U.S. patent application number 11/026133 was filed with the patent office on 2005-07-21 for methods for using the obese gene and its gene product to identify hematopoietic progenitor cells.
This patent application is currently assigned to Indevus Pharmaceuticals, Inc.. Invention is credited to Cioffi, Joseph, Shafer, Alan Wayne, Snodgrass, H. Ralph, Zupancic, Thomas Joel.
Application Number | 20050158287 11/026133 |
Document ID | / |
Family ID | 27501904 |
Filed Date | 2005-07-21 |
United States Patent
Application |
20050158287 |
Kind Code |
A1 |
Snodgrass, H. Ralph ; et
al. |
July 21, 2005 |
Methods for using the obese gene and its gene product to identify
hematopoietic progenitor cells
Abstract
The present invention relates to methods for using various forms
of a novel receptor expressed by hematopoietic and endothelial
cells. An additional variant form of this receptor has been
detected in brain cells and shown to bind to the obese gene
product, leptin. Therefore, leptin may be used to stimulate the
growth and development of receptor-positive hematopoietic and
endothelial cells in vitro and in vivo. In addition, this receptor
is selectively expressed in hematopoietic progenitor cells with
long-term repopulating potential. Thus, agents that specifically
bind to this receptor may be used to identify and isolate
progenitor cells for a variety of clinical applications.
Inventors: |
Snodgrass, H. Ralph;
(Powell, OH) ; Cioffi, Joseph; (New Albany,
OH) ; Zupancic, Thomas Joel; (Worthington, OH)
; Shafer, Alan Wayne; (Lancaster, OH) |
Correspondence
Address: |
JONES DAY
222 EAST 41ST ST
NEW YORK
NY
10017
US
|
Assignee: |
Indevus Pharmaceuticals,
Inc.
|
Family ID: |
27501904 |
Appl. No.: |
11/026133 |
Filed: |
December 30, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11026133 |
Dec 30, 2004 |
|
|
|
10095929 |
Mar 12, 2002 |
|
|
|
6838079 |
|
|
|
|
10095929 |
Mar 12, 2002 |
|
|
|
08618957 |
Mar 20, 1996 |
|
|
|
6355237 |
|
|
|
|
08618957 |
Mar 20, 1996 |
|
|
|
08589915 |
Jan 23, 1996 |
|
|
|
08589915 |
Jan 23, 1996 |
|
|
|
08355888 |
Dec 14, 1994 |
|
|
|
5763211 |
|
|
|
|
08355888 |
Dec 14, 1994 |
|
|
|
08306231 |
Sep 14, 1994 |
|
|
|
5643748 |
|
|
|
|
Current U.S.
Class: |
424/93.7 ;
424/85.1; 435/372 |
Current CPC
Class: |
A61K 48/00 20130101;
C12N 2501/125 20130101; C12N 2506/02 20130101; Y10S 514/814
20130101; A61K 38/2264 20130101; C07K 14/5759 20130101; C12N 5/0645
20130101; C07K 14/715 20130101; C12N 5/0641 20130101; C12N 2501/14
20130101; C12N 5/0647 20130101; C12N 2501/355 20130101; Y10S
514/885 20130101; C07K 14/705 20130101 |
Class at
Publication: |
424/093.7 ;
424/085.1; 435/372 |
International
Class: |
A61K 045/00; C12N
005/08 |
Claims
What is claimed is:
1-26. (canceled)
27. A method for identifying hematopoietic progenitor cells in a
cell mixture, comprising contacting the cell mixture with an agent
that binds to Hu-B1.219 protein and selecting the cells bound to
the agent.
28. The method of claim 27 in which the agent is an antibody or a
fragment thereof.
29. The method of claim 27 in which the agent is leptin or a
fragment thereof.
30. A method for detecting hematopoietic progenitor cells in a cell
mixture, comprising: (a) contacting an RNA extracted from the cell
mixture with a nucleic acid probe capable of specifically
hybridizing to at least a portion of a coding strand of a cDNA of
SEQ ID NO: 1; and (b) detecting hybridization between the probe and
the RNA.
31. A method for identifying hematopoietic progenitor cells in a
tissue, comprising: (a) contacting a tissue with a nucleic acid
probe capable of specifically hybridizing to at least a portion of
a coding strand of a cDNA of SEQ ID NO: 1 (b) detecting
hybridization between the probe and the RNA of the tissue.
32. A method for detecting cancer, comprising: (a) contacting a
bodily fluid with a specific binding agent for Hu-B1.219 protein;
and (b) detecting the presence Hu-B1.219 in the fluid.
Description
[0001] The present application is a continuation of co-pending U.S.
patent application Ser. No. 08/618,957, filed Mar. 20, 1996, which
is a continuation-in-part of U.S. patent application Ser. No.
08/589,915, filed Jan. 23, 1996, (now abandoned) which is a
continuation-in-part of U.S. patent application Ser. No.
08/355,888, filed Dec. 14, 1994 (now U.S. Pat. No. 5,763,211),
which is a continuation-in-part of U.S. patent application Ser. No.
08/306,231 filed Sep. 14, 1994 (now U.S. Pat. No. 5,643,748), each
of which is incorporated by reference herein in its entirety.
1. INTRODUCTION
[0002] The present invention relates to methods for using various
forms of a novel receptor expressed by hematopoietic and
endothelial cells. An additional variant form of this receptor has
been detected in brain cells and shown to bind to the obese gene
product, leptin. Therefore, leptin may be used to stimulate the
growth and development of receptor-positive hematopoietic and
endothelial cells in vitro and in vivo. In addition, this receptor
is selectively expressed in hematopoietic progenitor cells with
long-term repopulating potential. Thus, agents that specifically
bind to this receptor may be used to identify and isolate
progenitor cells for a variety of clinical applications.
2. BACKGROUND OF THE INVENTION
[0003] 2.1. Hematopoietin Receptor Gene Family
[0004] A variety of diseases, including malignancy and
immunodeficiency, are related to malfunction within the
lympho-hematopoietic system. Some of these conditions could be
alleviated and/or cured by repopulating the hematopoietic system
with progenitor cells, which when triggered to differentiate would
overcome the patient's deficiency. Therefore, the ability to
initiate and regulate hematopoiesis is of great importance (McCune
et al., 1988, Science 241: 1632).
[0005] The process of blood cell formation, by which a small number
of self-renewing stem cells give rise to lineage specific
progenitor cells that subsequently undergo proliferation and
differentiation to produce the mature circulating blood cells has
been shown to be at least in part regulated by specific hormones.
These hormones are collectively known as hematopoietic growth
factors or cytokines (Metcalf, 1985, Science 229: 16; Dexter, 1987,
J. Cell Sci. 88: 1; Golde and Gasson, 1988, Scientific American,
July: 62; Tabbara and Robinson, 1991, Anti-Cancer Res. 11: 81;
Ogawa, 1989, Environ. Health Presp. 80: 199; Dexter, 1989, Br. Med.
Bull. 45: 337).
[0006] With the advent of recombinant DNA technology, the genes
encoding a number of these molecules have now been molecularly
cloned and expressed in recombinant form (Souza et al., 1986,
Science 232: 61; Gough et al., 1984, Nature 309: 763; Yokota et
al., 1984, Proc. Natl. Acad. Sci. U.S.A. 81: 1070; Kawasaki et al.,
1985, Science 230: 291). These cytokines have been studied in their
structure, biology and even therapeutic potential. Some of the most
well characterized factors include erythropoietin (EPO), stem cell
factor (SCF), granulocyte macrophage colony stimulating factor
(GM-CSF), macrophage colony stimulating factor (M-CSF), granulocyte
colony stimulating factor (G-CSF), the interleukins (IL-1 to IL-15)
and thrombopoietin (TPO).
[0007] These cytokines act on different cell types at different
stages during blood cell development, and their potential uses in
medicine are far-reaching which include blood transfusions, bone
marrow transplantation, correcting immunosuppressive disorders,
cancer therapy, wound healing, and activation of the immune
response (Golde and Gasson, 1988, Scientific American, July:
62).
[0008] Apart from inducing proliferation and differentiation of
hematopoietic progenitor cells, such cytokines have also been shown
to activate a number of functions of mature blood cells (Stanley et
al., 1976, J. Exp. Med. 143: 631; Schrader et al., 1981, Proc.
Natl. Acad. Sci. U.S.A. 78: 323; Moore et al., 1980, J. Immunol.
125: 1302; Kurland et al., 1979, Proc. Natl. Acad. Sci. U.S.A. 76:
2326; Handman and Burgess, 1979, J. Immunol. 122: 1134; Vadas et
al., 1983, Blood 61: 1232; Vadas et al., 1983, J. Immunol. 130:
795), including influencing the migration of mature hematopoietic
cells (Weibart et al., 1986, J. Immunol. 137: 3584).
[0009] Cytokines exert their effects on target cells by binding to
specific cell surface receptors. A number of cytokine receptors
have been identified and the genes encoding them molecularly
cloned. Several cytokine receptors have recently been classified
into a hematopoietin receptor (HR) superfamily. The grouping of
these receptors was based on the conservation of key amino acid
motifs in the extracellular domains (Bazan, 1990, Immunology Today
11: 350). The HR family is defined by three conserved motifs in the
extracellular domain of its members. The first is a
Trp-Ser-X-Trp-Ser (WSXWS box) motif which is highly conserved and
located amino-terminal to the transmembrane domain. Most members of
the HR family contain this motif. The second consists of four
conserved cysteine residues located in the amino-terminal half of
the extracellular region. The third is that both the conserved
cysteines and the WSXWS box are found within two separate conserved
fibronectin Type III (FN III) domains. The members of the HR family
include receptors for ligands such as EPO, G-CSF (Fukunaga, 1990,
Cell 61: 341), GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-2
(.beta.-subunit), IL-12, IL-13, IL-15 and LIF (Cosman, 1990, TIBS
15: 265).
[0010] Ligands for the HR are critically involved in the
proliferation, maturation and differentiation of blood cells. For
example, IL-3 promotes the proliferation of early multilineage
pluripotent stem cells, and synergizes with EPO to produce red
cells. IL-6 and IL-3 synergize to induce proliferation of early
hematopoietic precursors. GM-CSF has been shown to induce the
proliferation of granulocytes as well as increase macrophage
function. IL-7 is a bone marrow-derived cytokine that plays a role
in producing immature T and B lymphocytes. IL-4 induces
proliferation of antigen-primed B cells and antigen-specific T
cells. Thus, members of this receptor superfamily are involved in
the regulation of the hematopoietic system.
[0011] 2.2. The Obese Gene, Gene Product and its Receptor
[0012] In order to study the molecular mechanism of weight
regulation, Zhang et al. (1994, Nature 372: 425-432) cloned the
mouse obese (ob) gene from ob/ob mice, which contain a single
nucleotide mutation resulting in an obese phenotype. When an
isolated gene fragment was used as a probe, it was shown to
hybridize with RNA only in white adipose tissue by northern blot
analysis, but not with RNA in any other tissue. In addition, the
coding sequence of the ob gene hybridized to all vertebrate genomic
DNAs tested, indicating a high level of conservation of this
molecule among vertebrates. The deduced amino acid sequences are
84% identical between human and mouse, and both molecules contain
features of secreted proteins.
[0013] In an effort to understand the physiologic function of the
ob gene, several independent research groups produced recombinant
ob gene product in bacteria for in vivo testing (Pelleymounter et
al., 1995, Science 269: 540-543; Halaas et al. 1995, Science 269:
543-546; Campfield et al., 1995, Science 269: 546-549). When the OB
protein (also known as leptin) was injected into grossly obese
mice, which possessed two mutant copies of the ob gene, the mice
exhibited a reduced appetite and began to lose weight. More
importantly, Campfield et al. (1995, Science 269: 546-549) injected
leptin directly into lateral ventricle, and observed that the
animals reduced their food intake, suggesting that leptin acts on
central neuronal networks to regulate feeding behavior and energy
expenditure. This result also provided evidence that
leptin-responsive cells might reside in the brain.
