U.S. patent application number 10/775487 was filed with the patent office on 2005-07-21 for methods for diagnosing and treating autoimmune disease.
This patent application is currently assigned to General Hospital Corporation. Invention is credited to Faustman, Denise L., Hayashi, Takuma.
Application Number | 20050158302 10/775487 |
Document ID | / |
Family ID | 21860541 |
Filed Date | 2005-07-21 |
United States Patent
Application |
20050158302 |
Kind Code |
A1 |
Faustman, Denise L. ; et
al. |
July 21, 2005 |
Methods for diagnosing and treating autoimmune disease
Abstract
The invention provides a method of activating NF.kappa.B
activity in a mammal afflicted with an autoimmune disease in which
a reduction in NF.kappa.B activity is observed, comprising
administering to a mammal suffering from the autoimmune disease a
therapeutically effective amount of a polypeptide which activates
NF.kappa.B, so as to treat the autoimmune disease in the
mammal.
Inventors: |
Faustman, Denise L.;
(Weston, MA) ; Hayashi, Takuma; (Malden,
MA) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Assignee: |
General Hospital
Corporation
|
Family ID: |
21860541 |
Appl. No.: |
10/775487 |
Filed: |
February 10, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10775487 |
Feb 10, 2004 |
|
|
|
09258682 |
Feb 26, 1999 |
|
|
|
6773705 |
|
|
|
|
09258682 |
Feb 26, 1999 |
|
|
|
09031629 |
Feb 27, 1998 |
|
|
|
6617171 |
|
|
|
|
Current U.S.
Class: |
424/131.1 ;
435/7.2; 514/44A |
Current CPC
Class: |
A61K 48/00 20130101;
A61K 38/00 20130101; C12N 9/6421 20130101; G01N 33/564 20130101;
C07K 14/4703 20130101; G01N 2333/9121 20130101; G01N 2800/042
20130101; C12Q 1/37 20130101; C12N 9/1205 20130101; G01N 2500/04
20130101; C07K 14/4702 20130101; A61P 37/06 20180101; G01N
2333/96425 20130101 |
Class at
Publication: |
424/131.1 ;
435/007.2; 514/044 |
International
Class: |
A61K 039/395; G01N
033/53; G01N 033/567; A61K 048/00 |
Claims
1-75. (canceled)
76. A method of treating a mammal having, or predisposed to having,
an autoimmune disease, said method comprising administering to said
mammal a therapeutically effective amount of a substance that
stimulates a signaling pathway that activates NF.kappa.B.
77. The method of claim 76, wherein said substance is
TNF-.alpha..
78. The method of claim 77, wherein said substance is an antibody,
an antisense RNA molecule, or a ribozyme directed against I.kappa.B
or one of the 240 kD or 200 kD human erythrocyte derived proteasome
inhibitors.
79. The method of claim 76, wherein said mammal is a human.
80. The method of claim 76, wherein said disease is diabetes,
rheumatoid arthritis, multiple sclerosis, lupus erythematosis,
myasthenia gravis, scleroderma, Crohn's disease, ulcerative
colitis, Hashimoto's disease, Graves' disease, Sjogren's syndrome,
polyendocrine failure, vitiligo, peripheral neuropathy,
graft-versus-host disease, autoimmnune polyglandular syndrome type
I, acute glomerulonephritis, Addison's disease, adult-onset
idiopathic hypoparathyroidism (AOIH), alopecia totalis, amyotrophic
lateral sclerosis, ankylosing spondylitis, autoimmune aplastic
anemia, autoimmune hemolytic anemia, Behcet's disease, Celiac
disease, chronic active hepatitis, CREST syndrome, dermatomyositis,
dilated cardiomyopathy, eosinophilia-myalgia syndrome,
epidermolisis bullosa acquisita (EBA), giant cell arteritis,
Goodpasture's syndrome, Guillain-Barr syndrome, hemochromatosis,
Henoch-Schonlein purpura, idiopathic IgA nephropathy,
insulin-dependent diabetes mellitus (IDDM), juvenile rheumatoid
arthritis, Lambert-Eaton syndrome, linear IgA dermatosis,
myocarditis, narcolepsy, necrotizing vasculitis, neonatal lupus
syndrome (NLE), nephrotic syndrome, pemphigoid, pemphigus,
polymyositis, primary sclerosing cholangitis, psoriasis,
rapidly-progressive glomerulonephritis (RPGN), Reiter's syndrome,
stiff-man syndrome, or thyroiditis.
81. A method of treating a mammal having, or predisposed to having,
an autoimmune disease, said method comprising the steps of: a.
measuring the activity of NF.kappa.B in said mammal; and b. if the
activity of step (a) is less than a basal state level,
administering to said mammal a therapeutically effective amount of
a substance that stimulates a signaling pathway that activates
NF.kappa.B.
82. The method of claim 81, wherein said substance is TNF-.alpha.,
or an antibody, antisense RNA molecule, or ribozyme directed
against I.kappa.B or one of the 240 kD or 200 kD human erythrocyte
derived proteasome inhibitors.
Description
[0001] This is a continuation of application Ser. No. 09/258,682,
filed Feb. 26, 1999, which is a continuation-in-part of application
Ser. No. 09/031,629, filed Feb. 27, 1998, now U.S. Pat. No.
6,617,171, the entire teachings of each of which are hereby
incorporated by reference, including drawings and tables.
FIELD OF THE INVENTION
[0002] The invention relates in general to the diagnosis and
treatment of immune disorders.
BACKGROUND OF THE INVENTION
[0003] Proteolysis in the Cell
[0004] A. The Proteasome
[0005] In the cytosol, there is a soluble proteolytic pathway that
requires ATP and involves covalent conjugation of the cellular
proteins with the small polypeptide ubiquitin, or Ub, (Hershko et
al., 1992, Ann. Rev. Biochem., 61: 761-807; Rechsteiner et al.,
1987, Ann. Rev. Cell. Biol., 3: 1-30). Thereafter, the conjugated
proteins are hydrolyzed by a 26S proteolytic complex containing a
20S degradative particle called the proteasome (Goldberg, 1992,
Eur. J. Biochem., 203: 9-23); Goldberg et al., 1992, Nature, 357:
375-379). This multicomponent system is known to catalyze the
selective degradation of highly abnormal proteins and short-lived
regulatory proteins. However, the system also appears to be
responsible for the breakdown of most proteins in maturing
reticulocytes (Boches et al., 1982, Science, 215: 978-980); Spenser
et al., 1985, J. Biol. Chem., 257: 14122-14127), in growing
fibroblasts (Ciechanover et al., 1984, Cell, 37: 57-66;
Gronostajski et al., 1985, J. Biol. Chem., 260: 3344-3349) and in
atrophying skeletal muscle.
[0006] The first step in degradation of many proteins involves
their conjugation to Ub by an ATP-requiring process, as described
below. The ubiquitinated proteins are then degraded by an
ATP-dependent proteolytic complex, referred to above, known as the
26S proteasome complex.
[0007] The precise nature of the 26S proteasome complex is unclear,
although it has been shown that the 1000-15 00 kDa (26S) complex
can be formed in extracts of energy-depleted reticulocytes by an
ATP-dependent association of three components, referred to as CF-1,
CF-2, and CF-3 (Ganoth et al., 1988, J. Biol. Chem, 263:
12412-12419). A large (.about.700 kDa) multimeric protease found in
the cytoplasm and nucleus of eukaryotic cells, referred to as the
proteasome, is a component (CF-3) (Driscoll et al., 1992, J. Biol.
Chem, 265: 4789-4792; Eytan et al., 1989, Proc. Natl. Acad. Sci.
U.S.A., 86: 7751-7755; Orlowski et al., 1990, Biochemistry, 29:
10289-10297; Rivet, 1989, Arch. Biochem. Biophys., 268: 1-8).
[0008] The proteasome is believed to make up the catalytic core of
the large 26S multisubunit cytoplasmic particle necessary for the
ubiquitin-dependent pathway of intracellular proteolysis (Driscoll
et al., 1990, J. Biol. Chem., 265: 4789-4692; Eytan et al., 1989,
Proc. Natl. Acad. Sci. U.S.A., 86: 7751-7755; Hough et al., 1987,
Biochemistry, 262: 8303-83 13; McGuire et al., 1988, Biochim.
Biophys. Acta., 967: 195-203; Rechsteiner et al., 1987, Ann. Rev.
Cell. Biol., 3: 1-30; Waxman et al., 1987, J. Biol. Chem., 262: 245
1-2457). By itself, the proteasome is unable to degrade
ubiquitinated proteins, but provides most of the proteolytic
activity of the 26S proteasome complex.
[0009] There is another ATP-dependent protease that is involved in
degradation of ubiquitinated proteins, forms a complex with the
proteasome and appears to be part of the 26S proteasome complex,
which rapidly degrades proteins conjugated to ubiquitin. This
protease, referred to as multipain, has been identified in muscle
and plays an essential role in the ATP/ubiquitin-dependent
pathway.
[0010] The complex formed between multipain and proteasome in vitro
appears very similar or identical to the 1500 kDa Ub-conjugate,
degrading enzyme, or 26S proteolytic complex, isolated from
reticulocytes and muscle. The complexes contain the characteristic
20-30 kDa proteasome subunits, plus a number of larger subunits,
including the six large polypeptides found in multipain. The
complex formed contains at least 10-12 polypeptides of 40-150 kDa.
A 40 kDa polypeptide regulator of the proteasome, which inhibits
the proteasome's proteolytic activities has been purified from
reticulocytes and shown to be an ATP-binding protein whose release
appears to activate proteolysis. The isolated regulator exists as a
250 kDa multimer and is quite labile (at 42.degree. C.). It can be
stabilized by the addition of ATP or a nonhydrolyzable ATP analog,
although the purified regulator does not require ATP to inhibit
proteasome function and lacks ATPase activity. The regulator has
been shown to correspond to an essential component of the 1500 kDa
proteolytic complex. The regulator appears identical to CF2 by many
criteria. These findings suggest that the regulator plays a role in
the ATP-dependent mechanism of the 26S proteasome complex.
[0011] The 20S proteasome is composed of about 15 distinct 20-30
kDa subunits. It contains at least three different peptidases that
cleave specifically an the carboxyl side of the hydrophobic, basic,
and acidic amino acids (Goldberg et al., 1992, Nature, 357:
375-379: Goldberg, 1992, Eur, J. Biochem., 203: 9-23; Orlowski,
1990, Biochemistry, 29: 10289-10297; Rivett et al., 1989, Arch.
Biochem. Biophys., 218: 1; Rivett et al., 1989, J. Biol. Chem, 264:
12215-12219; Tanaka et al., 1992, New Biol. 4: 1-11). These
peptidases are referred to as the chymotrypsin-like peptidase, the
trypsin-like peptidase, and the peptidylglutamyl peptidase. Which
subunits are responsible for these activities is unknown although
the cDNA's encoding several subunits have been cloned (Tanaka et
al., 1992, New Biol., 4: 1-11).
[0012] B. Ubiguitination and Phosphorylation in Protein
Processing
[0013] As reviewed by Hopkin (1997, J. NIH Research, 9: 36-42) and
briefly summarized herein, insight into the mechanisms by which
proteolysis is controlled come from studies of the eukaryotic cell
cycle. To proceed through the cell cycle, replicating its genome
and dividing the resulting DNA between daughter cells during
mitosis, a cell must appropriately activate and inactivate the
regulators of cell division, the cyclindependent kinases (Cdks). To
control Cdks, cells can specifically degrade the cyclin proteins
that activate Cdks and the inhibitors that inactivate them. One
mechanism by which specificity in targeted proteolysis is achieved
is ubiquitination, the process by which cells tack long chains of a
76-amino acid marker protein called ubiquitin (Ub) onto proteins
that are destined for destruction. Ubiquitination of a handful of
cyclins and Cdk inhibitors leads to their timely demise and allows
a cell to complete mitosis or to replicate its DNA; further, it is
believed that phosphorylation of unstable proteins, such as the
cyclins, often increases their susceptibility to ubiquitination and
subsequent elimination.
[0014] As described below, ubiquitination affects signal
transduction, as it may mark certain cell-surface growth-factor
receptors for endocytosis and destruction; further, it is known
that ubiquitination, coupled with phosphorylation, stimulates the
signaling pathway that activates the transcription factor
NF.kappa.B. Ubiquitin also plays a role in protein degradation
pathways regulating cell differentiation and death during
development.
[0015] i. Ubiguitination and Cell Cycle
[0016] Evidence that ubiquitination was interesting from the point
of view of regulation came with the development of a mouse cell
line that arrests in the G.sup.2, or gap 2, phase of the cell
cycle; these cells harbor a defect that cripples an enzyme that
activates Ub before it can bind to proteins, such as the cyclins,
that must be targeted for destruction. Prior to this work,
ubiquitination was viewed only as a means for eliminating damaged,
denatured, and misfolded proteins.
[0017] Most of the proteolysis that occurs in cells involves the
degradation of Ubconjugated proteins. As stated above, the
proteasome recognizes the polyubiquitin tag, selectively admits
proteins to which this marker is complexed and then cleaves them
into small peptide fragments. Ubiquitination is dependent upon a
series of proteins named for their order of elution from a
Ub-affinity column. Ub-activating enzymes, called Els, prime Ub for
transfer to a substrate protein by forming a temporary thioester
linkage between a terminal glycine of Ub and one of their own
cysteine residues. Enter the Ubconjugating proteins generically
called E2s. These enzymes accept activated Ub from an E1 and
transfer it to the substrate protein, either directly or with the
help of a Ub-ligase protein, or E3; interactions between different
E2s and E3s may contribute to the substrate specificity of the
ubiquitination reaction. Yeast maintain a cadre of more than a
dozen structurally related E2s as well as a handful of E3s
(reviewed by Haas and Siepmann, 1997, FASEB J., 11: 1257-1268).
Functional homologues of these proteins have been found in humans
(see Honda et al., 1997, FEBS Lett., 420: 25-27).
[0018] Even within the cell cycle, different sets of E2s and E3 s
function to mark cyclins and Cdk inhibitors for destruction.
Together these proteins regulate entry into new cycles of cell
division, initiation of DNA replication, and the onset of mitosis.
In yeast, cyclins bind to and activate Cdc28, which then pushes
cells into the next phase of the cell cycle, initiating cell
division. It is said that the concentrations of both the cyclins
and the Cdk inhibitors that drive the cell cycle through their
interactions with Cdc28 may be tightly controlled by Ub-associated
proteolysis. The G1 cyclins Cln1, Cln2, and Cln3 activate Cdc28, by
which they are then reciprocally phosphorylated; this
phosphorylation marks the cyclins for ubiquitination and subsequent
destruction by the proteasome.
[0019] The Ub-ligase complex that ubiquitinates the cell-cycle
proteins that control the completion of mitosis is known to be
activated by phosphorylation. The coupling of cyclin B and its
kinase Cdc2 initiates mitosis in yeast. In that system, cyclin B
accumulates during interphase until its pairing with Cdc2 drives
the cell into mitosis and leads to its eventual destruction. The
cyclosome (also called the anaphase-promoting complex, or APC), a
20S nuclear particle which serves as the Ub-ligase complex, helps
to ubiquitinate the mitotic cyclins A and B as well as the
as-yet-unidentified "glue" proteins that bind sister chromatids
together during metaphase. Late in mitosis, an unknown kinase
phosphorylates and activates the cyclosome/APC. Then, working in
conjunction with a Ub-conjugating enzyme called E2-C in clams (an
organism favored by cell-cycle researchers), the cyclosome marks
the mitotic cyclins for degradation by the proteasome (Aristarkhov
et al., 1996, Proc. Natl. Acad. Sci. U.S.A., 93: 9303-9307);
Ub-directed destruction of the mitotic cyclins leads to the
inactivation of Cdc2 and the degradation of the "glue" proteins, so
that sister chromatids are allowed to segregate into the two
daughter cells. E2-C and its human homologue, the
ubiquitin-conjugating human enzyme UbCH10, have been characterized
in detail (Townsley et al., 1997, Proc. Natl. Acad. Sci. U.S.A.,
94: 2362-2367).
[0020] ii. Cell Signalling Pathways
[0021] Proteins that control cell-cycle progression may respond to
environmental cues, such as are provided by growth factors. Growth
factor-stimulated signaling pathways are, themselves controlled in
part by ubiquitination. One of the best studied examples is the
NF.kappa.B pathway (see below). Binding of the cytokine tumor
necrosis factor-.alpha. (TNF.alpha.) to cell-surface receptors, or
the occurrence of another proinflanimatory or stress event (e.g.
hypoxia), initiates a signaling cascade that activates NF.kappa.B
(see below) and c-Jun, transcription factors that govern the
proliferative response in cells.
[0022] Ubiquination may be involved in regulating the amount of a
receptor present on the cell membrane. Stimulation of the Met
tyrosine-kinase receptor by the ligand hepatocyte growth
factor/scatter factor (HGF/SFD spurs the embryonic development of a
variety of mammalian tissues, including liver, placenta, and
muscles). For example, it has been reported that HGF/SF stimulates
the degradation of the Met tyrosine-kinase receptor by proteasomes
in a human sarcoma cell line (Jeffers et al., 1997, Mol. Cell.
Biol., 17: 799-808). In the absence of HGF/SF, this receptor is
cleaved by an unknown protease and the fragment containing the
tyrosine-kinase activity remains embedded in the cell membrane.
According to Hopkin et al. (1997, supra), it has been postulated
that the presence of an unregulated tyro sine kinase in the
membrane could be dangerous and that Ub-targeted degradation is
intended to rid the cell of the membrane-embedded kinase fragment
before damage can occur.
[0023] It is thought that the proteasome will cleave any
ubiquitinated protein with which it comes in contact; however,
different receptors may recognize substrates bearing Ub chains that
differ in internal. The 2-megadalton proteasome complex, which
comprises four stacked rings of .alpha. and .beta. protein subunits
with a series of protease-active sites lining the inside of the
resulting tube, recognizes a subset of ubiquitin chains via the S5
protein subunit. After a Ub-tagged protein binds to the proteasome
complex, it is unfolded in order to facilitate passage through the
proteasome pore into the proteolytic chamber. Mutational
inactivation of the S5 proteasome subunit results in a specific
subset of ubiquitinated proteins being spared from degradation (van
Nocker et al., 1996, Mol. Cell. Biol., 16: 6020-6028). It is this
selectivity which suggests that the proteasome may possess more
than one receptor for detecting Ub-conjugated proteins.
[0024] NF.kappa.B has been implicated in the etiology of immune
disorders. Adams et al. (WO 96/13266) teach inhibition of
proteasome activity, which mediates the activation of NF.kappa.B,
to treat autoimmune diseases.
[0025] Similarly, Brand et al. (WO 95/249 14) teach that new, as
well as existing, proteasome inhibitors may be used to treat
autoimmune diseases.
[0026] Further, according to Palombella et al. (WO 95/25533; page
7, lines 16-23), Goldberg et al. are said to teach methods and
drugs that inhibit antigen processing for the treatment of
autoimmune diseases.
[0027] According to Kopp and Ghosh (1994, Science, 265: 956-969)
and Grilli et al. (1996, Science, 274: 1383-1385), salicylate and
glucocorticoids, anti-inflammatory drugs that are inhibitors of
NF.kappa.B, are widely used to treat established cases of
autoimmune diseases.
[0028] In addition, NF.kappa.B is said to said to be a positive
transcriptional regulator of inducible nitric oxide synthase
(iNOS), which in turn mediates cytokine-induced inhibition of
insulin secretion by pancreatic cells of the islets of Langerhans
(Kwon et al., 1995, Endocrinology, 136: 4790-4795); inhibition of
NF.kappa.B activity suppresses this phenotype.
[0029] There is need in the art for improved methods of treating
autoimmune disorders.
SUMMARY OF THE INVENTION
[0030] The invention provides a method of detecting autoimmune
disease in a mammal, comprising providing a biological sample from
a mammal and detecting proteasome activity, wherein a reduction in
proteasome activity from a basal state is indicative of autoimmune
disease.
[0031] As used herein, the term "autoimmune disease" refers to a
disorder wherein the immune system of a mammal mounts a humoral or
cellular immune response to the mammal's own tissue or has
intrinsic abnormalities in its tissues preventing proper cell
survival without inflammation.
[0032] Examples of autoimmune diseases include, but are not limited
to, diabetes, rheumatoid arthritis, multiple sclerosis, lupus
erythematosis, myasthenia gravis, scieroderma, Crohn's disease,
ulcerative colitis, Hashimoto's disease, Graves' disease, Sjogren's
syndrome, polyendocrine failure, vitiligo, peripheral neuropathy,
graft-versus-host disease, autoimmnune polyglandular syndrome type
I, acute glomerulonephritis, Addison's disease, adult-onset
idiopathic hypoparathyroidism (AOIH), alopecia totalis, amyotrophic
lateral sclerosis, ankylosing spondylitis, autoimmune aplastic
anemia, autoimmune hemolytic anemia, Behcet's disease, Celiac
disease, chronic active hepatitis, CREST syndrome, dermatomyositis,
dilated cardiomyopathy, eosinophilia-myalgia syndrome,
epidermolisis bullosa acquisita (EBA), giant cell arteritis,
Goodpasture's syndrome, Guillain-Barr syndrome, hemochromatosis,
Henoch-Schonlein purpura, idiopathic IgA nephropathy,
insulin-dependent diabetes mellitus (IDDM), juvenile rheumatoid
arthritis, Lambert-Eaton syndrome, linear IgA dermatosis,
myocarditis, narcolepsy, necrotizing vasculitis, neonatal lupus
syndrome (NLE), nephrotic syndrome, pemphigoid, pemphigus,
polymyositis, primary sclerosing cholangitis, psoriasis,
rapidly-progressive glomerulonephritis (RPGN), Reiter's syndrome,
stiff-man syndrome and thyroiditis.
[0033] As used herein, the term "diabetes" refers both to the type
I form of the disease and to type II cases that share only an islet
cell defect with type I.
[0034] Symptoms common to many types of autoimmune dysfunction
include, but are not limited to: fatigue; inflammation; paresis;
joint stiffness, pain or swelling; skin lesions or nodules; skin
discoloration; enzymatic imbalances; tissue degeneration. Examples
of such symptoms as pertain to specific autoimmune diseases are
described hereinbelow in the Description section. Such symptoms or,
alternatively, measurements of tissue death/destruction, may be
used either as diagnostic indicators of the presence of an
autoimmune disease, or as indices by which to assess the efficacy
of treatment thereof.
[0035] In the treatment of autoimmune disease, a therapeutically
effective dosage regimen should be used. By "therapeutically
effective", one refers to a treatment regimen sufficient to restore
the mammal to the basal state, as defined herein, at the cellular
or tissue site of manifestation or to prevent an autoimmune disease
in an individual at risk thereof or restore the mammal's immune
system to the basal state. Alternatively, a "therapeutically
effective regimen" may be sufficient to arrest or otherwise
ameliorate symptoms of an autoimmune disease. Generally, in the
treatment of autoimmune diseases, an effective dosage regimen
requires providing the medication over a period of time to achieve
noticeable therapeutic effects; such a period of time may begin at,
or even before, birth and continue throughout the life of the
individual being treated. Methods of treatment are discussed in
detail in the Description section, below.
[0036] As used herein, the term "biological sample" refers to a
whole organism or a subset of its tissues, cells or component parts
(e.g. body fluids, including but not limited to blood, mucus,
lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva,
amniotic fluid, amniotic cord blood, urine, vaginal fluid and
semen). "Biological sample" further refers to a homogenate, lysate
or extract prepared from a whole organism or a subset of its
tissues, cells or component parts, or a fraction or portion
thereof. Lastly, "biological sample" refers to a medium, such as a
nutrient broth or gel in which an organism has been propagated,
which contains cellular components, such as proteins or nucleic
acid molecules.
[0037] As used herein, the term "organism" refers to all cellular
life-forms, such as prokaryotes and eukaryotes, as well as
non-cellular, nucleic acid-containing entities, such as
bacteriophage and viruses.
[0038] As used herein, the term "mammal" refers to a member of the
class Mammalia, including a human.
[0039] It is contemplated that procedures useful for the detection
of proteins or nucleic acids and biological activities thereof
include, but are not limited to, immunological assays, such as
immunoblotting, immocytochemistry, immunohistochemistry or
antibody-affinity chromatography, electrophoretic analysis, such as
one- or two-dimensional SDS-PAGE, Northern or Southern analysis, in
vivo or in vitro enzymatic activity assay, the polymerase chain
reaction (PCR), reverse-transcription PCR (RTPCR), in situ nucleic
acid hybridization, electrophoretic mobility shift analysis (EMSA),
transcription assay, or variations or combinations of these or
other techniques such as are known in the art.
[0040] As used herein, the term "proteasome" refers to a
multi-subunit protein complex in the cytoplasm of eukaryotic cells
which recognizes and selectively cleaves ubiquitinated protein
molecules to mediate either activation or degradation of the
protein so recognized and cleaved.
[0041] As used herein in reference to proteasome activity, the term
"reduction" refers to the failure of the proteasome to cleave a
target ubiquitinated protein at as few as one-, more than one-, or
even as many as all of the sites that it normally (i.e., in a
genetically wild-type or otherwise healthy individual) recognizes
and cleaves in that protein. Preferably, such a reduction involves
failure to cleave the target protein at 5-10% of sites, more
preferably, at 20-50% of sites, and most preferably at 75-100% of
such sites. Different numbers and/or patterns of sites on different
proteins are cleaved by the proteasome. The term "different
proteins" refers to protein molecules that differ in amino acid
sequence in at least one position. Promiscuous cleavage (i.e., at a
site not normally recognized and cleaved) of a protein by the
proteasome is defined as a reduction only if such aberrant cleavage
is accompanied by the failure of the proteasome to cleave a site
normally recognized and cleaved.
[0042] As used herein, the term "basal state" refers to the level
of activity of a protein, nucleic acid or other molecule where
autoimmune disease is not present, i.e. a "normal level" of
activity. The basal state is observed in genetically wild-type or
otherwise healthy individuals, as well as in individuals who have a
propensity for an autoimmune disease (as judged by genetic or
environmental criteria known to those of skill in the medical art)
but have not yet developed such a disease and even individuals who
are in the early stages of an autoimmune disease but have not, for
example, become actively symptomatic.
[0043] Preferably, the biological sample comprises protein.
[0044] It is contemplated that the protein of a biological sample
of use in the invention may be crude (i.e., in an unfractionated
cell lysate), partially-purified or isolated, and either
naturally-occurring or produced by recombinant techniques, such as
the expression of a cDNA or other gene sequence cloned from a
mammal.
[0045] In a preferred embodiment, a reduction in proteasome
activity is detected.
[0046] A reduction in proteasome activity may be observed as a
reduction in the activation of transcription factors (among them,
NF.kappa.B) as judged either by observation of the physical
properties of such a protein (for example, antigenicity or
molecular weight, as judged by sedimentation or electrophoretic
mobility) that are characteristic of its pre-activation form or by
the absence of mRNA (or the protein encoded by such a message)
resulting from the transcription of a gene that is positively
regulated by the protein in a biological sample. In addition, a
reduction in the proteolytic processing of a protein normally
cleaved by the proteasome (such as an MHC antigen, which is cleaved
by the proteasome prior to transport to- and presentation on the
cell surface).
[0047] Preferably, the reduction in proteasome activity comprises a
reduction of proteolytic processing of NF.kappa.B, p105, p100,
I.kappa.B, or a subunit thereof.
[0048] Methods for the detection of a reduction in proteolytic
processing of NF.kappa.B are as described in detail hereinbelow in
Example 2.
[0049] Preferably, the mammal is a human.
[0050] It is preferred that the autoimmune disease is an HLA class
II-linked disease.
[0051] As used herein, the term "HLA class II-disease" refers to
those autoimmune diseases showing statistical risk factors for
disease penetrance attributed to HLA class II genes or to
neighboring genes.
[0052] The term "HLA" (for "human lymphocyte antigen") refers to
genes of the human major histocompatibility complex (MHC) or their
protein products. In mice, the genetic region corresponding to- or
homologous with the HLA is termed the H2 complex.
[0053] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed above
as autoimmune diseases.
[0054] Another aspect of the present invention is a method of
detecting autoimmune disease in a mammal, comprising providing a
biological sample from a mammal and detecting protein
ubiquitination, wherein a reduction in protein ubiquitination from
a basal state is indicative of autoimmune disease.
[0055] As used herein in reference to protein ubiquitination, the
term "reduction" refers to the failure of ubiquitinating enzymes to
ubiquitinate a target protein at as few as one-, more than one-, or
even as many as all of the sites that they normally (i.e., in a
genetically wild-type or otherwise healthy individual) recognize
and ubiquitinate in that protein. Preferably, such a reduction
involves failure to ubiquitinate the target protein at 10-20% of
sites, more preferably, at 40-50% of sites, and most preferably at
80-100% of sites. Different numbers and/or patterns of sites on
different proteins are ubiquitinated by the ubiquitinating enzymes.
The term "different proteins" refers to protein molecules that
differ in amino acid sequence in at least one position. Promiscuous
ubiquitination (i.e., at a site not normally recognized and
ubiquitinated) of a protein by the ubiquitinating enzymes is
defined as a reduction only if such aberrant ubiquitination is
accompanied by the failure of the ubiquitinating enzymes to
ubiquitinate a site normally recognized and ubiquitinated.
[0056] It is preferred that the biological sample comprises
protein.
[0057] It is additionally preferred that a reduction in protein
ubiquitination is detected for a protein.
[0058] Preferably, the mammal is a human.
[0059] It is preferred that the autoimmune disease is an HLA class
II-linked disease.
[0060] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed
above.
[0061] The invention also encompasses a method of detecting
autoimmune disease in a mammal, comprising providing a biological
sample from a mammal and detecting protein phosphorylation, wherein
a reduction in protein phosphorylation from a basal state is
indicative of autoimmune disease.
[0062] As used herein in reference to protein phosphorylation, the
term "reduction" refers to the failure of a protein kinase to
phosphorylate a target protein at as few as one-, more than one-,
or even as many as all of the sites that it normally (i.e., in a
genetically wild-type or otherwise healthy individual) recognizes
and phosphorylates in that protein. Preferably, such a reduction
involves failure to phosphorylate the target protein at 2-10% of
sites, more preferably, at 25-50% of sites, and most preferably at
90-100% of sites. Different numbers and/or patterns of sites on
different proteins are phosphorylated by protein kinases. The term
"different proteins" refers to protein molecules that differ in
amino acid sequence in at least one position. Promiscuous
phosphorylation (i.e., at a site not normally recognized and
phosphorylated) of a protein by a protein kinase is defined as a
reduction only if such aberrant phosphorylation is accompanied by
the failure of the protein kinase to phosphorylate a site normally
recognized and phosphorylated.
[0063] It is preferred that the biological sample comprises
protein.
[0064] It is also preferred that a reduction in protein
phosphorylation is detected.
[0065] Preferably, the mammal is a human.
[0066] It is preferred that the autoimmune disease is an HLA class
II-linked disease.
[0067] In another preferred embodiment, the autoimmune disease is
selected from the group provided above.
