat
cytokine and 1 bacterial gene (E. coli biotin synthetase, bioB)
which serves as a quantitation reference. The initial experiments
with these relatively simple arrays were designed to determine
whether short in situ synthesized oligonucleotides can be made to
hybridize with sufficient sensitivity and specificity to
quantitatively detect RNAs in a complex cellular RNA population.
These arrays were intentionally highly redundant, containing
hundreds of oligonucleotide probes per RNA, many more than
necessary for the determination of expression levels. This was done
to investigate the hybridization behavior of a large number of
probes and develop general sequence rules for a priori selection of
minimal probe sets for arrays covering substantially larger numbers
of genes.
[0546] The oligonucleotide arrays contained collections of pairs of
probes for each of the RNAs being monitored. Each probe pair
consisted of a 20-mer that was perfectly complementary (referred to
as a perfect match, or PM probe) to a subsequence of a particular
message, and a companion that was identical except for a single
base difference in a central position. The mismatch (MM) probe of
each pair served as an internal control for hybridization
specificity. The analysis of PM/MM pairs allowed low intensity
hybridization patterns from rare RNAs to be sensitively and
accurately recognized in the presence of crosshybridization
signals.
[0547] For array hybridization experiments, labeled RNA target
samples were prepared from individual clones, cloned CDNA
libraries, or directly from cellular mRNA as described above.
Target RNA for array hybridization was prepared by incorporating
fluorescently labeled ribonucleotides in an in vitro transcription
(IVT) reaction and then randomly fragmenting the RNA to an average
size of 30-100 bases. Samples were hybridized to arrays in a
self-contained flow cell (volume .about.200 .mu.L) for times
ranging from 30 minutes to 22 hours. Fluorescence imaging of the
arrays was accomplished with a scanning confocal microscope
(Molecular Dynamics). The entire array was read at a resolution of
11.25 .mu.m (.about.80-fold oversampling in each of the
100.times.100 .mu.m synthesis regions) in less than 15 minutes,
yielding a rapid and quantitative measure of each of the individual
hybridization reactions.
[0548] 1) Specificity of Hybridization
[0549] In order to evaluate the specificity of hybridization, the
high density array described above was hybridized with 50 pM of the
RNA sense strand of IL-2, IL-3, IL-4, IL-6, Actin, GAPDH and Bio B
or IL-10, IL-2p40, GM-CSF, IFN-.gamma., TNF-.alpha., mCTLA8 and Bio
B. The hybridized array showed strong specific signals for each of
the test target nucleic acids with minimal cross hybridization.
[0550] 2) Detection of Gene Expression Levels in a Complex Target
Sample.
[0551] To determine how well individual RNA targets could be
detected in the presence of total mammalian cell message
populations, spiking experiments were carried out. Known amounts of
individual RNA targets were spiked into labeled RNA derived from a
representative cDNA library made from the murine B cell line T10.
The T10 cell line was chosen because of the cytokines being
monitored, only IL-10 is expressed at a detectable level.
[0552] Because simply spiking the RNA mixture with the selected
target genes and then immediately hybridizing might provide an
artificially elevated reading relative to the rest of the mixture,
the spiked sample was treated to a series of procedures to mitigate
differences between the library RNA and the added RNA. Thus the
"spike" was added to the sample which was then heated to 37.degree.
C. and annealed. The sample was then frozen, thawed, boiled for 5
minutes, cooled on ice and allowed to return to room temperature
before performing the hybridization.
[0553] FIG. 2A shows the results of an experiment in which 13
target RNAS were spiked into the total RNA pool at a level of
1:3000 (equivalent to a few hundred copies per cell). RNA
frequencies are given as the molar amount of an individual RNA per
mole of total RNA. FIG. 2B shows a small portion of the array (the
boxed region of 2A) containing probes specific for interleukin-2
and interleukin-3 (IL-2 and IL-3,) RNA, and FIG. 2C shows the same
region in the absence of the spiked targets. The hybridization
signals are specific as indicated by the comparison between the
spiked and unspiked images, and perfect match (PM) hybridizations
are well discriminated from missmatches (MM) as shown by the
pattern of alternating brighter rows (corresponding to PM probes)
and darker rows (corresponding to MM probes). The observed
variation among the different perfect match hybridization signals
was highly reproducible and reflects the sequence dependence of the
hybridizations. In a few instances, the perfect match (PM) probe
was not significantly brighter than its mismatch (MM) partner
because of cross-hybridization with other members of the complex
RNA population. Because the patterns are highly reproducible and
because detection does not depend on only a single probe per RNA,
infrequent cross hybridization of this type did not preclude
sensitive and accurate detection of even low level RNAS.
[0554] Similarly, infrequent poor hybridization due to, for
example, RNA or probe secondary structure, the presence of
polymorphism or database sequence errors does not preclude
detection. An analysis of the observed patterns of hybridization
and cross hybridization led to the formulation of general rules for
the selection of oligonucleotide probes with the best sensitivity
and specificity described herein.
[0555] 3) Relationship Between Target Concentration and
Hybridization Signal
[0556] A second set of spiking experiments was carried out to
determine the range of concentrations over which hybridization
signals could be used for direct quantitation of RNA levels. FIG. 3
shows the results of experiments in which the ten cytokine RNAs
were spiked together into 0.05 mg/ml of labeled RNA from the B cell
(T10) cDNA library at levels ranging from 1:300 to 1:300,000. A
frequency of 1:300,000 is that of an mRNA present at less than a
few copies per cell. In 10 .mu.g of total RNA and a volume of 200
.mu.l, a frequency of 1:300,000 corresponds to a concentration of
approximately 0.5 picomolar and 0.1 femptomole
(.about.6.times.10.sup.7 molecules or about 30 picograms) of
specific RNA.
[0557] Hybridizations were carried out in parallel at 40.degree. C.
for 15 to 16 hours. The presence of each of the 10 cytokine RNAs
was reproducibly detected above the background even at the lowest
frequencies. Furthermore, the hybridization intensity was linearly
related to RNA target concentration between 1:300,000 and 1:3000
(FIG. 3). Between 1:3000 and 1:300, the signals increased by a
factor of 4-5 rather than 10 because the probe sites were beginning
to saturate at the higher concentrations in the course of a 15 hour
hybridization. The linear response range can be extended to higher
concentrations by reducing the hybridization time. Short and long
hybridizations can be combined to quantitatively cover more than a
10.sup.4-fold range in RNA concentration.
[0558] Blind spiking experiments were performed to test the ability
to simultaneously detect and quantitate multiple related RNAs
present at a wide range of concentrations in a complex RNA
population. A set of four samples was prepared that contained 0.05
mg/ml of sense RNA transcribed from the murine B cell CDNA library,
plus combinations of the 10 cytokine RNAs each at a different
concentration. Individual cytokine RNAs were spiked at one of the
following levels: 0, 1:300,000, 1:30,000, 1:3000, or 1:300. The
four samples plus an unspiked reference were hybridized to separate
arrays for 15 hours at 40.degree. C. The presence or absence of an
RNA target was determined by the pattern of hybridization and how
it differed from that of the unspiked reference, and the
concentrations were detected by the intensities. The concentrations
of each of the ten cytokines in the four blind samples were
correctly determined, with no false positives or false
negatives.
[0559] One case is especially noteworthy: IL-10 is expressed in the
mouse B cells used to make the CDNA library, and was known to be
present in the library at a frequency of 1:60,000 to 1:30,000. In
one of the unknowns, an additional amount of IL-10 RNA
(corresponding to a frequency of 1:300,000) was spiked into the
sample. The amount of the spiked IL-10 RNA was correctly
determined, even though it represented an increase of only 10-20%
above the intrinsic level. These results indicate that subtle
changes in expression are sensitively determined by performing
side-by-side experiments with identically prepared samples on
identically synthesized arrays.
Example 2
T Cell Induction Experiments Measuring Cytokine mRNAs as a Function
of Time Following Stimulation
[0560] The high density arrays of this invention were next used to
monitor cytokine MRNA levels in murine T cells at different times
following a biochemical stimulus. Cells from the murine T helper
cell line (2D6) were treated with the phorbol ester
4-phorbol-12-myristate 13-acetate (PMA) and a calcium ionophore.
Poly (A).sup.+ MRNA was then isolated at 0, 2, 6 and 24 hours after
stimulation. Isolated mRNA (approximately 1 .mu.g) was converted to
labeled antisense RNA using a procedure that combines a
double-stranded cDNA synthesis step with a subsequent in vitro
transcription reaction. This RNA synthesis and labeling procedure
amplifies the entire mRNA population by 20 to 50-fold in an
apparently unbiased and reproducible fashion (Table 2).
[0561] The labeled antisense T-cell RNA from the four time points
was then hybridized to DNA probe arrays for 2 and 22 hours. A large
increase in the .gamma.-interferon mRNA level was observed, along
with significant changes in four other cytokine mRNAs (IL-3, IL-10,
GM-CSF and TNF.alpha.). As shown in FIG. 4, the cytokine messages
were not induced with identical kinetics. Changes in cytokine mRNA
levels of less than 1:130,000 were unambiguously detected along
with the very large changes observed for .gamma.-interferon.
[0562] These results highlight the value of the large experimental
dynamic range inherent in the method. The quantitative assessment
of RNA levels from the hybridization results is direct, with no
additional control hybridizations, sample manipulation,
amplification, cloning or sequencing. The method is also efficient.
Using current protocols, instrumentation and analysis software, a
single user with a single scanner can read and analyze as many as
30 arrays in a day.
Example 3
Higher-Density Arrays Containing 65,000 Probes for Over 100 Murine
Genes
[0563] FIG. 5 shows an array that contains over 65,000 different
oligonucleotide probes (50 .mu.m feature size) following
hybridization with an entire murine B cell RNA population. Arrays
of this complexity were read at a resolution of 7.5 .mu.m in less
than fifteen minutes. The array contains probes for 118 genes
including 12 murine genes represented on the simpler array
described above, 35 U.S.C. .sctn. 1020 additional murine genes,
three bacterial genes and one phage gene. There are approximately
300 probe pairs per gene, with the probes chosen using the
selection rules described herein. The probes were chosen from the
600 bases of sequence at the 3' end of the translated region of
each gene. A total of 21 murine RNAs were unambiguously detected in
the B cell RNA population, at levels ranging from approximately
1:300,000 to 1:100.
[0564] Labeled RNA samples from the T cell induction experiments
(FIG. 4) were hybridized to these more complex 118-gene arrays, and
similar results were obtained for the set of genes in common to
both chip types. Expression changes were unambiguously observed for
more than 20 other genes in addition to those shown in FIG. 4.
[0565] To determine whether much smaller sets of probes per gene
are sufficient for reliable detection of RNAs, hybridization
results from the 118 gene chip were analyzed using ten different
subsets of 20 probe pairs per gene. That is to say, the data were
analyzed as if the arrays contained only 20 probe pairs per gene.
The ten subsets of 20 pairs were chosen from the approximately 300
probe pairs per gene on the arrays. The initial probe selection was
made utilizing the probe selection and pruning algorithms described
above. The ten subjects of 20 pairs were then randomly chosen from
those probes that survived selection and pruning. Labeled RNAs were
spiked into the murine B cell RNA population at levels of 1:25,000,
1:50,000 and 1:100,000. Changes in hybridization signals for the
spiked RNAs were consistently detected at all three levels with the
smaller probe sets. As expected, the hybridization intensities do
not cluster as tightly as when averaging over larger numbers of
probes. This analysis indicates that sets of 20 probe pairs per
gene are sufficient for the measurement of expression changes at
low levels, but that improvements in probe selection and
experimental procedures will are preferred to routinely detect RNAs
at the very lowest levels with such small probe sets. Such
improvements include, but are not limited to higher stringency
hybridizations coupled with use of slightly longer oligonucleotide
probes (e.g., 25 mer probes)) are in progress.
Example 4
Scale Up to Thousands of Genes
[0566] A set of four high density arrays each containing 25-mer
oligonucleotide probes approximately 1650 different human genes
provided probes to a total of 6620 genes. There were about 20
probes for each gene. The feature size on arrays was 50 microns.
This high density array was successfully hybridized to a cDNA
library using essentially the protocols described above. Similar
sets of high density arrays containing oligonucleotide probes to
every known expressed sequence tag (EST) are in preparation.
Example 5
Direct Scale up for the Simultaneous Monitoring of Tens of
Thousands of RNAs
[0567] In addition to being sensitive, specific and quantitative,
the approach described here is intrinsically parallel and readily
scalable to the monitoring of very large numbers of mRNAs. The
number of RNAs monitored can be increased greatly by decreasing the
number of probes per RNA and increasing the number of probes per
array. For example, using the above-described technology, arrays
containing as many as 400,000 probes in an area of 1.6 cm.sup.2
(20.times.20 .mu.m synthesis features) are currently synthesized
and read. Using 20 probe pairs per gene allows 10,000 genes to be
monitored on a single array while maintaining the important
advantages of probe redundancy. A set of four such arrays could
cover the more than 40,000 human genes for which there are
expressed sequence tags (ESTS) in the public data bases, and new
ESTs can be incorporated as they become available. Because of the
combinatorial nature of the chemical synthesis, arrays of this
complexity are made in the same amount of time with the same number
of steps as the simpler ones used here. The use of even fewer
probes per gene and arrays of higher density makes possible the
simultaneous monitoring of all sequenced human genes on a single,
or small number of small chips.
[0568] The quantitative monitoring of expression levels for large
numbers of genes will prove valuable in elucidating gene function,
exploring the causes and mechanisms of disease, and for the
discovery of potential therapeutic and diagnostic targets. As the
body of genomic information grows, highly parallel methods of the
type described here provide an efficient and direct way to use
sequence information to help elucidate the underlying physiology of
the cell.
Example 6
Probe Selection Using a Neural Net
[0569] A neural net can be trained to predict the hybridization and
cross hybridization intensities of a probe based on the sequence of
bases in the probe, or on other probe properties. The neural net
can then be used to pick an arbitrary number of the "best" probes.
When a neural net was trained to do this it produced a moderate
(0.7) correlation between predicted intensity and measured
intensity, with a better model for cross hybridization than
hybridization.
[0570] A) Input/Output Mapping.