[0014] Recently, a leptin fusion protein was generated and used to
screen for a leptin receptor (OB-R) in a cDNA expression library
prepared from mouse choroid plexus, a tissue that lines brain
cavities termed ventricles (Tartaglia et al., 1995, Cell 83:
1263-1271). This approach led to the cloning of one form of the
OB-R coding sequence, which reveals a single membrane-spanning
receptor, sharing structural similarities with several Class I
cytokine receptors, such as the gp130 signal-transducing component
of the IL-6 receptor (Taga et al., 1989, Cell 58: 573-581), the
G-CSF receptor (Fukunaga et al., 1990, Cell 61: 341-350), and the
leukemia inhibitory factor receptor (Gearing et al., 1991, EMBO J.
10: 2839-2848). Northern blot analysis and reverse
transcription-polymerase chain reaction (RT-PCR) demonstrate that
OB-R mRNA is expressed in several tissues, including lung, kidney,
total brain and hypothalamus, but there was no report on the
expression of OB-R in hematopoietic tissues.
[0015] The mouse OB-R isolated by Tartaglia, et al., contains a
relatively short intracellular cytoplasmic domain as compared with
other Class I cytokine receptors. Subsequently, when its human
homolog was isolated from a human infant brain library, its
predicted protein sequence contains a much longer intracellular
domain. In view of this finding, it was speculated that different
forms of the receptor might exist (Barinaga, 1996, Science 271:
29). However, prior to the present invention, no alternative forms
of the OB-R had been identified.
3. SUMMARY OF THE INVENTION
[0016] The present invention relates to methods for using Hu-B1.219
(or OB-R) variants as markers for the identification and isolation
of progenitor cells in the hematopoietic and endothelial lineages,
and methods for using the ob gene and its gene product, leptin, to
stimulate hematopoietic and endothelial development.
[0017] The invention is based, in part, on the Applicants'
discovery of three forms of a novel member of the HR family,
designated Hu-B1.219, which have been isolated from a human fetal
liver cDNA library. Sequence comparison of these molecules with a
human OB-R sequence (Tartaglia et al., 1995, Cell 83: 1263-1271)
shows that they are nearly identical in their extracellular
domains. Therefore, these four molecules represent variant forms of
the receptor that respond to leptin as a ligand. While the three
isoforms described herein differ from the reported OB-R protein at
only three amino acid positions in the extracellular domain, all
four variants contain extensive differences in their intracellular
domains at their 3' ends. Thus, although these receptors bind to
leptin, they may transduce different signals upon ligand binding.
In addition, Hu-B1.219 is expressed in several cell lines of
hematopoietic and endothelial origin. Tissue expression analysis
demonstrates that fetal lung and liver also contain high levels of
its mRNA. Moreover, human CD34.sup.+ bone marrow cells express
Hu-B1.219. When mouse fetal liver cells are separated into several
fractions based on their expression of AA4.1 and FcR, the
expression of the mouse homolog of Hu-B1.219 is detected
exclusively in the AA4.1.sup.+/FcR.sup.- population, which has been
shown to contain most if not all of the long-term repopulating
hematopoietic progenitor cells at this stage of fetal liver
development. Furthermore, mouse bone marrow cells proliferate and
differentiate in response to leptin stimulation by producing
erythroid colony-forming units (CFU-e), erythroid burst-forming
units (BFU-e) and granulocyte-macrophage (CFU-GM) colonies. Freshly
isolated murine yolk sac cells also produce erythroid growth
following leptin stimulation. Additionally, Hu-B1.219 is expressed
in some endothelial cells and their precursors as they are derived
from the embryonic yolk sac. Therefore, Hu-B1.219 is a marker for
hematopoietic and endothelial progenitor cells.
[0018] A wide variety of uses are encompassed in the present
invention, including but not limited to, the use of
Hu-B1.219-specific binding agents to identify and isolate
hematopoietic and endothelial progenitor cells, the use of leptin
to activate such progenitor cells for in vitro or ex vivo
expansion, the use of leptin for in vivo stimulation of the same
cell population in patients with immunodeficiency and anemia, and
the use of leptin to promote angiogenesis and vasculogenesis, as
well as augmentation of donor cell engraftment following bone
marrow transplantation.
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1A-1G Nucleotide sequence (SEQ ID NO: 1) and deduced
amino acid sequences (SEQ ID NOs: 2, 3, & 4) of Form 1 of
Hu-B1.219. The 3' end of this molecule is 98% identical to a human
retrotransposon sequence.
[0020] FIG. 2. Nucleotide Sequence comparison between Hu-B1.219
Form 1 (SEQ ID NO: 5), Form 2 (SEQ ID NO: 6) and Form 3 (SEQ ID NO:
7) at the 3' end.
[0021] FIG. 3A-3F Amino acid comparison between Hu-B1.219 Forms 1
(HuB1.219-1)(SEQ ID NO: 8), 2 (HuB1.219-2)(SEQ ID NO: 9), 3
(HuB1.219-3)(SEQ ID NO: 10), human OB-R (HuOBR)(SEQ ID NO: 11) and
murine OB-R (MuOBR)(SEQ ID NO: 12).
[0022] FIG. 4. Human adult multiple tissue northern blots are
carried out with a probe derived from the extracellular domain of
Hu-B1.219 according to the manufacturer's instructions (Clontech,
Palo Alto, Calif.).
[0023] FIGS. 5A and 5B PCR analysis of Hu-B1.219 expression in
human CD34.sup.+ and CD34.sup.- cells. FIG. 5A is detected with
Hu-B1.219 primers, whereas FIG. 5B is detected with CD34 primers.
BMMNC represents bone marrow mononuclear cells as positive
controls.
[0024] FIGS. 6A and 6B PCR analysis of murine Hu-B1.219 expression
in mouse fetal liver subpopulations separated by antibodies to
AA4.1 and FcR. FIG. 6A is detected with Hu-B1.219 primers, whereas
FIG. 6B is detected with CD34 primers. NS represents non-sorted
cells and BM represents bone marrow cells as controls.
[0025] FIG. 7. Age matched female mice from normal, ob/ob and db/db
strains were used as marrow donors for erythroid colony forming
assays containing low serum concentration. .quadrature.=medium
containing IL-3, GM-CSF and EPO; .box-solid.=medium containing
IL-3, GM-CSF, EPO and recombinant murine leptin.
[0026] FIG. 8. Three types of bone marrow colonies are stimulated
by leptin: CFU-e, BFU-e and CFU-GM. .quadrature.=medium containing
IL-3, GM-CSF and EPO; .box-solid.=medium containing IL-3, GM-CSF,
EPO and recombinant murine leptin.
5. DETAILED DESCRIPTION OF THE INVENTION
[0027] 5.1. Expression of the OB-R in Hematopoietic Cells
[0028] The present invention relates to a novel hematopoietic
progenitor cell marker and its use for cell identification and
isolation, as well as the use of leptin to stimulate hematopoietic
and endothelial development via this receptor known as Hu-B1.219.
In a specific embodiment by way of example in Section 6, infra,
several forms of this receptor were cloned and characterized. Amino
acid sequence comparison of these related molecules with a
published human OB-R sequence (Tartaglia et al., 1995, Cell 83:
1263-1271) reveals only three amino acid differences in their
extracellular domains but extensive diversity in their
intracellular cytoplasmic domains. More specifically, FIG. 1A-1G
shows that in the Hu-B1.219 molecules described herein, nucleotide
residues #349-351 encode alanine, nucleotide residues #421-423
encode arginine and nucleotide residues #763-765 encode arginine.
Additionally, the four forms diverge both in length and sequence
composition from nucleotide residue #2771 and beyond. In this
regard, the intracellular domain of Form 1 of Hu-B1.219 described
herein is highly homologous to a retrotransposon sequence (Ono et
al., 1987, Nucl. Acid. Res. 15: 8725-8737).
[0029] Analysis of the Hu-B1.219 variants reveals significant
homology to the FN III domain of the HR family indicating that they
belong to the HR family of receptors. Northern blot hybridization
and RT-PCR analyses indicates that Hu-B1.219 mRNA is highly
expressed in cells of hematopoietic and endothelial origin. In
addition, the Hu-B1.219 sequence is expressed in certain fetal
tissues and tumor cell lines. Hence, in addition to its expression
in the brain for weight regulation by leptin, Hu-B1.219 (or OB-R)
is expressed by hematopoietic and endothelial cells, thereby
rendering these cells responsive to the action of leptin.
[0030] Since additional variant forms of the molecule may exist,
they can be identified by labeled DNA probes made from nucleic acid
fragments corresponding to any portion of the cDNA disclosed herein
in a cDNA library prepared from human fetal liver, human lung,
human kidney, human choroid plexus, human hypothalamus, human
prostate and human ovary. More specifically, oligonucleotides
corresponding to either the 5' or 3' terminus of the cDNA sequence
may be used to obtain longer nucleotide sequences. Briefly, the
library may be plated out to yield a maximum of 30,000 pfu for each
150 mm plate. Approximately 40 plates may be screened. The plates
are incubated at 37.degree. C. until the plaques reach a diameter
of 0.25 mm or are just beginning to make contact with one another
(3-8 hours). Nylon filters are placed onto the soft top agarose and
after 60 seconds, the filters are peeled off and floated on a DNA
denaturing solution consisting of 0.4N sodium hydroxide. The
filters are then immersed in neutralizing solution consisting of 1M
Tris HCL, pH 7.5, before being allowed to air dry. The filters are
prehybridized in casein hybridization buffer containing 10% dextran
sulfate, 0.5M NaCl, 50 mM Tris HCL, pH 7.5, 0.1% sodium
pyrophosphate, 1% casein, 1% SDS, and denatured salmon sperm DNA at
0.5 mg/ml for 6 hours at 60.degree. C. The radiolabelled probe is
then denatured by heating to 95.degree. C. for 2 minutes and then
added to the prehybridization solution containing the filters. The
filters are hybridized at 60.degree. C. for 16 hours. The filters
are then washed in 1.times. wash mix (10.times. wash mix contains
3M NaCl, 0.6M Tris base, and 0.02M EDTA) twice for 5 minutes each
at room temperature, then in 1.times. wash mix containing 1% SDS at
60.degree. C. for 30 minutes, and finally in 0.3.times. wash mix
containing 0.1% SDS at 60.degree. C. for 30 minutes. The filters
are then air dried and exposed to x-ray film for autoradiography.
After developing, the film is aligned with the filters to select a
positive plaque. If a single, isolated positive plaque cannot be
obtained, the agar plug containing the plaques will be removed and
placed in lambda dilution buffer containing 0.1M NaCl, 0.01M
magnesium sulfate, 0.035M Tris HCl, pH 7.5, 0.01% gelatin. The
phage may then be replated and rescreened to obtain single, well
isolated positive plaques. Positive plaques may be isolated and the
cDNA clones sequenced using primers based on the known cDNA
sequence. This step may be repeated until a full length cDNA is
obtained.
[0031] One method for identifying all 31 isoforms is to PCR amplify
the 31 ends of the variant cDNA from a variety of tissues including
but not limiting to, choroid plexus, hypothalamus, fetal liver,
bone marrow, ovary, or prostate. To obtain the 3' end of the cDNA,
an oligo-dT primer is used to synthesize the cDNA first strand.
Hu-B1.219 specific primers from the conserved region of the gene
(e.g. up stream of nucleotide 2770) and oligo-dT are then used to
amplify the 3' end. The PCR fragments are cloned and sequenced by
standard techniques. Once obtained, these sequences may be
translated into amino acid sequence and examined for certain
landmarks such as continuous open reading frame, regulatory regions
that associate with tyrosine kinase activation, and finally overall
structural similarity to known variants.