[0068] Another aspect of the present invention is a method of
detecting autoimmune disease in a mammal, comprising providing a
biological sample from a mammal and detecting NF.kappa.B activity,
wherein a reduction in NF.kappa.B activity from a basal state is
indicative of autoimmune disease.
[0069] As defined herein with regard to NF.kappa.B activity, the
term "reduction" refers to a loss of the ability of NF.kappa.B to
direct the transcription of genes whose cis-regulatory sequences
comprise an NF.kappa.B recognition site, wherein such a site is
normally bound and transcription of the gene activated by
NF.kappa.B. Preferably, such a reduction is in the range of 5-10%
of the basal state level of activity, more preferably 25-50% and
most preferably 70-100%.
[0070] Preferably, the biological sample comprises protein.
[0071] It is preferred that the biological sample comprises a
nucleic acid.
[0072] As used herein, the term "nucleic acid" refers to a DNA
molecule, such as genomic DNA or cDNA, and also to RNA. A nucleic
acid may be double- or single-stranded, circular or linear and may
be naturally-occurring, recombinant or synthetic (produced by
either enzymatic or chemical means as a known in the art); if
recombinant or synthetic, a nucleic acid molecule may comprise
sequences which are known to occur naturally or which are
novel.
[0073] It is preferred that a reduction in said NF.kappa.B activity
is detected.
[0074] As stated above, a reduction in NF.kappa.B activity may be
determined either through its failure to direct the transcription
of downstream genes, physical characteristics or DNA- or
protein-binding activity in comparison to those of the basal state.
NF.kappa.B activity may be assayed either in vivo or in vitro using
an NF.kappa.B-dependent reporter gene expression construct and a
substrate for enzymatic detection (such as chloramphenicol acetyl
transferase or .beta.-galactosidase, depending on the specificity
of the enzyme encoded by the reporter gene), wherein comparative
quantitation of the product of the diagnostic enzymatic reaction
(or, in the absence of a reaction substrate, the level of the
reporter mRNA or its encoded protein) in biological samples derived
from a test subject and a normal control indivicual allow for the
assessment of NF.kappa.B functional loss. Alternatively,
immunological or other biochemical determination of whether or not
1%B has been cleaved from NF.kappa.B may be made, as described
above and in Example 2, below.
[0075] Preferably, the mammal is human.
[0076] It is preferred that the autoimmune disease is an HLA class
II-linked disease.
[0077] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed
above.
[0078] The invention also provides a method of detecting autoimmune
disease in a mammal, comprising providing a biological sample from
a mammal and detecting cell survival or growth, wherein cell death
prior to direct lymphocyte or antibody attack in a tissue that is a
suspected target of an autoimmune disease is indicative of the
autoimmune disease.
[0079] As used herein, the term "growth" refers to mitosis or
differentiation (acquisition of cell surface marders or specialized
functions, e.g. protein production, indicative of a mature cell
type.
[0080] As used herein, the term "tissue" refers to intact tissue or
tissue fragments, such that the cells are sufficiently aggregated
(associated) so as to form a cohesive mass. A tissue may comprise
an entire organ (e.g. the pancreas, the thyroid, a muscle, or
others) or other system (e.g. the lymphatic system) or a subset of
the cells thereof; therefore, a tissue may comprise 0.1-10%, 20-50%
or 50-100% of the organ or system (e.g. as is true of islets of the
pancreas).
[0081] Examples of tissue types that are the targets of autoimmune
disease include, but are not limited to, blood, lymph, the central
nervous system (including brain or spinal cord gray or white
matter), liver, kidney, spleen, heart muscle or blood vessels,
cartilage, ligaments, tendons, lung, pancreas (in particular,
pancreatic islets of Langerhans), lacrimal ducts, melanocytes, the
adrenal cortex, skin, the intestinal tract (in particular, the
luminal epithelium and the colon), ovary, testes, prostate, and
regions such as joints, nerve/blood vessel junctions, salivary
glands, bones, specific tendons or ligaments.
[0082] As used herein, the term "cells" is defined as including
dissociated cells, intact tissue or tissue fragments.
[0083] As used herein, the term "suspected target" refers to a
tissue that is damaged in the course of an autoimmune disease of
which a mammal is believed to suffer or to be at risk of
suffering.
[0084] It is contemplated that an individual is at risk of an
autoimmune disease based either upon family history, the results of
genetic testing, exposure (either after birth or in utero) to a
substance such as is known to trigger autoimmune disease (see,
below, the description of animal models of autoimmune disease);
such an individual is "suspected of suffering" (see below) or
"suspected of harboring" an autoimmune disease or is said to have a
"propensity" for developing such a disease.
[0085] Preferably, the sample is obtained from the mammal at an
early stage in the disease prior to or early in the formation of
autoantibodies against the tissue.
[0086] As used herein, the term "prior" may refer to a period of
time immediately before autoantibodies first are or would expected
to be formed in an individual with a propensity for autoimmune
disease. "Prior" may be used to indicate a time weeks, months or
years before the appearance of autoantibodies. It is contemplated
that in an individual suspected of being at risk for an autoimmune
disease, this may be as early as birth or even during the prenatal
period.
[0087] As used herein, the term "early" refers to a stage of an
autoimmune disease preceding complete target tissue destruction by
the immune system.
[0088] Preferably, cell death is detected in a tissue that is a
suspected target of autoimmune disease prior to the formation of
autoantibodies.
[0089] It is preferred that the biological sample comprises cells
of a tissue that is a suspected target of autoimmune disease.
[0090] It is additionally preferred that the mammal is a human.
[0091] Preferably, the autoimmune disease is an HLA class II-linked
disease.
[0092] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed
above.
[0093] The invention also encompasses a method of treating an
autoimmune disease in a mammal, comprising administering to a
mammal suspected of suffering from an autoimmune disease an agent
which restores protein ubiquitinating enzyme function in an amount
and for a time sufficient to result in normal protein
ubiquitination in the mammal.
[0094] As used herein, the term "agent" refers to a biochemical
substance selected from the group that includes, but is not limited
to, proteins, peptides or amino acids; nucleic acids such as DNA,
such as full-length genes or fragments thereof derived from
genomic, cDNA or artificial coding sequences, gene regulatory
elements, RNA, including mRNA, tRNA, ribosomal RNA, ribozymes and
antisense RNA, oligonucleotides and oligoribonucleotides,
deoxyribonucleotides and ribonucleotides; carbohydrates; lipids;
proteoglycans; such agents may be administered as isolated
(purified) compounds or in crude mixtures, such as in a tissue,
cell or cell lysate. Alternatively, "agent" may refer to an organic
or inorganic chemical as is known in the art.
[0095] Methods of administering a therapeutic agent include, but
are not limited to, topical application (e.g., for skin lesions),
intravenous drip or injection, subcutaneous, intramuscular,
intraperitoneal, intracranial and spinal injection, ingestion via
the oral route, inhalation, trans-epithelial diffusion (such as via
a drug-impregnated, adhesive patch) or by the use of an
implantable, time-release drug delivery device, which may comprise
a reservoir of exogenously-produced agent or may, instead, comprise
cells that produce and secrete the therapeutic agent.
[0096] As used herein, the term "ubiquitinating enzyme function"
refers to the covalent attachment of one or more ubiquitin
molecules to a protein by members of the several classes of
ubiquitinating enzymes, which include ubiquitin-activating enzymes
(E1, which prime ubiquitin for attachment to a protein),
ubiquitin-conjugating enzymes (E2, which bind primed ubiquitin for
transfer to a target protein and ubiquitin ligases (E3, which
catalyze the linkage of ubiquitin to specific sites on the target
protein, which sites vary in number and type from protein to
protein, as discussed above).
[0097] As used herein with regard to protein ubiquitination, the
term "restore" refers to a return of the ubiquitination of at least
one site which is normally ubiquitinated (that is, a site that is
ubiquitinated in the basal state, as defined above) and, preferably
all such sites, but is not ubiquitinated in the course of an
autoimmune disease. Preferably, in the restoration of a normal
level and pattern of ubiquitination, 50% of such sites are
restored, more preferably, 60-85% and, most preferably, 90-100%.
Such percentages include only the ubiquitination of sites that are
normally ubiquitinated in the protein in question. In addition, an
elevation of ubiquitination beyond 100% of normal values is not
encompassed by this definition. It is contemplated that a
restoration is sufficient to allow proper (i.e., that which is
qualitatively comparable to that observed in the basal state)
recognition and cleavage of the protein so ubiquitinated by the
proteasome.
[0098] Preferably, the agent is selected from the group that
consists of a protein and a nucleic acid that encodes that
protein.
[0099] It is preferred that the protein is selected from the group
that includes a ubiquitin-activating enzyme (E1), a
ubiquitin-conjugating enzyme (E2) and ubiquitin-ligases (E3).
[0100] Examples of human homologues of the yeast ubiquitination
enzymes include, but are not limited to UbCH5 (which functions as
an E2) and the MDM2 oneoprotein, which acts as a ubiquitin ligase,
or E3.
[0101] Preferably, the agent is a nucleic acid which encodes an
antisense RNA or a ribozyme.
[0102] It is preferred that the mammal is a human.
[0103] It is additionally preferred that the autoimmune disease is
an HLA class II-linked disease.
[0104] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed
above.
[0105] Another aspect of the present invention is a method of
treating an autoimmune disease in a mammal, comprising
administering to a mammal suspected of suffering from an autoimmune
disease an agent which restores NF.kappa.B activity in an amount
and for a time sufficient to result in normal NF.kappa.B activity
in the mammal.
[0106] As used herein, the term "normal NF.kappa.B activity" refers
to a value that is at least 25% of the activity of one or more of
NF.kappa.B and its subunits p50, p105 and p65 observed in the basal
state, as defined herein above, preferably in the range of 30-90%
and most preferably in the range of 95-100%. "Normal NF.kappa.B
activity" may not exceed 100% of NF.kappa.B basal state
activity.
[0107] Preferably, the agent is selected from the group that
consists of a protein and a nucleic acid that encodes that
protein.
[0108] It is preferred that the protein is selected from the group
that includes a mutant- or wild-type NF.kappa.B p50, NF.kappa.B
p52, a competitor of I.kappa.B that does not bind NF.kappa.B p50 or
NF.kappa.B p65 (e.g., the I.kappa.B mutant described in Ex. Jour.
Biol. Chem., 1998, 273: 2931, herein incorporated by reference), a
mutant- or wild-type NF.kappa.B p65, tumor necrosis factor-.alpha.,
E-selectin, I-cam, and V-cam, interleukin-2, interleukin-6,
granulocyte colony-stimulating factor, interferon-.beta., Lmp2,
Lmp7, a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating
enzyme (E2), a ubiquitin-ligase (E3), a ubiquitin deconjugating
enzyme (UCH), a protein kinase, a proteasome subunit and an
antibody directed against one of the 240 kD and 200 kD human
erythrocyte proteasome inhibitors, CF-2 and I.kappa.B.
[0109] In another preferred embodiment, the agent is selected from
the group that consists of a ribozyme, an antisense RNA molecule, a
DNA molecule that encodes a said ribozyme, and a DNA molecule that
encodes a said antisense RNA molecule.
[0110] Preferably, the ribozyme or antisense RNA molecule is
directed against one of the 240 kD and 200 kD human erythrocyte
proteasome inhibitors, CF-2 and I.kappa.B.
[0111] It is preferred that the mammal is a human.
[0112] It is additionally preferred that the autoimmune disease is
an HLA class II-linked disease.
[0113] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed
above.
[0114] Another aspect of the present invention is a method of
treating an autoimmune disease in a mammal, comprising
administering to a mammal suspected of suffering from an autoimmune
disease resulting from a reduction in the activity of NF.kappa.B,
DNA repair factor TFIIH, STAT transcription factor, ubiquitination,
phosphorylation or the proteasome an agent which restores
lymphocyte maturation in an amount and for a time sufficient to
result in normal lymphocyte maturation in the mammal.
[0115] It is preferred that the agent is selected from the group
that consists of a protein and a nucleic acid that encodes that
protein.
[0116] It is additionally preferred that the protein is selected
from the group that includes apolipoprotein B 100, DNA repair
factor TFIIH, STAT transcription factor, a mutant- or wild-type
NF.kappa.B p50, a mutant- or wild-type NF.kappa.B p65, tumor
necrosis factor-.alpha., E-selectin, I-cam, and V-cam,
interleukin-2, interleukin-6, a ubiquitin deconjugating enzyme
(UCH), colony-stimulating factor, interferon-.beta., Lmp2, Lmp7, a
ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme
(E2), a ubiquitin-ligase (E3), a protein kinase, a proteasome
subunit and an antibody directed against one of the 240 kD and 200
kD human erythrocyte proteasome inhibitors, CF-2 and I.kappa.B.
[0117] Preferably, the agent is selected from the group that
includes a ribozyme, an antisense RNA molecule, a DNA molecule that
encodes a ribozyme and a DNA molecule that encodes an antisense RNA
molecule.
[0118] It is preferred that the ribozyme or antisense RNA molecule
is directed against one of the 240 kD) and 200 kD human erythrocyte
proteasome inhibitors, CF-2 and I.kappa.B.
[0119] It is additionally preferred that the mammal is a human.
[0120] Preferably, the autoimmune disease is an HLA class II-linked
disease.
[0121] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed
above.
[0122] A final aspect of the present invention is a method of
treating an autoimmune disease in a mammal, comprising
administering to a mammal suspected of suffering from an autoimmune
disease resulting from a reduction in the activity of NF.kappa.B,
DNA repair factor TFIIH, STAT transcription factor, or the
proteasome an agent which restores the cell cycle in an amount and
for a time sufficient to result in normal survival of cells of a
tissue that is susceptible to an autoimmune disease prior to the
formation of autoantibodies, prior to cell death or prior to
cellular attack against the cells in the mammal.
[0123] As defined herein, "normal survival of cells" is at least a
10% cell survival rate relative to that observed in the basal
state. Preferably, "normal survival of cells" is in the range of
25-50% or even 75-100%; however, "normal survival of cells" does
not encompass cell survival at a rate higher than 100% of that
observed in the basal state. In other words, "normal survival of
cells" does not refer to hyperproliferation of cells.
[0124] Preferably, the agent is selected from the group that
includes a protein and a nucleic acid that encodes that
protein.
[0125] It is preferred that the protein is selected from the group
that includes a cyclin, a cyclin-dependent kinase, apolipoprotein B
100, DNA repair factor TFIIH, STAT transcription factor, a mutant-
or wild-type NF.kappa.B p50, a mutant- or wild-type NF.kappa.B p65,
tumor necrosis factor-.alpha., E-selectin, I-cam, and V-cam,
interleukin-2, interleukin-6, granulocyte colony-stimulating
factor, interferon-.beta., Lmp2, Lmp7, a ubiquitin-activating
enzyme (E1), a ubiquitin-conjugating enzyme (E2), a
ubiquitin-ligase (E3), a ubiquitin deconjugating enzyme (UCH), a
protein kinase, a proteasome subunit and an antibody directed
against one of the 240 kD and 200 kD human erythrocyte proteasome
inhibitors, CF-2 and I.kappa.B.
[0126] It is additionally preferred that the agent is selected from
the group that includes a ribozyme, an antisense RNA molecule, a
DNA molecule that encodes a ribozyme and a DNA molecule that
encodes an antisense RNA molecule.
[0127] Preferably, the ribozyme or antisense R.NA molecule is
directed against one of the 240 kD and 200 kD human erythrocyte
proteasome inhibitors, CF-2 and I.kappa.B.
[0128] It is preferred that the mammal is a human.
[0129] It is additionally preferred that the autoimmune disease is
an HLA class 11-linked disease.
[0130] In another preferred embodiment, the autoimmune disease is
selected from the group that includes those diseases listed
above.
[0131] A final aspect of the invention is a method for screening
for a modulator of LMP2 function, comprising the steps of
contacting an assay system with a candidate modulator of LMP2,
wherein in the system, proteasome-mediated cleavage of a
ubiquitinated protein occurs, and monitoring cleavage of the
ubiquitinated protein, wherein a change in cleavage resulting from
the contacting indicates that the candidate modulator is effective
as a modulator of LMP2 function.
[0132] Further features and advantages of the invention will become
more fully apparent in the following description of the embodiments
and drawings thereof, and from the claims.
BRIEF DESCRIPTIONS OF THE DRAWINGS
[0133] FIG. 1 shows the association of NF.kappa.Bp65 with a
cellular serine kinase. FIG. 1A: GST-NF.kappa.Bp65 and GST-CTD were
expressed in BL21pLysSE. Coli cells and purified by selective
absorption to glutathionsepharose beads. GST-NF-.kappa.Bp65 was
incubated with cytosolic and nuclear extracts. Reaction mixtures
were washed in PBS. The precipitated complexes were then incubated
with GST-CTD of RNA polymerase II large subunit under the kinase
buffer containing .gamma.-[.sup.32P]ATP as previously described
(Hayashi et al., 1993, J. Biol. Chem., 268: 26790-26795; Faustman
et al., 1989, Diabetes, 38: 1462-1468). The phosphorylated products
were separated on 12% SDS-PAGE and visualized by autoradiography.
One-fortieth of the input (I) and supernatant (5) fractions and
{fraction (1/40)} of the last wash (W) and pellet (P) fractions
were used for in vitro kinase reaction. FIG. 1B: In vitro kinase
reactions were performed under the different conditions containing
the individual indicated amount of the precipitated complexes,
GST-CTD. FIG. 1C: Selective inhibition of phosphorylation activity
by DRB. In vitro kinase assays were carried out and phosphorylated
products were separated by SDS-PAGE and visualized by
autoradiography (upper panel). Quantitation of phosphorylated
GST-CTD was performed with BAS 3000 phosphoimager and were plotted
out (lower panel). The indicated concentration of DRB were included
in each kinase reaction mixture. FIG. 1D: Phosphoamino acid
analysis of in vitro--labeled GST-CTD. GST-CTD of RNA polymerase II
large subunit were phosphorylated in the in vitro kinase reaction
and resolved by SDS-PAGE. The phosphorylated form of GST-CTD was
excised from the gel and processed for phosphoamino acid analysis.
The phosphoamino acids were separated by electrophoresis by
standard methods, and the migration of the phosphoamino acid
standards were visualized by ninhydrin staining, as indicated. FIG.
1E: Transactivation domain of NF.kappa.Bp65 is sufficient for the
association with a cellular serine kinase. Cytosolic extracts or
nuclear extracts were incubated with either GST,
GST-NF.kappa.Bp65Q417 or GST-NF.kappa.Bp65C418. Precipitated
complexes were incubated with GST-CTD of RNA polymerase II large
subunit in kinase buffer containing .gamma.-{.sup.32P] ATP. The
phosphorylated products were separated on 12% SDS-PAGE and
visualized by autoradiography. One-fortieth of the input (I) and
supernatant (S) fractions and {fraction (1/40)} of the last wash
(W) and pellet (P) fractions were used for the in vitro kinase
reaction.
[0134] FIG. 2 presents the detection of ATP-binding proteins that
associate with NF.kappa.Bp65, such as cellular serine kinases, by
in vitro affinity labeling. GST-NF-.kappa.Bp65 (FIG. 2A) or
GST-NF-.kappa.Bp65C418 (FIG. 2B) was incubated with cytosolic
extract (left panel), nuclear extract (right panel). The
precipitated complexes were then incubated with GST-CTD under the
kinase buffer containing .gamma.-[.sup.32P]ATP for in vitro kinase
assay. The precipitated complexes were incubated with
8-azide-.alpha.-.sup.32P) ATP in kinase buffer for the ATP-binding
assay. The samples were irradiated by a UV lamp. The phosphorylated
products or ATP affinity-labeled products were separated on 12%
SDS-PAGE and visualized by autoradiography. One fortieth of the
input (I) and supernatant (S) fractions and {fraction (1/40)} of
the last wash (W) and pellet (P) fractions were used for the in
vitro kinase reaction. FIG. 2C: The cytosolic extract (left panel),
nuclear extract (right panel) were incubated with
anti-NF.kappa.Bp65 polyclonal antibody. Immunoprecipitation assays
were performed and then the inmiunoprecipitated complexes were
incubated with GST-CTD in kinase buffer containing
.gamma.-[.sup.32P] ATP for the in vitro kinase assay. The
immunoprecipitated complexes were incubated with
8-azide-(.alpha.-.sup.32P) ATP in kinase buffer for the ATP-binding
assay. The samples were irradiated by a UV lamp. The phosphorylated
products or ATP affinity-labeled products were separated on 12%
SDSPAGE and visualized by autoradiography. One-fortieth of the
input (S) and supernatant (5) fractions and {fraction (1/40)} of
the last wash (W) and pellet (P) fractions were used for in vitro
kinase reaction.
[0135] FIG. 3 shows the induction of kinase activity by HIV-1
trans-activator transcription factor (Tat). FIG. 3A:
GST-NF.kappa.Bp65 was incubated with cytosolic and nuclear
extracts. The precipitated complexes were pre-incubated with either
wild-type GST-Tat, or either of the mutants GST-Tat K41A and
GST-Tat Cys22 at 4.degree. C. for 5 minutes. The amount of GST-Tat
added into the reaction mixtures is indicated in the figure. The
reaction mixtures were then incubated with GST-CTD in kinase buffer
containing .gamma.-[.sup.32P]ATP. The phosphorylated products were
separated on 12% SDSPAGE and visualized by autoradiography. FIG.
3B: Graphic representation of quantitation of phosphorylated
GST-CTD.
[0136] FIG. 4 shows the association of NF.kappa.Bp65 with Cdks.
Cytosolic extracts or nuclear extracts were incubated with either
GST-NF.kappa.Bp65 (FIG. 4A, FIG. 4C) or GST-NF.kappa.Bp65 C418
(FIG. 4B). FIGS. 4A and 4B: The protein complexes were precipitated
using GST-sepharose beads after incubation and immunoblotting. FIG.
4C: The protein complexes were precipitated using
anti-NF.kappa.Bp65 polyclonal antibody after incubation and
immunoblotting blotting with appropriate antibodies. One-fortieth
of the input (I) and supernatant (S) fractions and {fraction
(1/40)} of the last wash (W) and pellet (P) fractions were used for
the immunoblotting blotting assay.
[0137] FIG. 5 shows the absence of association of NF.kappa.Bp65
with Cdks in NOD mice.
[0138] FIG. 6 shows DNA-binding activities of NF.kappa.B and other
transcription factors in lung tissue of BALB/C and NOD mice.
[0139] FIG. 7 presents the identification of NF.kappa.B DNA-binding
protein in DNA/protein complexes using super-shift assay.
[0140] FIG. 8 presents .kappa.B sequence-binding activities in
spleen cells from BALB/C and NOD mice.
[0141] FIG. 9 shows the identification of .kappa.B sequence-binding
protein in DNA/protein complexes using the super-shift assay.
[0142] FIG. 10 presents immunoblot analysis of the basal expression
of NF-.kappa.B subunits, I.kappa.B.alpha. and cyclin-dependent
kinases in spleen cell cytosolic and nuclear extracts of male and
female BALB/c and NOD mice.
[0143] FIG. 11 presents DNA-binding activity of NF-.kappa.B in
Lmp-deficient T2 cells.
[0144] FIG. 12 presents in vitro analysis of phosphorylation,
ubiquitination, and proteolysis of p105 in cytosolic extracts of
BALB/c and NOD mice and immunoblot analysis of MHC-linked
proteasome subunits.
[0145] FIG. 13 presents TNF-.alpha. cytotoxicity of spleen cells
and embryonic fibroblasts derived from BALB/c and NOD mice.
[0146] FIG. 14 shows that NOD spleen cells, but not embryonic
fibroblasts (MEF), lack expression of the MHC-encoded LMP2
proteasome protein and the p50 subunit of NF-.kappa.B.
[0147] FIG. 15 presents blocking early p105 processing to the p50
subunit in NOD mouse spleen cells.
[0148] FIG. 16 presents a .kappa.B binding protein competition
assay using oligonucleotides comprising palindromic .kappa.B
binding motif in BALB/c and NOD lymphocyte extracts.
DESCRIPTION OF THE INVENTION
[0149] The present invention is predicated on the discovery that
NOD mice are deficient for NF.kappa.B activity. As described herein
below, the methods and of the present invention comprise
restoration of proteasome function, or simply that of NF.kappa.B,
in the treatment of autoimmune disorders. The inventive methods are
therefore contrary to prior art methods and, indeed, unexpected,
based upon prior art references, which teach suppression of
NF.kappa.B or of proteasome activity (and, consequently, that of
NF.kappa.B) as a method of treating autoimmune disorders (see
above). Restoration of proteasome function or of NF.kappa.B
activity may be directed at the proteasome, the ubiquitinating
machinery or protein kinases. Alternatively, therapy may involve
providing functional (active forms of) NF.kappa.B that is
independent of the proteasome for activation or even the products
of downstream genes normally under the transcriptional control of
NF.kappa.B or providing the cell with cytoplasmic forms of
NF.kappa.B for cell cycle control and cell
differentiation/viability. The object of such treatment is to
inhibit the progression of an autoimmune disease or to prevent its
clinical initiation, where "clinical initiation" refers to the
presentation of symptoms and to organ destruction.
[0150] Detection of Defects in Proteolytic Processing
[0151] The invention contemplates detection of autoimmune disease
by detecting a defect in proteasome activity. Such defects may be
detected using the following assays.
[0152] i. The Proteasome
[0153] Proteasome activity may be assayed as previously described
(Gaczynska et al., 1994, Proc. Nat. Acad. Sci. U.S.A., 91:
9213-9217, incorporated herein by reference). Briefly; cells
(whether cultured cells, or those of an model animal, such as a
mouse) in which the efficacy of a stimulator of proteasome activity
is to be assayed prior to administration to a human are homogenized
in a Dounce homogenizer or other grinding device (e.g. a mortar and
pestle or a blender) and then by vortex mixing with glass beads in
a homogenization buffer (40 mM Tris HCl, 5 mM MgCl.sub.2, 2 mM ATP,
250 mM sucrose, pH 7.4). Fractions containing total 20S and 26 S
proteasomes are isolated by differential centrifugation of
homogenates: for 20 minutes at 10,000.times.g, then for 1 hour at
100,000.times.g or for 5 hours at 100,000.times.g. Pellets are
solubilized in 50 mM Tris HCl, 5 mM MgCl.sub.2, 2 mM ATP, 20%
(volume/volume) glycerol, pH 7.4. Resulting "proteasome fractions"
are used for peptidase assays and Western blot analysis.
Degradation of the fluorogenie peptides,
N-succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA),
N-tert-butoxyearbonyl-Leu Arg-Arg-7-amido-4-methylcoumari- n
(Boc-LRR-MCA) and N-carbobenzoyx-Leu-Leu-Glu-.beta.-naphthylamide
(Cbz-LLE-.beta.NA) is assayed at 37.degree. C., for 40 minutes or 1
hour in the presence of apyrase (5 units/ml), as described
previously described (Gaczynska et al., 1993, Nature, 365: 552-554,
also incorporated herein by reference).
[0154] ii. Ubquitination
[0155] The invention contemplates detection of autoimmune disease
by detecting a defect in the activity of ubiquitinating enzymes.
Such defects maybe detected using the following assays: Western
analysis with antibodies directed against active forms of
ubiquitinating enzymes, observation of eletrophoretic mobility of
on a Western blot of the ubiquitinated form of a test protein or
peptide relative to its non-ubiquitinated form or its
proteolytically processed form relative to its unprocessed form in
cytoplasmic extracts of unknown ubiquitinating capacity, Northern
analysis to detect loss of mRNAs whose transcription is dependent
upon a protein which required ubiquitination or enzymatic or other
assay to determine the function of a protein or peptide incubated
in a cytoplasmic extract of unknown ubiquitinating capacity,
wherein the protein or peptide requires ubiquitination in order to
undergo proteolytic activation. In vitro ubiquitination assays are
known in the art (see Chen et al., 1995, Genes Dev., 9: 1586-1597;
Corsi et al., 1995, J. Biol. Chem., 270: 8928-8935; Corsi et al.,
1997, J. Biol. Chem., 272: 2977-2983; Mori et al., 1997, Eur. J.
Biochem., 247: 1190-1196; Verma et al., 1997, Mol. Cell. Biol., 8:
1427-1437; Kumar et al., 1997, J. Biol. Chem., 272:
13548-13554).
[0156] iii. NF.kappa.B
[0157] The invention contemplates detection of autoimmune disease
by detecting a defect in the activation of NF.kappa.B. Such defects
may be detected using the following assays.
[0158] The presence or absence of NF.kappa.B activity may be
assayed by immunological analysis of protein from cells or
individuals using anti-NF.kappa.B antibodies (in which one would
expect to observe a band the size of I.kappa.B-free NF.kappa.B).
Such protein may be derived from a biological sample, including,
but not limited to, a tissue, cell, cell lysate or body fluid from
an individual. Northern analysis using labeled nucleic acid probes
specific for transcripts that may be produced by the downstream
targets of NF.kappa.B (i.e., genes which are transcriptionally
activated by that protein) may be performed. Alternatively, nuclear
protein extracts may be prepared from such cells and tested for the
ability to activate transcription in vitro of a marker gene which
is operatively linked to an NF.kappa.B-inducible gene regulatory
sequence. Assays may be directed at individual NF.kappa.B subunits,
such as p50 and p65, as in Examples 1 and 2 below, wherein the
cytoplasmic and nuclear functions of these subunits are tested in
normal and autoimmune mice. In addition to activity, their
processing from a larger protein or release from inhibitory
substances may be assessed by molecular and biochemical methods
known in the art (such as PAGE or Western analysis, as described
below).
[0159] While these approaches are technically feasible, they may
not be medically expedient or even safe, as they entail removal of
treated cells from the patient. It is recommended that
immunological analysis be performed on serum protein extracts,
using antibodies which are directed against products of genes under
the control of NF.kappa.B which are secreted proteins, by methods
described below.
[0160] Restoration of Normal Proteolytic Processing
[0161] The invention contemplates methods of treating autoimmunity
by restoring proteolytic processing, based upon the observation
that NF.kappa.B activity is absent in the NOD mouse model of
autoimmune disease. Restoration of proteolytic processing, such as
would result in the restoration of NF.kappa.B activity, may be
directed at the proteasome, the ubiquitinating machinery or protein
kinases.
[0162] A. Therapeutic Targets
[0163] Suppression of Proteasome Inhibitors
[0164] The invention contemplates methods of treating autoimmunity
by restoring proteolytic processing by blocking the activity of
inhibitors of proteasome function or changing the specificity of a
proteasome subunit to favor activation of the substrate(s)
deficient in an autoimmune disease, so that correct protein
processing is restored.
[0165] Inhibition of proteasome activity blocks the production of
activated NF.kappa.B and other essential proteins, as described
above; therefore, in order to promote correct protein processing,
it may be necessary to inactivate cellular inhibitors of the
proteasome. Such endogenous inhibitors of proteasome activities
have been isolated. These include the 240 kD and the 200 kD
inhibitors isolated from human erythrocytes (Murakami et al., 1986,
Proc. Natl. Acad. Sci. U.S.A., 83: 7589-7592; Li et al., 1991,
Biochemistry, 30: 9709-9715) and purified CF-2 (Goldberg, 1992,
Eur. J. Biochem., 203: 9-23).