[0571] The neural net was trained to identify the hybridization
properties of 20-mer probes. The 20-mer probes were mapped to an
eighty bit long input vector, with the first four bits representing
the base in the first position of the probe, the next four bits
representing the base in the second position, etc. Thus, the four
bases were encoded as follows:
[0572] A: 1000 C: 0100 G: 0010 T: 0001
[0573] The neural network produced two outputs; hybridization
intensity, and crosshybridization intensity. The output was scaled
linearly so that 95% of the outputs from the actual experiments
fell in the range 0. to 1.
[0574] B) Neural Net Architecture.
[0575] The neural net was a backpropagation network with 80 input
neurons, one hidden layer of 20 neurons, and an output layer of two
neurons. A sigmoid transfer function was used:
(s(x)=1/(1+exp(-1*x))) that scales the input values from 0 to 1 in
a non-linear (sigmoid) manner.
[0576] C) Neural Net Training.
[0577] The network was trained using the default parameters from
Neural Works Professional 2.5 for a backprop network. (Neural Works
Professional is a product of NeuralWare, Pittsburgh Pa., USA). The
training set consisted of approximately 8000 examples of probes,
and the associated hybridization and crosshybridization
intensities.
[0578] D) Neural Net Weights.
[0579] Neural net weights are provided in two matrices; an
81.times.2.0 matrix (Table 3) (weights.sub.--1) and a 2.times.20
matrix Table 4 (weights.sub.--2).
9TABLE 3 Neural net weights (81 .times. 20 matrix) (weights_1).
-0.0316746 .sup. -0.0263491 0.15907079 -0.0353881 -0.0529314 .sup.
0.09014647 0.19370709 -0.0515666 0.06444275 -0.0480836 0.29237783
-0.034054 .sup. 0.02240546 .sup. 0.08460676 0.14313674 .sup.
0.06798329 0.06746746 0.033717 0.16692482 -0.0913482 0.05571244
.sup. 0.22345543 0.04707823 -0.0035547 0.02129388 .sup. 0.12105247
0.1405973 -0.0066357 -0.0760119 .sup. 0.11165894 0.03684745
-0.0714359 0.02903421 .sup. 0.09420238 0.12839544 0.08542864
0.00603615 .sup. 0.04986877 0.02134438 0.0852259 0.13453935
0.03089394 0.11111762 .sup. 0.12571541 0.09278143 .sup. 0.11373715
0.03250757 -0.0460193 0.01354388 0.1131407 0.06123798 .sup.
0.14818664 0.07090721 0.05089445 -0.0635492 .sup. -0.0227965
0.1081195 .sup. 0.13419148 0.08916269 -0.010634 .sup. 0.18790121
.sup. 0.09624594 -0.0865264 .sup. -0.0126238 0.11497019 -0.0057307
0.02378313 .sup. 0.10295142 0.05553147 -0.0193289 -0.0627925 .sup.
-0.024633 .sup. -0.0403537 .sup. .sup. 0.23566079 0.10335726 .sup.
0.07325625 0.11329328 0.2555581 -0.0694051 .sup. -0.0637478 .sup.
0.2687766= -0.0731941 .sup. .sup. 0.08858298 0.39719725 -0.0709359
0.14039235 0.23244983 0.06500423 .sup. 0.11003297 0.0403917 .sup.
0.02953459 0.26901209 -0.0605089 0.03036973 .sup. 0.06836637
0.02345118 0.0206452 -0.0079707 .sup. 0.20967795 0.17097448
-0.007098 -0.0348659 .sup. .sup. 0.09989586 0.07417496 -0.1236805
0.05442215 .sup. 0.23686385 0.01979881 -9.80E-06.sup. -0.0549301
.sup. 0.08891765 0.08683836 .sup. 0.14047802 0.00982503 .sup.
0.11756061 0.09054346 -0.028868 .sup. 0.08829379 .sup. 0.17881326
0.12465772 .sup. 0.13134554 0.09500015 0.04572553 0.0749867 .sup.
0.08564588 0.05334799 .sup. 0.14341639 0.11468539 0.14277624
0.05022619 .sup. 0.14544216 0.03519877 .sup. 0.12799838 0.01427337
0.16172577 0.08078995 -0.0022168 0.05439407 -0.0789278 0.07312368
0.11417327 0.03405219 .sup. 0.06140256 0.01802093 0.0954654
0.00130152 -0.035995 .sup. 0.11517255 .sup. 0.17431773 0.09664405
.sup. 0.01782892 0.03840308 0.05180788 0.14236264 .sup. 0.17182963
0.02306779 -0.0489743 -0.0006051 .sup. 0.19077648 -0.0866363 .sup.
.sup. 0.11008894 0.40543473= -0.0163019 .sup. .sup. 0.06256609
0.16058824 .sup. 0.14149499 0.15698175 -0.1197781 0.38030735 .sup.
0.28241798 0.2882407 -0.2227429 0.34799534 0.38490915 0.23144296
-0.3207987 0.56366867 .sup. 0.35976714 0.20325871 -0.343972 .sup.
0.46158856 .sup. 0.20649959 0.35099933 -0.5071837 0.56459975
0.21605791 0.45084599 -0.5829023 0.51297456 .sup. 0.33494622
0.43086055 -0.5538613 0.55080342 .sup. 0.30968052 0.54485208
-0.7155912 0.30799151 0.29871368 0.36848074 -0.5196409 0.33829662
.sup. 0.21612473 0.41646513 -0.5573701 0.47133151 .sup. 0.30909833
0.37790757 -0.464661 0.50172138 0.21158406 0.46017882 -0.5331213
0.60684419 .sup. 0.47586009 0.28597337 -0.3345993 0.33042327
0.4072904 0.24270254 -0.3750777 0.14083703 0.30998308 0.19591335
-0.4028497 0.30585453 .sup. 0.35896543 0.24851802 -0.2937264
0.19672842 .sup. 0.16133355 0.21780767 -0.2419563 0.17847325
0.07593013 0.1710967 -0.2728708 0.1234024 .sup. 0.06987085
0.1741322 0.05922241 0.03326527 .sup. 0.22045346 0.98782647=
-0.0752053 .sup. -0.0571054 -0.1834571 .sup. .sup. 0.14263187
-0.0715346 .sup. -0.0524248 -0.0838031 .sup. .sup. 0.01667063
-0.0945634 .sup. -0.1137057 -0.1040308 .sup. 0.04263301 -0.2039919
.sup. -0.0532526 -0.0828366 .sup. 0.1373803 -0.0562212 .sup.
-0.2127942 -0.0482095 .sup. .sup. 0.04316666 -0.1732933 .sup.
0.0550463 -0.0526818 .sup. 0.06739104 -0.0065265 .sup. -0.2011867
-0.0434558 .sup. -0.0369132 -0.0196296 .sup. -0.1314755 0.09420983
-0.0010159 -0.1768979 .sup. -0.2365085 -0.0150508 .sup. 0.14120786
0.00565713 -0.1990354 0.11568499 -0.0690084 -0.1509431 .sup.
-0.0575663 0.11275655 .sup. 0.01772332 -0.0016695 .sup. -0.249011
0.09066539 0.05357879 -0.0850152 .sup. -0.1931012 0.08498721 .sup.
0.03673514 -0.1446398 .sup. -0.199778 .sup. 0.1065109 .sup.
0.07205399 -0.1304159 .sup. -0.1723315 0.09151162 0.05596334
-0.0922655 .sup. -0.1478272 0.08858409 .sup. 0.14206541 -0.0314846
.sup. -0.1985286 0.19862956 -0.0502828 -0.11447 .sup. -0.1440073
0.01366408 0.11101657 -0.0721622 .sup. -0.1506944 0.14910588 .sup.
0.03297219 -0.0266356 .sup. -0.2501774 0.20344114 -0.061502
-0.1647823= 0.02848385 .sup. 0.00254791 -0.0646306 .sup. .sup.
0.02634032 -0.0654473 .sup. 0.04731949 -0.0742345 .sup. -0.0545447
-0.1119258 .sup. .sup. 0.10765317 -0.0606677 .sup. 0.05693235
-0.0747124 .sup. .sup. 0.13325705 -0.0508435 .sup. -0.1761459
-0.0883804 .sup. -0.0777852 -0.1090026 .sup. -0.0988943 -0.0445145
.sup. .sup. 0.03802977 -0.0484086 .sup. -0.0337959 0.07326921 .sup.
0.02654305 -0.1239398 .sup. .sup. 0.03043288 0.09781751 0.02590732
-0.0586419 .sup. -0.08015 -0.0073617 .sup. -0.1682889 0.00400978
0.01282504 0.05150735 -0.1449667 0.06144469 0.1005446 0.22570252
-0.3763289 -0.0001517 .sup. -0.0521925 0.21106339 -0.4393073
0.0053312 0.13283829 0.12470152 -0.3589714 -0.0061972 .sup. .sup.
0.07370338 0.25447422 -0.3289591 -0.049451 .sup. 0.05717351
0.14784867 -0.3082401 0.01207511 -0.1141143 0.18880892 -0.3259364
0.04754021 -0.0576587 0.02376083 -0.2828108 0.0234996 -0.1177034
0.02549919 -0.1671077 0.00582423 -0.0715723 0.16712189 -0.0122822
-0.109654 -0.0327367 0.01481733 -0.0636454 -0.0487184 .sup. .sup.
0.01467591 -0.0759871= 0.146753 -0.0931665 -0.1475015 .sup. .sup.
0.07284982 -0.0609536 .sup. -0.0945313 -0.0739603 .sup. .sup.
0.17018235 -0.0636651 .sup. .sup. 0.04693379 -0.2586751 .sup.
0.15550844 -0.1548294 .sup. -0.0908961 -0.0415557 .sup. .sup.
0.04915113 -0.0436857 .sup. -0.031472 .sup. -0.1728483 .sup. .sup.
0.12621336 -0.1321529 .sup. -0.1091831 -0.0989133 .sup. 0.0294641
-0.0950026 .sup. -0.1562225 -0.0917397 .sup. .sup. 0.18711324
0.04599057 -0.2039073 0.07691807 .sup. 0.13016214 0.10801306
-0.3151104 0.0105284 0.10938062 -0.035349 -0.302975 0.03706082
.sup. 0.12322487 0.07198878 -0.2535323 0.04664604 .sup. 0.08887579
-0.0210248 .sup. -0.1427284 0.09078772 0.08646259 0.00194441
-0.1631221 0.11259725 -0.0984519 -0.0939511 .sup. -0.218395 .sup.
0.13777457 .sup. 0.00339417 -0.2007502 .sup. -0.0703103 0.1548807
0.13540466 -0.0514387 .sup. -0.0722146 0.07706029 .sup. 0.04593663
-0.2334163 .sup. -0.0250262 0.0994828 -0.035077 -0.106266 -0.059766
0.13616422 0.22308858 -0.1571046 .sup. -0.1713289 0.14155054 .sup.
0.00283311 0.01067419 -0.360891 .sup. 0.13411179 -0.0159559
-0.1296399= -0.0304715 .sup. -0.0845574 0.17682472 -0.0552084
0.07044557 -0.1482136 0.13328855 -0.1492282 0.11350834 -0.1121938
0.02089526 0.00104415 0.0217719 -0.3102229 0.18922243 -0.0940011
0.08787836 -0.1835242 0.04117605 .sup. 0.03997391 0.06022124
-0.1808036 0.04742034 -0.0744867 0.08965616 -0.1572192 0.00942572
.sup. 0.07957069 0.12980177 -0.2440033 0.08670026 .sup. 0.03785197
0.21052985 -0.3564453 0.01492627 0.04286519 0.00865917 -0.2995701
-0.0835971 .sup. .sup. 0.14536868 0.08446889 -0.1689682 -0.1322389
.sup. .sup. 0.21433547 0.08046963 -0.1548838 -0.021533 0.0558197
0.1623435 -0.3362183 -0.1335399 .sup. .sup. 0.10284293 0.16658102
-0.3004514 -0.0887844 .sup. .sup. 0.07691832 0.11459036 -0.056257
0.01970494 0.08940192 0.08622501 -0.2421202 0.00845924 -0.0151014
0.19088623 -0.1967196 -0.0290916 .sup. -0.0839412 0.10590381
-0.1593935 -0.0399097 .sup. -0.0861852 0.17453311 -0.1529943
0.02726452 .sup. 0.06178628 0.06624542 0.01004315 -0.158326
-0.0149114 -0.1479269= 0.11429903 -0.0432327 0.14520219 .sup.
0.51860482 0.19151463 -0.1127352 0.33529782 .sup. 0.24581231
0.07311282 -0.2268714 0.31717882 0.35736522 0.09062219 -0.2974442
0.46336258 .sup. 0.17145836 0.32802406 -0.3898261 0.49959001 .sup.
0.22195752 0.32254469 -0.4994924 0.75497276 0.35112098 0.52447188
-0.5555881 0.68481833 .sup. 0.20251468 0.39860719 -0.7198414
0.78773916 .sup. 0.45518181 0.71273196 -0.7655811 0.7155844
0.39701831 0.47296903 -0.672706 0.69020337 .sup. 0.37193877
0.47959387 -0.9032337 0.80210346 .sup. 0.40167108 0.50383294
-0.6195157 0.80366057 0.3884458 0.45408139 -0.7316507 0.48975253
.sup. 0.47984859 0.33738744 -0.5510914 0.56882453 .sup. 0.29653791
0.4472059 -0.5177853 0.36228263 0.40129057 0.4490836 -0.4754149
0.46366793 .sup. 0.31378582 0.48470935 -0.2453159 0.39600489 .sup.
0.24787127 0.20359448 -0.203447 0.25734761 0.17168433 0.35209069
-0.203685 0.25115264 .sup. 0.21313109 0.12461348 0.10632347
0.13266218 .sup. 0.20236486 .sup. 1.1078833= -0.0112394 .sup. .sup.
0.01601524 0.11363719 -0.1440069 0.05522444 -0.0711868 0.09505147
-0.0220034 0.0714381 -0.1994763 0.12304886 -0.1611445 0.16811867
-0.4498019 0.10313182 -0.0149997 0.47659361 -0.4639786 -0.0380792
.sup. -0.0468904 0.37975076 -0.7120748 -0.1078557 .sup. 0.10635795
0.42699403 -0.6348544 0.00025528 .sup. 0.06202703 0.57867163
-0.6733171 -0.0381787 .sup. .sup. 0.09532065 0.50065184 -0.7413587
-0.0193744 .sup. -0.1180785 0.74187845 -0.8996705 0.03180836 .sup.