[0032] 5.2. Hu-B1.219 AS A Progenitor Cell Marker
[0033] Hu-B1.219 is expressed in cells of hematopoietic and
endothelial origin. In a specific embodiment by way of example in
Section 7, infra, Hu-B1.219 is expressed in early progenitor cells,
and in a small percentage of progenitors with long-term
repopulating potential. In order to utilize Hu-B1.219 receptor as a
marker for cell identification and isolation, specific binding
agents such as antibodies may be generated to the protein.
[0034] 5.2.1. Generation of Antibodies
[0035] Various procedures known in the art may be used for the
production of antibodies to epitopes of natural or recombinant
Hu-B1.219 receptor. Such antibodies include but are not limited to
polyclonal, monoclonal, chimeric, single chain, Fab fragments and
fragments produced by an Fab expression library. Neutralizing
antibodies i.e., those which compete for the ligand binding site of
the receptor are especially preferred for diagnostics and
therapeutics.
[0036] Monoclonal antibodies that bind Hu-B1.219 may be
radioactively labeled allowing one to follow their location and
distribution in the body after injection. Radioisotope tagged
antibodies may be used as a non-invasive diagnostic tool for
imaging de novo cells of tumors and metastases as well as fetal
tissues.
[0037] Immunotoxins may also be designed which target cytotoxic
agents to specific sites in the body. For example, high affinity
Hu-B1.219 specific monoclonal antibodies may be covalently
complexed to bacterial or plant toxins, such as diphtheria toxin,
or ricin. A general method of preparation of antibody/hybrid
molecules may involve use of thiol-crosslinking reagents such as
SPDP, which attack the primary amino groups on the antibody and by
disulfide exchange, attach the toxin to the antibody. The hybrid
antibodies may be used to specifically eliminate Hu-B1.219
expressing tumor cells.
[0038] For the production of antibodies, various host animals may
be immunized by injection with the Hu-B1.219 protein, fragments
thereof or synthetic peptides, including but not limited to
rabbits, mice, rats, hamsters etc. Various adjuvants may be used to
increase the immunological response, depending on the host species,
including but not limited to Freund's (complete and incomplete),
mineral gels such as aluminum hydroxide, surface active substances
such as lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin, dinitrophenol, and
potentially useful human adjuvants such as BCG (bacilli
Calmette-Guerin) and Corynebacterium parvum.
[0039] Monoclonal antibodies to Hu-B1.219 may be prepared by using
any technique which provides for the production of antibody
molecules by continuous cell lines in culture. These include but
are not limited to the hybridoma technique originally described by
Kohler and Milstein, (Nature, 1975, 256: 495-497), the human B-cell
hybridoma technique (Kosbor et al., 1983, Immunology Today, 4: 72;
Cote et al., 1983, Proc. Natl. Acad. Sci., 80: 2026-2030) and the
EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In addition,
techniques developed for the production of "chimeric antibodies"
(Morrison et al., 1984, Proc. Natl. Acad. Sci., 81: 6851-6855;
Neuberger et al., 1984, Nature, 312: 604-608; Takeda et al., 1985,
Nature, 314: 452-454) by splicing the genes from a mouse antibody
molecule of appropriate antigen specificity together with genes
from a human antibody molecule of appropriate biological activity
can be used. Alternatively, techniques described for the production
of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted
to produce Hu-B1.219-specific single chain antibodies.
[0040] Antibody fragments which contain specific binding sites of
Hu-B1.219 may be generated by known techniques. For example, such
fragments include but are not limited to, the F(ab').sub.2
fragments which can be produced by pepsin digestion of the antibody
molecule and the Fab fragments which can be generated by reducing
the disulfide bridges of the F(ab').sub.2 fragments. Alternatively,
Fab expression libraries may be constructed (Huse et al., 1989,
Science, 246: 1275-1281) to allow rapid and easy identification of
monoclonal Fab fragments with the desired specificity to
Hu-B1.219.
[0041] 5.2.2. Progenitor Cell Separation
[0042] Human hematopoietic progenitor cells may be isolated using
an antibody to Hu-B1.219 protein, a leptin ligand, a leptin peptide
containing the receptor-binding domain or a leptin fusion protein
using conventional cell separation methods well known in the art.
Such Hu-B1.219-specific binding agents may be used in combination
with other agents such as anti-CD34 antibodies.
[0043] Although bone marrow is the preferred cell source, other
physiologic sources of hematopoietic cells may be utilized, for
example, the spleen, thymus, peripheral blood, cytokine-mobilized
blood, umbilical cord blood, embryonic yolk sac, or fetal liver.
Bone marrow is preferably removed from the iliac crest, but may
also be removed from other bone cavity. Bone marrow may be removed
from bone cavity by various methods well known to those skilled in
the art, including flushing the bone with a mixture of
physiological media, balanced salt solution, physiological buffer,
and other naturally occurring factors. Typically, the bone marrow
is filtered, centrifuged and resuspended.
[0044] Once a source of hematopoietic cells is obtained,
hematopoietic progenitor cells may be separated from the cell
mixture by various methods which utilize an agent such as a
specific antibody or a leptin ligand which specifically binds to
cell surface Hu-B1.219-encoded receptor protein. These techniques
may include, for example, flow cytometry using a fluorescence
activated cell sorter (FACS) and specific fluorochromes,
biotin-avidin or biotin-streptavidin separations using biotin
conjugated to cell surface marker-specific antibodies and avidin or
streptavidin bound to a solid support such as affinity column
matrix or plastic surfaces, magnetic separations using
antibody-coated magnetic beads, destructive separations such as
antibody and complement or antibody bound to cytotoxins or
radioactive isotopes.
[0045] Separation of a cell mixture via antibodies may be performed
by negative or positive selection procedures. In negative
separation, antibodies are used which are specific for markers
present on undesired hematopoietic cells. Cells bound by an
antibody may be removed or lysed and the remaining desired mixture
retained. In positive separation, antibodies specific for Hu-B1.219
or leptin ligand may be used. Cells bound by the antibody or leptin
are separated and retained. It will be understood that positive and
negative separations may be used substantially simultaneously or in
a sequential manner. It will also be understood that the present
invention encompasses any separation technique which can isolate
cells based on the expression of Hu-B1.219 as disclosed herein. For
example, a cell mixture may be separated into CD34.sup.+ and
CD34.sup.- fractions first followed by Hu-B1.219-specific
separation.
[0046] At present, the most common technique for antibody-based
separation has been the use of flow cytometry such as by a FACS.
Typically, separation by flow cytometry is performed as follows.
The suspended mixture of hematopoietic cells are centrifuged and
resuspended in media. Antibodies which are conjugated to
fluorochrome are added to allow the binding of the antibodies to
specific cell surface markers. The cell mixture is then washed by
one or more centrifugation and resuspension steps. The mixture is
run through FACS which separates the cells based on different
fluorescence characteristics. FACS systems are available in varying
levels of performance and ability, including multi-color analysis.
The cells can be identified by a characteristic profile of forward
and side scatter which is influenced by size and granularity, as
well as by positive and/or negative expression of certain cell
surface markers.
[0047] Other separation techniques besides flow cytometry may
provide for faster separations. One such method is biotin-avidin
based separation by affinity chromatography. Typically, such a
technique is performed by incubating the washed hematopoietic cells
with biotin-coupled leptin or antibodies to specific markers
followed by passage through an avidin column. Biotin-antibody-cell
or biotin-leptin-cell complexes bind to the column via the
biotin-avidin interaction, while other cells pass through the
column. Finally, the column-bound cells may be released by
perturbation or other methods. The specificity of the biotin-avidin
system is well suited for rapid positive separation.
[0048] Flow cytometry and biotin-avidin techniques provide highly
specific means of cell separation. If desired, a separation may be
initiated by less specific techniques which, however, can remove a
large proportion of mature blood cells from the hematopoietic cell
source. For example, magnetic bead separations may be used to
initially remove differentiated hematopoietic cell populations,
including T-cells, B-cells, natural killer (NK) cells, and
macrophages, as well as minor cell populations including
megakaryocytes, mast cells, eosinophils, and basophils. Desirably,
at least about 70% and usually at least about 80% of the total
hematopoietic cells present can be removed.
[0049] A preferred initial separation technique is density-gradient
separation. Here, the bone marrow or other hematopoietic cell
mixture preparation is centrifuged and the supernatant removed. The
cells are resuspended in, for example, RPMI 1640 medium (Gibco)
with 10% FCS and placed in a density gradient prepared with, for
example, "FICOLL" or "PERCOLL" or "EUROCOLLINS" media. The
separation may then be performed by centrifugation or automatically
with a Cobel & Cell Separator '2991 (Cobev, Lakewood, Colo.).
Additional separation procedures may be desirable depending on the
source of the hematopoietic cell mixture and its content. For
example, if blood is used as a source of hematopoietic cells, it
may be desirable to lyse red blood cells prior to the separation of
any fraction. Furthermore, elutriation may also be used alone or in
combination with all of other purification procedures described
herein (Noga et al., 1990, Prog. Clin. Biol. Res. 333: 345; Noga et
al., 1992, Prog. Clin. Biol. Res. 377: 411).
[0050] 5.3. The Obese Gene Product, Leptin
[0051] The nucleotide and amino acid sequences of both human and
mouse leptin have been published recently by Zhang et al. (1994,
Nature 372: 425-432). Thereafter, the mouse coding sequence was
used to express functional leptin in E. coli (Pelleymounter et al.,
1995, Science 269: 540-543; Halaas et al., 1995, Science 269:
543-546; Campfield et al., 1995, Science 269: 546-549).
Furthermore, human leptin was also expressed and shown to be
biologically active in murine experiments (Halaas et al., 1995,
Science 269: 543-546). Hence, human, murine and homologous coding
sequences from other species may be expressed, and the recombinant
protein purified by conventional techniques such as affinity
chromatography with an antibody. Alternatively, natural protein may
be directly purified from cells that secrete leptin, such as
adipose cell lines.
[0052] 5.3.1. Expression of Leptin Protein
[0053] For the practice of the present invention, human and mouse
leptin polynucleotide sequences which encode the proteins, peptide
fragments, fusion proteins or functional equivalents thereof, may
be used to generate recombinant DNA molecules that direct their
expression in appropriate host cells.
[0054] Due to the inherent degeneracy of the genetic code, other
DNA sequences which encode substantially the same or a functionally
equivalent amino acid sequence, may be used in the practice of the
invention for the cloning and expression of the leptin protein. In
particular, such DNA sequences include those which are capable of
hybridizing to the human leptin sequences under stringent
conditions.
[0055] Altered DNA sequences which may be used in accordance with
the invention include deletions, additions or substitutions of
different nucleotide residues resulting in a sequence that encodes
the same or a functionally equivalent gene product. The gene
product itself may contain deletions, additions or substitutions of
amino acid residues within a coding sequence, which result in a
silent change thus producing a functionally equivalent leptin
protein. Such amino acid substitutions may be made on the basis of
similarity in polarity, charge, solubility, hydrophobicity,
hydrophilicity, and/or the amphipathic nature of the residues
involved. For example, negatively charged amino acids include
aspartic acid and glutamic acid; positively charged amino acids
include lysine, histidine and arginine; amino acids with uncharged
polar head groups having similar hydrophilicity values include the
following: glycine, asparagine, glutamine, serine, threonine,
tyrosine; and amino acids with nonpolar head groups include
alanine, valine, isoleucine, leucine, phenylalanine, proline,
methionine, tryptophan.
[0056] The DNA sequences of leptin may be engineered in order to
alter the coding sequence for a variety of ends including but not
limited to alterations which modify processing and expression of
the gene product. For example, mutations may be introduced using
techniques which are well known in the art, e.g., site-directed
mutagenesis, to insert new restriction sites, to alter
glycosylation patterns, phosphorylation, etc.