[0166] Proteasome processed proteins leading to activation include
P100 and P105. Proteasome processed proteins leading to degradation
include TFIIH, Stat proteins, Jak proteins (Jak2, Jak1), Shc, Sp1,
CDC25B, Kip1, p27, Serotonin N-acetyl transferase, IkB, P53,
Cyclins, c-Fos, c-Jun, presenilin 1 FosL, tyrosine
aminotransferase, and ornithine decarboxylase.
[0167] Endogenous proteasome inhibitors may be inactivated by
methods known in the art, which methods include the administration
of antibodies which bind them specifically, the use of antisense
RNA or ribozymes directed against the mRNAs which encode them (see
below). Antibodies against numerous proteins are now publicly
available, both through commercial and non-profit suppliers (e.g.
ATCC); however, antibodies of use in the invention may, if
necessary, be prepared as described below.
[0168] Restoration of Wild-Type Proteasome Function
[0169] The invention contemplates methods of treating autoimmune
disease by direct stimulation of proteasome function, thereby
restoring or preserving correct proteolytic processing.
[0170] Japanese Patent No. JP8322576, which is herein incorporated
in full by reference, discloses proteasome activator PA28.beta.
(see also Chu-ping et al., 1992, J. Biol. Chem., 267: 10515; Dubiel
et al., 1992, J. Biol. Chem., 267: 22369); both cloning of a cDNA
from bovine tissues (e.g. liver, heart and red blood cells) and a
method for the production of the recombinant polypeptide encoded by
the cloned nucleic acids are described by these references. PA28
(or PA28.beta.) has a subunit molecular weight of 28,000, as judged
by denaturing gel eleetrophoresis and a native molecular weight of
approximately 180,000 as determined by gel filtration and density
gradient centrifugation; therefore, it is thought to exist as a
hexameric protein complex. Dubiel et al. (1992, supra) further
describe the isolation of a human protein of M.sub.r approximately
200,000 that activates proteasomes; this complex is a hexamer
comprising subunits that display M.sub.r of approximately 29,000
and 31,000 on danaturing electrophoretic gels. This activator
complex lacks intrinsic peptidase activity, but stimulates
proteolysis of certain substrates about 60-fold, although activated
proteasomes are unable to degrade ubiquitin-lysozyme conjugates,
bovine serum albumin or lysozyme; activation involves reversible
binding of the activator complex to proteasomes. WO 95/2705 8
discloses a human protein complex (M.sub.r approximately 29,000)
which is a .gamma.-interferon-inducible activator of proteasome
function. The sequences encoding each of these polypeptides are of
use in gene therapy according to the invention, as described below.
Alternatively, the proteins themselves may be administered by
methods known in the art (see also below).
[0171] In addition to proteasome-stimulating proteins, wild-type
proteasome subunits or other associated proteins (e.g. Lmp2, Lmp7)
may be administered if inactivating mutations are found within the
sequences encoding them or in the regulatory elements controlling
the transcription or these genes. While there exist many targets
for such specifically-directed treatment, it should be noted that
the discovery of one such mutant (that found in the shared Lmp2/Tap
promoter) is described herein above (Yan et al., 1997, supra).
[0172] Restoration of Correct Uhiquitination/Phosphorylation
[0173] The invention contemplates methods of treating an autoimmune
disease by restoring correct patterns of ubiquitination and/or
phosphorylation.
[0174] If proteolytic failure has been traced to a deficiency in
ubiquitination or phosphorylation, the missing activity may be
supplemented either through the administration of a wild-type
protein whose absence or inactivation is responsible for the
deficiency or through gene therapy, in which a gene encoding such a
protein is administered under the influence of transcriptional
control elements (e.g., its own wild-type element or another strong
promoter, e.g. thymidine kinase, heat-shock or others as are known
in the art). Such proteins may include ubiquitinating proteins of
the E1, E2 and E3 families as well as "glue" proteins (all as
described above); alternatively, protein kinases (e.g.,
cyclin-dependent kinases; see also above) or cyclins may be
administered.
[0175] Restoration of NF.kappa.B function
[0176] The invention contemplates methods of treating autoimmune
diseases by restoring NF.kappa.B function, which, in turn, restores
the transcription of NF.kappa.B-dependent genes.
[0177] As is true of the proteasome and of the ubiquitination and
protein phosphorylation machinery described above, it is possible
to administer to cells of an organism in which NF.kappa.B carries
an inactivating mutation, either in coding or regulatory sequences,
a wild-type sample of the NF.kappa.B protein or one or more copies
of the gene encoding it; however, a second scenario may instead be
envisioned.
[0178] In the case in which NF.kappa.B activity is reduced or
absent due to an `upstream` defect (that is, one involving
activation by the proteasome, instead of- or in addition to a
mutation in the NF.kappa.B gene itself), it is possible to
circumvent the need for proteolytic activation of NF.kappa.B by
introducing a constitutively-active version of the protein, such as
one in which the I.kappa.B recognition site has been mutated such
that I.kappa.B can no longer bind to- and inactivate NF.kappa.B.
Binding of NF.kappa.B to I.kappa.B occurs through ankyrin repeats
(as reviewed by Siebenlist et al., 1994, Ann. Rev. Cell. Biol., 10:
405-455); it is contemplated that sequences encoding these repeats
be deleted or mutated in an NF.kappa.B subunit p100 or p105 gene
expression construct such that binding to I.kappa.B is
significantly impaired or is eliminated. As a
transcription/signalling factor which remains active when it is no
longer required may have undesirable consequences, particularly in
the absence of proteolytic which would normally inactivate it under
such circumstances, administration of such a protein in limited
doses or of a gene encoding it under a tightly-regulated (i.e.
inducible, rather than constitutive, promoter) may be necessary.
Alternatively, such a protein may be expressed at all times,
provided that an inhibitor thereof is co-administered; such an
inhibitor may be an antibody directed against the protein, or an
antisense RNA or ribozyme directed against the message encoding it,
as described below.
[0179] Inactivation of I.kappa.B may also be performed by methods
described below, such as by the use of antibodies directed against
it or of antisense RNA or ribozymes directed against the mRNA
transcript encoding it. Preferably, such inactivation is transient,
as it would otherwise lead to constitutive activation of
NF.kappa.B, which activation is not, itself, normal.
[0180] The invention contemplates treatment of autoimmune disease
using methods directed at the potential therapeutic targets
discussed above. In the section following, methods by which such
treatment may be carried out are presented.
[0181] B. Therapeutic Methods.
[0182] Autoimmune Disorders in Humans
[0183] In order to provide effective treatment according to methods
contemplated by the invention, it is first necessary to identify
those individuals in need of treatment.
[0184] Genetic linkage studies have confirmed the MHC to be an
important contributor to human autoimmune diseases such as type I
diabetes, rheumatoid arthritis, lupus erythematosus, Hashimoto's
disease, and multiple sclerosis (Bach et al., 1994, Endocr. Rev.,
15: 516; Cudworth and Woodrow, 1976, Br. Med. J., 2: 846;
Festenstein et al., 1986, Nature, 322: 64; Nerup et al., 1977, HLA
and Disease, Munksgaard, Copenhagen; Todd et al., 1987, Nature,
329: 599; Van Endert et al., 1994, Diabetes, 43: 110). Other
autoimmune disorders include Graves' disease, ulcerative colitis,
Crohn's disease, polyendocrine failure, Sjogren's syndrome and
others as listed above in the Summary.
[0185] The present invention is of use in the treatment of HLA
class II-linked autoimmune diseases such as those listed above.
Diagnostic symptoms or other indicators may be used either to
assess a patient for the presence of- or susceptibility to such a
disorder; in addition, improvement (i.e., a change toward the basal
state, as defined above) in one or more of these indicators is
indicative of the efficacy of a given method of treatment for such
a disease.
[0186] Examples of autoimmune disease-related symptoms for several
representative diseases are as follows:
[0187] Addison's Disease
[0188] Addison's disease is a disorder characterised by failure of
the adrenal gland and is often an autoimmune disorder involving
destruction of the adrenal cortex and the presence of adrenal
autoantibodies in the patient's serum. The adrenal cortex is
responsible for producing several steroid hormones including
cortisol, aldosterone and testosterone. In autoimmune Addison's
disease and other forms of the disease, levels of these hormones
are reduced. This reduction in hormone levels is responsible for
the clinical symptoms of the disease which include low blood
pressure, muscle weakness, increased skin pigmentation and
electrolyte imbalance.
[0189] Autoantibodies to the adrenal cortex may be identified for
diagnosis of Addison's disease using the technique of complement
fixation or immunofluoreseenee (Anderson et al., 1957, Lancet, 1:
1123-1124; Blizzard and Kyle, 1963, J. Clin. Invest, 42: 1653-1660;
Goudie et al., 1968, Clin. Exp. Immunol., 3: 119-131; Sotosiouet
al., 1980, Clin. Exp. Immimol, 39: 97-111). Radioimmunoassay and
ELISA techniques using crude adrenal membrane preparations are also
of use in the invention (Stechemesser et al., 1985, J. Immunol.
Methods, 80: 67-76; Kosowicz et al., 1986, Clin. Exp. Immunol., 63,
671-679).
[0190] U.S. Pat. No. 5,705,400 discloses methods for the detection
of adrenal auto antigen. Such assays are useful for the diagnosis
of latent or actual autoimmune Addison's disease. These methods are
briefly summarized as follows:
[0191] 1. Assay Based on a Radioactive Label
[0192] Purified adrenal autoantigen is labeled with a radioactive
label such as .sup.125I using one of many well-known techniques.
The labeled material is then incubated (1 hour at room temperature)
with a suitably diluted (e.g. 1:20 in phosphate buffered saline)
serum sample. Adrenal autoantibodies present in the test sample
bind to the .sup.125I-labeled adrenal auto antigen and the
resulting complex is precipitated by addition of antibodies to
human immunoglobulins or a similar reagent (e.g. solid phase
Protein A). The amount of .sup.125I-labelled antigen in the
precipitate is then determined. The amount of adrenal autoantibody
in the test serum sample is a function of the amount of
radioactivity precipitated. The amount of adrenal autoantibody can
be expressed as the amount of radioactivity in the pellet or more
usually by including dilution of an adrenal autoantibody-positive
reference serum in the assay. Note that such techniques using
autoantigens such as have been identified in other diseases may be
broadly applied to the detection of auto antibodies.
[0193] 2. Assay Based on an Enzyme Label
[0194] Purified adrenal autoantigen is coated onto plastic wells of
ELISA plates either directly onto plain wells or indirectly. The
indirect method may involve coating the wells first with a
monoclonal or polyclonal antibody to adrenal autoantigen (the
antibody is selected so as not to bind to the same site as adrenal
autoantibodies) followed by addition of adrenal auto antigen.
Several other indirect coating methods are well known in the art.
After coating with autoantigen, suitably diluted (e.g., 1:20 in
phosphate buffered saline) test sera are added to the wells and
incubated (1 hour at room temperature) to allow binding of adrenal
autoantibody to the antigen coated onto the wells. The wells are
then washed and a reagent such as antihuman IgG conjugated to
horseradish peroxide is added. After further incubation (e.g., 1
hour at room temperature) and washing, an enzyme substrate such as
orthophenylene diamine is added and the color generated measured by
light absorbance. The amount of adrenal autoantibody in the test
sample is a function of the final color intensity generated.
Results are expressed as light absorbance or, more usually, by
including dilution of an adrenal autoantibody positive reference
serum in the assay.
[0195] Ulcerative Colitis and Crohn's Disease
[0196] A number of human diseases result in the subject having a
diseased gut in which digestion or absorption is impaired. Examples
of autoimmune diseases in humans include chronic ulcerative gut
diseases (e.g., ulcerative colitis) and inflammatory gut diseases
such as colitis and Crohn's disease.
[0197] In addition to impaired digestion and inflammation and/or
ulteration of the intestinal tract, symptoms include pain,
bleeding, abnormal stool production and weight loss. Such symptoms
may be assessed either by patient interview or through techniques
such as endoscopy and other imaging techniques such as heavy metal
(e.g. barium enema followed by X-ray), and scanning using CAT,
positron emission tomography (PET), (magnetic resonance imaging)
MRI or histological analysis (biopsy).
[0198] Lupus Erythematosus
[0199] As described by U.S. Pat. Nos. 5,695,785 and 5,700,641, and
briefly summarized here, lupus erythematosus is an autoimmune
disease which is not specific to a particular organ. The common
type of lupus erythematosus, Discoid Lupus Erythematosus (DLE),
affects exposed areas of the skin. The more serious and fatal form
of the disease, Systemic Lupus Erythematosus (SLE), affects a large
number of organs and has a chronic course with acute episodes. The
external manifestations of SLE are lesions on the facial skin. In
most cases, other areas of skin and the mucosa are affected. Also
observed are nephritis, endocarditis, hemolytie anemia, leukopenia
and involvement of the central nervous system.
[0200] Many immunological phenomena have been observed with SLE.
For example, the formation of antibodies against certain endogenous
antigens has been seen. These antibodies are directed against, for
example, the basement membrane of the skin, and against
lymphocytes, erythrocytes and nuclear antigens. Antibodies which
are directed against double-stranded DNA (ds-DNA) form with the
latter complexes. These antibodies, together with complement, are
deposited on small blood vessels and frequently result in
vasculitis. These deposits are especially dangerous when they occur
in the renal glomeruli because they result in glomerulonephritis
and kidney failure. The incidence of clinically detectable kidney
involvement is reported in the literature to be between 50 and
80%.
[0201] Of the multitude of autoreactive antibodies that
spontaneously arise during the disease, high levels of circulating
auto antibodies to DNA are the best evidence of the pathogenesis.
In SLE, there is almost invariable presence in the blood of
antibodies directed against one or more components of cell nuclei.
Certain manifestations in SLE seem to be associated with the
presence of different antinuclear antibodies and genetic markers,
which have suggested that SLE may be a family of diseases (Mills,
1994, Medical Progress, 33: 1871-1879). Lupus nephritis, especially
diffuse proliferative glomerulonephritis, has been known to be
associated with circulating antibodies to double stranded (native)
DNA (Casals et al., 1964, Arthritis Rheum., 7: 379-390; Tan et al.,
1964, J. Clin. Invest., 82: 1288-1294). The detection of
antinuclear antibodies is a sensitive screening test for SLE.
Antinuclear antibodies occur in more than 95% of patients
(Hoehberg, 1990, Rheum. Dis. Clin. North Am., 16: 617-639). Such
autoantibodies may be detected using DNA or other cellular
components (such as small nuclear ribonucleoprotein complexes) by
the methods described above.
[0202] Sjogren's Syndrome
[0203] Tear film dysfunctions are collectively diagnosed as
keratoconjunctivitis sicca (KCS) or, simply, dry eye (Holly et al.,
1987, Internat. Opthalmol. Clin., 27: 2-6; Whitcher, 1987,
Internat. Opthalmol. Clin., 27: 7-24). Lacrimal gland abnormalties
falling into the category of aqueous tear deficiencies, which are
most frequently responsible for dry eye states, include autoimmune
disease. By far, the greatest single cause of KCS worldwide,
excluding those countries wherein trachoma remains epidemic, is
Sjogren's syndrome (Whitcher, 1987, supra). This syndrome. which is
the second most common autoimmune disease (Tabbara, 1983,
"Sjogren's Syndrome" in The cornea. Scientific Foundations and
Clinical Practice, Smolin and Thoft, eds., Little Brown and Co.,
Boston, Mass., pp. 309-3 14; Daniels, 1990, "Sjogren's Syndrome--in
a nut shell" in Sjogren's Syndrome Foundation Inc. Report, Port
Washington, N.Y.). This disease occurs almost exclusively in
females and is characterized by an insidious and progressive
lymphocytic infiltration into the main and accessory lacrimal
glands, an immune mediated extensive destruction of lacrimal acinar
and ductal tissues and the consequent development of persistent KCS
(Tabbara, 1983, supra; Moutsopoulos and Talal, 1987, in Sjogren's
Syndrome. Clinical and Immunological Aspects, Talal et al., eds.,
Springer Verlag, Berlin, pp. 258-265; Talal and Moutsopoulos, 1987,
in Sjogren's Syndrome. Clinical and Immunological Aspects, Talal et
al., eds., Springer Verlag, Berlin, pp. 291-295; Kincaid, 1987, in
Sjogren's Syndrome. Clinical and Immunological Aspects, Talal et
al., eds., Springer Verlag, Berlin, pp. 25-33). In primary
Sjogren's syndrome, which afflicts about 50% of the patient
population, the disease is also associated with an immunological
disruption of the salivary gland and pronounced xerostomia. In
secondary Sjogren's, the disorder is accompanied by another
autoimmune disease, which is most often rheumatoid arthritis and,
less frequently, systemic lupus.
[0204] Dryness of the eyes, infiltration of lymphocytes into the
lacrymal glands and the presence of autoantibodies are diagnostic
criteria for Sjogren's disease that are of use in the invention.
The restoration one, more than one or even all of these indices to
the basal state is indicative of effective treatment.
[0205] Type I Diabetes
[0206] Insulin dependent diabetes mellitus (IDDM) (also known as
type I diabetes) primarily afflicts young people. Although insulin
is available for treatment the several-fold increased morbidity and
mortality associated with this disease require the development of
early diagnostic and preventive methods, as well as methods for the
restoration of normal insulin secretion (e.g., with islet therapy
or regeneration os endogenous islets by methods described in detail
below). As described in U.S. Pat. No. 5,691,448 and summarized
briefly herein, the disappearance of pancreatic .beta.-cells (which
are the insulin-secreting cells of the islets of Langerhans)
precedes the clinical onset of IDDM. Among the most thoroughly
studied autoimmune abnormalities associated with the disease is the
high incidence of circulating .beta. cell-specific autoantibodies
years prior to frank hyperglycemia, the typical clinical diagnosis.
Family studies have shown that the autoantibodies appear prior to
overt IDDM by years, suggesting a long prodromal period of humoral
autoirnmunity before clinical symptoms emerge, and have also
documented a slow, progressive loss of insulin response to
intravenous glucose in the years preceding diagnosis. The presence
of .beta. cell-specific autoantibodies in the prediabetic period
allows for diagnosis according to the invention prior to critical
.beta.-cell depletion and insulin dependency. It has been estimated
that only 10% of the total n-cell mass remains at the time of
clinical onset (i.e., presentation of elevated blood glucose levels
relative to those observed in unaffected individuals, who represent
the basal state, as defined above).
[0207] The target of auto antibodies in pancreatic .beta.-cells in
IDDM were originally identified as both insulin and a 64 kD
autoantigen by immunoprecipitation experiments using detergent
lysates of human islets (Baekkeskov et al., 1982, Nature, 298:
167-169). Antibodies to the 64 kD auto antigen precede the clinical
onset of IDDM and have been shown to have an incidence of about 80%
at clinical onset and during the prediabetic period (Baekkeskov et
al., 1987, J. Clin. Invest., 79: 926-934; Atkinson et al., 1990,
Lancet, 335: 1357-1360; and Christie et al., 1988, Diabetologia,
31: 597-602. Many other autoantibodies exist, most directed against
intracellular proteins.
[0208] A therapeutic agent is administered to a patient suspected
of suffering- or suffering from established diabetes in an amount
sufficient to inhibit or prevent further .beta.-cell
destruction/death. For individuals at risk of IDDM or stiff man
syndrome, the pharmaceutical agent is administered prophylactically
in an amount sufficient to either prevent or inhibit destruction
and death of the .beta.-cell. According to the invention, a
therapeutic agent is administered in an amount and for a time
sufficient to prevent or inhibit .beta. cell destruction; .beta.
cell survival, as judged by immunological detection of insulin, the
level of serum glucose levels or restoration of vigorous insulin
stimulation to glucose challenge (intravenous glucose tolerance
test, or IVGTT; Joslin, 1985, Diabetes Mellitus, 20th Edition, eds.
Marble et al., Lea & Febiger, Philadelphia, Pa.), is indicative
of effective treatment.
[0209] Multiple Sclerosis
[0210] The symptoms of multiple sclerosis, such as those described
in Treatment of Multiple Sclerosis: Trial Design, Results, and
Future Perspectives, eds. Rudick and Goodkin, Springer-Verlag,
N.Y., 1992 (particularly those symptoms described on pages 48-52),
incorporated by reference as if fully set forth herein.
[0211] These multiple sclerosis symptoms include perturbations of
pyramidal functions, for example the development of paraparesis,
hemiparesis, monoparesis, quadriparesis and the development of
monoplegia, paraplegia, quadriplegia, and hemiplegia. The symptoms
of multiple sclerosis also include perturbations in cerebellular
functions. These perturbations include the development of ataxia,
including truncal and limb ataxia. When we refer to "paralytic
symptoms of multiple sclerosis" we are referring to these
perturbations in pyramidal and cerebellar funtions. The symptoms of
multiple sclerosis also include changes in brain stem functions,
including development of nystamus and extraoeular weakness along
with dysarthria. Further symptoms include loss of sensory function
including decrease in touch or position sense and loss of sensation
in limbs. Perturbations in bowel and bladder function, including
hesitancy, urgency, retention of bowel or bladder or incontinence,
can also occur. Visual functions, such as the development of
scotoma, are also affected by multiple sclerosis. Cerebral function
degeneration, including a decrease in mentation and the development
of dementia, is also a symptom.
[0212] Inflamed MS and EAE (see below) lesions, but not normal
white matter, sometimes have infiltrating CD4 T cells that respond
to self antigens presented by MHC class II-linked molecules like
human HLA-DR2 (MS) or murine I-A.sup.M (EAE). The infiltrating CD4
Tcells (Th1 cells) produce proinflammatory cytokines interleukin
(IL)-2, interferon (IFN)-.gamma., and tumor necrosis factor
(TNF)-.alpha. that activate antigen-presenting cells like
macrophage to produce inflammatory cytokines (IL-1.beta., IL-6, and
IL-8) and IL-12. The IL-12 induces further IFN-.gamma. synthesis.
The imbalance of one or more of these proteins relative to other
cellular factors may be assayed by biochemical or immunological
methods as are known in the art. Such methods are described below.
The disclosure of the present invention of poor NF.kappa.B function
inside cells of autoimmune mammals implicates decreased resistance
of target tissues to such inflammatory cytokine insults.
[0213] To evaluate whether a patient is benefitting from treatment,
the patient's symptoms are examined in a quantitative way, such as
by the EDSS (Rudick and Goodkin, supra), or decrease in the
frequency of relapses, or increase in the time to sustained
progression, or improvement in the magnetic resonance imaging (MRI)
behavior in frequent, serial MRI studies and compare the patient's
status measurement before and after treatment. In a successful
treatment, the patient status will have improved, i.e., the EDSS
measurement number or frequency of relapses will have decreased, or
the MRI scans will show less pathology.
[0214] Preferably, treatment should continue as long as multiple
sclerosis symptoms are suspected or observed.
[0215] Rheumatoid Arthritis
[0216] In rheumatoid arthritis, the main presenting symptoms are
pain, stiffness, swelling, and loss of function (Bennett, 1984,
"The etiology of rheumatoid arthritis" in Textbook of Rheumatology,
Kelley et al., eds., W.B. Saunders, Philadelphia, pp. 879-886). The
multitude of drugs used in controlling such symptoms seems largely
to reflect the fact that none is ideal. Although there have been
many years of intense research into the biochemical, genetic,
microbiological, and immunological aspects of rheumatoid arthritis,
its pathogenesis is not completely understood, and none of the
treatments clearly stop progression of joint destruction (Harris,
1985, "Rheumatoid Arthritis: The clinical spectrum" in Textbook of
Rheumatology, Kelley. et al., eds., W.B. Saunders, Philadelphia,
pp. 915-990).
[0217] TNF-.alpha. is present in rheumatoid joint tissues and
synovial fluid at the protein and mRNA level (Buchan et al., 1988,
Clin. Exp. Immunol, 73: 449-455), indicating local synthesis.
Detection of this protein by methods described herein below (e.g.
enzyme immunoassay, ETA, or enzyme-linked immunosorbent assay,
ELISA) provides a diagnotic indicator of arthritis independent of
clinical symptoms. In addition, autoantibodies may be quantified as
described above.
[0218] Analysis of improvement in individual patients following
treatment is made using two separate indices. Firstly, an index of
disease activity (IDA) is calculated for each time point according
to the method of Mallya and Mace (Mallya et al., 1981, Rheumatol.
Rehab., 20: 14-17, the contents of which are fully incorporated
herein by reference) with input variable of morning stiffness, pain
score, Richie Index grip strength, ESR and Hgb. The second index
calculated was that of Paulus (Paulus et al., 1990, Arthritis
Rheum., 33: 477-484, the contents of which are fully incorporated
herein by reference) which uses input variables of morning
stiffness, ESR, joint pain/tenderness, joint swelling, patient's
and Physician's global assessment of disease severity.
[0219] Rheumatoid factors may be measured using the rheumatoid
arthritis particle agglutination assay (FAPA, FujiBerio Inc.,
Tokyo, Japan), in which titers of {fraction (1/160)} or greater are
considered significant. Rheumatoid factors are measured by ELISA
(e.g. using a kit supplied by Cambridge Life Sciences, Ely,
UK).
[0220] Hashimoto's Disease (Hypothyroidism)
[0221] Symptoms include low levels of circulating thryoid hormone,
tiredness, yellow skin discoloration, delayed reflexes, slowed
heartrate, with eventual edema leading to coma and death.
[0222] Graves' Disease (Hyperthyroidism)
[0223] Symptoms include high levels of circulating thyroid hormone,
hyperactivity, inability to sleep, thinning hair, irritable bowel
and orbital abnormality (protruding eyes).
[0224] Vitiligo
[0225] This disorder is characterized by melanocyte loss in a
characteristic pattern on the body.
[0226] It is initially diagnosed; as is true of other autoimmune
diseases affecting the skin (see "psoriasis" and "pemphigus
vulgaris", below), tissue biopsy is performed to confirm
diagnosis.
[0227] Psoriasis
[0228] The symptom of psoriasis, also present for visual diagnosis,
is scaly skin.
[0229] Pemphigus Vulgaris
[0230] Symptoms of pemphigus vulgaris include skin peeling and
scaling. It, too, is diagnosed visually and by skin biopsy.
[0231] In addition, genetic diagnosis of autoimmune disease, which
is an effective means of early diagnosis, is possible for diseases
for which genetic linkage (pedigree) studies have been performed
for large (or, alternatively, small but numerous) families of
affected individuals. Early diagnosis may, additionally, be
facilitated by the simple assay of NF.kappa.B activity in
individuals deemed to be at risk of disease; methods by which
NF.kappa.B are described herein, and include in vitro DNA/protein
binding and/or transcriptional activation assays.
[0232] In order to ensure the safety of treatments according to the
invention, following treatment of arthritis or another autoimmune
disease, vital signs are recorded at intervals for up to 24 hours
following administration of the therapeutic agent. Patients are
later questioned concerning possible adverse events before each
treatment. Preferably, a complete physical examination is performed
at the time of initial diagnosis. In addition, patients may be
monitored by standard laboratory tests including complete blood
count, C3 and C4 components of complement, IgG, IgM and IgA, serum
electrolytes, creatinine, urea, alkaline phosphatase, aspartate
transaminase and total bilirubin. Urine analysis may, additionally,
be performed.
[0233] Prior to testing potential therapeutic compositions and
methods on human subjects, testing is performed in an animal model.
It is generally accepted by those of skill in the art that results
obtained through the use of animal models are predictive of the
efficacy of a given treatment in a human clinical patient. The
following section describes a selection of animal models which are
of use in assessing the efficacy of proposed treatments of
autoimmune disease according to the invention.
[0234] Animal Models of Autoimmune Disease
[0235] i. Mouse Models
[0236] Animal models such as the NOD.sup.3 (or, simply, NOD) mouse,
which is prone to diabetes, Sjogren's syndrome and hemolytic anemia
have also demonstrated the importance of the H2 (again, the mouse
MHC) genomic region, in combination with non-H2 genes in
autoimmunity. The inheritance of MHC and MHC-linked genes with
minimal recombinations (linkage disequilibrium), together with the
fact that most of these genes contribute to immune responses, has
hampered the identification of the genes that underlie
autoimmunity. Polymorphisms are abundant in the MHC and are readily
detected but the challenge remains to identify those polymorphisms
that contribute to disease susceptibility and have functional
consequences, and to define the disease-causing mechanisms.
[0237] NOD mice, like humans with type I diabetes, exhibit a
phenotype in which conformationally abnormal forms of class I
molecules (which can be detected with conformationally specific
antibodies) are present on the surface of APCs (Faustman et al.,
1992, supra). The exit of class I molecules from the endoplasmic
reticulum (ER) of NOD mouse APCs is delayed, and the presentation
of test antigens by these cells is markedly impaired in in vitro
assays of cytotoxic T cell lysis (Li et al., 1994, supra). Surface
class I molecules of NOD mouse APCs can be stabilized by culture at
low-temperature or by the addition of allele-specific peptides that
presumably occupy the empty peptide-binding pockets of the class I
protein.
[0238] Impaired antigen presentation and class I assembly may be
essential for disease expression in diabetes-prone NOD mice and
humans. Only NOD females who progress to hyperglycemia or salivary
gland destruction possess the defect; normoglycemic NOD males, 15%
of which develop diabetes, lack the APC defect.
[0239] The NOD mouse exhibits a rare MHC haplotype known as
H-2.sup.g7, in which many polymorphisms are apparent (Hattori et
al., 1986, supra; Lund et al., 1990, J. Autoimmun., 3: 289;
Prochazka et al., 1987, Science, 237: 286; Acha-Orbea and McDevitt,
1987, Proc. Natl. Acad. Sci. U.S.A., 84: 2435). For instance, the
NOD mouse has a rare Tap1 allele with a transcription defect
(Faustman et al., 1991, supra), an uncommon Lmp2 allele with a
transcription defect, and a unique MHC class II gene at the I-A
locus. The quantitative defect in Tap1 transcription, like the
class I cell surface assembly abnormality, correlates with disease
expression in NOD mice, again demonstrating a pattern of gene
expression that can be influenced by the environment (Huang et al.,
1995, Diabetes, 44: 1114), gender or noninherited gene phenomena
(e.g. somatic gene rearrangements or changes in gene methlyation
pattern). Many of these genes have similar promoters and respond in
unison to external stimuli. In the case of Tap1 and Lmp2, the genes
even share the same promoter in opposing orientations. Therapies
based on nonspecific immunostimulation, such as injection with CFA
or infection with mouse hepatitis virus, ameliorate diabetes in NOD
mice. These treatments also increase the rate of Tap1
transcription, and re-educated or reselected the 7 cell repertoire
so that T cell autoreactivity to class I and syngeneic peptides is
eliminated (Huang et al., 1995, supra). These data suggest
transcription or quantitative issues of gene expression could be
dominant in patterns of disease expression.