0.04010354 0.82366729 -0.6429569 0.02410492 -0.0632124 0.73732454
-0.8188882 0.04538922 -0.1471086 0.7597335 -0.6287012 0.03615654
-0.1248241 0.56647652 -0.6294683 0.15992545 -0.1780757 0.3820785
-0.5642462 -0.0609947 .sup. -0.0350918 0.25537059 -0.4526066
-0.0761788 .sup. -0.0242514 0.35473567 -0.3512402 -0.1888455 .sup.
0.1974159 0.01620384 -0.1306533 -0.1468564 .sup. 0.25235301
0.08058657 -0.0768841 -0.316401 .sup. 0.09779498 0.08537519
-0.0738487 -0.2839164 .sup. .sup. 0.12684187 -0.2450078= -0.1147067
.sup. -0.0084124 -0.5239977 .sup. -0.5021591 0.02636886 0.1470097
-0.5139894 .sup. -0.6221746 -0.3979228 .sup. .sup. 0.30136263
-0.742976 -0.4011821 0.19038832 .sup. 0.55414283 -1.1652025 .sup.
-0.3686967 -0.4750175 .sup. 0.54713631 -0.9312411 .sup. -0.410718
-0.1498093 .sup. .sup. 0.55332947 -1.0870041 .sup. -0.4378341
-0.5433689 .sup. .sup. 0.92539561 -0.9013531 .sup. -0.6145319
-0.5512772 .sup. 1.0310978 -0.9422795 .sup. -0.6914638 -0.7839714
.sup. 1.4393494 -0.7092296 .sup. -0.894987 .sup. -0.6896155 .sup.
1.1251011 -0.8161536 .sup. -0.8204682 -0.8957642 .sup. 1.3315079
-1.0231192 .sup. -0.5556009 -0.7499282 .sup. .sup. 1.281976
-0.9347371 .sup. -0.6562014 -0.6568274 .sup. 1.1967098 -1.150661
-0.5503616 -0.6640182 .sup. 0.84698498 -0.7811472 .sup. -0.5740913
-0.4527726 .sup. .sup. 0.64911795 -0.6970047 .sup. -0.5759697
-0.4704399 .sup. .sup. 0.51728982 -0.545236 -0.8311051 -0.4240301
.sup. 0.37167478 -0.7735854 .sup. -0.3031097 -0.4083092 .sup.
-0.0152683 -0.2330878 .sup. -0.5839304 -0.1544528 .sup. 0.2042688
-0.8989772 .sup. -0.3088974 -0.2014994 .sup. 0.11505035 -0.4815812
.sup. -0.5319371 -1.3798244= 0.07143499 -0.1589592 0.04816094
-0.0301291 0.15144217 -0.3037405 0.1549352 -0.0608833 0.21059546
-0.4705076 0.16360784 -0.0684895 0.44703272 -0.6194252 0.19459446
-0.0523894 0.31194624 -0.8030509 0.2595928 -0.119705 0.4913742
-0.8455008 0.15694356 -0.0023983 0.53066176 -0.9705743 0.1324198
.sup. 0.08982921 0.43900672 -0.8588745 0.1702383 .sup. 0.02221953
0.44412452 -0.7700244 0.10496679 0.14137991 0.5403164 -0.5077381
0.00849557 0.1611405 0.31764683 -0.5240273 -0.092208 .sup.
0.21902563 0.25788471 -0.3861519 -0.2022993 .sup. 0.13711917
0.22238699 -0.156256 -0.2092034 .sup. .sup. 0.16458821 0.20111787
-0.1418906 -0.180493 .sup. 0.17164391 0.15690604 -0.0254563
-0.1990184 .sup. 0.10211211 0.17421109 -0.0730809 -0.3717274 .sup.
0.1436436 -0.0215865 .sup. -0.2363243 -0.1982318 .sup. .sup.
0.06996673 0.19735655 .sup. 0.05625506 -0.241524 0.12768924
0.05979542 -0.0623277 -0.2521037 .sup. 0.0944353 -0.0492548 .sup.
0.05238663 -0.1978694 .sup. .sup. 0.05119598 -0.2067173= 0.06230025
-0.0752745 0.32974288 .sup. 0.00985043 0.07881941 -0.0835249
0.1073643 -0.090154 -0.0938452 .sup. .sup. 0.00704324 0.2569764
0.08700065 -0.0272076 .sup. -0.1014201 0.19723812 -0.0935401
0.0913924 -0.0728388 0.33091745 -0.0610701 0.01335303 .sup.
0.02156818 0.21619918 -0.0909865 0.01069087 .sup. 0.02569587
0.11676744 -0.0213131 0.1322203 0.11848255 0.11231339 -0.0392407
0.06117272 -0.0234323 0.14693312 0.13509636 -0.0213237 .sup.
-0.0261696 0.09474246 -0.0100756 0.10580003 -0.0147534 0.12980145
-0.038394 0.08167668 -0.0105376 0.02142166 -0.0161705 0.15833771
.sup. 0.01835199 0.04420554 .sup. 0.02605363 0.27427858 0.05774866
-0.0696303 .sup. .sup. 0.03802699 0.0806741 .sup. 0.03993953
-0.0121658 .sup. 0.07568218 0.05538817 .sup. 0.01067943 0.04131892
-0.0267609 0.14418064 0.0897231 -0.0677462 .sup. -0.0772208
0.16641215 .sup. 0.09142463 0.02115551 -0.0876383 0.14652038 .sup.
0.06084725 -0.1150111 .sup. -0.0687876 0.10878915 0.32776353
-0.1929855 .sup. .sup. 0.00694158 0.26604816= -0.0786668 .sup.
.sup. 0.05454836 -0.0834711 .sup. .sup. 0.07707115 0.05659099
-0.0285798 -0.0029815 .sup. -0.0837616 0.02468397 .sup. 0.03531792
-0.1437671 .sup. 0.10122854 -0.1259448 .sup. -0.0845026 0.10171869
-0.0541042 0.05257236 0.04065102 -0.1091328 .sup. 0.0090488
0.06142418 -0.167912 -0.098868 0.02574896 0.00333312 -0.2812204
0.02039073 -0.052828 -0.0439769 .sup. -0.0458286 0.14768517 .sup.
0.02989549 0.09454407 -0.1860176 -0.0505908 .sup. 0.088718
0.0611263 -0.1895157 0.08583955 .sup. 0.09382812 -0.0001466 .sup.
-0.4065202 0.09951859 .sup. 0.14843601 0.12351749 -0.1327625
0.10949049 0.07129322 0.05554885 -0.3743193 -0.0205463 .sup. .sup.
0.12675567 0.0775801 -0.1869074 0.01806534 .sup. 0.09599103
-0.0570596 .sup. -0.1523381 0.08384241 0.00704122 0.10942505
-0.0473638 0.01151769 .sup. 0.09737793 0.07082167 -0.2184597
-0.0365961 .sup. -0.0962418 0.01007566 -0.0049753 0.01404589
-0.0406134 0.01934035 -0.0073082 -0.0489736 .sup. .sup. 0.10457312
-0.0520154 .sup. -0.0454775 -0.0525739 .sup. .sup. 0.06086259
-0.1788069= 0.19904579 -0.2001437 0.04977471 .sup. 0.26628217
0.19910193 0.15184447 0.01703933 .sup. 0.06875326 0.09066898
-0.2003548 0.26507998 0.0629771 0.39202845 -0.6033413 0.57940209
-0.0460919 0.53419203 -0.7680888 0.65535748 .sup. 0.32430753
0.64831889 -1.0950515 0.80829531 0.05049393 0.95144385 -1.2075449
0.94851351 -0.0852669 0.94320357 -1.680338 .sup. 0.99852085 .sup.
0.48870567 1.7470727 -1.7586045 0.56886804 0.66196042 1.2572207
-1.5854638 0.89351815 .sup. 0.39586932 1.586942 -1.6365775
0.73526824 .sup. 0.31977594 1.2270083 -1.2818555 0.71813524
0.37488377 0.95438999 -1.2543333 0.55854511 0.1672449 0.56084049
-0.7980669 0.45917389 .sup. 0.27823627 0.26928344 -0.9804664
0.62299174 0.53984308 0.33946255 -0.5412283 0.1085042 .sup.
0.44658452 0.39120093 -0.5676367 0.19083619 .sup. 0.37056214
0.24114503 -0.3020035 0.39015424 0.09788869 0.30190364 -0.3655235
0.33355939 .sup. 0.44246852 0.17172456 -0.3479928 0.18584418 .sup.
0.34009755 .sup. 4.5490937= 0.13698889 -0.0798945 0.3366704 .sup.
0.17313539 0.01228174 -0.2679709 0.31540671 .sup. 0.08274947
0.11212139 -0.428847 0.57447821 -0.0305296 0.00119518 -0.1978176
0.59532708 -0.0309942 -0.0107875 .sup. -0.7312108 0.74023747 .sup.
0.38564634 0.03748908 -0.6475483 0.87958473 0.05327692 0.06987014
-0.5168169 1.0081589 -0.0517421 0.08651814 -0.761238 .sup.
0.7840901 0.4372991 0.13783893 -0.8574924 0.90612286 0.06334394
0.05702339 -0.5161278 0.66693234
-0.0496743 0.07689167 -0.5775976 0.70519674 .sup. 0.15731441
0.08724558 -0.7325026 0.65517086 0.29064488 0.11747536 -0.612968
0.98160452 .sup. 0.02407174 0.02613025 -0.677594 .sup. 0.81293154
.sup. 0.18651071 0.03182137 -0.7051651 0.89682412 0.181806
0.24770954 -0.4320194 0.72470272 .sup. 0.12951751 0.14626819
-0.3964331 0.54755467 .sup. 0.08819038 0.22105552 -0.3489864
0.4620938 0.06516677 0.03049339 -0.1913544 0.4782092 -0.098419
-0.0160188 .sup. 0.07177288 0.1008145 .sup. 0.01412579 0.42727205=
-0.0048454 .sup. 0.1204864 0.15507312 .sup. 0.25648347 0.03982652
0.14641231 -0.0273505 .sup. .sup. 0.10494121 0.1988914 .sup.
0.09454013 -0.0560908 .sup. 0.07466536 0.1325469 .sup. 0.15324508
-0.01398 .sup. .sup. 0.08281901 0.07909692 0.36858437 -0.0007111
.sup. .sup. 0.13285491 -0.1658676 .sup. .sup. 0.25348473 0.08835109
0.16466415 -0.118853 .sup. 0.26435438 -0.0775707 .sup. .sup.
0.09143513 -0.1019902 .sup. 0.29236633 0.07947435 .sup. 0.07329605
-0.0903666 .sup. .sup. 0.10754076 0.04456592 0.18368921 -0.162177
.sup. 0.18712705 0.03216886 .sup. 0.04698242 -0.0385783 .sup.
0.2276271 0.04106503 .sup. 0.08498254 -0.0325038 .sup. .sup.
0.29328787 0.01249749 0.10016124 -0.0012895 .sup. 0.2371086
0.14713244 -0.053306 -0.0808243 .sup. 0.28909287 0.13412228 .sup.
0.10756335 -0.0486093 .sup. .sup. 0.05799349 0.21323961 -0.0118695
-0.142963 .sup. 0.09792294 0.06907349 .sup. 0.05942665 -0.143813
0.21673524 0.19903891 .sup. 0.02989559 0.15750381 -0.0373194
0.12471988 0.10462648 -0.0027455 .sup. .sup. 0.16604523 0.06245366
-0.0775013 -0.0160873 .sup. 0.21550164 0.25000233 .sup. 0.05931267
0.22881882= 0.04679342 .sup. 0.10158926 -0.122116 .sup. 0.23491009
-0.0625733 .sup. 0.19985424 -0.1704439 .sup. .sup. 0.302394
-0.0671487 .sup. .sup. 0.33251444 -0.0581705 .sup. 0.21095584
-0.215752 .sup. 0.32740423 -0.1597161 .sup. .sup. 0.18950906
-0.1232446 .sup. 0.27883759 -0.0430407 .sup. .sup. 0.04886867
-0.0914212 .sup. .sup. 0.28192514 0.05275658 0.21014904 -0.1322077
.sup. 0.2981362 0.1254565 .sup. 0.15627012 0.04116358 0.08507752
0.10109599 .sup. 0.23081669 -0.1617257 .sup. .sup. 0.29508773
-0.0405337 .sup. -0.0497829 -0.0808031 .sup. .sup. 0.15750171
0.08072432 .sup. 0.12990661 -0.1935954 .sup. 0.29120663 0.13912162
.sup. 0.04256131 -0.1625126 .sup. .sup. 0.25232118 0.04736055
-0.0530935 -0.2270383 .sup. .sup. 0.22945035 0.18167619 .sup.
0.00080986 -0.1253632 .sup. 0.15695702 0.01596376 .sup. 0.03504543
0.00964208 .sup. 0.11757879 -0.0230768 .sup. 0.04350457 -0.1284984
.sup. .sup. 0.24145114 0.20540115 .sup. 0.07580803 -0.0932236 .sup.
0.14288881 0.00538179 .sup. 0.05302088 -0.1001294 .sup. .sup.
0.27505419 0.22654785 0.02395938 -0.0861699 .sup. .sup. 0.05814215
0.21307872 .sup. 0.01372274 0.04515802 -0.0269269 0.20031671 .sup.
0.23140682 0.16010799= 0.37838998 .sup. 0.00934576 -0.139213 .sup.
0.29823828 0.40640026 -0.067578 .sup. -0.038453 .sup. 0.24550894
0.30729383 -0.2807365 -0.0689575 .sup. 0.26537073 0.58336282
-0.2145292 -0.2378269 .sup. .sup. 0.25939462 0.64761585 -0.3581158
0.07741276 .sup. 0.45081589 0.65251595 -0.4543131 -0.0671543 .sup.
0.48592216 0.85640681 -0.6068144 -0.1187844 .sup. .sup. 0.35959438
0.71842372 -0.7140775 -0.0642752 .sup. .sup. 0.37914035 0.71409059
-0.7180941 0.21169594 0.27888221 0.79736245 -0.7102081 0.14268413
.sup. 0.41374633 0.75569016 -0.7394939 0.02592243 .sup. 0.37013471
0.82774776 -0.8136597 0.24068722 0.45081198 0.88004726 -0.6990998
0.23456772 .sup. 0.24596012 0.67229778 -0.8148533 0.30492786 .sup.