[0057] In another embodiment of the invention, a leptin or a
modified leptin sequence may be ligated to a heterologous sequence
to encode a fusion protein. It may also be useful to encode a
chimeric leptin protein expressing a heterologous epitope that is
recognized by a commercially available antibody. A fusion protein
may also be engineered to contain a cleavage site located between a
leptin sequence and the heterologous protein sequence, so that the
leptin protein may be cleaved away from the heterologous
moiety.
[0058] In an alternate embodiment of the invention, the coding
sequence of leptin could be synthesized in whole or in part, using
chemical methods well known in the art. See, for example, Caruthers
et al., 1980, Nuc. Acids Res. Symp. Ser. 7: 215-233; Crea and Horn,
180, Nuc. Acids Res. 9(10): 2331; Matteucci and Caruthers, 1980,
Tetrahedron Letters 21: 719; and Chow and Kempe, 1981, Nuc. Acids
Res. 9(12): 2807-2817. Alternatively, the protein itself could be
produced using chemical methods to synthesize leptin amino acid
sequence in whole or in part. For example, peptides can be
synthesized by solid phase techniques, cleaved from the resin, and
purified by preparative high performance liquid chromatography.
(e.g., see Creighton, 1983, Proteins Structures And Molecular
Principles, W.H. Freeman and Co., N.Y. pp. 50-60). The composition
of the synthetic peptides may be confirmed by amino acid analysis
or sequencing (e.g., the Edman degradation procedure; see
Creighton, 1983, Proteins, Structures and Molecular Principles,
W.H. Freeman and Co., N.Y., pp. 34-49).
[0059] In order to express a biologically active leptin protein,
the nucleotide sequence coding for leptin, or a functional
equivalent, is inserted into an appropriate expression vector,
i.e., a vector which contains the necessary elements for the
transcription and translation of the inserted coding sequence. The
leptin gene products as well as host cells or cell lines
transfected or transformed with recombinant leptin expression
vectors can be used for a variety of purposes.
[0060] 5.3.2. Expression Systems for Leptin
[0061] Methods which are well known to those skilled in the art can
be used to construct expression vectors containing the leptin
coding sequence and appropriate transcriptional/translational
control signals. These methods include in vitro recombinant DNA
techniques, synthetic techniques and in vivo recombination/genetic
recombination. See, for example, the techniques described in
Sambrook et al., 1989, Molecular Cloning A Laboratory Manual, Cold
Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989, Current
Protocols in Molecular Biology, Greene Publishing Associates and
Wiley Interscience, N.Y.
[0062] A variety of host-expression vector systems may be utilized
to express the leptin coding sequence. These include but are not
limited to microorganisms such as bacteria transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing the leptin coding sequence; yeast transformed
with recombinant yeast expression vectors containing the leptin
coding sequence; insect cell systems infected with recombinant
virus expression vectors (e.g., baculovirus) containing the leptin
coding sequence; plant cell systems infected with recombinant virus
expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco
mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing the leptin coding
sequence; or animal cell systems.
[0063] The expression elements of these systems vary in their
strength and specificities. Depending on the host/vector system
utilized, any of a number of suitable transcription and translation
elements, including constitutive and inducible promoters, may be
used in the expression vector. For example, when cloning in
bacterial systems, inducible promoters such as pL of bacteriophage
.lambda., plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like
may be used; when cloning in insect cell systems, promoters such as
the baculovirus polyhedrin promoter may be used; when cloning in
plant cell systems, promoters derived from the genome of plant
cells (e.g., heat shock promoters; the promoter for the small
subunit of RUBISCO; the promoter for the chlorophyll .alpha./.beta.
binding protein) or from plant viruses (e.g., the 35S RNA promoter
of CaMV; the coat protein promoter of TMV) may be used; when
cloning in mammalian cell systems, promoters derived from the
genome of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia
virus 7.5K promoter) may be used; when generating cell lines that
contain multiple copies of the leptin DNA, SV40-, BPV- and
EBV-based vectors may be used with an appropriate selectable
marker.
[0064] In bacterial systems a number of expression vectors may be
advantageously selected depending upon the use intended for the
leptin expressed. For example, when large quantities of leptin are
to be produced for the generation of antibodies or to screen
peptide libraries, vectors which direct the expression of high
levels of fusion protein products that are readily purified may be
desirable. Such vectors include but are not limited to the E. coli
expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1791), in
which the leptin coding sequence may be ligated into the vector in
frame with the lac Z coding region so that a hybrid AS-lac Z
protein is produced; pIN vectors (Inouye & Inouye, 1985,
Nucleic acids Res. 13: 3101-3109; Van Heeke & Schuster, 1989,
J. Biol. Chem. 264: 5503-5509); and the like. pGEX vectors may also
be used to express foreign polypeptides as fusion proteins with
glutathione S-transferase (GST). In general, such fusion proteins
are soluble and can easily be purified from lysed cells by
adsorption to glutathione-agarose beads followed by elution in the
presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned polypeptide of interest can be released from the GST
moiety.
[0065] In yeast, a number of vectors containing constitutive or
inducible promoters may be used. For a review see, Current
Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al.,
Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et
al., 1987, Expression and Secretion Vectors for Yeast, Methods in
Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol.
153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press,
Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene Expression
in Yeast, Methods in Enzymology, Eds. Berger & Kimmel, Acad.
Press, N.Y., Vol. 152, pp. 673-684; and The Molecular Biology of
the Yeast Saccharomyces, 1982, Eds. Strathern et al., Cold Spring
Harbor Press, Vols. I and II.
[0066] In cases where plant expression vectors are used, the
expression of the leptin coding sequence may be driven by any of a
number of promoters. For example, viral promoters such as the 35S
RNA and 19S RNA promoters of CaMV (Brisson et al., 1984, Nature
310: 511-514), or the coat protein promoter of TMV (Takamatsu et
al., 1987, EMBO J. 6: 307-311) may be used; alternatively, plant
promoters such as the small subunit of RUBISCO (Coruzzi et al.,
1984, EMBO J. 3: 1671-1680; Broglie et al., 1984, Science 224:
838-843); or heat shock promoters, e.g., soybean hsp17.5-E or
hsp17.3-B (Gurley et al., 1986, Mol. Cell. Biol. 6: 559-565) may be
used. These constructs can be introduced into plant cells using Ti
plasmids, Ri plasmids, plant virus vectors, direct DNA
transformation, microinjection, electroporation, etc. For reviews
of such techniques see, for example, Weissbach & Weissbach,
1988, Methods for Plant Molecular Biology, Academic Press, NY,
Section VIII, pp. 421-463; and Grierson & Corey, 1988, Plant
Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9.
[0067] An alternative expression system which could be used to
express leptin is an insect system. In one such system, Autographa
californica nuclear polyhidrosis virus (AcNPV) is used as a vector
to express foreign genes. The virus grows in Spodoptera frugiperda
cells. The leptin coding sequence may be cloned into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter). Successful insertion of the leptin coding sequence will
result in inactivation of the polyhedrin gene and production of
non-occluded recombinant virus (i.e., virus lacking the
proteinaceous coat coded for by the polyhedrin gene). These
recombinant viruses are then used to infect Spodoptera frugiperda
cells in which the inserted gene is expressed. (e.g., see Smith et
al., 1983, J. Virol. 46: 584; Smith, U.S. Pat. No. 4,215,051).
[0068] In mammalian host cells, a number of viral based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the leptin coding sequence may be ligated to an
adenovirus transcription/translation control complex, e.g., the
late promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or in
vivo recombination. Insertion in a non-essential region of the
viral genome (e.g., region E1 or E3) will result in a recombinant
virus that is viable and capable of expressing leptin in infected
hosts (e.g., See Logan & Shenk, 1984, Proc. Natl. Acad. Sci.
USA 81: 3655-3659). Alternatively, the vaccinia 7.5K promoter may
be used. (See, e.g., Mackett et al., 1982, Proc. Natl. Acad. Sci.
USA 79: 7415-7419; Mackett et al., 1984, J. Virol. 49: 857-864;
Panicali et al., 1982, Proc. Natl. Acad. Sci. USA 79:
4927-4931).
[0069] Specific initiation signals may also be required for
efficient translation of inserted leptin coding sequences. These
signals include the ATG initiation codon and adjacent sequences. In
cases where the entire leptin gene, including its own initiation
codon and adjacent sequences, is inserted into the appropriate
expression vector, no additional translational control signals may
be needed. However, in cases where only a portion of the leptin
coding sequence is inserted, exogenous translational control
signals, including the ATG initiation codon, must be provided.
Furthermore, the initiation codon must be in phase with the reading
frame of the leptin coding sequence to ensure translation of the
entire insert. These exogenous translational control signals and
initiation codons can be of a variety of origins, both natural and
synthetic. The efficiency of expression may be enhanced by the
inclusion of appropriate transcription enhancer elements,
transcription terminators, etc. (see Bittner et al., 1987, Methods
in Enzymol. 153: 516-544).
[0070] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. The presence of several consensus N-glycosylation sites in
leptin support the possibility that proper modification may be
important for leptin function. Different host cells have
characteristic and specific mechanisms for the post-translational
processing and modification of proteins. Appropriate cell lines or
host systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERO, BHK, HeLa,
COS, MDCK, 293, WI38, etc.
[0071] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the leptin sequence may be engineered. Rather
than using expression vectors which contain viral origins of
replication, host cells can be transformed with the leptin DNA
controlled by appropriate expression control elements (e.g.,
promoter, enhancer, sequences, transcription terminators,
polyadenylation sites, etc.), and a selectable marker. Following
the introduction of foreign DNA, engineered cells may be allowed to
grow for 1-2 days in an enriched media, and then are switched to a
selective media. The selectable marker in the recombinant plasmid
confers resistance to the selection and allows cells to stably
integrate the plasmid into their chromosomes and grow to form foci
which in turn can be cloned and expanded into cell lines.
[0072] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler, et
al., 1977, Cell 11: 223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc.
Natl. Acad. Sci. USA 48: 2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22: 817) genes
can be employed in tk.sup.-, hgprt.sup.- or aprt.sup.- cells,
respectively. Also, antimetabolite resistance can be used as the
basis of selection for dhfr, which confers resistance to
methotrexate (Wigler, et al., 1980, Proc. Natl. Acad. Sci. USA 77:
3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1527);
gpt, which confers resistance to mycophenolic acid (Mulligan &
Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072); neo, which
confers resistance to the aminoglycoside G-418 (Colberre-Garapin et
al., 1981, J. Mol. Biol. 150: 1); and hygro, which confers
resistance to hygromycin (Santerre, et al., 1984, Gene 30: 147)
genes. Additional selectable genes have been described, namely
trpB, which allows cells to utilize indole in place of tryptophan;
hisD, which allows cells to utilize histinol in place of histidine
(Hartman & Mulligan, 1988, Proc. Natl. Acad. Sci. USA 85:
8047); and ODC (ornithine decarboxylase) which confers resistance
to the ornithine decarboxylase inhibitor,
2-(difluoromethyl)-DL-ornithine, DFMO (McConlogue L., 1987, In:
Current Communications in Molecular Biology, Cold Spring Harbor
Laboratory ed.).
[0073] Once the leptin protein is expressed by any of the
aforementioned systems, supernatants of the cultured cells or cell
lysates may be subjected to various standard methods of protein
purification. For example, an anti-leptin antibody or Hu-B1.219
protein can be used to purify it by affinity chromatography.
Alternatively, leptin may be purified by ion exchange
chromatography or HPLC. Thereafter, the purity of the protein can
be confirmed by various methods, including SDS-PAGE, and the
protein used immediately or stored frozen for future use. For cell
cultures and in vivo administration, purified leptin must be
sterilized prior to use.
[0074] 5.4. Activation of HU-B1.219-Expressing Cells by Leptin
[0075] Since various forms of Hu-B1.219, including OB-R, are
essentially identical in the extracellular domain, these receptors
can bind leptin as a ligand. In order to compare the binding
affinity of Hu-B1.219 isoforms to leptin, the variant forms are
cloned into standard expression vectors, e.g. CMV promoter
expression vectors, and transfected into COS and BaF3 cells.