[0240] As in humans, lymphocytic developmental errors are
characteristic of mouse (NOD) and rat (BB; see below) models of
Type I diabetes (Shimada et al., 1996, Diabetes, 45: 71-78; Serreze
et al., 1993, Proc. Natl. Acad. Sci. U.S.A., 90: 9625-9629; Li et
al., 1994, Proc. Natl. Acad. Sci. U.S.A., 91: 11128-11132). For
instance, mature T lymphocytes in peripheral blood, spleen and
lymph nodes are markedly absent in autoimmune disease-prone BB
animals (Crisa et al., 1992, Diabetes Metabolism Rev., 8: 9-37). As
might be expected of an immature lymphoid cell, diabetic
lymphocytes in animal and human models demonstrate defective
intracellular activation of signal transduction pathways, including
responses to TNF, lipopolysaccharides (LPS, which are non-specific
immunostimulants) and signal transduction along the
microtubule-associated protein kinase (MAP kinase) pathway of T
cell activation (Serreze et al., 1993, supra; Rapoport et al.,
1993, J. Exp. Med., 177: 1221-1226).
[0241] Given the established role of antigen presentation in T cell
education and its impairment in numerous autoimmune diseases in
both humans and mice, mutations which contribute to the abnormal
antigen presentation and processing in the NOD mouse (made
apparent, in part, by altered class I assembly and altered
presentation of syngeneic peptides) are of significant interest;
therefore, the NOD mouse provides a good model system in which
genetic and environmental factors influencing autoimmune diseases
can be studied. Recently, a mutation in the shared, bidirectional
Lmp2/Tap1 promoter has been found to reduce expression of these
genes in the NOD mouse (Yan et al., 1997, J. Immunol., 159:
3068-3080).
[0242] ii. The BB Rat
[0243] Diabetes-prone BB rats have profound peripheral T lymphocyte
immunodeficiencies and lack a surface maturation molecule or
lymphocytes RT6, a member of the src tyrosine kinase family (Elder
and Maclaren, 1983, J. Immunol., 130: 1723-1731; Rigby et al.,
1996, Diabetes, 45: 1419-1426; Jackson et al., 1983, Metabolism,
32: 83-86; Woda et al., 1986, J. Immunol., 136: 856-859; Greiner et
al., 1986, J. Immunol., 136: 148-151).
[0244] iii. Other Models
[0245] Other animal models of autoimmune disease as are known in
the art are as follows:
[0246] Experimental autoimmune eneephalomyelitis (EAE) in mice and
rats serves as a model for multiple sclerosis (MS.) in humans. It
is a CD4.sup.+ T-cell mediated autoimmune disease that is directed
against protein components of CNS myelin (Miller and Karpus, supra,
1994). In this model, the demyelinating disease is induced by
administration, typically by injection, of myelin basic protein
(MBP), as described by Paterson, P. Y. (1986, Textbook of
Immunopathology, eds. Mischer et al., Grune and Stratton, New York,
pp. 179-213), McFarlin et al. (1973, Science, 179: 487-480) and
Satoh et al. (1987, J. Immunol., 138: 179-184). B10.PL mice are
known to have histopathological and clinical similarities to the
relapsing-remitting form of human M.S. (Miller and Karpus, 1994,
Immun. Today, 15: 356); these mice develop EAE in response to
injection with MBP. EAE is characterized by transient asscending
paralysis of the affected mouse's limbs.
[0247] Systemic lupus erythematosis (SLE) is tested in susceptible
mice as disclosed by Knight et al. (1978, J. Exp. Med., 147: 1653).
Myasthenia gravis (MG) is tested in SJL/J female mice by inducing
the disease with soluble acetyl-cholinesterase receptor (AChR)
protein from another species, as described by Lindstrom et al.,
(1988, Adv. Immunol., 42: 233-284). Arthritis is induced in a
susceptible strain of mice by injection of type II collagen, as
described by Stuart et al., (1984, Ann. Rev. Immunol., 42:
233-284). Thyroiditis is induced in mice by administration of
thyroglobulin as described by Maron et al., (1980, J. Exp. Med.,
152: 1115-1120). Insulin-dependent diabetes mellitus (IDDM) occurs
naturally or can be induced in certain strains of mice.
[0248] The contents of the above references relating to animal
models of autoimmune disease are all herein fully incorporated by
reference.
[0249] NF.kappa.B
[0250] i. Activation
[0251] Rather than treating defects in proteolytic processing at
the stage of the proteolytic processing, it is possible to target
treatment according to the invention at the restoration of an
important downstream target of proteasome activation, the
transcription factor, NF.kappa.B and/or its downstream targets.
[0252] NF.kappa.B is a heterodimeric transcription factor composed
of 50- and 65 kD subunits that belong to the rel family; it is
present with inhibitory factor I.kappa.B in the cytoplasm of most
cells (Baeuerle and Henkel, 1994, Ann. Rev. Immunol., 12: 141-179;
Verma et al., 1995, Genes Dev., 9; 2723-2735). This transcription
factor is responsive to cell surface cytokines, such as tumor
necrosis factor .alpha., interleukin-1 and cytoplasmic activation
of this factor is required prior to nuclear localization.
NF.kappa.B plays an active role in lymphocytic development and in
cell survival (Wang et al., 1996, Science, 274: 784-787; Beg and
Baltimore, 1996, Science, 274: 782-784; Van Antwerp et al., 1996,
Science, 274: 787-789; Arsura et al., 1997, Cell Growth Differ., 8:
1049-1059; Liu et al., 1996, Cell, 87: 565-576). In B cells,
NF.kappa.B is constitutively expressed (Wu et al., 1996, EMBO J.,
15: 4682-4690). Knock-out mice missing RelA (p65) die before birth,
in part, due to a described developmental defect of the immune
system (macrophages, B and T cells) and massive death of liver
cells (Arsura et al., 1997, supra; Beg et al., 1995, Nature, 376:
167-170; Bargou et al., 1997, J. Clin. Invest., 100: 2961-2969). In
vitro inhibition of NF.kappa.B induces similar developmental arrest
and death of B cells (Liu et al., 1996, supra).
[0253] In the NF.kappa.B pathway, it has been observed that
phosphorylation and ubiquitination work in concert to transmit a
message to the nucleus and to activate the cell-cycle genes and
proteins in the cytoplasm, thus activating cell signalling,
division, development (e.g., differentiation) and proliferation;
stimulating the human epithelial HeLa cell line with TNF-.alpha.
switches on a stress-activated MAP (mitogen-activated protein)
cascade that promotes the phosphorylation of I.kappa.B.alpha.
kinase (Lee et al., 1997, Cell, 88: 213-222). The kinase, in turn,
phosphorylates the NF.kappa.B inhibitor protein I.alpha.B.kappa.
marking it for ubiquitination. In unstimulated cells, I.kappa.B
binds to- and inhibits the activity of NF.kappa.B. When
ubiquitinated I.kappa.B is degraded by the proteasome, NF.kappa.B
translocates to the nucleus where it activates transcription. As is
stated in Hopkin (1997, supra), the combination of two highly
specific processes, phosphorylation and ubiquitination, has been
utilized by cells to control complex signal-transduction pathways
precisely. Such a mechanism which allows for a rapid return to
normal is critical in the activation and de-activation of molecules
such as cytokines, which are said to act transiently, as
constitutive activation would be cytotoxic.
[0254] Cell surface signals on lymphocytes activate NF.kappa.B
through cascades of kinases (Verma et al., 1995, supra; Baeuerle
and Baltimore, 1996, Cell, 87: 13-20). A previous report shows a
possible association of NF-.kappa.B with a cellular serine kinase,
resulting phosphorylation and activation of NF-.kappa.B (Ostrowski
et al., 1991, J. Biol. Chem., 266: 12722-12733; Hayashi et al.,
1993, J. Biol. Chem., 268: 26790-26795). NF.kappa.B also can
interact with cyclin dependent kinases (Cdk), phosphorylation steps
regulating cell cycle progression and conveyance of signals for
differentiation and apoptosis. Specifically, Cdk8 or Cdk7 (in
combination with cyclins) coordinate the metabolism of
differentiated cells with extracellular stimuli and regulate
transcriptional activation.
[0255] ii. Activity in the Nucleus
[0256] NF.kappa.B and other members of the rel family of protein
complexes play a central role in the transcriptional regulation of
a remarkably diverse set of genes involved in the immune and
inflammatory responses (Grilli et al., 1993, Int. J. Cytology, 143:
1-62). For example, NF.kappa.B is required for the expression of a
number of immune response genes, the Ig-.kappa. light chain
immunoglobulin gene, the IL-2 receptor .alpha. chain gene, the T
cell receptor .beta. chain gene, and class I and II major
histocompatibility genes. In addition, NF.kappa.B has been shown to
be required for a number of genes involved in the inflammatory
response, such as the TNF-.alpha. gene and the cell adhesion genes,
E-selectin, I-cam, and V-cam. NF.kappa.B is also required for the
expression of a large number of cytokine genes such as IL-2, IL-6,
G-CSF, and IFN-.beta.. Finally, NF.kappa.B is essential for the
expression of the human immunodeficiency virus (HIV).
[0257] iii. Role in the Cytoplasm
[0258] In addition to its role as a transcription factor,
NF.kappa.B is believed mediate events occurring in the cytoplasm.
Subunit p65 binds cyclin-dependent kinases (cdk's), cdc's and other
cell cycle activators, which are part of a multiprotein complex;
the data presented in Example 1, below, demonstrates such binding.
These proteins control the cell cycle, differentiation, DNA
replication and cell proliferation. It is thought that p50 may have
similar binding affinities.
[0259] iv. Role in Autoimmune Disease
[0260] Developmental arrest of lymphocytes has been observed in
humans with type I diabetes; such an arrest often manifests itself
as an increase in the number of CD45RA-naive cells (Faustman et
al., 1989, Diabetes 38: 1462-1468; Faustman, 1993, Diabetes Metab.
19: 446-457; Faustman et al., 1990, J. Autoimmunity, 3: 111-116;
Faustman et al., 1991, Diabetes, 40: 590-597). Functional assays of
antigen presentation and analysis of surface antigens on
lymphocytes have confirmed the existence of diverse and immature
lineages of lymphocytes in type I diabetics (Faustman et al., 1991,
Science, 254: 1756-1761; Peakman et al., 1993, Lancet, 342: 1296;
Peakman et al., 1994, Lancet, 343: 424; Peakman et al., 1994,
Diabetes, 43: 712-717).
[0261] Regardless of the level at which an autoimmune disease is
treated according to the methods of the invention, it is necessary
to deliver therapeutic agents in a safe and medically expedient
manner. Gene therapy provides one set of methods by which bioactive
substances, such as proteins and nucleic acids, may be delivered in
active form to- or synthesized at their intended sites of action.
Gene therapy methods are discussed in the following section.
[0262] Gene Therapy According to the Invention
[0263] i. Therapeutic Nucleic Acids
[0264] Sequences
[0265] A therapeutic gene may be transfected for use in the
invention using a viral or non-viral DNA or RNA vector, where
non-viral vectors include, but are not limited to, plasmids, linear
nucleic acid molecules, artificial chromomosomes and episomal
vectors. Expression of heterologous genes has been observed after
injection of plasmid DNA into muscle (Wolff J. A. et al., 1990,
Science, 247: 1465-1468; Carson D. A. et al., U.S. Pat. No.
5,580,859), thyroid (Sykes et al., 1994, Human Gene Ther., 5:
837-844), melanoma (Vile et al., 1993, Cancer Res., 53: 962-967),
skin (Hengge et al., 1995, Nature Genet., 10: 161-166), liver
(Hickman et al., 1994, Human Gene Therapy, 5: 1477-1483) and after
exposure of airway epithelium (Meyer et al., 1995, Gene Therapy, 2:
450-460).
[0266] Therapeutic nucleic acid sequences useful according to the
methods of the invention include those encoding receptors, enzymes,
ligands, regulatory factors, and structural proteins. Therapeutic
nucleic acid sequences also include sequences encoding nuclear
proteins, cytoplasmic proteins, mitochondrial proteins, secreted
proteins, plasmalemma-associated proteins, serum proteins, viral
antigens, bacterial antigens, protozoal antigens and parasitic
antigens. Therapeutic nucleic acid sequences useful according to
the invention also include sequences encoding proteins,
lipoproteins, glycoproteins, phosphoproteins and nucleic acids
(e.g., RNAs such as ribozymes or antisense nucleic acids). Proteins
or polypeptides which can be expressed using the methods of the
present invention include hormones, growth factors,
neurotransmitters, enzymes, clotting factors, apolipoproteins,
receptors, drugs, oncogenes, tumor antigens, tumor suppressors,
structural proteins, viral antigens, parasitic antigens and
bacterial antigens. The compounds which can be incorporated are
only limited by the availability of the nucleic acid sequence
encoding a given protein or polypeptide. One skilled in the art
will readily recognize that as more proteins and polypeptides
become identified, their corresponding genes can be cloned into the
gene expression vector(s) of choice, administered to a tissue of a
recipient organism, such as a mammalian tissue (including human
tissue), and expressed in that tissue.
[0267] Therapeutic sequences according to the invention may encode
products which restore proteasome activity; such genes are referred
to as being `upstream` of NF.kappa.B. For example, gene expression
constructs encoding proteasome components or associated proteins
(e.g. the Lmp2/Tap1 gene pair, or Lmp2, Lmp7, Tap1 or Tap2)
comprising cDNA sequences functionally linked to the corresponding
wild-type transcriptional regulatory sequences are of use. Genes
which restore proper ubiquitination include those encoding members
of the superfamily of ubiquitination-mediating enzymes of the
classes E1, E2 and E3; as stated above, human homologues of the
yeast ubiquitination enzymes have been discovered, among them the
UbCH5 (which functions as an E2) and the MDM2 oncoprotein, which
acts as a ubiquitin ligase, or E3 (see Honda et al., 1997,
supra).
[0268] Sequences encoding wild-type NF.kappa.B subunits for use in
the reconstitution of missing activity resulting from inactivating
mutations in either or both of p65 and p50; genes encoding these
proteins may be administered according to the invention. Genes
which might compensate for a loss of proteasome function to
activate NF.kappa.B by removing the need for proteasome-mediated
cleavage of I.kappa.B are also of use, for example, a recombinant
NF.kappa.B cDNA engineered such that its product can no longer be
bound by I.kappa.B, as discussed above.
[0269] Other genes requiring activation by the proteasome encode
apolipoprotein B100 (apoB), transcription factors, e.g. STAT
transcription factor or DNA repair factor TFIIH, are also of
use.
[0270] Genes downstream of NF.kappa.B (i.e. those which are under
NF.kappa.B transcriptional control) may, themselves be expressed as
cDNA constructs in a recipient host; however, this requires a
knowledge of all downstream activation targets of NF.kappa.B in
cells which are to receive treatment, as well as designing
individual expression constructs for each such gene and ensuring
that they are expressed in the proper ratios relative to one
another an to other cellular proteins. As stated above, such genes
include, but are not limited to, those which encode the
Ig-.kappa.light chain immunoglobulin, the IL-2 receptor .alpha.
chain, the T cell receptor .beta. chain, class I and II major
histocompatibility proteins, TNF-.alpha., E-selectin, I-cam, and
V-cam, IL-2, IL-6, G-CSF, and IFN-.beta..
[0271] Nucleic acids of use in the invention include those that
encode proteins for which a patient might be deficient or that
might be clinically effective in higher-than-normal concentration
as well as those that are designed to eliminate the translation of
unwanted proteins. As discussed above, nucleic acids of use
according to the invention for the elimination of deleterious
proteins are antisense RNA and ribozymes, as well as DNA expression
constructs that encode them. Note that antisense RNA molecules,
ribozymes or genes encoding them may be administered to a patient
by a method of nucleic acid delivery that is known in the art, such
as an in vivo or an ex vivo method, as described below.
[0272] Therapeutic genes of use in the invention include those
whose products may suppress the function of inhibitors or other
negative regulators of proteasome function. One such regulator is
the 40 kD-, ATP-dependent protein mentioned above whose release
from the proteasome complex permits proteolytic cleavage of target
proteins to occur. Inactivating nucleic acid sequences such may
encode a ribozyme or antisense RNA specific for the mRNA which
encodes the 40 kD protein or, alternatively, may encode an antibody
directed against the 40 kD protein or a polypeptide of like
sequence with the site on the proteasome complex to which the 40 kD
protein binds in vivo; such a polypeptide could, if present at
several-fold molar excess (e.g. 10-fold or more) over the
endogenous proteasome component bound by the 40 kD species, serve
as to compete the inhibitory protein off of it. Note that the 40 kD
proteasome regulator is said to exist as a 250 kD multimer when
released (see again WO 95/25533). Japanese patent JP 95121484
discloses a non-functional mutant of this protein which may be of
use to titrate functional 40 kD molecules away from the proteasome
complex.
[0273] In addition to the need to suppress the activity of
inhibitors of proteasome function, it may be equally necessary to
suppress that of proteins normally targeted for inactivation by the
proteasome. These include oncogene c-Fos, ornithine decarboxylase,
tyrosine aminotransferase, c-myb, HMG-R (a key enzyme of sterol
synthesis) and apoB (also activated by proteasomes).
[0274] Successful methods for the therapeutic administration of
antibodies for the treatment of autoimmune disease (in this case,
rheumatoid arthritis) have been disclosed in U.S. Pat. No.
5,698,195, the contents of which are herein incorporated by
reference.
[0275] Ribozymes of the hammerhead class are the smallest known,
and lend themselves both to in vitro synthesis and delivery to
cells (summarized by Sullivan, 1994, J. Invest. Dermatol., 103:
85S-98S; Usman et al., 1996, Curr. Opin. Struct. Biol., 6:
527-533).
[0276] Physical Properties and Delivery Vehicles
[0277] A nucleic acid of use according to the methods of the
invention may be either double- or single stranded and either naked
or associated with protein, carbohydrate, proteoglycan and/or lipid
or other molecules. Such vectors may contain modified and/or
unmodified nueleotides or ribonucleotides. Examples of some
therapeutic nucleic acid sequences are enumerated above. In the
event that the gene to be transfeeted is without its native
transcriptional regulatory sequences, the vector must provide such
sequences to the gene, so that it can be expressed once inside the
target cell. Such sequences may direct transcription in a
tissue-specific manner, thereby limiting expression of the gene to
its target cell population, even if it is taken up by other
surrounding cells. Alternatively, such sequences may be general
regulators of transcription, such as those that regulate
housekeeping genes, which will allow for expression of the
transfected gene in more than one cell type; this assumes that the
majority of vector molecules will associate preferentially with the
cells of the tissue into which they were injected, and that leakage
of the vector into other cell types will not be significantly
deleterious to the recipient mammal. It is also possible to design
a vector that will express the gene of choice in the target cells
at a specific time, by using an inducible promoter, which will not
direct transcription unless a specific stimulus, such as heat
shock, is applied.
[0278] Delivery of a nucleic acid may be performed using a delivery
technique selected from the group that includes, but is not limited
to, the use of viral vectors and non-viral vectors, such as
episomal vectors, artificial chromosomes, liposomes, cationic
peptides, tissue-specific cell transfection and transplantation,
administration of genes in general vectors with tissue-specific
promoters, etc.
[0279] ii. Dosage
[0280] Generally, nucleic acid molecules are administered in a
manner compatible with the dosage formulation, and in such amount
as will be prophylactically and/or therapeutically effective. When
the end product (e.g. an antisense RNA molecule or ribozyme) is
administered directly, the dosage to be administered is directly
proportional to the amount needed per cell and the number of cells
to be transfected, with a correction factor for the efficiency of
uptake of the molecules. In cases in which a gene must be expressed
from the nucleic acid molecules, the strength of the associated
transcriptional regulatory seuqences also must be considered in
calculating the number of nucleic acid molecules per target cell
that will result in adequate levels of the encoded product.
Suitable dosage ranges are on the order of, where a gene expression
construct is administered, 0.5- to 1 .mu.g, or 1-10 .mu.g, or
optionally 10-100 .mu.tg of nucleic acid in a single dose. It is
conceivable that dosages of up to 1 mg may be advantageously used.
Note that the number of molar equivalents per cell vary with the
size of the construct, and that absolute amounts of DNA used should
be adjusted accordingly to ensure adequate gene copy number when
large constructs are injected.
[0281] iii. Administration
[0282] Nucleic acid molecules to be administered according to the
invention also may be formulated in a physiologically acceptable
diluent such as water, phosphate buffered saline, or saline, and
further may include an adjuvant. Adjuvants such as incomplete
Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum
are materials well known in the art. Administration of a nucleic
acid molecule as described herein may be either localized or
systemic.
[0283] Localized Administration
[0284] It is contemplated that global administration of a
therapeutic composition to an animal is not needed in order to
achieve a highly localized effect. Localized administration of a
nucleic acid is preferably by via injection or by means of a drip
device, drug pump or drug-saturated solid matrix from which the
nucleic acid can diffuse implanted at the target site. When a
tissue that is the target of treatment according to the invention
is on a surface of an organism, topical administration of a
pharmaceutical composition is possible. For example, antibiotics
are commonly applied directly to surface wounds as an alternative
to oral or intravenous administration, which methods necessitate a
much higher absolute dosage in order to counter the effect of
systemic dilution, resulting both in possible side-effects in
otherwise unaffected tissues and in increased cost.
[0285] Compositions comprising a therapeutic composition which are
suitable for topical administration can take one of several
physical forms, as summarized below:
[0286] (i) A liquid, such as a tincture or lotion, which may be
applied by pouring, dropping or "painting" (i.e. spreading manually
or with a brush or other applicator such as a spatula) or
injection.
[0287] (ii) An ointment or cream, which may be spread either
manually or with a brush or other applicator (e.g. a spatula), or
may be extruded through a nozzle or other small opening from a
container such as a collapsible tube.
[0288] (iii) A dry powder, which may be shaken or sifted onto the
target tissue or, alternatively, applied as a nebulized spray.
[0289] (iv) An liquid-based aerosol, which may be dispensed from a
container selected from the group that comprises pressure-driven
spray bottles (such as are activated by squeezing), natural
atomizers (or "pump-spray" bottles that work without a compressed
propellant) or pressurized canisters.
[0290] (v) A carbowax or glycerin preparation, such as a
suppository, which may be used for rectal or vaginal administration
of a therapeutic composition.
[0291] In a specialized instance, the tissue to which a therapeutic
composition is the lung. In such a case the route of administration
is via inhalation, either of a liquid aerosol or of a nebulized
powder of. Drug delivery by inhalation, whether for topical or
systemic distribution, is well known in the art for the treatment
of asthma, bronchitis and anaphylaxis. In particular, it has been
demonstrated that it is possible to deliver a protein via aerosol
inhalation such that it retains its native activity in vivo (see
Hubbard et al., 1989, J. Clin. Invest., 84: 1349-1354).
[0292] Note that in some cases, the surface in question is
internal, for example, the gastric lining; in such a case, topical
application would comprise taking the therapeutic composition via
an oral route, whether in liquid, gel or solid form.
[0293] Systemic Administration
[0294] Systemic administration of a nucleic acid or other
therapeutic composition according to the invention may be performed
by methods of whole-body drug delivery are well known in the art.
These include, but are not limited to, intravenous drip or
injection, subcutaneous, intramuscular, intraperitoneal,
intracranial and spinal injection, ingestion via the oral route,
inhalation, trans-epithelial diffusion (such as via a
drug-impregnated, adhesive patch) or by the use of an implantable,
time-release drug delivery device, which may comprise a reservoir
of exogenously-produced nucleic acid or other material or may,
instead, comprise cells that produce and secrete a therapeutic
protein or other agent (see "Ex vivo therapy", below). Note that
injection may be performed either by conventional means (i.e. using
a hypodermic needle) or by hypospray (see Clarke and Woodland,
1975, Rheumatol. Rehahil., 14: 47-49).
[0295] Systemic administration is advantageous when a
pharmaceutical composition must be delivered to a target tissue
that is widely-dispersed, inaccessible to direct contact or, while
accessible to topical or other localized application, is resident
in an environment (such as the digestive tract) wherein the native
activity of the nucleic acid or other agent might be compromised,
e.g. by digestive enzymes or extremes of pH.
[0296] Nucleic acid constructs of use in the invention can be given
in a single- or multiple dose. A multiple dose schedule is one in
which a primary course of administration can include 1-10 separate
doses, followed by other doses given at subsequent time intervals
required to maintain and or reinforce the cellular level of the
transfeeted nucleic acid. Such intervals are dependent on the
continued need of the recipient for the therapeutic nucleic acid,
the ability of a given nucleic acid to selfreplicate in a mammalian
cell if it does not become integrated into the recipient's genome
and the half-life of a non-renewable nucleic acid (e.g. a molecule
that will not self-replicate). Preferably, when the medical needs
of the recipient mammal dictate that a nucleic acid or a product
thereof will be required throughout its lifetime, or at least over
an extended period of time, such as a year or more, a nucleic acid
may be encoded by sequences of a vector that will self-replicate in
the target cells. The efficacy of transfection and subsequent
maintenance of the nucleic acid molecules may be assayed either by
monitoring the activity of a marker gene, which may additionally be
comprised by the transfected construct, or by the direct
measurement of either the protein product encoded by the gene of
interest or the reduction in the levels of a protein the production
of which it is designed to inhibit. The assays can be performed
using conventional molecular and biochemical techniques, such as
are known to one skilled in the art.
[0297] Ex Vivo Therapy
[0298] As alluded to earlier, it is possible to administer a
therapeutic nucleic acid for use not only in in vivo therapy (i.e.,
that in which a nucleic acid is administered directly to a patient
for uptake by- and subsequent expression in cells in situ) but also
in ex vivo therapy (i.e., that in which a nucleic acid is
administered to cultured or explanted cells in vitro, which
transfected cells are subsequently transplanted into the clinical
patient in order to supply a therapeutic product). Methods of ex
vivo gene therapy are described in detail herein. By these methods,
a plasmid which continues to be maintained in a transformed or
transfected cell after such a cell has been administered (e.g. via
transplantation) to a multicellular host, such as a mammal,
delivers a gene product to that individual. It is contemplated that
a gene of interest, particularly a therapeutic gene, will be
expressed by the transplanted cell, thereby providing the recipient
organism, particularly a human, with a needed RNA (e.g., an
antisense RNA or ribozyme) or protein.
[0299] As discussed above, a cell type may be used according to the
invention which is amenable to methods of nucleic acid transfeetion
such as are known in the art. Such cells may include cells of an
organism of the same species as the recipient organism, or even
cells harvested from the recipient organism itself for ex vivo
nucleic acid transfection prior to re-introduction. Such autologous
cell transplants are known in the art. One common example is that
of bone marrow transplantation, in which bone marrow is drawn
either from a donor or from a clinical patient (for example, one
who is about to receive a cytotoxic treatment, such as high doses
of ionizing radiation), and then transplanted into the patient via
injection, whereupon the cells re-colonize bones and other organs
of the hematopoietic system.
[0300] a. Cell Dosage
[0301] The number of transfected cells which are administered to a
recipient organism is determined by dividing the absolute amount of
therapeutic or other gene product required by the organism by the
average amount of such an agent which is produced by a transfected
cell. Note that steady-state plasmid copy number varies depending
on the strength of its origin of replication as well as factors
determined by the host cell environment, the availability of
nucleotides and replicative enzyme complexes, as does the level of
expression of the gene of interest encompassed by the plasmid,
which level likewise is determined by the strength of its
associated promoter and the availability of nucleotides and
transcription factors in a given host cell background. As a result,
the level of expression per cell of a given gene of interest must
be determined empirically prior to administration of cells to a
recipient.
[0302] While efficient methods of cell transfection and
transplantation are known in the art, they do not ensure that the
transfected cell is immortal. In addition, the requirements of the
recipient organism for the product encoded by the transgene may
change over time. In light of these considerations, it is
contemplated that cells may be administered in a single dose or in
multiple doses, as needed. A multiple dose schedule is one in which
a primary course of administration can include 1-10 separate doses,
followed by other doses given at subsequent time intervals required
to maintain and or reinforce the cellular level of the transfected
nucleic acid. Such intervals are dependent on the continued need of
the recipient for the therapeutic gene product. Preferably, when
the medical needs of the recipient mammal dictate that a gene
product will be required throughout its lifetime, or at least over
an extended period of time, such as a year or more, the transfected
cells will be replenished on a regular schedule, such as monthly or
semi-monthly, unless such cells are able to colonize the recipient
patient in permanent fashion, such as is true in the case of a
successful bone-marrow cell transplant.
[0303] b. Nucleic Acid Dosage
[0304] Provided a nucleic acid vector capable of replication in the
transfected cell is used, the absolute amount of nucleic acid which
is transfected into cells prior to transplantation is not critical,
since in cells receiving at least one copy of such a vector, the
vector will replicate until an equilibrium copy-number is achieved.
As a first approximation, an amount of vector equivalent to between
1 and 10 copies thereof per cell to be transfected may be used; one
of skill in the art may adjust the ratio of plasmid molecules to
cells as is necessary to optimize vector uptake. Of particular used
in the invention are vectors or transfection techniques which
result in the stable integration of the gene of interest into the
chromosome of the transfected cell, so as to aviod the need to
maintain selection for cells bearing the vector following
transplantation into a recipient multicellular organism, such as a
human.
[0305] c. Administration of Autologous or Syngeneic Cells
[0306] A cell type which is commonly transplanted between
individuals of a single species (or, even, from an individual to a
cell culture system and back to the same individual) is that of
hematopoietic stem cells (HSCs), which are found in bone marrow;
such cells have the advantage that they are amenable to nucleic
acid transfection while in culture, and are, therefore, well suited
for use in the invention. Cultures of HSCs are transfected with a
minimal plasmid comprising an operator sequence and a gene of
interest and the transfected cells administered to a recipient
mammal in need of the product of this gene. Transfection of
hematopoietic stem cells is described in Mannion Henderson et at.,
1995, Exp. Hematol., 23: 1628; Schiffmann et al., 1995, Blood, 86:
1218; Williams, 1990, Bone Marrow Transplant, 5: 141; Boggs, 1990,
Int. J. Cell Cloning, 8: 80; Martensson et at., 1987, Eur. J.
Immunol., 17: 1499; Okabe et al., 1992, Eur. J. Immunol., 22:
37-43; and Banerji et al., 1983, Cell, 33: 729. Such methods may
advantageously be used according to the present invention.
Administration of transfeeted cells proceeds according to methods
established for that of non-transfected cells, as described
below.
[0307] The transplantation of hematopoietic cells, such as in a
bone marrow transplant, is commonly performed in the art by
procedures such as those described by Thomas et al. (1975, New
England J. Med., 292: 832-843) and modifications thereof. Such a
procedure is briefly summarized: In the case of a syngeneic graft
or of a patient suffering from an immunological deficiency, no
immunosuppressive pre-treatment regiment is required; however, in
cases in which a cells of a non-self donor are to be administered
to a patient with a responsive immune system, an immunosuppressive
drug must be administered, e.g. cyclophosphamide (50 mg/kg body
weight on each of four days, with the last dose followed 36 hours
later by the transplant). Leukemic patients routinely receive a
1000-rad midline dose of total-body irradiation in order to ablate
cancerous blood cells; this irradiation also has an
immune-suppressive effect. Following pre-treatment, bone marrow
cells (which population comprises a small number of pluripotent
hematopoietic stem cells, or HSCs), are administered via injection,
after which point they colonize the hematopoietic system of the
recipient host. Success of the graft is measured by monitoring the
re-appearance of the numerous adult blood cell types by the
immunological and molecular methods which are well known in the
art. While as few as 1-10 HSCs are, in theory, able to colonize and
repopulate a lethally-irradiated recipient mammal over time, it is
advantageous to optimize the rate at which repopulation occurs in a
human bone marrow transplant patient; therefore, a transplanted
bone marrow sample comprising 10 to 100, or even 100 to 1000 HSCs
should be administered in order to be therapeutically
effective.