0.39735735 0.55497372 -0.6593497 0.20656242 0.3752968 0.54989374
-0.5660355 0.1205707 .sup. 0.22377795 0.46045718 -0.519361 .sup.
0.17151839 .sup. 0.39539635 0.50465524 -0.3791285 0.07184427
0.36315975 0.51068121 -0.3502096 -0.2094818 .sup. .sup. 0.31471297
0.18174268 -0.1241962 -0.1255455 .sup. .sup. 0.35898197 0.79502285=
0.02952595 -0.0751979 -0.2556099 .sup. -0.3040917 -0.0942183 .sup.
-0.0541431 -0.6262965 .sup. -0.1423945 -0.0537339 .sup. .sup.
0.11189342 -0.3791296 .sup. -0.3382006 0.02978903 .sup. 0.20563391
-0.5457558 .sup. -0.3666513 -0.1922515 .sup. 0.29512301 -0.7473708
.sup. -0.0415357 0.18283925 .sup. 0.28153449 -0.7847292 .sup.
-0.2313099 0.00290797 0.6284017 -0.6397845 .sup. -0.5606785
-0.1479581 .sup. 0.57049137 -1.0829539 .sup. -0.1822221 -0.1832336
.sup. .sup. 0.49371469 -0.6362705 .sup. -0.2790937 0.06966544 .sup.
0.75524592 -0.9053063 .sup. -0.5826979 -0.114608 0.90401584
-0.8823278 .sup. -0.3404879 -0.0334436 .sup. .sup. 0.50130409
-0.57275 .sup. -0.3842527 0.0915129 .sup. 0.44590429 -0.7808504
.sup. -0.4399623 -0.1189605 .sup. 0.59226018 -0.499517 -0.4873153
-0.2889721 .sup. .sup. 0.47303999 -0.4015501 .sup. -0.2875251
-0.1106236 .sup. .sup. 0.27437851 -0.6061368 .sup. -0.4166524
-0.0637606 .sup. 0.33875695 -0.6255118 .sup. -0.1046614 -0.2710638
.sup. .sup. 0.26425925 -0.4123208 .sup. -0.2157291 -0.1468192 .sup.
-0.1719856 -0.4140109 .sup. -0.1058299 0.02873472 -0.1210428
-0.213571 -0.1335077 -0.7155944 .sup. 0.06424081 -0.0978306
-0.1169782 .sup. .sup. 0.13909493 -0.0838893 .sup. -0.1300299
-0.1032737 .sup. .sup. 0.11563963 -0.0709175 .sup. -0.028875
-0.1718288 .sup. -0.026291 .sup. 0.05533361 -0.033985 -0.049436
.sup. 0.11520655 -0.0279296 .sup. -0.0170352 0.05850215 .sup.
0.03830531 -0.0893732 .sup. -0.0066427 0.06969514 0.13403182
-0.012636 -0.1925185 0.13028348 -0.0045112 0.05260766 -0.2759708
-0.0395793 .sup. .sup. 0.03069885 0.07913893 -0.1470363 0.09080192
0.19741131 -0.0917266 .sup. -0.2185763 0.04743406 -0.0364127
0.00991712 -0.2093729 0.23327024 -0.0898143 -0.0578982 .sup.
-0.2096201 0.09257686 0.00566842 0.10926479 -0.1167006 0.18223672
.sup. 0.09710353 0.03838636 -0.2026017 0.12219627 .sup. 0.05705986
-0.0505442 .sup. -0.1334345 -0.0204458 .sup. 0.01167099 -0.1091286
.sup. -0.075133 0.02949276 -0.0217044 -0.0782921 .sup. -0.1160332
-0.0210903 .sup. .sup. 0.11607172 -0.0943146 .sup. -0.1014408
0.02903902 0.02963065 -0.1233738 .sup. -0.0760847 0.00098273 .sup.
0.07522969 0.05794976 -0.1959872 0.06584878 -0.0323083
-0.0581293=
[0580]
10TABLE 4 Second neural net weighting matrix (2 .times. 21)
(weights_2). -0.5675537 -0.6119734 0.20069507 0.26132998 -0.5071653
0.2793434 -0.5328685 0.31165671 -0.9999997 -0.4128213 -1.0000007
-0.6456627 -0.209518 1.6362301 -1.9999975 -0.2563241 0.04389827
1.7597554 2.0453076 0.08412334 -0.1645829= 0.55343837 0.68506879
-1.1869608 0.39551663 0.38050765 0.40832204 0.12712023 -1.7462951
0.0818732 6.111361 0.62210494 0.42921746 0.19891988 -4.0000067
-0.5605077 1.3601962 1.7318885 -1.0558798 3.1242371 0.22860088
1.6726165=
[0581] E) Code for Running the Net.
[0582] Code for running the neural net is provided below in Table 5
(neural_n.c) and Table 6 (lin_alg.c).
11TABLE 5 Code for running the neural net (neural_n.c). #define
local far #include <windows.h> #include <alloc.h>
#include "utils.h" #include <string.h> #include
<ctype.h> #include <stdio.h> #include <math.h>
#include <mem.h> #include "des_util.h" #include "chipwin.h"
#include "lin_alg.h" void reportProblem( char local * message,
short errorClass); char iniFileName[] = "designer.ini"; static void
sigmoid( vector local * transformMe ){ short i; for( i = 0; i <
transformMe->size; i++ ) transformMe->values[i] = 1/(1+
exp(-1 * transformMe->values[i])); } static short
getNumCols(char far * buffer){ short count = 1; for( ;*buffer != 0;
buffer++ ) if( *buffer == `.backslash.t`) count++; return count; }
static short getNumRows(char far * buffer){ char far * last, far *
current; short count = -1; current = buffer; do{ count++; last =
current; current = strchr( last+1, 0 ); }while( current > last+1
); return count; } static void readMatrix( matrix local * theMat,
char far * buffer ){ short i,j; char far * temp; temp = buffer;
for( i = 0; i < theMat->numRows; i++ ){ for( j = 0; j <
theMat->numCols; j++ ){ while( isspace( *temp )
.vertline..vertline. (*temp == 0 && *(temp-1) != 0 ) ) =
temp++; sscanf( temp, "%f", &theMat->values[i][j]); while(
!isspace( *temp ) && *temp != 0) temp++; } } } #define
MaxNumLines (20) #define MaxLineSize (1024) short
readNeuralNetWeights(matrix local *weights1, matrix local *weights2
){ char far * buffer; int copiedLength; short numCols, numRows;
buffer = farcalloc( MaxNumLines * MaxLineSize, sizeof( char ) ); if
(buffer == NULL ){ errorHwnd( "failed to allocate file reading =
buffer"); return FALSE;} copiedLength =
GetPrivateProfileString("weights_1", NULL,
".backslash.0.backslash.0", buffer, MaxNumLines * MaxLineSize,
iniFileName); if( copiedLength < 10 .vertline..vertline.
copiedLength >= (MaxNumLines * MaxLineSize = -10)){
errorHwnd("failed to read .ini file"); return FALSE; } numCols =
getNumCols( buffer ); numRows = getNumRows( buffer ); if(
!allocateMatrix( weights1, numRows, numCols )) return FALSE;
readMatrix( weights1, buffer ); copiedLength =
GetPrivateProfileString("weights_2", NULL,
".backslash.0.backslash.0", buffer, MaxNumLines * MaxLineSize,
iniFileName); if( copiedLength < 10 .vertline..vertline.
copiedLength >= (MaxNumLines * MaxLineSize -10)){
errorHwnd("failed to read .ini file"); farfree( buffer ); return
FALSE; } numCols = getNumCols( buffer ); numRows = getNumRows(
buffer ); if( !allocateMatrix( weights2, numRows, numCols )){
farfree( buffer ); return FALSE; } readMatrix( weights2, buffer );
farfree( buffer ); return TRUE; } short runForward( vector local
*input, vector local *output, matrix local *weights1, matrix local
*weights2){ vector hiddenLayer; if( !allocateVector(
&hiddenLayer, (short)(weights1->numRows +1) )) return FALSE;
if( ! vectorTimesMatrix( input, &hiddenLayer, weights 1 ) ){
freeVector( &hiddenLayer ); return FALSE; } sigmoid(
&hiddenLayer ); hiddenLayer.values[ hiddenLayer.size -1] = 1;
if( !vectorTimesMatrix( &hiddenLayer, output, weights2 ) ){
freeVector( &hiddenLayer ); return FALSE; } freeVector(
&hiddenLayer ); sigmoid( output ); return TRUE; } static vector
inputVector= {NULL, 0}, outputVector = {NULL, 0}; static matrix
firstWeights = {NULL, 0, 0} , secondWeights = {NULL, 0, 0}; static
short beenHereDoneThis = FALSE; static short makeSureNetIsSetUp(
void ){ if( beenHereDoneThis ) return TRUE; if(
!readNeuralNetWeights( &firstWeights, &secondWeights ))
return = FALSE; if( !allocateVector( &inputVector,
firstWeights.numCols )) return = FALSE; if( !allocateVector(
&outputVector, secondWeights.numRows )) return = FALSE;
beenHereDoneThis = TRUE; return TRUE; } void removeNetFromMemory(
void ) { freeVector( &inputVector ); freeVector(
&outputVector ); freeMatrix( &firstWeights ); freeMatrix(
&secondWeights ); beenHereDoneThis = FALSE; } short
nnEstimateHybAndXHyb( float local * hyb, float local * xHyb, char =
local * probe){ short probeLength, i; if( !makeSureNetIsSetUp( ))
return FALSE; probeLength = (short)(strlen( probe )); if(
(probeLength *4 + 1) != inputVector.size ){ //
reportProblem("Neural net not set up to deal with probes of this =
length", 0); if( (probeLength *4 + 1) > inputVector.size ){ //
reportProblem( "probe being trimmed to do annlysis", 1);
probeLength = (short)(inputVector.size / 4); } } memset(
inputVector.values, 0, inputVector.size * sizeof( float)); input
Vector.values[inputVector.size-1] = 1; for( i = 0; i <
probeLength; i++ ) inputVector.values[i * 4 + lookupIndex(
tolower(probe[i] ))]= 1; runForward( &inputVector,
&outputVector, &firstWeights, &secondWeights); *hyb =
outputVector.values[0]; *xHyb = outputVector.values[1]; return
TRUE; }
[0583]
12TABLE 6 Code for running the neural net (lin_alg.c). lin_alg.c
#include "utils.h" #include "lin_alg.h" #include <alloc.h>
short allocateMatrix( matrix local * theMat, short rows, short
columns){ short i; theMat->values = calloc( rows, sizeof ( float
local * )); if( theMat->values == NULL ){ errorHwnd( "failed to
allocate = matrix"); return FALSE;} for( i = 0; i < rows; i++ ){
theMat->values[i] = calloc( columns, sizeof (float) ); if(
theMat->values[i] == NULL ){ errorHwnd ("failed to allocate
matrix"); for( --i; i >= 0; i--) free( theMat->values[i] );
return FALSE; } } theMat->numRows = rows; theMat->numCols =
columns; return TRUE; } short allocateVector( vector local *
theVec, short columns){ theVec->values = calloc( columns, sizeof
( float)); if( theVec->values == NULL ) { errorHwnd( " faile to
allocate = vector"); return FALSE;} theVec->size = columns;
return TRUE; } void freeVector( vector local * theVec ){ free(
theVec->values ); theVec->values = NULL; theVec->size = 0;
} void freeMatrix( matrix local * theMat){ short i; for( i = 0; i
< theMat->numRows; i++ ) free( theMat->values[i] ); free(
theMat->values ); theMat->values = NULL; theMat->numRows =
theMat->numCols = 0; } float vDot( float local * input1, float
local * input2, short size ){ float return Value = 0; short i; for(
i = 0; i < size; i++) returnValue += input1[i] * input2[i];
return returnValue; } short vectorTimesMatrix( vector local *
input, vector local * output, matrix local *mat ){ short i;
if((input->size != mat->numCols) .vertline..vertline.
(output->size < mat->numRows)){ errorHwnd( "illegal
multiply" ); return FALSE; } for( i = 0; i < mat->numRows;
i++ ) output->values[i] = vDot( input->values,
mat->values[i], input->size = ); return TRUE; }
Example 7
Generic Difference Screening
[0584] High density arrays comprising arbitrary (haphazard) probe
oligonucleotides for generic difference screening were produced by
shuffling (randomizing) the masks used in light-directed polymer
synthesis. The resulting arrays contained more than 34,000 pairs 25
mer arbitrary probe oligonucleotides. The oligonucleotides in each
pair differed by a single nucleotide at position 13.
[0585] After hybridization, washing, staining, and scanning as
described above, data files (containing information regarding probe
identity and hybridization intensity) were created.
[0586] Differences in intensity between the two oligonucleotides
comprising each probe pair K (where K ranges from 1 to 34,320) were
calculated. More specifically, the intensity differences between
the oligonucleotides of pair K for replicate j of sample i was
calculated as:
[0587] X.sub.ijk1-X.sub.ijk2
[0588] where X is the hybridization intensity, i indicates which
sample (in this case sample 1 or 2), and j indicates which
replicate (in this case replicate 1 or two for each sample), and K
is the probe pair (in this case 1 . . . 34,320), and 1 indicates
one member of the probe pair, while 2 indicates the other member of
the probe pair.
[0589] FIGS. 16a and 16b and 16c illustrate the differences between
replicate 1 and 2 of sample 1 (FIG. 16a, the normal cell line) and
between replicate 1 and replicate 2 of sample 2 (FIG. 16b, the
tumor cell line) for each probe. Thus, FIG. 16a plots the value of
(X.sub.11k1-X.sub.11k2)-(X.sub.12k1-X.sub.12k2) for k-1 to 34,320
on the vertical axis and K on the horizontal axis. The two
replicates were normalized based on the average ratio of
(X.sub.11k1-X.sub.11k2)/(X.sub.1- 2k1-X.sub.12k2) for all probe
pairs (i.e., after normalization, the average ratio should
approximate 1). Similarly, FIG. 15b plots the value of
(X.sub.21k1-X.sub.21k2)--(X.sub.22k1-X.sub.22k2) after
normalization between the two replicates based on the average ratio
of (X.sub.21k1-X.sub.21k2)/(X.sub.22k1-X.sub.22k2). FIG. 16c plots
the differences between sample 1 and 2 averaged over the two
replicates. This value is calculates as
((X.sub.21k1+X.sub.22k2)/2)-((X.sub.11k1+X.sub.12k- 2)/2) after
normalization between the two samples based on the average ratio of
[(X.sub.21k1+X.sub.22k2)/2]/[(X.sub.11k1+X.sub.12k2)/2].
