U.S. patent application number 11/020026 was filed with the patent office on 2005-07-21 for altering memory by affecting staufen function.
This patent application is currently assigned to Helicon Therapeutics, Inc.. Invention is credited to Bourtchouladze, Rusiko, Scott, Roderick E.M., Tully, Timothy P..
Application Number | 20050158243 11/020026 |
Document ID | / |
Family ID | 30000737 |
Filed Date | 2005-07-21 |
United States Patent
Application |
20050158243 |
Kind Code |
A1 |
Tully, Timothy P. ; et
al. |
July 21, 2005 |
Altering memory by affecting STAUFEN function
Abstract
The present invention provides methods for screening a
pharmaceutical agent for its ability to modulate long term memory
formation, performance of a hippocampal-dependent cognitive task or
STAUFEN function. The present invention also provides methods for
modulating long term memory formation or performance of a
hippocampal-dependent cognitive task by modulating
staufen-dependent protein expression. The present invention further
provides methods for treating a defect in long term memory
formation associated with a defect in STAUFEN and methods for
treating a defect in performance of a hippocampal-dependent
cognitive task associated with a defect in STAUFEN.
Inventors: |
Tully, Timothy P.; (Cold
Spring Harbor, NY) ; Scott, Roderick E.M.; (New York,
NY) ; Bourtchouladze, Rusiko; (New York, NY) |
Correspondence
Address: |
HAMILTON, BROOK, SMITH & REYNOLDS, P.C.
530 VIRGINIA ROAD
P.O. BOX 9133
CONCORD
MA
01742-9133
US
|
Assignee: |
Helicon Therapeutics, Inc.
Farmingdale
NY
|
Family ID: |
30000737 |
Appl. No.: |
11/020026 |
Filed: |
December 21, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11020026 |
Dec 21, 2004 |
|
|
|
PCT/US03/20125 |
Jun 25, 2003 |
|
|
|
60391687 |
Jun 25, 2002 |
|
|
|
Current U.S.
Class: |
424/9.2 ;
435/6.13; 514/44R |
Current CPC
Class: |
A61P 25/00 20180101;
G01N 33/5008 20130101; G01N 33/5023 20130101; G01N 33/5088
20130101; G01N 33/502 20130101; G01N 33/6896 20130101; G01N 33/5035
20130101; G01N 33/5058 20130101; A61P 25/28 20180101; G01N 2500/00
20130101 |
Class at
Publication: |
424/009.2 ;
435/006; 514/044 |
International
Class: |
A61K 049/00; C12Q
001/68; A61K 048/00 |
Claims
1. a method of screening for or identifying a pharmaceutical agent
capable of modulating staufen function comprising the steps of: a)
introducing a pharmaceutical agent of interest into host cells
expressing a STAUFEN::indicator fusion protein; and b) determining
STAUFEN function, wherein a difference in the STAUFEN function
determined in b) compared to the STAUFEN function of host cells of
a) to which said pharmaceutical agent has not been administered
identifies the pharmaceutical agent as one capable of modulating
STAUFEN function.
2. The method of claim 1, wherein STAUFEN function is determined by
detecting and determining the level of STAUFEN::indicator fusion
protein expression.
3. The method of claim 1, wherein STAUFEN function is determined by
detecting and determining the level of STAUFEN::indicator fusion
protein mRNA produced.
4. The method of claim 1, wherein STAUFEN function is determined by
detecting and determining the level of STAUFEN::indicator fusion
protein produced.
5. The method of claim 1, wherein STAUFEN function is determined by
detecting translocation of STAUFEN::indicator fusion protein into
dendrites.
6. The method of claim 1, wherein STAUFEN function is determined by
measuring downstream gene products regulated by a staufen gene
product.
7. The method of claim 1, wherein STAUFEN function is determined by
determining the distribution of neural granules in the cells.
8. A method of screening a pharmaceutical agent for its ability to
modulate long term memory formation in a mammal, comprising the
steps of: a) administering to a mammal a pharmaceutical agent of
claim 1 which modulates STAUFEN function; b) training the mammal of
step a) and a control mammal of the same species to which said
pharmaceutical agent has not been administered under conditions
sufficient to produce long term memory formation in said mammal; c)
assessing long term memory formation in the mammals trained in step
b); and d) comparing long term memory formation in the mammals
assessed in step c), wherein a difference in long term memory
formation assessed in the mammal administered the pharmaceutical
agent relative to long term memory formation assessed in the
control mammal identified the pharmaceutical agent as one which
capable of modulating long term memory formation in said
mammal.
9. The method of claim 8, wherein the animal is a rodent.
10. A method of screening a pharmaceutical agent for its ability to
modulate performance of a hippocampal-dependent cognitive task by a
mammal, comprising the steps of: a) administering to a mammal a
pharmaceutical agent of claim 1 which modulates STAUFEN function;
b) training the mammal of step a) and a control mammal of the same
species to which said pharmaceutical agent has not been
administered under conditions sufficient for performance of a
specified hippocampal-dependent cognitive task by the mammal; c)
assessing performance of the hippocampal-dependent cognitive task
by the mammals trained in step b); and d) comparing performance of
the mammals assessed in step c), wherein a difference in
performance of the specified hippocampal-dependent cognitive task
by the mammal administered the pharmaceutical agent relative to
performance of the cognitive task by the control mammal identifies
the pharmaceutical agent as one which capable of modulating
performance of the specified hippocampal-dependent cognitive task
by the mammal.
11. The method of claim 10, wherein the mammal is a rodent.
12. A method of screening a pharmaceutical agent for its ability to
modulate long term memory formation in a mammal, comprising the
steps of: a) administering a pharmaceutical agent of interest to a
first mammal; b) determining STAUFEN function in said mammal
administered the pharmaceutical agent in step a) relative to
STAUFEN function in a control mammal of the same species as said
first mammal to which said pharmaceutical agent has not been
administered; c) selecting the pharmaceutical agent if STAUFEN
function determined in step b) differs from the STAUFEN function in
said control mammal; d) administering the pharmaceutical agent
selected in step c) to a second mammal; e) training said second
mammal administered the pharmaceutical agent in step d) and a
control mammal of the same species as the second mammal to which
said pharmaceutical agent has not been administered under
conditions appropriate to produce long term memory formation in the
mammals; f) assessing long term memory formation in the mammals
trained in step e); and g) comparing long term memory formation in
the mammals assessed in step f).
13. The method of claim 12, wherein said mammal has a defect in
long term memory formation associated with a defect in STAUFEN
function.
14. The method of claim 12, wherein said mammal is a rodent.
15. A method of screening a pharmaceutical agent for its ability to
modulate performance of a hippocampal-dependent cognitive task by a
mammal, comprising the steps of: a) administering a pharmaceutical
agent of interest to a first mammal; b) determining STAUFEN
function in said mammal administered the pharmaceutical agent in
step a) relative to STAUFEN function in a control mammal of the
same species a as the first mammal to which said pharmaceutical
agent has not been administered; c) selecting said pharmaceutical
agent if STAUFEN function determined in step b) differs from the
STAUFEN function in said control mammal; d) administering the
pharmaceutical agent selected instep c) to a second mammal; e)
training said second mammal administered the pharmaceutical agent
in step d) and a control mammal of the same species as the second
mammal to which said pharmaceutical agent has not been administered
under conditions appropriate for performance of a specified
hippocampal-dependent cognitive task by the mammals; f) assessing
performance of said hippocampal-dependent cognitive task by the
mammals trained in step e); and g) comparing performance of said
hippocampal-dependent cognitive task by the mammals assessed in
step f).
16. The method of claim 15, wherein said mammal is a rodent.
17. A method of screening a pharmaceutical agent for its ability to
modulate STAUFEN function in a mammal, comprising the steps of: a)
administering a pharmaceutical agent of interest to said mammal;
and b) determining STAUFEN function in said mammal administered
said pharmaceutical agent in step a) relative to STAUFEN function
in a control mammal of the same species to which said
pharmaceutical agent has not been administered.
18. The method of claim 17, wherein said mammal has a defect in
long term memory formation associated with a defect in STAUFEN
function.
19. The method of claim 17, wherein said mammal is a rodent.
20. A method of modulating long term memory formation in a mammal
comprising modulating STAUFEN function in said animal.
21. The method of claim 20, wherein long term memory formation is
enhanced.
22. The method of claim 20, wherein modulating STAUFEN function
comprises administering to said mammal a pharmaceutical agent which
modulates STAUFEN function in said mammal, in an amount effective
to modulate STAUFEN function in said mammal.
23. The method of claim 20, wherein said mammal is a rodent or a
human.
24. The method of claim 20 comprising modulating STAUFEN protein
expression in said mammal.
25. The method of claim 24, wherein long term memory formation is
enhanced.
26. The method of claim 24, wherein modulating STAUFEN protein
expression comprises administering to said mammal a pharmaceutical
agent which modulates STAUFEN protein expression in said mammal, in
an amount effective to modulate STAUFEN protein expression.
27. The method of claim 24, wherein said mammal is a rodent or a
human.
28. A method of treating a mammal with a defect in long term memory
formation associated with a defect in STAUFEN comprising increasing
STAUFEN function in said mammal relative to STAUFEN function in
said mammal prior to said treatment.
29. The method of claim 28, wherein increasing STAUFEN function
comprises administering to said mammal a pharmaceutical agent which
is capable of increasing STAUFEN function in said mammal, in an
amount effective to increase STAUFEN function relative to STAUFEN
function in said mammal prior to administration of said
pharmaceutical agent.
30. The method of claim 28, wherein said mammal is a rodent or a
human.
31. The method of claim 28 comprising increasing STAUFEN protein
expression in said mammal relative to STAUFEN protein expression in
said mammal prior to said treatment.
32. The method of claim 31, wherein increasing STAUFEN protein
expression comprises administering to said mammal a pharmaceutical
agent which increases STAUFEN protein expression in said mammal, in
an amount effective to increase STAUFEN protein expression relative
to STAUFEN protein expression in said mammal prior to
administration of said pharmaceutical agent.
33. The method of claim 31, wherein said mammal is a rodent or a
human.
34. The method of claim 28 comprising administering to said mammal
an effective amount of STAUFEN, STAUFEN analog, biologically active
STAUFEN fragment or STAUFEN fusion protein.
35. The method of claim 34, wherein said mammal is a rodent or a
human.
36. The method of claim 28 comprising administering to said mammal
an effective amount of a nucleic acid sequence encoding STAUFEN,
STAUFEN analog, biologically active STAUFEN fragment or STAUFEN
fusion protein.
37. The method of claim 36, wherein said mammal is a rodent or a
human.
38. The method of claim 36, wherein the nucleic acid sequence is
incorporated into a viral vector.
39. A method of modulating performance by a mammal of a
hippocampal-dependent cognitive task comprising modulating STAUFEN
function in said mammal.
40. The method of claim 39, wherein performance by a mammal of a
hippocampal-dependent cognitive task is enhanced.
41. The method of claim 39, wherein modulating STAUFEN function
comprises administering a pharmaceutical agent which modulates
STAUFEN function in said mammal, in an amount effective to modulate
STAUFEN function in said mammal.
42. The method of claim 39, wherein said mammal is a rodent or a
human.
43. The method of claim 39 comprising modulating STAUFEN protein
expression.
44. The method of claim 43, wherein performance by a mammal of a
hippocampal-dependent cognitive task is enhanced.
45. The method of claim 43, wherein modulating STAUFEN protein
expression comprises administering a pharmaceutical agent which
modulates STAUFEN protein expression in said mammal, in an amount
effective to modulate STAUFEN protein expression in said
mammal.
46. The method of claim 43, wherein said mammal is a rodent or a
human.
47. A method of treating a mammal with a defect in performance of a
hippocampal-dependent cognitive task, said defect in performance
associated with a defect in STAUFEN, comprising increasing STAUFEN
function in said mammal relative to STAUFEN function in said mammal
prior to said treatment, thereby resulting in treatment of said
mammal.
48. The method of claim 47, wherein increasing STAUFEN function
comprises administering to said mammal a pharmaceutical agent which
increases STAUFEN function in said mammal, in an amount effective
to increase STAUFEN function relative to STAUFEN function in said
mammal prior to administration of said pharmaceutical agent.
49. The method of claim 47, wherein said mammal is a rodent or a
human.
50. The method of claim 47 comprising increasing STAUFEN protein
expression in said mammal relative to STAUFEN protein expression in
said mammal prior to said treatment.
51. The method of claim 50, wherein increasing STAUFEN protein
expression comprises administering to said mammal a pharmaceutical
agent which increases STAUFEN protein expression in said mammal, in
an amount effective to increase STAUFEN protein expression relative
to STAUFEN protein expression in said mammal prior to
administration of said pharmaceutical agent.
52. The method of claim 50, wherein said mammal is a rodent or a
human.
53. The method of claim 47 comprising administering to said mammal
an effective amount of STAUFEN, STAUFEN analog, biologically active
STAUFEN fragment or STAUFEN fusion protein.
54. The method of claim 53, wherein said mammal is a rodent or a
human.
55. The method of claim 47 comprising administering to said mammal
an effective amount of a nucleic acid sequence encoding STAUFEN,
STAUFEN analog, biologically active STAUFEN fragment or STAUFEN
fusion protein.
56. The method of claim 55, wherein said mammal is a rodent or a
human.
57. The method of claim 55, wherein the nucleic acid sequence is
incorporated into a viral vector.
Description
RELATED APPLICATION(S)
[0001] This application is a continuation of International
Application No. PCT/US2003/020125, which designated the United
States and was filed Jun. 25, 2003, published in English, which
claims the benefit of U.S. Provisional Application No. 60/391,687,
filed Jun. 25, 2002. The entire teachings of the above applications
are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Long term memory (LTM) involves induction of a cascade of
gene expression (Davis, H. P. and Squire, L. R., Psychol. Bull.,
96:518-559 (1984); Tully, T. et al., Cell, 79:35-47 (1994); Yin, J.
C. et al., Cell, 79:49-58 (1994); Yin, J. C. et al., Cell,
81:107-115 (1995); Josselyn, S. A. et al., J. Neurosci.,
21:2404-2412 (2001); Alberini, C. M. et al., Cell, 76:1099-1114
(1994); and Taubenfeld, S. M. et al., J. Neurosci., 21:84-91
(2001)) under control of the CREB transcription factor (Davis, H.
P. and Squire, L. R., Psychol. Bull., 96:518-559 (1984); Tully, T.
et al., Cell, 79:35-47 (1994); Yin, J. C. et al., Cell, 79:49-58
(1994); Yin, J. C. et al., Cell, 81:107-115 (1995); Josselyn, S. A.
et al., J. Neurosci., 21:2404-2412 (2001); Alberini, C. M. et al.,
Cell, 76:1099-1114 (1994); and Taubenfeld, S. M. et al., J.
Neurosci., 21:84-91 (2001)), which leads to structural and
functional changes in specific synapses (Bartsch, D. et al., Cell,
83:979-992 (1995); and Dash, P. K. et al., Nature, 345:718-721
(1990)). LTM is disrupted by induced over-expression of a CREB
repressor transgene in flies (Yin, J. C. et al., Cell, 79:49-58
(1994)), by partial knock-out of CREB in mice (Bourtchuladze, R. et
al., Cell, 79:59-68 (1994)), by knock-down of CREB with anti-sense
RNA in rats (Guzowski, J. F. and McGaugh, J. L., Proc. Natl. Acad.
Sci. USA, 94:2693-2698 (1997); and Lamprecht, R. et al., J.
Neurosci., 17:8443-8450 (1997)) or by induced over expression of a
dominant-negative CREB in mice (Kida, S. et al., Nat. Neurosci.,
5:348-355 (2002); and Pittenger, C. et al., Neuron, 34:447-462
(2002)). Synaptic plasticity is disrupted similarly in Aplysia
(Bartsch, D. et al., Cell, 83:979-992 (1995)), in flies (Davis, G.
W. et al., Neuron, 17:669-679 (1996); and Sanyal, S. et al.,
Nature, 416:870-874 (2002)) and in mice (Bourtchuladze, R. et al.,
Cell, 79:59-68 (1994); Barco, A. et al., Cell, 108:689-703 (2002);
and Casadio, A. et al., Cell, 99:221-237 (1999)). Strikingly, over
expression of CREB activator in transgenic flies, or in
virus-infected rats, enhances LTM (Yin, J. C. et al., Cell,
81:107-115 (1995); and Josselyn, S. A. et al., J. Neurosci.,
21:2404-2412 (2001)), while analogous modulations of CREB activator
enhance (i) long-term facilitation (LTF) and the concomitant growth
of synaptic connections in sensorimotor neuron co-cultures of
Aplysia (Bartsch, D. et al., Cell, 83:979-992 (1995)) and (ii)
long-term potentiation (LTP) in rat hippocampus (Barco, A. et al.,
Cell, 108:689-703 (2002)). These convergent data establish that
long-term memory (LTM) formation requires gene transcription (Yin,
J. C. et al., Cell, 81:107-115 (1995); Abel, T. et al., Science,
279:338-341 (1998); and Tully, T., Proc. Natl. Acad. Sci. USA,
94:4239-4241 (1997)).
[0003] This insight has raised two new questions. First,
specifically what genes are regulated during LTM formation?
Attempts to answer this question have been pursued with in vitro
models of neuronal plasticity, with strong pharmacological
stimulation in vivo and, in a few cases, with behavioral training
(Cole, A. J. et al., Nature, 340:474-476 (1989); Hevroni, D. et
al., J. Mol. Neurosci., 10:75-98 (1998); Irwin, L. N., Brain Res.
Mol. Brain Res., 96:163-169 (2001); Luo, Y. et al., J. Mol.
Neurosci., 17:397-404 (2001); Cavallaro, S. et al., Eur. J.
Neurosci., 13:1809-1815 (2001); Nedivi, E. et al., Nature,
363:718-722 (1993); and Nedivi, E. et al., Proc. Natl. Acad. Sci.
USA, 93:2048-2053 (1996)). Second, how does a transcriptional
response in the cell nucleus tag only a subset of synapses involved
in LTM (Barco, A. et al., Cell, 108:689-703 (2002); Casadio, A. et
al., Cell, 99:221-237 (1999); Frey, U. and Morris, R. G., Nature,
385:533-536 (1997); Martin, K. C. et al., Cell, 91:927-938 (1997);
Steward, O. et al., Neuron, 21:741-751 (1998); Steward, O. and
Schuman, E. M., Annu. Rev. Neurosci., 24:299-325 (2001); Steward,
O. and Worley, P. F., Proc. Natl. Acad. Sci. USA, 98:7062-7068
(2001); Steward, O. and Worley, P. F., Neuron, 30:227-240 (2001);
and Steward, O. and Worley, P., Results Probl. Cell. Differ.,
34:1-26 (2001))? Thus far, analyses of in vitro models of synaptic
plasticity have described the cellular phenomenology of synapse
specific modification but have not yet identified the cellular
machinery or established a connection to memory.
SUMMARY OF THE INVENTION
[0004] It has been discovered that STAUFEN plays an important role
in mediating the cellular events underlying memory formation in
mammals. As described herein, STAUFEN-mediated mRNA trafficking
within the hippocampus has been discovered to be important for
contextual long-term memory formation in mammals. It has been
discovered that disruption of hippocampal STAUFEN function impairs
long term memory formation in mammals.
[0005] The present invention provides cell-based screening methods
for identifying pharmaceutical agents which are capable of
modulating (have the ability to modulate) STAUFEN function by
screening for STAUFEN function. In one embodiment, STAUFEN function
is screened by determining the level of STAUFEN protein expression
(translation). As described herein, STAUFEN is transcriptionally
upregulated during memory formation. Accordingly, in this
embodiment, STAUFEN protein expression can be determined by
determining STAUFEN mRNA or protein production. In a second
embodiment, STAUFEN function is screened by determining the
functional readout of STAUFEN. In this embodiment, a functional
readout of STAUFEN can be determined by detecting (such as using an
antibody) the translocation of the STAUFEN into dendrites or by
determining the level of STAUFEN protein production. A functional
readout of STAUFEN can also be determined indirectly by detecting
and measuring downstream gene products regulated by a staufen gene
product. In a third embodiment, STAUFEN function is screened by
determining the change in distribution of neural granules in the
cells.
[0006] By "STAUFEN function" is meant the biological activity of
STAUFEN, which includes subcellular translocation of various mRNAs
and local regulation of various protein translations ("the STAUFEN
pathway"). Biological activity is understood to mean biological
function or action. By "STAUFEN pathway function" is meant a set of
gene products which interact with a staufen gene product and/or
with each other to produce STAUFEN function, particularly the
subcellular translocation of mRNA and local regulation of protein
translation.
[0007] In a particular embodiment, STAUFEN::indicator fusion
protein constructs are employed in cell-based screening methods for
identifying a pharmaceutical agent which is capable of modulating
STAUFEN function. Thus, in one embodiment, a cell-based screening
method for identifying a pharmaceutical agent which is capable of
modulating STAUFEN function comprises (a) introducing a
pharmaceutical agent of interest into host cells (particularly
cells of neural origin) expressing a STAUFEN::indicator fusion
protein (e.g., STAUFEN::GFP fusion protein); and (b) determining
STAUFEN function. In a particular embodiment, the pharmaceutical
agent is introduced into cells after stimulation of the CREB
pathway using forskolin, for example. By CREB pathway function is
meant CREB-dependent gene expression. The STAUFEN function
determined in (b) is compared to the STAUFEN function of the host
cells of (a) to which the pharmaceutical agent has not been
introduced (untreated host cells expressing STAUFEN::indicator
fusion protein) (control). A difference in STAUFEN function
determined in the treated cells relative to the STAUFEN function of
untreated cells identifies the pharmaceutical agent as one which
modulates (or is capable of modulating) STAUFEN function. In one
embodiment, STAUFEN function is determined by detecting and
determining the level of STAUFEN::indicator fusion protein
expression (translation) (e.g., by detecting STAUFEN::indicator
fusion protein mRNA or protein production). In a second embodiment,
STAUFEN function is determined by detecting (such as using an
antibody) the translocation of the STAUFEN::indicator fusion
protein into dendrites or by determining the level of
STAUFEN::indicator fusion protein production. In a third
embodiment, STAUFEN function is determined indirectly by detecting
and measuring downstream gene products regulated by a staufen gene
product. In a fourth embodiment, STAUFEN function is determined by
determining the change in distribution of neural granules in the
cells.