[0308] It is contemplated that both lymphoid and parenchymal cells,
particularly those which are targeted for destruction in autoimmune
disease, are of use in the invention. Such parenchymal include
those of the islets of Langerhans, the thyroid, the adrenal cortex,
muscles, cartilagenous- or other synovial tissue, the kidneys,
epithelial tissues (both external and internal, particularly that
of the intestinal lumen, lung, heart, liver, kidney, neurons and
synovial cells) and the nervous system.
[0309] In that such cells are meant to either to replace those lost
to autoimmune destruction or to provide a pool of
autoimmune-resistant cells prior to massive cell death, it is
necessary to ensure that such cells indeed are not susceptible to
autoimmune disease. Provided that early treatment is undertaken, it
is possible to harvest small (or, in some cases, large) numbers of
cells of the target tissue directly from the patient for
transfection and reintroduction; alternatively, cells of a donor of
matching tissue type may be used.
[0310] To render the transplanted cells resistant, at least
collectively, to immune rejection by the recipient organism, it is
contemplated that transplanted cells expressing a high level of
activated NF.kappa.B (a high NF.kappa.B "set point"), while still
subject to destruction by autoimmune host lymphocytes, would enjoy
the advantage of robust proliferative capacity in order to multiply
at a rate surpassing that of cell killing, thereby providing a
long-lived population of therapeutic cells to the recipient
organism. Such cells may be transfected with gene expression
constructs which result in the production of high levels of
activated NF.kappa.B, or may be cells obtained from a donor
selected for high endogenous NF.kappa.B activity, as may be
determined in an in vitro transcription assay or DNA/protein
binding assay (as described in Example 2, below) using protein
extracts drawn from such a donor, which may, itself, be a
transgenic mammal.
[0311] As an alternative, a procedure has been developed which
allows for the shielding of transplanted cells, even those
transplanted from a members of one species to another (see also
below, for other such methods). As a protective measure against
viral infection, a mechanism has evolved in the immune system of
vertebrates in which viral proteins being produced within the
infected cells are broken down into peptides by intracellular
proteolytic enzymes. Some of the peptides are enfolded by a
particular class (Class I) of proteins of the major
histocompatibility complex (MHC) of genes and are transported to
the cell surface, where the viral peptide/MHC protein complex is
displayed as a surface antigen. Circulating cytotoxic T lymphocytes
(CTLs) having the appropriate specificity recognize the displayed
MHC Class I antigen as foreign and proceed, through activation and
a complex lytic cascade, to kill the infected cell. The MIHC Class
I proteins are expressed in essentially all nucleated cells of the
body and are a key element in the immune system's ability to
distinguish between "self" molecules and "foreign" (non-self)
molecules. They can be distinguished from the other class of
proteins of the major histocompatibility complex of genes, known as
MI {C Class H proteins.
[0312] Although MHC Class I antigens are a magnificent mechanism
for combating infection, they also are primarily responsible for
the failure of tissues, e.g., cells, organs, or parts of organs,
that are transplanted from one mammal (donor) to another (host).
This rejection of tissue by the host organism was first observed in
mouse skin graft experiments in the 1950s and was named the
transplant reaction. The search for the factor on donor cells that
was evidently recognized and attacked by the host's immune system
led finally to the characterization of the two classes of MHC
proteins (see, Snell, 1957, Ann Rev. Microbiol., 2: 439-57).
[0313] Recognition of donor MHC Class I antigens as foreign by host
CTLs occurs not only where the donor tissue is different from a
different species (a xenogeneic transplant) but also where the
tissues are from a donor of the same species as the host (an
allogeneic transplant). The specificity of the T cell receptors on
CTLs and other T cells that bind to Class I and Class II antigens
is such that a single amino acid difference in the structure of a
MHC antigen can be detected as foreign, leading to an immune
response. The MHC proteins are expressed from DNA formed by
rearrangement of several gene segments in the MHC loci, leading to
a high degree of polymorphism in MEC proteins.
[0314] A method applicable to inhibiting the rejection of
transplanted tissues mediated by recognition of MHC class I
antigens is as follows: Transplanted allogeneic or xenogeneic
tissue comprising treating the transplant tissue with an enzyme
capable of cleaving MHC Class I antigens. Removal of Class I
antigens from the donor tissue attenuates the extent of the inmiune
response mounted by the host mammal receiving the transplant.
Furthermore, the enzyme treatment is an effective preparatory
treatment for all tissues intended for transplant, without regard
to the specific MIHC antigens displayed on the donor tissue or the
specificities of the immune system cells of the host.
[0315] The method of treating tissues to render them suitable for
transplant comprises incubating the donor tissue with an enzyme
capable of cleaving MHC Class I antigens, e.g., in an amount and
for a sufficient period to remove sufficient MHC Class I antigens
to significantly attenuate the host's immune response to the donor
tissue. Such incubation is performed in a medium which allows both
enzymatic cleavage of the surface antigens to proceed, but is still
amenable to tissue survival (e.g. a physiological salt buffer, such
as PBS, or a cell-, tissue- or organ culture medium, such as are
known in the art. Typically the mean cell density of Class I
antigens will be reduced below about 10% of untreated levels,
preferably below 1%. One such useful enzyme is papain.
[0316] The enzyme selected for use in this method must be capable
of cleaving MHC Class I antigens, that is, removing a MHC Class I
protein/peptide complex from the surface of a cell on which it was
displayed. Useful cleavage is that which alters the MHC Class I
antigen as displayed sufficiently to avoid interaction with the
immune system cells of the recipient mammal; the object of this
cleavage step is to remove substantially all of the extracellular
portion of the MHC Class I antigen from the cell. Any amount of MHC
Class I antigen that can be removed from the donor tissue is
helpful in avoiding rejection of the transplant; however, as a
practical matter, removal of as much of the MHC Class I antigens as
possible without killing the tissue is desired, e.g. a reduction in
MHC Class I density of at least 90% or even as much as 99% is
desirable.
[0317] Typically, this is accomplished by bathing the donor tissue
in a solution of the enzyme for a period to allow the enzyme to
react with the MHC proteins, e.g., from 20 minutes to 24 hours or
more. At high enzyme concentration, incubation of tissues may be
for even shorter periods, so long as the cells of the tissues are
not damaged. In general, a minimum of 75% viability of the tissue
cells is required, although 90% viability or more is sought. In
order to retard resynthesis of the MHC class I molecules, the
enzyme treatment is earned out at the optimal temperature for
enzyme activity, but the treated tissue is thereafter maintained at
a low temperature, for example at 4.degree. C., until ready for
use.
[0318] There are several advantages to the use of enzymes as a
treatment for avoiding transplant rejection: (a) the enzymes are
comparatively inexpensive, and many are commercially available in
high purity with well-characterized activity and specificity; (b)
enzymes can be used locally or in vitro to avoid systemic
treatments; (c) enzyme shaving of the transplant tissue can be used
in combination with (i.e., without foreclosing) other complementary
therapies; and (d) the use of enzymes is not species-restricted or
allelically restricted, and thus the method is adaptable to
veterinary, human and xenogenie tissue treatment without radical
modification of the procedures or reagents. Since the tissues will
remain viable after treatment, expression of MHC molecules will
continue, and eventually reappearance of MHC antigens on the donor
tissue will occur, e.g., after transplantation; consequently, it is
this method may be used as part of an overall therapy that may
include additional measures to avoid rejection of the transplanted
cells, such as immunosuppression, plasmaphoresis, antigen blocking,
transfection, and the like. Although pre-transplantation treatment
of the tissues will be the most common practice, it is also
contemplated that this method of the present invention may be
employed in situ to effect local immune response inhibition to
preserve previously translated tissue. In such cases, cleavage of
the surface antigen produces a local, soluble, competitive receptor
for the cells of the host's immune system, which may serve to
effectively blunt immune attack on the transplanted tissue.
[0319] Useful enzymes include proteolytie enzymes, gycosidases,
proteinases and combinations of such enzymes that may sufficiently
alter the surface antigens to inhibit subsequent transplant
rejection. Examples include, but are not limited to,
endoproteinase, pepsin, papain, chymotrypsin, trypsin, collagenase,
cyanogen bromide, enterokinase (Asp or Glu-specific),
iodosobenzoate, lysobacter endoproteinase, Nbromosucciimide,
N-chlorosuccinimide, hydroxylamine, 2-nitro-5-thiocyanobenzoate and
endopeptidase. Papain particularly of use, as it is known to cut
all MHC Class I molecules of different alleles and different
species in the a3 domain. Papain does not cut the a1 or a2
domain.
[0320] Papain cutting characteristics are well described. Papain is
the major ingredient of meat tenderizers and is sulthydryl protease
isolated from the latex green fruit of papaya. It was first
isolated in 1955 and its enzymatic capabilities have been
extensively documentated. In its native state, the enzyme is
inactive, and therefore donor tissue treatments may be
advantageously carried out with a high degree of control, using
native papain in the presence of activators such as cysteine (0.005
M) and/or EDTA (0.002 M). See generally, Stockell et al., 1957, J.
Biol. Chem., 227: 1-26.
[0321] Additional such enzymatic reagents include, but are not
limited to, oxidoreductases acting on: (1) OH--OH groups: (2)
aldehyde or keto groups; (3) CH--CH groups; (4) CH--NH.sub.2
groups; (5) reduced NAD or NADP; (6) nitrogenous compounds; (7)
diphenols; (8) acting on H.sub.2 02; (9) hydrogen; (10) acting on
single donors with incorporation of oxygen: and (11) acting on
paired donors with incorporation of oxygen into one donor;
tranferases: (1) transferring one-carbon groups (methyltranferases,
hydroxymethyl-, formyl-and related transferases, carboxyl- and
carbamoyltransferases, amidinotransferases); (2) transferring
aldehydie or ketonic residues; (3) acting on acyltranferases,
aminoacyltransferases); (4) acting on glycosyltranferases
(hexosyltranferases, pentosyltranferases); (5) transferring alkyl
or related groups; (6) transferring nitrogenous groups; (7)
transferring phosphorus-containing groups (phosphotranferases with
an alcohol group as acceptor, phosphotransferases with a carboxyl
group as acceptor, phosphotranferases with a nitrogenous group as
acceptor, phosphotransferases with a phosphate group as acceptor,
phosphotransferases, pyrophosphotransferases,
nucleotidyltransferases, transferases for other substituted
phospho-groups); and, (8) transferring sulphur-containing groups
(sulphurtransferases, sulphotransferases, CoA-transferases);
hydrolases: (1) acting on ester bonds (carboxylic ester hydrolases,
thiolester hydrolases, phosphoric monoester hydrolases, phosphoric
diester hydrolases, triphosphoric monoester hydrolases, sulphuric
ester hydrolases); (2) acting on glyeosyl compounds (glycoside
hydrolases, hydrolysing N-glyeosyl compounds, hydrolysing
S-glycosal compounds); (3) acting on ether bonds (thioether
hydrolases); (4) acting on peptide bonds (peptide hydrolases)
(a-amino-acyl-peptide hydrolases, peptidyl-amino-acid hydrolases,
dipetide hydrolases, peptidyl-peptide hydrolases); (5) acting on
C--N bonds other than peptide bonds (in linear amides, in cylic
amides, in linear amidines, in cylic amidines, in cyanides); (6)
acting on acid-anhydride bonds (in phosphoryl-containing
anhydrides); (7) acting on C.dbd.C bonds; (8) acting on
carbon-halogen bonds; (9) acting on P--N; lyases (1) acting on
carbon-carbon bonds (carboxyl-lyases, aldehyde-lyases, keto
acid-lyases); (2) acting on carbon-oxygen bonds (hydrolyases and
other carbon-oxygen lyases); (3) acting on carbon-nitrogen bonds
(amonia-lyases and amidine-lyases); (4) carbon-sulphur lyases; (5)
carbon-halogen lyases; (6) other lyases; isomerases: (1) racemases
and epimerases (acting on amino acids and derivatives; acting on
hydroxyacids and derivatives, acting on carbohydrates and
derivatives, acting on other compounds; (2) acting on cis-trans
isomerases; (3) acting on intramolecular oxidoreductases
(interoconverting aldoses and ketoses, interoconverting keto- and
enol-groups, transposing C.dbd.C bonds); (4) acting on
intramolecular transferases (transferring acyl groups, transferring
phosphoryl groups, transferring other groups); (5) acting on
intramolecular lyases; (6) other isomerases; ligases: (1) acting on
forming C--O bonds (amino-acid-RNA ligases); (2) acting on forming
C--N bonds (acid-ammonia ligases (amide synthetases),
acid-amino-acid ligases (peptide synthetases), cyclo-ligases, other
C--N ligases, C--N ligases with glutamine as N-donor); (3) forming
C--C bonds; and glycosidases, such as .alpha.-amylase,
.quadrature.-amylase, glucoamylase, celulase, laminarinase,
inulase, dextranase, chitinase, polygalacturonase, lysozyme,
neuramimidase, .alpha.-glucosidase, .beta.-glucosidase,
.alpha.-galactosidase, .beta.-galactosidase, .alpha.-mannosidase,
-.beta.-fructofuranosidase, trehalase, chitobiase,
.beta.-acetylglucosaminidase, .beta.-glucuronidase,
dextrin-1,6-glucosidase, hyaluronidase, .beta.-D-fucosidase,
metalopeptidases, phospholiphase C and nucleosidase.
[0322] d. Administration of Xenogeneic and Allogeneic Cells
[0323] While transfection and subsequent tranplantation of cells
which are obtained from an individual or cell culture system of
like species with the recipient organism may be performed, it is
equally true that the invention may be practised using cells of
another organism (such as a well-characterized eukaryotic
microorganism, e.g. yeast, in which appropriate processing of
proteins encoded by therapeutic genes is likely and in which useful
origins of replication are known). In such a case, certain concerns
must be addressed.
[0324] First, when a protein is encoded by the gene of interest,
the transplanted cells must produce the protein in a form that may
is of use to the recipient organism. Post-translational processing
(including, but not limited to, cleavage and patterns of
glycosylation) must be consistent with proper function in the
recipient. In addition, either a protein or an RNA molecule of
interest must be made available to the recipient after synthesis,
such as by secretion, excretion or exocytosis from the transplanted
cell. To address the former, the protein produced by the
transfected cells may be qualitatively compared to the native
protein produced by an individual of the same species as the
recipient organism by biochemical methods well known in the art of
protein chemistry. The latter, release of the protein of interest
by the cells to be transplanted, may be assayed by isolating
protein from culture medium which has been decanted from the
transfected cells or from which such cells have been separated
(i.e. by centrifugation or filtration), and performing Western
analysis using an antibody directed at the protein of interest.
Antibodies against many proteins are commercially available;
teclmiques for the production of antibody molecules are well known
in the art.
[0325] Second, the cells must be shielded from immune rejection by
the recipient organism. It is contemplated that such cells may be
transfected with constructs expressing cell-surface markers (e.g.
MHC antigens) characteristic of the recipient patient so as to
provide them with biochemical camoflage.
[0326] In addition, methods for the encapsulation of living
cultures of cells for growth either in an artificial growth
environment, such as in a fermentor, or in a recipient organism
have been developed, and are also of use in the administration of
cells transfected according to the invention. Such an encapsulation
system renders the cell invisible to immune detection and, in
addition, allows for the free exchange of materials (e.g. the gene
product of interest, oxygen, nutrients and waste materials) between
the transplanted cells and the environment of the host
organism.
[0327] Methods and devices for cell encapsulation are disclosed in
numerous U.S. patents; among these are U.S. Pat. Nos. 4,353,888;
4,409,311; 4,673,566; 4,744,933; 4,798,786; 4,803,168; 4,892,538;
5,011,472; 5,158,881; 5,182,111; 5,283,187; 5,474,547; 5,498,401
(which is particularly directed to the encapsulation of bacterial
and yeast cells in chitosan); U.S. Pat. Nos. 5,550,050; 5,573,934;
5,578,314; 5,620,883; 5,626,561; 5,653,687; 5,686,115; 5,693,513;
and 5,698,413, the contents of which are fully incorporated by
reference herein. Typically required for the successful culture of
encapsulated cells is a selectively-permeable outer covering or
`skin` which is biocompatible (i.e., tolerated by both the
encapsulated cells and the recipient host), and, optionally, a
matrix in- or upon which cells are distributed such that the matrix
provides structural support and a substrate to which
anchorage-dependent cells may attach themselves. As relates to
encapsulation devices applicable to use in the invention, the term
"selectively-permeable" refers to materials comprising openings
through which small molecules (including molecules of up to about
50,000 M.W.-100,000 M.W.) may pass, but from which larger
molecules, such as antibodies (approximately 150,000 M.W.), are
excluded. Suitable covering materials include, but are not limited
to, porous and/or polymeric materials such as polyaspartate,
polyglutamate, polyacrylates (e.g., acrylic copolymers or RL.RTM.,
Monsanto Corporation), polyvinylidene fluoride, polyvinylidienes,
polyvinyl chloride, polyurethanes, polyurethane isocyanates,
polystyrenes, polyamides, cellulose-based polymers (e.g. cellulose
acetates and cellulose nitrates), polymethyl-acrylate,
polyalginate, polysulfones, polyvinyl alcohols, polyethylene oxide,
polyaciylonitriles and derivatives, copolymers and/or mixtures
thereof, stretched polytetrafluoroethylene (U.S. Pat. Nos.
3,953,566 and 4,187,390, both incorporated herein by reference),
stretched polypropylene, stretched polyethylene, porous
polyvinylidene fluoride, woven or non-woven collections of fibers
or yarns, such as "Angel Hair" (Anderson, Science, 246: 747-749;
Thompson et al., 1989, Proc. Natl. Acad. Sci. U.S.A., 86:
7928-7932), fibrous matrices (see U.S. Pat. No. 5,387,237,
incorporated herein by reference), either alone or in combination,
or silicon-oxygen-silicon matrices (U.S. Pat. No. 5,693,513).
Polylysine having a molecular weight of 10,000 to 30,000,
preferably 15,000 to 25,000 and most preferably 17,000 is also of
use in the invention (see U.S. Pat. No. 4,673,566). Alternatively,
the matrix material, comprising the transfected cells of the
invention, is exposed to conditions that induce it to form its own
outer covering, as discussed below.
[0328] As described in U.S. Pat. No. 5,626,561, the selective
permeability of such a covering may be varied by impregnating the
void spaces of a porous polymeric material (e.g., stretched
polytetrafluoroethylene) with a hydrogel material. Hydrogel
material can be impregnated in substantially all of the void spaces
of a porous polymeric material or in only a portion of the void
spaces. For example, by impregnating a porous polymeric material
with a hydrogel material in a continuous band within the material
adjacent to and/or along the interior surface of a porous polymeric
material, the selective permeability of the material is varied
sharply from an outer cross-sectional area of the material to an
inner cross-sectional area of the material. The amount and
composition of hydrogel material impregnated in a porous polyhmeric
material depends in large part on the particular porous polymeric
material used to encapsulate cells for transplant. Examples of
suitable hydrogel materials include, but are not limited to,
HYPAN.RTM. Structural Hydrogel (Hymedix International, Inc.;
Dayton, N.J.), non-fibrogenic alginate, as taught by Dorian in
PCT/US93/05461, which is incorporated herein by reference, agarose,
alginic acid, carrageenan, collagen, gelatin, polyvinyl alcohol,
poly(2-hydroxyethyl methacrylate), poly(N-vinyl-2-pynolidone) or
gellan gum, either alone or in combination.
[0329] The matrix typically has a high surface-area:volume ratio,
comprising pores or other spaces in- or on which cells may grow and
through which fluids may pass; in addition, suitable matrix
materials are stable following transplantation into a recipient
organism. Preferably, the matrix comprises an aggregation of
multiple particles, fibers or laminae. Alternatively, a matrix may
comprise an aqueous solution, such as a physiological buffer or
body fluid from the recipient organism (see U.S. Pat. No.
5,011,472). Suitable matrix materials include liquid, gelled,
polymeric, co-polymeric or particulate formulations of aminated
glucopolysachharides (e.g., deacetylated chitin, or "chitosan",
which is prepared from the pulverized shells of crabs or other
crustaceans, and is commercially available as a dry powder; Cat. #
C 3646, Sigma, St. Louis, Mo.), alginate (U.S. Pat. No. 4,409,331),
poly-.beta.-1.fwdarw.5-N-acetyl- glucosamine (p-G1cNAc)
polysaccharide species (either alone of formulated as co-polymer
with collagen; see U.S. Pat. No. 5,686,115), reconstituted
extracellular matrix preparations (e.g. Matrigel.RTM.;
Collaborative Research, Inc, Lexington, Mass.; Babensee et al.,
1992, J. Biomed. Matr. Res., 26: 1401), proteins, polyacrylamide,
agarose and others.
[0330] Methods by which cells become encapsulated using such
materials are both numerous and varied. Encapsulation devices
comprising a semi-permeable membrane material, as described above,
may be pre-formed, filled with cells (e.g. by injection or other
manual means) and then sealed (U.S. Pat. Nos. 4,892,538; 5,011,472;
5,626,56; and 5,653,687); such sealing may be effectively permanent
(e.g. by the use of heat-sealing), semi-permanent (e.g. by the use
of a biocompatible adhesive, such as an epoxy, which will not
dissolve or degrade in an aqueous environment) or temporary (e.g.
by the use of a removable cap or plug, or by shutting of a valve or
stopcock). Methods of permanent and semi-permanent sealing are
disclosed in U.S. Pat. No. 5,653,687. As an alternative to the use
of a pre-formed, semi-permeable cell reservoir, methods by which
cells suspended in matrix material and the substance which is to
form the outer covering of the encapsulation device are co-extruded
under conditions which cause the cell/matrix mixture, which may be
in liquid or semi-liquid (i.e., gelled) form to be encased in a
continuous tube of the semi-permeable polymer, which either forms,
or becomes crosslinked, under the extrusion conditions; such an
extrusion procedure may lead to the formation of capsules which
have only one cell reservoir (U.S. Pat. No. 5,283,187) or which are
divided into multiple, discrete compartments (U.S. Pat. No.
5,158,881). As an alternative to both types of procedure, a liquid
or semi-liquid (i.e., gelled) cell/matrix mixture droplet is
suspended either in an agent which induces `curing` or crosslinking
of the outer layer of matrix material to form a semi-permeable
barrier (U.S. Pat. Nos. 4,798,786 and 5,489,401) or in a solution
of polymeric material (or monomers thereof), which will polymerize
and/or crosslink upon contact with the cell/matrix droplet such
that a semi-permeable membrane is deposited thereon (U.S. Pat. Nos.
4,353,888; 4,673,566; 4,744,933; 5,620,883; and 5,693,513).
[0331] One of skill in the art is well able to select the
appropriate matrix and semi-permeable membrane materials and to
construct a cell-encapsulation device as described above.
[0332] Implantation of such a device is achieved surgically, via
standard techniques, to a site at or near the anatomical location
to which the product encoded by the gene on the gene of interest is
to be delivered, as is deemed safest and most expedient. Such a
device may take a convenient shape, including, but not limited to,
that of a sphere, pellet or other capsule shape, disk, rod or tube;
often, the shape of the device is determined by its method of
synthesis. For example, one which is formed by co-extrusion of a
cell suspension and a polymeric covering material is typically
tubular, while one formed by the deposition of a covering on
droplets comprising cells in matrix material might be spherical. As
discussed above, the number of cells which must be implanted (and,
therefore, encapsulated) is dependent upon the requirements of the
recipient organism for the product of the transfected gene. The
encapsulation devices described above are typically small (most
usefully, 10m to 1 mm in diameter, so as to permit efficient
diffusion of substances back and forth between the outer covering
and the cells most deeply embedded in the matrix), and it is
contemplated that such devices may carry between 10 and 1010 cells
each. Should the need for larger numbers of cells be anticipated, a
plurality (2, 10 or even 100 or more) of such in vivo culturing
devices may be made and implanted in a given recipient
organism.
[0333] An encapsulated cell device may be intended for permanent
installation; alternatively, retrieval of the device may be
desirable, whether to terminate delivery of the product of the gene
of interest to the recipient organism at the discretion of one of
skill in the art, such as a physician (who must determine on a
case-by-case basis the length of time for which a given cell
implant is beneficial to the recipient organism) or to replenish
the device with fresh cells after long-term use (i.e. months to
years). To the latter end, an implantation device may usefully
comprise a retrieval aid, such as a guidewire, and a cap or other
port, such as may be opened and re-sealed in order to gain access
to the cell reservoir, both as described in U.S. Pat. No.
4,892,538.
[0334] Live cultures of encapsulated cells have been used
successfully to deliver gene products to tissues of a recipient
animal. U.S. Pat. No. 4,673,566 discloses successful maintenance of
normal blood sugar levels in a diabetic rat into which encapsulated
rat islet of Langerhans cells were implanted; two administrations
of 3,000 cells each together were effective for six months, while a
single dose of 1,000 cells was effective for two months.
[0335] Encapsulated GABA-secreting pancreatic cells implanted into
subthalamic nucleus of monkeys in whom Parkinsonism has been
clinically-induced have been observed relieve the symptoms of that
syndrome (U.S. Pat. No. 5,474,547), demonstrating invisibility of
encapsulated cells to the immune system, as well as efficacy in
delivering a product of encapsulated, transplanted cells to a
recipient organism.
[0336] More encouraging, as it demonstrates immunological shielding
by cell encapsulation systems sufficient for cross-species cell
transplants, as is advantageous for their use in practicing the
present invention, is the finding that encapsulated embryonic mouse
mesencephalon cells, when transplanted into recipient rats,
alleviate symptoms of clinically-induced Parkinsonism (U.S. Pat.
No. 4,892,538).
[0337] Similarly, heterospecific transplantation of encapsulated
islet cells has been demonstrated to treat diabetes successfully
(dog islet cells to a mouse recipient, U.S. Pat. No. 5,578,314;
porcine islet cells to a mouse recipient, Sun et al., 1992, ASAIO
J., 38: 124). It is believed that such an approach is promising for
the clinical treatment of diabetes mellitus in humans (Calafiore,
1992, ASAIO J., 38: 34).
[0338] It is contemplated that these techniques, which have been
applied successfully to untransfected cells, may be utilized
advantageously with cells that are transfected with therapeutic
nucleic acid molecules of use in the invention.
[0339] e. Assay of Efficacy of Transplanted Cells in a Recipient
Organism
[0340] The efficacy of the transfected cells so administered and
their subsequent maintenance in the recipient host may be assayed
either by monitoring the activity of a marker gene, which may
additionally be comprised by the transfected construct, or by the
direct measurement of either the product (e.g. a protein) encoded
by the gene of interest or the reduction in the levels of a protein
the production of which it (an antisense message or ribozyme) is
designed to inhibit. The assays can be performed using conventional
molecular and biochemical techniques, such as are known to one
skilled in the art, or may comprise histological sampling (i.e.,
biopsy) and examination of tranplanted cells or organs.
[0341] In addition to direct measurements of protein or nucleic
acid levels in blood or target tissues encoded by the gene of
interest borne by the vector in transfected/transplanted cells, it
is possible to monitor changes in the disease state in patients
receiving gene transfer via transplantation of cells in which the
gene of interest is maintained and compare them to the progression
or persistence of disease in patients receiving comparable cells
transfected with vector constructs lacking the gene of
interest.
[0342] Proteins and Other Therapeutic Agents
[0343] In addition to nucleic acids, proteins and perhaps other
bioactive substances may be used to stimulate proteosome activity
in a recipient mammal. When the amount of a protein or other
therapeutic agent to be used is considered, the lowest dose that
provides the desired degree of enhancement of NF.kappa.B activity
by the target cells should be used; lower doses may be advantageous
in order to minimize the likelihood of possible adverse effects.
Note that "NF.kappa.B activity" includes not only the presence of
functional NF.kappa.B, but may also include the presence of the
products of genes regulated by NF.kappa.B, regardless of the means
by which they have arisen in the cell, as well as normal
differentiation, proliferation and survival of the cell. It will be
apparent to those of skill in the art that the
therapeutically-effective amount of a composition administered in
the invention will depend, inter alia, upon the efficiency of
cellular uptake of a composition, the administration schedule, the
unit dose administered, whether the compositions are administered
in combination with other therapeutic agents, the health of the
recipient, and the therapeutic activity of the particular protein
or other pharmaceutical substance.
[0344] As is also true of nucleic acids administered according to
the invention, the precise amount of a protein or other
pharmaceutical agent required to be administered depends on the
judgment of the practitioner and may be peculiar to each subject,
within a limited range of values. An appropriate dose of a protein
or other substance may be calculated as follows:
[0345] The NOD mouse model may be used to assay the effectiveness
of varying doses of a protein or other agent in treating an
autoimmune disease according to the invention. For a given
therapeutic composition, it is necessary to establish an
approximate range of dosages that are useful, yet relatively safe,
in a clinical situation. The NOD mouse model may be employed to
establish a dosage curve prior to use of the invention in human
subjects. Alternatively, if a pharmaceutical agent useful according
to the invention already has been granted regulatory approval, it
stands that acceptable upper limits of dosage tolerance for humans
and other mammals already will have been established for these
drugs prior to testing, as have systemic concentrations useful for
other clinical applications. These known dosages may serve as the
basis upon which calculations may be made prior to use of the mouse
model.
[0346] A therpeutic composition may be administered either
systemically or locally. In the general case, a starting dosage to
be administered locally to cells in the mice equals the optimal
systemic concentration described for a known use of the therapeutic
agent. Ideally, such a dosage has been established for mice;
otherwise, the relevant human dosage is used for the purposes of
calculation. As it is not known whether the concentration of a
particular protein or other agent that is useful for enhancing
NF.kappa.B activity is higher or lower than that used for other
clinical purposes, a range of values above and below the
recommended dosage may be assayed. In a first attempt, values
spanning four orders of magnitude below this dosage are examined;
if no effect is seen, or if enhancement of NF.kappa.B activity in
the target cells is observed to increase at or near the starting
dosage, values that exceed that dosage by up to four orders of
magnitude are assayed. If no effect is seen within four orders of
magnitude in either direction of the starting dosage, it is likely
that the agent is not of use according to the invention. It is
critical to note that when elevated dosages are used, the
concentration must be kept below harmful levels, which are also
known for all drugs that are approved for clinical use. Such a
dosage should be one (or, preferably, two or more) orders of
magnitude below the LD50 value that is known for a laboratory
mammal, whether or not that mammal is a mouse, and preferably below
concentrations that are documented as producing serious, if
non-lethal, side effects. If it determined that a therapeutic agent
is optimally useful at levels that are harmful if achieved
systemically, that agent should be used for local administration
only, and then only at such doses where diffusion of the drug from
the target site reduces its concentration to safe levels.
