U.S. patent application number 11/073649 was filed with the patent office on 2005-07-07 for bifunctional antibiotics for targeting rrna and resistance-causing enzymes and for inhibition of anthrax lethal factor.
This patent application is currently assigned to Technion Research & Development Foundation Ltd.. Invention is credited to Baasov, Timor, Belakhov, Valery, Fridman, Micha, Yaron, Sima.
Application Number | 20050148522 11/073649 |
Document ID | / |
Family ID | 36036737 |
Filed Date | 2005-07-07 |
United States Patent
Application |
20050148522 |
Kind Code |
A1 |
Baasov, Timor ; et
al. |
July 7, 2005 |
Bifunctional antibiotics for targeting rRNA and resistance-causing
enzymes and for inhibition of anthrax lethal factor
Abstract
A novel group of aminoglycosides which share some structural
features of currently available aminoglycosides with regard to the
backbone, while also having significant structural differences, is
disclosed. The similarity enables these aminoglycosides to be
highly potent and effective antibiotics, while the significant
differences enable these aminoglycosides to reduce or even block
antibiotic resistance. The aminoglycosides of the present invention
are suitable for inhibition of antrax lethal factor, hence are
suitable for use as a cure for anthrax.
Inventors: |
Baasov, Timor; (Haifa,
IL) ; Fridman, Micha; (Kiryat Bialik, IL) ;
Belakhov, Valery; (Haifa, IL) ; Yaron, Sima;
(Shimshit, IL) |
Correspondence
Address: |
Martin MOYNIHAN
c/o ANTHONY CASTORINA
SUITE 207
2001 JEFFERSON DAVIS HIGHWAY
ARLINGTON
VA
22202
US
|
Assignee: |
Technion Research & Development
Foundation Ltd.
|
Family ID: |
36036737 |
Appl. No.: |
11/073649 |
Filed: |
March 8, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11073649 |
Mar 8, 2005 |
|
|
|
PCT/IL04/00490 |
Jun 9, 2004 |
|
|
|
PCT/IL04/00490 |
Jun 9, 2004 |
|
|
|
10829976 |
Apr 23, 2004 |
|
|
|
60540359 |
Feb 2, 2004 |
|
|
|
60484293 |
Jul 3, 2003 |
|
|
|
60608372 |
Sep 10, 2004 |
|
|
|
Current U.S.
Class: |
514/36 ;
536/16.7 |
Current CPC
Class: |
C07H 15/00 20130101;
C07H 15/232 20130101 |
Class at
Publication: |
514/036 ;
536/016.7 |
International
Class: |
A61K 031/704; C07H
017/04 |
Claims
What is claimed is:
1. A compound having the general formula I: 26wherein: R.sub.1 is a
monosaccharide residue or an oligosaccharide residue; X and Y are
each independently oxygen or sulfur; R.sub.2 and R.sub.3 are each
independently selected from the group consisting of hydrogen,
hydroxy, thiol, amine, alkyl, cycloalkyl, aryl, alkoxy, aryloxy,
thioalkoxy and thioaryloxy; and wherein the carbon at the fifth
position of ring B has an R configuration or an S configuration; or
a pharmaceutically acceptable salt thereof.
2. The compound of claim 1, wherein X is oxygen.
3. The compound of claim 2, wherein Y is oxygen.
4. The compound of claim 3, wherein R.sub.1 is a monosaccharide
residue.
5. The compound of claim 4, wherein said monosaccharide residue is
a five-membered (furanose) or a six-membered (pyranose)
monosaccharide residue.
6. The compound of claim 4, wherein said monosaccharide residue
comprises at least one amine group and/or at least one aminoalkyl
group.
7. The compound of claim 6, wherein said at least one amine group
and/or said at least one aminoalkyl group is at one or more of
positions 2, 3, 4 or 5.
8. The compound of claim 7, wherein said at least one aminoalkyl
group is an aminomethyl group (CH.sub.2--NH.sub.2).
9. The compound of claim 8, wherein said monosaccharide residue is
a pyranose monosaccharide residue, and said aminomethyl group is at
position 5.
10. The compound of claim 7, wherein said monosaccharide residue is
a pyranose monosaccharide residue, and said at least one amine
group is at one or more of positions 2, 3 or 4.
11. The compound of claim 7, wherein said monosaccharide residue is
a furanose monosaccharide residue, and said aminoalkyl group is at
position 4.
12. The compound of claim 4, wherein said monosaccharide residue is
a L-monosaccharide or a D-monosaccharide.
13. The compound of claim 1, wherein R.sub.1 is an oligosaccharide
residue.
14. The compound of claim 13, wherein said oligosaccharide residue
comprises at least two monosaccharide residues, wherein each is
independently a five-membered (furanose) or a six-membered
(pyranose) monosaccharide residue.