[0008] Pharmaceutical agents which modulate, or are capable of
modulating, STAUFEN function are further screened to determine the
effect of the agents on long term memory formation or to identify
those agents capable of modulating long term memory. In one
embodiment, the method comprises (a) administering to an animal
(particularly a mammal) a pharmaceutical agent which modulates, or
is capable of modulating, STAUFEN function; (b) training the animal
of (a) and a control animal of the same species to which the
pharmaceutical has not been administered under conditions
sufficient to produce long term memory formation in the animals;
(c) assessing long term memory formation in the animals trained in
step (b); and (d) comparing long term memory formation in the
animals assessed in step (c). A control animal is the basis for
comparison in assessing results associated with administration of a
pharmaceutical agent to an experimental animal. The experimental
and control animals are comparable, e.g., same age, genetic makeup,
basal STAUFEN function (i.e., STAUFEN function prior to treatment
with the pharmaceutical agent). A difference in long term memory
formation assessed in the animal treated with (administered) the
pharmaceutical agent relative to the long term memory formation
assessed in the control animal identifies the pharmaceutical agent
as one which has the ability to modulate long term memory formation
in the animal.
[0009] Pharmaceutical agents which modulate, or are capable of
modulating, STAUFEN function are also screened to determine the
effect of the agents on performance by an animal of a
hippocampal-dependent cognitive task or to identify those agents
capable of modulating performance of a hippocampal-dependent
cognitive task by an animal. In one embodiment, the method
comprises (a) administering to an animal (particularly a mammal) a
pharmaceutical agent which modulates, or is capable of modulating,
STAUFEN function; (b) training the animal of (a) and a control
animal of the same species to which the pharmaceutical agent has
not been administered under conditions appropriate for performance
by the animals of a specified hippocampal-dependent cognitive task;
(c) assessing performance of the hippocampal-dependent cognitive
task by the animals trained in step (b); and (d) comparing
performance of the animals assessed in step (c). The experimental
and control animals are comparable, e.g., same age, genetic makeup,
basal STAUFEN function (i.e., STAUFEN function prior to treatment
with the pharmaceutical agent). A difference in assessed
performance by the animal treated with (administered) the
pharmaceutical agent relative to the assessed performance by the
control animal identifies the pharmaceutical agent as one which has
the ability to modulate the performance by the animal of the
specified hippocampal-dependent cognitive task.
[0010] The present invention also provides methods of screening a
pharmaceutical agent for its ability to modulate long term memory
formation in a mammal, preferably an adult mammal, comprising (a)
administering a pharmaceutical agent of interest to a first mammal;
(b) determining STAUFEN function in the mammal administered the
pharmaceutical agent (a) relative to STAUFEN function in a control
mammal of the same species as the first mammal to which the
pharmaceutical agent has not been administered; (c) selecting the
pharmaceutical agent if the STAUFEN function determined in (b)
differs from the STAUFEN function in the control mammal; (d)
administering the pharmaceutical agent selected in (c) to a second
mammal; (e) training the second mammal administered the
pharmaceutical agent (d) and a control mammal of the same species
as the second mammal under conditions appropriate to produce long
term memory formation in the mammals; (f) assessing long term
memory formation in the mammals trained in step (e); and (g)
comparing long term memory formation in the mammals assessed in
step (f). The first and second mammals can be of the same or
different species. The first mammal and the corresponding control
mammal are comparable, e.g., same age, genetic makeup, basal
STAUFEN function (i.e., STAUFEN function prior to treatment with
the pharmaceutical agent). Similarly, the second mammal and the
corresponding control mammal are comparable, e.g., same age,
genetic makeup, basal STAUFEN function (i.e., STAUFEN function
prior to treatment with the pharmaceutical agent). A difference in
long term memory formation assessed in the mammal treated with the
pharmaceutical agent relative to the long term memory formation
assessed in the control mammal identifies the pharmaceutical agent
as one which has the ability to modulate long term memory formation
in the mammal.
[0011] The present invention further provides methods of screening
a pharmaceutical agent for its ability to modulate STAUFEN function
in a mammal, preferably an adult mammal, comprising (a)
administering a pharmaceutical agent of interest to a mammal; and
(b) determining STAUFEN function in the mammal administered the
pharmaceutical agent (a) relative to STAUFEN function in a control
mammal of the same species to which the pharmaceutical agent has
not been administered. The experimental and control mammals are
comparable, e.g., same age, genetic makeup, basal STAUFEN function
(i.e., STAUFEN function prior to treatment with pharmaceutical
agent). A difference in STAUFEN function determined in the mammal
treated with the pharmaceutical agent relative to STAUFEN function
determined in the control mammal identifies the pharmaceutical
agent as one having the ability to modulate STAUFEN function in the
mammal.
[0012] The invention further relates to methods for assessing the
effect of a pharmaceutical agent on long term memory formation in a
mammal, preferably an adult mammal, comprising (a) administering a
pharmaceutical agent of interest to a first mammal; (b) determining
STAUFEN function in the mammal administered the pharmaceutical
agent (a) relative to STAUFEN function in a control mammal of the
same species as the first mammal to which the pharmaceutical agent
has not been administered; (c) selecting the pharmaceutical agent
if the STAUFEN function determined in (b) differs from the STAUFEN
function in the control mammal; (d) administering the
pharmaceutical agent selected in (c) to a second mammal; (e)
training the second mammal administered the pharmaceutical agent in
(d) a control mammal of the same species as the second mammal under
conditions appropriate to produce long term memory formation in the
mammals; (f) assessing long term memory formation in the mammals
trained in step (e); and (g) comparing long term memory formation
in the mammals assessed in step (f). The first and second mammals
can be of the same or different species. The first mammal and the
corresponding control mammal are comparable, e.g., same age,
genetic makeup, basal STAUFEN function (i.e., STAUFEN function
prior to treatment with the pharmaceutical agent). Similarly, the
second mammal and the corresponding control mammal are comparable,
e.g., same age, genetic makeup, basal STAUFEN function (i.e.,
STAUFEN function prior to treatment with the pharmaceutical agent).
A difference in long term memory formation assessed in the mammal
treated with the pharmaceutical agent relative to the long term
memory formation assessed in the control mammal identifies the
pharmaceutical agent as one having an effect on long term memory
formation in the mammal.
[0013] The invention also relates to methods of assessing the
effect of a pharmaceutical agent on STAUFEN function in a mammal,
preferably an adult mammal, comprising (a) administering a
pharmaceutical agent of interest to the mammal; and (b) determining
STAUFEN function in the mammal administered the pharmaceutical
agent in (a) relative to STAUFEN function in a control mammal of
the same species to which the pharmaceutical agent has not been
administered. The experimental and control mammals are comparable,
e.g., same age, genetic makeup, basal STAUFEN function (i.e.,
STAUFEN function prior to treatment with pharmaceutical agent). A
difference in STAUFEN function determined in the mammal treated
with the pharmaceutical agent relative to STAUFEN function
determined in the control mammal identifies the pharmaceutical
agent as one having an effect on STAUFEN function in the
mammal.
[0014] The invention also relates to methods of screening a
pharmaceutical agent for its ability to modulate performance of a
hippocampal-dependent cognitive task by a mammal, preferably an
adult mammal, comprising (a) administering a pharmaceutical agent
of interest to a first mammal; (b) determining STAUFEN function in
the mammal administered the pharmaceutical agent (a) relative to
STAUFEN function in a control mammal of the same species as the
first mammal to which the pharmaceutical agent has not been
administered; (c) selecting the pharmaceutical agent if STAUFEN
function determined in (b) differs from the STAUFEN function in the
control mammal; (d) administering the pharmaceutical agent selected
in (c) to a second mammal; (e) training the mammal administered the
pharmaceutical agent in (d) and a control mammal of the same
species as the second mammal under conditions appropriate for
performance by the mammals of a specified hippocampal-dependent
cognitive task; (f) assessing performance of the
hippocampal-dependent cognitive task by the mammals trained in step
(e); and (g) comparing performance of the hippocampal-dependent
cognitive task by the mammals assessed in step (f). The first and
second mammals can be of the same or different species. The first
mammal and the corresponding control mammal are comparable, e.g.,
same age, genetic makeup, basal STAUFEN function (i.e., STAUFEN
function prior to treatment with the pharmaceutical agent).
Similarly, the second mammal and the corresponding control mammal
are comparable, e.g., same age, genetic makeup, basal STAUFEN
function (i.e., STAUFEN function prior to treatment with the
pharmaceutical agent). A difference in assessed performance by the
mammal treated with the pharmaceutical agent relative to the
assessed performance by the control mammal identifies the
pharmaceutical agent as one which has the ability to modulate the
performance by the mammal of the specified hippocampal-dependent
cognitive task.
[0015] The invention further relates to methods for assessing the
effect of a pharmaceutical agent on performance of a
hippocampal-dependent cognitive task by a mammal, preferably an
adult mammal, comprising (a) administering a pharmaceutical agent
of interest to a first mammal; (b) determining STAUFEN function in
the mammal administered the pharmaceutical agent in (a) relative to
STAUFEN function in a control mammal of the same species as the
first mammal to which the pharmaceutical agent has not been
administered; (c) selecting the pharmaceutical agent if the STAUFEN
function determined in (b) differs from the STAUFEN function in the
control mammal; (d) administering the pharmaceutical agent selected
in (c) to a second mammal; (e) training the mammal administered the
pharmaceutical agent in step (d) and a control mammal of the same
species as the second mammal under conditions appropriate for
performance by the mammals of a specified hippocampal-dependent
cognitive task; (f) assessing performance of the
hippocampal-dependent cognitive task by the mammals trained in step
(e); and (g) comparing the performance of the hippocampal-dependent
cognitive task by the mammals assessed in step (f). The first and
second mammals can be of the same or different species. The first
mammal and the corresponding control mammal are comparable, e.g.,
same age, genetic makeup, basal STAUFEN function (i.e., STAUFEN
function prior to treatment with the pharmaceutical agent).
Similarly, the second mammal and the corresponding control mammal
are comparable, e.g., same age, genetic makeup, basal STAUFEN
function (i.e., STAUFEN function prior to treatment with the
pharmaceutical agent). A difference in assessed performance by in
the mammal treated with the pharmaceutical agent relative to the
assessed performance by the control mammal identifies the
pharmaceutical agent as one having an effect on performance by the
mammal of the specified hippocampal-dependent cognitive task.
[0016] Training can comprise one or multiple training sessions and
is training appropriate for long term memory formation or for
performance of the specified cognitive task. The pharmaceutical
agent can be administered before, during or after one or more
training sessions.
[0017] The invention also provides methods for modulating long term
memory formation in a mammal. In a particular embodiment, the
mammal is an adult mammal. In one embodiment, the method comprises
treating the mammal to modulate staufen-dependent protein
expression. In a second embodiment, the method comprises treating
the mammal to modulate STAUFEN function. In a particular
embodiment, the method comprises administering to the mammal an
effective amount of a pharmaceutical agent which modulates STAUFEN
function in the mammal. In another embodiment, the method comprises
treating the mammal to modulate STAUFEN protein expression. In a
particular embodiment, the method comprises administering to the
mammal an effective amount of a pharmaceutical agent which
modulates STAUFEN protein expression in the mammal.
[0018] The present invention also provides methods for enhancing
long term memory formation in a mammal. In a particular embodiment,
the mammal is an adult mammal. In one embodiment, the method
comprises treating the mammal to modulate staufen-dependent protein
expression. In a second embodiment, the method comprises treating
the mammal to increase STAUFEN function relative to the STAUFEN
function in the mammal prior to treatment. In a particular
embodiment, treatment to increase STAUFEN function comprises
administering to the mammal an effective amount of a pharmaceutical
agent which increases STAUFEN function relative to STAUFEN function
in the mammal prior to administration of the pharmaceutical agent.
In another embodiment, the method comprises treating the mammal to
increase STAUFEN protein expression relative to STAUFEN protein
expression in the mammal prior to treatment. In a particular
embodiment, treatment to increase STAUFEN protein expression
comprises administering to the mammal an effective amount of a
pharmaceutical agent which increases STAUFEN protein expression
relative to STAUFEN protein expression in the mammal prior to
administration of the pharmaceutical agent. In still another
embodiment, the method comprises administering to the mammal an
effective amount of exogenous STAUFEN, STAUFEN analog, biologically
active STAUFEN fragment or STAUFEN fusion protein. In yet another
embodiment, the method comprises administering to the mammal an
effective amount of a nucleic acid sequence encoding exogenous
STAUFEN, STAUFEN analog, biologically active STAUFEN fragment or
STAUFEN fusion protein.
[0019] The present invention further provides methods for treating
a mammal with a defect in long term memory formation associated
with a defect in STAUFEN. The mammal is preferably an adult mammal.
The defect in STAUFEN is either a diminution in the amount of
STAUFEN produced, a diminution in STAUFEN function of STAUFEN
produced or both a diminution in amount of STAUFEN produced and
STAUFEN function of STAUFEN produced. In one embodiment, the method
comprises treating a mammal with a defect in long term memory
formation associated with a defect in STAUFEN to increase STAUFEN
function relative to the STAUFEN function in the mammal prior to
treatment. In a particular embodiment, treatment to increase
STAUFEN function comprises administering to the mammal an effective
amount of a pharmaceutical agent which increases STAUFEN function
relative to STAUFEN function in the mammal prior to administration
of the pharmaceutical agent. In a second embodiment, the method
comprises treating a mammal with a defect in long term memory
formation associated with a defect in STAUFEN to increase STAUFEN
protein expression relative to STAUFEN protein expression in the
mammal prior to treatment. In a particular embodiment, treatment to
increase STAUFEN protein expression comprises administering to the
mammal an effective amount of a pharmaceutical agent which
increases STAUFEN protein expression relative to STAUFEN protein
expression in the mammal prior to administration of the
pharmaceutical agent. In a another embodiment, the method comprises
administering to a mammal with a defect in long term memory
formation associated with a defect in STAUFEN, a STAUFEN compound
such as exogenous STAUFEN, STAUFEN analog, biologically active
STAUFEN fragment or STAUFEN fusion protein. In still another
embodiment, the method comprises administering to a mammal with a
defect in long term memory formation with a defect in STAUFEN, a
nucleic acid sequence encoding exogenous STAUFEN, STAUFEN analog,
biologically active STAUFEN fragment or STAUFEN fusion protein.
[0020] The invention also provides methods for modulating
performance of a hippocampal-dependent cognitive task by a mammal.
In a particular embodiment, the mammal is an adult mammal. In one
embodiment, the method comprises treating the mammal to modulate
staufen-dependent protein expression. In a second embodiment, the
method comprises treating the mammal to modulate STAUFEN function.
In a particular embodiment, the method comprises administering to
the mammal an effective amount of a pharmaceutical agent which
modulates STAUFEN function in the mammal. In another embodiment,
the method comprises treating the mammal to modulate STAUFEN
protein expression. In a particular embodiment, the method
comprises administering to the mammal an effective amount of a
pharmaceutical agent which modulates STAUFEN protein expression in
the mammal.
[0021] The present invention provides methods for enhancing
performance of a hippocampal-dependent cognitive task by a mammal.
The mammal is preferably an adult mammal. In one embodiment, the
method comprises treating the mammal to modulate staufen-dependent
protein expression. In a second embodiment, the method comprises
treating the mammal to increase STAUFEN function relative to
STAUFEN function in the mammal prior to treatment. In a particular
embodiment, treatment to increase STAUFEN function comprises
administering to the mammal an effective amount of a pharmaceutical
agent which increases STAUFEN function relative to STAUFEN function
in the mammal prior to administration of the pharmaceutical agent.
In another embodiment, the method comprises treating the mammal to
increase STAUFEN protein expression relative to STAUFEN protein
expression in the mammal prior to treatment. In a particular
embodiment, treatment to increase STAUFEN protein expression
comprises administering to the mammal an effective amount of a
pharmaceutical agent which increases STAUFEN protein expression
relative to STAUFEN protein expression in the mammal prior to
administration of the pharmaceutical agent. In another embodiment,
the method comprises administering to the mammal an effective
amount of exogenous STAUFEN, STAUFEN analog, biologically active
STAUFEN fragment or STAUFEN fusion protein. In still another
embodiment, the method comprises administering to the mammal an
effective amount of a nucleic acid sequence encoding exogenous
STAUFEN, STAUFEN analog, biologically active STAUFEN fragment or
STAUFEN fusion protein.
[0022] The present invention further provides methods for treating
a mammal with a defect in performance of a hippocampal-dependent
cognitive task, wherein the defect in performance is associated
with a defect in STAUFEN. The mammal is preferably an adult mammal.
The defect in STAUFEN is either a diminution in the amount of
STAUFEN produced, a diminution in STAUFEN function of STAUFEN
produced or both a diminution in amount of STAUFEN produced and
STAUFEN function of STAUFEN produced. In one embodiment, the method
comprises treating a mammal with a defect in performance of a
hippocampal-dependent cognitive task associated with a defect in
STAUFEN to increase STAUFEN function relative to STAUFEN function
in the mammal prior to treatment. In a particular embodiment,
treatment to increase STAUFEN function comprises administering to
the mammal an effective amount of a pharmaceutical agent which
increases STAUFEN function relative to STAUFEN function in the
mammal prior to administration of the pharmaceutical agent. In a
second embodiment, the method comprises treating a mammal with a
defect in performance of a hippocampal-dependent cognitive task
associated with a defect in STAUFEN to increase STAUFEN protein
expression relative to STAUFEN protein expression in the mammal
prior to treatment. In a particular embodiment, treatment to
increase STAUFEN protein expression comprises administering to the
mammal an effective amount of a pharmaceutical agent which
increases STAUFEN protein expression relative to STAUFEN protein
expression in the mammal prior to administration of the
pharmaceutical agent. In another embodiment, the method comprises
administering to a mammal with a defect in performance of a
hippocampal-dependent cognitive task associated with a defect in
STAUFEN, a STAUFEN compound such as exogenous STAUFEN, STAUFEN
analog, biologically active STAUFEN fragment or STAUFEN fusion
protein. In still another embodiment, the method comprises
administering to a mammal with a defect in performance of a
hippocampal-dependent cognitive task associated with a defect in
STAUFEN, a nucleic acid sequence encoding exogenous STAUFEN,
STAUFEN analog, biologically active STAUFEN fragment or STAUFEN
fusion protein.
[0023] The invention also provides methods for modulating
performance by a mammal of cognitive tasks associated with
non-hippocampal regions of the brain where staufen gene expression
is found to occur, methods for treating a defect in performance by
an animal of cognitive tasks associated with non-hippocampal
regions of the brain where staufen gene expression is found to
occur and methods for screening a pharmaceutical agent for its
ability to modulate performance by an animal of cognitive tasks
associated with non-hippocampal regions of the brain where staufen
gene expression is found to occur. Such methods are similar to the
methods described herein for modulating performance by a mammal of
hippocampal-dependent cognitive tasks, for treating a defect in
performance by an animal of hippocampal-dependent cognitive tasks
and for screening a pharmaceutical agent for its ability to
modulate performance by an animal of hippocampal-dependent
cognitive tasks.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 is a bar graph representation of the effect on memory
in mice four days after training in a contextual fear conditioning
task. Mice were trained with 1, 2, 5 or 10 training trials
(1.times., 2.times., 5.times. and 10.times.; 0.5 mA shock for 2
seconds; n=22, n=20, n=19 and n=22 animals, respectively). 5.times.
yields maximal levels of long-term memory, which is not
significantly different from memory induced by 10.times.
(P>0.05). 2.times. yields less than half maximal levels
(P<0.001 for 2.times. vs. 5.times.).
[0025] FIG. 2 is a bar graph representation of the effect of CREB
oligodeoxynucleotides (ODNs) treatment on memory in mice after
training. CREB ODNs decreased memory induced by strong training (5
trials) to the levels produced by weak training (2 trials). CREB
ODNs or scrambled CREB were delivered into the hippocampus (2
nmol/2 .mu.l) 20 hours before training mice with weak (2 trials) or
strong training (5 trials). Mice were tested 4 days after training.
CREB ODNs significantly impaired memory induced by strong training
(p<0.01; n=17 and n=14 for CREB ODNs- and scrambled
CREB-injected animals, respectively) but had no effect on the
memory levels produced by weak training (p=0.47; n=12 and n=11 for
CREB ODNs- and scrambled CREB-injected animals, respectively).
[0026] FIG. 3 is a bar graph representation of the effect of
Rolipram treatment on memory in mice after weak training in a
contextual fear conditioning task. Memory is enhanced in C57B16
mice by Rolipram after weak training in a contextual fear
conditioning task. Rolipram or vehicle were delivered into the
hippocampus (30 ng/1 .mu.l per hippocampus) immediately after
training mice with weak (2 trials) or strong training (5 trials).
Mice were tested 4 days after training. Rolipram significantly
enhanced memory induced by weak training (p<0.001; n=12 and n=24
for Rolipram and vehicle injected animals, respectively) but had no
effect on the maximal memory levels produced by strong training
(p=0.93; n=8 and n=13 for drug and vehicle injected animals,
respectively). Similarly, injection of 3 ng Rolipram produced
memory enhancing effect on weak training (p<0.005; n=16).
However, 0.03 ng Rolipram had no memory enhancing effect
(p<0.42; n=8).
[0027] FIG. 4 is a bar graph representation of the effect of
anisomycin (ANI) treatment on memory in mice after training.
Contextual conditioning memory is anisomycin sensitive. ANI (62.5
mg/2 .mu.l per hippocampus) or vehicle was delivered into the
hippocampus immediately after training. Mice were tested 4 days
after training. ANI significantly impaired memory induced strong
(p<0.01; n=13 and n=11 for ANI- and vehicle-injected mice,
respectively) or weak training (p<0.05; n=10 and n=12 for ANI-
and vehicle-injected mice, respectively).