[0347] Assessment of Changes in Proteasome Activity According to
the Invention
[0348] Methods for assessing proteasome activity following
treatment are as described above for use in the detection of
deficiencies in proteolytic processing.
[0349] Assessment of NF.kappa.B Activation According to the
Invention
[0350] The amount of NF.kappa.B in cells treated according to the
invention may be assessed by methods well known in the art, as
described above for the detection of defects in proteolysis leading
to the failure to activate NF.kappa.B.
[0351] Molecular Methods
[0352] i. Northern Analysis
[0353] Molecular methods such as Northern analysis are well known
in the art (see Sambrook et al., 1989, Molecular Cloning. A
Laboratory Manual., 2nd Edition, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y.).
[0354] ii. RT-PCR
[0355] As an alternative to Northern analysis, reverse
transcription/polymerase chain reaction (RT-PCR) may be performed.
In the reverse transcription (RT) step of RT-PCR, the RNA is
converted to first strand cDNA, which is relatively stable and is a
suitable template for a PCR reaction. In the second step, the cDNA
template of interest is amplified using PCR. This is accomplished
by repeated rounds of annealing sequence-specific primers to either
strand of the template and synthesizing new strands of
complementary DNA from them using a thermostable DNA
polymerase.
[0356] 1.quadrature.g of total RNA and 75 pmol random hexamer
primer (e.g., Pd(n)6, supplied by Pharmacia; Piscataway, N.J.) are
resuspended in a 10 .mu.l volume with DEPC-treated water in an
RNase-free 0.5 .mu.l tube. This mixture is incubated at 70.degree.
C. for 10 minutes and placed on ice for two minutes. The following
reagents are added to the 10 .mu.l reaction; 1 .mu.l (200U) MMLV-RT
(Superscript.RTM. reverse transcriptase, BRL, Life Technologies,
Gaithersburg, Md.), 4 .mu.l 5.times.reaction buffer (BRL, Life
Technologies, Gaithersburg, Md.), 2 .mu.l 0.1M DTT, 1 .mu.l 10 mM
dNTP and 1 .mu.l human placental RNase inhibitor (10 to 50 units
per .mu.1; Boehringer Mannheim, Indianapolis, Ind.). In addition,
for each RNA sample a second reaction is prepared except that
MMLV-RT was omitted (RT negative control). The 19 .mu.l reaction is
incubated for 50 minutes at 42.degree. C. in a programmable thermal
cycler (such as is manufactured by MJ Research; Watertown, Mass.)
and inactivated by heating to 90.degree. C. for 5 minutes. After
cooling to 37.degree. C., 1 .mu.l RNase H (3 units per .mu.1;BRL,
Life Technologies, Gaithersburg, Md.) is added, the reaction is
incubated at 37.degree. C. for 20 minutes, then cooled to 4.degree.
C. RNA integrity is confirmed by amplification of a transcript of a
constitutively-expressed gene (e.g., interleukin-2 or G.alpha.s);
therefore, it is ensured that a negative result subsequently
observed on a test sample can be ascribed to a lack of that
specific mRNA and not to degradation of the pool of mRNA or failure
of the reverse transcription reaction.
[0357] The polymerase chain reaction, or PCR, is then performed as
previously described (Mullis and Faloona, 1987, Methods Enzymol.,
155: 335-350, herein incorporated by reference). PCR, which uses
multiple cycles of DNA replication catalyzed by a thermostable,
DNA-dependent DNA polymerase to amplify the target sequence of
interest, is well known in the art.
[0358] Oligonucleotide primers useful according to the invention
are single-stranded DNA or RNA molecules that are hybridizable to a
nucleic acid template to prime enzymatic synthesis of a second
nucleic acid strand. The primer is complementary to a portion of a
target molecule present in a pool of nucleic acid molecules used in
the preparation of sets of arrays of the invention. It is
contemplated that such a molecule is prepared by synthetic methods,
either chemical or enzymatic. Alternatively, such a molecule or a
fragment thereof is naturally-occurring, and is isolated from its
natural source or purchased from a commercial supplier.
Oligonucleotide primers are 15 to 100 nucleotides in length,
ideally from 20 to 40 nucleotides, although oligonucleotides of
different length are of use.
[0359] Typically, selective hybridization occurs when two nucleic
acid sequences are substantially complementary (at least about 65%
complementary over a stretch of at least 14 to 25 nucleotides,
preferably at least about 75%, more preferably at least about 90%
complementary). See Kanehisa, M., 1984, Nucleic Acids Res. 12: 203,
incorporated herein by reference. As a result, it is expected that
a certain degree of mismatch at the priming site is tolerated. Such
mismatch may be small, such as a mono-, di- or tri-nucleotide.
Alternatively, it may encompass loops, which we define as regions
in which mismatch encompasses an uninterrupted series of four or
more nucleotides.
[0360] Overall, five factors influence the efficiency and
selectivity of hybridization of the primer to a second nucleic acid
molecule. These factors, which are (i) primer length, (ii) the
nucleotide sequence and/or composition, (iii) hybridization
temperature, (iv) buffer chemistry and (v) the potential for steric
hindrance in the region to which the primer is required to
hybridize, are important considerations when non-random priming
sequences are designed.
[0361] There is a positive correlation between primer length and
both the efficiency and accuracy with which a primer will anneal to
a target sequence; longer sequences have a higher melting
temperature (TM) than do shorter ones, and are less likely to be
repeated within a given target sequence, thereby minimizing
promiscuous hybridization. Primer sequences with a high G-C content
or that comprise palindromic sequences tend to self-hybridize, as
do their intended target sites, since unimolecular, rather than
bimolecular, hybridization kinetics are generally favored in
solution; at the same time, it is important to design a primer
containing sufficient numbers of G-C nucleotide pairings to bind
the target sequence tightly, since each such pair is bound by three
hydrogen bonds, rather than the two that are found when A and T
bases pair. Hybridization temperature varies inversely with primer
annealing efficiency, as does the concentration of organic
solvents, e.g. formamide, that might be included in a priming
reaction or hybridization mixture, while increases in salt
concentration facilitate binding. Under stringent annealing
conditions, longer hybridization probes (of use, for example, in
Northern analysis) or synthesis primers hybridize more efficiently
than do shorter ones, which are sufficient under more permissive
conditions. Stringent hybridization conditions typically include
salt concentrations of less than about 1M, more usually less than
about 500 mM and preferably less than about 200 mM. Hybridization
temperatures range from as low as 0.degree. C. to greater than
22.degree. C., greater than about 30.degree. C., and (most often)
in excess of about 37.degree. C. Longer fragments may require
higher hybridization temperatures for specific hybridization. As
several factors affect the stringency of hybridization, the
combination of parameters is more important than the absolute
measure of a single factor.
[0362] Primers are designed with these considerations in mind.
While estimates of the relative merits of numerous sequences may be
made mentally by one of skill in the art, computer programs have
been designed to assist in the evaluation of these several
parameters and the optimization of primer sequences. Examples of
such programs are "PrimerSelect" of the DNAStar.TM. software
package (DNAStar, Inc.; Madison, Wis.) and OLIGO 4.0 (National
Biosciences, Inc.). Once designed, suitable oligonucleotides are
prepared by a suitable method, e.g. the phosphoramidite method
described by Beaucage and Carruthers (1981, Tetrahedron Lett., 22:
1859-1862) or the triester method according to Matteucci et al.
(1981, J. Am. Chem. Soc., 103: 3185), both incorporated herein by
reference, or by other chemical methods using either a commercial
automated oligonucleotide synthesizer or VLSIPS.TM. technology.
[0363] PCR is performed using template DNA (at least 1 fg; more
usefully, 1-1000 ng) and at least 25 pmol of oligonucleotide
primers; it may be advantageous to use a larger amount of primer
when the primer pool is heavily heterogeneous, as each sequence is
represented by only a small fraction of the molecules of the pool,
and amounts become limiting in the later amplification cycles. A
typical reaction mixture includes: 2 .mu.l of DNA, 25 pmol of
oligonucleotide primer, 2.5 .mu.l of 10.times.PCR buffer 1
(Perkin-Elmer, Foster City, Calif.), 0.4 .mu.l of 1.25 .mu.M dNTP,
0.15 .mu.l (or 2.5 units) of Taq DNA polymerase (Perkin Elmer,
Foster City, Calif.) and deionized water to a total volume of 25
.mu.l. Mineral oil is overlaid and the PCR is performed using a
programmable thermal cycler.
[0364] The length and temperature of each step of a PCR cycle, as
well as the number of cycles, is adjusted in accordance to the
stringency requirements in effect. Annealing temperature and timing
are determined both by the efficiency with which a primer is
expected to anneal to a template and the degree of mismatch that is
to be tolerated; obviously, when nucleic acid molecules are
simultaneously amplified and mutagenized, mismatch is required, at
least in the first round of synthesis. In attempting to amplify a
population of molecules using a mixed pool of mutagenic primers,
the potential for loss, under stringent (high-temperature)
annealing conditions, of products that would only result from low
melting temperatures is weighed against the promiscuous annealing
of primers to sequences other than the target site. The ability to
optimize the stringency of primer annealing conditions is well
within the knowledge of one of moderate skill in the art. An
annealing temperature of between 30.degree. C. and 72.degree. C. is
used. Initial denaturation of the template molecules normally
occurs at between 92.degree. C. and 99.degree. C. for 4 minutes,
followed by 20-40 cycles consisting of denaturation (94-99.degree.
C. for 15 seconds to 1 minute), annealing (temperature determined
as discussed above; 1-2 minutes), and extension (72.degree. C. for
1 minute). Final extension is generally for 4 minutes at 72.degree.
C., and maybe followed by an indefinite (0-24 hour) step at
4.degree. C.
[0365] Several techniques for detecting PCR products quantitatively
without electrophoresis may be advantageously used with the assay
of the invention in order to make it more suitable for easy
clinical use. One of these techniques, for which there are
commercially available kits such as Taqman.TM. (Perkin Elmer,
Foster City, Calif.), is performed with a transcript-specific
antisense probe. This probe is specific for the PCR product (e.g. a
nucleic acid fragment derived from an NF.kappa.B-inducible gene)
and is prepared with a quencher and fluorescent reporter probe
complexed to the 5' end of the oligonucleotide. Different
fluorescent markers can be attached to different reporters,
allowing for measurement of two products in one reaction. When Taq
DNA polymerase is activated, it cleaves off the fluorescent
reporters by its 5'-to-3' nucleolytic activity. The reporters, now
free of the quenchers, fluoresce. The color change is proportional
to the amount of each specific product and is measured by
fluorometer; therefore, the amount of each color can be measured
and the RT-PCR product can be quantified. The PCR reactions can be
performed in 96 well plates so that samples derived from many
individuals can be processed and measured simultaneously. The
Taqman.TM. system has the additional advantage of not requiring gel
electrophoresis and allows for quantification when used with a
standard curve.
[0366] Detection of NF.kappa.B-directed transcripts may
advantageously be performed in a single tube reaction for reverse
transcription of RNA and specific amplification of transcripts of
interest. This system utilizes two enzymes, AMV reverse
transcriptase to prepare first strand cDNA, and the thermostable
Tfl DNA polymerase for second strand cDNA synthesis and subsequent
DNA amplification, with an optimized single buffer system that
permits RT-PCR to be performed in one step, simplifying the assay
and minimizing the chance for contamination during preparation of a
separate PCR reaction. Commercial kits such as the Access.TM.
RT-PCR system (Promega; Madison, Wis.) conveniently assemble all
materials (except primers) necessary to carry out the method in
this way. The single-tube RT-PCR assay according to this technique
may be used to assay serum- or other samples.
[0367] Alternatively, it is possible to use an enzyme such as rTth
polymerase (Perkin Elmer, Foster City, Calif.) that has reverse
transcriptase activity in the presence of Mn2+ and has DNA
polymerase function at higher temperatures (Juhasz et al., 1996,
BioTechniques, 20: 592-600). Such an enzyme system allows for
single tube and single enzyme RT-PCR. PCR product detection has
been performed both by polyacrylamide gel electrophoresis and
ethidium bromide staining and also by performing the PCR reaction
in a 96-well plate in combination with a fluorescent detection
system such as the one described above. Utilization of such a
fluorescent detection system in the one-tube system allows for the
simple addition of RNA to a well containing the buffer, enzymes,
dNTPs, primers and the detection probe followed by RT-PCR and
luminescent reading. The sensitivities of these systems are equal
or superior to standard two-tube methods (Chehadeh et al., 1995,
BioTechniques, 18: 26-28; Sellner et al., 1992, Nucleic Acids Res.,
20: 1487-1490; Juhasz et al., supra), although there is no excess
cDNA available for amplification of multiple transcripts.
[0368] Alternatively, in situ detection of mRNA transcripts may be
performed using either `squashed` cellular material or to sectioned
tissue samples affixed to glass surfaces, prepared as described
below. Either paraffin-, plastic- or frozen (Serrano et al., 1989,
Dev. Biol. 132: 410-418) sections are used in the latter case.
Following preparation of either squashed or sectioned tissue, the
RNA molecules of the sample are reverse-transcribed in situ. In
order to contain the reaction on the slide, tissue sections are
placed on a slide thermal cycler (e.g. Tempcycler II; COY Corp.,
Grass Lake, Mich.) with heating blocks designed to accommodate
glass microscope slides. Stainless steel or glass (Bellco Glass
Inc.; Vineland, N.J.) tissue culture cloning rings approximately
0.8 cm (inner diameter).times.1.0 cm in height are placed on top of
the tissue section. Clear nail polish is used to seal the bottom of
the ring to the tissue section, forming a vessel for the reverse
transcription and subsequent localized in situ amplification (LISA)
reaction (Tsongalis et al., 1994, Clinical Chemistry, 40: 38
1-384).
[0369] Reverse transcription is carried out using reverse
transcriptase, (e.g. avian myoblastosis virus reverse
transcriptase, AMV-RT; Life Technologies/Gibco-BRL or Moloney
Murine Leukemia Virus reverse transcriptase, M-MLV-RT, New England
Biolabs, Beverly, Mass.) under the manufacturer's recommended
reaction conditions. For example, the tissue sample is rehydrated
in the reverse transcription reaction mix, minus enzyme, which
contains 50 mM Tris-HCl (pH 8.3), 8 mM MgCl2, 10 mM dithiothreitol,
1.0 mM each dATP, dTTP, dCTP and dGTP and 0.4 mM oligo-dT (12- to
18-mers). The tissue sample is, optionally, rehydrated in
RNAase-free TE (10 mM Tris-HCl, pH 8.3 and 1 mM EDTA), then drained
thoroughly prior to addition of the reaction buffer. To denature
the RNA molecules, which may have formed some double-stranded
secondary structures, and to facilitate primer annealing, the slide
is heated to 65.degree. C. for 1 minute, after which it is cooled
rapidly to 37.degree. C. After 2 minutes, 500 units of M-MLV-RT are
added the mixture, bringing the total reaction volume to 100 .mu.l.
The reaction is incubated at 37.degree. C. for one hour, with the
reaction vessel covered by a microscope cover slip to prevent
evaporation.
[0370] Following reverse transcription, reagents are pipetted out
of the containment ring structure, which is rinsed thoroughly with
TE buffer in preparation for amplification of the resulting cDNA
molecules.
[0371] The amplification reaction is performed in a total volume of
25 .mu.l, which consists of 75 ng of both the forward and reverse
primers (for example the mixed primer pools 1 and 2 of Example 6)
and 0.6 U of Taq polymerase in a reaction solution containing, per
liter: 200 mmol of each deoxynucleotide triphosphate, 1.5 mmol of
MgCl.sub.2, 67 mmol of Tris-HCl (pH 8.8), 10 mmol of
2-mercaptoethanol, 16.6 mmol of ammonium sulfate, 6.7 .mu.mol of
EDTA, and 10 .mu.mol of digoxigenin-11-dUTP. The reaction mixture
is added to the center of the cloning ring, and layered over with
mineral oil to prevent evaporation before slides are placed back
onto the slide thermal cycler. DNA is denatured in situ at
94.degree. C. for 2 min prior to amplification. LISA is
accomplished by using 20 cycles, each consisting of a 1-minute
primer annealing step (55.degree. C.), a 1.5-min extension step
(72.degree. C.), and a 1-min denaturation step (94.degree. C.).
These amplification cycle profiles differ from those used in tube
amplification to preserve optimal tissue morphology, hence the
distribution of reverse transcripts and the products of their
amplification on the slide.
[0372] Amplified products containing incorporated
digoxigenin-11-dUTP are detected with a modification of the
protocol supplied with the Genius 1 kit (Boehringer Mannheim
Biochemicals; Indianapolis, Ind.), which is briefly summarized as
follows: Following amplification, the oil layer and reaction mix
are removed from the tissue sample, which is then rinsed with
xylene. All solutions and reactions are at room temperature. The
containment ring is removed with acetone, and the tissue containing
the amplified cDNA is rehydrated by washing three times in
approximately 0.5 ml of buffer 1(100 mM Tris-Cl (pH 7.5) and 150 mM
NaCl) and then incubated for 30 minutes in 0.5 ml of buffer 2 (5 ml
blocking reagent per liter of buffer 1) in a humidified chamber.
Subsequently, the slides bearing the tissue samples are rinsed with
0.5 ml of buffer 1 and incubated for 1 hour with a 1:100 dilution
of antibody (alkaline phosphatase-conjugated anti-digoxigenin;
Boehringer Mannheim) in a humidified chamber. Excess antibody is
removed by three washes in buffer 3(100 mM Tris HCl, 100 mM NaCl,
50 mM MgCl2, pH 9.5) before the addition of the chromogen
(nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl
phosphate). The detection reaction is monitored for optimal
staining (.about.10-25 minutes) and stopped by rinsing three times
in buffer 4 (10 mM Tris.HCl, 1 mM EDTA, pH 8.0). The tissues are
then dehydrated in a series of graded alcohols and stained with
eosin before coverslips are applied; negative control slides are
also stained at this time. Samples are then examined by light
microscopy and photographed.
[0373] Other measures of restored function include testing of cells
for normal mitotic activity, cell viability, cell growth, restored
differentiation, normal cell cycle progression and increased
protection afforded by NF.kappa.B.
[0374] Immunological Methods
[0375] i. Preparation of Antibodies
[0376] Either recombinant proteins or those derived from natural
sources can be used to generate antibodies using standard
techniques, well known to those in the field. For example, the
proteins are administered to challenge a mammal such as a monkey,
goat, rabbit or mouse. The resulting antibodies can be collected as
polyclonal sera, or antibody-producing cells from the challenged
animal can be immortalized (e.g. by fusion with an immortalizing
fusion partner) to produce monoclonal antibodies.
[0377] 1. Polyclonal Antibodies.
[0378] The antigen protein may be conjugated to a conventional
carrier in order to increases its immunogenicity, and an antiserum
to the peptide-carrier conjugate is raised. Coupling of a peptide
to a carrier protein and immunizations may be performed as
described (Dymecki et al., 1992, J. Biol. Chem., 267: 48-15-4823).
The serum is titered against protein antigen by ELISA (below) or
alternatively by dot or spot blotting (Boersma and Van Leeuwen,
1994, J. Neurosci. Methods, 51: 317). At the same time, the
antiserum may be used in tissue sections prepared as described
below. The serum is shown to react strongly with the appropriate
peptides by ELISA, for example, following the procedures of Green
et al., 1982, Cell, 28: 477-487.
[0379] 2. Monoclonal Antibodies.
[0380] Techniques for preparing monoclonal antibodies are well
known, and monoclonal antibodies may be prepared using a candidate
antigen whose level is to be measured or which is to be either
inactivated or affinity-purified, preferably bound to a carrier, as
described by Amheiter et al., Nature, 294, 278-280 (1981).
[0381] Monoclonal antibodies are typically obtained from hybridoma
tissue cultures or from ascites fluid obtained from animals into
which the hybridoma tissue was introduced. Nevertheless, monoclonal
antibodies may be described as being "raised to" or "induced by" a
protein.
[0382] Monoclonal antibody-producing hybridomas (or polyclonal
sera) can be screened for antibody binding to the target protein.
By antibody, we include constructions using the binding (variable)
region of such an antibody, and other antibody modifications. Thus,
an antibody useful in the invention may comprise a whole antibody,
an antibody fragment, a polyfunctional antibody aggregate, or in
general a substance comprising one or more specific binding sites
from an antibody. The antibody fragment may be a fragment such as
an Fv, Fab or F(ab1)2 fragment or a derivative thereof, such as a
single chain Fv fragment. The antibody or antibody fragment may be
non-recombinant, recombinant or humanized. The antibody may be of
an immunoglobulin isotype, e.g., IgG, IgM, and so forth. In
addition, an aggregate, polymer, derivative and conjugate of an
immunoglobulin or a fragment thereof can be used where
appropriate.
[0383] ii. Detection Methods
[0384] Particularly preferred immunological tests rely on the use
of either monoclonal or polyclonal antibodies and include
enzyme-linked immunoassays (ELISA), immunoblotting and
immunoprecipitation (see Voller, 1978, Diagnostic Horizons, 2: 1-7,
Microbiological Associates Quarterly Publication, Walkersville,
Md.; Voller et al., 1978, J. Clin. Pathol., 31: 507-520; U.S.
Reissue Pat. No. 31,006; UK Patent 2,019,408; Butler, 1981, Methods
Enzymol., 73: 482-523; Maggio, E. (ed.), 1980, Enzyme Immunoassay,
CRC Press, Boca Raton, Fla.) or radioimmunoassays (RIA) (Weintraub,
B., Principles of radioimmunnassays, Seventh Training Course on
Radioligand Assay Techniques, The Endocrine Society, March 1986,
pp. 1-5, 46-49 and 68-78). For analyzing tissues for the presence
or absence of a protein in the present invention,
immunohistochemistry techniques may be used. Tissue samples to be
assayed by these methods are prepared as described below. It will
be apparent to one skilled in the art that the antibody molecule
will have to labeled to facilitate easy detection of a target
protein. Techniques for labeling antibody molecules are well known
to those skilled in the art (see Harlour and Lane, 1989,
Antibodies, Cold Spring Harbor Laboratory, pp. 1-726).
[0385] Alternatively, other techniques can be used to detect the
target proteins, including chromatographic methods such as SDS
PAGE, isoelectric focusing, Western blotting, HPLC and capillary
electrophoresis.
[0386] Preparation of Histological Samples
[0387] Tissue samples intended for use in in situ detection of
either RNA or protein are fixed using conventional reagents; such
samples may comprise whole or squashed cells, or may instead
comprise sectioned tissue. Fixatives adequate for such procedures
include, but are not limited to, formalin, 4% paraformaldehyde in
an isotonic buffer, formaldehyde (each of which confers a measure
of RNAase resistance to the nucleic acid molecules of the sample)
or a multi-component fixative, such as FAAG (85% ethanol, 4%
formaldehyde, 5% acetic acid, 1% EM grade glutaraldehyde). Note
that for RNA detection, water used in the preparation of an aqueous
component of a solution to which the tissue is exposed until it is
embedded is RNAase-free, i.e. treated with 0.1% diethylprocarbonate
(DEPC) at room temperature overnight and subsequently autoclaved
for 1.5 to 2 hours. Tissue is fixed at 4.degree. C., either on a
sample roller or a rocking platform, for 12 to 48 hours in order to
allow fixative to reach the center of the sample.
[0388] Prior to embedding, samples are purged of fixative and
dehydrated; this is accomplished through a series of two- to
ten-minute washes in increasingly high concentrations of ethanol,
beginning at 60%- and ending with two washes in 95%- and another
two in 100% ethanol, followed two ten-minute washes in xylene.
Samples are embedded in one of a variety of sectioning supports,
e.g. paraffin, plastic polymers or a mixed paraffin/polymer medium
(e.g. Paraplast.RTM.Plus Tissue Embedding Medium, supplied by
Oxford Labware). For example, fixed, dehydrated tissue is
transferred from the second xylene wash to paraffin or a
paraffin/polymer resin in the liquid-phase at about 58.degree. C.,
then replace three to six times over a period of approximately
three hours to dilute out residual xylene, followed by overnight
incubation at 58.degree. C. under a vacuum, in order to optimize
infiltration of the embedding medium in to the tissue. The next
day, following several more changes of medium at 20 minute to one
hour intervals, also at 58.degree. C., the tissue sample is
positioned in a sectioning mold, the mold is surrounded by ice
water and the medium is allowed to harden. Sections of 6 .mu.m
thickness are taken and affixed to `subbed` slides, which are those
coated with a proteinaceous substrate material, usually bovine
serum albumin (BSA), to promote adhesion. Other methods of fixation
and embedding are also applicable for use according to the methods
of the invention; examples of these are found in Humason, G. L.,
1979, Animal Tissue Techniques, 4th ed. (W.H. Freeman & Co.,
San Francisco), as is frozen sectioning (Serrano et al., 1989,
supra).
[0389] Assessment of the efficacy of disease treatment according to
the invention
[0390] In addition to direct measurements of protein or nucleic
acid levels in target cells resulting from the specific composition
administered by the methods of the present invention, it is
possible to monitor changes in the disease state in patients
receiving therapy to enhance NF.kappa.B activity and compare them
to the progression or persistence of disease in control patients
who are treated with placebos (i.e. a pharmaceutically-acceptable
carrier without the therapeutic nucleic acid, protein or other
agent).
[0391] In treating autoimmune diseases according to the invention,
it is possible to deliver one or more of a number of
therapeutically-relevant nucleic acids proteins or other substances
to cells or a recipient individual. A sampling of genes and/or
proteins that might be of use is provided above. Following
administration of the chosen composition, an improved rate of
improvement in diagnostic clinical indicators (e.g. insulin or
blood sugar level in the case of diabetes) in those patients
receiving the therapeutic gene(s), protein(s) or other agent(s)
relative to those who do not is indicative of efficacious disease
treatment using the methods of the invention.
[0392] The progression of autoimmune disorders may be slowed or
reversed according to the methods of the invention. Treatment of an
autoimmune disorder using the invention may be judged advantageous
if the loss of tissue or function thereof in patients so treated is
slowed or halted relative to untreated control individuals; for
example, the p50 and/or the p65 gene, which encode the p50 and p65
subunits of NF.kappa.B, may be administered in vivo (e.g., by
systemic or localized injection) or ex vivo into cells which are
subsequently transplanted into a clinical patient, and the
recipient patient monitored for elimination of tissue or functional
loss, or a reduction in such loss sufficient to result in
noticeable improvement in health.
EXAMPLE 1
[0393] In this Example, the role that phosphorylation of
NF.kappa.Bp65 by cyclin-dependent kinase (Cdk) might play in the
maturation of lymphocytes in the immune system is assessed, as is
the possibility that this NF.kappa.Bp65 activation step links
defective lymphocyte development to diabetes in the NOD mouse
model.
[0394] To demonstrate an association of NF.kappa.Bp65 with a cell
cycle development regulator protein involved in Cdk/Cyclin
coupling, a glutathione-5-transferase (GST) NF.kappa.Bp65 fusion
protein was utilized in an affinity purification protocol.
GST-NF.kappa.Bp65 fusion proteins, wild type NF.kappa.Bp65 or
deletion mutants, NF.kappa.Bp65 Q417 and NF.kappa.Bp65 C418 were
constructed and characterized. GST-carboxy-terminal domain (CTD) of
RNA polymerase II large subunit fusion proteins were also
constructed and utilized as the substrate of kinase assay. Genes
encoding the carboxy-terminal domain (CTD) of RNA polymerase II
large subunit or either wild-type- or mutant NF.kappa.B subunit p65
were inserted into the pGEX2T fusion-protein expression vector
(Pharmacia; Uppsala, Sweden) by molecular biology techniques which
are well known in the art (see Sambrook et al., 1989, supra). The
GST-CTD or GST-NF.kappa.Bp65 proteins were expressed in E. coli
strain BL21 (DE3) LysS. Cultures (50 ml) were grown overnight at
37.degree. C.; the next day, the resulting stationary-phase
cultures were diluted 1:100 with fresh LB medium containing
ampicillin (100 .mu.g/ml) and grown until A600=0.6 optical density
units (O.D.U.) at 30.degree. C. Production of GST-CTD or
GST-NF.kappa.Bp65 fusion proteins encoded by genes under control of
the Ptac promoter was then induced for 3 hours with
isopropyl-thio-P-D-galactoside (IPTG; an inducer which causes
derepression of transcription and subsequent GST fusion protein
expression) at a final concentration of 0.4 mM. The cultures were
collected by centrifugation and the bacterial pellets are
resuspended in 4 ml PBS (150 mM NaCl, 16 mM Na2HPO4,4 mM NaH2PO4)
with 5 mM DTT. The GST-CTD and GST-NF.kappa.Bp65 fusion proteins
were purified from the lysate by binding to glutathione-Sepharose
beads (Pharmacia).
[0395] Phosphorylation is a common mechanism of regulating proteins
involved in cell cycle and transcription and CTD of mammals
consists of 52 identical copies of the heptapeptide sequence
Tyr-Ser-Pro-Thr-Pro-Ser. To investigate if phosphorylation of
NF.kappa.Bp65 might be mediated through a cellular protein kinase,
we looked for an association of NF.kappa.Bp65 with a cellular
protein kinase. Nuclear and cytosolic extracts were prepared from a
human T-cell lymphoma cell line, Molt-4; note that the preparation
protocol is identical to that used to prepare protein extracts from
spleen tissue removed from six-week-old male and female NOD mice
(see below). Cells were harvested, centrifuged for 15 minutes at
3000 rpm, washed in 10 ml of ice-cold PBS and collected by
centrifugation for 15 minutes at 3000 rpm. The pelleted cells were
resuspended in 4 ml of buffer A (10 mM Hepes, pH 7.8; 10 mM KCl; 2
mM MgCl2 1 mM DTT; 0.1 mM EDTA; 0.1 mM PMSF) and incubated on ice
for 15 min. Then 250 .mu.l of 10% Nonidet P-40 solution (Sigma; St.
Louis, Mo.) were added and cells were vigorously mixed and
incubated for 30 minutes at 4.degree. C. The harvested cells were
centrifuged for 15 mm at 3000 rpm. The resulting supernatant
comprised the cytosolic fraction, and is herein referred to as the
"cytosol extract". Pelleted nuclei were resuspended in 1500 .mu.l
of buffer C (50 mM Hepes, pH 7.8; 50 mM KCl; 300 mM NaCl; 0.1 mM
EDTA; 1 mM DTT; 0.1 mM PMSF; 10% (v/v) glycerol), mixed for 30
minutes and centrifuged for 15 minutes at 3000 rpm at 4.degree. C.
The supernatant obtained at this step contained the nuclear
proteins; hence, this supernatant is herein referred to as the
"nuclear extract". The concentration of protein was 20
.mu.g/.mu.l.