Surface expression of the receptor is then evaluated by direct
binding to an anti-Hu-B1.219 antibody. In addition, leptin binding
assays can also be performed as described by Tartaglia et al.
(1995, Cell 83: 1263) using a leptin fusion protein or soluble
leptin conjugated to a radiolabel, a fluorescent dye or an enzyme.
The results are compared with mock transfected cells as negative
controls.
[0076] Since the four variants of Hu-B1.219 contain different
intracellular domains, these isoforms can be compared with respect
to their signal transduction capabilities to determine the most
active form. Stimulation of most if not all hematopoietic receptors
with ligands results in the rapid phosphorylation of tyrosines,
both on the receptors and on a cascade of cellular protein kinases
(Heidin, 1995, Cell 80: 213-233; Ihle, 1995, Nature 377: 591-594).
Phosphorylation of these molecules results in an activation signal
being propagated ultimately to the nucleus leading to gene
activation. Upon ligand binding to an hematopoietin receptor, some
of the first molecules to be activated in this fashion are the JAK
(Janus) family of protein kinases (Ziemiecki et al., 1994, Trends
Cell Biol. 4: 207-212). These activated kinases, in turn,
phosphorylate members of the STAT family of molecules which
eventually translocate to the nucleus and form active transcription
complexes (Darnell et al., 1994, Science 264: 1415-1421; Zhong et
al., 1994, Proc. Natl. Acad. Sci. USA 91: 4806-4810; Hou et al.,
1994, Science 265: 1701-1706).
[0077] Therefore, cell activation by leptin can be evaluated by
studying the pattern of phosphorylation of JAK1-3 following
Hu-B1.219 binding. This can be carried out by culturing
hematopoietic cells or Hu-B1.219 transfectants
(1-100.times.10.sup.3), in RPMI 1640 (GIBCO) with gentamicin (100
.mu.g/ml), 2 mM glutamine (GIBCO), 10% FCS, and leptin (from 0 to
500 nM) for 10-60 minutes at 37.degree. C. Following the
incubation, the cells are washed in ice-cold PBS and resuspended in
lysing buffer (1% Triton X-100, 200 mM NaCl, 10 mM Tris pH 7.5, 2.5
mM p-nitrophenyl guanidinobenzoate, 100 .mu.M Na.sub.3VO.sub.4, 1
.mu.M pepstatin, 50 .mu.M 3,4-dichloroisocoumarin, 1 mM PMSF, 10
.mu.g/ml leupeptin, 10 .mu.g/ml aprotinin) for 30 minutes at
4.degree. C. followed by removal of nuclei and insoluble material
by centrifugation. To the cell lysate is added polyclonal
antibodies to JAK1 and JAK2 (Upstate Biotechnology, Lake Placid,
N.Y.) or human Tyk2, a human kinase related to the JAK family
(Santa Cruz, Calif.) according to manufacturer's recommendation.
This mixture is rotated for 30-60 minutes at 4.degree. C. and then
100 .mu.l of a 10% protein A-sepharose solution (Sigma) is added
and rotated for an additional 30 minutes at 4.degree. C. The
precipitate is washed with lysis buffer and eluted in standard SDS
reducing sample buffer and resolved by SDS-PAGE. The proteins are
analyzed by Western blots by transferring to Immobilon membranes
(Millipore). The membranes are blocked with gelatin (1%) and
incubated with anti-phosphotyrosine (4G10, Upstate Biotechnology,
Lake Placid, N.Y.) according to the manufacturer's recommendations.
Phosphorylated proteins are detected with .sup.125I-labeled protein
A (Amersham).
[0078] For the aforementioned experiment, hematopoietic cells can
be obtained from human CD34.sup.+ bone marrow and cord blood. For
the murine experiments, three primitive populations can be
evaluated, e.g. Ly-6.sup.+ lineage negative bone marrow, or the
equivalent in fetal liver, or AA4.1.sup.+ fetal liver.
[0079] While tyrosine phosphorylation is an indication of cell
activation resulting from ligand-receptor interactions, additional
manifestations of activation at the cellular level can be assayed
by using leptin to induce the proliferation and/or differentiation
of hematopoietic precursors. Cell proliferation can be easily
assessed by .sup.3H-thymidine uptake or by visual enumeration of
cell numbers. Differentiation of hematopoietic cells can be assayed
by testing the ability of leptin to stimulate the in vitro growth
and differentiation of various hematopoietic colonies. For example,
a cell mixture can be isolated from the yolk sac, fetal liver or
bone marrow, and cultured in standard methylcellulose colony assays
with and without serum supplements, in the presence of leptin
(0.1-500 nM) with or without various other cytokines (Metcalf,
1984, in Clonal Culture of Hematopoietic Cells: Techniques and
Applications, Elsevier, N.Y.).
[0080] A standard protocol for such an assay involves density
gradient centrifugation of a cell mixture by Ficoll-Hypaque (1.077
gm/cm.sup.3) and resuspending about 1.times.10.sup.6 viable cells
in Iscove's Modified Dulbecco's Medium (IMDM) with 0.5-15% fetal
calf serum (FCS). The cells (1-100.times.10.sup.3/ml) are then
mixed with IMDM that contains methylcellulose (1.3%), FCS
(0.5-15%), BSA (1%), monothioglycerol (100 .mu.M), gentamicin (50
.mu.g/ml), and leptin (0.1-500 nM). In parallel cultures,
additional cytokines may include: IL-3 (100 pg/ml), steel factor or
c-Kit ligand or SCF (10 ng/ml), and EPO (2 U/ml). After mixing, 1
ml of the mixture is dispensed into a 25 mm bacterial grade culture
dishes at 37.degree. C. in a humidified incubator for 5 to 18 days.
Using an inverted microscope the number and type of hematopoietic
colonies are determined. The colony morphology is used to
categorize the various colony types, e.g. BFU-e, CFU-e, CFU-G,
CFU-GM, CFU-M, CFU-blast, or CFU-fibroblast (Metcalf, 1984, Clonal
Culture of Hematopoietic Cells: Techniques and Applications,
Elsevier, N.Y.; Freshney, 1994, in Culture of Hematopoietic Cells,
Wiley-Liss, Inc., pp. 265-68). Optimal concentrations of leptin in
this assay may increase both the size and the frequency of these
primitive pluripotent colonies.
[0081] While leptin may be used alone, it can also be used
synergistically with several cytokines to promote hematopoietic
cell growth including but not limited to, IL-1, IL-3, IL-6, EPO,
steel factor (SCF) and GM-CSF (1 ng/ml). In addition, since
biologically active leptin is present in fetal calf serum (FCS),
cultures with 0.5-15% of FCS can be tested. The specific activity
of leptin in FCS can be inhibited by an anti-leptin antibody or a
soluble variant of Hu-B1.219 as a control.
[0082] In particular, the effects of leptin may be tested on the
primitive precursors that form high proliferative potential cells
(HPPC) (McNiece and Briddell, 1994, in Culture of Hematopoietic
Cells, Wiley-Liss, Inc., pp. 23-40) and blast colonies (Leary and
Ogawa, 1994, in Culture of Hematopoietic Cells, Wiley-Liss Inc.,
pp. 41-54). In order to evaluate the effects of leptin on even more
primitive cells in these assays, CD34.sup.+ bone marrow, cord
blood, and fetal liver cells can be first sorted by an antibody and
tested in the above assays. Since recent evidence has suggested the
existence of a CD34.sup.- stem cell, the CD34.sup.- Lin.sup.-
population may also be stimulated by leptin.
[0083] Furthermore, the effect of leptin on the primitive long term
culture initiating cells (LTCIC) and on hematopoietic stem cells
can be evaluated. LTCIC are precursors that can initiate a
long-term hematopoietic culture and are believed to be a function
of hematopoietic stem cells (Sutherland and Eaves, 1994, in Culture
of Hematopoietic Cells, Wiley-Liss, Inc., pp. 139-162; Van der
Sluijs et al., 1990, Exp. Hematol. 18: 893-896; Traycoff et al.,
1994, Exp. Hematol. 22: 215-222). The ability of these culture
conditions to expand the hematopoietic stem cell can be confirmed
by the competitive repopulation assay (Harrison, 1980, Blood 55:
77-81). This assay allows for the quantification of hematopoietic
stem cells.
[0084] Additionally, since endothelial cells also express
Hu-B1.219, leptin may be used to stimulate the growth of primary
endothelial cells at 0.1-500 nM in standard cultures for
maintaining primary endothelial cells (Masek and Sweetenham, 1994,
Br. J. Haematol. 88: 855-865; Visner et al., 1994, Am. J. Physiol.
267: L406-413; Moyer et al., 1988, In Vitro Cell Dev. Biol. 24:
359-368). Alternatively, leptin may be used to induce endothelial
cells to produce cytokines (Broudy et al., 1987, J. Immunol. 139:
464-468; Seelentag et al., 1987, EMBO J. 6: 2261-2265).
Supernatants of 2-5 day primary endothelial cell cultures or
endothelial cell lines cultured in the presence of leptin with or
without other cytokines, such as vascular endothelial growth factor
(VEGF), platelet-derived growth factor (PDGF), fibroblast growth
factor (FGF), transforming growth factor (TGF) and epidermal growth
factor (EGF), are harvested and tested as a supplement in the
hematopoietic colony assays above.
[0085] In another aspect of the invention, since receptors often
form dimers on the cell surface, the combination of different
Hu-B1.219 isoforms that give optimal signal transduction can be
measured by growth stimulation and phosphorylation patterns. A
Hu-B1.219.sup.- growth factor-dependent indicator cell line (e.g.
BaF3) can be transfected with various combinations of the isoforms
using standard CMV expression vectors. Following the demonstration
of cell surface expression, leptin (0.1-500 nM) is added to the
cultures followed by the measurement of growth rates and
phosphorylation patterns by established techniques. Other cell
lines such as TF-1, FD5 and TS1 may also be used.
[0086] Because of the expression of isoforms with truncated
cytoplasmic tails, it is possible that another protein chain is
used in some tissues as the signaling molecule in association with
Hu-B1.219. Such a molecule can be screened and selected by
transfecting pools of cDNA from expression libraries of a variety
of tissues e.g. fetal liver, CD34.sup.+ bone marrow, lung, ovary,
etc. together with constructs expressing one of the truncated
Hu-B1.219 isoforms into a growth factor-dependent cell line (e.g.
BaF3). The ability to grow in the presence of leptin is used as a
readout. In particular, the insulin receptor-related receptor
(Zhang and Roth, 1992, J. Biol. Chem. 267: 18320), the LIFR.alpha.,
IL-2R.gamma., IL-4R.alpha. (Mosely et al., 1989, Cell 89: 335) and
IL-13R.alpha. chains (Hilton et al., 1996, Proc. Natl. Acad. Sci.
USA 93: 497) may function as complementary chains for Hu-B1.219
activity. The techniques to identify the unique cDNA responsible
for this complementation are well established in the art.
[0087] Additionally, agents that activate Hu-B1.219 in a manner
similar to leptin may also be used in place of leptin. These agents
include small molecules and peptides, and they may be selected in
the following screening assay. Ten thousand BaF3 and BaF3/Hu-B1.219
(transfectant cells that express the full length Hu-B1.219 isoform)
cells will be screened in microtiter plates for proliferative
effects after incubation with a test agent. Without stimulation
these cells die. Any growth promoting effect seen on the
transfected cell line and not with the BaF3 host would indicate
that the test agent specifically activates the Hu-B1.219 receptor
or its signaling pathway. This assay is used to screen small
molecules, including peptides, oligonucleotides, and chemical
libraries.