[0028] FIG. 5 is a bar graph representation of the effect of
staufen ODNs treatment on memory in mice after training. Staufen
ODNs impair 4-day memory in mice. Staufen ODNs or scrambled staufen
were delivered into the hippocampus (4 nmol/2 ml per hippocampus,
44 hours and 15 hours before training, and immediately after
training. Staufen ODNs significantly impaired memory induced by
strong training (p<0.05; n=12 and n=10 for staufen ODNs and
scrambled staufen-injected animals, respectively) but had no
significant effect on the memory produced by weak training (p=0.08;
n=7 and n=10 for staufen ODNs and scrambled staufen-injected
animals, respectively).
[0029] FIG. 6 is a bar graph representation showing 24 hour memory
in Drosophila after spaced training in wildtype controls and
temperature-sensitive staufen mutants. Memory was assessed using a
Pavlovian assay (Tully, T. et al., Cell, 79:35-47 (1994); and
Tully, T. and Quinn, W. G., J. Comp. Physiol. [A], 157:263-277
(1985)) in which an odor (CS) is paired with a footshock (US).
One-day memory after spaced training is equivalent in wildtype
controls and temperature-sensitive staufen
(stau.sup.C8/stau.sup.D3) mutants when animals were trained, stored
during the 24 hour retention interval, and tested at the permissive
temperature (P=0.44 (18.degree. C.)). In contrast, one-day memory
after spaced training was disrupted specifically in stau mutants
(P<0.001) when they were trained and tested at permissive
temperature but were shifted to restrictive temperature (29.degree.
C.) during the retention interval. N=16 PIs per group.
[0030] FIGS. 7A and 7B are schematic diagrams depicting a model
described herein for synapse-specific modification underlying
long-term memory.
[0031] FIG. 7A shows that transcripts induced by spaced training
are packaged into neural granules (GR) along with other functional
components including stau, osk, faf and mago, which are required to
translocate GR along microtubules (MT) into neuronal processes
dendrites (Krichevsky, A. M. and Kosik, K. S., Neuron, 32:683-696
(2001); Kiebler, M. A. et al., J. Neurosci., 19:288-297 (1999); and
Kohrmann, M. et al., Mol. Biol. Cell., 10: 2945-2953 (1999)).
Disassembly of GR and derepression of packaged mRNAs occur in
response to depolarization (Krichevsky, A. M. and Kosik, K. S.,
Neuron, 32:683-696 (2001)).
[0032] FIG. 7B shows detail of the boxed area from FIG. 7A. mRNAs
packaged into GR are translationally repressed by RNA binding
proteins, including PUM, NOS, MASKIN and (inactive) ORB. Synaptic
depolarization stimulates local kinases, such as aurora kinase,
cdc2-kinase (and perhaps others) to phosphorylate ORB. Activated
ORB promotes elongation of polyA tail (Wu, L. et al., Neuron,
21:1129-1139 (1998)) and induces the release of eIF4E from MASKIN
(Stebbins-Boaz, B. et al., Mol. Cell., 4:1017-1027 (1999)). eIF4E
then is free to associate with the rest of the translation
initiation complex. OSKAR, 5C and CYC B were identified in a DNA
chip screen. CREB, STAU, FAF, MAGO, PUM, ORB and CDC2 were
identified from an independent behavioral screen for memory
mutants.
DETAILED DESCRIPTION OF THE INVENTION
[0033] In various species, long-term memory (LTM) is defined by two
main biological properties. First, formation of long-term memory
requires synthesis of new proteins. Second, it involves
cAMP-responsive transcription and is mediated through the
cAMP-response element binding protein (CREB) family transcription
factors. Thus, numerous early studies demonstrated that infusions
of protein synthesis inhibitors and RNA synthesis inhibitors around
the time of training, blocks long-term memory but not short-term
memory. A compelling role for CREB as a molecular switch for
long-term memory emerged from an analysis of recent "loss- and
gain-of-function" experiments in Drosophila, Aplysia, mice and
rats. Specifically, blocking CREB function has no effect on initial
learning or early memory, but long-term memory does not form.
Enhancing CREB function causes long term memory to form with less
training (practice)--the functional equivalent of a photographic
memory.
[0034] In vertebrates, CREB is expressed widely in the brain and
appears involved in various aspects of developmental and behavioral
plasticity (both implicit and explicit forms of memory). These
observations suggest, more generally, that pharmacological
enhancers of the CREB pathway will reduce the requirement for
repetitive "training sessions" to achieve performance gains from
cognitive training, while inhibition of CREB pathway, will reduce
memory.
[0035] Based on cellular studies of CREB function in neurons, a
"weak versus strong" contextual fear conditioning protocol was
developed that would be sensitive to "upstream" modulation of the
CREB pathway (Kaang, B. K. et al., Neuron, 10(3):427-435 (1993)).
During acquisition, repeated training trials lead to increases in
cAMP levels and activation of protein kinase A (PKA). After
surpassing a threshold level, activated PKA (catalytic subunit) is
translocated to the nucleus, where it phosphorylates CREB (or it
yields a permissive state for the phosphorylation of CREB by a
cofactor). Phosphorylated CREB induces the transcription of genes
encoding proteins required for long-lasting plasticity and memory.
In this context:
[0036] i) Phosphodiesterase inhibitors (PDEI) would act to increase
cAMP levels beyond the threshold in fewer training trials, thereby
producing optimal long-term memory with "weaker" (less)
training.
[0037] ii) Disruption of CREB expression would reduce long-tem
memory induced by "strong" training to the levels produced by
"weak" training.
[0038] iii) Long-term memory for contextual fear conditioning would
be sensitive to inhibitors of protein synthesis administered around
the time of training.
[0039] iv) Neuronal genes working in "orchestrated" manner with
CREB pathway would be involved in learning and/or memory.
[0040] Contextual fear conditioning is a form of associative
learning in which animals learn to recognize a training environment
(conditioned stimulus, CS) that has been previously paired with an
aversive stimulus such as foot shock (unconditioned stimulus, US).
When exposed to the same context at a later time, conditioned
animals show a variety of conditional fear responses, including
freezing behavior (Fanselow, M. S., Behav. Neurosci., 98:269-277
(1984); Fanselow, M. S., Behav. Neurosci., 98:79-95 (1984); and
Phillips, R. G. and LeDoux, J. E., Behav. Neurosci., 106:274-285
(1992)). Contextual conditioning has been used to investigate the
neural substrates mediating fear-motivated learning (Phillips, R.
G. and LeDoux, J. E., Behav. Neurosci., 106:274-285 (1992); and
Kim, J. J. et al., Behav. Neurosci., 107:1093-1098 (1993)). Recent
studies in mice and rats provided evidence for functional
interaction between hippocampal and nonhippocampal systems during
contextual conditioning training (Maren, S. et al., Behav. Brain
Res., 88(2):261-274 (1997); Maren, S. et al., Neurobiol. Learn.
Mem., 67(2):142-149 (1997); and Frankland, P. W. et al., Behav.
Neurosci., 112:863-874 (1998)). Specifically, post-training lesions
of the hippocampus (but not pre-training lesions) greatly reduced
contextual fear, implying that: 1) the hippocampus is essential for
contextual memory but not for contextual learning per se and 2) in
the absence of the hippocampus during training, non-hippocampal
systems can support contextual conditioning.
[0041] Contextual conditioning has been extensively used to study
the impact of various mutations on hippocampus-dependent learning
and memory (Bourtchouladze et al., Cell, 79:59-68 (1994);
Bourtchouladze et al., Learn Mem., 5(4-5):365-374 (1998); Kogan, J.
H. et al., Current Biology, 7(1):1-11 (1997); Silva A. J. et al.,
Current Biology, 6(11):1509-1518 (1996); Abel, T. et al., Cell,
88:615-626 (1997); and Giese, K. P. et al., Science, 279:870-873
(1998)) and strain differences in mice (Logue, S. F. et al.,
Neuroscience, 80(4):1075-1086 (1997); Chen, C. et al., Behav.
Neurosci., 110:1177-1180 (1996); and Nguyen, P. V. et al., Learn
Mem., 7(3):170-179 (2000)). Because robust learning can be
triggered with a few minutes training session, contextual
conditioning has been especially useful to study the biology of
temporally distinct processes of short- and long-term memory (Kim,
J. J. et al., Behav. Neurosci., 107:1093-1098 (1993); Abel, T. et
al., Cell, 88:615-626 (1997); Bourtchouladze et al., Cell, 79:59-68
(1994); Bourtchouladze et al., Learn Mem., 5(4-5):365-374 (1998)).
As such, contextual conditioning provides an excellent model to
evaluate the role of various novel genes in hippocampal-dependent
memory formation.
[0042] One such gene is a gene encoding a STAUFEN protein. STAUFEN
is a critical protein for the targeting of specific mRNAs in
Drosophila during development (Li, P. et al., Cell, 90:437-447
(1997); and Ephrussi, A. and Lehmann, R., Nature, 358:387-392
(1992)). Recently, it was shown to be present in the adult rat
brain as well. Specifically, STAUFEN was detected in somata and
dendrites of neurons of the adult rat hippocampus and cerebral
cortex (Monshausenm M. et al., J. Neurochem., 76:155-165 (2001)).
In hippocampal neurons, STAUFEN accumulates along microtubules and
is thought to participate in the trafficking of mRNA (Tang, S. J.
et al., Neuron, 32(3):463-475 (2001)).
[0043] Recent studies in Drosophila identified STAUFEN as a
candidate memory gene (CMG) expressed at a high level after long
term memory formation. Moreover, temporary disruption of STAUFEN
function in temperature-sensitive stau.sup.C8/stau.sup.D3 mutant
flies, almost completely abolished 24 hour memory, indicating an
acute requirement for STAUFEN during memory consolidation.
[0044] Applicants have discovered that STAUFEN plays an important
role in mediating the cellular events underlying memory formation
in mammals. As described herein, to examine the functional
connection of hippocampal STAUFEN to contextual long-term memory
formation, hippocampal infusions of antisense oligonucleotides
(ODNs) directed against Staufen mRNA were performed. To validate
the sensitivity of a "weak versus strong" training-induced memory
on CREB-dependent transcription and protein synthesis, a combined
behavioral, pharmacological and ODN approach was used.
[0045] Five training trials (5.times. "strong" training) was found
to induce maximal levels of long term contextual memory, which is
significantly stronger than memory induced by two training trials
(2.times., "weak" training). By injecting the CREB antisense
oligonucleotides into the hippocampus before training, a reduction
of memory induced by strong training to the levels produced by weak
training was observed. Similarly, injection of staufen antisense
oligonucleotides into the hippocampus reduced memory induced by
strong training. In contrast, Rolipram, a type-IV phosphodiesterase
inhibitor, administered immediately after training, enhances the
amount of memory induced by weak training to the levels produced by
strong training. Finally, an inhibitor of protein synthesis,
anisomycin (ANI), blocks both weak- and strong training-induced
contextual memory.
[0046] Combined, these studies underscore the parallel dependence
of long-term contextual memory induced by strong training on
protein synthesis and CREB-dependent transcription and they
implicate the involvement of hippocampal STAUFEN in contextual
memory formation.
[0047] mRNAs are present in neuronal dendrites and may be used for
local protein synthesis in response to synaptic activity (Steward,
O. and Levy, W. B., J. Neurosci., 2:284-291 (1982); and Schuman, E.
M., Neuron, 23:645-648 (1999)). Recent studies have demonstrated
that dendritic protein synthesis can accompany plasticity and
participate in long-lasting synaptic changes (Wu, L. et al.,
Neuron, 21:1129-1139 (1998); Huber, K. M. et al., Science,
288:1254-1257 (2000); and Casadio, A. et al., Cell, 99:221-237
(1999)).
[0048] STAUFEN already has been implicated in mRNA localization in
mammalian neurons. In hippocampal neurons, STAUFEN has a punctate,
somato-dendritic distribution and is a component of large
RNP-containing neural granules, which themselves are associated
with microtubules (Steward, O. and Schuman, E. M., Annu. Rev.
Neurosci., 24:299-325 (2001); Krichevsky, A. M. and Kosik, K. S.,
Neuron, 32:683-696 (2001); Tang, S. J. et al., Neuron, 32:463-475
(2001); Kiebler, M. A. et al., J. Neurosci., 19:288-297 (1999);
Kohrmann, M. et al., Mol. Biol. Cell., 10: 2945-2953 (1999); and
Aakalu, G. et al., Neuron, 30:489-502 (2001)). These neural
granules appear to play an analogous role in targeting mRNA
translation to subcellular (synaptic) compartments in neurons, as
do polar granules in Drosophila oocytes (Steward, O. and Schuman,
E. M., Annu. Rev. Neurosci., 24:299-325 (2001); Johnstone, O. and
Lasko, P., Annu. Rev. Genet., 35:365-406 (2001); Palacios, I. M.
and Johnston, D. S., Annu. Rev. Cell. Dev. Biol., 17:569-614
(2001); Tang, S. J. et al., Proc. Natl. Acad. Sci. USA, 99:467-472
(2002); Aakalu, G. et al., Neuron, 30:489-502 (2001); Crino, P. B.
and Eberwine, J., Neuron, 17:1173-1187 (1996); and Torre, E. R. and
Steward, O., J. Neurosci., 12:762-772 (1992)). In cultured
hippocampal neurons, neural granules are located near dendritic
spines and appear to dissociate in response to local synaptic
activity, thereby releasing translationally repressed mRNAs. This
process has been proposed as a mechanism for synapse-specific
modification via local protein synthesis in response to neural
activity (Steward, O. and Schuman, E. M., Annu. Rev. Neurosci.,
24:299-325 (2001)). The occurrence in dendrites of protein
synthesis and the presence there of the cellular machinery for
translation are firmly established (Tang, S. J. et al., Proc. Natl.
Acad. Sci. USA, 99:467-472 (2002); Aakalu, G. et al., Neuron,
30:489-502 (2001); Crino, P. B. and Eberwine, J., Neuron,
17:1173-1187 (1996); and Torre, E. R. and Steward, O., J.
Neurosci., 12:762-772 (1992)). The findings described herein imply
that these cellular processes are engaged during long term memory
formation and, more generally, that the similarity between polar
granules in the oocyte and neural granules in neurons is not
limited to STAUFEN protein. Thus, the mechanistic relations among
many CMGs likely will be similar in neurons as occur for trafficked
genes in oocytes. By analogy to what is known about local
translational control in embryos, it is reasonable to expect that
additional components of neural granules that are suggested as CMGs
from DNA chip experiments or as memory mutants from complementary
behavioral experiments also will be involved in this neuronal
process underlying long-term memory formation.
[0049] DNA chip experiments on wildtype Drosophila and behavioral
screens for memory mutants in Drosophila have identified fat facets
(faf), mago nashi (mago), pumilio (pum), orb, cdc2, eIF2G, eIF-5C,
oskar (osk) and cyclin B as CMGs, which are known to interact with
staufen (stau). The staufen, fat facets, mago nashi, pumilio, orb,
cdc2 and eIF2G genes were identified directly from the DNA chip
experiments as transcriptionally regulated genes during long term
memory formation. The eIF-5C, oskar and cyclin B genes were
identified from the behavioral screens for memory mutants
(defective in one-day memory after spaced training). Together,
these genetic components, staufen (FlyBase #FBgn0003520; vertebrate
homologs: gi:4759176 (human), gi:4335945 (mouse)), fat facets
(FlyBase #FBgn0005632; vertebrate homologs: gi:4759294 (human),
MGI:89468 (mouse)), mago nashi (FlyBase #FBgn0002736; vertebrate
homolog: gi:4505087 (human)), pumilio (FlyBase #CG1755; FlyBase
#FBgn0003165; vertebrate homolog: gi:1944416 (human)), orb (FlyBase
#FBgn0004882; vertebrate homologs: gi:4589524 (human), MGI:108442
(mouse)), cdc2 (FlyBase #FBgn0004106; vertebrate homologs:
gi:4502709 (human), MGI:88351 (mouse)), eIF2G (FlyBase
#FBgn0003600; vertebrate homologs: gi:4503507 (human), gi:3790184
(mouse)), eIF-5C (FlyBase #CG2922; vertebrate homologs: gi:286001
(human), gi: 4426565 (rat)), oskar (FlyBase #CG10901) and cyclin B
(FlyBase #CG3510; vertebrate homologs: OMIM:123836 (human),
MGI:88298 (mouse)) (Gelbart, W. M., et al., Nucleic Acids Research,
25:63-66 (1997); Flybase, http://flybase.bio.indiana.edu/, Nucleic
Acids Research, 27:85-88 (1999)), define a biological pathway
involved with subcellular localization of mRNAs and local
regulation of translation, a cellular mechanism that may link
CREB-dependent transcription in the nucleus with the tagging of
specific synapses underlying long-term memory formation. This
pathway is also referred to herein as the "staufen pathway", the
"pumilio pathway" or the "pumilio/staufen pathway". The
evolutionary conservation of gene function that has been observed
repeatedly indicates that many homologs of identified Drosophila
genes likely subserve similar roles in vertebrate memory
formation.
[0050] A model for synapse-specific modification underlying
long-term memory formation is shown in FIGS. 7A-7B. First,
behavioral training results in activation of CREB-mediated
transcription and nascent mRNAs are packaged into an RNP complex, a
neural granule. These granules likely include genetic components of
polar granules such as stau, osk, mago and faf and perhaps
additional RNA binding CMGs (RNP-4f, hnRNP-A1, no-on transient A,
PO, GCR101, La). These neural granules then are transported into
dendritic shafts along an organized microtubule network (Johnstone,
O. and Lasko, P., Annu. Rev. Genet., 35:365-406 (2001); Palacios,
I. M. and Johnston, D. S., Annu. Rev. Cell. Dev. Biol., 17:569-614
(2001); Tang, S. J. et al., Neuron, 32:463-475 (2001); and
Kohrmann, M. et al., Mol. Biol. Cell., 10: 2945-2953 (1999)).
Activity-induced transcripts may be delivered to all dendrites or
selectively to sites of recent synaptic activity (Barco, A. et al.,
Cell, 108:689-703 (2002); Frey, U. and Morris, R. G., Nature,
385:533-536 (1997); Martin, K. C. et al., Cell, 91:927-938 (1997);
and Steward, O. and Worley, P. F., Neuron, 30:227-240 (2001)). In
either case, packaged mRNAs likely are translationally quiescent
while in transport (Krichevsky, A. M. and Kosik, K. S., Neuron,
32:683-696 (2001)), thereby preventing ubiquitous expression. It is
reasonable to expect that this translational repression complex
includes pum. In this model, synapse-specific modification results
from the depolarization-dependent release of neural
granule-associated mRNAs and translational derepression at recently
active synapses (Krichevsky, A. M. and Kosik, K. S., Neuron,
32:683-696 (2001); and Aakalu, G. et al., Neuron, 30:489-502
(2001)).
[0051] The process of derepression appears to involve
phosphorylation of CPEB (orb) by aurora kinase, resulting in
cytoplasmic polyadenylation (Richter, J. D., Proc. Natl. Acad. Sci.
USA, 98:7069-7071 (2001); Wells, D. G. et al., Curr. Opin.
Neurobiol., 10:132-137 (2000); Wu, L. et al., Neuron, 21:1129-1139
(1998); and Huang, Y. S. et al., EMBO J., 21:2139-2148 (2002)) and
the dissociation of MASKIN from eIF4-E, which then allows
interaction between eIF4-E with eIF4-G (Stebbins-Boaz, B. et al.,
Mol. Cell., 4:1017-1027 (1999)). Release of eIF-4E via
phosphorylation of other 4E binding proteins also may promote
assembly of the rest of the translation initiation complex (Tang,
S. J. et al., Proc. Natl. Acad. Sci. USA, 99:467-472 (2002)). The
presence during synaptic or behavioral plasticity of several
persistently active kinases also may contribute to such
phosphorylation (Tang, S. J. et al., Proc. Natl. Acad. Sci. USA,
99:467-472 (2002); Ling, D. S. et al., Nat. Neurosci., 5:295-296
(2002); Drier, E. A. et al., Nat. Neurosci., 5:316-324 (2002);
Selcher, J. C. et al., Neuroscientist, 8:122-131 (2002); Chain, D.
G. et al., J. Neurosci., 15:7592-7603 (1995); and Muller, U. and
Carew, T. J., Neuron, 21:1423-1434 (1998)). Finally, CPEB-mediated
translational activation in Xenopus oocytes is associated with
phosphorylation of ORB by CDC2 kinase (which is a dimer of CycB and
CDC2) (Mendez, R. et al., EMBO J., 21:1833-1844 (2002)) and
ubiquitin-mediated degradation of ORB (Reverte, C. G. et al., Dev.
Biol., 231:447-458 (2001)), perhaps modulated by faf. The DNA chip
and memory mutant experiments have identified several potential
components (pum, orb, cdc2, CycB, faf, eIF5-C, eIF2-G, and
ribosomal protein PO).
[0052] The results link two biological phenomena of LTM,
transcription dependence and synaptic tagging (Barco, A. et al.,
Cell, 108:689-703 (2002); Casadio, A. et al., Cell, 99:221-237
(1999); Frey, U. and Morris, R. G., Nature, 385:533-536 (1997);
Martin, K. C. et al., Cell, 91:927-938 (1997); and Steward, O. et
al., Neuron, 21:741-751 (1998)), with two well-known cellular
mechanisms, mRNA translocation and local, activity-dependent
regulation of translation (FIGS. 7A-7B) (Steward, O. and Schuman,
E. M., Annu. Rev. Neurosci., 24:299-325 (2001)).
[0053] The present invention provides cell-based screening methods
for identifying a pharmaceutical agent which is capable of
modulating STAUFEN function by screening for STAUFEN function. By
"capable of modulating STAUFEN function" is meant to include
pharmaceutical agents which can modulate STAUFEN function. In one
embodiment, STAUFEN function is screened by determining the level
of STAUFEN protein expression (translation). As described herein,
STAUFEN is transcriptionally upregulated during memory formation.