15. The compound of claim 14, wherein at least one of said at least
two monosaccharide residues comprises at least one amine group
and/or at least one aminoalkyl group.
16. The compound of claim 15, wherein said at least one amine group
is at position 2 of a pyranose monosaccharide residue.
17. The compound of claim 16, wherein said at least one aminoalkyl
group is at position 5 of a pyranose monosaccharide residue.
18. The compound of claim 14, wherein said oligosaccharide
comprises a furanose monosaccharide linked to a pyranose
monosaccharide.
19. The compound of claim 14, wherein each of said at least two
monosaccharide residues is independently a D-monosaccharide or a
L-monosaccharide.
20. The compound of claim 1, wherein X is sulfur and R.sub.1 is a
monosaccharide residue.
21. The compound of claim 20, wherein said monosaccharide is a
furanose monosaccharide residue.
22. The compound of claim 13, wherein said oligosaccharide residue
comprises at least four monosaccharide residues, wherein each
monosaccharide residue is independently a five-membered (furanose)
or a six-membered (pyranose) monosaccharide residue.
23. The compound of claim 22, wherein said oligosaccharide residue
is selected from the group consisting of a Neomycin B residue, a
Paromomycin residue, a Ribostamycin residue, a Gentamycin residue,
a Amikacin residue, a Neamine residue, a Nebramine residue and a
Tobramine residue.
24. A pharmaceutical formulation comprising a therapeutically
effect amount the compound of claim 1 and a pharmaceutically
acceptable carrier.
25. A compound having the general formula II: 27wherein: Y is
oxygen or sulfur; R.sub.2 and R.sub.3 are each independently
hydrogen, hydroxy, thiol, amine, alkyl, cycloalkyl, aryl, alkoxy,
aryloxy, thioalkoxy or thioaryloxy, and wherein the carbon at the
fifth position of ring B has an R configuration or an S
configuration; or a pharmaceutically acceptable salt thereof.
26. The compound of claim 25, wherein Y is oxygen, and R.sub.2 and
R.sub.3 are both hydroxy.
27. A pharmaceutical formulation comprising a therapeutically
effective amount of the compound of claim 1 and a pharmaceutically
acceptable carrier.
28. A compound having the general formula III: 28wherein: R.sub.1
is an oligosaccharide residue comprising at least two
monosaccharide residues, wherein each is independently a
five-membered (furanose) or a six-membered (pyranose)
monosaccharide residue. Y is oxygen or sulfur; X is disulfide;
R.sub.2 and R.sub.3 are each independently selected from the group
consisting of hydrogen, hydroxy, thiol, amine, alkyl, cycloalkyl,
aryl, alkoxy, aryloxy, thioalkoxy and thioaryloxy; and wherein the
carbon at the fifth position of ring B has an R configuration or an
S configuration; or a pharmaceutically acceptable salt thereof.
29. The compound of claim 28, wherein Y is oxygen.
30. The compound of claim 28, wherein R.sub.2 and R.sub.3 are both
hydroxy.
31. The compound of claim 28, wherein said oligosaccharide residue
comprises at least four monosaccharide residues, each of said
monosaccharide residues is independently a five-membered (furanose)
or a six-membered (pyranose) monosaccharide residue.
32. The compound of claim 31, wherein said oligosaccharide residue
is selected from the group consisting of a Paromomycin residue, a
Ribostamycin residue, a Gentamycin residue, a Amikacin residue, a
Neamine residue, a Nebramine residue and a Tobramine residue.
33. A pharmaceutical formulation comprising a therapeutically
effective amount of the compound of claim 28 and a pharmaceutically
acceptable carrier.
34. A method for treating a subject in need thereof, comprising:
administering to the subject a therapeutically effective amount of
the compound of claim 1.
35. A method for treating a subject having an infectious
micro-organism, comprising: administering to the subject a
therapeutically effective amount of the compound of claim 1.
36. The method of claim 35, wherein said infectious microorganism
comprises a bacterial strain.
37. The method of claim 36, wherein said bacterial strain is
resistant to at least one antibiotic.
38. The method of claim 36, wherein said bacterial strain comprises
one or more of Gram-positive and Gram-negative organisms with a
variety of growth circumstances and requirements ranging from
aerobic to anaerobic growth.