[0590] FIGS. 17a, 17b, and 17c show the data filtered. FIG. 16a
shows the relative change in hybridization intensities of replicate
1 and 2 of sample 1 for the difference of each oligonucleotide
pair. After normalization between replicates (see above), the ratio
is calculated as follows: If the absolute value of
(X.sub.11k1-X.sub.11k2)/(X.sub.12k1-X.s- ub.12k2)>1, then the
ratio=(X.sub.11k1-X.sub.11k2)/(X.sub.12k1-X.sub.12- k2) else the
ratio=(X.sub.12k1-X.sub.12k2)/(X.sub.11k1-X.sub.11k2) (the
inverse). The ratio of replicate 1 and 2 of sample 2 for the
difference of each oligonucleotide pair, normalized, filtered, and
plotted the same way as in FIG. 17a is shown in FIG. 17b. The ratio
is calculated as in FIG. 17a, but based on the absolute value of
(X.sub.21k1-X.sub.21k2)/(X.s- ub.22k1-X.sub.22k2) and
(X.sub.22k1-X.sub.22k2)/(X.sub.21k1-X.sub.21k2). FIG. 17c shows the
ratio of sample 1 and sample 2 averaged over two replicates for the
difference of each oligonucleotide pair. The ratio is calculated as
in FIG. 17a, but based on the absolute value of
[(X.sub.21k1+X.sub.22k2)/2]/[(X.sub.11k1+X.sub.12k2)/2] and
[(X.sub.11k1+X.sub.12k2)/2]/[(X.sub.21k1+X.sub.22k2)/2] after
normalization as in FIG. 16c.
[0591] The oligonucleotide pairs that show the greatest
differential hybridization between the two samples can be
identified by sorting the observed hybridization ratio and
difference values. The oligonucleotides that show the largest
change (increase or decrease) can be readily seen from the ratio
plot of samples 1 and 2 (FIG. 17c). These differences do not appear
to be in the background noise. Based on the identified
oligonucleotide pair sequences, a gene or EST with the suspected
sequence tag can be searched for in the sequence databases, such as
GENBANK, to determine whether the gene has been cloned and
characterized. If the search is negative, appropriate primers can
be made to obtain the cDNA or part of the cDNA directly from mRNA,
cDNA, or from a cDNA library.
[0592] From FIGS. 16a and 16b, it is observed that several
oligonucleotide pairs show large differences between two replicates
for the same sample. It is believed that this results from
differential expression in a given tissue. These oligonucleotide
pairs detect genes that are likely highly expressed, so the
deviation of replicates for these pairs are larger than those
oligonucleotide pairs that bind to nucleotides expressed at low
levels (i.e., the standard deviation of the mean is proportional to
the mean). That is also why the relative change between two samples
is a better indicator to detect the differential expression between
two samples (see FIG. 17c). In order to determine which
oligonucleotide pairs are of greatest interest, the absolute and
relative difference measures could be combined into a scoring
function.
[0593] Increasing the number of related oligonucleotide pairs
(increased redundancy) and employment of two-color
hybridization/detection schemes is expected to help reduce the
background variation. This allows more sensitive detection of small
differences and decreases the noise and occurrence of false
positives. The 25 mer array used in this example is a small subset
of all possible 25 mers, thus, increasing the total number of
oligonucleotide pairs will greatly increase the ability to detect
changes in genes of unknown sequences by allowing more complete
coverage of the available sequence space.
Example 8
Nucleic Acid End Labeling
[0594] Several RNA transcripts as well as a full mRNA sample from
mouse cells were fragmented by heat in the presence of Mg.sup.2+. A
riboA.sub.6 (deoxyribonucleic acid 6 mer poly A) labeled with
either fluorescein or biotin at the 5' end was then ligated to the
fragmented RNA using RNA ligase under standard conditions.
[0595] The labeling appeared to be efficient and the hybridization
pattern obtained using the labeled RNA as a probe was similar to
one obtained using RNA that was labeled during an in vitro
transcription step.
Example 9
Quantification of Labeling Efficiency
[0596] Quantification of the labeling efficiency is accomplished by
spiking experiments in which specific full-length unfragmented RNA
species are spiked into the total mRNA pool at different
concentrations prior to the end-labeling procedure. The relative
concentrations of the spiked RNA in the pool can then be measured
by hybridization to a high density array of target oligonucleotides
prepared as described above. This permits evaluation of the ability
to detect particular RNA species at low concentration in the mRNA
pool.
Example 10
PCR Labeling of Nucleic Acids
[0597] Polymerase Chain Reaction (PCR)
[0598] 20 .mu.l PCR reactions substituted with 10% biotin-dUTP were
conducted and the quantity of each PCR product was estimated with
gel analysis. Approximately 250 fmoles of each PCR product was
pooled. A Pharmacia S300 sephacryl column (cat # 27-5130-01) was
prepared with a 1 minute prespin at 3000.times.g followed with a
200 .mu.l H.sub.2O wash and spin at 3000.times.g for 1 more minute.
The pooled PCR product was loaded and spun for 2 minutes at
3000.times.g.
[0599] The column was discarded and the eluate was speed vacuumed
to dryness.
[0600] DNase Fragmentation
[0601] The dried down PCR pool in was resuspended in 13 .mu.l
H.sub.2O from NEN DuPont End Labeling Kit (cat # NEL824). 2.5 .mu.l
CoCl.sub.2 and 12.5 .mu.l TdT buffer were added. Gibco BRL DNase 1
was diluted to 0.25 U/.mu.l using 10 mM Tris pH 8. 1 .mu.l of
diluted DNase was added to PCR product pool and incubated for 6
minutes at 37.degree. C., denatured for 10 minutes at 99.degree.
C., and cooled to 4.degree. C. The total volume was 29 .mu.l.
[0602] Terminal Transferase (TdT) Labeling
[0603] To the fragmented PCR pool, 2 .mu.l of TdT enzyme (from NEN
kit 2 U/.mu.l stock) was added and 4 .mu.l NEN kit biotin-ddATP was
then added. The final volume was 35 .mu.l. and was incubated at
37.degree. C. for 1.5 hr.
[0604] Hybridization
[0605] The 35 .mu.l labeled target was split into two 17.5 .mu.l
aliquots, one for a coding chip (GeneChip containing sense-strand
sequences and permutations thereof) and one for the non-coding
(antisense) chip. 182.5 .mu.l of 2.5 M TMACl (Sigma 5 M stock
diluted 1:2 using 10 mM Tris pH 8) was added. Triton X-100 was
added to a final concentration of 0.001%. In certain experiments, 4
.mu.l of 100 nM control oligonucleotide was added to the solution
rather than at the stain step.
[0606] The mixture was denatured at 95.degree. C. for 5 minutes,
added directly to the chip cartridge and hybridized with mixing at
37.degree. C. for 60 minutes.
[0607] Staining and Washing
[0608] The hybridization solution was removed from the flow cell
used in the GeneChip system (Affymetrix, Inc., Santa Clara, Calif.)
and the chamber was manually rinsed with 3.times. with
6.times.SSPE/0.001% Triton X-100 to remove TMACl.
[0609] A phycoerythrin stain solution was prepared as follows: 190
.mu.l 6.times.SSPE/0.001% Triton X-100+10 .mu.l of 20 mg/ml
acetylated BSA+0.4 .mu.l stock phycoerythrin (Molecular Probes Cat
# S866)+4 .mu.l fluorescein control oligo 100 nM stock.
[0610] The staining solution was added to the flow cell with mixing
at room temperature for 5 minutes. The staining solution was
removed from the flow cell and manually rinsed 3.times. with
washing buffer.
[0611] The chip was washed on hybridization station (the GeneChip
system, Affymetrix, Inc.) using 6.times.SSPE/0.001% Triton X-100 at
35.degree. C. 9 fill/drain changes of fresh wash solution were used
and scanning took place in this buffer. Target sequences were
accurately identified in this experiment.
Example 11
End Labeling PCR Product
[0612] PCR product was fragmented and end labeled using TdT from
Boehringer Mannheim: After the PCR amplification, 5 .mu.l of a 50
.mu.l PCR reaction was run on a 1% agarose gel to estimate total
yield of the amplification reaction. To fragment the DNA, the
remaining 45 .mu.l of solution was combined with DNAse I (diluted
in H.sub.2O to a final concentration of 5 U DNAse I/.mu.g DNA) and
reacted for 15 minutes at 31.degree. C. The DNAse was then heat
killed for 10 minutes at 95.degree. C. The fragmented DNA solution
was then held at 4.degree. C. until ready for the terminal
transferase reaction.
[0613] The terminal transferace reaction mixture consisted of the
fragmented PCR sample, 20 .mu.L 5.times. terminal transferase
reaction buffer, 6 .mu.l 25 mM CoCl.sub.2 (final concentration 1.5
mM), 1 .mu.l of fluorescent dideoxynucleotide triphosphates (ddNTP
final concentration 10 .mu.M) and 2 .mu.L of Boehringer Mannheim
terminal transferase (TdT, final concentration 50 U/reaction), and
H.sub.2O up to 100 .mu.l volume.
[0614] The reaction was incubated for 30 minutes at 37.degree. C.
THe whole reaction volume was then transferred to a 1.7 ml tube,
brought up to 500 .mu.l with 5.times.SSPE, 0.05% Triton hyb and
scanned normally.
[0615] Protocols for the 50 .mu.L PCR reaction are found in the
instructional materials accompanying the GeneChip.TM. HIV PRT Assay
(Affymetrix, Sunnyvale, Calif.).
Example 12
CAIP Improves Base Calling
[0616] In certain fragment end labeling experiments, the accuracy
of base calling in a GeneChip system was improved when calf
intestinal alkaline phosphatsae (CAIP) was used during
fragmentation with DNAse. See FIG. 18.
[0617] CIAP is usefull in degrading any nucleotides that were not
incorporated in any previous amplification, transcription, and
polymerase other polymerase reactions. Such degredation prevents
the incorporation of those nucleotides in subsequent reactions,
such as tailing and labeling reactions for example.
Example 13
Post-Hybridization End Labeling
[0618] Post-hybridization end labeling experiments were performed.
After hybridization of a target to a probe array in the GeneChip
system, the targets were labeled using terminal transferase (shown
as TdTase) as shown in FIG. 19.
[0619] Post-hybridization labeling was shown to yield better
results when the probe array (Chip) was pre-reacted as shown in
FIGS. 20 and 21.
[0620] FIG. 21 also shows the results of a DNAse titrations
experiment. The various titration experiments are shown below in
Table 7.
13TABLE 7 Hybridization TdTase end labeling call accuracy. Accuracy
is based on Ratio = 1.2 of maximum to next highest calculated
intensities. Calculated intensities = minimum of A, C, G, or T in
tile set subtracted from adjusted intensity. Adjusted intensity =
raw intensity of PCR - raw intnsity of no PCR. Experiment Pre-react
Labeling Accuracy HM207 ddTTP = 1.8 mM FITC-dUTP = 5 nmol At least
one strand = 5 U DNAse dTTP = dATP = 50 nmol 100.0% TdTase = 50 U
TdTase = 50 U Both strands = 91.3% Temp = room T Temp = room T
GeneSeq Composite = Time = 1 hr Time= 1 hr NA HM217 ddTTP = 1.0 mM
FITC-dUTP = 0.5 nmol At least one strand = 5 U DNAse dTTP = 3.0 mM
dATP = 5 nmol 99.8% TdTase = 12.5 U TdTase = 5 U Both strands =
89.6% Temp = room T Temp = room T Geneseq Composite = Time =
overnight Time = 15 min 99.2% HM220 ddTTP = 1.8 mM FITC-dUTP = 0.5
nmol At least one strand = 5 U DNAse dTTP = 3.0 mM dATP = 5 nmol
100.0% TdTase = 12.5 U TdTase = 5 U Both strands = 91.1% Temp =
37.degree. C. Temp = 37.degree. C. GeneSeq Composite = Time =
overnight Time = 15 min 99.1%
[0621] These results show that base calling accuracy can impacted
by the length of the target fragments. Such results further
demonstrate the utility of the methods disclsoed herein.
[0622] Other experiments have shown that 1 U of DNAse is
particularly useful in obtaining ideal fragment lengths.
Example 14
End-Labeling (Tailing) with Poly T
[0623] The nucleic acids tailed with poly-A or poly-A analogs
(labeled or unlabeled) using methods similar to those set forth in
Example 13 can be labeled using labeled poly-T, as shown in FIG.
22.
Example 15
Synthesis of Fluorescent Triphosphate Labels
[0624] To 0.5 .mu.moles (50 .mu.L of a 10 mM solution) of the
amino-derivatized nucleotide triphosphate,
3'amino-3'deoxythymidinetripho- sphate (1) or
2'-amino-2'-deoxyuridine triphosphate (2), in a 0.5 ml ependorf
tube was added 25 .mu.L of 11 M aqueous solution of sodium borate,
pH 7, 87 .mu.L of methanol, and 88 .mu.L (10 .mu.mol, 20 wquiv) of
a 100 mM solution of 5-carboxyfluorescein-X-NHS ester in methanol.
The mixture was vortexed briefly and allowed to stand at room
temperature in the dark for 15 hours. The sample was then purified
by ion-exchange HPLC to afford the fluoresceinated derivatives
Formula 3 or Formula 4, below, in about 78-84% yield. 1
[0625] Experiments suggest that these molecules are not substrates
for terminal transferase (TdT). It is believed, however, that these
molecules would be sutstrates for a polymerase, such as klenow
fragment.
Example 10
Synthesis of as-Triazine-3,5[2H,4H]-diones
[0626] The analogs as-triazine-3,5[2H,4H]-dione
("6-aza-pyrimidine") nucleotides (see, FIG. 23a) are synthesized by
methods similar to those used by Petrie, et al., Bioconj. Chem. 2:
441 (1991).
[0627] Other useful labeling reagents are sythesized including
5-bromo-U/dUTO or ddUTP. See for example Lopez-Canovas, L. Et al.,
Arch. Med. Res 25: 189-192 (1994); Li, X., et al., Cytometry 20:
172-180 (1995); Boultwood, J. Et al., J. Pathol. 148: 61 ff.