Accordingly, in this embodiment, STAUFEN protein expression can be
determined by determining STAUFEN mRNA or protein production. In a
second embodiment, STAUFEN function is screened by determining the
functional readout of STAUFEN. In this embodiment, a functional
readout of STAUFEN can be determined by detecting (such as using an
antibody) the translocation of the STAUFEN into dendrites or by
determining the level of STAUFEN protein production. A functional
readout of STAUFEN can also be determined indirectly by detecting
and measuring downstream gene products regulated by a staufen gene
product. In a third embodiment, STAUFEN function is screened by
determining the change in distribution of neural granules in the
cells.
[0054] By "STAUFEN function" is meant the biological activity of
STAUFEN, which includes subcellular translocation of various mRNAs
and local regulation of various protein translations ("the STAUFEN
pathway"). Biological activity is understood to mean biological
function or action. By "STAUFEN pathway function" is meant a set of
gene products which interact with a staufen gene product and/or
with each other to produce STAUFEN function, particularly the
subcellular translocation of mRNA and local regulation of protein
translation.
[0055] In a particular embodiment, STAUFEN: :indicator fusion
protein constructs are employed in cell-based screening methods for
identifying a pharmaceutical agent which is capable of modulating
STAUFEN function. Thus, in one embodiment, a cell-based screening
method for identifying a pharmaceutical agent which is capable of
modulating STAUFEN function comprises (a) introducing a
pharmaceutical agent to be evaluated for its ability to modulate
STAUFEN function into host cells (particularly cells of neural
origin) expressing a STAUFEN::indicator fusion protein (e.g.,
STAUFEN::GFP fusion protein); and (b) determining STAUFEN function.
In a particular embodiment, the pharmaceutical agent is introduced
into the cells after stimulation of the CREB pathway using
forskolin. By CREB pathway is meant CREB-dependent gene expression.
The STAUFEN function determined in step (b) is compared to the
STAUFEN function of the host cells of step (a) to which the
pharmaceutical agent has not been introduced (untreated host cells
expressing STAUFEN::indicator fusion protein) (control). A
difference in STAUFEN function of the treated cells relative to the
STAUFEN function of the untreated cells identifies the
pharmaceutical agent as one which modulates (or is capable of
modulating) STAUFEN function.
[0056] In one embodiment, STAUFEN function is determined by
detecting and determining the level of STAUFEN::indicator fusion
protein expression (translation) (e.g., by detecting
STAUFEN::indicator fusion protein mRNA or protein production). In a
second embodiment, STAUFEN function is determined by detecting
(such as using an antibody) the translocation of the
STAUFEN::indicator fusion protein into dendrites or by determining
the level of STAUFEN::indicator fusion protein production. In a
third embodiment, STAUFEN function is determined indirectly by
detecting and measuring downstream gene products regulated by a
staufen gene product. In a fourth embodiment, STAUFEN function is
determined by determining the change in distribution of neural
granules in the cells.
[0057] In another embodiment, a cell-based screening method for
identifying a pharmaceutical agent capable of modulating STAUFEN
function comprises (a) introducing a pharmaceutical agent to be
evaluated for its ability to modulate STAUFEN function into host
cells of neural origin, said cells expressing STAUFEN::indicator
fusion protein; and (b) detecting the translocation of the
STAUFEN::indicator fusion protein into dendrites. In a particular
embodiment, the pharmaceutical agent is introduced into the cells
after stimulation of the CREB pathway using forskolin. A difference
in translocation of STAUFEN::indicator fusion protein into
dendrites in the presence of a pharmaceutical agent relative to its
translocation in the absence of pharmaceutical agent identifies the
pharmaceutical agent as one which modulates (or is capable of
modulating) STAUFEN function.
[0058] Cells expressing a STAUFEN::indicator fusion protein can be
produced by introducing into host cells a DNA construct comprising
(1) DNA encoding a STAUFEN::indicator fusion protein (e.g.,
STAUFEN::GFP fusion protein); and (2) a promoter sequence of a
ubiquitously expressed gene, wherein the promoter sequence is
operably linked to the DNA encoding the STAUFEN::indicator fusion
protein. In a particular embodiment, the DNA construct is
introduced into host cells, e.g., via a vector, which causes the
fusion protein to be expressed in the cells. Expression of the
STAUFEN::indicator fusion protein can be transient or stable. As
used herein, "a promoter sequence of a ubiquitously expressed gene"
refers to a promoter sequence of a gene with widespread expression.
Examples of ubiquitously expressed genes are known in the art and
include the actin gene and the ELAV gene.
[0059] A vector, as the term is used herein, refers to a nucleic
acid vector, e.g., a DNA plasmid, virus or other suitable replicon
(e.g., viral vector). Viral vectors include retrovirus, adenovirus,
parvovirus (e.g., adeno-associated viruses), coronavirus, negative
strand RNA viruses such as orthomyxovirus (e.g., influenza virus),
rhabdovirus (e.g., rabies and vesicular stomatitis virus),
paramyxovirus (e.g. measles and Sendai), positive strand RNA
viruses such as picomavirus and alphavirus, and double stranded DNA
viruses including adenovirus, herpesvirus (e.g., Herpes Simplex
virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and
poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses
include Norwalk virus, togavirus, flavivirus, reoviruses,
papovavirus, hepadnavirus, and hepatitis virus, for example.
Examples of retroviruses include: avian leukosis-sarcoma, mammalian
C-type, B-type viruses, D-type viruses, HTLV-BLV group, lentivirus,
spumavirus (Coffin, J. M., Retroviridae: The viruses and their
replication, In Fundamental Virology, 3rd Edition, B. N. Fields, et
al., eds., Philadelphia, Pa.: Lippincott-Raven Publishers) (1996)).
Other examples include Sindbis virus, murine leukemia viruses,
murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia
virus, feline leukemia virus, feline sarcoma virus, avian leukemia
virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon
ape leukemia virus, Mason Pfizer monkey virus, simian
immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus
and lentiviruses. Other examples of vectors are described, for
example, in McVey et al., U.S. Pat. No. 5,801,030, the teachings of
which are incorporated herein by reference.
[0060] DNA encoding a STAUFEN: :indicator fusion protein can be
manufactured as described using methods known and described in the
art (see, e.g., Ausubel et al., Current Protocols In Molecular
Biology (New York: John Wiley & Sons) (1998); and Sambrook et
al., Molecular Cloning: A Laboratory Manual, 2nd edition (New York:
Cold Spring Harbor University Press (1989)). DNA constructs
comprising a promoter sequence operably linked to DNA encoding a
STAUFEN::indicator fusion protein can be manufactured as described
using methods known and described in the art (see, e.g, Ausubel et
al., Current Protocols In Molecular Biology (New York: John Wiley
& Sons) (1998); and Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd edition (New York: Cold Spring Harbor
University Press (1989)). DNA constructs can be introduced into
cells according to methods known in the art (e.g., transformation,
direct uptake, calcium phosphate precipitation, electroporation,
projectile bombardment, using liposomes). Such methods are
described in more detail, for example, in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, 2nd edition (New York: Cold
Spring Harbor University Press) (1989); and Ausubel, et al.,
Current Protocols in Molecular Biology (New York: John Wiley &
Sons) (1998).
[0061] A vector, as the term is used herein, refers to a nucleic
acid vector, e.g., a DNA plasmid, virus or other suitable replicon
(e.g., viral vector). Viral vectors include retrovirus, adenovirus,
parvovirus (e.g., adeno-associated viruses), coronavirus, negative
strand RNA viruses such as orthomyxovirus (e.g., influenza virus),
rhabdovirus (e.g., rabies and vesicular stomatitis virus),
paramyxovirus (e.g. measles and Sendai), positive strand RNA
viruses such as picomavirus and alphavirus, and double stranded DNA
viruses including adenovirus, herpesvirus (e.g., Herpes Simplex
virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and
poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses
include Norwalk virus, togavirus, flavivirus, reoviruses,
papovavirus, hepadnavirus, and hepatitis virus, for example.
Examples of retroviruses include: avian leukosis-sarcoma, mammalian
C-type, B-type viruses, D-type viruses, HTLV-BLV group, lentivirus,
spumavirus (Coffin, J. M., Retroviridae: The viruses and their
replication, In Fundamental Virology, 3rd Edition, B. N. Fields, et
al., eds., Philadelphia, Pa.: Lippincott-Raven Publishers) (1996)).
Other examples include murine leukemia viruses, murine sarcoma
viruses, mouse mammary tumor virus, bovine leukemia virus, feline
leukemia virus, feline sarcoma virus, avian leukemia virus, human
T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia
virus, Mason Pfizer monkey virus, simian immunodeficiency virus,
simian sarcoma virus, Rous sarcoma virus and lentiviruses. Other
examples of vectors are described, for example, in McVey et al.,
U.S. Pat. No. 5,801,030, the teachings of which are incorporated
herein by reference.
[0062] Anti-staufen antibodies can also be used to determine
whether a particular pharmaceutical agent has an effect on STAUFEN
function, such as by detecting translocation of STAUFEN protein, as
described above. Anti-staufen antibodies can also be used to
determine whether a particular pharmaceutical agent has an effect
on the levels of STAUFEN protein expression (translation) by
detecting STAUFEN protein production.
[0063] The present invention also encompasses methods of screening
for or identifying a pharmaceutical agent which is capable of
modulating STAUFEN function comprising (a) introducing into host
cells (particularly cells of neural origin) a DNA construct,
wherein the DNA construct comprises (1) DNA encoding an indicator
gene; and (2) a staufen promoter sequence operably linked to the
DNA encoding the indicator gene; (b) producing a sample by
introducing into host cells comprising the DNA construct a
pharmaceutical agent to be assessed for its ability to modulate
STAUFEN function under conditions appropriate for expression of the
indicator gene; (c) detecting and determining the level of
indicator gene product produced in the sample obtained in step (b);
and (d) comparing the level of indicator gene product detected in
step (c) with the level of indicator gene product detected in
control cells into which the pharmaceutical agent has not been
introduced. A difference in the level of indicator gene product in
the sample obtained in step (b) compared to the level of indicator
gene product in control cells identifies the pharmaceutical agent
as one which modulates STAUFEN function. By "staufen promoter
sequence" is meant a promoter sequence usually upstream (5') of the
coding region of the staufen gene, which controls the expression of
the coding region by providing recognition and binding sites for
RNA polymerase and other factors which may be required for
initiation of transcription.
[0064] DNA constructs comprising a promoter sequence operably
linked to DNA encoding an indicator gene can be manufactured as
described using methods known and described in the art. See, for
example, Ausubel et al., Current Protocols In Molecular Biology
(New York: John Wiley & Sons) (1998); and Sambrook et al.,
Molecular Cloning: A Laboratory Manual, 2nd edition (New York: Cold
Spring Harbor University Press (1989).
[0065] The term "indicator gene", as used herein, refers to a
nucleic acid sequence whose product can be easily assayed, for
example, calorimetrically as an enzymatic reaction product, such as
the lacZ gene which encodes .beta.-galactosidase. Other examples of
widely used indicator genes include those encoding enzymes, such as
.beta.-glucoronidase and .beta.-glucosidase; luminescent molecules,
such as green fluorescent protein (GFP) and firefly luciferase; and
auxotrophic markers such, as His3p and Ura3p. See, e.g., Ausubel et
al., Current Protocols In Molecular Biology (New York: John Wiley
& Sons, Inc.), Chapter 9 (1998)).
[0066] As used herein, a cell refers to an animal cell. The cell
can be a stem cell or somatic cell. Suitable animal cells can be
of, for example, mammalian origin. Examples of mammalian cells
include human (such as HeLa cells), bovine, ovine, porcine, murine
(such as embryonic stem cells), rabbit and monkey (such as COS1
cells) cells. Preferably, the cell is of neural origin (such as a
neuroblastoma, neuron, neural stem cell, etc.). The cell can also
be an embryonic cell, bone marrow stem cell or other progenitor
cell. Where the cell is a somatic cell, the cell can be, for
example, an epithelial cell, fibroblast, smooth muscle cell, blood
cell (including a hematopoietic cell, red blood cell, T-cell,
B-cell, etc.), tumor cell, cardiac muscle cell, macrophage,
dendritic cell, neuronal cell (e.g., a glial cell or astrocyte), or
pathogen-infected cell (e.g., those infected by bacteria, viruses,
virusoids, parasites, or prions).
[0067] The cells can be obtained commercially or from a depository
or obtained directly from an animal, such as by biopsy.
[0068] The pharmaceutical agent can be introduced into host cells
(particularly cells of neural origin) either alone or after
stimulation of the CREB pathway using forskolin.
[0069] Pharmaceutical agents which modulate, or are capable of
modulating, STAUFEN function are further screened to determine the
effect of the agents on long term memory formation or to identify
those agents capable of modulating long term memory. In one
embodiment, the method comprises (a) administering to an animal
(particularly a mammal) a pharmaceutical agent which modulates, or
is capable of modulating, STAUFEN function; (b) training the animal
of (a) and a control animal of the same species to which the
pharmaceutical agent has not been administered under conditions
sufficient to produce long term memory formation in the animals;
(c) assessing long term memory formation in the animals trained in
step (b); and (d) comparing long term memory formation in the
animals assessed in step (c). A control animal is the basis for
comparison in assessing results associated with administration of a
pharmaceutical agent to an experimental animal. The experimental
and control animals are comparable, e.g., same age, genetic makeup,
basal STAUFEN function (i.e., STAUFEN function prior to treatment
with the pharmaceutical agent). A difference in long term memory
formation assessed in the animal treated with (administered) the
pharmaceutical agent relative to the long term memory formation
assessed in the control animal identifies the pharmaceutical agent
as one which has the ability to modulate long term memory formation
in the animal.
[0070] Pharmaceutical agents which modulate, or are capable of
modulating, STAUFEN function are also screened to determine the
effect of the agents on performance by an animal of a
hippocampal-dependent cognitive task or to identify those agents
capable of modulating performance of a hippocampal-dependent
cognitive task by an animal. In one embodiment, the method
comprises (a) administering to an animal (particularly a mammal) a
pharmaceutical agent which modulates, or is capable of modulating,
STAUFEN function; (b) training the animal of (a) and a control
animal of the same species to which the pharmaceutical agent has
not been administered under conditions appropriate for performance
by the animals of a specified hippocampal-dependent cognitive task;
(c) assessing performance of the hippocampal-dependent cognitive
task by the animals trained in step (b); and (d) comparing
performance of the animals assessed in step (c). The experimental
and control animals are comparable, e.g., same age, genetic makeup,
basal STAUFEN function (i.e., STAUFEN function prior to treatment
with the pharmaceutical agent). A difference in assessed
performance by the animal treated with (administered) the
pharmaceutical agent relative to the assessed performance by the
control animal identifies the pharmaceutical agent as one which has
the ability to modulate the performance by the animal of the
specified hippocampal-dependent cognitive task.
[0071] The present invention also provides methods for screening a
pharmaceutical agent for its ability to modulate long term memory
formation in an animal and for assessing its effect on long term
memory in an animal. Preferably, the animal is an adult mammal. In
one embodiment, the method comprises (a) administering to a first
animal a pharmaceutical agent of interest; (b) determining STAUFEN
function in the animal administered the pharmaceutical agent in (a)
relative to STAUFEN function in a control animal of the same
species as the first animal to which the pharmaceutical agent has
not been administered; (c) selecting the pharmaceutical agent if
the STAUFEN function determined in (b) differs from the STAUFEN
function in the control animal; (d) administering the
pharmaceutical agent selected in (c) to a second animal; (e)
training the second animal administered the pharmaceutical agent in
(d) and a control animal of the same species as the second animal
under conditions appropriate to produce long term memory formation
in the animals; (f) assessing long term memory formation in the
animals trained in step (e); and (g) comparing long term memory
formation in the animals assessed in step (f). The first and second
animals can be of the same or different species. The first animal
and the corresponding control animal are comparable, e.g., same
age, genetic makeup, basal STAUFEN function (i.e., STAUFEN function
prior to treatment with the pharmaceutical agent). Similarly, the
second animal and the corresponding control animal are comparable,
e.g., same age, genetic makeup, basal STAUFEN function (i.e.,
STAUFEN function prior to treatment with (administration of) the
pharmaceutical agent). A difference in long term memory formation
assessed in the animal treated with the pharmaceutical agent
relative to the long term memory formation assessed in the control
animal identifies the pharmaceutical agent as one which has the
ability to modulate long term memory formation in the animal.
[0072] The present invention also encompasses methods for screening
a pharmaceutical agent for its ability to modulate STAUFEN function
in an animal and for assessing the effect of a pharmaceutical agent
on STAUFEN function in an animal. Preferably, the animal is an
adult mammal. In one embodiment, the method comprises (a)
administering a pharmaceutical agent of interest to the animal; and
(b) determining STAUFEN function in the animal obtained in (a)
relative to STAUFEN function in a control animal of the same
species to which the pharmaceutical agent has not been
administered. The experimental and control animals are comparable,
e.g., same age, genetic makeup, basal STAUFEN function (i.e.,
STAUFEN function prior to treatment with the pharmaceutical agent).
A difference in STAUFEN function determined in the animal treated
with the pharmaceutical agent relative to STAUFEN function
determined in the control animal identifies the pharmaceutical
agent as one having the ability to modulate STAUFEN function in the
animal.
[0073] The invention also relates to methods for screening a
pharmaceutical agent for its ability to modulate performance of a
hippocampal-dependent cognitive task by an animal and for assessing
the effect a pharmaceutical agent on performance of a
hippocampal-dependent cognitive task by an animal. In a particular
embodiment, the animal is an adult mammal. In one embodiment, the
method comprises (a) administering a pharmaceutical agent of
interest to a first animal; (b) determining STAUFEN function in the
animal administered the pharmaceutical agent in (a) relative to
STAUFEN function in a control animal of the same species to which
the pharmaceutical agent has not been administered; (c) selecting
the pharmaceutical agent if the STAUFEN function determined in (b)
differs from the STAUFEN function in the control animal; (d)
administering the pharmaceutical agent selected in (c) to a second
animal; (e) training the animal administered the pharmaceutical
agent in (d) and a control animal of the same species as the second
animal under conditions appropriate for performance by the animals
of a specified hippocampal-dependent cognitive task; (f) assessing
performance of the hippocampal-dependent cognitive task by the
animals trained in step (e); and (g) comparing performance of the
animals assessed in step (f). The first and second animals can be
of the same or different species. The first animal and the
corresponding control animal are comparable, e.g., same age,
genetic makeup, basal STAUFEN function (i.e., STAUFEN function
prior to treatment with the pharmaceutical agent). Similarly, the
second animal and the corresponding control animal are comparable,
e.g., same age, genetic makeup, basal STAUFEN function (i.e.,
STAUFEN function prior to treatment with the pharmaceutical agent).
A difference in assessed performance by the animal treated with the
pharmaceutical agent relative to the assessed performance by the
control animal identifies the pharmaceutical agent as one which has
the ability to modulate the performance by the animal of the
specified hippocampal-dependent cognitive task.
[0074] As used herein, training can comprise one or multiple
training sessions and is training appropriate for long term memory
formation or for performance of the specified cognitive task. The
pharmaceutical agent can be administered before, during or after
one or more of the training sessions. By "training" is meant
cognitive training.
[0075] Training of mammals for long term memory formation is
conducted using methods generally known in the art (see, e.g.,
Josselyn et al., Society for Neurosci., 24:926, Abstract 365.10
(1998); Guzowski et al., Proc. Natl. Acad. Sci. USA, 94:2693-2698
(1997); Lamprecht et al., J. Neuroscience, 17(21):8443-8450 (1997):
Bourtchuladze et al., Cell, 79:59-68 (1994); and Kogan et al.,
Curr. Biol., 7:1-11 (1996)). Training of mammals for performance of
specified hippocampal-dependent cognitive tasks is conducted using
methods generally known in the art (see, e.g., Barnes, C. A. et
al., In Brain and Memory: Modulation and Mediation of
Neuroplasticity, J. L. McGaugh et al. (Eds.), Oxford University
Press, pp. 259-276 (1995); Jarrard, L. E., Behavioral Neural
Biology, 60:9-26 (1993); Moser, M. B. et al., Proc. Natl. Acad.
Sci. USA, 92(21):9697-9701 (1995); Chen, C. et al., Behav.
Neurosci., 110:1177-1180 (1996); Frankland, P. W. et al., Behav.
Neurosci., 112:863-874 (1998); Holland, P. C. and Bouton, M. E.,
Curr. Opin. Neurobiol., 9:195-202 (1999); Kim, J. J. et al., Behav.
Neurosci., 107:1093-1098 (1993); Logue, S. F. et al., Behav.
Neurosci., 111: 104-113 (1997); and Squire, L. R., Psychological
Review, 99:195-231 (1992)).
[0076] Pharmaceutical agents (drugs), as used herein, are compounds
with pharmacological activity and include inorganic compounds,
ionic materials, organic compounds, organic ligands, including
cofactors, saccharides, recombinant and synthetic peptides,
proteins, peptoids, nucleic acid sequences, including genes,
nucleic acid products.
[0077] Pharmaceutical agents can be individually screened.
Alternatively, more than one pharamaceutical agent can be tested
simultaneously for the ability to modulate long term memory
formation and/or the ability to modulate performance of a
hippocampal-dependent cognitive task and/or the ability to modulate
STAUFEN function in accordance with the methods herein. Where a
mixture of pharmaceutical agents is tested, the pharmaceutical
agents selected by the methods described can be separated (as
appropriate) and identified by suitable methods (e.g.,
chromatography, sequencing, PCR).
[0078] Large combinatorial libraries of pharmaceutical agents
(e.g., organic compounds, recombinant or synthetic peptides,
peptoids, nucleic acids) produced by combinatorial chemical
synthesis or other methods can be tested (see e.g., Zuckerman, R.
N. et al., J. Med. Chem., 37:2678-2685 (1994) and references cited
therein; see also, Ohlmeyer, M. H. J. et al., Proc. Natl. Acad.