39. The method of claim 38, wherein said bacterial strain is
selected from the group consisting of: (a) Gram-positive bacteria
selected from the group consisting of Strep.pyogenes (Group A),
Strep.pneumoniae, Strep.GpB, Strep.viridans,
Strep.GpD-(Enterococcus), Strep.GpC and GpG, Staph.aureus,
Staph.epidermidis, Bacillus subtilis, Bacillus anthraxis, Listeria
monocytogenes, Anaerobic cocci, Clostridium spp., and Actinomyces
spp; and (b) Gram-negative bacteria selected from the group
consisting of Escherichia coli, Enterobacter aerogenes, Kiebsiella
pneumoniae, Proteus mirabilis, Proteus vulgaris, Morganella
morganii, Providencia stuartii, Serratia marcescens, Citrobacter
freundii, Salmonella typhi, Salmonella paratyphi, Salmonella typhi
murium, Salmonella virchow, Shigella spp., Yersinia enterocolitica,
Acinetobacter calcoaceticus, Flavobacterium spp., Haemophilus
influenzae, Pseudomonas aueroginosa, Campylobacter jejuni, Vibrio
parahaemolyticus, Brucella spp., Neisseria meningitidis, Neisseria
gonorrhoea, Bacteroides fragilis, and Fusobacterium spp.
40. The method of claim 36, wherein said bacterial strain comprises
a Mycobacteria strain.
41. The method of claim 40, wherein said Mycobacteria strain is
selected from the group consisting of Mycobacterium tuberculosis or
Mycobaterium smegmatis.
42. The method of claim 39 wherein said bacterial strain comprises
Bacillus anthraxis.
43. A method for treating a subject having a genetic disorder,
comprising: administering a therapeutically effective amount of the
compound of claim 1.
44. The method of claim 43, wherein the genetic disorder comprises
a protein having a truncation mutation.
45. The method of claim 44, wherein the genetic disorder comprises
cystic fibrosis.
46. The method of claim 44, wherein the genetic disorder comprises
Duchenne's muscular dystrophy or Hurler's syndrome.
47. A method for treating anthrax, comprising administering to a
subject in need thereof a therapeutically effective amount of the
compound of claim 1.
48. A method for treating a subject in need thereof, comprising:
administering to the subject a therapeutically effective amount of
the compound of claim 25.
49. A method for treating a subject having an infectious
micro-organism, comprising: administering to the subject a
therapeutically effective amount of the compound of claim 25.
50. The method of claim 49, wherein said infectious microorganism
comprises a bacterial strain.
51. The method of claim 50, wherein said bacterial strain is
resistant to at least one antibiotic.
52. The method of claim 50, wherein said bacterial strain comprises
one or more of Gram-positive and Gram-negative organisms with a
variety of growth circumstances and requirements ranging from
aerobic to anaerobic growth.
53. The method of claim 52, wherein said bacterial strain is
selected from the group consisting of: (a) Gram-positive bacteria
selected from the group consisting of Strep.pyogenes (Group A),
Strep.pneumoniae, Strep.GpB, Strep.viridans,
Strep.GpD-(Enterococcus), Strep.GpC and GpG, Staph.aureus,
Staph.epidermidis, Bacillus subtilis, Bacillus anthraxis, Listeria
monocytogenes, Anaerobic cocci, Clostridium spp., and Actinomyces
spp; and (b) Gram-negative bacteria selected from the group
consisting of Escherichia coli, Enterobacter aerogenes, Kiebsiella
pneumoniae, Proteus mirabilis, Proteus vulgaris, Morganella
morganii, Providencia stuartii, Serratia marcescens, Citrobacter
freundii, Salmonella typhi, Salmonella paratyphi, Salmonella typhi
murium, Salmonella virchow, Shigella spp., Yersinia enterocolitica,
Acinetobacter calcoaceticus, Flavobacterium spp., Haemophilus
influenzae, Pseudomonas aueroginosa, Campylobacter jejuni, Vibrio
parahaemolyticus, Brucella spp., Neisseria meningitidis, Neisseria
gonorrhoea, Bacteroides fragilis, and Fusobacterium spp.
54. The method of claim 50, wherein said bacterial strain comprises
a Mycobacteria strain.
55. The method of claim 54, wherein said Mycobacteria strain is
selected from the group consisting of Mycobacterium tuberculosis or
Mycobaterium smegmatis.
56. The method of claim 54 wherein said bacterial strain comprises
Bacillus anthraxis.
57. A method for treating a subject having a genetic disorder,
comprising: administering a therapeutically effective amount of the
compound of claim 25.
58. The method of claim 57, wherein the genetic disorder comprises
a protein having a truncation mutation.
59. The method of claim 57, wherein the genetic disorder comprises
cystic fibrosis.
60. The method of claim 57, wherein the genetic disorder comprises
Duchenne's muscular dystrophy or Hurler's syndrome.
61. A method for treating anthrax, comprising administering to a
subject in need thereof a therapeutically effective amount of the
compound of claim 25.
62. A method for treating a subject in need thereof, comprising:
administering to the subject a therapeutically effective amount of
the compound of claim 28.
63. A method for treating a subject having an infectious
micro-organism, comprising: administering to the subject a
therapeutically effective amount of the compound of claim 28.