[0088] 5.5. In Vitro Uses of Leptin
[0089] In view of the expression of Hu-B1.219 in diverse cell
types, leptin may be used to activate these cells in culture. The
activated cells expand in number due to increased proliferation
and/or differentiate to become more mature cells. In this
connection, the optimal effective concentration of leptin for each
cell type may be determined by conventional titration experiments
in which different amounts of leptin are incubated with the
specific cells and their activation levels measured by tyrosine
phosphorylation, proliferation or differentiation.
[0090] In particular, hematopoietic progenitor cells express
Hu-B1.219. Hematopoietic cells may be activated by exposure to
leptin in vitro which results in their expansion in number prior to
their use in vitro and in vivo. Such hematopoietic cells may be
obtained from the bone marrow, the peripheral blood (Demuynck et
al., 1995, Ann. Hematol. 71: 29-33; Scheding et al., 1994, Stem
Cells 12: Suppl. 1: 203-210) and cord blood. In order to
selectively enhance the growth of hematopoietic stem cells, the
donor cell mixture may be first separated into CD34.sup.+ cells,
followed by leptin stimulation. The expanded cells may be used as
donor cells in bone marrow transplantation or as long-term bone
marrow cultures (Ponchio et al., 1995, Blood 86: 3314-3321; Testa
and Dexter, 1991, Curr. Opin. 3: 272-278; Naughton and Naughton,
1991, U.S. Pat. No. 5,032,508) for in vitro cytotoxicity testing
and the discovery of novel cytokines.
[0091] Since Hu-B1.219 is also expressed in some endothelial cells
and their progenitors, leptin may be used to induce blood vessel
formation in vitro. In that regard, leptin may be used alone or in
combination with VEGF, PDGF, FGF or TGF-.alpha.. Blood vessels form
by a combination of two primary processes. Some blood vessel growth
depends on angiogenesis, in a process similar to that associated
with pathological conditions. For instance, the CNS depends solely
on angiogenesis for development of its vascular supply (Nodew,
1989, Am. Rev. Respir. Dis. 140: 1097-1103; Risau et al., 1988,
EMBO J. 7: 959-962). A second process, vasculogenesis, depends on
the incorporation of migratory individual endothelial cells
(angioblasts) into the developing blood vessel. Leptin may be used
to promote both angiogenesis and vasculogenesis.
[0092] In addition, the coding sequence of leptin may be inserted
in an expression vector in accordance with Section 5.3, supra, and
transferred into leptin-nonproducing cell types to result in
endogenous expression of leptin. For example, hematopoietic stem
cells are isolated and transfected with the leptin coding sequence.
Thereafter, the cells are transferred into a bone marrow transplant
recipient to cause endogenous production of leptin in stimulating
hematopoiesis (U.S. Pat. No. 5,399,346).
[0093] 5.6. In Vivo Uses of Leptin
[0094] The appropriate dosage and formulation of leptin on human
hematopoietic and endothelial development in vivo can be first
determined in animal models. For example, normal mice may be
lethally irradiated or chemically ablated and reconstituted with
syngeneic or allogeneic bone marrow. Since recombinant human leptin
has been shown to be active on mouse cells, the rate of donor cell
engraftment can be compared between leptin-treated and non-treated
groups. Because of the Hu-B1.219 expression on primitive
hematopoietic cells, leptin facilitates the growth and recovery of
these cells in the recipient. The effect of leptin on in vivo
hematopoietic proliferation and differentiation in these situations
can be evaluated by reconstituting lethally irradiating mice (900R)
with normal bone marrow cells (1-5.times.10.sup.6 per mouse).
Groups of animals are given PBS injections as controls and other
groups receive leptin (0.1-10 mg/kg) at varying intervals. The
activity of leptin is assayed by the rapidity of re-normalization
and stability of blood profiles (e.g. hematocrit, WBC count,
differential, etc.).
[0095] In addition, neonatal, sublethally irradiated adult normal
or SCID mice can be reconstituted with human hematopoietic stem
cell isolated from bone marrow, cord blood, or fractions thereof.
In these mice, the human hematopoietic cells engraft and
differentiate (McCune et al., 1988, Science 241: 1632-1639; Sandhu
et al., 1994, J. Immunol. 152: 3806-3813). The effects of leptin
can be evaluated by measuring the growth rate and extent of
differentiation of human cells in these animals.
[0096] An effective amount of leptin may be administered into a
patient who is in need of increased hematopoietic cell function.
Such a need may arise from various forms of immunodeficiencies (B
cell deficiencies, T cell deficiencies and combined deficiencies),
myelosuppression, anemias and cancer. In these cases, leptin may be
used alone or in combination with other cytokines. Additionally,
since certain tumor cells such as leukemic cells express Hu-B1.219,
leptin may be used therapeutically to suppress tumor growth by
inducing terminal differentiation of these cells. Alternatively,
leptin may be conjugated to a growth inhibitory agent such as
ricin, diphtheria toxin or a chemotherapeutic drug to specifically
target and destroy tumor cells. Furthermore, antagonists of leptin,
e.g., a modified leptin molecule or a fragment thereof that binds
to its receptor but does not trigger signal transduction may be
used to block the stimulatory effects of leptin in cases where
naturally occurring leptin stimulates tumor growth in vivo.
[0097] Additionally, the leptin coding sequence may be inserted in
a viral vector for use in gene therapy (Jolly, 1994, Cancer Gene
Therapy, 1: 51). In particular, retrovirus, adenovirus, vaccinia
virus and adeno-associated viruses are preferred. The leptin coding
sequence-carrying virus is injected into a patient to directly
supply leptin by secretion into the bloodstream or to a specific
target tissue.
[0098] 5.6.1. Dosage Determination
[0099] The leptin protein, and nucleic acid sequences described
herein can be administered to a patient at therapeutically
effective doses to treat or ameliorate various hematologic
disorders and deficiencies. A therapeutically effective dose refers
to that amount of the protein sufficient to result in amelioration
of symptoms of the disorder, or alternatively, to that amount of a
nucleic acid sequence sufficient to express a concentration of gene
product which results in the amelioration of the disorder.
[0100] Toxicity and therapeutic efficacy of leptin can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD.sub.50 (the
dose lethal to 50% of the population) and the ED.sub.50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.50/ED.sub.50. Purified
leptin which exhibits large therapeutic indices is preferred. While
leptin preparations that exhibit toxic side effects may be used,
care should be taken to design a delivery system that targets such
preparations to the site of affected tissue in order to minimize
potential damage to normal cells and, thereby, reduce side
effects.
[0101] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of leptin lies preferably within a range of
circulating concentrations that include the ED50 with little or no
toxicity. The dosage may vary within this range depending upon the
dosage form employed and the route of administration utilized. A
dose may be formulated in animal models to achieve a circulating
plasma concentration range that includes the IC50 (i.e., the
concentration of leptin which achieves a half-maximal inhibition of
symptoms) as determined in cell culture. Such information can be
used to more accurately determine useful doses in humans. Levels in
plasma may be measured, for example, by high performance liquid
chromatography.
[0102] 5.6.2. Formulation and Administration
[0103] Pharmaceutical compositions for use in accordance with the
present invention may be formulated in conventional manner using
one or more physiologically acceptable carriers or excipients. The
compositions may be formulated for parenteral administration i.e.,
intravenous, subcutaneous, intradermal or intramuscular, via, for
example, bolus injection or continuous infusion. Formulations for
injection may be presented in unit dosage form, e.g., in ampoules
or in multi-dose containers, with an added preservative. The
compositions may take such forms as suspensions, solutions or
emulsions in oily or aqueous vehicles, and may contain formulatory
agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the active ingredient may be in powder form for
constitution with a suitable vehicle, e.g., sterile pyrogen-free
water, before use. It is preferred that leptin be introduced into
patients via intravenous administration to directly stimulate blood
progenitors.
[0104] Leptin may be formulated for administration by inhalation or
insufflation (either through the mouth or the nose) or oral,
buccal, parenteral or rectal administration.
[0105] For oral administration, the pharmaceutical compositions may
take the form of, for example, tablets or capsules prepared by
conventional means with pharmaceutically acceptable excipients such
as binding agents (e.g., pregelatinised maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g., lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycollate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets may be
coated by methods well known in the art. Liquid preparations for
oral administration may take the form of, for example, solutions,
syrups or suspensions, or they may be presented as a dry product
for constitution with water or other suitable vehicle before use.
Such liquid preparations may be prepared by conventional means with
pharmaceutically acceptable additives such as suspending agents
(e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible
fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous
vehicles (e.g., almond oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations may
also contain buffer salts, flavoring, coloring and sweetening
agents as appropriate.
[0106] Preparations for oral administration may be suitably
formulated to give controlled release of the active compound.
[0107] For buccal administration the compositions may take the form
of tablets or lozenges formulated in conventional manner.
[0108] For administration by inhalation, the compositions for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebuliser, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator may
be formulated containing a powder mix of the protein and a suitable
powder base such as lactose or starch.
[0109] The compositions may also be formulated in rectal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0110] In addition to the formulations described above, the
compositions may also be formulated as a depot preparation. Such
long acting formulations may be administered by implantation (for
example subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the compositions may be formulated
with suitable polymeric or hydrophobic materials (for example as an
emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives, for example, as a sparingly soluble
salt.
[0111] The compositions may, if desired, be presented in a pack or
dispenser device which may contain one or more unit dosage forms
containing the active ingredient. The pack may comprise metal or
plastic foil, such as a blister pack. The pack or dispenser device
may be accompanied by instructions for administration.
6. EXAMPLE
The OB-R is a Variant Form of the Hematopoietin Receptor Designated
Hu-B1.219
[0112] 6.1. Materials and Methods
[0113] 6.1.1. Northern Blot Analysis
[0114] In order to study the expression of the Hu-B1.219 gene,
Northern blots containing RNA obtained from a variety of human
tissues (Clontech, Palo Alto, Calif.) were hybridized with a
radiolabelled 530 base pair (bp) DNA probe corresponding to
nucleotides #578 through 1107 (see FIG. 1A-1G). Briefly, the blots
were prehybridized at 42.degree. C. for 3-6 hours in a solution
containing 5.times.SSPE, 10.times. Denhardt's solution, 100
.mu.g/ml freshly denatured, sheared salmon sperm DNA, 50% formamide
(freshly deionized), and 2% SDS. The radiolabelled probe was heat
denatured and added to the prehybridization mix and allowed to
hybridize at 42.degree. C. for 18-24 hours with constant shaking.
The blots were rinsed in 2.times.SSC, 0.05% SDS several times at
room temperature before being transferred to a wash solution
containing 0.1.times.SSC, 0.1% SDS and agitated at 50.degree. C.
for 40 minutes. The blots were then covered with plastic wrap,
mounted on Whatman paper and exposed to x-ray film at -70.degree.
C. using an intensifying screen.
[0115] 6.1.2. Reverse Transcription/Polymerase Chain Reaction
(RT/PCR)
[0116] Total RNA was isolated using standard laboratory procedures
(Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual,
Cold Spring Harbor Laboratory, NY). Approximately 1 .mu.g of total
RNA was reverse transcribed and the cDNA was amplified by PCR
(Perkin Elmer, Norwalk, Conn.). The PCR amplification conditions
were the same for Hu-B1.219 and Form 1 expression analysis. They
were: 94.degree. C. for 30 sec, 60.degree. C. for 30 sec,
72.degree. C. for 30 sec for a total of 40 cycles. The amplified
products (224 bp for Hu-B1.219 and 816 bp for Form 1) were resolved
by agarose gel electrophoresis and visualized by ethidium bromide
staining. The Hu-B1.219 amplimers were GGTTTGCATATGGAAGTC
(upper)(SEQ ID NO: 13) and CCTGAACCATCCAGTCTCT (lower)(SEQ ID NO:
14). The Form 1 specific amplimers were GACTCATTGTGCAGTGTTCAG
(upper)(SEQ ID NO: 15) and TAGTGGAGGGAGGGTCAGCAG (lower)(SEQ ID NO:
16). The upper amplimer was commonly shared by all 3 forms, whereas
the lower amplimer was Form 1-specific. The OB-R-specific (Form 4)
amplimers were ACATCTTCCCAAAATAGC (upper)(SEQ ID NO: 17) and
TGCCTGGGCCTCTATCTC (lower)(SEQ ID NO: 18).