Sci. USA, 90:10922-10926 (1993) and DeWitt, S. H. et al., Proc.
Natl. Acad. Sci. USA, 90:6909-6913 (1993), relating to tagged
compounds; Rutter, W. J. et al. U.S. Pat. No. 5,010,175; Huebner,
V. D. et al., U.S. Pat. No. 5,182,366; and Geysen, H. M., U.S. Pat.
No. 4,833,092). The teachings of these references are incorporated
herein by reference. Where pharmaceutical agents selected from a
combinatorial library carry unique tags, identification of
individual pharmaceutical agents by chromatographic methods is
possible.
[0079] Chemical libraries, microbial broths and phage display
libraries can also be tested (screened) for the presence of one or
more pharmaceutical agent(s) which are capable of modulating long
term memory formation and/or modulating performance of a
hippocampal-dependent cognitive task and/or modulating STAUFEN
function in accordance with the methods herein.
[0080] Pharmaceutical agents identified in accordance with the
screening methods herein can be administered to an animal to
modulate or enhance long term memory formation or performance of a
hippocampal-dependent cognitive task in accordance with the methods
herein. Pharmaceutical agents identified in accordance with the
screening methods herein can also be administered in the treatment
of the animal with a defect in long term memory formation that is
associated with a defect in STAUFEN or an animal with a defect in
performance of a hippocampal-dependent cognitive task, wherein the
defect is associated with a defect in STAUFEN, in accordance with
the methods herein.
[0081] As used herein, a defect in long term memory formation
associated with a defect in STAUFEN can be a biochemical or
developmental defect. The defect in STAUFEN is either a diminution
in the amount of STAUFEN produced, a diminution in STAUFEN function
of STAUFEN produced or both a diminution in amount of STAUFEN
produced and a diminution in STAUFEN function.
[0082] "Modulating", as the term is used herein, includes
induction, enhancement, potentiation, reduction, blocking,
inhibition (total or partial) and regulation. By "regulation", as
the term is used herein, is meant the ability to control the rate
and extent to which a process occurs.
[0083] By "enhancing" or "enhancement" is meant the ability to
potentiate, increase, improve or make greater or better, relative
to normal, a biochemical or physiological action or effect. For
example, enhancing long term memory formation refers to the ability
to potentiate or increase long term memory formation in an animal
relative to the normal long term memory formation of the animal. As
a result, long term memory acquisition is faster or better
retained. Enhancing performance of a hippocampal-dependent
cognitive task refers to the ability to potentiate or improve
performance of a specified hippocampal-dependent cognitive task by
an animal relative to the normal performance of the
hippocampal-dependent cognitive task by the animal. The term
"hippocampal-dependent cognitive task" refers to a cognitive task
associated with the hippocampal region of the brain.
[0084] In mammals, the hippocampus is essential for the initial
consolidation of explicit, or declarative memory. For reviews, see
Squire, L. R., Psychological Review, 99:195-231 (1992); and Milner,
B. et al., Neuron, 20:445-468 (1998). In particular, various
studies have suggested that the hippocampus plays a key role in
spatial memory, such as Morris water maze, Barnes circular maze,
radial-arm maze, T-maze and Y-maze (O'Keefe, J. and Nadel, L., The
Hippocampus As A Cognitive Map, Oxford University Press (1978);
Morris, R. G. M. et al., Nature, 297:681-683 (1992); Jarrard, L.
E., Behavioral Neural Biology, 60:9-26 (1993); Moser, M. B. et al.,
Proc. Natl. Acad. Sci. USA, 92(21):9697-9701 (1995); O'Keefe, J.,
Hippocampus, 9:352-364 (1999); Burgess, N. et al., Biological
Cybernetics, 83:301-312 (2000); and Barnes, C. A. et al., In Brain
and Memory: Modulation and Mediation of Neuroplasticity, J. L.
McGaugh et al. (Eds.), Oxford University Press, pp. 259-276
(1995)), contextual conditioning (Phillips, R. G. and LeDoux, J.
E., Behav. Neurosci., 106:274-285 (1992); Kim, J. J. et al., Behav.
Neurosci., 107:1093-1098 (1993); Logue, S. F. et al., Behav.
Neurosci., 111:104-113 (1997); Chen, C. et al., Behav. Neurosci.,
110:1177-1180 (1996); and Holland, P. C. and Bouton, M. E., Curr.
Opin. Neurobiol., 9:195-202 (1999)), context discrimination
(Frankland, P. W. et al., Behav. Neurosci., 112:863-874 (1998);
McDonald, R. J. and White, N. M., Behav. Neurosci., 109:579-593
(1995); and McDonald, R. J. and White, N. M., Hippocampus,
5(3):189-197 (1995)) and trace conditioning (Kim, J. J. et al.,
Behav. Neurosci., 109:195-203 (1995); Buchel, C. et al., J.
Neurosci., 19(24):10869-10876 (1999); Clark, R. E. and Squire, L.
R., Science, 280:77-81 (1998); McGlinchey-Berroth, R. et al.,
Behav. Neurosci., 111(5):873-882 (1997); and McEchon, M. D. et al.,
J. Neurophysiol., 86(4):1839-1857 (1998)).
[0085] STAUFEN can be an intact protein or a functional or
biologically active equivalent of intact STAUFEN protein. A
functional or biologically active equivalent of intact STAUFEN
protein refers to a molecule which functionally resembles (mimics)
intact STAUFEN protein. A functional or biologically active
equivalent of intact STAUFEN protein need not have an amino acid
sequence analogous to the amino acid sequences of the staufen gene
products described herein. For example, a functional equivalent of
intact STAUFEN protein can contain a "SILENT" codon or one or more
conservative amino acid substitutions, deletions or additions
(e.g., substitution of one acidic amino acid for another acidic
amino acid; or substitution of one codon encoding the same or
different hydrophobic amino acid for another codon encoding a
hydrophobic amino acid). See Ausubel et al., Eds., Current
Protocols In Molecular Biology (New York: John Wiley & Sons)
(1997).
[0086] As used herein, the term "animal" includes mammals, as well
as other animals, vertebrate and invertebrate (e.g., birds, fish,
reptiles, insects (e.g., Drosophila species), mollusks (e.g.,
Aplysia). Preferably, the animal is a mammal. The terms "mammal"
and "mammalian", as used herein, refer to any vertebrate animal,
including monotremes, marsupials and placental, that suckle their
young and either give birth to living young (eutharian or placental
mammals) or are egg-laying (metatharian or nonplacental mammals).
Examples of mammalian species include humans and primates (e.g.,
monkeys, chimpanzees), rodents (e.g., rats, mice, guinea pigs) and
ruminants (e.g., cows, pigs, horses). The animal is preferably an
adult animal.
[0087] The invention also relates to methods of modulating long
term memory formation in an animal. In a particular embodiment, the
animal is an adult mammal. In one embodiment, the method comprises
treating the animal to modulate staufen-dependent protein
expression. In a second embodiment, the method comprises treating
the animal to modulate STAUFEN function. In a particular
embodiment, the method comprises administering to the animal an
effective amount of a pharmaceutical agent which modulates STAUFEN
function in the animal. In another embodiment, the method comprises
treating the animal to modulate STAUFEN protein expression. In a
particular embodiment, the method comprises administering to the
animal an effective amount of a pharmaceutical agent which
modulates STAUFEN protein expression in the animal.
[0088] The present invention also relates to methods of enhancing
long term memory formation in an animal, preferably an adult
mammal. In one embodiment, the method comprises treating the animal
to modulate staufen-dependent protein expression. In a second
embodiment, the method comprises treating the animal to increase
STAUFEN function relative to the STAUFEN function in the animal
prior to treatment. In a particular embodiment, treatment to
increase STAUFEN function comprises administering to the animal an
effective amount of a pharmaceutical agent which increases STAUFEN
function relative to STAUFEN function in the animal prior to
administration of the pharmaceutical agent. In a second embodiment,
the method comprises treating the animal to increase STAUFEN
protein expression relative to STAUFEN protein expression in the
animal prior to treatment. In a particular embodiment, treatment to
increase STAUFEN protein expression comprises administering to the
animal an effective amount of a pharmaceutical agent which
increases STAUFEN protein expression relative to STAUFEN protein
expression in the animal prior to administration of the
pharmaceutical agent. In another embodiment, the method comprises
administering to the animal an effective amount of a STAUFEN
molecule, STAUFEN analog, biologically active STAUFEN fragment or
STAUFEN fusion protein. In still another embodiment, the method
comprises administering to the animal an effective amount of a
nucleic acid sequence encoding a STAUFEN molecule, STAUFEN analog,
biologically active STAUFEN fragment or STAUFEN fusion protein.
[0089] The present invention further provides methods for treating
an animal with a defect in long term memory formation associated
with a defect in STAUFEN. The animal is preferably an adult mammal.
The defect in STAUFEN is either a diminution in the amount of
STAUFEN produced, a diminution in STAUFEN function of STAUFEN
produced or both a diminution in amount of STAUFEN produced and
STAUFEN function of STAUFEN produced. In one embodiment, the method
comprises treating an animal with a defect in long term memory
formation associated with a defect in STAUFEN to increase STAUFEN
function relative to the STAUFEN function in the animal prior to
treatment. In a particular embodiment, treatment to increase
STAUFEN function comprises administering to the animal an effective
amount of a pharmaceutical agent which increases STAUFEN function
relative to STAUFEN function in the animal prior to administration
of the pharmaceutical agent. In a second embodiment, the method
comprises treating an animal with a defect in long term memory
formation associated with a defect in STAUFEN to increase STAUFEN
protein expression relative to STAUFEN protein expression in the
animal prior to treatment. In a particular embodiment, treatment to
increase STAUFEN protein expression comprises administering to the
animal an effective amount of a pharmaceutical agent which
increases STAUFEN protein expression relative to STAUFEN protein
expression in the animal prior to administration of the
pharmaceutical agent. In a another embodiment, the method comprises
administering to an animal with a defect in long term memory
formation associated with a defect in STAUFEN a STAUFEN compound
such as exogenous STAUFEN, STAUFEN analog, biologically active
STAUFEN fragment or STAUFEN fusion protein. In another embodiment,
the method comprises administering to an animal with a defect in
long term memory formation with a defect in STAUFEN a nucleic acid
sequence encoding STAUFEN, STAUFEN analog, biologically active
STAUFEN fragment or STAUFEN fusion protein.
[0090] The invention also relates to methods of modulating
performance of a hippocampal-dependent cognitive task by an animal,
preferably an adult mammal. In one embodiment, the method comprises
treating the animal to modulate staufen-dependent protein
expression. In a second embodiment, the method comprises treating
the animal to modulate STAUFEN function. In a particular
embodiment, the method comprises administering to the animal an
effective amount of a pharmaceutical agent which modulates STAUFEN
function in the animal. In another embodiment, the method comprises
treating the animal to modulate STAUFEN protein expression. In a
particular embodiment, the method comprises administering to the
animal an effective amount of a pharmaceutical agent which
modulates STAUFEN protein expression in the animal.
[0091] The present invention also relates to methods of enhancing
performance of a hippocampal-dependent cognitive task by an animal,
preferably an adult mammal. In one embodiment, the method comprises
treating the animal to modulate staufen-dependent protein
expression. In a second embodiment, the method comprises treating
the animal to increase STAUFEN function relative to STAUFEN
function in the animal prior to treatment. In a particular
embodiment, treatment to increase STAUFEN function comprises
administering to the animal an effective amount of a pharmaceutical
agent which increases STAUFEN function relative to STAUFEN function
in the animal prior to administration of the pharmaceutical agent.
In another embodiment, the method comprises treating the animal to
increase STAUFEN protein expression relative to STAUFEN protein
expression in the animal prior to treatment. In a particular
embodiment, treatment to increase STAUFEN protein expression
comprises administering to the animal an effective amount of a
pharmaceutical agent which increases STAUFEN protein expression
relative to STAUFEN protein expression in the animal prior to
administration of the pharmaceutical agent. In another embodiment,
the method comprises administering to the animal an effective
amount of STAUFEN, STAUFEN analog, biologically active STAUFEN
fragment or STAUFEN fusion protein. In another embodiment, the
method comprises administering to the animal an effective amount of
a nucleic acid sequence encoding STAUFEN, STAUFEN analog,
biologically active STAUFEN fragment or STAUFEN fusion protein.
[0092] The present invention further provides methods for treating
an animal with a defect in performance of a hippocampal-dependent
cognitive task, wherein the defect in performance is associated
with a defect in STAUFEN. The animal is preferably an adult mammal.
The defect in STAUFEN is either a diminution in the amount of
STAUFEN produced, a diminution in STAUFEN function of STAUFEN
produced or both a diminution in amount of STAUFEN produced and
STAUFEN function of STAUFEN produced. In one embodiment, the method
comprises treating an animal with a defect in performance of a
hippocampal-dependent cognitive task associated with a defect in
STAUFEN to increase STAUFEN function relative to STAUFEN function
in the animal prior to treatment. In a particular embodiment,
treatment to increase STAUFEN function comprises administering to
the animal an effective amount of a pharmaceutical agent which
increases STAUFEN function relative to STAUFEN function in the
animal prior to administration of the pharmaceutical agent. In a
second embodiment, the method comprises treating an animal with a
defect in performance of a hippocampal-dependent cognitive task
associated with a defect in STAUFEN to increase STAUFEN protein
expression relative to STAUFEN protein expression in the animal
prior to treatment. In a particular embodiment, treatment to
increase STAUFEN protein expression comprises administering to the
animal an effective amount of a pharmaceutical agent which
increases STAUFEN protein expression relative to STAUFEN protein
expression in the animal prior to administration of the
pharmaceutical agent. In another embodiment, the method comprises
administering to an animal with a defect in performance of a
hippocampal-dependent cognitive task associated with a defect in
STAUFEN a STAUFEN compound such as exogenous STAUFEN, STAUFEN
analog, biologically active STAUFEN fragment or STAUFEN fusion
protein. In another embodiment, the method comprises administering
to an animal with a defect in performance of a
hippocampal-dependent cognitive task associated with a defect in
STAUFEN a nucleic acid sequence encoding STAUFEN, STAUFEN analog,
biologically active STAUFEN fragment or STAUFEN fusion protein.
[0093] The invention also relates to methods for modulating
performance by an animal, preferably an adult mammal, of cognitive
tasks associated with non-hippocampal regions of the brain where
staufen gene expression is found to occur, methods for treating a
defect in performance by an animal of cognitive tasks associated
with non-hippocampal regions of the brain where staufen gene
expression is found to occur and methods for screening a
pharmaceutical agent for its ability to modulate performance by an
animal of cognitive tasks associated with non-hippocampal regions
of the brain where staufen gene expression is found to occur. Such
methods are similar to the methods described herein for modulating
performance by an animal of hippocampal-dependent cognitive tasks,
for treating a defect in performance by an animal of
hippocampal-dependent cognitive tasks and for screening a
pharmaceutical agent for its ability to modulate performance by an
animal of hippocamapl-dependent cognitive tasks.
[0094] STAUFEN analogs, or derivatives, are defined herein as
proteins having amino acid sequences analogous to the staufen gene
products described herein. Analogous amino acid sequences are
defined herein to mean amino acid sequences with sufficient
identity of amino acid sequence of the staufen gene product
described herein to possess the biological activity or biological
function or action of the staufen gene product, but with one or
more "SILENT" changes in the amino acid sequence.
[0095] Biologically active STAUFEN fragments refer to biologically
active polypeptide fragments of STAUFEN and can include only a part
of the full-length amino acid sequence of STAUFEN, yet possess
biological activity of STAUFEN. Such fragments can be produced by
carboxyl or amino terminal deletions, as well as one or more
internal deletions.
[0096] STAUFEN fusion proteins comprise STAUFEN as described
herein, referred to as a first moiety, linked to a second moiety
not occurring in the STAUFEN protein. The second moiety can be a
single amino acid, peptide or polypeptide or other organic moiety,
such as a carbohydrate, a lipid or an inorganic molecule.
[0097] The present invention further encompasses biologically
active derivatives or analogs of STAUFEN, referred to herein as
STAUFEN peptide mimetics. These mimetics can be designed and
produced by techniques known to those skilled in the art. See,
e.g., U.S. Pat. Nos. 5,643,873 and 5,654,276. These mimetics are
based on staufen sequences. Staufen sequences are readily available
in the art (see, e.g., Shao, et al., Neuron, 32:463-475 (2001);
Wickham et al., Mol. Cell. Biol., 19(3):2220-2230 (1999); Buchner
et al., Genomics, 62(1):113-118 (1999); Micklem et al., EMBO J.,
19(6):1366-1377 (2000); Monshausen et al., J. Neurochem.,
76(1):155-165(2001); Tang et al., Neuron, 32(3):463-475 (2001);
Falcon et al., Nucleic Acid Research, 27(11):2241-2247 (1999); and
Kiebler et al., J. Neurosci., 19(1):288-297 (1999)). Peptide
mimetics possess biological activity or biological function or
action similar to the biological activity or biological function or
action of the corresponding peptide compound, but possess a
"biological advantage" over the corresponding peptide inhibitor
with respect to one, or more, of the following properties:
solubility, stability and susceptibility to hydrolysis and
proteolysis.
[0098] Methods for preparing peptide mimetics include modifying the
N-terminal amino group, the C-terminal carboxyl group and/or
changing one or more of the amino linkages in the peptide to a
non-amino linkage. Two or more such modifications can be coupled in
one peptide mimetic. Examples of modifications of peptides to
produce peptide mimetics are described in U.S. Pat. Nos. 5,643,873
and 5,654,276.
[0099] Increased STAUFEN protein expression or production can be
achieved by administration of an exogenous STAUFEN or,
alternatively, by increasing production of the endogenous STAUFEN,
for example by stimulating the endogenous gene to produce increased
amounts of STAUFEN. In a preferred embodiment, suitable
pharmaceutical agents, as described herein, can be administered to
the animal to stimulate the endogenous gene to produce increased
amounts of a functional STAUFEN, thereby increasing STAUFEN
function in the animal.
[0100] In some animals, the amount of STAUFEN being produced can be
of sufficient quantity, but the STAUFEN is abnormal in some way
and, thus, cannot exert its biological effect. That is, the STAUFEN
being produced has diminished or no functional activity (i.e., no
biological activity, function or action). In this instance,
providing copies of normal staufen genes to the animal using
techniques of gene transfer well known to those skilled in the art,
can increase STAUFEN function or concentration. In another
embodiment, an exogenous STAUFEN, STAUFEN analog, biologically
active STAUFEN fragment or STAUFEN fusion protein can be
administered to the animal.
[0101] Nucleic acid sequences are defined herein as heteropolymers
of nucleic acid molecules. The nucleic acid molecules can be double
stranded or single stranded and can be a deoxyribonucleotide (DNA)
molecule, such as cDNA or genomic DNA, or a ribonucleotide (RNA)
molecule. As such, the nucleic acid sequence can, for example,
include one or more exons, with or without, as appropriate,
introns, as well as one or more suitable control sequences. In one
example, the nucleic acid molecule contains a single open reading
frame which encodes a desired nucleic acid product. The nucleic
acid sequence is "operably linked" to a suitable promoter.
[0102] A nucleic acid sequence encoding a desired STAUFEN, STAUFEN
analog, biologically active STAUFEN fragment or STAUFEN fusion
protein can be isolated from nature, modified from native sequences
or manufactured de novo, as described in, for example, Ausubel et
al., Current Protocols in Molecular Biology, (New York: John Wiley
& Sons) (1998); and Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd edition (New York: Cold Spring Harbor
University Press) (1989). Nucleic acids can be isolated and fused
together by methods known in the art, such as exploiting and
manufacturing compatible cloning or restriction sites.
[0103] Typically, the nucleic acid sequence will be a gene which
encodes the desired STAUFEN, STAUFEN analog or STAUFEN fusion
protein. Such a gene is typically operably linked to suitable
control sequences capable of effecting the expression of the
STAUFEN, preferably in the CNS. The term "operably linked", as used
herein, is defined to mean that the gene (or the nucleic acid
sequence) is linked to control sequences in a manner which allows
expression of the gene (or the nucleic acid sequence). Generally,
operably linked means contiguous.
[0104] Control sequences include a transcriptional promoter, an
optional operator sequence to control transcription, a sequence
encoding suitable messenger RNA (mRNA) ribosomal binding sites and
sequences which control termination of transcription and
translation. In a particular embodiment, a recombinant gene (or a
nucleic acid sequence) encoding STAUFEN, STAUFEN analog,
biologically active STAUFEN fragment or STAUFEN fusion protein can
be placed under the regulatory control of a promoter, which can be
induced or repressed, thereby offering a greater degree of control
with respect to the level of the product.
[0105] As used herein, the term "promoter" refers to a sequence of
DNA, usually upstream (5') of the coding region of a structural
gene, which controls the expression of the coding region by
providing recognition and binding sites for RNA polymerase and
other factors which may be required for initiation of
transcription. Suitable promoters are well known and readily
available in the art (see, e.g., Ausubel et al., Current Protocols
in Molecular Biology (New York: John Wiley & Sons, Inc.)
(1998); Sambrook et al., Molecular Cloning: A Laboratory Manual,
2nd edition (New York: Cold Spring Harbor University Press (1989);
and U.S. Pat. No. 5,681,735).
[0106] STAUFEN, STAUFEN analogs, biologically active STAUFEN
fragments, STAUFEN fusion proteins and pharmaceutical agents, as
well as nucleic acid sequences encoding STAUFEN, STAUFEN analogs,
biologically active STAUFEN fragments or STAUFEN fusion proteins
can be administered directly to an animal in a variety of ways. In
a particular embodiment, administration is via transplant of neural
tissue, e.g., by injecting neural cells into the brain. Other
routes of administration are generally known in the art and include
intravenous injection including infusion and/or bolus injection,
intracerebroventricular, intrathecal, parenteral, mucosal, implant,
intraperitoneal, oral, intradermal, transdermal (e.g., in slow
release polymers), intramuscular, subcutaneous, topical, epidural,
etc. routes. Other suitable routes of administration can also be
used, for example, to achieve absorption through epithelial or
mucocutaneous linings. STAUFEN, STAUFEN analogs, biologically
active STAUFEN fragments and STAUFEN fusion proteins can also be
administered by gene therapy, wherein a DNA molecule encoding a
particular therapeutic protein or peptide is administered to the
animal, e.g., via a vector, which causes the particular protein or
peptide to be expressed and secreted at therapeutic levels in
vivo.