64. The method of claim 63, wherein said infectious microorganism
comprises a bacterial strain.
65. The method of claim 64, wherein said bacterial strain is
resistant to at least one antibiotic.
66. The method of claim 64, wherein said bacterial strain comprises
one or more of Gram-positive and Gram-negative organisms with a
variety of growth circumstances and requirements ranging from
aerobic to anaerobic growth.
67. The method of claim 64, wherein said bacterial strain is
selected from the group consisting of: (a) Gram-positive bacteria
selected from the group consisting of Strep.pyogenes (Group A),
Strep.pneumoniae, Strep.GpB, Strep.viridans,
Strep.GpD-(Enterococcus), Strep.GpC and GpG, Staph.aureus,
Staph.epidermidis, Bacillus subtilis, Bacillus anthraxis, Listeria
monocytogenes, Anaerobic cocci, Clostridium spp., and Actinomyces
spp; and (b) Gram-negative bacteria selected from the group
consisting of Escherichia coli, Enterobacter aerogenes, Kiebsiella
pneumoniae, Proteus mirabilis, Proteus vulgaris, Morganella
morganii, Providencia stuartii, Serratia marcescens, Citrobacter
freundii, Salmonella typhi, Salmonella paratyphi, Salmonella typhi
murium, Salmonella virchow, Shigella spp., Yersinia enterocolitica,
Acinetobacter calcoaceticus, Flavobacterium spp., Haemophilus
influenzae, Pseudomonas aueroginosa, Campylobacter jejuni, Vibrio
parahaemolyticus, Brucella spp., Neisseria meningitidis, Neisseria
gonorrhoea, Bacteroides fragilis, and Fusobacterium spp.
68. The method of claim 64, wherein said bacterial strain comprises
a Mycobacteria strain.
69. The method of claim 68, wherein said Mycobacteria strain is
selected from the group consisting of Mycobacterium tuberculosis or
Mycobaterium smegmatis.
70. The method of claim 67, wherein said bacterial strain comprises
Bacillus anthraxis.
71. A method for treating a subject having a genetic disorder,
comprising: administering a therapeutically effective amount of the
compound of claim 28.
72. The method of claim 71, wherein the genetic disorder comprises
a protein having a truncation mutation.
73. The method of claim 71, wherein the genetic disorder comprises
cystic fibrosis.
74. The method of claim 71, wherein the genetic disorder comprises
Duchenne's muscular dystrophy or Hurler's syndrome.
75. A method for treating anthrax, comprising administering to a
subject in need thereof a therapeutically effective amount of the
compound of claim 28.
76. Ethyl
2-O-Benzoyl-3,4-dideoxy-3,4-diazido-6-O-chloroacetyl-1-thio-.bet-
a.-D-allopyranoside (compound 9).
77.
p-Methylphenyl-4,6-dideoxy-4,6-diazido-2,3-O-benzoyl-1-thio-.beta.-D-g-
lucopyranoside (compound 5f).
78. Ethyl
3,4-di-O-benzoyl-6-O-chloroacetyl-2-deoxy-2-phthalimido-1-thio-.-
beta.-D-glucopyranose (compound 10).
79. Ethyl 2,3,5-Tri-O-acetyl-1-thio-D-ribofuranose (compound
11).
80.
p-Methylphenyl-2-deoxy-2-phthalimido-6-deoxy-6-azido-3,4-di-O-benzoyl--
1-thio-.beta.-D-glucopyranoside (compound 5e).
81.
p-Methylphenyl-6-O-Acetyl-4-deoxy-4-azido-2,3-di-O-benzoyl-1-thio-.bet-
a.-D-glucopyranoside (compound 5c).
82.
p-Methylphenyl-5-deoxy-5-azido-2,3-di-O-benzoyl-1-thio-D-ribofuranose
(compound 8b).
83.
p-Methylphenyl-5-deoxy-5-O-benzoyl-2,3-diazido-1-thio-D-ribofuranose
(compound 24).
84.
p-methylphenyl-2-O-Benzoyl-3,4-dideoxy-3,4-diazido-6-O-chloroacetyl-1--
thio-.beta.-D-allopyranoside (compound 7a).
85. p-Methylphenyl
3,4-di-O-acetyl-2,6-dideoxy-2,6-diazido-.beta.-L-idopyr-
anoside(1-3)-2-O-acetyl-5-O-tert-butyldiphenylsylil-1-thio-.beta.-D-ribofu-
ranoside (Compound 19b).
86. A compound having the general formula IV: 29wherein: each of
Z.sub.1 and Z.sub.2 is independently selected from the group
consisting of hydrogen, alkyl, cycloalkyl, aryl, a hydroxy
protecting group, an amino protecting group and a thiol protecting
group. each of T.sub.1-T.sub.4 is independently a hydroxy
protecting group; each of Q.sub.1-Q.sub.6 is independently an amino
protecting group; X is oxygen or sulfur; Y is oxygen or sulfur; and
wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration.