[0117] 6.2. Results
[0118] A number of cDNA clones were isolated from a human fetal
liver cDNA library (Clontech, Palo Alto, Calif.), and the DNA
sequences of several of these clones were determined. These clones
(designated Hu-B1.219 #4, #33, #34, #1, #36, #8, #55, #60, #3, #57,
#62) contained overlapping sequences, which were then compiled into
a contiguous nucleotide sequence. Both the nucleotide sequence and
the predicted protein sequence from one such cDNA are shown in FIG.
1A-1G. This cDNA sequence contains two FN III domains, each
containing a "WS box", which are characteristic of genes of the HR
family. Thus, this cDNA represents a novel member of the HR gene
family, herein referred to as Hu-B1.219 (Table 1). Based on the
sequence of Hu-B1.219 presented in FIG. 1A-1G, the translation
initiation site appears at position #97. The sequence encodes an
open reading frame up to and including nucleotide #2970. It is
believed that the sequence from about nucleotide #2629 to about
#2682 encodes a transmembrane domain. The complete sequence encodes
a protein of 958 amino acids.
[0119] Subsequent amino acid sequence comparison of this molecule
with other published protein sequences revealed that it was highly
homologous to a recently published human OB-R protein (Tartaglia,
1995, Cell 83: 1263-1271). In this connection, the sequence of
Hu-B1.219 shown in FIG. 1A-1G differs from the published human OB-R
sequence only at three nucleotide positions in the extracellular
domain, i.e. nucleotide residues #349, #422 and #764, resulting in
amino acids alanine, arginine and arginine, respectively, in
Hu-B1.219 protein. The two molecules are identical in the
transmembrane region and a portion of the intracellular domain up
to and including nucleotide #2769, then they diverge at nucleotide
#2770 and beyond.
1TABLE 1 CYTOKINE RECEPTOR GENE FN III DOMAIN SIZES (BP) Gene Human
Mouse Rat Hu-B1.219(5') 273 Hu-B1.219(3') 282 IL-2R.beta. 291 288
291 IL-2R.gamma. 273 IL-3R.alpha. 246 252 IL-3R.beta.Aic2a 306 and
273 IL-3R.beta.Aic2b 306 and 282 303 and 276 IL-4R 294 291
IL-5R.alpha. 276 273 IL-6R 288 285 gp130 288 291 288 IL-7R 294
IL-9R 321 321 mpl 270 G-CSFR 300 297 GM-CSFR 288 CNTFR 282 285 PRLR
288 EPOR 288 285 288 LIFR-1 321 and 297
[0120] In addition to the sequence in FIG. 1A-1G referred to as
Form 1 of Hu-B1.219 and the variant form reported to be OB-R, other
lambda clones were discovered that contained different sequences
from Form 1 near the 3' end known as Form 2 and Form 3. All three
forms contain the identical sequence up to and including nucleotide
#2770, then they diverge at nucleotide #2771 and beyond (FIG. 2).
An alignment of the deduced amino acid sequences of all three forms
and the OB-R is shown in FIG. 3A-3F. Two of the originally isolated
lambda clones, #36 and #8, contain the 3' end sequences of Form 1
and Form 2, respectively. The different forms of Hu-B1.219 may
derive from a common precursor mRNA by an alternative splicing
mechanism. The sequence in this region is consistent with well
known splice junctions. It is noteworthy that the DNA sequence of
Form 1 from nucleotide #2768 to the end is 98% identical to a human
retrotransposon sequence that is thought to be derived from a human
endogenous retroviral DNA sequence (Singer, 1982, Cell 28: 433;
Weiner et al., 1986, Ann. Rev. Biochem. 55: 631; Lower et al.,
1993, Proc. Natl. Acad. Sci. USA 90: 4480; Ono et al., 1987, Nucl.
Acid Res. 15: 8725-8735).
[0121] In view of the foregoing, the recently published human OB-R
by Tartaglia (1995, Cell 83: 1263) represents a fourth form of
Hu-B1.219 because of its structural similarities to the
aforementioned three forms (FIG. 3A-3F). Although there are three
amino acid substitutions in the OB-R, such differences may have
resulted from allelic disparities between genetically diverse
individuals. It is also possible that the three forms of the
receptor described herein are specific isoforms in fetal and
hematopoietic cells, while the OB-R is expressed in the brain. The
differences in their intracellular domains may be involved in the
different signalling pathways used by these receptor variants in
different cells.
[0122] In order to examine the expression of the variant forms of
cDNA, RT/PCR was performed using several human cell lines. The
results in Table 2 show that Form 1 was expressed as RNA in K-562
cells and in a human fetal liver cDNA preparation. Since Hu-B1.219
was cloned from human fetal liver cDNA library, this served as a
positive control. However, with respect to several other human cell
lines, Form 1 was not detected, whereas Hu-B1.219 expression was
positive. For example, Form 1 was not expressed in KGla cells, but
Form 3 was expressed. Thus, it is possible that different forms of
Hu-B1.219 are not expressed simultaneously in the same cells. There
may be selective expression of certain forms in particular cell
populations. Additionally, Table 3 shows expression of Hu-B1.219 in
cell lines of diverse origins, including hematopoietic,
endothelial, central nervous system (CNS), breast and muscle. It is
interesting to note that the variant (Hu-B1.219.4) reported to be
OB-R is also detected in these cells, particularly in hematopoietic
cell lines, HEL and K562 (Table 3).
2TABLE 2 RT/PCR ANALYSIS OF COMPARATIVE EXPRESSION OF TWO HU-B1.219
FORMS Cell Lines Hu-B1.219* Form 1.DELTA. Form 3.DELTA. MRC5 (Lung
fibroblast) ++ +/- + KG1a (lymphoblast) + - ++ Raji (B cell
lymphoma) + - + Kit 225/K6 (T cell) +++ - + K562 (myelogenous
leukemia) ++++ +++ ++++ Human Fetal Liver (positive +++ +++ +++
control) *Analysis by Northern blots .DELTA.Analysis by RT/PCR
[0123] Various human tissue RNA were probed with a radiolabelled
Hu-B1.219 fragment corresponding to nucleotide numbers from #578 to
#1107 as disclosed in FIG. 1A-1G for Northern blot analyses. Two
different size mRNAs were detected. This result suggests that there
may be another homologous gene or there is alternative splicing of
a single RNA transcript. Hu-B1.219 expression was by far the
strongest in human fetal tissues, particularly the liver and lung.
Trace levels were found in several adult tissues. Interestingly, a
chronic myelogenous leukemia cell line, K562 (Table 2), was
strongly positive for its expression, while some expression was
also detected in A549 cells, a lung carcinoma cell line (Table 4).
A representative northern lot showing the expression of Hu-B1.219
in several human tissues is presented in FIG. 4. Using more
sensitive PCR, Hu-B1.219 was also detected in bone marrow.
3TABLE 3 EXPRESSION OF Hu-B1.219 IN CELL LINES BY PCR Tissue Type
Cell Lines Hu-B1.219 Hu-B1.219.1 Hu-B1.219.4 Hematopoietic K562
++++ +++ ++ HEL ++++ ++ ++++ Mo7e + +/- - Endothelial HYSE ++++ ++
++ HYS-VS1 + - + HuVEC ++ + - ECV304 ++ + - CNS U188MG ++ + - SF295
+ + +/- U251 ++ + + SNB75 + + + U87MG +++ ++ ++ SNB19 ++ + + SF539
++ + + Breast DU4475 ++ ++ ++ MCF-7 + + +/- Muscle 143B ++ + +
fetal +++ ++ +++ myoblast Hu-B1.219 refers to all isoforms
detected. Hu-B1.219.1 refers to Form 1 only. Hu-B1.219.4 refers to
the isoform reported to be human OB-R.
[0124]
4TABLE 4 SUMMARY OF NORTHERN BLOT ANALYSIS OF Hu-B1.219 EXPRESSION
IN HUMAN TISSUES AND CELL LINES Developmental Stage Tissue Type
Expression fetal brain - lung +++ liver +++++ kidney + adult heart
++ brain +/- placenta + lung + liver +++ skeletal muscle + kidney
+/- pancreas + spleen +/- thymus +/- prostate ++ testis +/- ovary
+++ small intestine ++ colon - peripheral blood - leukocytes cancer
HL-60 - HeLa - K-562 +++ MOLT-4 - Raji - SW480 - A549 + G361 -
[0125] Taken together, the data indicates that the Hu-B1.219
represents a new member of the human hematopoietin receptor family.
It was originally cloned from a hematopoietic tissue, fetal liver.
It is expressed by certain fetal tissues, and shares structural
homology with several receptors which interact with ligands capable
of influencing hematopoietic development. In this regard, it shares
certain sequence homology with the IL-6R, IL-4R, G-CSFR, IL-3R beta
chain, gp130, IL-12R, and LIFR. It contains two "WS box" motifs
with the correct spacing of conserved amino acids in the FN III
domains, an amphipathic sequence in block 3 of the FN III domains,
and alternating hydrophobic and basic amino acids in block 6 of the
FN III domains. It also contains conserved cysteines in the
cysteine rich regions upstream of the FN III domains.
[0126] Despite its structural similarities with receptors expressed
by hematopoietic cells, the extracellular domain of Hu-B1.219 is
nearly identical to that of the human OB-R expressed in the brain.
In fact, since three variant forms of Hu-B1.219 have been isolated,
which show extensive sequence diversity primarily in their
intracellular cytoplasmic domains, OB-R may be considered an
additional isoform of the same receptor. The data presented in
Table 3 further confirm that the OB-R is expressed not only in
cells of the brain, but also in hematopoietic and endothelial
cells. Therefore, since leptin binds to OB-R, it is also a ligand
that can trigger Hu-B1.219 activation in hematopoietic and
endothelial cells that express these receptor variants.
7. EXAMPLE
Hu-B1.219 is Expressed by Long-Term Repopulating Hematopoietic
Progenitor Cells
[0127] 7.1. Materials and Methods
[0128] 7.1.1. RNA Extraction and cDNA Synthesis
[0129] Total RNA was extracted using the recommended procedure for
RNAzol reagent (Biotecx). RNA was added at 1 .mu.g/2 .mu.l of a
random hexamer primed RT cDNA synthesis reaction. Mock RT reactions
were also performed for each of the experimental samples. RT
reactions were incubated at room temperature for 10 minutes,
42.degree. C. for 15 minutes, 99.degree. C. for 5 minutes and a
4.degree. C. hold. All PCR reagents were obtained from Perkin
Elmer.
[0130] 7.1.2. PCR Conditions
[0131] The quality of each cDNA and mock cDNA was determined by the
relative level of amplification of the .beta.-actin gene. The
conditions for actin amplification were 94.degree. C. for 30
seconds; 55.degree. C. for 30 seconds; 72.degree. C. for 30 seconds
for 27 to 30 cycles followed by a 72.degree. C. extension for 5
minutes and a 4.degree. C. hold. The DNA sequence of the
.beta.-actin primers were (forward) 5'GTGACGGCCCAGAGCAAGAG-3' (SEQ
ID NO: 19) and (reverse) 5'-AGGGGCCGGACTCATCGTACTC-3' (SEQ ID NO:
20).
[0132] PCR amplification conditions for murine homolog of Hu-B1.219
and CD34 were 94.degree. C. for 30 seconds; 60.degree. C. for 30
seconds; 72.degree. C. for 30 seconds for 40 to 45 cycles followed
by a 72.degree. C. extension for 5 minutes and a 4.degree. C. hold.