[0107] A nucleic acid sequence encoding a protein or peptide (e.g.,
STAUFEN, STAUFEN analog, biologically active STAUFEN fragment or
STAUFEN fusion protein) can be inserted into a nucleic acid vector
according to methods generally known in the art (see, e.g., Ausubel
et al., eds., Current Protocols in Molecular Biology, John Wiley
& Sons, Inc., New York (1998); Sambrook et al., eds., Molecular
Cloning: A Laboratory Manual, 2nd edition (New York: Cold Spring
Harbor University Press) (1989)).
[0108] The mode of administration is preferably at the location of
the target cells. In a particular embodiment, the mode of
administration is to cells of neural origin. Cells of neural origin
include neural stem cells, neuroblastoma cells and neurons.
[0109] STAUFEN, STAUFEN analogs, biologically active STAUFEN
fragments, STAUFEN fusion proteins and pharmaceutical agents, as
well as nucleic acid sequences encoding STAUFEN, STAUFEN analogs,
biologically active STAUFEN fragments or STAUFEN fusion proteins
can be administered together with other components of biologically
active agents, such as pharmaceutically acceptable surfactants
(e.g., glycerides), excipients (e.g., lactose), stabilizers,
preservatives, humectants, emollients, antioxidants, carriers,
diluents and vehicles. If desired, certain sweetening, flavoring
and/or coloring agents can also be added.
[0110] STAUFEN, STAUFEN analogs, biologically active STAUFEN
fragments, STAUFEN fusion proteins and pharmaceutical agents, as
well as nucleic acid sequences encoding STAUFEN, STAUFEN analogs,
biologically active STAUFEN fragments or STAUFEN fusion proteins
can be administered prophylactically or therapeutically to an
animal prior to, simultaneously with or sequentially with other
therapeutic regimens or agents (e.g., multiple drug regimens),
including with other therapeutic regimens used for the treatment of
long term memory defects, the enhancement of long term memory
formation, the modulation of performance of hippocampal-dependent
cognitive tasks or the treatment of hippocampal-dependent cognitive
task performance defects. STAUFEN, STAUFEN analogs, biologically
active STAUFEN fragments, STAUFEN fusion proteins and
pharmaceutical agents, as well as nucleic acid sequences encoding
STAUFEN, STAUFEN analogs, biologically active STAUFEN fragments or
STAUFEN fusion proteins, that are administered simultaneously with
other therapeutic agents can be administered in the same or
different compositions. Two or more different STAUFEN, STAUFEN
analogs, biologically active STAUFEN fragments, STAUFEN fusion
proteins, nucleic acid sequences, pharmaceutical agents or
combinations thereof can also be administered.
[0111] STAUFEN, STAUFEN analogs, biologically active STAUFEN
fragments, STAUFEN fusion proteins, and pharmaceutical agents, as
well as nucleic acid sequences encoding STAUFEN, STAUFEN analogs,
biologically active STAUFEN fragments or STAUFEN fusion proteins,
can be formulated as a solution, suspension, emulsion or
lyophilized powder in association with a pharmaceutically or
physiologically acceptable parenteral vehicle, carrier or
excipient. Examples of such vehicles, carriers and excipients are
water, saline, Ringer's solution, isotonic sodium chloride
solution, dextrose solution, and 5% human serum albumin. Liposomes
and nonaqueous vehicles such as fixed oils can also be used. The
vehicle or lyophilized powder can contain additives that maintain
isotonicity (e.g., sodium chloride, mannitol) and chemical
stability (e.g., buffers and preservatives). The formulation can be
sterilized by commonly used techniques. Suitable pharmaceutical
carriers are described in Remington's Pharmaceutical Sciences.
[0112] An effective amount of pharmaceutical agent, STAUFEN,
STAUFEN analog, biologically active STAUFEN fragment, STAUFEN
fusion protein or nucleic acid sequence is that amount, or dose,
administered to an animal that is required to effect a change
(increase or decrease) in STAUFEN protein expression or in STAUFEN
function. The dosage administered to an animal, including frequency
of administration, will vary depending upon a variety of factors,
including pharmacodynamic characteristics of the particular
augmenting agent, mode and route of administration; size, age, sex,
health, body weight and diet of the recipient; nature and extent of
symptoms being treated or nature and extent of the cognitive
function(s) being enhanced or modulated, kind of concurrent
treatment, frequency of treatment, and the effect desired.
[0113] Pharmaceutical agents, STAUFEN, STAUFEN analogs,
biologically active STAUFEN fragments, STAUFEN fusion proteins and
nucleic acid sequences can be administered in single or divided
doses (e.g., a series of doses separated by intervals of days,
weeks or months), or in a sustained release form, depending upon
factors such as nature and extent of symptoms, kind of concurrent
treatment and the effect desired. Other therapeutic regimens or
agents can be used in conjunction with the present invention.
Adjustment and manipulation of established dosage ranges are well
within the ability of those skilled in the art.
[0114] Once an effective amount has been administered, a
maintenance amount of a pharmaceutical agent, STAUFEN, STAUFEN
analog, biologically active STAUFEN fragment or STAUFEN fusion
protein, or nucleic acid sequence encoding a STAUFEN, STAUFEN
analog, biologically active STAUFEN fragment or STAUFEN fusion
protein, can be administered to the animal. A maintenance amount is
the amount of pharmaceutical agent, STAUFEN, STAUFEN analog,
biologically active STAUFEN fragment or STAUFEN fusion protein (or
nucleic acid sequence encoding a STAUFEN, STAUFEN analog,
biologically active STAUFEN fragment or STAUFEN fusion protein)
necessary to maintain the change (increase or decrease) in STAUFEN
protein expression or in STAUFEN function achieved by the effective
dose. The maintenance amount can be administered in the form of a
single dose, or a series or doses separated by intervals of days or
weeks (divided doses). Second or subsequent administrations can be
administered at a dosage which is the same, less than or greater
than the initial or previous dose administered to the animal.
Determination of such amounts are well within the ability of those
skilled in the art.
[0115] The present invention will now be illustrated by the
following examples, which are not to be considered limiting in any
way.
EXAMPLES
Example 1 Staufen Expression In Mouse Hippocampus
[0116] A fragment of mouse staufen, from nucleotide 551 to 851 of
sequence AF061942 from the NCBI database, was amplified by
polymerase chain reaction (PCR) and subcloned into a EcoRI site of
a PCRII vector (InVitroGen).
[0117] Antisense probes were generated by cutting the PCRII
subclone with SmaI, priming from the Sp6 promoter. Sense probes
were generated by cutting the PCRII subclone with Bg1II, priming
from the T7 promoter.
[0118] Brains of 8-10 week old male wild type C57B1/6 mice were
surgically removed and placed in liquid nitrogen. Brains were
sliced on a cryostat at 16 um and allowed to air dry. Tissue
sections then were subjected to the following in situ hybridization
protocol:
[0119] Day 1:
[0120] If sections from fixed brains were used, the sections were
sent to the prehybridization washes step. If fresh-frozen brains
(i.e., not fixed) were used, the sections were first fixed as
follows:
[0121] Fixing Fresh-Frozen Sections:
[0122] Slides were immersed in 4% paraformaldehyde/1.times. PBS at
4.degree. C. for 20 min. The sections were then sent to
prehybridization washes.
[0123] Prehybridization Washes:
[0124] 1. The slides were washed 2.times.5 minutes with 1.times.
PBS (pH 7.4)
[0125] 2. The slides were then washed 2.times.5 minutes with
1.times. PBS containing 100 mM glycine, freshly made since it will
precipitate if made ahead of time.
[0126] 3. The slides were then incubated 15 minutes with 1.times.
PBS containing 0.3% Triton X-100.
[0127] 4. The slides were then washed 2.times.5 minutes with
1.times. PBS.
[0128] Permeabilization:
[0129] 5. Pre-warmed TE buffer, pH 8.0 (100 mM Tris-HCl, pH 8.0, 50
mM EDTA, pH 8.0) at 37.degree. C. was used. The slides were
incubated 20 minutes at 37.degree. C. with TE buffer, pH 8.0,
containing 1 .mu.g/ml Proteinase K (RNase-free).
[0130] Post-Fix:
[0131] 6. The slides were incubated 5 minutes at 4.degree. C. in 4%
paraformaldehyde/1.times. PBS.
[0132] 7. The slides were then wash 2.times.5 minutes with 1.times.
PBS.
[0133] Acetylation:
[0134] 8. The slides were incubated and rocked 2.times.5 minutes
with 0.1 M triethanolamine (TEA) buffer, pH 8.0, containing 0.25%
(v/v) acetic anhydride which has been added immediately before
incubation.
[0135] Pre-Hybridization:
[0136] 9. Slide hybridization chambers were placed over sections on
slide. Pre-hybridization buffer was pre-warmed (4.times.SSC, 50%
formamide) at 37.degree. C. About 750 .mu.l were pipetted in per
slide. The slides were incubated at 37.degree. C. for 10 min. or
more.
[0137] Hybridization:
[0138] 10. Hybridization solutions were prepared using Ambion In
Situ Hyb Buffer (Ambion #8806G) and 0.5-1 .mu.g of DIG-labeled
riboprobe per ml. Enough hyb buffer plus probe was prepared for
about 750 .mu.l per slide. These solutions were kept on ice.
[0139] 11. Pre-hybridization buffer was removed with pipet and
about 750 .mu.l of hyb buffer plus probe was pipetted into hyb
chamber. The slides were laid out in a humid chamber. The humid
chamber was sealed tightly and the slides were incubated overnight
at 42.degree. C.
[0140] Day 2:
[0141] Posthybridization:
[0142] 12. Slides were kept separated according to probe, removed
from the hyb chambers, then washed 2.times.15 minutes in
2.times.SSC, with shaking at 37.degree. C.
[0143] 13. The slides were washed 2.times.15 minutes with
1.times.SSC, with shaking at 37.degree. C.
[0144] 14. RNasing--At this point, slides with different probes
could be put together. NTE buffer (500 mM NaCl, 10 mM Tris, pH 8.0,
1 mM EDTA, pH 8.0) to 37.degree. C. was pre-warmed. Slides were
incubated for 30 minutes at 37.degree. C. in NTE buffer containing
20 .mu.g/ml RNase A.
[0145] 15. 0.1.times.SSC was prewarmed to 37.degree. C. The slides
were washed 2.times.30 minutes in 0.1.times.SSC, with shaking at
37.degree. C.
[0146] Immunological Detection:
[0147] 16. Slides were washed 2.times.10 minutes in Buffer 1 (100
mM Tris-HCl, pH 7.6, 150 mM NaCl), with shaking at RT.
[0148] 17. New hyb chambers were placed on slides, and blocking
solution was added (Buffer 1 with 2% normal sheep serum and 0.1%
Triton X-100) about 750 .mu.l per slide. The slides were incubated
for 30 minutes in blocking solution.
[0149] 18. The blocking solution was removed with pipet and about
750 .mu.l of antibody solution (0.1% Triton X-100, 1% sheep serum,
1:1000 anti-DIG-alkaline phosphatase) was gently pipetted in. The
slides were placed in a humid chamber and either incubated for 2
hours at room temperature (RT), or overnight at 4.degree. C.
[0150] 19. Hyb chambers were removed, then the slides were washed
2.times.10 minutes in Buffer 1 with shaking at RT.
[0151] 20. The slides were incubated for 10 minutes in Buffer 2
(100 mM Tris-HCl, pH 9.5, 100 mM NaCl, 50 mM MgCl.sub.2).
[0152] 21. The slides were incubated in color solution (1.times.
NBT/BCIP, 1 mM levamisole) for 2-24 hours in the dark (NBT=4-nitro
blue tetrazolium chloride;
BCIP=5-bromo-4-chloro-3-indolyl-phosphate). When color development
was optimal, the color reaction was stopped by incubating the
slides in Buffer 3 (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0),
then the slides were dipped in distilled water. Counterstaining
could be done on the slides using 0.1% Nuclear Fast Red (in water),
about 5 minutes incubation. The slides were incubated 2.times.10
minutes in distilled water.
[0153] After mounting tissue, DIG-labeled sections were viewed with
an Axioplan 2 imaging microscope from Ziess for expression in the
hippocampus and adjoining areas.
[0154] Staufen expression was detected throughout the hippocampus
with antisense RNA probes. Expression also was detected in other
regions of the brain. In particular, antisense RNA probe hybridized
to cells in the CA1, CA3 and dendate gyrus regions. In contrast,
sense (control) probes yielded no detectable signal. These results
imply that interference with staufen function vis RNA antisense
injections into the hippocampus will disrupt memory formation.
[0155] The following materials and methods were used in the work
described in Example 2.
Animals and Surgery
[0156] Ten to twelve week old C57B1/6 male mice (Taconic
Laboratory, N.Y.) were used. Mice were housed in groups of four in
standard mouse cages and kept in a 12:12 light-dark cycle and
constant temperature (22.degree. C.) in a humidity and
ventilation-controlled animal house. With the exception of surgery,
training and testing times, the mice had ad lib access to food and
water. Animals were acclimatized to animal house environment for a
week before surgery. On a day of surgery, mice were anesthetized
with 20 mg/kg Avertin and implanted with a 26-gauge guide double
cannula aimed at the dorsal hippocampus using a stereotaxic
apparatus (Korf Instruments, Calif.; coordinates: P=1 mm; L=1.5 mm
to a depth of 1-1.2 mm; Franklin and Paxinos, The Mouse Brain In
Stereotaxis Coordinates, Academic Press, San Diego, Calif. (1997)).
After the end of surgery, animals were individually maintained in a
cage with ad lib access to food and water. Seven days after
recovery from surgery, animals were trained for contextual fear
conditioning.
Fear Conditioning Experiments
[0157] The basic fear conditioning procedures and equipment
remained as described (Bourtchuladze, R. et al., Cell, 79:59-68
(1994); and Bourtchouladze et al., Learn Mem., 5(4-5):365-374
(1998)). On the training day, the mouse was placed in the
conditioning chamber (Med Associates) for 2 minutes before the
onset of unconditioned stimulus (US) of 0.5 mA, two seconds shock.
For weak training, US was repeated two times with a one minute
inter-trial interval between shocks. For strong training, 5 USs
were given. Training was automated and performed by computerized
software package (Med Associates).
[0158] Thirty seconds after the end of the last trial, the mouse
was returned to its home cage. The conditioning chamber was cleaned
with 75% ethanol and then with water. Contextual memory was tested
four days after training by scoring freezing responses. Freezing
was assessed with a sampling method. That is, 2 second observations
were taken every 5 seconds (Bourtchuladze, R. et al., Cell,
79:59-68 (1994); Bourtchouladze et al., Learn Mem., 5(4-5):365-374
(1998); and Frankland, P. W. et al., Behav. Neurosci., 112:863-874
(1998)). A mouse was determined to be freezing when it adopted a
motionless posture, refraining from all but respiratory
movements.
[0159] For each training and drug-injecting procedure, an
experimentally nave group of animals was used. The observations
were made by an experimenter unaware of the experimental treatment
of the mice. In each experiment, both training and testing were
videotaped. Experiments were analyzed with an analysis of variance
(ANOVA) and t-tests.
Drug and Oligodeoxynucleotide (OND) Infusion Procedures
[0160] Anisomycin (ANI) (Sigma) was dissolved in 0.9% saline, and
the pH was adjusted with 1 N HCl to 7.4. Control animals received
injections of saline. Mice were injected in the hippocampus (62.5
.mu.g/2 .mu.l per hippocampus) immediately after training.
Infusions were made through the guide cannula using a 33-gauge
injection needle. The needle was connected via a polyethylene tube
to a microsyringe fixed in the pump 11 (Harvard Instruments). The
entire infusion procedure took 2 minutes and animals were freely
moving during this time in the home cage. Experiments were
replicated 2 times and for each training procedure, an
experimentally nave group of animals was used (n=47 total).
[0161] Mouse antisense oligodeoxynucleotides (ODNs) directed
against CREB mRNA
(5'-T-s-g-s-g-s-T-C-A-T-T-T-g-T-T-A-C-C-g-s-g-s-T-s-g-3') (SEQ ID
NO:1) was used to disrupt hippocampal CREB protein levels. Control
groups received infusions of ODN of the same base composition but
in randomized order (scrambled CREB:
5'-g-s-T-s-C-s-T-g-T-A-g-T-C-g-A-T-C-T-A-T-s-g-s-g- -s-T-3') (SEQ
ID NO:2). ODNs were administered into the hippocampus (2 nmol/2
.mu.l per hippocampus) as described above for ANI-infusion. CREB
ODNs were infused 20 hours before training. Experiments were
replicated 3 times and for each training procedure, an
experimentally nave group of animals was used (n=54 total).
[0162] Mouse antisense oligodeoxynucleotides (ODNs) directed
against staufen mRNA
(5-'g-s-g-s-g-s-C-T-T-A-T-A-C-A-T-T-g-s-g-s-T-s-T-3') (SEQ ID NO:3)
were used to disrupt hippocampal STAUFEN protein levels. Control
groups received infusions of ODN of the same base composition but
in randomized order (scrambled staufen:
5'-g-s-T-s-g-s-T-A-C-T-g-A-T-T-g-A-C- -s-T-s-g-s-T-3') (SEQ ID
NO:4). ODNs were administered into the hippocampus (4 nmol/2 .mu.l
per hippocampus) as described above for ANI-infusion. Staufen ODNs
were infused repeatedly, 3 times. The first infusion was made 44
hours before training. The second infusion was made 15 hours before
training. The third infusion was made immediately after training.
Experiments were replicated 3 times and for each training
procedure, an experimentally nave group of animals was used (n=39
total).
Histology
[0163] After the end of the behavioral testing, 2 .mu.l of a
solution of 4% methylene blue was infused into the cannula. Animals
were sacrificed and their brains were removed, frozen and then cut
at -20.degree. C. with cryostat for histological localization of
infusion cannula.
Example 2
STAUFEN and Long Term Memory Formation In Mice
[0164] Five training trials (5.times.; "strong" training) yields
maximal levels of long term memory, while two training trials
(2.times., "weak" training) yields less than half maximal levels
(FIG. 1).
[0165] Partial knock down of CREB expression by injection of
antisense oligonucleotides into the hippocampus 20 hours before
training reduced memory induced by strong training to the levels
produced by weak training (FIG. 2). CREB ODN-injected mice showed
significantly less freezing responses than vehicle-injected mice
when animals were trained with 5USs (65.1.+-.4.3% and 44.2.+-.6.3%,
control- and CREB ODN-injected mice, n=14 and n=17, respectively;
p<0.01) (FIG. 2). There was no significant difference between
CREB ODN- and vehicle-injected mice when mice were trained with 2
USs, although freezing responses of CREB ODN-treated mice were less
than controls (34.+-.5.8% and 28.4.+-.5.1%, n=11 and n=12,
respectively, p=0.47). These results provided validation of
"CREB-dependence" for the assay.
[0166] The prototypical type-IV phosphodiesterase inhibitor,
Rolipram, administered immediately after training, significantly
enhanced the amount of memory induced by weak training but had no
effect on the maximal memory levels produced by strong training.
These experiments provided further support for "CREB-dependence"
for the assay (FIG. 3).
[0167] Protein synthesis inhibitor anisomycin (ANI), injected
immediately after training, blocked contextual memory (FIG. 4).
ANI-injected mice showed significantly fewer freezing responses
than vehicle-injected mice when animals were trained with 5USs
(51.01.+-.7% and 28.42.+-.4.9%, control- and ANI-mice, n=11 and
n=13, respectively; p<0.01) or 2USs (32.7.+-.4.4% and
17.1.+-.4.3%, control- and ANI-mice, n=10 and n=12, respectively;
p<0.05).
[0168] Staufen antisense ODN treatments impaired 4-day retention in
mice after 5 US training (FIG. 5). Freezing responses of
staufen-treated mice (42.8.+-.6.6%, n=12) were significantly less
(p<0.05) than vehicle-injected mice (61.+-.4.5%, n=10). There
was no significant difference between staufen- and vehicle-injected
mice when mice were trained with 2 USs, although freezing responses
of staufen-treated mice were less than controls (30.+-.3.1% and
38.4.+-.3.0%, n=10 and n=7, respectively, p=0.08).
[0169] Together, these results indicate that different training
protocols--weak and strong training--recruit shared and distinct
molecular processes for contextual memory formation. Maximal levels
of memory, induced with strong training, require protein synthesis
that is matched by a requirement of cAMP-signaling, CREB-dependent
transcription and normal function of STAUFEN in the hippocampus
(most likely in somata). Memory induced by weak training appears to
recruit protein synthesis in CREB- and STAUFEN-independent fashion;
perhaps, through local protein synthesis pools in dendrites.
[0170] The following materials and methods were used in the work
described in Examples 3 to 5.
Behavioral Training and Genetic Strains
[0171] Olfactory associative learning was quantified by subjecting
two-to-three day old adult flies to a Pavlovian conditioning
procedure (Tully, T. et al., Cell, 79:35-47 (1994); and Tully, T.
and Quinn, W. G., J. Comp. Physiol. [A], 157:263-277 (1985)).
Briefly, groups of about 100 flies were exposed sequentially to one
odor (CS+) paired with footshock and then a second odor (CS-)
without foot-shock. Spaced and massed trained animals received 10
such training sessions with a 15-minute rest interval between
sessions in the case of spaced training. For DNA chip experiments,
animals were rapidly frozen immediately (t=0), six (t=6) or 24
hours (t=24) after training. 10 massed training sessions are
completed in 39 minutes, compared with 2 hours 51 minutes for 10
spaced training sessions. To control for this timing difference,
all groups of flies were loaded into machines at the same time, but
onset of massed training was delayed such that completion of both
training regimens were simultaneous. Groups experiencing massed
training thus experienced the training context (including air
current) for the same total duration as the spaced-trained groups.