87. The compound of claim 86, wherein each of said hydroxy
protecting groups is an O-acetyl group (OT.sub.1-OT.sub.4).
88. The compound of claim 86, wherein each of said amino protecting
groups is an azido group.
89. The compound of claim 86, wherein X is oxygen, each of said
Z.sub.1, Z.sub.2 and OT.sub.1-OT.sub.4 is an O-acetyl group and
each of said NQ.sub.1-NQ.sub.6 is an azido group.
90. The compound of claim 86, wherein X is oxygen, each of said
Z.sub.1, Z.sub.2 is hydrogen, each of said OT.sub.1-OT.sub.4 is an
O-acetyl group and each of said NQ.sub.1-NQ.sub.6 is an azido
group.
91. The compound of claim 86, wherein X is sulfur, each of said
Z.sub.1, Z.sub.2 and OT.sub.1-OT.sub.4 is an O-acetyl group and
each of said NQ.sub.1-NQ.sub.6 is an azido group.
92. A method of synthesizing the compound of claim 1, the method
comprising: (a) providing a compound having the general formula IV:
30wherein: each of Z.sub.1 and Z.sub.2 is independently selected
from the group consisting of hydrogen, alkyl, cycloalkyl, aryl, a
hydroxy protecting group, an amino protecting group and a thiol
protecting group. each of T.sub.1-T.sub.4 is independently a
hydroxy protecting group; each of Q.sub.1-Q.sub.6 is independently
an amino protecting group; X is oxygen or sulfur; Y is oxygen or
sulfur; and wherein the carbon at the fifth position of ring B has
an R configuration or an S configuration; (b) providing a compound
having the general formula V, VI or VII: 31wherein: each of G, I,
J, K, U and V is independently selected from the group consisting
of a hydroxy protecting group and an amino protecting group; SL is
a thiolated leaving group; and each of the carbons at positions 1,
3 and 4 in Formula I and at position 1 in Formula II has an R
configuration or an S configuration; (c) coupling said compound
having said general formula IV and said compound having said
general formula I, II or IV; and (d) removing each of said hydroxy
protecting groups and said amino protecting groups, to thereby
provide the compound of claim 1.
93. The method of claim 92, wherein said hydroxy protecting group
is selected from the group consisting of O-acetyl, O-chloroacetyl
and O-benzoyl.
94. The method of claim 92, wherein said amino protecting group is
selected from the group consisting of an azido group and a
N-phtalimido group.
95. The method of claim 92, wherein said thiolated leaving group is
selected from the group consisting of thioethyl and
para-thiotoluene.
96. A method of synthesizing the compound of claim 25, the method
comprising: (a) providing a compound having the general formula IV:
32wherein: each of Z.sub.1 and Z.sub.2 is independently selected
from the group consisting of hydrogen, alkyl, cycloalkyl, aryl, a
hydroxy protecting group, an amino protecting group and a thiol
protecting group. each of T.sub.1-T.sub.4 is independently a
hydroxy protecting group; each of Q.sub.1-Q.sub.6 is independently
an amino protecting group; X is sulfur; Y is oxygen or sulfur; and
wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration; and (b) removing each of said
hydroxy protecting groups and said amino protecting groups, to
thereby provide the compound of claim 25.
97. The method of claim 96, wherein said hydroxy protecting group
is selected from the group consisting of O-acetyl, O-chloroacetyl
and O-benzoyl.
98. The method of claim 96, wherein said amino protecting group, is
selected from the group consisting of an azido group and a
N-phtalimido group.
99. A method of synthesizing the compound of claim 28, the method
comprising: (a) providing a compound having the general formula IV:
33wherein: each of Z.sub.1 and Z.sub.2 is independently selected
from the group consisting of hydrogen, alkyl, cycloalkyl, aryl, a
hydroxy protecting group, an amino protecting group and a thiol
protecting group; each of T.sub.1-T.sub.4 is independently a
hydroxy protecting group; each of Q.sub.1-Q.sub.6 is independently
an amino protecting group; X is sulfur; Y is oxygen or sulfur; and
wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration; (b) providing an
oligosaccharide comprised of at least four monosaccharide residues
and having at least one free thiol group attached to at least one
of said monosaccharide residues, wherein any hydroxy group or amino
group attached to said monosaccharide resiudes is protected by a
hydroxy protecting group or an amino protecting group,
respectively; (c) coupling said compound having said general
formula IV and said oligosaccharide, to thereby form a disulfide
bond therebetween; and (d) removing each of said hydroxy protecting
groups and said amino protecting groups, to thereby provide the
compound of claim 28.