(1986); Traincard, et al., Ann. Immunol. 1340: 399-405 (1983); and
FIGS. 23a, and 23b set forth herein.
[0628] Details of the synthesis of nucleoside analogs corresponding
to all of the above structures (in particular those of FIG. 23b)
have been described in the literature Known procedcures can be
applied in order to attach a linker to the base. The linker
modified nucleosides can then be converted to a triphosphate amine
for final attachment of the dye or hapten which can be carried out
using commercially available activated derivatives.
[0629] Other suitable labels include non-ribose or
non-2'-deoxyribose-cont- aining structures some of which are
illustrated in FIG. 23c and sugar-modified nucleotide analogues
such as are illustrated in FIG. 23d.
[0630] Using the guidance provided herein, the methods for the
synthesis of reagents and methods (enzymatic or otherwise) of label
incorporation useful in practicing the invention will be apparent
to those skilled in the art. See, for example, Chemistry of
Nucleosides and Nucleotides 3, Townsend, L. B. ed., Plenum Press,
New York, at chpt. 4, Gordon, S. The Synthesis and Chemistry of
Imidazole and Benzamidizole Nucleosides and Nucleotides (1994); Gen
Chem. Chemistry of Nucleosides and Nucleotides 3, Townsend, L. B.
ed., Plenum Press, New York (1994); can be made by methods simliar
to those set forth in Chemistry of Nucleosides and Nucleotides 3,
Townsend, L. B. ed., Plenum Press, New York, at chpt. 4, Gordon, S.
"The Synthesis and Chemistry of Imidazole and Benzamidizole
Nucleosides and Nucleotides (1994); Lopez-Canovas, L. Et al., Arch.
Med. Res 25: 189-192 (1994); Li, X., et al., Cytometry 20: 172-180
(1995); Boultwood, J. Et al., J Pathol. 148: 61 ff. (1986);
Traincard, et al., Ann. Immunol. 1340: 399405 (1983).
Example 11
[0631] Biotin-chem Link (Boehringer-Mannheim)
[0632] The labeling density is suppose to be 1 biotin per 10 bases.
Coordinative, non-covalent binding of Biotin-chem-Link to N7 of
adenosine and guanosine involves heating 1 ug RNA or DNA+1 ul BCL
in 20 ul vol. 85.degree. C. for 30 minutes.
[0633] RNA Labeling Experiment (4 Sets of 4 Pooled RNA
Transcripts)
[0634] Very poor labeling and/or hybridization (cant see 5 pM at
all, 20 pM is very weak). Samples may have been lost after labeling
when microcon-100s was used to remove unincorporated label. RNA was
fragmented after labeling. It is believed that this should not be a
probem (BM tech help).
[0635] BCL Labeling of dsDNA
[0636] Low signal, background across the entire chip. No
discrimination.
[0637] Fast-Tag (Vector Labs) (RNA)
[0638] Should get 1 biotin per 10-20 bases. Five reactions were
run:
[0639] a) RNA1+RNA2+RNA3 (5 pmoles each, total of 5.2 ug)+25 ul
Fast Tag reagent
[0640] b) RNA 1+RNA2+RNA3 (9 pmoles each, total of 9.4 ug)+25 ul
Fast Tag reagent
[0641] c) RNA 1+RNA2+RNA3 (18 pmoles each, total of 19 ug)+40 ul
Fast Tag reagent
[0642] d) RNA4+RNA5+RNA6 (10 pmoles each, total of 8.7 ug)+25 ul
Fast Tag reagent
[0643] e) RNA7+RNA8+RNA9 (10 pmoles each, total of 11.4 ug)+25 ul
Fast Tag reagent
[0644] The heat method was used to link S--S to RNA. The result:
20.times. lower hybridization signal than same targets labeled by
IVT method.
Example 12
[0645] RNA Ligase/bio-.alpha.6 End Labeling
[0646] This experiment generally involved the following steps: a).
RNA was fragmented; b) RNA fragments were 5' phosphorylated with
polynucleotide kinase/ATP; and c) The 5' end of the RNA is ligated
to the 3' end of BioA6 using RNA ligase. This is illustrated by the
following formula:
[0647] 5' biotin-AAAAAA-OH 3'+5' P--RNA-OH 3'=5'bioAAAAAA-RNA
3'
[0648] Previously this technique was used to label total cellular
mRNA which was hybridized to unpackaged chips (high density
oligonucleotide arrays) (on 2.times.3 slides) in a 10 ul volume.
Lack of mixing was a significant problem and resulted in low
hybridization intensities. In vitro transcription (IVT) labeled RNA
under these conditions gave 10.times. higher signal than bio-A6/RNA
Ligase labeled target.
[0649] In other experriments, 3 different ratios of bio-A6:RNA were
used:
[0650] 1) 1.times. bioA6=0.5 mmoles biotin-A6 per 1 ug RNA);
[0651] 2) 2.times. bioA6; and
[0652] 3) 4.times.Bio A6.
[0653] After labeling, the sample was spun through a microcon-EZ
and microcon-3 to remove enzymes and dilute out buffer
components.
[0654] Bio-A6 labeled target hybridized to chips (high density
oligonucleotide arrays) gave approximately the same hyb. intensity
as in vitro transcription (IVT) labeled target.
[0655] Staining was for 15 minutes with PE at normal conc. No
significantly higher signal or background was seen with 4.times. as
much bioA6 per ug RNA.
[0656] For these expereiments, BioA6: (5' biotin-AAAAAA RNA) was
ordered from Genset.
Example 13
Preparation of Gene-Specific Transcripts
[0657] Template DNA Preparation
[0658] Linearization of Vector:
[0659] If the gene is not already cloned in a vector with T3 and T7
RNA polymerase promoter sites flanking the insert, see PCR
amplification below.
[0660] The vector is linearized with an enzyme that cuts at the 3'
end of the insert for sense transcripts, or at the 5' end for
antisense transcripts. The insert sequence was checked to verify
that the RE does not cut internally. In a preferred embodiment, aa
restriction enzyme was chosen that does not produce 3' protruding
ends.
[0661] Following linearization, an aliquot of the sample is run on
a gel (next to uncut vector) to verify complete digestion.
[0662] The sample is optionally treated with Proteinase K (100-200
ug/ml) at 50 C/20 min--1 hour to remove enzyme or residual RNases
(used in plasmid miniprep protocols).
[0663] The linearized DNA is purified DNA by phenol/chloroform
extraction and ethanol precipitation or 3-4 rounds of microcon-100
concentration/redilution (see below).
[0664] PCR Amplification
[0665] Amilification is only preferred if the desired region of the
gene is not already in a cloning vector with RNA polymerase
promoters.
[0666] Starting with genomic DNA (or cDNA), amplify the ORF of
interest (or region of the gene represented on the chip) using PCR
primers with 5' T3/T7 RNA polymerase promoter sequences and 3'
gene-specific sequences.
[0667] The following 5' sequence has worked well (with 19-21
gene-specific bases added to the 3' end).
14 5'-GAATTGTAATACGACTCACTATAGGGAGG-[+19-21 gene- specific
bases]-3'
[0668] The 5' end consists of:
[0669] a) six 5' flanking bases of your choice--not part of the
promoter sequence, but necessary for maximum IVT efficiency.
[0670] b) 17 bases of the core T7 RNA polymerase promoter
sequence
[0671] c) 1st 6 bases transcribed (sequence of +1 to +6 can affect
efficiency)
[0672] The other PCR primer would then contain the T3 RNA
polymerase promoter sequence at the 5' end. The following sequence
has worked well:
15 5'-AGATGCAATTAACCCTCACTAAAGGGAGA-(+19-21 gene- specific
bases)-3'
[0673] The 5' end consists of:
[0674] a) six 5' flanking bases (sequence can vary from this
example)
[0675] b) 17 bases of core T3 RNA Polymerase promoter sequence
[0676] c)+1 to +6 transcribed bases
[0677] Amplify the desired sequence using standard PCR conditions
with 1st 5 cycles at the annealing temp. best suited for the gene
specific part of the primers alone (typically 55-58.degree. C.),
followed by 25 cycles with annealing at 70.degree. C. Check PCR
products on an agarose gel (3-5 ul of a 100 .mu.l rxn). It is not
necessary to quantify at this stage.
[0678] Optional Proteinase K Treatment:
[0679] Add 1 ul of Proteinase K (20 mg/ml) (Ambion) to the
remainder of the PCR reaction and incubate 20 min to 1 h at
50-60.degree. C. This is usually not necessary, but if the in vitro
transcription (IVT) products appear degraded while the control IVT
product included in the kit (described later) is full length, then
this step may be added prior to the microcon-100 and IVT.
[0680] Microcon 50/100 Purification
[0681] Other purification methods are being tested. Ethanol
precipitation can be subsituted for micron-50 purification.
CAUTION: Microcons may leak. Save all flow-through portions.
[0682] Add 380 .mu.l RNase-free water to the PCR product and
concentrate using a microcon-100 or microcon-50 as suggested in
instructions (Amicon). Repeat the dilution and concentration 2-3
times. The final concentrated sample should be 5-100 .mu.l.
[0683] In Vitro Transcription Labeling with Biotin
[0684] For maximum yield use Ambion's T3 (#1338) or T7 (#1334)
Megascript system (their proprietary buffer allows higher
nucleotide concentrations without inhibiting the polymerase). (Read
Ambion instructions and suggestions in kit book!).
[0685] Perform IVT as suggested, but with (1:3)
biotinylated:unlabeled CTP and UTP. Do not interchange T3 and T7
10.times. nucleotides that come with the Megascript kits.
[0686] For example, make a NTP mix for 4 IVT-labeling reactions as
follows:
[0687] 8 .mu.l Ambion's T7 10.times.ATP [75 mM]
[0688] 8 .mu.l Ambion's T7 10.times.GTP [75 mM]
[0689] 6 .mu.l Ambion's T7 10.times.CTP [75 mM]
[0690] 6 .mu.l Ambion's T7 10.times.UTP [75 mM]
[0691] 15 .mu.l Bio-11-CTP [10 mM] (ENZO #42818)
[0692] 15 .mu.l Bio-16-UTP [10 mM] (ENZO #42814)
[0693] For each IVT-labeling reaction, add (at room temp.--not on
ice):
[0694] 14.5 ul NTP mix
[0695] 2.0 ul 10.times.T7 transcription buffer (Ambion)
[0696] *1.5 ul purified PCR product (not more than 1 .mu.g)
[0697] 2.0 ul 10.times.T7 enzyme mix (Ambion) *Do NOT add more than
1 ug of DNA to the IVT reaction. Higher concentrations of DNA
actually inhibit the reaction and result in LOWER yields. Final
rNTP composition:
[0698] 7.5 mM ATP
[0699] 7.5 mM GTP
[0700] 5.625 mM cold UTP/1.875 mM bio-UTP
[0701] 5.625 mM cold CTP/1.875 mM bio-CTP
[0702] Incubate 4-6 hours at 37.degree. C. Shorter incubation times
may be sufficient for some transcripts or when maximum yield is not
important.
[0703] Optional: DNase 1 Treatment
[0704] Add 1 .mu.l RNase-free DNaseI (provided with Ambion kit) to
each reaction and mix well. Incubate 15-20 min. at 37.degree.
C.
[0705] Optional--Proteinase K Treatment
[0706] This step may help reduce background caused by nonspecific
protein binding to chip and to Strepavidin-phycoerythrin:
[0707] Add RNase-free water to IVT reactions to a final volume of
99 ul.
[0708] Add 1 ul of Ambion's 20 mg/ml proteinase K.
[0709] Incubate at 50.degree. C. 20-30 min.
[0710] Microcon Purification
[0711] Several other purification methods have been tested--many
did not sufficiently remove rNTPs or had low yields. A protocol for
Carboxy bead-based purification (Archana Nair) looks very promising
and will soon be used in place of microcon purification.
[0712] Note: Set aside an aliquot of the IVT reaction before
further purification. Setting aside 1% will enable trouble shooting
of this step if necessary.
[0713] 1. Add 400 ul DEPC water to sample and concentrate sample
with microcon 50 or 100 (as suggested by Amicon). SAVE ALL
FLOW-THROUGH FRACTIONS.
[0714] 2. Repeat dilution/concentration 3-4 times. Final volume can
be 10-100 .mu.l.
[0715] See comments below.
[0716] Check IVT Product(s) on a Gel
[0717] Usually it is sufficient to check .about.0.01-1% of the
reaction on a nondenaturing agarose/TBE gel. Samples are heated to
65.degree. C. for 15 minutes prior to electrophoresis. A single
band close to the expected size is usually observed. If there is
enough space on the gel, run 2 or 3 different dilutions of both the
unpurified and purified IVT products on a gel (.about.0.01%, 0.1%
and 1% of each). Gels can be stained with Sybr Green II (FMC) at a
1:10,000 dilution in 1.times.TBE buffer (more sensitive than
ethidium bromide).
[0718] If precise determination of transcript size it desired, a
denaturing gel can be run with biotinylated RNA standards
(available from Ambion).
[0719] Quantify Transcript Yield by A.sub.260
[0720] Expect 75-150 .mu.g RNA per 1 ug starting DNA template. For
quantitation of purified transcript, about 1% of the concentrated
sample diluted with water (or TE) into a final volume of 60-70 ul
(for a microcuvette) should give absorbance readings within the
accurate range (0.1-1 OD). For accurate pipetting volumes (>1
.mu.l), it is usually necessary to make a serial dilution first
(for example, make a 1/10 dilution of your RNA sample, then measure
10% of the dilution in 60-70 ul final vol.). Always be sure to take
a blank reading in the same cuvette and using the same buffer/water
that the RNA sample is diluted into.
[0721] Since accurate quantitation of pure transcript is essential
for meaningful spiking experiments, extra care should be taken to
verify that excess nucleotides from the IVT reaction have been
sufficiently removed and are not contributing to the A.sub.260.
[0722] The microcon flow through should be saved and checked for
A.sub.260. If significant absorbance is present in the last flow
through, the RNA should be subjected to additional rounds of
dilution and concentration until no significant absorbance is
detected at 260 nm.
[0723] Since microcon filtration devices occassionaly leak, it is
advisable to save all flow-through fractions. If the transcript RNA
concentration in the retained/collected sample is much lower than
predicted, the flow-through fractions can be re-concentrated using
a fresh cartridge (then diluted and reconcentrated at least 4
times).