The primer sequences for Hu-B1.219 were (forward)
5'-GGTCAGAAGATGTGGGAAA-31 (SEQ ID NO: 21) and (reverse)
5'-GTGCCCAGGAACAATTCTT-3' (SEQ ID NO: 22). These PCR primers
amplified both human and murine sequences. The CD34 primer
sequences for human were (forward) 5'-CTCTTCTGTCCAGTCACAGACC-3'
(SEQ ID NO: 23), and (reverse) 5'-GAATAGCTCTGGTGGCTTGC-3' (SEQ ID
NO: 24). The CD34 primer sequences for murine were (forward)
5'-CTACCACGGAGACTTCTACAC-- 3' (SEQ ID NO: 25) and (reverse)
5'-TGGATCCCCAGCTTTCTCAA-3' (SEQ ID NO: 26). The PCR products ere
analyzed on a 1.5% TAE agarose gel containing 0.5 .mu.g thidium
bromide/ml of buffer.
[0133] 7.2. Results
[0134] Section 6.2, supra, demonstrates that Hu-B1.219 is expressed
in hematopoietic and endothelial cells. In this connection, its
expression in fetal liver is consistent with the high hematopoietic
activities in the fetal liver, and its expression in fetal lung is
consistent with the high level of endothelial development in fetal
lung. To more precisely determine the expression of Hu-B1.219 in
different populations of hematopoietic cells, human bone marrow
cells were highly enriched for hematopoietic stem cells by cell
sorting based on their CD34 expression (Collins et al., 1994, Stem
Cells 12: 577-585; Berenson, 1993, J. Hematother. 2: 347-349; Civin
and Gore, 1993, J. Hematother. 2: 137-144). When RNA extracted from
human CD34.sup.+ and CD34.sup.- bone marrow fractions were reacted
with Hu-B1.219 primers in PCR, Hu-B1.219 message was detected in
both fractions (FIG. 5A). The fact that only the CD34.sup.+
fraction expressed CD34 message in PCR demonstrates the purity of
the sorted population (FIG. 5B). Since the CD34.sup.- fraction
contained several cell types, the detected Hu-B1.219 message might
have been produced by endothelial cells. Alternatively, Hu-B1.219
may be expressed by a CD34.sup.- hematopoietic stem cell.
[0135] The expression of Fc receptors (FcR) and AA4.1 antigen in
murine fetal liver cells has been used to define distinct fetal
liver precursor cell subpopulations (Carlsson et al., 1995, Eur. J.
Immunol. 25: 2308-2317; Jordan et al., 1995, Exp. Hematol. 23:
1011-1015; Trevisan and Iscove, 1995, J. Exp. Med. 181: 93-103).
Sorting murine fetal liver cells (day 12) based on the expression
of these two markers has resulted in the isolation of a small
(2-4%) subpopulation of AA4.1.sup.+ and FcR.sup.- cells that are
highly enriched for primitive hematopoietic stem cells. Animal
repopulating experiments have shown that fetal liver cells with
this phenotype contain long-term repopulating potential upon
adoptive transfer into recipients with destroyed
lympho-hematopoietic system. Therefore, fetal liver cells were
sorted into various fractions based on expression of AA4.1 and FcR,
and primers designed from Hu-B1.219 that would amplify murine
Hu-B1.219 message were used to detect its expression. FIGS. 6A and
6B shows that the highly enriched AA4.1.sup.+/FCR.sup.-
subpopulation was the only population at this stage that expressed
Hu-B1.219, whereas CD34 mRNA was detected in all fractions tested.
This result indicates that while CD34 has been used as a marker of
hematopoietic progenitor cells, Hu-B1.219 marks with greater
specificity the long-term repopulating cells within the CD34.sup.+
fraction. In addition, Hu-B1.219 expression was also observed in
the subpopulation of murine adult bone marrow sorted for Ly-6
expression but negative for mature lineage markers. This
fractionation procedure is a well established technique for
isolating a highly purified population of hematopoietic stem cells
from bone marrow (Li et al., 1992, J. Exp. Med. 175: 1443-1447;
Spangrude and Brooks, 1993, Blood 82: 3327-3332; Szilvassy and
Cory, 1993, Blood 81: 2310-2320). Furthermore, murine fetal liver
cells enriched for long-term repopulating cells by a recently
developed method utilizing expression of the Mac-1 marker also
expressed Hu-B1.219 (Morrison et al., 1995, Proc. Natl. Acad. Sci.
USA 92: 10302-10306). Taken collectively, the aforementioned mouse
and human studies indicate that Hu-B1.219 is a marker of a
subpopulation of early progenitor cells within the CD34.sup.+
fraction. In particular, Hu-B1.219 expression in long-term
repopulating cells allows its use as a marker for their isolation.
In this regard, an antibody specific for Hu-B1.219 or leptin may be
used alone or in combination with a progenitor cell-specific
antibody such as anti-CD34. For example, human bone marrow cells
can be separated first into CD34.sup.+ cells followed by Hu-B1.219
sorting to obtain such progenitor cells. In addition, since
Hu-B1.219 expression is detected in a CD34.sup.- subpopulation, it
can also be used as a marker to isolate a CD34.sup.- stem cell.
[0136] Additionally, early embryonic yolk sac cells have been
described to possess the potential of giving rise to both
hematopoietic and endothelial cells (Wagner and Antczak, 1995,
WO95/02038). In the yolk sac, endothelial cells also produce the
microenvironment for hematopoietic differentiation and
proliferation. It is important to note that yolk sac cells with
endothelial potential (Wei et al., 1995, Stem Cells 13: 541-547)
have also been shown to express Hu-B1.219. Therefore, Hu-B1.219 may
also be used as a marker for endothelial progenitor cells.
8. EXAMPLE
Recombinant Leptin Stimulates Bone Marrow Colony Formation
[0137] 8.1. Materials and Methods
[0138] 8.1.1. Production of Recombinant Leptin
[0139] Total RNA was isolated, using RNAzol method, from brown
adipose tissue from C57B mice. RT-PCR was performed using the
Boehringer Mannheim "High Fidelity PCR System." PCR primers: murine
leptin U462 GGAATTCCATATGGTGCCTATCCAGAA (SEQ ID NO: 27) and L462
GCGGATCCTCAGCATTCAGGGCTAA (SEQ ID NO: 28) were designed based on
Genbank sequence U18812 (Zhang et al., 1995, NATURE 372: 425-432).
The PCR product was purified using the Promega Wizard column. The
PCR fragment was cut with NdeI and BamHI and cloned into NdeI-BamHI
cleaved pET15b vector (Novagen). Clones were obtained first in E.
coli strain DH10B (GibcoBRL), then transferred to the BL21 (DE3)
(Novagen) host for production. Two splicing variants of mOB ere
identified. One that was missing a single glutamine amino acid at
residue #49 from the iniator Met and one that had a glutamine at
that position. Proteins were made from both clones. Murine leptin
was made in E. coli as a fusion protein with poly histidine on the
amino terminus. Recombinant murine leptin was produced as insoluble
inclusion bodies and purified as described in Sambrook et al.,
supra. The insoluble material was denatured and "refolded" to
reconstitute biologically active leptin. Inclusion bodies were
dissolved in 8M Urea plus 100 mM DTT, diluted {fraction (1/100)}
into a "refolding reaction buffer" (100 mM Tris pH8.3, 100 mM
(NH.sub.4).sub.2SO.sub.4, 100 .mu.M Triton X100, 2 mM reduced
glutathione, 0.4 mM oxidized glutathione) and incubated at
4.degree. C. for 3 to 5 days. The refolded leptin was recovered by
adding the histidine binding resin (Novagen) for 1 hr. The resin
was recovered by centrifugation, rinsed with Novagen "binding
buffer", and the Novagen "wash buffer". The leptin was eluted from
the resin with Novagen "elution buffer" plus 1M imidazole. The
final step was dialysis in PBS.
[0140] 8.1.2. Methylcellulose Colony Forming Assays
[0141] Adult bone marrow cells were isolated from normal C5-7BL/6
female mice, ob/ob mice and db/db mice. About 1.times.10.sup.6
viable cells were suspended in Iscove's Modified Dulbecco's Medium
(IMDM) with either 0.5 to 15% fetal calf serum (FCS). The cells
(1-100.times.10.sup.3/ml) were then mixed with IMDM that contained
methylcellulose (1.3%) (Sawyer-Biddle, NY, N.Y.), FCS (4%), BSA
(1%), monothioglycerol (100 .mu.M), gentamicin (50 .mu.g/ml),
purified recombinant leptin (1 ng/ml), IL-3 (100 pg/ml), GM-CSF (1
ng/ml) and EPO (2 U/ml). After mixing, 1 ml of the mixture was
dispensed into a 25 mm bacterial grade culture dishes at 37.degree.
C. in a humidified incubator for 3 days. Using an inverted
microscope, CFU-e, BFU-e and GEMM .gtoreq.4 cells ere counted
(Metcalf, 1984, Clonal Culture of Hematopoietic Cells: Techniques
and Applications, Elsevier, N.Y.; Freshney, 1994, in Culture of
Hematopoietic Cells, Wiley-Liss, Inc., p. 265-68).
[0142] 8.2. Results
[0143] Recombinant leptin was tested for its ability to stimulate
bone marrow cells to form hematopoietic colonies in ethylcellulose
assays. When normal mouse bone marrow cells were incubated with
leptin in the presence of IL-3, GM-CSF and EPO, a two-fold increase
in the number of CFU-e was observed as compared to the cells
stimulated with medium containing the cytokines except leptin (FIG.
7). Similarly, leptin caused an increased number of CFU-e from
ob/ob mouse bone marrow. In contrast, leptin did not stimulate
CFU-e from db/db mouse bone marrow, an observation consistent with
the belief of an aberrant OB-R expressed by such animals (Chen et
al., 1996 Cell 84: 491-495).
[0144] Additionally, leptin also stimulated other types of colonies
from normal mouse bone marrow. For example, BFU-e was induced by
leptin incubation, indicating that leptin acts on early progenitor
cells of the erythroid lineage (FIG. 8). Furthermore, leptin also
stimulated the formation of early CFU-GM colonies, indicating its
effects on granulocyte, erythroid, macrophage and megakaryocyte
lineages. When freshly isolated murine yolk sac cells were
incubated with leptin alone, cellular proliferation and erythroid
development were also induced. In conclusion, the Hu-B1.219/OB-R is
not only expressed in early hematopoietic progenitor cells, it
renders these cells responsive to leptin stimulation resulting in
cellular proliferation and differentiation into cell types of
diverse hematopoietic lineages. Thus, leptin is a growth and
differentiation factor of hematopoietic progenitor cells.
[0145] 9. Deposit of Microorganisms
[0146] The following organisms were deposited with the American
Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville,
Md. 20852.
5 Strain Designation Accession No. Hu-B1.219, #1 75885 Hu-B1.219,
#4 75886 Hu-B1.219, #8 75887 Hu-B1.219, #33 75888 Hu-B1.219, #34
75889 Hu-B1.219, #36 75890 Hu-B1.219, #55 75971 Hu-B1.219, #60
75973 Hu-B1.219, #3 75970 Hu-B1.219, #57 75972 Hu-B1.219, #62
75974
[0147] The use in the present application of the computer readable
Sequence Listing submitted Mar. 27, 1998 in U.S. patent application
Ser. No. 08/618,957 is hereby requested. The computer readable
Sequence Listing on file for U.S. patent application Ser. No.
08/618,957 is identical to the paper copy (29 pages) submitted with
the present application.
[0148] The present invention is not to be limited in scope by the
exemplified embodiments, which are intended as illustrations of
individual aspects of the invention. Indeed, various modifications
for the invention in addition to those shown and described herein
will become apparent to those skilled in the art from the foregoing
description and accompanying drawings. Such modifications are
intended to fall within the scope of the appended claims.
[0149] All publications cited herein are incorporated by reference
in their entirety.
Sequence CWU 1
1
* * * * *