100. The method of claim 99, wherein said oligosaccharide has said
general formula IV.
101. The method of claim 99, wherein said hydroxy protecting group
is selected from the group consisting of O-acetyl, O-chloroacetyl
and O-benzoyl.
102. The method of claim 99, wherein said amino protecting group is
selected from the group consisting of an azido group and a
N-phtalimido group.
Description
[0001] This application is a continuation-in-part of PCT Patent
Application No. PCT/IL2004/000490, filed Jun. 9, 2004, which claims
priority from U.S. Pat. application Ser. No. 10/829,976, filed Apr.
23, 2004, and U.S. Provisional Patent Applications Nos. 60/540,359,
filed Feb. 2, 2004, and 60/484,293, filed Jul. 3, 2003. This
application also claims the benefit of priority from U.S.
Provisional Patent Application No. 60/608,372, filed Sep. 10, 2004.
The teachings of the above applications are hereby incorporated by
reference as if fully set forth herein.
FIELD OF THE INVENTION
[0002] The present invention relates to bi-functional antibiotics,
and in particular to aminoglycosides which are capable of reducing
the efficacy of and/or blocking antibiotic resistance. The
aminoglycosides of the present invention are suitable for
inhibition of anthrax lethal factor, hence are suitable for use as
a cure for anthrax.
BACKGROUND OF THE INVENTION
[0003] The rapid spread of antibiotic resistance in pathogenic
bacteria has prompted a continuing search for new agents capable of
antibacterial activity. Indeed, microbiologists today warn of a
"medical disaster" which could lead back to the era before
penicillin, when even seemingly small infections were potentially
lethal. Thus, research into the design of new antibiotics is of
high priority (1-3). One way to delay the emergence of
antibiotic-resistance is to develop new synthetic materials that
can selectively inhibit bacterial enzymes, via novel mechanisms of
action. However, this approach is both time-consuming and
financially prohibitive, yet remains indispensable if an acceptable
level of care is to be provided in the immediate future. On the
other hand, it may be less costly in time and money to employ
strategies to circumvent existing bacterial resistance mechanisms
and thereby to restore usefulness to antibacterials that have
become compromised by resistance (4). The remarkable advances in
recent years in elucidating the mechanisms of resistance to various
clinical antibiotics on the molecular level provide complementary
tools to this approach via structure-based and mechanism-based
design.
[0004] One example of an important group of antibiotics which could
benefit from such a redesign is the aminoglycoside class of
antibiotics. Aminoglycosides (as shown in prior art FIG. 1) are
highly potent, broad-spectrum antibiotics with many desirable
properties for the treatment of life-threatening infections (5).
Their history begins in 1944 with streptomycin and was thereafter
marked by the successive introduction of a series of milestone
compounds (neomycin, kanamycin, gentamycin, tobramycin, and
others), which definitively established the usefulness of this
class of antibiotics for the treatment of gram-negative bacillary
infections (6). It is believed that aminoglycosides exert their
therapeutic effect by interfering with translational fidelity
during protein synthesis via interaction with the A-site rRNA on
the 16S domain of the ribosome (7,8). Recent achievements in
ribosome structure determination have provided fascinating new
insights into the decoding site of the ribosome at high resolution
and how aminoglycosides might induce misreading of the genetic
code.
[0005] Unfortunately, prolonged clinical use of currently available
aminoglycosides has resulted in effective selection of resistance
to this family of antibacterial agents (9). Presently, resistance
to these agents is widespread among pathogens worldwide which
severely limits their usefulness. The primary mechanism for
resistance to aminoglycosides is the bacterial acquisition of
enzymes which modify this family of antibiotics by
acetyltransferase (AAC), adenyltransferase (ANT), and
phosphotransferase (APH) activities (as shown in prior art FIG. 2).
Among these enzyme families, aminoglycoside 3'-phosphotransferases
[APH(3')s], of which seven isozymes are known, are widely
represented. These enzymes catalyze transfer of .gamma.-phosphoryl
group of ATP to the 3'-hydroxyl of many aminoglycosides, rendering
them inactive because the resulted phosphorylated antibiotics no
longer bind to the bacterial ribosome with high affinity. Due to
the unusually broad spectrum of aminoglycosides that can be
detoxified by APH(3') enzymes, much effort has been put into
understanding the structural basis for their promiscuity in
substrate recognition and catalysis (10).