Example 14
Labeling Total mRNA from Cells/Tissues
[0724] Starting material: Good quality poly A.sup.+RNA from at
least 5.times.10.sup.5-1.times.10.sup.6 cells *(0.1 ug-5 ug poly
A+). It is more economical to start with more poly A.sup.+ RNA (up
to 5 .mu.g), but if material is limited, as little as 0.1 .mu.g of
poly(A)+ can yield a sufficient quantity of labeled RNA target (10
.mu.ug after IVT labeling/amplification).
[0725] Double Stranded cDNA Synthesis:
[0726] This protocol is a supplement to instructions provided in
Gibco BRLs Superscript Choice System. Before proceeding read the
Gibco protocol. Follow Gibco BRL's Superscript Choice System for
cDNA Synthesis, except use the T7-(T).sub.24 sequence (below) for
priming the reverse transcription-first strand cDNA synthesis
instead of the oligo(dT) or random primers provided with the
kit.
16 T7-(T).sub.24 primer: 5'-GGCCAGTGAATTGTAATACGACTCACTA- TAGGGAG
GCGG-(T).sub.243'
[0727] First Strand Synthesis
[0728] Use 0.1 .mu.g-5 .mu.g Poly (A).sup.+RNA and adjust amount of
H.sub.2O and enzyme as indicated in the BRL instructions. For
example:
[0729] 3 .mu.l DEPC-water
[0730] 4.5 .mu.l (1 .mu.g/.mu.l) mRNA
[0731] 1 .mu.l (100 pmol/ul) T7-(T).sub.24 primer
[0732] 1. Mix/Spin/Incubate at 70.degree. C. for 10 minutes.
[0733] 2. Chill on ice.
[0734] 3. Add the following components (on ice) to the RNA/primer
mix:
[0735] 4 .mu.l of 5.times.1st strand cDNA buffer
[0736] 2 .mu.l 0.1 M DTT
[0737] 1 .mu.l [10 mM] dNTP mix
[0738] 4. Incubate at 37.degree. C. for 2 minutes.
[0739] 5. Add 4.5 ul Superscript II reverse transcriptase/mix well.
Use (1 ul SSII RT per ug RNA). For <1 ug RNA, use 1 ul RT.
[0740] 6. Incubate for 1 hour at 37.degree. C.
[0741] Final Reaction Composition (20 .mu.l vol.):
[0742] 50 mM Tris-HCl, pH 8.3
[0743] 75 mM KCl
[0744] 3 mM MgCl.sub.2
[0745] 10 mM DTT
[0746] 500 uM each: dATP, dCTP, dGTP, dTTP
[0747] 100 pmol T7-(T).sub.24 primer
[0748] 4.5 ug mRNA
[0749] 900 U RT (200 Upper .mu.g mRNA)
[0750] Second Strand Synthesis
[0751] 1. Place first strand reactions on ice (quickly spin
down).
[0752] 2. Add:
[0753] 95 .mu.l DEPC-H.sub.2O
[0754] 30 .mu.l 5.times. Second Strand Buffer
[0755] 3 .mu.l [10 mM] dNTP mix
[0756] 1 .mu.l [10 U/.mu.l] E. coli DNA Ligase
[0757] 4 .mu.l [10 U/.mu.l] E. coli DNA Polymerase I
[0758] 1 .mu.l [2 U/.mu.l] RNaseH
[0759] Final Composition (150 .mu.l):
[0760] 25 mM Tris-HCl, pH 7.5
[0761] 100 mM KCl
[0762] 5 mM MgCl.sub.2
[0763] 10 mM (NH.sub.4).sub.2SO.sub.4
[0764] 0.15 mM b-NAD.sup.+
[0765] 250 .mu.M each: dATP, dCTP, dGTP, dTTP
[0766] 1.2 mM DTT
[0767] 65 U/ml DNA ligase
[0768] 250 U/ml DNA Polymerase I
[0769] 13 U/ml RNase H
[0770] 3. Mix/spin down/incubate at 16.degree. C. for 2 hours.
[0771] 4. Add 2 .mu.l [10 U] T4 DNA Polymerase.
[0772] 5. Incubate 5 min. at 16.degree. C.
[0773] 6. Add 10 .mu.l 0.5 M EDTA/store at -20.degree. C.
[0774] Clean Up
[0775] Phenol/Chloroform Extraction
[0776] Optional: To reduce sample loss during extraction, see the
PLG protocol below
[0777] 1. Add an equal volume (162 ul) of (25:24:1)
Phenol:chloroform:isoamyl alcohol (saturated with 10 mM Tris-HCl pH
8.0/1 mM EDTA--Sigma).
[0778] 2. Vortex/spin 5 minutes@14000.times.g. Transfer aqueous
phase to a fresh 1.5 ml tube.
[0779] PLG-Phenol/Chloroform Extraction
[0780] Phase Lock Gels (PLG)* form an inert sealed barrier between
the aqueous and organic phases of phenol-chloroform extractions.
The solid barrier allows more complete recovery of the sample
(aqueous phase) and minimizes interface contamination of the
sample. PLGs are sold as premeasured aliquots in 1.5 ml tubes, to
which the user directly adds sample and phenol-chloroform.
[0781] 1. Pellet the Phase Lock Gel (1.5 ml tube with PLG 1-light.)
in a microcentrifuge for 20-30 seconds [PLG I-heavy should also
work, but we haven't specifically tested it for this
application].
[0782] 2. Transfer the entire (162 .mu.l) cDNA sample to the PLG
tube.
[0783] 3. Add an equal volume (162 .mu.l) of (25:24:1)
Phenol:chlofroform:isoamyl alchohol (saturated with 10 mM Tris-HCL
ph 8.0/1 mMEDTA-Sigma).
[0784] 4. Mix by inverting (DO NOT VORTEX). PLG will not become
part of the suspension. Microcentrifuge at full speed
(12,000.times.g or greater) for 2 min.
[0785] 5. Transfer the aqueous upper phase to a fresh 1.5 ml tube.
PLG I IS available from 5 Prime-3 Prime, Inc., cat. #pl-175850 for
50 or #pl-188233 for 200
[0786] Microcon-50 Purification
[0787] Other purification methods are being tested. Ethanol
precipitation can be subsituted for micron-50 purification.
CAUTION: Microcons may leak. Save all flow-through portions.
[0788] 1. Add 300 ul of 5 mM Tris pH 7.5 to sample.
[0789] 2. Concentrate by spinning through a Microcon-50 column
(Microcon-50 columns, Amicon part #42416) following directions
supplied by Amicon.
[0790] 3. Repeat dilution/concentration 3-4 times, collect and set
aside flow through in case of column failure.
[0791] Concentrate to a final volume of 5-10 ul if possible, taking
care not to allow the cartridge to spin to dryness. Collect upper
volume.
[0792] In Vitro Transcription Labeling with Biotin
[0793] For maximum yield use Ambion's T3 (#1338) or T7 (#1334)
Megascript System (their proprietary buffer allows higher
nucleotide concentrations without inhibiting the polymerase).
[0794] Perform IVT as suggested, but with (1:3)
biotinylated:unlabeled CTP and UTP. Do not interchange T3 and T7
10.times. nucleotides that come with the Megascript System. Read
the Ambion detailed instructions and suggestions before
proceeding.
[0795] NTP Labeling Mix
[0796] To make NTP labeling mix for 4 IVT-labeling reactions
combine:
[0797] 8 .mu.l Ambion's T7 10.times.ATP [75 mM]
[0798] 8 .mu.l Ambion's T7 10.times.GTP [75 mM]
[0799] 6 .mu.l Ambion's T7 10.times.CTP [75 mM]
[0800] 6 .mu.l Ambion's T7 10.times.UTP [75 mM]
[0801] 15 .mu.l Bio-11-CTP [10 mM] (ENZO #42818)
[0802] 15 .mu.l Bio-16-UTP [10 mM] (ENZO #42814)
[0803] IVT Reaction
[0804] 1. For each reaction, combine the following at room
temperature, not on ice
[0805] 14.5 .mu.l NTP labeling mix
[0806] 2.0 .mu.l 10.times.T7 transcription buffer (Ambion)
[0807] *1.5 .mu.l ds cDNA (0.1-1 ug is optimal: see note
below!)
[0808] 2.0 .mu.l 10.times. T7 enzyme mix (Ambion) *Do NOT add more
than 1 .mu.g of ds cDNA to the IVT reaction. Higher concentrations
of DNA actually inhibit the reaction and result in LOWER
yields.
[0809] Final rNTP Composition:
[0810] 7.5 mM ATP
[0811] 7.5 mM GTP
[0812] 5.625 mM cold UTP/1.875 mM bio-UTP
[0813] 5.625 mM cold CTP/1.875 mM bio-CTP
[0814] 2. Incubate 4-6 hours at 37.degree. C. (Shorter incubation
times may be sufficient for some transcripts or when maximum yield
is not important).
[0815] 3. Store unused NTP labeling mix at -20.degree. C.
[0816] Clean Up
[0817] Optional DNAse 1 Treatment
[0818] 1. Add 1 ul RNase-free DNaseI (provided with Ambion kit) to
each reaction and mix well.
[0819] 2. Incubate 15-20 min. at 37.degree. C.
[0820] Optional Proteinase K Treatment
[0821] This treatment may help reduce background caused by
nonspecific protein binding to chip and to
Strepavidin-phycoerythrin.
[0822] 1. Add RNase-free water to IVT reactions to a final volume
of 99
[0823] 2. Add 1 .mu.l of Ambion's 20 mg/ml Proteinase K.
[0824] 3. Incubate at 50.degree. C. 20-30 minutes.
[0825] Microcon Purification
[0826] Several other purification methods have been tested--many
did not sufficiently remove rNTPs or had low yields. A protocol for
Carboxy bead-based purification (Archana Nair) looks very promising
and will soon be used in place of microcon purification. Set aside
an aliquot of the IVT reaction before further purification. Setting
aside 1% will enable trouble shooting of this step if
necessary.
[0827] 1. Add 400 ul DEPC water to sample and concentrate sample
with microcon 50 or 100 (as suggested by Amicon). SAVE ALL
FLOW-THROUGH FRACTIONS.
[0828] 2. Repeat dilution/concentration 3-4 times. Final volume can
be 10-100 ul.
[0829] 3. Since microcon filtration devices occasionally leak, it
is advisable to save all flow-through fractions. If transcript RNA
concentration in the retained/collected sample is much lower than
predicted, the flow-through fractions can be reconcentrated using a
fresh column then diluted and reconcentrated at least 4 times.
[0830] Notes on Yield
[0831] 1. Starting with 4-5 ug poly (A).sup.+ for the ds cDNA
synthesis and using 20% of the purified ds cDNA sample for the IVT,
expect .about.75-125 ug labeled RNA per IVT reaction.
[0832] 2. Reading .about.1% of the concentrated sample diluted with
water (or TE) into a final volume of 60-70 ul (for a microcuvette)
should give absorbance data within the accurate range (0.1-1 OD).
For accurate pipetting volumes (>1 ul), it is usually necessary
to make a serial dilution first. For example, make a 1/10 dilution
of your RNA sample, then measure 10% of the dilution in 60-70 ul
final volume. Be sure to take blank readings in the same cuvette
and use the same buffer/water that was used for diluting the RNA
sample.
[0833] 3. For accurate quantitation of labeled RNA, extra care
should be taken to verify that excess nucleotides from the IVT
reaction have been sufficiently removed and are not contributing to
the A.sub.260.
[0834] The microcon flow-through should be saved and checked for
A.sub.260. If significant absorbance is present in the last flow
through, the RNA should be subjected to additional rounds of
dilution and concentration until no significant absorbance is
detected at 260 nm.
[0835] Check Unfragmented Samples on Gel
[0836] Electrophorese the labeled RNA before fragmentation to
observe the size distribution of labeled transcripts. Samples can
be heated to 65.degree. C. for 15 minutes and electrophoresed on
agarose/TBE gels to get an approximate idea of the transcript size
range. If there is enough space on the gel, run 2 or 3 different
dilutions of both the unpurified and purified IVT products on a gel
(.about.0.01%, 0.1% and 1% of each). Gels can be stained with Sybr
Green II (FMC) at a 1:10,000 dilution in 1.times.TBE buffer (more
sensitive than ethidium bromide).
[0837] Alternatively, for more accurate estimations of the size
distribution of the RNA population pre and post fragmentation,
electrophorese samples through a denaturing gel using biotinylated
RNA molecular weight markers (Ambion).
Example 15
Direct Labeling of DNA with Psoralen-Biotin
[0838] The psoralen-biotin reagent comes lyophilized and can be
bought separately or as part of "Rad-Free Universal Oligo Labeling
and Hybridization Kit" (Schleicher & Schuell). It is actually
cheaper (per nmole) when bought with the kit so you might as well
get the extra kit components and save money. The Rad-Free Universal
Oligo Labeling and Hybridization kit: catalog # 483122 (contains 20
mmoles of Psoralen-biotin). The same kit with UV Long wave 365 mm
lamp: #483124.
[0839] 1. Spin down then resuspend the lyophilized psoralen-biotin
reagent in either:
[0840] a) 14 ul of DMF if you may label fragmented DNA/RNA or
oligonucleotides with some of the reagent (it needs to be more
concentrated) OR
[0841] b) 56 ul of DMF if you will definitely be labeling before
fragmentation.
[0842] Labeling has been performed both before and after
fragmenting with similar results, but it is easier to do before
fragmentation because it can't be labeled in high salt (>20
mM).
[0843] 2. Adjust the RNA/DNA concentration to 0.5 ug/10 ul (200 ul
for 10 ug of DNA), less than 20 mM salt. pH does not matter (pH
2.5-10) so you can just use sterile or DEPCed water to resuspend or
dilute the RNA/DNA into. Plasmid DNA needs to be linearized.
[0844] If RNA/DNA is in high salt, it can be diluted and
concentrated using the appropriate size of microcon (even microcon
3 works for fragmented material but takes .about.70 min per
cycle).
[0845] 3. Boil sample 10 min./quick chill on ice (store on ice 5
min-3 hrs) [important--ds DNA will become cross-linked by reagent
if strands are not separated before labeling]
[0846] 4. In dim light add 1 ul of psoralen-biotin reagent per 20
ul of DNA/RNA solution (1 ul psoralen-biotin that was resuspended
in 56 ul DMF per ug DNA/RNA). *if Psoralen-biotin was resuspended
in 14 ul, dilute the amount you will need for labeling 1:3 in DMF
(1 ul conc. psoralen-biotin+3 ul DMF)
[0847] 5. Transfer solution to into a well of a 96-microwell plate
on ice (up to 150 ul/well).