During the test trial (FIG. 6), flies were exposed simultaneously
to the CS+ and CS- in a T-maze. After two minutes, flies were
trapped in either T-maze arm, anesthetized and counted. From this
distribution, a performance index (PI) was calculated, so that a
50:50 distribution (no memory) yielded a PI of zero and a 0:100
distribution away from the CS+ yielded a PI of 100. PIs were
distributed normally and, hence, were analyzed parametrically. For
DNA chip and QPCR follow up experiments, an isogenic white line
(w.sup.1118(isoCJ1)) (Yin, J. C. et al., Cell, 81:107-115 (1995))
was used. StauC8/stauD3 heteroallelic mutants were generated by
crossing b,pr,stau.sup.C8/Cy0 and cn,stau.sup.D3/Cy0 flies.
Affymetrix Chip Hybridizations and Probe Preparation
[0172] Total cellular RNA was isolated from adult heads using
Trizol reagent (Gibco-BRL manufacturer's protocol). Frozen tissue
was dolfed in a mortar and then dounce homogenized in Trizol using
a glass homogenizer (5 ml Trizol/gram tissue). Biotinylated cRNA
probes for Affymetrix chip hybridizations were generated according
to Affymetrix protocols. Reverse transcription was carried out
using an anchored oligo-DT primer containing a T7 RNA polymerase
sequence (5'-GGCCAGTGAATTG TAATACGACTCACTATAGGGA
GGCGG-T.sub.24-VN-3') (SEQ ID NO:5). cRNA (10 .mu.g) probes were
resuspended in 200 .mu.l hybridization solution: 0.1 mg/ml herring
sperm DNA, 0.5 mg/ml acetylated BSA, 0.1 M MES (Sigma MES-hydrate
and MES-sodium salt), 1.0 M NaCl, 0.01% Triton X-100. Hybridization
reactions, labeling, and chip scanning were done according to
Affymetrix protocols.
Statistical Analysis
[0173] "Average Difference" (AvDif) values for each gene from each
chip were obtained from Affymetrix software without regard to any
other parameter therein. The following steps of data analysis then
were performed:
[0174] 1) For a given timepoint (N=10 chips for spaced and 10 chips
for massed), all AvDif values below 10 were eliminated from the
database (set to "missing values).
[0175] 2) The remaining AvDif values on each chip were normalized
to the mean AvDif for all genes and chips, 1 NormAvDiff = AvDif ij
.times. Mean AvDif Mean AvDif j for gene i on chip j .
[0176] 3) All genes for which N=0 (because of eliminated values)
for spaced OR massed treatments were eliminated.
[0177] 4) A BoxCox transformation was performed (Westfall, P. H.
and Young, S. S., Resampling-based Multiple Testing: Examples and
Methods for p-value Adjustment (New York: John Wiley & Sons,
Inc.) (1993)) on NormAvDif values, according to a two-way analysis
of variance (ANOVA) model with TREATMENT and GENE as main effects
and TREAT.times.GENE as the interaction term. This method evaluates
a family of transformations of
BoxAvDif=NormAvDif.sup.x,
[0178] where -1<X<1
[0179] to find the particular value of X that minimizes the Sums of
Squares Error (SSE) of the ANOVA model (Sokal, R. R. and Rohlf, F.
J., Biometry, 2nd edition (San Francisco: W. H. Freeman)
(1981)).
[0180] 5) All genes for which N<3 for spaced OR massed
treatments were eliminated.
[0181] 6) The Effect Size (ES) for each gene was calculated as:
ES=mean BoxAVDIF (spaced)-mean BoxAvDif (massed)
[0182] 7) The statistical significance of each ES was determined
via a bootstrapping method with the critical value (alpha) set at
0.05.
[0183] 8) For comparisons across different experiments (timepoints)
ES values were expressed as Standard Normal Deviates (StNDs) as
follows: 2 StD = ES i St . Dev . ES
[0184] for genes i and where St.Dev is the standard deviation of
the mean ES.
Quantitative Polymerase Chain Reaction (QPCR)
[0185] RNA isolations were performed with Trizol (BRL) as for
Affymetrix chip probe preparation (see above) with the following
modifications. After the Trizol step, samples were treated with
DNAaseI (Promega-5U per sample) for 30 minutes (37.degree. C.) and
then were extracted with phenol/chloroform/iso-amyl alcohol (BRL),
precipitated with ethanol and resuspended in DEPC-treated water.
Reverse transcription reactions were performed using 2.5 .mu.G RNA
per reaction with an oligo dT primer using Taqman reverse
transcription reagents (Applied Biosystems). PCR quantification was
performed using 10% of the above RT product per reaction on a 7,700
real-time PCR machine using (Perkin Elmer) and SYBR green PCR core
reagents (Applied Biosystems) according to manufacturer's
protocols. Prior to QPCR, all PCR products were verified by either
restriction mapping or automated sequencing. Gene specific primers
had the following sequences: pum: 5'-TGTAGACATAGTCTGGGGTCCTC-3'
(SEQ ID NO:6) and 5'-AAGCAACAGCCATTGGGTCCAC-3' (SEQ ID NO:7),
dCREB2: 5'-GCAACTCGTCGGCGGC ATC-3' (SEQ ID NO:8) and
5'-CGCCGGGCCGTTGTA CTTTGT-3' (SEQ ID NO:9), rux:
5'-CCACTCTGATTCCGCCACTG-3' (SEQ ID NO:10) and
5'-GCGTTGAATCCTCCTCGGTATC-3' (SEQ ID NO:11), TBP:
5'-GCGGCTGTGATTATGCGAAT- -3' (SEQ ID NO:12) and 5'-CATACTTTCTC
GCTGCCAGTCTG-3' (SEQ ID NO:13), slbo: 5'-CAGACTACCGATGCGAACA ACA-3'
(SEQ ID NO:14) and 5'-GTGCCTGAACTGGTGGTGTATCA-3' (SEQ ID NO:15),
gliotactin: 5'-CGCCTTCTGGAGGCAATACT-3' (SEQ ID NO:16) and
5'-GCGATCTGTAGTGGCTCCTTG-3' (SEQ ID NO:17). Expression levels were
normalized to Drosophila TBP transcript levels. TBP was confirmed
as an unchanged control by comparing in excess of 100 RNA
extractions each after spaced and massed training. Thus TBP was a
false positive at t=6 in these DNA chip experiments. All reactions
were done in parallel using at least 8 independent RNA isolations
for each group, with each RNA isolate being assayed in
triplicate.
Immunocytochemistry and Confocal Imaging
[0186] Whole mount immunolabeling of adult brains was performed
according to Chiang et al., 2001 (Chiang, A. S. et al., J. Comp.
Neurol., 440:1-11 (2001)) using a Rat-anti-PUM antibody originally
tested for specificity using Western blots from mutant animals
(Sonoda, J. and Wharton, R. P., Genes Dev., 13:2704-2712 (1999)).
Briefly, dissected brains were fixed for two hours in a room
temperature vacuum and then overnight with 4% paraformaldehyde in
PBS. Fixed tissue then was blocked for two days at 4.degree. C. in
PBS containing 2% Triton-X and 10% normal goat serum (NGS) and then
successively incubated for 2 days each (with washing in between) at
4.degree. C. in PBS containing 1% Triton X, 0.25% NGS and (1) a
polyclonal rat anti-pum antibody (Sonoda, J. and Wharton, R. P.,
Genes Dev., 13:2704-2712 (1999)) diluted 1/1000, (2) a biotinylated
goat anti-mouse IgG (1:200) and (3) a strepavidin Cy5-conjugate (1
.mu.g/ml, diluted 1000.times. from stock solution) in PBS
containing 1% Triton-X. Next, tissue was treated with RNAse (0.1
mg/ml) for one hour, stained overnight in NBD (0.435 mM) (Chiang,
A. S. et al., J. Comp. Neurol., 440:1-11 (2001)), for 30 minutes in
propidium iodide (0.00625 mg/ml) and then mounted in FOCUSCLEAR.
Whole-mount brains were imaged with a Zeiss LSM 510 confocal
microscope (Carl Zeiss, Jena), equipped with a 10.times. Fluor
objective lens (N.A. 0.5, working distance 2000 .mu.m) and a
40.times. C-Apochromat water immersion objective lens (N.A. 1.2,
working distance 220 mm).
Example 3
Experimental Design and Statistical Analysis for DNA
Microarrays
[0187] Transcriptional responses to olfactory LTM are likely to
occur in a small subset of neurons of the adult brain. One brain
region critically involved in olfactory learning and memory is the
mushroom body (de Belle, J. S. and Heisenberg, M., Science,
263:692-695 (1994); Dubnau, J. et al., Nature, 411:476-480 (2001);
Pascual, A. and Preat, T., Science, 294:1115-1117 (2001); Zars, T.
et al., Science, 288:672-675 (2000)), which consists of
approximately 5,000 neurons or roughly 10% of the brain. Since mRNA
is extracted from whole heads, a significant reduction in the
signal from transcripts responding to memory formation is expected.
Thus, a statistical method which optimizes the detection of
small-magnitude differences in transcript levels was developed as
described below.
[0188] The nalyot.sup.P1 mutation disrupts LTM and produces a
two-fold reduction in the level of expression of ADF1, a
transcription factor apparently involved in structural but not
functional aspects of synaptic plasticity (DeZazzo, J. et al.,
Neuron, 27:145-158 (2000)). Thus, Adf-1 served as an internal
positive control by comparing basal transcript levels between
control (wildtype) flies and nalyot mutants using a prototype
Drosophila DNA chip from Affymetrix containing 1,542 known, cloned
genes. An experimental design was employed that (i) balanced
various sources of variation across treatment groups (wildtype
versus mutant) and (ii) increased the number of replicate chips to
improve statistical power. Traditional parametric statistics were
optimized to detect reliably the Adf-1 difference. The optimal
method is as follows: (1) 1,000 heads were used per RNA extract,
thereby averaging any individual variation (from genetic background
or other epigenetic effects) and any batch effects (from handling
subgroups of animals on different days). (2) A minimum of 5
replicate chips (independent RNA extractions) were used per
treatment group. (3) "Avg-Diff" values less than 10 were
eliminated. (4) Avg-Diff values on each chip were normalized for
small differences in the amounts of probe used per chip. (5) A
Box-Cox transformation was applied to Normalized Avg-Diff values to
minimize the experiment-wide error variance (sums of squares error,
SSE) and to yield more homogeneous error variances among groups
(genes). (6) Statistical significance for the effect size (ES; the
difference between mean values for wild-type versus mutant
treatment) for each gene was determined via bootstrapping. (7)
Effect sizes for all genes then were expressed as "standard
deviates" (sdv; the effect size for a given gene expressed in units
of the standard deviation of all ESs (for all genes).
[0189] This method yielded a significant difference for expression
of Adf-1 transcripts between wildtype flies and nal.sup.P1 mutants
(ES=2.8 sdv; N=5; P=0.002). The decrease in Adf-1 expression in
nalyot mutant flies was confirmed with real-time (quantitative)
RT-PCR (QPCR; N=4 RNA extracts; P=0.001) and with Northern blots
(N=12 RNA extracts; P=0.001).
[0190] Another gene on the chip, annotated as "CaSpeR-1" in the
Affymetrix database, expressed at significantly higher levels in
nal.sup.P1 mutants than in wildtype flies (ES=-4.1 sdv.). The
specific oligonucleotide (oligo) sequences on the chip corresponded
to the "mini-white" eye color marker gene contained within the
PlacW transposon insertion of the nal.sup.P1 mutation (DeZazzo, J.
et al., Neuron, 27:145-158 (2000)). In fact, the wildtype control
flies (white.sup.1118) carry a deletion of this region of the white
gene. Hence, another internal control was detected on the chip that
is expressed in mutant flies but not in wildtype control flies.
[0191] Overall, 68 of 1,542 genes showed statistically significant
differences between wildtype and nal.sup.P1 flies, with effect
sizes (absolute values) ranging from 0.3 to 5.1. When ranking these
effects from highest to lowest, the "CasPer-1" gene was fourth and
Adf1 was sixth. The largest effect size for the photolyase gene
(FBgn0003082) was also confirmed via Northern blot analysis.
[0192] When compared to this parametric method, the traditional
2-fold approach differs in two important ways. First is the
"denominator effect": A majority of candidates from the 2-fold
method are relatively low-expressing genes. This occurs because
smaller effect sizes are needed to yield a 2-fold change when the
denominator of the ratio is a smaller number. Second is the "false
negative effect": A majority of candidates identified from the
parametric method were higher-expressing genes that were not
detected by the 2-fold approach. This observation indicates that
many biologically relevant changes in transcript expression levels
might be missed with the traditional 2-fold method. This comparison
is a relative one; each statistical method also has its own
implicit false-positive rate. Similar issues regarding the
traditional two-fold analysis have been echoed in emerging
literature on the statistical analysis of DNA microarray data (Jin,
W. et al., Nat. Genet., 29:389-395 (2001); Schadt, E. E. et al., J.
Cell. Biochem., 80:192-202 (2000); Van Der Laan, M. J. and Bryan,
J., Biostatistics, 2: 445-461 (2001); and Wolfinger, R. D. et al.,
J. Comput. Biol., 8:625-637 (2001)).
Example 4
Identification of Candidate Memory Genes (CMGs)
[0193] Previous studies have yielded a genetic dissection of
olfactory memory formation in Drosophila (Tully, T. et al., Cell,
79:35-47 (1994); Dubnau, J. and Tully, T., Annu. Rev. Neurosci.,
21:407-444 (1998); Tully, T., Proc. Natl. Acad. Sci. USA,
93:13460-13467 (1996); and Waddell, S. and Quinn, W. G., Annu. Rev.
Neurosci., 24:1283-1309 (2001)). Of particular relevance is the
observation that the long-lasting memory produced by spaced
training (10 training sessions with a 15 minute rest interval
between each) is blocked when protein synthesis is inhibited
(Tully, T. et al., Cell, 79:35-47 (1994)) or when expression of a
CREB repressor transgene is induced (Yin, J. C. et al., Cell,
79:49-58 (1994)). Both of these manipulations produce no effect on
memory after massed training (10 training sessions with no rest
intervals). These results indicate that the memory produced in
normal flies after spaced training, above and beyond that after
massed training, is critically dependent on (CREB-mediated) gene
expression. Thus, comparing mRNA from wildtype flies subjected to
spaced versus massed training should identify transcriptional
changes specific to LTM. For example, non-specific transcriptional
effects produced by exposure to odors or foot-shock alone are
likely to be present after both spaced and massed training, thereby
yielding no differential effect.
[0194] To accomplish this DNA chip comparison, approximately 60,000
wild-type flies were subjected to spaced or massed training in a
balanced experimental design using batches of approximately 100
flies per training run. One hundred batches of flies (10,000
individuals) were frozen in liquid nitrogen at each of three
time-points (t=0, 6 and 24 hours) after spaced or massed training.
These 100 batches of frozen flies were combined, heads were
collected and then distributed randomly into 10 sets of
approximately 1,000 to generate 10 independent RNA extracts (for
each time point and training regimen). In this manner, potential
variations among different training runs or among individual flies
(because of genetic background differences or other epigenetic
effects) were averaged out leaving only the potential treatment
effects of spaced and massed training. These 10 replicate RNA
extractions then were used to generate probes for hybridization to
10 independent Affymetrix DNA chips. Importantly, inclusion of 10
replicates in this experimental design ensured a proper sampling of
variation derived from separate RNA extractions (which were
estimated to be nearly 40 times greater than the variation due to
replicate chip hybridizations using the same cDNA).
[0195] From these data, 129 candidate memory genes (CMGs) were
identified using the statistical method described herein in Example
3: 47 from t=0, 26 from t=6 and 58 from t=24 hour groups (two genes
were significant at two time points each).
[0196] False positives are inherent in all DNA chip experiments,
regardless of statistical method. Hence, only a subset of these
CMGs will prove to be true positives. Follow-up QPCR assays can be
done on independent samples of RNA to identify true positives.
[0197] Most, if not all, genes are pleiotropic, with protein
functions that subserve more than one biological process. For
example, a cell cycle gene that functions as a kinase to regulate
cytoskeletal elements during mitosis also may phosphorylate
different substrates in terminally differentiated neurons (Mendez,
R. et al., EMBO J., 21:1833-1844 (2002)). Thus, CMGs that initially
do not appear to be involved in memory formation, nevertheless, may
participate in memory formation (Pinto, S. et al., Neuron, 23:45-54
(1999)).
[0198] Confirmation that a CMG is involved in memory formation
rests with the demonstration that in vivo modulation (disruption)
of the gene alters that process (with some specificity). To this
end, the pum gene has been identified two independent times (a CMG
both at t=0 and t=6) from a behavioral screen for memory mutants
with defective one-day memory after spaced training. Mutations in
pum produce deficits in one-day memory after spaced training, and
pum is transcriptionally regulated in normal flies during long-term
memory formation. The former result constitutes confirmation of pum
as a CMG that was suggested by the DNA chip experiments. The latter
result indicates that pum participates in a cellular process that
is acutely required during memory formation in the adult.
[0199] Existing polyclonal antibodies (Sonoda, J. and Wharton, R.
P., Genes Dev., 13:2704-2712 (1999)) were used to determine the
expression pattern of PUM in the central nervous system (CNS) of
normal adults. Immunolabeling with a polyclonal rat-anti-PUM
antibody (Sonoda, J. and Wharton, R. P., Genes Dev., 13:2704-2712
(1999)) decorates somatic regions of most neurons. PUM was found to
be expressed broadly with a complex subcellular distribution. The
majority of PUM immunoreactivity is peri-nuclear, but significant
punctate staining also is observed in neuropilar regions. For
example, in the mushroom bodies, strong somatic staining surrounds
the nucleus of all intrinsic neurons (Kenyon cells). Weaker
punctate expression is detected in the dendritic neuropil region of
the mushroom bodies (calyx). These observations suggest that PUM
may function widely in the CNS.
[0200] Similar results were obtained on 5 .mu.M sections as well as
in whole mount preparations with a polyclonal rabbit-anti-PUM
antibody (Sonoda, J. and Wharton, R. P., Genes Dev., 13:2704-2712
(1999)), with or without pre-absorption against embryonic
tissue.
[0201] First discovered in genetic screens for mutations affecting
Drosophila embryonic development, the pum gene is part of a pathway
involved in translational repression during posterior patterning
and germline determination (Johnstone, O. and Lasko, P., Annu. Rev.
Genet., 35:365-406 (2001); and Palacios, I. M. and Johnston, D. S.,
Annu. Rev. Cell. Dev. Biol., 17:569-614 (2001)). Polarization of
the antero-posterior axis of the oocyte involves
microtubule-dependent transport to the posterior pole of a large
RNP complex known as a "polar granule", containing nanos (nos)
mRNA, as well as numerous additional components, including the CMGs
staufen, oskar, mago nashi and faf. Localized nos message serves as
a restricted source of NOS protein, which functions together with
PUM to repress translation of several target mRNAs. Other genetic
components in xenopus or fly oocytes that interact with PUM/NOS to
regulate translation include cytoplasmic polyadenylation element
binding protein (CPEB or orb in flies) (Nakahata, S. et al., J.
Biol. Chem., 276:20945-20953 (2001)), CycB, cdc2 (as a dimer, the
latter two show kinase activity which phosphorylates orb, thereby
targeting it for ubiquitin-mediated degradation) (Mendez, R. et
al., EMBO J., 21:1833-1844 (2002); and Reverte, C. G. et al., Dev.
Biol., 231:447-458 (2001)), the ubiquitin-proteosome pathway and
eIF4-E (the cap-binding protein). Phosphorylation of CPEB by aurora
kinase also facilitates interaction of eIF4-E with eIF4-G and the
rest of the translation initiation complex (Stebbins-Boaz, B. et
al., Mol. Cell., 4:1017-1027 (1999)). Known PUM/NOS target mRNAs
include CycB (Nakahata, S. et al., J. Biol. Chem., 276:20945-20953
(2001); and Asaoka-Taguchi, M. et al., Nat. Cell Biol., 1:431-437
(1999)) and sex lethal (Sxl) (Deshpande, G. et al., Cell,
99:271-281 (1999)).
[0202] Both the DNA chip experiments described here and a
complementary behavioral screen for memory mutants (e.g., see
Example 2) have identified several components of this pathway. In
addition to pum, DNA chip analyses have yielded stau, mago, faf,
orb and Sxl as CMGs. Moreover, another CMG, msl-2, is a known
translational target of Sxl. Several other CMGs appear to be
involved more generally in the cellular machinery subserving RNA
binding, regulation of translation and cytoskeletal function. Only
one of these CMGs (pumilio) was identified using the traditional
2-fold method of microarray analysis, thereby providing some
biological validation for this statistical method.
[0203] These findings are further convergent with those of the
complementary behavioral screen for memory mutants in which P
element insertions have been identified in or near pum, oskar,
eIF-5C, CycB and seven additional genes involved with RNA
processing and cytoskeletal function. These findings suggest that
the cellular machinery involved in targeting mRNAs and locally
regulating their translation during embryogenesis also may be used
by neurons during long term memory formation.
Example 5
Disruption of staufen After Training Interferes with Long Term
Memory Formation In Drosophila
[0204] In vertebrate hippocampal neurons, STAUFEN protein is
associated with a large RNP complex known as a "neural granule"
(Krichevsky, A. M. and Kosik, K. S., Neuron, 32:683-696 (2001);
Tang, S. J. et al., Neuron, 32:463-475 (2001); Kiebler, M. A. et
al., J. Neurosci., 19:288-297 (1999); and Kohrmann, M. et al., Mol.