[0006] To tackle the problem of antibiotic resistance, many
structural analogs of natural aminoglycosides have been synthesized
over the past decade (11). In the majority of these studies a
minimal structural motif, which is common for a series of
structurally related aminoglycosides, has been identified and used
as a scaffold for the construction of diverse analogs as potential
new antibiotics (12). Some of the designed structures showed
considerable antibacterial activities. Since the structural and
mechanistic information on the target(s) of aminoglycosides and
their respective resistance enzymes has only began to emerge in the
past few years, this information stimulated novel developments in
the de novo design of molecules that bind to the ribosomal target
site and simultaneously are poor substrates for resistance-causing
enzymes (13, 14). These results and design principles hold the
promise of the generation of a large series of designer antibiotics
uncompromised by the existing mechanisms of resistance.
[0007] In view of recent events, one particular disease for which
effective therapeutic strategies are urgently required is
anthrax.
[0008] Anthrax is an infectious disease caused by toxigenic strains
of the Gram-positive Bacillus anthracis (15). If inhaled, B.
anthracis spores rapidly reach the regional lymphonodes of the
lungs where they germinate and release anthrax toxins (16). These
toxins inhibit the adaptive immune response, thereby enabling the
bacteria to reach the blood system where they cause bacteraemia and
toxaemia, which rapidly kills the host. Non-toxigenic strains of B.
anthracis are poorly pathogenic indicating that the anthrax toxins
play a major role from the very beginning of infection to death.
Since anthrax is asymptomatic until the bacterium reach the blood
(15, 16), the development of anti-toxin therapeutics for preventive
use or in combination with antibiotics, is of high urgency (17).
Alternatively, and even preferably, the development of bifunctional
substances that would inactivate the released toxins and in
addition would function as an antibiotic would be highly
beneficial.
[0009] The anthrax toxins consist of three proteins: protective
antigen (PA), edema factor (EF), and lethal factor (LF) (18). Being
individually nontoxic, their toxic effects during anthrax infection
require cooperation: PA binds to a cell surface receptor and forms
an oligomeric pore that translocates both EF and LF into the
cytosol of target cells. Once inside the cell, EF causes edema via
Ca.sup.2+/calmodulin-dependent adenylate cyclase activity. LF is a
zinc-dependent endopeptidase that specifically cleaves most
isoforms of mitogen-activated protein kinase kinases, thereby
inhibiting one or more signaling pathways of the host macrophage
(19). Through a mechanism that is not yet well understood, this
results in the death of the host. Strains of B. anthracis deficient
in EF remain pathogenic, while those lacking LF become attenuated.
LF is therefore considered the dominant virulence factor of anthrax
(20). Consequently, an intensive search for specific inhibitors of
LF has been performed during the last years (17, 21-22).
[0010] The prior art does not teach or suggest a highly effective
group of aminoglycosides which both share certain structural
features of currently available aminoglycosides while also being
able to reduce or eliminate antibiotic resistance. The prior art
also does not teach or suggest such aminoglycosides which have
reduced side effects. The prior art also does not teach or suggest
such aminoglycosides which are capable of functioning both by
inhibition of anthrax lethal factor, and as an antibiotic and are
therefore highly effective for treatment of anthrax.
[0011] There is thus a widely recognized need for, and it would be
highly advantageous to have, bifunctional antibiotics which both
inactivate toxins and function as an antibiotic, while reducing or
eliminating antibiotic resistance, and further resulting in reduced
side effects. Such antibiotics would be highly beneficial in the
treatment of bacterial infections such as anthrax.
SUMMARY OF THE INVENTION
[0012] The present invention overcomes the deficiencies of the
prior art by providing a novel group of aminoglycosides which share
some structural features of currently available aminoglycosides
with regard to the backbone, while also having significant
structural differences. The similarity enables these
aminoglycosides to be highly potent and effective antibiotics,
while the significant differences enable these aminoglycosides to
reduce or even block antibiotic resistance. These aminoglycosides
are highly effective for treatment of anthrax.
[0013] The present invention represents a new class of bifunctional
antibiotics that circumvent antibiotic resistance and that also
have a high potential for immediate therapeutic applications.
Without wishing to be limited by a single hypothesis, it is
believed that the aminoglycosides of the present invention target
both bacterial rRNA and inhibit resistance-causing enzymes. These
aminoglycosides are therefore a new class of semi-synthetic analogs
of currently available aminoglycosides, which are useful for many
different functions, including determining important complementary
information on their antibacterial activity, interaction with
resistance-causing enzymes in the means of kinetics of binding and
high-resolution three-dimensional structures of binary and ternary
complexes, and binding to the A-site rRNA. The new design
strategies, methodologies and principles developed and discussed in
the present invention are also expected to be valuable for
unraveling similar problems posed to other families of antibiotics
and other drugs.
[0014] According to preferred embodiments of the present invention,
compounds belonging to the novel group of aminoglycosides described
above have the general formula I: 1
[0015] wherein:
[0016] R.sub.1 is a monosaccharide residue or an oligosaccharide
residue;
[0017] X and Y are independently oxygen or sulfur;
[0018] R.sub.2 and R.sub.3 are each independently selected from the
group consisting of hydrogen, hydroxy, thiol, amine, alkyl,
cycloalkyl, aryl, alkoxy, aryloxy, thioalkoxy and thioaryloxy;
and
[0019] wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration;
[0020] and pharmaceutically acceptable salts thereof.