[0848] 6. Place 365 nm UV lamp directly on top of plate so that
light source is about 2 cm from the sample. Irradiate samples for
one hour.
[0849] 7. Transfer samples to microcentrifuge tubes and add 2
volumes of H.sub.2O-saturated n-butanol to extract unincorporated
psoralen biotin. vortex/centrifuge 1 min.
[0850] 8. Discard butanol (top layer). Repeat extraction.
[0851] 9. Fragment as you would normally. Denature as normal before
hybridization (10 min 99-100.degree. C.). * longer UV irradiation
does not improve results. adding more psoralen-biotin per ug
DNA/RNA does not seem to improve results.
Example 16
Psoralen-Biotin Labeling Experiments
[0852] Labeling RNA by Standard Protocol
[0853] Pool of 4 diff. fragmented RNA transcripts labeled with
psoralen-biotin
[0854] Results of hybridization to chip (5 pM each). PB labeled
targets showed approximately .about.5.times. lower intensities than
IVT(bio-U+C) labeled targets
[0855] Labeling Before vs. After Fragmentation:
[0856] No significant difference in hybridization intensities
[0857] Ratio of Psoralen-Biotin to RNA
[0858] Labeling with a 4.times. higher ratio of PB:RNA does not
significantly affect hybridization intensities on chips.
[0859] Time of Labeling Reaction/UV Lamp Intensity
[0860] No significant difference between 1 vs. 3 hr. labeling or
15-20 mW/cm2 (Affy lamp) vs. 5-7 mW/cm2 (S&S lamp) intensity at
365 nm,
[0861] Psoralen-Biotin
[0862] Psoralens: planar, tricyclic compounds
[0863] Psoralen-biotin: psoralen conjugated to biotin via 14-atom
linker arm.
[0864] High affinity for nucleic acids
[0865] Intercalates into DNA/RNA
[0866] Becomes covalently attached when irradiated with long wave
UV light.
Example 17
Terminal Transferase End-Labeling Protocol
[0867] This protocol is tested and optimized thoroughly with only
PRT 440S chips.)
[0868] DNAse Fragmentation
[0869] This will have enough for 4 labeling rxeactions:
17 4 pmol of HIV PCR target (3.17 ug of 1.2 kb insert) X ul DNAse
(BRL) X ul (1 U/ug) Calf Alkaline Phosphatase, 1 U/ul (BRL) 2.5 ul
(2.5 U/rx) Dilution CAP Buffer (BRL) 2.5 ul MgCI.sub.2 X ul (1.25
mM) Bring up with H2O to 100 ul 37.degree. C. for 15 min.
95.degree. C. for 10 min. 4.degree. C. on hold.
[0870] TdT Labeling
[0871] F-N-6-ddATP, F-ddATP, F-ddCTP, and F-ddUTP are comparable
labeled in the reaction. We decided to use F-N-6-ddATP.
18 Fragment DNA sample 25 ul (1 pmol) 5X TdT Buffer (Boehringer) 20
ul (1X) 25 mM CoCl2 (Boehringer) 10 ul (2.5 mM) F-N6-ddATP (1 mM) 1
ul (10 uM) TdT (25 U/ul) (Boebringer) 1 ul (25 U/rx) H.sub.2O 43 ul
37.degree. C. for 30 min. 95.degree. C. for 5 min. 4.degree. C. on
hold.
[0872] PRT 440S Hybridization (Rela Station)
19 Labeled sample 100 ul 10X SSPE; 0.1% Triton X-100 300 ul Control
(100 nM) 213 Oligos 5 ul H.sub.2O 195 ul 45.degree. C. Hyb for 30
min. 20.degree. C. Wash with 6X SSPE, 0.005% Triton X-100; 4
cycles/10 drain-fill. Scan chip at 530 nm, 11.25 um pixel size.
Example 18
Alternate Labeling Procedures
[0873] Ligation Assay
[0874] RNA can be directly labeled by ligating an A6 RNA
oligonucleotide with biotin at the 5' end with RNA ligase. Cre, a
bacterial gene, was transcribed with T7 RNA polymerase to generate
an antisense RNA. The RNA was fragmented and kinased with
olynucleootide kinase to generate 5' phosphorylated ends. The
Biotin A6 RNA was then ligated using T4 RNA ligase. 5 pm of ligated
RNA was tested on gene expression chips along with the labeled
Cre.
[0875] Direct Labeling of 3' RNA Using Poly A Polymerase
[0876] Poly A polymerse has been used to catalyze poly A tail on to
the free 3' hydroxyl terminus of RNA utilizing ATP as a precursor.
Recently, it was reported by Joomyeong Kim et al. (1995) Nucl.
Acids Res., 23(12): 2245-2251, that they successfully used poly A
polymerase to tail 3' RNA with CTP. This method can be used to
label fragmented RNA with biotin CTP to generate labeled
target.
[0877] The advantage of this method is that sense RNA (mRNA) can be
directly labeled by biotin CTP. Antisense RNA can also be labeled
after fragmentation. The consumption of CTP can be cut down by
{fraction (1/5)}th compared to an IVT reaction.
Example 19
Direct Labeling Protocol
[0878] Reagents for Direct Labeling mRNA
[0879] 1) 100 .mu.M rATP 200 .mu.l
[0880] 198 .mu.L DEPC H.sub.2O
[0881] 2 .mu.L (101 mM) rATP
[0882] 2) 100 .mu.g/ml BSA
[0883] NEB Acelylated BSA
[0884] 3) 30 mM DTT
[0885] 4) 10 U/.mu.L polynucleotide kinase
[0886] Boehringer Mannheim 3' phosphatase free cat # 83829
[0887] 5) 1 mmole/.mu.L BioA6
[0888] Genetics Institute
[0889] 6) 5 U/.mu.L T4 RNA Ligase+10.times.T4 RNA Ligase Buffer
[0890] Epicentre Technologies, catalogue # LR5025
[0891] 7) 5.times.RNA Fragmentation Buffer
[0892] 200 mM Tris-Acetate, pH 8.1
[0893] 500 mM KOAc
[0894] 150 mM MgOAc
[0895] Direct Labeling Protocol
[0896] Fragmentation
[0897] Add to a 1.5 ml sterile tube
[0898] 8 .mu.L poly (A).sup.+ RNA in DEPC-H.sub.2O (1 .mu.g)
[0899] 2 .mu.L 5.times.RNA Fragmentation Buffer
[0900] Heat to 94.degree. C. for 35 minutes.
[0901] Kinase Reaction
[0902] Add to the 10 .mu.L fragmented RNA:
[0903] 2.4 .mu.L rATP (100 .mu.M)
[0904] 2 .mu.L BSA (100 .mu.g/ml)
[0905] 2 .mu.L DTT (30 mM)
[0906] 1.6 .mu.L DEPC-H.sub.2O
[0907] 2 .mu.L polynucleotide kinase (10 U/.mu.L)
[0908] Incubate at 37.degree. C. for 2.5 hours. Heat to 94.degree.
C. for 2 minutes (heat kill enzyme).
[0909] T4 RNA Ligase Reaction
[0910] Add to the 20 .mu.L kinased RNA:
[0911] 0.5 .mu.L BioA6 (1 nmole/.mu.L in DEPC-H.sub.2O)
[0912] 3 .mu.L rATP (19 mM)
[0913] 3 .mu.L 10.times.T4 RNA Ligase buffer
[0914] 0.5 .mu.L DEPC-H.sub.2O
[0915] 17.degree. C. overnight--2 days. 94.degree. C. for 2
minutes.
Example 20
Computer Algorithms to Perform Basecalling on a Target DNA Sample
Hybridized or Ligated to Generic DNA Arrays
[0916] Resequencing a DNA Target by Generating a Set of N
Electronic Tiling Arrays on an n-mer Generic DNA Array.
[0917] This method of resequencing the target is similar to the
method used with customized resequencing GeneChips except that
unlike the custom GeneChips which physically place a single series
of tiling probes on the chip, with a generic GeneChip a computer
electronically reconstructs a set of n tiling arrays by fetching
the appropriate probe information from the generic array (a generic
array contains a possible n-mer sequences). In general, to
resequence a target DNA, the target is decomposed into an n-mer
complement word spectrum of tiling probes. For each tiling probe,
there exists a set of "first order nearest-neighbor" tiling probes
(probes containing a single base substitution) on the generic chip
(generic chips also contain higher order nearest neighbors). This
process is termed tiling through the target sequence with n-mer
words (FIG. 24). To make a basecall at a given position within the
target, the intensity of the tiling probe at that position is
compared to the intensities of its "nearest-neighbors" at that
position. There are n sets of such "nearest-neighbors" because the
single base substitution can occur at n different positions within
the probe. The base substitution at a particular position within
the probe that yields the highest intensity is the base called for
that position within the probe (FIG. 25). The advantage of using a
generic DNA array vs. the standard custom GeneChips is the high
degree of redundancy achieved for each basecall of the target. An
n-mer generic arrays makes n base calls for each base within the
target whereas the custom resequencing GeneChips make only a single
base call.
[0918] The final basecall of a target base is decided upon by an
electronic vote of the base calls from the n different electronic
tilings at each target position (FIG. 26).
[0919] Emperically Using the Accuracy of the Basecalls Derived from
the N Electronic Tiling Arrays to Filter Out Inaccurate Electronic
Tilings.
[0920] A given reference DNA sample is hybridized/ligated to a
generic DNA array. A set of n electronic tilings are generated and
the corresponding basecalls made. A correctness score table is
constructed by giving a score of 1 if a given tiling substitution
series makes a correct basecall or a score of 0 if the basecall is
incorrect (FIG. 27). A confidence level for a given basecall can
also be attached to each scoring according to the ratio of the
intensities of the base substitutions for any given basecall.
[0921] A variant DNA sample is then hybridized/ligated to a second
generic DNA array. Again a set of n electronic tilings are
generated, except this time all tilings are discarded which have a
0 correctness score, and only those tilings which have a
correctness score of 1 are included in the overall base voting
procedure (FIG. 28). The result is to dramatically improve the
overall percentage of correct basecalls.
[0922] Comparing "Locally" Normalized Tiling Probe Intensities
Between a Reference Sample and a Variant is a Sensitive Method of
Detecting a Mutation.
[0923] For a given n-mer generic array, the ability to correctly
resequence a target decreases as the complexity of the target
increases. As the target complexity increases, the number of n-mer
tiling probes which repeat themselves within the target increases,
the cross-talk between nearest neighbors at different positions
increases, and the overall cross hybridization increases. All these
factors contribute to miscalls of the bases within the target. The
comparison of a sample target against a reference target provides a
powerful way to "filter out" all the non-specific noise via
difference detection.
[0924] One method of comparison between the reference and sample is
to compare the intensities of the tiling probes themselves.
However, before a direct comparison can be made, the intensities
have to be normalized in some matter to account for both chip to
chip and sample to sample variation. I employed a "local"
normalization process to normalize the signals. By "local"
normalization, I simply divide the intensity of the tiling probe by
the sum of the intensities of its nearest neighbors (FIG. 29).
[0925] This method of normalization creates good signal tracking
between samples and is quite sensitive to the presence of a
mutation indicated by the formation of a "bubble" (FIG. 30). This
"local" normalization tiling probe comparison can be further
transformed by difference analysis and smoothing to a format where
the presence of a mutation is more easily visualized.
[0926] Induced Difference Method for Detecting Mutations.
[0927] Another method for using comparisons between a reference and
a sample to detect mutations is via mutational "induced
differences" between tilings probes and their nearest neighbors.
Application of this method to a first order nearest neighbor tiling
analysis involves comparing "locally normalized" probes in the
reference target to the corresponding probe in the sample target.
Tilings that where uninformative in part II, because they miscalled
the base, may now be informative because certain probe members
within that tiling can be induced (caused to increase or decrease
in intensity) between the reference and the sample indicating the
presence of a mutation (FIG. 31.) These inductions are summed over
all the tilings on both the forward and reverse strand for a given
target position, and the resultant number is a measure of whether a
mutation is present or not (FIG. 32, FIG. 33).
Example 21
Use of Inosine on the 5'ends of the MenPoc Synthesized Probes to
Increase Duplex Stability and Increase the Resultant Ligation
Signal on Generic Ligation GeneChips
[0928] We investigated the use of adding degenerate bases, such as
inosine (pairs with all other bases), to the end of the MenPoc
synthesized probes to increase duplex stability. We found that
indeed, the addition of 1-6 inosines onto the end of the probes did
in fact increase the signal intensity in both hybridization and
ligation reactions on a Generic Ligation GeneChip and allowed us to
ligate at higher temperatures.
[0929] Inosines (0-6) are placed at the 5' end of the probe during
manufacturating, and the effects of these terminal inosines are
assayed by ligating a DNAaseI digested, TdT labeled 788 bp DNA
fragment to the chips. The increased brightness with 2-6 inosines
indicated an enhancement of duplex stability. With 6 inosines there
is a slight decrease in intensity compared to 2-4 inosines because
the terminal inosines are probably starting to form quartet-like
secondary structures.
Example 22
Comparison Between the Specificity of T4 Ligase and Taq Ligase when
Used on a Generic Ligation GeneChip
[0930] We investigated whether T4 ligase or Taq ligase was more
specific in ligating target to the Generic Ligation GeneChip. In
order use Taq ligase, we need to perform the ligation reaction at
40 degrees C. or higher. Consequently, we used an 8mer chip with 6
Inosines at the end of the MenPoc probes to increase the thermal
stability of the duplexes. This allowed us to perform the Taq
ligase reaction at 44 degrees C. and compare this to a T4 ligation
reaction at 37 degrees C. Our results indicated that Taq is much
more specific than T4 ligase, and ligates a set of target ends that
T4 ligase is unable to ligate.
[0931] Taq lights up fewer features but with a brighter intensity
than T4 does indicating the specificity of Taq versus T4.
[0932] Intensity profiles of the tiling probes and nearest neighbor
substitutions at given probe positions within the target illustrate
that Taq is more specific than T4 and that Taq detects signal
intensity at probes that T4 fails to detect signal.
[0933] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference for all purposes.
Sequence CWU 0
0
* * * * *