Biol. Cell., 10: 2945-2953 (1999)). Neural granules are thought to
package newly transcribed mRNAs with translational repressors and
ribosomal components. These RNP particles then are transported via
microtubules along dendritic shafts, where they appear to
disassemble in response to specific postsynaptic depolarizations
presumably to release their repressed mRNAs for local,
activity-dependent translation of new proteins (Steward, O. and
Schuman, E. M., Annu. Rev. Neurosci., 24:299-325 (2001);
Krichevsky, A. M. and Kosik, K. S., Neuron, 32:683-696 (2001);
Tang, S. J. et al., Proc. Natl. Acad. Sci. USA, 99:467-472 (2002);
and Aakalu, G. et al., Neuron, 30:489-502 (2001)). Identification
with DNA chips and a behavioral screen (e.g., see Example 2) of
multiple components of this cellular machinery suggests the
involvement during memory formation of neural granules in the
delivery of CREB-dependent transcripts to recently activated
synapses. A direct prediction from this hypothesis is that
disruption of staufen after training will interfere with long-term
memory formation.
[0205] To test this hypothesis, memory formation was assayed in a
temperature-sensitive mutant of staufen (stau.sup.C8/stau.sup.D3)
(Ephrussi, A. et al., Cell, 66:37-50 (1991); and Lehmann, R. and
Nusslein-Volhard, C., Development, 112:679-691 (1991)). At the
restrictive temperature (29.degree. C.), stau.sup.C8/stau.sup.D3
mutant embryos exhibit a strong mutant phenotype (a complete
deletion of abdominal patterning, along with other defects).
However, at permissive temperature (18.degree. C.), only slight
defects in abdominal segmentation can be seen. Accordingly, when
these stau.sup.C8/stau.sup.D3 mutants were raised at the permissive
temperature, and then adults were subjected to spaced training,
stored during the retention interval and tested for one-day memory
all at permissive temperature, memory scores were comparable to
controls reared under the same conditions (FIG. 6). In contrast,
when these mutants were raised, trained and tested at permissive
temperature but were transiently shifted to restrictive temperature
only during the retention interval, one-day memory was nearly
abolished (FIG. 6). Importantly, this transient disruption of
staufen does not produce non-specific effects on learning or on
sensorimotor responses because performance levels are similar
(P=0.92, N=6 PIs per group) in staufen mutants when they are
trained and tested at 18.degree. C. (PI=41.+-.5) or when they first
are shifted to 29.degree. C. for one-day prior to training and
testing immediately after being returned to 18.degree. C.
(PI=40.+-.6). These latter controls rule out the possibility that
non-specific effects on sensorimotor responses to odors or
footshock underlie the observed defects in memory retention
produced by this transient disruption of STAUFEN. Rather, these
data demonstrate an acute requirement for STAUFEN after
training--during the consolidation of long-term memory.
[0206] The following materials and methods were used in the work
described in Example 6.
Breeding of Mutant Strains
[0207] Transposon mutagenesis was carried out as described (Dura,
J. et al., J. Neurogenet., 9:1-14 (1993)) with minor modifactions.
A PGAL4 transposon or a PlacZ X-linked mutator was used to generate
strains "A-D" and "E", respectively, which carried homozygous,
adult-viable transposon insertions somewhere on the second or third
chromosomes (autosomes). At maximum effort, 96 mutant strains were
generated and screened each week. After N=5 experiment, those
strains with reproducibly defective memory (see below) were
outcrossed for at least five generations to the parental strain to
equilibrate genetic backgrounds. For A-D strains, this parental
strain was w.sup.1118;Sp/CyO;Sb/TM3, Ser double-balancer stock,
which itself had been outcrossed to our standard w.sup.1118
(isoCJ1) stock. For E strains, the parental strain was w.sup.1118
(isoCJ1) itself.
Behavioral Screen
[0208] Pavlovian olfactory conditioning: One to four day old adult
flies were placed in dry food bottles the night before training and
kept at 25.degree. C. Environment-controlled rooms remained at a
constant 25.degree. C. with 70% humidity, and flies were
trained/tested in the dark. During one training session, a group of
approximately 100 flies was exposed consecutively to octanol (CS+)
paired with footshock (US) and then to a methycyclohexanol (CS-)
without footshock, piped through the training chamber in an air
current. For spaced training, flies were subjected to ten training
sessions with a 15-minutes rest interval in between each. Flies
then were placed in dry food vials overnight at 18.degree. C. The
next day, conditioning odor avoidance responses were assessed for
two minutes in a T-maze, where the CS+ and CS- are delivered
simultaneously on convergent currents of air. After testing, flies
were trapped in their respective T-maze arms, anesthetized and
counted. A performance index (PI) was calculated so that a 50:50
distribution (no memory) yielded a PI of 0 and a 0:100 distribution
away from the CS+ yielded a PI of 100. For one complete experiment,
a second group of 100 flies was trained with odor2 as the CS+ and
odor1 as the CS-, and the two resulting PIs were averaged for an
N=1.
[0209] One-day memory after spaced training was evaluated for
mutant strains in a minimum of three passes. On the first pass, an
N=1 was generated for a strain. If the resulting PI was .ltoreq.50%
of normal (wild-type) levels, then an N=4 PIs was generated in a
second pass. [At the maximum effort, 96 mutant strains were
evaluated each week, and the 17 lowest-scoring strains were chosen
for the second pass; their scores still were .ltoreq.50% of
wild-type controls.] If the average PI.ltoreq.70% of normal, then
the strain was outcrossed to equilibrate genetic backgrounds (see
above), re-homozygosed, and a second N=4 PIs was generated in a
third pass. If the average PI again was .ltoreq.70%, then the
strain was designated a candidate memory mutant, and task-relevant
sensorimotor responses were evaluated.
[0210] Sensorimotor Responses: Shock reactivity was carried out in
the T-maze according to (Tully, T. et al., Cell, 79:35-47 (1994)).
Two copper grids were attached to either arm while only one was
electrified (60 V). PIs were calculated as above by designating the
shocked T-maze arm as "CS+". Olfactory acuity was carried out in
the T-maze according to a previously published procedure herein
incorporated by reference (Tully, T. et al., Cell, 79:35-47
(1994)). The relative avoidance of octanol versus
methylcyclohexonal (delivered at the concentrations used during
conditioning) was quantified for nave flies. PIs were calculated as
above by arbitrarily designating one odor as "CS+". A minimum of
N=6 PIs were generated for each sensorimotor response. Sixty
candidate mutant strains yielded average PIs.gtoreq.90% of
wild-type controls and were designated as memory mutants. Two
additional strains (D0107 and D0185) yielded average PIs for
olfactory acuity <75%, with those for shock reactivity still
.gtoreq.90%, of controls. These were designated olfactory mutants.
In a similar fashion, two strains (E3029 and E3065) were designated
shock reactivity mutants.
[0211] Learning: Memory retention immediately after a single
training session also was quantified in the 60 memory mutants.
Average PIs were .ltoreq.90% of controls for 10 strains; these
strains were distinguished as "learning" mutants, rather than
"memory" mutants, although the distinction is somewhat
arbitrary.
Molecular Identification of Transposon Mutations
[0212] Plasmid rescue of transposons: Genomic DNA was isolated from
homozygous mutant flies, digested to completion with one of several
possible restriction enzymes (mainly EcoRI, SacI and XhoI) and
"plasmid rescued" using standard protocols (Sullivan, W. et al.
(Eds.), Drosophila Protocols (Cold Spring Harbor Laboratory Press,
Cold Spring Harbor) (2000)). Sequences were obtained by automated
sequencing (ABI) using a primer directed against the 3' LTR of
pGawB or PlacZ (5-CACTCGCACTTAT TGCAAGCATACG-3') (SEQ ID NO:18) and
were compared to the FlyBase annotated database of Drosophila
genome sequence (6 Gelbart, W. M. et al., Nucleic Acids Res.,
25:63-66 (1997)). In every successful case (57 of 60), a unique
genomic insertion site was determined. For two strains (D0264 and
D0851), the DNA sequence appeared identical, but it corresponded
entirely to sequences internal to PGAL4. Consequently, a genomic
insertion site(s) has not yet been identified for these
strains.
[0213] "Dog-tagging": To confirm the molecular identification of
each genomic insertion site and to identify each memory mutant
unambiguously, a rapid PCR-based method was developed to detect the
transposon insertion unique to each mutant strain. From the genomic
sequence around the transposon insertion site, three PCR primers
were generated. The sequence of one primer corresponded to the
(common) 5' end of the transposon; the sequences of the other two
primers then corresponded to genomic sequence flanking the (unique)
transposon insertion site. The PCR reaction then was run with all
three primers. In each case, the choice of genomic primer sequences
was such that fragments of two discernable sizes were
PCR-amplified. A "mutant" fragment appeared if genomic DNA
contained the appropriate transposon insertion. Alternatively,
"wild-type" fragment appeared of genomic DNA did not contain the
appropriate transposon insertion (i.e., from wild-type flies or
from an inappropriate transposant strain). Flies (or populations)
heterozygous (heterogeneous) for the appropriate transposon
insertion were identified by the presence of both the mutant and
wild-type PCR fragment. Genomic DNA from a given strain was
obtained with standard methods.
[0214] For PCR, one 1 .mu.l of each genomic sample was added to a
PCR tube, and 1 .mu.l of the appropriate primer was then added. The
addition of 5 .mu.l of PCR buffer, 1.5 .mu.l of magnesium chloride,
35.5 .mu.l of distilled water, 1 .mu.l of DNTP's, and 0.5 .mu.l of
Taq was added to all samples. Thirty rounds of ampflication were
run at the appropriate annealing temperatures for each primer. The
PCR samples were then electrophoresed on an 1% agarose gel. For
initial characterizations, the appropriate bands (mutant and
wild-type) were gel purified and restriction-digested to confirm
that the amplified bands were of the expected sequence. Such
dog-tag confirmation was accomplished for all 57 strains
described.
Northern Blot Analyses of CMGs
[0215] RNA was isolated (according to manufacturer's protocols)
with Trizol (Gibco) from heads of four independent groups of flies
for each strain. PolyA RNA was selected using oligo dT-magnetic
beads (Dynal) according to the manufacturer's protocol. Northern
blots were prepared using standard techniques (DeZazzo, J. et al.,
Neuron, 27:145-158 (2000)). Briefly, 5 .mu.g of PolyA-RNA per
sample were electrophoresed through a 1% agarose-formaldehyde gel
using MOPS buffer. Gels were blotted onto nylon membrane
(Schleicher and Schuel). P-32 labeled probes were generated by
random priming using PCR-fragments corresponding to each CMG (which
either were sequenced or restriction digested to confirm the
fidelity of amplification).
Enhancer-Trap Reporter-Gene Histology of Memory Mutants
[0216] PlacZ: Freshly dissected brains from 2-5 day-old flies were
fixed in freshly prepared 0.2% glutaraldehyde in PBS for 10 minutes
on ice. Brains are washed 3.times. in PBS for 5 minutes each at
room temperature (RT). Brains are incubated in XGAL staining
solution (2 mg XGAL/1 ml XGAL buffer) in a moist, sealed container
for 5 minutes to 48 hours at 37.degree. C. Brains are post-fixed in
4% paraformaldehyde and 0.1% Triton-X 100 in PBS for 30 minutes in
vaccuum at RT (allow air in and out several times for best
results). Brains were cleared in FocusClear.TM.; the FocusClear.TM.
bottle was kept in a hot water bath. Brains were mounted in
MountClear.TM. (from the hot-water bath). Whole-mount brains were
photographed on a Zeiss dissecting scope, using a SV11
objective.
[0217] PGAL4: Homozygous mutant females were bred to homozygous
UAS-GFPS.sup.S65T males (Bloomington stock #1521). The mushroom
body enhancer trap strain, C747, was used as a positive control,
while homozygous mutant females (no UAS-GFP) served as negative
controls. Three-to-five day old heterozygous female progeny were
examined for GFP expression patterns. Flies were anesthetized with
CO.sub.2 and quickly dissected while pinned to a Sylgard-covered
dish and submerged in PBS. The proboscis was pushed carefully into
the extended position with fine forceps, a patch of cuticle on the
posterior of the proboscis was removed, and the large silvery
tracheae within the head capsule were carefully peeled out,
avoiding damage to brain. The eyes to the level of the lamina were
then carefully removed and the brain was immaculately cleaned of
all external tracheae using two fine forceps. Brains were carefully
transferred to 4% paraformaldehyde for 30 minutes, then to 4%
paraformaldehyde +0.25% Triton-X100 for 30 minutes under mild
vacuum. Brains were then cleared using FocusClear.TM. solution
(Pacgen, Vancouver, Canada) for 5 minutes, and then mounted in a
drop of the same solution (Chiang, A. S. et al., J. Comp. Neurol.,
440:1-11 (2001)).
[0218] Whole-mount brains were imaged with a Zeiss LSM 510 confocal
microscope (Carl Zeiss, Jena), equipped with a 10.times. Fluar
objective lens (N.A. 0.5, working distance 2000 .mu.m) and a
40.times. C-Apochromat water immersion objective lens (N.A. 1.2,
working distance 220 .mu.m). Structures with GFP expression were
excited with a Kr/Argon laser at 488 nm, and their fluorescence was
detected after emissions had passed through a 505 nm long-pass
filter. Stacks confocal images were taken through the full
thickness of the central brain. The images were stored at a size of
1024.times.1024 pixels. The distance between successive images
(Z-axis distance) was adjusted for the refractive index mismatch of
the air and mounting medium as described previously (Chiang, A. S.
et al., J. Comp. Neurol., 440:1-11 (2001)). In some cases, frontal
and dorsal projections were rendered using Amira 2.3 (TGS, Inc.,
San Diego) after removing optical slices between brain surface and
mushroom bodies to better reveal internal structures.
Example 6
Behavioral Screen for Memory Mutants
[0219] A large-scale behavioral screen for memory mutants was
conducted one day after spaced training. The behavioral screen was
initiated using a genetically engineered P element transposon
(carrying a either a GAL4 or beta-GALACTOSIDASE enhancer-trap
reporter gene) as a mutator (Boynton, S. and Tully, T., Genetics,
131:655-672 (1992); and Dura, J. et al., J. Neurogenet., 9:1-14
(1993)). A total of 6,681 homozygous-viable transposants were
generated, each carrying (usually) a single P element insertion
somewhere on the 2nd or 3rd chromosomes (which comprise about 80%
of the Drosophila genome). One-day memory after spaced training was
quantified for each strain. One hundred and six strains showed an
average PI (performance index) .ltoreq.70% of wild-type control
flies after at least five generations of outcrossing to the genetic
background of wild-type control flies. Sensorimotor responses to
the odors and footshock used during Pavlovian training then were
evaluated. Sixty strains showed PIs .gtoreq.90% of wild-type
control flies both for olfactory acuity and for shock reactivity
(cf. Dura, J. et al., J. Neurogenet., 9:1-14 (1993)). Thus, these
60 strains represent new mutants with behavioral defects specific
to the associative component of olfactory long-term memory. These
memory mutants were named after Pavlov's dogs.
[0220] Memory immediately after a single training session also was
evaluated for these 60 memory mutants to judge whether "learning"
was defective along with one-day memory after spaced training. The
PIs of ten mutants were <90% of wild-type controls, indicating
defects in both initial learning and in one-day memory after spaced
training. Of the remaining 50 mutants, 9 were judged "weak" memory
mutants with PIs between 51% and 70% of controls, while 41 were
judged to be "strong" memory mutants with PIs.ltoreq.50%. In the
course of these genetic crosses and behavioral assays, it was
discovered that three of the latter memory mutants were
homozygous-lethal but nevertheless yielded memory defects as
heterozygotes.
[0221] Because the entire DNA sequence of the Drosophila genome now
is available, it was possible to rapidly identify the molecular
lesions for 57 of these 60 mutant strains. These 57 lesions define
49 sites in the Drosophila genome. Twenty five of these sites lie
within, and 24 lie between, defined transcription units (genes),
thereby identifying a total of 70 new candidate memory genes
(CMGs). Among these CMGs are four genes, oskar, CyclinB, eIF-5C and
pumilio, which are known to be involved in the translocation of
mRNA and regulation of translation during embryogenesis.
Significantly, pumilio and several other genetic components
(staufen, mago nashi, fat facets, orb, cdc2 and eIF2-G) of this
cellular machinery also have been identified as transcriptionally
regulated genes during long-term memory formation in normal
(wild-type) Drosophila. The milord, norka, avgust and krasavietz
enhancer-trap mutations all show reporter-gene expression in adult
mushroom bodies, as do a majority of the other mutant strains. More
interestingly, however, a few mutant strains show enhancer-trap
patterns of expression outside of mushroom bodies, thereby
revealing novel regions of the adult central nervous system that
may be involved in olfactory memory formation.
[0222] Among the known genes, pumilio was identified twice in the
behavioral screen for memory mutants (milord-1 and -2).
Significantly, pumilio also was identified from DNA chip
experiments on wild-type flies as a transcriptionally regulated CMG
at two different time-points (t=0 and t=6 hr) after spaced
training. These results are fully complementary. Identifying memory
mutants with transposon insertions in the pumilio transcription
unit confirms the gene as a "true positive" from the DNA chip
experiments. Identifying pumilio in wild-type flies as a
transcriptionally regulated gene during long-term memory formation
shows that the gene is actively involved in adult neural
plasticity.
[0223] This initial convergence on pumilio has been reinforced by
the observation that additional genetic components of this pathway
also have been identified from the behavioral screen and from the
DNA chip experiments. Genes that interact with pumilio have been
described in the context of embryonic development. Together, they
define a biological pathway involved with subcellular localization
of mRNAs and local regulation of translation. Several of these
interacting genes, including staufen, mago nashi, fat facets, orb,
cdc2 and eIF-2G, have been identified from DNA chip experiments.
Consistent with this result, three more genetic components of this
pathway--oskar, CyclinB and eIF-5C--were CMGs from the behavioral
screen for memory mutants (norka, avgust and krasavietz,
respectively).
[0224] The pumilio, oskar, CyclinB and eIF-5C genes are likely CMGs
disrupted in milord-1/-2, norka, avgust and krasavietz memory
mutants. For milord-1/-2 and krasavietz, transposon insertions were
found to reside within the respective pumilio and eIF-5C
transcription units, while the transposons associated with norka
and avgust reside near the CycB and oskar genes and disrupt their
transcription. The pumilio, staufen, mago nashi, fat facets, orb,
cdc2 and eIF-2G genes, which are known to interact with each other,
were identifed directly from DNA chip experiments as a
transcriptionally regulated genes during long-term memory
formation. The discovery that mutations of pumilio yield defects in
one-day memory, as shown herein, constitutes strong initial proof
that pumilio is actively involved in long-term memory formation.
The observation that multiple genetic components of this pathway
have been identified cross-validates both the DNA microarray
experiment and the behavioral mutant screen for identifying genes
associated with long-term memory formation.
[0225] Convergence beyond the "pumilio pathway" and the "staufen
pathway" also is suggested from these two approaches. The mutant
screen described herein has identified several CMGs involved in
ubiquitin-dependent protein degradation, a cellular process already
shown to participate in long-term synaptic plasticity in Aplysia
and in Drosophila (Hegde, A. N. et al., Cell, 89:115-126 (1997);
and DiAntonio, A. et al., Nature, 412: 449-452 (2001)). In Xenopus
oocytes, local translation is controlled in part via
phosphorylation of cytoplasmic polyadenylation element binding
protein (CPEB; orb is the fly homolog) by CDC2 kinase (Reverte, C.
G. et al., Dev. Biol., 231:447-458 (2001)). To this end, DNA chip
experiments also identified as a CMG fat facets (faf), a gene that
is known to interact with other members of the "pumilio pathway" or
"staufen pathway". The faf gene encodes a ubiquitin C-terminal
hydrolase that negatively regulates proteolysis in several
development contexts including the larval neuromuscular junction
(DiAntonio, A. et al., Nature, 412: 449-452 (2001); and
Hochstrasser, M., Curr. Opin. Cell. Biol., 7:215-223 (1995)).
[0226] The teachings of all the articles, patents and patent
applications cited herein are incorporated by reference in their
entirety.
[0227] While this invention has been particularly shown and
described with references to preferred embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
scope of the invention encompassed by the appended claims.
Sequence CWU 1
1
18 1 25 DNA Artificial Sequence Antisense oligodeoxynucleotides 1
tsgsgstcat ttgttaccgs gstsg 25 2 26 DNA Artificial Sequence
Antisense oligodeoxynucleotides 2 gstscstgta gtcgatctat sgsgst 26 3
23 DNA Artificial Sequence Antisense oligodeoxynucleotides 3
gsgsgsctta tacattgsgs tst 23 4 23 DNA Artificial Sequence Antisense
oligodeoxynucleotides 4 gstsgstact gattgacsts gst 23 5 42 DNA
Artificial Sequence Oligo-DT primer containing T7 RNA polymerase
sequence 5 ggccagtgaa ttgtaatacg actcactata gggaggcggt vn 42 6 23
DNA Artificial Sequence PCR Primer 6 tgtagacata gtctggggtc ctc 23 7
22 DNA Artificial Sequence PCR Primer 7 aagcaacagc cattgggtcc ac 22
8 19 DNA Artificial Sequence PCR Primer 8 gcaactcgtc ggcggcatc 19 9
21 DNA Artificial Sequence PCR Primer 9 cgccgggccg ttgtactttg t 21
10 20 DNA Artificial Sequence PCR Primer 10 ccactctgat tccgccactg
20 11 22 DNA Artificial Sequence PCR Primer 11 gcgttgaatc
ctcctcggta tc 22 12 20 DNA Artificial Sequence PCR Primer 12
gcggctgtga ttatgcgaat 20 13 23 DNA Artificial Sequence PCR Primer
13 catactttct cgctgccagt ctg 23 14 22 DNA Artificial Sequence PCR
Primer 14 cagactaccg atgcgaacaa ca 22 15 23 DNA Artificial Sequence
PCR Primer 15 gtgcctgaac tggtggtgta tca 23 16 20 DNA Artificial
Sequence PCR Primer 16 cgccttctgg aggcaatact 20 17 21 DNA
Artificial Sequence PCR Primer 17 gcgatctgta gtggctcctt g 21 18 25
DNA Artificial Sequence Primer 18 cactcgcact tattgcaagc atacg
25
* * * * *
References