[0396] GST-NF.kappa.Bp65 and GST-CTD were expressed in BL21 pLysS
E. Coli cells and purified by selective absorption to glutathione
sepharose beads. GST-NF.kappa.Bp65 was incubated with Molt-4
cytosolic and nuclear extracts, prepared as described above.
Reaction mixtures were washed in PBS. The precipitated complexes
were then incubated with GST-CTD of RNA polymerase II large subunit
in kinase buffer containing .gamma.-[32P]ATP as previously
described (Hayashi et al., 1993, J. Biol. Chem., 268: 26790-26795;
Faustman et al., 1989, Diabetes, 38: 1462-1468). One-fortieth of
the input (I) and supernatant (S) fractions and {fraction (1/40)}
of the last wash (W) and pellet (P) fractions were used for in
vitro kinase reaction. Protein complexes were collected by brief
centrifugation, washed and then incubated with GST-CTD substrates
in kinase buffer containing .gamma.-32P ATP. The products of the in
vitro kinase reactions were then analyzed on SDS-PAGB. A protein of
approximately 90 kD was phosphorylated in the in vitro kinase
reaction (FIG. 1A). The 90 kDa phosphorylated protein was dependent
upon the presence of GST-CTD in the reaction mixtures (FIG. 1B). As
FIG. 1 shows, both GST-NF.kappa.Bp65/protein complexes associated
with cellular protein kinases which may phosphorylate a CTD. The
prime nucleoside analog,
5,6-dichloro-1-.beta.-D-ribofuranosylbenzimidazole (DRB) can
inhibit the activity of cellular kinases (Marciniak and Sharp,
1991, EMBO J., 10: 4189-4196). To determine whether the kinase
activity of NF.kappa.Bp65-associated protein kinase were sensitive
to DRB, the ability of DRB to inhibit the kinase activity of
NF.kappa.Bp65 association protein kinase was tested by examining
the phosphorylation of CTD in the presence of different
concentrations of DRB. In vitro kinase assays were carried out and
phosphorylated GST-CTD products were separated by SDS-PAGE and
visualized by autoradiography. Quantitation of the gel shown in
FIG. 1C with an image analyzer (a BAS 3000 phosphorimager) was
plotted on a graph. The concentrations of DRB indicated in the
figure were included in the respective kinase reaction mixtures.
From these data, it is apparent that the kinase activities of
NF.kappa.Bp65-associated protein kinases (cytosolic and nuclear)
were sensitive to DRB in a dose-dependent manner. The
concentrations of DRB required for 50% inhibition of the activity
of NF.kappa.Bp65-associated protein kinase were 10 .mu.M
(cytosolic) and 1 .mu.M (nuclear) (FIG. 1C).
[0397] To confirm that general inhibition of kinase activity was
not responsible for the observed results, the sensitivity of
NF.kappa.Bp65-associated protein kinase to DRB was also tested with
casein, which has multiple phosphorylation sites, as the substrate.
There was a difference in the biochemical character of
NF.kappa.Bp65 association protein kinase between cytosol and
nuclear. In that NF.kappa.cBp65 may associate with different
protein kinases in the cytosol and the nucleus (cytosol; band A and
nuclear; band B), the target amino acid residues on the CTD
substrate molecule were determined by phosphoamino acid analysis
(see Baeuerle and Baltimore, 1996, supra). In brief, 32P-labeled
GST-CTD fusion proteins were eluted from wet gels and precipitated
with trichloroacetic acid, hydrolyzed for 2 hours in 200 .mu.l of 6
M HCl boiling constantly at 110.degree. C. and then dried. The
samples were resuspended in formic acid/acetic acid buffer (pH 1.9)
and spotted onto a glass-backed silica gel plate. These samples,
along with 2 .mu.l each of unlabeled phosphoamino acids
(phosphoserine, phosphothreonine and phosphotyrosine; Sigma) as
internal markers, were analyzed by thin-layer electrophoresis at pH
1.9. Phosphoamino acids were visualized by autoradiography. The
results, shown in FIG. 1D revealed that only serine residues in the
CTD were phosphorylated, indicating that serine or serine/threonine
kinases may associate with NF.kappa.Bp65.
[0398] To identify the domain on NF.kappa.Bp65 molecule which is
essential for the recognition by cellular serine and/or
serine/threonine kinases, in vitro kinase assays were performed
using other deletion mutants, GST-NF.kappa.Bp65 Q417 and -C418. In
vitro and in vivo studies indicate that the p65 subunit of
NF-.kappa.B is responsible primarily for transcriptional activation
by NF-.kappa.B, and a potent transactivation domain has been mapped
to a carboxyl-terminal region of p65 that is not shared with p50
(Verma et al., 1995, supra; Baeuerle and Baltimore, 1996, supra;
Schmitz and Baeuerle, 1991, EMBO J., 10: 3805-3817; Fujita et al.,
1992, Genes Dev., 6: 775-787; Kerr et al., 1993, Nature, 365:
412-419; Pazin et al., 1996, Genes Dev., 10: 37-49 33-36).
Therefore, it was of interest to determine whether the
transactivation domain of NF.kappa.Bp65 were sufficient for the
activity of NF.kappa.Bp65-associated protein kinases, or it other
elements were required. GST-NF.kappa.Bp65 Q417 represents the
deleted transactivation domain of NF-.kappa.Bp65, while
GST-NF.kappa.Bp65 C418 is the GST-trans-activation domain only of
NF.kappa.Bp65. CTD phosphoiylation activities were generated
strongly in in vitro kinase reaction using GST-NF.kappa.Bp65
C418/nuclear protein complexes, but kinase activity was only mildly
detected in GST-NF.kappa.Bp65 C418/cytosolic protein complexes
(FIG. 1E), suggesting that the transactivation domain of
NF.kappa.Bp65 is required for high-affinity kinase binding. The
results of signal quantitation of the gel shown in FIG. 1E (again
performed using a BAS 3000 phosphorimager) were plotted on a graph.
The difference in the binding properties of NF.kappa.Bp65 to
protein kinases in the cytosol and the nucleus suggests that
NFKBp65 associates with different protein kinases in these two
regions of the cell.
[0399] To further characterize the kinase activities of the
proteins represented by cytosolic band A and nuclear band B in FIG.
1D, azide ATP UV-crosslinking assays were performed as previously
described (Hayashi et al., 1993, supra). In short, ATP
affinity-labeling was performed on complexes immunoprecipitated by
an anti-NF.kappa.Bp65 polyclonal antibody (Santa Cruz
Biotechnology, Inc.; CA) or instead on purified GST-NF.kappa.B
fusion proteins (wild-type and C417). The protein complexes were
incubated with 10 .mu.Ci of 8-azide-.alpha.[32P]ATP in kinase
buffer at 37.degree. C. for 30 minutes. The samples were placed 5
cm distant from a UV lamp (wavelength=254 mm) and irradiated on ice
for 30 minutes. After addition of 10 .mu.l of sampling buffer (2.5%
SDS, 0.65 mM DTT, 0.5 M sucrose) for SDS-polyacrylamide gel
electrophoresis (SDS-PAGE), the ATP-binding proteins were separated
on a 12.5% SDS-PAGE and visualized by autoradiography.
[0400] The results are shown in FIG. 2. ATP-binding proteins of
different molecular weights were detected in these assays. Single
bands representing 53 kD and 50 kD proteins with ATP binding
activities were detected in the cytosolic and nuclear samples,
respectively (FIG. 2).
[0401] It is possible that the 50 kD nuclear ATP-binding protein
associates with NF.kappa.B and can phosphorylate CTD, because the
observed ATP binding proteins appeared as single bands in the in
vitro ATP-binding assay. The cytosolic 53 kD protein recognized
both wild-type and deletion mutant C418 NF.kappa.Bp65 proteins and
phosphorylated CTD. To verify these findings, similar ATP binding
assays were performed with protein complexes immunoprecipitated
from cytoslic and nuclear extracts using an anti-NF.kappa.Bp65
polyclonal antibody. The proteins UV-crosslinked with
8-azide-.alpha.-[32P] ATP were separated by SDS-PAGE and
visualized. The 53 kD (cytosolic) and 50 kD (nuclear) protein bands
were again detected. Co-immunoprecipitation of these proteins with
the NF.kappa.Bp65 from cytosolic and nuclear extracts metabolically
labeled with [35S]-methionone and [35S]-cysteine was also
attempted; the results suggest that serine or serine/threonine
kinases of 53 kD (cytosolic) and 50 kD (nuclear) can associate with
NF-.kappa.Bp65 (data not shown).
[0402] HIV-1 Tat protein is a trans-activator that selectively
activates transcription in vivo and in vitro experiments. Recent in
vitro studies indicate that Tat activates the CTD phosphorylation
activity (Parada and Roeder, 1996, Nature, 384: 375-378). The
ability of Tat to activate CTD phosphorylation activities of the
protein kinases associated with NF.kappa.Bp65 was tested by in
vitro kinase assays in which the concentration of Tat in reaction
mixture was varied. As shown in FIG. 3, CTD phosphorylation was
activated strongly by wild-type Tat in a dose-dependent manner;
however, no such activation was observed when the Tat mutant
proteins K41A or Cys22 were assayed. Signal quantitation of the gel
shown in FIG. 3A was performed as described above, and the results
were plotted on a graph (FIG. 3B). When wild-type Tat was included
in the kinase reaction mixure, CTD phosphorylation by the nuclear
kinase associated with NF.kappa.Bp65 was induced 15- and 25-fold
more strongly than in the absence of Tat. On the other hand, CTD
phosphorylation activity of the cytosol kinase associated with
NF.kappa.Bp65 was activated 10-fold by wild-type Tat. A
phosphorylated protein with a molecular mass of approximately 40 kD
(again, as judged by electrophoretic mobility in SDS-PAGE analysis)
was detected in the nuclear kinase reaction (FIG. 3A, lane 11). It
is likely that Tat protein was phosphorylated by
NF.kappa.cBp65-associated nuclear kinase, however the
phosphorylated form of Tat protein was not detected in the cytosol
reaction mixture. This was confirmed by the finding that different
kinases associate with NF.kappa.Bp65 in the nucleus and the
cytosol.
[0403] One may conclude that it is likely that serine or
serine/threonine kinases with apparent molecular masses of 53 kD
(cytosol) and 50 kD (nucleus) associate with NF.kappa.Bp65.
Furthermore, the activities of these kinases is inhibited by DRB in
a dose-dependent manner. These protein kinases are similar in size
to an NF.kappa.B kinase which may be cytosolic Cdk8 (Tassan et al.,
1995, Proc. Natl. Acad. Sci. U.S.A., 92: 8871-8875; Leclerc et al.,
1996, Mol. Biol. Cell, 7: 505-513; Rickert et al., 1996, Oncogene,
12: 2631-2640). To determine whether the 53 kD protein kinase is
Cdk8, Western analysis was carried out using an anti-Cdk8
polyclonal antibody and appropriate control antibodies. As shown in
FIG. 4A, anti-Cdk8 antibody recognized the 53 kD cytosolic protein
kinase associated with wild-type and C418 mutant NF.kappa.Bp65; in
addition, Cdk8 was co-immunoprecipitated with anti-NF.kappa.Bp65
(FIG. 4C). Cdk2 was found to associate only weakly with
GST-NF.kappa.Bp65; however, it complexed strongly with
GST-NF.kappa.Bp65 C418 mutant protein (FIG. 4B). Cdk2 was
co-immunoprecipitated weakly from cytosolic extracts when an
anti-NF.kappa.Bp65 polyclonal antibody was used (FIG. 4C). As
expected, TAF 250 and SP1 did not associate with either wild-type
or C418 mutant NF-.kappa.Bp65 (FIGS. 4A and 4B). No antibody
binding to proteins of nuclear extracts was observed if wild-type
GST-NF.kappa.Bp65 protein was added. Cdk8 and Cdk2 did not
co-immunoprecipitate from nuclear extracts with NF.kappa.Bp65 (FIG.
4C). From these immunoblotting results, it is apparent that
cytosolic Cdk8 can associate with NF.kappa.Bp65; however, the
association of nuclear Cdk2 NF.kappa.Bp65 was not clearly
indicated.
[0404] Type I diabetic models of autoimmunity include a murine
model, the NOD mouse. As described above, NOD mice exhibit immature
forms of T cells, B cells and macrophages in the immune system as
well as signal transduction errors. To determine whether
NF.kappa.Bp65 dysfunction plays a role in autoimmune pathogenesis,
cytosolic and nuclear extracts from normal and NOD mice were
compared in in vitro kinase assays. The mice at 5-6 weeks of age
were normoglycemic (hyperglycemic onset due to complete .beta. cell
destruction typically occurs beyond 20 weeks). Cytosolic extracts
were prepared from spleens removed from normal mice and NOD mice as
described above and elsewhere (Wu et al., 1996, supra). The
GST-NF.kappa.Bp65 fusion proteins were mixed with cytosol and
nuclear extracts purified from normal mice and NOD mice. The
protein complexes were isolated by affinity binding to
GST-Sepharose beads; after washing, the complexes were incubated
with GST-CTD substrate in a kinase buffer that included
.gamma.-[32P]ATP. In vitro kinase assay was performed using the CTD
substrate and the reaction products were analyzed by 12% SDS-PAGE.
Kinase activity was observed in normal mice, both male and female,
but was not detectable in NOD mice (FIG. 5A). To verify this
result, a more sensitive in vitro kinase assay was performed.
Rather than using crude extracts, enriched protein samples were
generated using an anti-NF.kappa.Bp65 polyclonal antibody to
immunoprecipitate NF.kappa.Bp65 comlexes from cytosolic and nuclear
extracts prepared from normal and NOD mice.
NF.kappa.Bp65-associated kinase activities were strongly evident in
normal mice; still no kinase activity was detected in NOD mice
(FIG. 5B).
[0405] To further characterize the NOD defect in NF.kappa.Bp65
phosphorylation, the specific interactions of Cdks with
NF.kappa.Bp65 were evaluated by Western analysis. Cdk8 was detected
by a polyclonal antibody directed against it, and was appropriately
associated with GST-NF.kappa.Bp65 in cytosolic extracts derived
from normal mice, while no association of NF.kappa.Bp65 with the
Cdk8 protein was observed in NOD mice (FIG. 5C). In control
extracts, Cdk2 proteins were detected weakly in
GST-NF.kappa.Bp65/protein complexes (FIG. 5C); in NOD mice, Cdk2
proteins were not associated with NF.kappa.Bp65. As expected, TAF
250 and SP1 were not associated with NF.kappa.Bp65 in control or
NOD mice (FIG. 5C, D). No antibody tested was able to bind proteins
found in nuclear extracts of either normal or NOD mice, if
wild-type GST-NF.kappa.Bp65 were added; in this case, neither Cdk8
nor Cdk2 was found to co-immunoprecipitate with NF.kappa.Bp65 in
nuclear extracts prepared from either mouse strain (FIG. 5C). The
basal expression levels of Cdk8, Cdk2, NF.kappa.Bp65, SP1 and TAF
250 did not differ between normal and NOD mice (data not shown).
From these immunoblotting results, it is evident that in cytosolic
Cdk8 can associate with NF.kappa.Bp65 in normal, but not NOD,
mice.
EXAMPLE 2
[0406] In the previous Example, the cytoplasmic activities of
NF.kappa.B were examined. In the present Example, the nuclear
activity of NF.kappa.B is explored in both normal and autoimmune
mice.
[0407] Specific binding of NF.kappa.B to its recognition sequence
on a nucleic acid molecule was assayed by electrophoretic mobility
shift analysis (EMSA). In this procedure, protein samples are
incubated with labeled nucleic acid molecules under conditions
which permit nucleic acid/protein binding for a time sufficient to
allow such binding to occur and then electrophoresed on
non-denaturing polyacrylamide gels, which are subsequently
subjected to a signal detection procedure, such as autoradiography.
A .kappa.B binding site consists of a 5' and a 3' half site, of
which may variants exists; different members of the KB protein
family (e.g. NF.kappa.B, I.kappa.B) have different degrees of
affinity for different half-sites or combinations thereof, as
reviewed by Siebenlist et al. (1994, supra). In this set of
experiments, the affinity of NF.kappa.B for two binding site
variants (denoted .kappa.B1 and .kappa.B2) is examined. Lung
extracts were used because lung tissue has a high concentration of
lung-antigen-presenting cells, and thus would be expected to have
high levels of active NF .kappa.B. BALB/c mice display high levels
of NF.kappa.B activity in the lymphoid cells of the lung. Nuclear
extracts and cytosolic extracts were prepared from human T-cell
lymphoma Molt-4 cells, as well as lung and spleen tissue removed
from six-week-old BALB/c (normal) and NOD autoimmune mice, both
male and female. Lung, spleen and cultured cells were harvested,
centrifuged for 15 minutes at 3000 rpm, washed in 10 ml of ice-cold
PBS and collected by centrifugation for 15 minutes at 300 rpm. The
pelleted cells were resuspended in 4 ml of buffer A (10 mM Hepes,
pH 7.8; 10 mM KCl; 2 mM MgCl2 1 mM DTT; 0.1 mM EDTA; 0.1 mM PMSF)
and incubated on ice for 15 minutes. Then 250 .mu.l of 10% Nonidet
P-40 solution (Sigma) were added and cells were vigorously mixed
and incubated for 30 minutes at 4.degree. C. The harvested cells
were centrifuged for 15 minutes at 3000 rpm. After centrifugation,
the supernatant comprised cytosolic proteins, and was termed the
cytosolic extract. Pelleted nuclei were resuspended in 1500 .mu.l
of buffer C (50 mM Hepes, pH 7.8; 50 mM KCl; 300 mM NaCl; 0.1 mM
EDTA; 1 mM DTT.; 0.1 mM PMSF; 10% (v/v) glycerol), mixed for 30
minutes and centrifuged for 15 mm at 300 rpm at 4.degree. C. This
supernatant contained the nuclear proteins at a concentration of 20
.mu.g/.mu.l), and was termed the nuclear extract. The nuclear lung
extracts so prepared were incubated with a 32P end-labeled
oligonucleotide containing the NF.kappa.B binding sequence
(5'-GATCTAGGGACTTTCCGCTGGGGACTTTCCAG-3' [SEQ ID NO: 1]) under
conditions which permit specific DNA/protein binding (e.g., as
below). FIG. 6A presents the results of this experiment (BALB/C
male, lanes 2-3 and female, lanes 4-5; NOD male lanes 6-7 and
female lanes 8-9; Molt-4, lane 10). The labeled DNA probe was
included in the reaction mixtures containing nuclear extracts (1.5
.mu.l lane 2, 4, 6, 8; 3.0 .mu.l lane 3, 5, 7, 9, 10) and, as a
negative control, in a reaction mixture that was free of nuclear
extract (lane 1).
[0408] As shown in FIG. 6B, the sequence-specificity of NF.kappa.B
DNA binding was determined in a competitive binding experiment.
Nuclear extracts were incubated with a labeled probe and a molar
excess of unlabeled DNA ("cold competitor" or C.C.). Lung tissue
nuclear extracts (BALB/C, left panel; NOD right panel) were
premixed with cold competitor DNA and incubated for 15 minutes on
ice before the labeled nucleic acid probe was added; the two
competitor sequences were wild-type sequence .kappa.B1:
(5'-GATCTAGGGACTTTCCGCTGGGGACTTTCCAG-3' [SEQ ID NO: 1]) was run in
lanes 3, 6, 13 and 16, while wild-type sequence .kappa.B2
(5'-GATCTCAGGGGAATCTCCCTCTCCTTTTATGGGCGTAGCG-3' [SEQ ID NO: 2]) was
run in lanes 4, 7, 14 and 17. Nuclear extracts not pre-incubated
with cold competitor were run in lanes 2, 5, 8, 9, 10, 12, 15, 18,
19 and 20. The binding reactions were performed at 37.degree. C.
for 30 minutes in a total volume of 10 .mu.l of buffer containing:
10 mM Hepes (pH 7.9), 50 mM KCl, 5 mM Tris-HCl (pH 7.0), 1 mM DTT,
15 mM EDTA, 10% (v/v) glycerol, 1.0 .mu.g of poly(dI dC) and 4 ng
of the labeled probe. The DNA-protein complexes were resoled on
nondenaturing 8% polyacrylamide gels. Electrophoresis was performed
with 0.5.times.TBE buffer (4.5 mM Tris-HCl, 4.5 mM boric acid, 0.1
mM EDTA) at 4.degree. C. Again, a negative control containing no
nuclear extract was run in lane 1.
[0409] The results of NF.kappa.B DNA binding experiments using lung
cytosolic extracts are presented in FIG. 6C. As shown, cytosolic
NF.kappa.B/I .kappa.B complexes were identified by EMSA after
treatment of cytosolic extracts with 0.8% DOC (deoxycholate) and
1.2% NP-40. Cytosol extracts were prepared as described above from
BALB/C (lanes 2-5) and NOD (lanes 6-9) mice and Molt-4 cells (lanes
10-11). These extracts either were ("+", lanes 3, 5, 7, 9 and 11)
or were not ("-", lanes 2, 4, 6, 8 and 10) pretreated with the
detergents. As above, a negative control reaction to which no
extract was added was run in lane 1.
[0410] The DNA-binding activities of transcription factors other
than NF.kappa.B were then assayed; the results of this experiment
are shown in FIG. 6D. The binding activities were examined by EMSA
using as probe an 32P end-labeled oligonucleotide containing the
SP1 recognition/binding sequence (left panel) or the AP1
recognition/binding sequence (right panel). The respective DNA
probes were incubated with nuclear extracts prepared from lung
tissue of BALB/C (male, lane 2; female, lane 3) and NOD (male, lane
4; female, lane 5) mice and Molt-4 cells (lane 6); a negative
control containing no nuclear extract was run in lane 1. In all
panels, protein-DNA complexes were indicated by arrowheads.
(M=male; F=female).
[0411] As shown in FIG. 6A, nuclear extracts from the NOD mouse do
not exhibit NF.kappa.B binding activity to a 32P-end-labeled probe;
these data indicate that NF.kappa.B activity is virtually absent in
NOD mice. The data in FIG. 6B confirm the specificity of NF.kappa.B
binding to the labeled probe shown in FIG. 6A, since the cold
competitive DNA prevented specific binding of protein from the lung
extract of BALB/c control mice to the labeled oligonucleotide. The
failure to detect active NF.kappa.B in either nuclear or
cytoplasmic extracts in the NOD mouse indicate that the phenotype
is based upon a deficiency in the activity upstream of the
transport of NF.kappa.B to the nucleus. The integrity of the
protein extracts derived from the NOD mice were confirmed in the
experiment shown in FIG. 6D, in which the DNA binding capabilities
of other transcription factors were assayed and demonstrated to be
present; since the DNA-binding activity of two other
lymphocyte-expressed transcription factors, SP1 and AP1, were found
in the NOD mouse extracts, the observed deficiency appears to be
specific to NF.kappa.B activation.
[0412] Another way of examining transcription factors and their
activity is to bind antibodies to the factors and run the complexes
on a gel. If the factor is present, the antibody will bind and thus
delay migration down the gel; such a procedure is known as a
"super-shift" assay. In the experiment shown in FIG. 7A, a labeled
DNA probe containing a KB binding sequence was incubated with
nuclear extracts prepared from lung tissue of BALB/c (lanes 1-4)
and NOD (lanes 5-8) mice and Molt-4 cells (lanes 9-10). Nuclear
extracts were pre-incubated either with--("+", even numbered lanes)
or without ("-", odd numbered lanes) an anti-p50 polyclonal
antibody, and then the labeled DNA probe was added to the reaction
mixture.
[0413] The results of a similar experiment, this time using an
anti-p65 polyclonal antibody, are presented in FIG. 7B. Again,
nuclear extracts from lung tissue of BALB/c (lanes 1-4) and NOD
mice (lanes 5-8) and Molt-4 cells (lanes 9-10) were pre-incubated
either with--("+", even number lanes) or without ("-", odd number
lane) antibody, and the labeled DNA probe was then added to the
reaction mixture.
[0414] This experiment was repeated using an antibody directed
against the CCAAT-Box Enhancer Binding Protein (C/EBP); the
identities and treatment of reaction mixtures, as well as their
positions on the gel shown in FIG. 7C are otherwise the same as
those presented in FIGS. 7A and 7B. In all cases, DNA/NF.kappa.B
complexes (NF-.kappa.B) and super-shifted DNA-protein complexes
(S-NF-.kappa.B) are indicated by arrows. Nuclear extracts were
prepared from both males (M) and females (F).
[0415] Taken as a whole, the data presented in FIG. 7 demonstrate
that both male and female BALB/C mice possess the activated p50
subunit of NF.kappa.B in cell nuclei. In contrast, while the
activated p50 subunit is virtually absent from the NOD mouse,
another active subunit of NF.kappa.B is present in nuclei obtained
from tissue obtained from this autoimmune strain. When this assay
was repeated with a p65 antibody to nuclear extracts of NOD and
BALB/c mice, some p65 was detected in the NOD mouse lung nuclear
extract. Since this antibody recognizes both the active and
inactive forms of p65 we cannot tell from this assay if the reduced
amounts of p65 in the nucleus of the NOD were active or inactive.
The supershift additionally shows that female NOD mice displays a
more extreme reduction in p65 subunits than does the male, while
the BALB/c mouse extracts produce a greater amount of
antibody-mediated shift than is observed with either gender of
autoimmune mutant.
[0416] FIG. 8A shows the results of experiments to examine the
activation of NF.kappa.B nucleic acid-binding by TNF-.alpha.
treatment. TNF-.alpha. is an extracellular signalling molecule
which is thought to upregulate NF.kappa.B activation in vivo. In
order to assess the influence of TNF-.alpha. on NF.kappa.B in an in
vitro system, a DNA/protein binding assay was undertaken. Nuclear
extracts were prepared from BALB/C and NOD mice by methods
described above. The binding activities were examined by EMSA with
32P end-labeled oligonucleotide containing an NF.kappa.B
recognition sequence. Spleen cells were stimulated with TNF-.alpha.
treatment (10 ng/ml; +) or without TNF-.alpha. treatment (-) and
nuclear extracts from the treated cells were prepared 4 hours
later. Nuclear extract prepared from spleen cells of BALB/C (lanes
2-5; FIG. 8A) and NOD (lanes 6-9; FIG. 8A) mice and Molt-4 cells
(lanes 10 and 11; FIG. 8A) were incubated with DNA probe as
follows:
[0417] Double-stranded .kappa.B wt, .kappa.B mut or IL-R2.alpha.
.kappa.B oligonucleotides were end-labeled using [.alpha.-32P]dCTP
and Klenow polymerase. Binding reactions of the DNA probe with
nuclear extracts were performed at 37.degree. C. for 30 minutes in
a total volume of 10 .mu.l of buffer containing 10 mM Hepes (pH
7.9), 50 mM KCl, 5 mM Tris-HCl (pH 7.0), 1 mM DTT, 15 mM EDTA, 10%
(v/v) glycerol, 1.0 .mu.g of poly (dI dC), and 4 ng of the labeled
probe. The DNA-protein complexes were resolved on nondenaturing 8%
polyacrylamide gels. Electrophoresis was performed with
0.5.times.TBE buffer (4.5 mM Tris-HCl, 4.5 mM boric acid, 0.1 mM
EDTA) at 4.degree. C. A negative binding control, to which no
nuclear extract was added, was run in lane 1.
[0418] In contrast to the results obtained with MOLT-4 and BALB/c
cells, TNF-.alpha. treatment only slightly induced NF-.kappa.B
activation in spleen cells from NOD mice (male and female) at 10
ng/ml (FIG. 8A). To determine whether this effect was
concentration-dependent, spleen cells from male and female NOD and
BALB/c mice were incubated for 4 hours in the absence (-) or
presence (+) of TNF-.alpha. at 10 ng/ml (FIG. 8B, lanes 3,5,7, and
10) or 25 ng/ml (FIG. 8B, lanes 8 and 11). Nuclear extracts were
then prepared and assayed for NF-.kappa.B DNA-binding activity by
EMSA with the KB1 oligonucleotide. Lane 1 corresponds to a negative
control in which no nuclear extract was added to the reaction
mixture. Data represents a gel exposed for 4 days. NF-.kappa.B
DNA-binding activity detected in TNF-.alpha. treated BALB/c control
spleen cells appeared specific. Various oligonucleotides in cold
competition experiments prevented DNA binding activity of
NF-.kappa.B to radioactive oligonucleotide probe (data not shown).
TNF-.alpha. treatment had little effect on NF-.kappa.B activation
in spleen cells from NOD mice at increasing TNF-.alpha.
concentrations of 10 or 25 ng/ml (FIG. 8B), with the induced
activity far less than control BALB/c cells, even at 25 ng/ml
(FIGS. 8A and 8B).
[0419] NF.kappa.B DNA binding activity was examined in cytosolic
extracts (FIG. 8C). Cytosolic NF.kappa.B/I .kappa.B complexes were
identified by EMSA after treatment of cytosolic extracts by 0.8%
DOC and 1.2% NP-40. Cytosolic extracts that were not treated with
TNF-.alpha. were prepared from spleen cells from BALB/C (lanes 2-5)
and NOD (lanes 6-9) mice and Molt-4 cells (lanes 10-11). Cytosolic
extracts were either pre-treated ("+", lanes 3, 5, 7, 9 and 11)
ornotpre-treated ("-", lanes 2, 4, 6, 8 and 10) with the
detergents. A reaction to which no extract was added was run as a
negative control (lane 1). NF-.kappa.B DNA-binding activity in
cytosolic extracts of NOD spleen cells was not clearly detected
compared to BALB/c mouse spleen cells (FIG. 8C).
[0420] In addition to NF.kappa.B, other transcription factors were
examined for DNA binding capability in the NOD mouse model in
comparison with that observed in normal mice. The binding
activities were examined by EMSA with a 32P end-labeled
oligonucleotide containing an SP1 recognition site (FIG. 8D, left)
or an AP1 recognition site (FIG. 8D, right). Transcription factors
SP1 and AP1 had DNA binding activities that did not differ between
BALB/c and NOD extracts (FIG. 8D). Appropriate DNA probes were
incubated with nuclear extract prepared from lung of BALB/c (male,
lanes 2, 3 and 11; female, lanes 4, 5 and 12) and NOD mice (male,
lanes 6, 7 and 13; female, lanes 8, 9 and 14) and Molt-4 cells
(lane 15); again, a negative control reaction, to which no DNA
probe was added, was run in lanes 1 and 10. In each of FIGS. 8A
through 8D, protein-DNA complexes are indicated by arrowheads.
Nuclear extracts were prepared from spleen cells derived from
BALB/C or NOD mice. M=male; F=female.
[0421] As FIG. 8A clearly shows in spleen cell extracts,
TNF-.alpha. is only able to activate NF.kappa.B in the BALB/c mouse
and in the Molt-4 lymphoid cell line; NOD mice do not show
increased p65 activity, suggesting a disruption of normal
intracellular signalling pathways of p65-mediated protection from
TNF-.alpha. stimulation.
[0422] In order to confirm the identities of nuclear proteins
binding to .kappa.B sites following TNF-.alpha. stimulation, a
super-shift assay was performed (FIG. 9). A labeled DNA probe
containing a .kappa.B binding sequence was incubated with nuclear
extracts prepared from spleen cells after TNF-.alpha. treatment.
Spleen cells were pre-stimulated by TNF-.alpha. treatment for 4
hours. Nuclear extracts were preincubated with an anti-p50
polyclonal antibody (lanes 3 and 7), anti-p65 polyclonal antibody
(lanes 4 and 8), anti-C/EBP polyclonal antibody (lanes 5 and 9) or
without antibody ("-", lanes 1, 2 and 6); BALB/C (FIG. 9A), NOD
(FIG. 9B). The labeled DNA probe was then added to the reaction
mixture. Again, a control reaction to which no nuclear extract was
added was run in lane 1 as a negative control. In all panels,
DNA/NF.kappa.B complexes (NF-.kappa.B) and super-shifted
DNA-protein complexes (S-NF-.kappa.B) were indicated by arrows.
Nuclear extracts were prepared from males (M) and females (F).
[0423] As in previous experiments, the prominent finding is that in
TNF-.alpha.-stimulated Balb/c mice, the nucleus possesses an
abundance of the active form of NF.kappa.B (i.e., p50), as
demonstrated by supershift. In contrast, the NOD mouse appears
unresponsive for p50 activation, even after exposure to a stimulant
of NF.kappa.B activation.
[0424] Aberrant p52 proteins are found in lymphocytes, as a result
of chromosome rearrangements at the NF.kappa.B2 locus (Neri et al.,
1991, Cell, 67: 1075), p52 is normally produced as p 100, an
inactive precursor harboring I.kappa.B-like ankyrin-containing
sequences in its C-terminal half and presumably similarly processed
by the proteasome. To demonstrate whether p52 binds .kappa.B
oligonucleotide probe, supershift assays .by polyclonal antibody to
p52 were carried out. Nuclear extracts were incubated in the
absence (-) or presence (+) of polyclonal antibodies to p52 before
EMSA with a KB binding sequence oligonucleotide probe. Original
DNA-protein complexes (NF-.kappa.B) and supershifted DNA-protein
complexes (S-NF-.kappa.B) are indicated by arrows. In supershift
analysis performed with the nuclear extracts of TNF-.alpha.-treated
spleen cells, anti-p52 polyclonal antibody had no effect on the
DNA-protein complexes in the nuclear extracts prepared from
TNF-.alpha.-treated spleen cells, both BALB/c and NOD (FIG.
9C).
[0425] The basal expression of NF-.kappa.B subunits,
I.kappa.B.alpha. and cyclin-dependent kinases was examined by
immunoblot analysis of cytosolic and nuclear extracts of male (M)
or female (F) BALB/c and NOD mouse spleen cells (FIG. 10). In these
experiments, extracts of spleen cells were subjected to SDS-PAGE on
a 12.5% gel under non-reducing conditions. The separated proteins
were transferred electrophoretically to a polyvinylidene difluoride
(PVDF) membrane which was then incubated for 2 hours at room
temperature with TBS-T (20 mM Tris-HCl, pH 7.6; 137 mM NaCl; 0.05%
volume/volume Tween 20) containing 8% (weightlvolume) bovine serum
albumin. The membrane was then incubated for 12 h at 4.degree. C.
with TBS-T containing the appropriate polyclonal antibodies, washed
4.times.5 minutes with TBS-T at room temperature, incubated for 2
hours at room temperature with TBS-T containing alkaline
phosphatase-conjugated secondary antibodies, washed five times with
TBS-T and subjected to the alkaline phosphatase color reaction. In
cytosolic extracts, the abundance of p65 and precursor p105, as
well as that of the cyclin-dependent kinases CDK8, CDK7, and CDK2
(assayed as controls), did not differ between BALB/c and NOD mouse
spleen cells. The expression of p50 in cytosolic extracts from
spleen cells from NOD mice (male and female) was, however, markedly
reduced relative to that in those from BALB/c mice. In nuclear
extracts, basal expression levels of p65 were similar in the two
mouse strains, the expression of p50 was virtually inapparent in
NOD mice. Furthermore, the basal expression of p52 in cytoplasmic
and nuclear extracts of BALB/c and NOD mouse spleen cells was
examined by immunoblot analysis. In cytosolic extracts, the basal
expression of precursor p100, as well as that of the
cyclin-dependent kinases and p65(RelA), did not differ in spleen
cells from BALB/c and NOD (male and female). However, the basal
expression of p52 in the cytosolic extracts from NOD mice spleen
cells was significantly reduced relative to BALB/c mice (FIG. 10A).
Northern blot analysis also revealed that the abundance of both p65
and p105 mRNAs in cytosolic extracts of spleen (or lung) cells did
not differ between BALB/c and NOD mice (data not shown).
[0426] To assess the dynamics of I.kappa.B.alpha. protein
expression occurring during lymphocyte activation by TNF-.alpha.
treatment, subcellular fractions from lymphocytes derived from
BALB/c and NOD spleen were treated with 10 ng/ml TNF-.alpha..
Fractions were collected for preparation of cytosolic extracts at
the indicated times and then subjected to immunoblotting with
appropriate antibodies. I.kappa.B.alpha. protein was readily
detected in the cytosolic extracts from both unstimulated
lymphocytes, BALB/c and NOD. In BALB/c lymphocytes treated by
TNF-.alpha., the cytosolic I.kappa.B.alpha. disappeared within 40
minutes of stimulation without concomitant expression in the
nucleus; furthermore I.kappa.B.alpha. protein reappeared in the
cytoplasm after 4 hours of stimulation (FIG. 10B). In NOD
lymphocytes, however, cytosolic IxBa was clearly detected after 40
minutes of stimulation and then stably expressed during TNF-.alpha.
treatment. This finding indicates a likely defect in the proteasome
degradation of I.kappa.B.alpha. in TNF-.alpha.-treated lymphocytes
from NOD mice (FIG. 10B).
[0427] The processing of p105 to p50 is mediated by the proteasome
processing pathway (Fan and Maniatis, 1991, Nature, 354: 395;
Maniatis, 1997, Science, 278: 818; Scherer et al., 1995, Proc.
Natl. Acad. Sci. U.S.A., 92: 11258; Palombella et al., 1994, Cell,
78: 773; Coux and Goldberg, 1998, J. Biol. Chem., 273: 8820; Sears
et al., 1998, J. Biol. Chem., 273: 1409; Pahl and Baeuerle, 1996,
Curr. Opin. Cell Biol., 8: 340). Proteasome inhibitors block
activation of NF KB and reduce cell survival after exposure to
TNF-.alpha. (Cui et al., 1997, Proc. Natl. Acad. Sci. U.S.A., 94:
7515). It is possible that proteasome dysfunction in NOD mice is
attributable in part to down-regulation of LMP2, one of the .beta.
subunits of the 20S proteasome (Yan et al., 1997, J. Immunol., 159:
3068). LMP2 is thought to be required for the biological activity
of the 20S proteasome (Schmidtke et al., 1996, EMBO J., 15: 6887).;
Schmidt and Kloetzel, 1997, FASEB J., 11: 1235).
[0428] Furthermore, in the T2 cell line, in which Lmp2 and Lmp7
genes have been deleted, NF.kappa.B is not activated in response to
TNF-.alpha.. The effect of TNF-.alpha. treatment on the DNA-binding
activity of nuclear NF-.kappa.B was examined (FIG. 11). EMSA was
performed such that cell extracts from mutant T2 cells compared to
those of control T1 cells, Molt-4 cells and Jurkat cells after
stimulation for 4 h in the absence (-) or presence (+) of 10 ng/ml
TNF-.alpha.. Lane 1 corresponds to a negative control in which no
nuclear extract was added to the reaction mixture (arrowhead
indicates specific DNA-protein complexes). In TNF-.alpha.
treated-cell lines T1 cells, Molt-4 cells and Jurkat cells, the
expression of the active nuclear form of NF-.kappa.B was markedly
detected on EMSA; however NF-.kappa.B activity was not induced in
TNF-.alpha.-treated T2 cells (FIG. 11A).
[0429] The specificity of DNA-binding activity in the nuclear
extracts prepared from these cell lines was confirmed by
preincubation of these nuclear extracts in the presence (+) or
absence (-) of a 100-fold molar excess of unlabeled competitor
oligonucleotide comprising a wild-type KB binding site (w), a
mutant site, .kappa.B1 (ml) or a second mutant site, .kappa.B2 (m2)
before addition of 32P-unlabeled oligonucleotide (.kappa.B 1).
Double-stranded oligodeoxynucleotides were synthesized on a DNA
synthesizer by the phosphoramidite method and purified on an OPC
cartridge. They corresponded to KB binding motifs of the human
immunodeficiency virus-type 1 enhancer
(5'-GATCTAGGGACTTTCCGCTGGGGACTTTCC- AG-3'; .kappa.B1) and
interleukin-2 receptor .alpha. chain gene enhancer (5'-GAT
CTCAGGGGAATCTCCCTCTCCT TTTATGGGCGTAGCG-3'; .kappa.B2). The
oligonucleotides were end-labeled with [.alpha.-32P] dCTP and
Klenow polymerase. Nuclear extract was incubated at 37.degree. C.
for 30 minutes in a total volume of 10 .mu.g/.mu.l containing 10 mM
Hepes-NaOH (pH 7.9), 50 mM KCl, 5 mM Tris-HCl (pH 7.0), 1 mM DTT,
15 mM EDTA, 10% (v/v) glycerol, 1.0 .mu.g of poly (dI.dC) and 4 ng
of .sup.32P-labeled .kappa.B oligonucleotide. The DNA-protein
complexes were resolved by electrophoresis on nondenaturing 8%
polyacrylamide gels with 0.5.times.TBE (Tris-borate-EDTA) buffer at
4.degree. C. For competition experiments, nuclear extracts was
incubated for 15 minutes at 4.degree. C. with a 100-fold molar
excess of unlabeled KB oligonucleotide before addition of the
radioactive probe. Cytosolic extracts were treated with 1.2% NP-40
and 0.8% deoxycholate to dissociate I.kappa.B from NF-.kappa.B
before incubation with .sup.32P-labeled probe. For supershift
assays, nuclear extracts were incubated with specific antibodies in
1 hour at 4.degree. C. before addition of DNA probes. Lanes 1
correspondes to negative controls in which nuclear extract was not
added.
[0430] NF-.kappa.B DNA-binding activity in the cytosolic extracts
was analyzed by EMSA with the .kappa.B1 oligonucleotide after
pre-incubation with (+) or without (-) NP-40 and deoxycholate (FIG.
11C). Lane 1 corresponds to a negative control in which cytosolic
extract was not added to the reaction mixture. The KB binding
activity in the cytsolic extracts prepared from T2 cells was
dramatically reduced relative to that apparent in other cytoplasmic
extracts (FIG. 11C).
[0431] The specificity of the .kappa.B DNA-binding activity in T2
cells and the extract quality were confirmed by the DNA-binding
activities of the other transcription factors, SP1 and AP1 on EMSA
with specific oligonucleotide probes (FIG. 11D). DNA-binding
activities of SP1 (left) or AP1 (right) in the nuclear extracts of
these cell lines were measured and were found not to differ among
extracts from the T1, T2, Jurkat and Molt-4 cell lines (FIG.
11D).
[0432] Supershift assays were performed with the nuclear extracts
prepared from T1 and T2 cells (FIG. 11E, top) or Molt-4 and Jurkat
cells (FIG. 11E, top). Nuclear extracts prepared from these cell
lines were incubated in the absence (-) or presence (+) of
polyclonal antibodies to p50 (lanes 3, 7), to p65 (lanes 4, 8), or
to C/EBP (lanes 5, 9) before EMSA with the .kappa.B1
oligonucleotide. Non-shifted DNA-protein complexes (NF-.kappa.B)
and supershifted DNA-protein complexes (S-NF-.kappa.B) are
indicated by arrows. In these experiments, antibodies to p50 or to
p65 shifted the bands of the DNA-protein complexes in all nuclear
extracts of T1 cells, Molt-4 cells and Jurkat cells on the EMSA,
while no supershift band was detected in the T2 cells nuclear
extract pre-incubated with the anti-p50 antibodies (FIG. 11E).
Antibodies to C/EBP had no effect on the DNA-protein complexes in
all nuclear extracts of these cell lines (FIG. 11E).
[0433] The basal expression levels of NF-.kappa.B subunits,
I.kappa.B.alpha. and cyclin-dependent kinases were determined by
immunoblot analysis of cytosolic and nuclear extracts of T1, T2,
Molt-4 and Jurkat cells. Cytosolic and nuclear extracts prepared
from these cell lines were subjected to immunoblot analysis with
the appropriate antibodies, as described above. In cytosolic
extracts, the basal expression of p65, precursor p100 and p105, as
well as that of the cyclin-dependent kinases, did not differ in
these cell lines; however, the expression of p50 and p52 in
cytoplasmic extracts prepared from T2 cells was significantly
reduced relative to that in those from other cell lines (FIG. 11F).
In nuclear extracts, although the basal expression levels of p65
were similar in these cell lines, the expression of neither p50 nor
p52 was clearly detected in T2 cells (FIG. 11F). The findings
presented in FIG. 11 suggest that specific proteasome subunits are
required for the activation of NF-.kappa.B by TNF-.alpha.
treatment.
[0434] To investigate whether the altered abundance of p50 in NOD
mouse spleen cells could be attributable to defective processing of
p105 by the proteasome, the processing of p105 by cytosolic
extracts of NOD mouse spleen cells was examined using recombinant
p105 or the truncated version p60Tth as substrates. The in vitro
p105 processing assay reaction was performed as previously
described (Fan and Maniatis, 1991, supra). In brief, p105 and
p60Tth expression constructs were subjected to in vitro
transcription and translation in a wheat germ extract system
(Promega) in the presence of [35S]methionine. The 35S-labeled p105
and p60Tth proteins were immunoprecipitated with polyclonal
antibodies to p50 and purified for use as substrates. Each
substrate protein was incubated for 90 minutes at 30.degree. C.
with spleen cytosolic extract (20 or 40 .mu.g of protein) in a
final volume of 25 .mu.l in the absence or presence of 10 mM ATP
(Palombella et al., 1994, supra). The proteasome inhibitor MG115
was also added to the reaction mixture where indicated (FIG. 12).
The processed proteins were separated by SDS-polyacrylamide gel
electrophoresis (PAGE) on a 10% gel and visualized by
autoradiography. Incubation of p60Tth with cytosolic extracts of
neither BALB/c nor NOD mouse spleen cells resulted in the
generation of the cleaved fragment in the absence of ATP (FIG. 12A,
left). When p60Tth was incubated with cytosolic extracts of BALB/c
cells in the presence of 10 mM ATP, mature p50 was generated (FIG.
12A, center). Although p60Tth was incubated with cytosolic extracts
of NOD cells in the presence of 10 mM ATP, p50 was not produced
(FIG. 12A, center). The production of p50 has previously been shown
to be stimulated by ATP (Fan and Maniatis, 1991, supra; Palombella
et al., 1994, supra).
[0435] Similar results were obtained when p105 was used as
substrate, although the extent of processing was less than that
observed with p60Tth (FIG. 12B). ATP-dependent processing of both
p60Tth and p 105 with cytosolic extracts of NOD mouse spleen cells
was clearly impaired and the defect appeared more pronounced for
NOD females than for NOD males (FIGS. 12A and 12B). To confirm that
the formation of p50 in this in vitro assay was mediated by the
proteasome, we the effect of MG115 on proteasome function was
examined. MG115 is a potent inhibitor of the chymotryptic site on
the 20S proteasome particle, and has previously been shown to
reduce the degradation of ubiquitin-conjugated proteins in cell
extracts and, at a concentration of 50 .mu.M, to prevent the
processing of p105 (Palombella et al., 1994, supra). In the present
study, the processing of p105 and p60Tth was also completely
inhibited by MG115 at a concentration of 50 .mu.M (FIGS. 12A, right
and 12B, right).
[0436] A PEST-rich domain downstream of the ankyrin repeats of p105
is phosphorylated after stimulation, but the phosphorylation of the
c-terminus of p105 produces no clear functional consequences (Sears
et al., 1998, supra; Lin et al., 1998, Cell, 92: 819; Naumann and
Scheidereit, 1994, EMBO J., 13: 711; Pahl and Baeuerle, 1996,
supra; MacKichan et al., 1996, J. Biol. Chem., 271: 6084; Fujimoto
et al., 1995, Gene, 165: 183). The phosphorylation status of
recombinant p105 was examined in cytosolic extracts of spleen cells
from BALB/c and NOD mice (FIG. 12C). To do this, recombinant p105
was incubated for various times at 30.degree. C. in a reaction
mixture containing [8-32P] ATP and cytosolic extracts (40 .mu.g of
protein) of spleen cells from male or female BALB/c or NOD mice,
after which p105 was immunoprecipitated with antibodies to p50 and
subjected to SDS-PAGE and autoradiography. The positions of
phosphorylated p105 and of p50 are indicated (FIG. 12C).
Phosphorylation of p105 by cytosolic extracts of BALB/c spleen
cells reached a maximum at 30 minutes and thereafter decreased,
presumably because the phosphorylated protein was degraded by the
ubiquitin-proteasome pathway (FIG. 12C). In contrast, the
phosphorylation of p105 by cytosolic extracts of spleen cells from
NOD mice (male and female) continued to increase for up to 40
minutes, presumably because the phosphorylated protein did not
undergo proteolysis (FIG. 12C). Thus, the activity of the p105
kinase appears normal in cytosolic extracts of NOD mouse spleen
cells.
[0437] Ubiquitination of the ankyrin repeats of p105 is also
thought in most cases to be required for its proteolytic processing
(Palombella et al., 1994, supra; Coux and Goldberg, 1998, supra;
Sears et al., 1998, supra; Pahl and Baeuerle, 1996, supra). The
ubiquitination of p105 was examined after incubation of the protein
with cytosolic extracts of BALB/c and NOD mouse spleen cells (FIG.
12D). Recombinant p105 was incubated for various times at 30C in a
reaction mixture containing cytosolic extracts (40 .mu.g of
protein) of spleen cells from male or female BALB/c or NOD mice,
after which complexes were cross-linked with glutaraldehyde,
immunoprecipated with antibodies to p50, and detected by immunoblot
analysis with antibodies to ubiquitin. The positions of
ubiquitinated p105 (ubn-p105) and of molecular size standards (in
kilodaltons) are indicated. Impaired NF-.kappa.B activity in the
NOD mouse due to defective processing by the proteasome.
Cross-linking of ubiquitin p105 complexes with glutaraldehyde,
followed by their immunoprecipitation by antibodies to p50 and
immunoblot analysis with antibody to ubiquitin, revealed a temporal
pattern for ubiquitination similar to that for phosphorylation of
p105. Thus, whereas the ubiqutination of p105 by cytosolic extracts
of BALB/c cells reached a maximum at 30 minutes and thereafter
decreased, that mediated by extracts of NOD mouse (male and female)
cells continued to increase for up to 40 minutes (FIG. 12D). Thus,
ubiquitination activity appeared not to be down-regulated in
cytosolic extracts of NOD mouse spleen cells. Overall, these data
localize the defect in p105 processing in NOD mouse cells to the
proteasome.
[0438] These results suggest that the activity of the proteasome
particle of NOD mouse cells is impaired with regard to p105
processing. This impaired p105 proteolytic processing is also
consistent with the relative toxicity of TNF-.alpha. in NOD spleen
cells.
[0439] To demonstrate the defective proteosome processing pathway
of p105 in T2 cells, the processing of p105 in cytoplasmic extracts
of T1 cells, T2 cells, Molt-4 cells and Jurkat cells was
investigated by in vitro assay with 35S-labeled and purified
recombinant p105 as substrate. The labeled p105 was incubated with
the cytosolic extracts of these cell lines (20 or 40 .mu.g of
protein at left and center) and the reaction mixtures were
incubated with (center; FIGS. 12E, F and G) or without (upper;
FIGS. 12E, F and G) 10 mM ATP in a wheat germ extract system
(Promega) as above. Incubations were also performed in the absence
(-) or presence (+) of 50 .mu.g MG115 (lower; FIGS. 12E, F and G).
Lane 1 in all gels presented in FIGS. 12E, F and G corresponds to
reaction mixtures without substrate. Incubations were performed at
30.degree. C. for 90 minutes, after which the reaction mixtures
were analyzed by SDS-PAGE and autoradiography. Incubation of p105
with cytoplasmic extracts prepared from these cell lines in the
absence of ATP did not result in the generation of the cleaved
fragment p50 (FIG. 12E). When p105 was incubated with the
cytoplasmic extracts of T1 cells, Molt-4 cells and Jurkat cells in
the presence of 10 mM ATP, the mature p50 was detected (FIG. 12F);
however, the p50 was not generated by incubation of p105 with the
cytoplasmic extracts prepared from T2 cells in the presence of 10
mM ATP (FIG. 12F, lanes 4 and 5). To verify that the maturation
processing of p50 in the in vitro reaction was mediated by the
proteasome processing pathway, the effect of MG115 on proteasome
function was examined. Addition of MG115 into the reaction mixture
clearly resulted in defective p105 processing (FIG. 12G).
[0440] To determine the basal expression level of components of the
20S proteasome and cyclin-dependent kinases in the T1, T2, Molt-4
and Jurkat cell lines, the immunoblot analysis was performed with
appropriate antibodies on cytosolic and nuclear extracts. The basal
expression level of proteasome components were also compared to
TAFII250 and cyclin-dependent kinases (CDK2, CDK7 and CDK8). The
results demonstrated that the basal expression of TAFII250 and
cyclin-dependent kinases did not differ among these cell lines
(FIG. 12H). In the case of proteasome components, the lack of
expression of LMP2 and LMP7 in the cytoplasmic extracts prepared
from T2 cells was confirmed by immunoblot analysis (FIG. 12H).
[0441] One critical function of NF-.kappa.B is to provide
protection to cells from the effects of exogenous TNF-.alpha.. In
the experiments shown in FIG. 13A, spleen cells were prepared from
BALB/c and NOD mice, and tested for survival following TNF-.alpha.
stimulation. Spleen cells were cultured for 24 hours after exposure
to various concentrations (2, 5, 10 or 20 ng/ml) of TNF-.alpha., as
indicated on the X axis of the figure. Viable cells remaining after
TNF-.alpha. treatment are shown as a percentage of viable control
(untreated) cells. Standard deviations were calculated from four
independent readings within a single experiment. The survival over
time of cells treated with TNF-.alpha. is charted in FIG. 13B.
Spleen cells were treated with TNF-.alpha. (10 ng/ml), and viable
cells were counted at various times following treatment as
indicated on the X axis of the figure.
[0442] These data clearly demonstrate that TNF-.alpha. treatment is
toxic to NOD mice and the cells experience rapid death. That the
survival of NOD mice is compromised with regard to that of normal
mice indicates clearly that NF.kappa.B activation is defective in
this autoimmune mouse model.
[0443] DNA fragmentation was evaluated and detected by agarose gel
electrophoresis after spleen cells were cultured in 10 ng/ml
TNF-.alpha. for 24 hours. These assays confirmed TNF-.alpha.
treatment of NOD but not BALB/c spleen cells resulted in apoptosis
as demonstrated by agarose gel electrophoresis (FIG. 13C).
Embryonic fibroblasts prepared from BALB/c and NOD mice were
cultured DMEM containing 10% fetal bovine serum and then incubated
with various concentrations of TNIF-.alpha. for 24 hours (FIG. 13D,
top) or with TNF-.alpha. at 10 ng/ml for the indicated times (FIG.
13D, bottom). Cell viability was assessed by trypan blue exclusion.
Data are means.+-.SD of four replicates from a representative
experiment, and are expressed as a percentage of the survival value
for the corresponding cells not exposed to TNF-.alpha.. In contrast
to the data of FIG. 13C, recently established cultures of NOD mouse
embryonic fibroblasts (MEF) demonstrated no cellular toxicity with
TNF-.alpha. exposure suggesting tissue or developmental specificity
of the NIP-.kappa.B defect (FIG. 13D).
[0444] The promoter of the Lmp2 gene in the NOD mouse contains a
candidate mutation that may reduce transcription and/or translation
(Yan et al., 1997, J. Immunol., 159: 3068). NOD mice have reduced
Lmp2 mRNA in lymphocytes and reduced reporter protein in transcient
transfection assays. To determine at the protein level whether the
NOD mouse exhibits low in vivo basal protein expression of the
LMP2, LMP7, LMP10 or C9 components of the 20S proteasome,
immunoblot analysis was conducted on splenic and mouse embryonic
fibroblasts (MEF) extracts. Basal expression of TAFII25U and cyclin
dependent kinases CDK2, CDK7, and CDK8 were compared to basal
expression levels of proteasome components by immunoblot in spleen
cells (extracts from male and female BALB/c and NOD mice) (FIG.
14A) and mouse embryonic fibroblasts (MEF) derived from BALB/c and
NOD mice (FIG. 14B). Purified antibodies were used to detect
TAFII250, CDK2, CDK7, and CDK8 as well as p105, p50 and p65 of
NP-.kappa.B and c-Rel under conditions as described above.
Anti-sera recognized murine LMIP2, LMP7 and LMP10 proteasome
components and C9 antibody recognized both proteasome precursors as
well as mature proteasomes. The basal expression level of
proteasome protein was also compared to TAFII250, which is a factor
that promotes cell cycle progression, and to cyclmn dependent
kinases CDK2, CDK7 and CDK8.
[0445] TNF-.alpha. stimulated spleen cells were evaluated for
downstream c-myc protein, a transcriptionally-induced protein by
properly activated NF-.kappa.B subunits. These data show, using
polyclonal antibody detection methods, that basal expression levels
of TAFII250, CDK2, CDK7, and CDK8 are equivalent for spleen cells
of male and female mice from both the NOD and BALB/c strains (FIG.
14A). The basal expression levels of NF-.kappa.B subunits p50, p65,
p105 precursor and c-Rel were examined in both cytosolic and
nuclear extracts of BALB/c and NOD mice spleen cells by immunoblot
analysis (FIG. 14A). The expression of p50 in cytosolic and nuclear
extracts from spleen cells derived from NOD mice was significantly
lower than that observed in BALB/c mice (FIG. 14A). In the case of
proteasome proteins, the NOD mice lacked detectable basal
expression of LMP2 selectivity in spleen cells but not MEF (FIGS.
14A and 14B). NOD spleen cells and MEF both exhibited normal levels
of LMP7, LMP10 and the C9 proteasome subunits. The C9 antibody
recognizes most precursor proteasomes and mature proteasomes (Nandi
et al., 1997, EMBO J., 16: 5363). Furthermore, MEF from NOD mice
expressed normal levels of both NF-.kappa.B subunits p50, p65, p
105 precursors and c-Rel in whole cell lysates (FIG. 14B). FIG. 14
indicates that transcriptional activated heterodimer complexes,
p50-p60 and p50-c-Rel were impaired in NOD mice spleen cells but
not MEF. These findings suggest that Rel/NF-.kappa.B dysfunction as
positive transcriptional regulators for several interleukins and
their receptors, the c-myc proto-oncogene and a variety of adhesion
molecules in NOD lymphoid cells. In addition, expression of the
gene encoding proto-oncogene product c-myc was not strongly induced
in TNF-.alpha. treated NOD spleen cells (data not shown).
NF-.kappa.B dysfunction was apparent in TNF-.alpha. induced NOD
spleen cells by the total lack of c-myc protein (data not
shown).
[0446] While the data presented above indicate that the
phosphorylation and ubiquitination of p105 appears normal in NOD
mouse spleen cells, it was of interest to determine whether the
proteolytic processing of p105 to p50 by the proteasome is impaired
in these animals (FIG. 15). The mutant T2 cell line, deficient in
MHC-encoded LMP protein in a manner comparable the NOD mouse, was
seen to experimentally mirror NOD splenocytes for deranged
NF-.kappa.B activation and downstream nuclear events. The markedly
defective function of the proteasome in NOD mouse spleen cells was
associated with impaired TNF-.alpha. induced NF-.kappa.B activation
and increased susceptibility to TNF-.alpha. induced apoptosis. The
proteasome cutting detect extended to defective p100 processing to
p52 subunits as well as interrupted I.kappa.B-.alpha. degradation,
indicating that NOD mouse spleen cells have an immature proteasome
in which processing of p105 to the p50 subunit is blocked.
[0447] The results above indicate that the protein complexes
observed in NOD mice differ from those seen in mice of the BALB/c
strain, prompting a more rigorous examination of the DNA binding
specificity. In particular, mutant oligonucleotides which are not
bound by the active p50/p65 complex were tested as specificity
controls. As reported in the published literature, the p50-p65
heterodimer interacts with artificial palindromic .kappa.B binding
motifs which duplicate the half sites in the motif 5'-GGGACTTTCC-3'
(AB) into 5'-GGGACGTCCC-3' (AA) and 5'-GGAAATTTCC-3' (BB) (Urban
and Baueurle, 1990; Urban et al., 1991). A published competition
assay revealed that active p50-p65 heterodimer was unable to bind
the two palindromic sites, AA and BB with high affinity (Urban and
Baueurle, 1990, supra; Urban et al., 1991, supra).
[0448] To verify the impairment of the p50-p65 active form in NOD
lymphocytes, KB site binding protein was tested in a competition
assay with 32P-labeled AB probe, using unlabeled AB, AA and BB
oligonucleotides as competitors. In TNF-.alpha.-treated BALB/c
lymphocytes, .kappa.B site binding protein was unable to bind two
palindromic sites AA and BB with high affinity, indicating that the
nuclear form of p50-p65 had been induced. In contrast, .kappa.B
site binding protein was able to bind the BB oligonucleotides with
high affinity in the TNF-.alpha.-treated NOD lymphocytes (FIG. 16).
This assay, using competitive oligonucleotides, indicates defective
nuclear expression of p50-p65 active forms in TNF-.alpha.-treated
NOD lymphocytes.
Use
[0449] The invention is of use in the diagnosis and treatment of
autoimmune disorders
Other Embodiments
[0450] Other embodiments will be evident to those of skill in the
art. It should be understood that the foregoing description is
provided for clarity only and is merely exemplary. The spirit and
scope of the present invention are not limited to the above
examples, but are encompassed by the following claims.
Sequence CWU 1
1
11 1 32 DNA Artificial Sequence Synthetic 1 gatctaggga ctttccgctg
gggactttcc ag 32 2 40 DNA Artificial Sequence Synthetic 2
gatctcaggg gaatctccct ctccttttat gggcgtagcg 40 3 10 DNA Artificial
Sequence Synthetic 3 gggactttcc 10 4 10 DNA Artificial Sequence
Synthetic 4 gggacgtccc 10 5 10 DNA Artificial Sequence Synthetic 5
ggaaatttcc 10 6 5 DNA Artificial Sequence Synthetic 6 gggac 5 7 5
DNA Artificial Sequence Synthetic 7 ggaaa 5 8 5 DNA Artificial
Sequence Synthetic 8 ctcac 5 9 5 DNA Artificial Sequence Synthetic
9 tttcc 5 10 5 DNA Artificial Sequence Synthetic 10 gtccc 5 11 5
DNA Artificial Sequence Synthetic 11 tttcc 5
* * * * *