[0021] As used herein, the term "hydroxy" refers to a --OH
group.
[0022] The term "thiol" refers to a --SH group.
[0023] The term "alkyl", as used herein, refers to a saturated
aliphatic hydrocarbon including straight chain and branched chain
groups. Preferably, the alkyl group has 1 to 20 carbon atoms.
Whenever a numerical range; e.g., "1-20", is stated herein, it
implies that the group, in this case the alkyl group, may contain 1
carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and
including 20 carbon atoms. More preferably, the alkyl is a medium
size alkyl having 1 to 10 carbon atoms. Most preferably, unless
otherwise indicated, the alkyl is a lower alkyl having 1 to 4
carbon atoms. The alkyl group may be substituted or unsubstituted.
When substituted, the substituent group can be, for example, halo,
hydroxy, cyano, nitro, azo and amine, as these terms are defined
herein.
[0024] A "cycloalkyl" group refers to an all-carbon monocyclic or
fused ring (i.e., rings which share an adjacent pair of carbon
atoms) group wherein one of more of the rings does not have a
completely conjugated pi-electron system. Illustrative examples,
without limitation, of cycloalkyl groups are cyclopropane,
cyclobutane, cyclopentane, cyclopentene, cyclohexane,
cyclohexadiene, cycloheptane, cycloheptatriene, and adamantane. A
cycloalkyl group may be substituted or unsubstituted. When
substituted, the substituent group can be, for example, halo,
hydroxy, cyano, nitro, azo and amine, as these terms are defined
herein.
[0025] An "aryl" group refers to an all-carbon monocyclic or
fused-ring polycyclic (i.e., rings which share adjacent pairs of
carbon atoms) groups having a completely conjugated pi-electron
system. Examples, without limitation, of aryl groups are phenyl,
naphthalenyl and anthracenyl. The aryl group may be substituted or
unsubstituted. When substituted, the substituent group can be, for
example, halo, hydroxy, cyano, nitro, azo and amine, as these terms
are defined herein.
[0026] An "alkoxy" group refers to both an --O-alkyl and an
--O-cycloalkyl group, as defined herein.
[0027] An "aryloxy" group refers to both an --O-aryl group, as
defined herein.
[0028] A "thioalkoxy" group refers to both an --S-alkyl group, and
an --S-cycloalkyl group, as defined herein.
[0029] A "thioaryloxy" group refers to both an --S-aryl and an
--S-heteroaryl group, as defined herein.
[0030] An "azo" group refers to a --N.dbd.NR' group, wherein R' is
hydrogen, alkyl, cycloalkyl or aryl.
[0031] A "halo" group refers to fluorine, chlorine, bromine or
iodine.
[0032] An "amine" group refers to an --NR'R" group where R' is as
defined hereinabove and R" is as defined herein for R'.
[0033] A "nitro" group refers to a --NO.sub.2 group.
[0034] A "cyano" group refers to a --C.ident.N group.
[0035] Preferably X is oxygen. Also preferably, Y is oxygen.
Optionally and preferably, R.sub.1 is a monosaccharide residue.
More preferably, the monosaccharide residue is a five-membered
(furanose) or a six-membered (pyranose) monosaccharide residue.
Also more preferably, the monosaccharide residue comprises at least
one amine group and/or at least one aminoalkyl group. Optionally
and more preferably, the at least one amine group and/or the at
least one aminoalkyl group is at one or more of positions 2, 3, 4
or 5. As used herein, the term "aminoalkyl" refers to an alkyl
group, as defined hereinabove, which is substituted by an amine
group, as defined hereinabove. Optionally, at least one aminoalkyl
group is an aminomethyl group (--CH.sub.2--NH.sub.2).
[0036] Optionally and preferably, if the monosaccharide residue is
a pyranose monosaccharide residue, the aminomethyl group is at
position 5.
[0037] Also optionally and preferably, if the monosaccharide
residue is a pyranose monosaccharide residue, the amine group is at
one or more of positions 2, 3 or 4.
[0038] Also optionally and preferably, if the monosaccharide
residue is a furanose monosaccharide residue, the aminoalkyl group
is at position 4.
[0039] Optionally, the monosaccharide residue is a L-monosaccharide
or a D-monosaccharide.
[0040] According to preferred embodiments of the present invention,
R.sub.1 is an oligosaccharide residue. Preferably, the
oligosaccharide residue comprises at least two monosaccharide
residues, wherein each is independently a five-membered (furanose)
or a six-membered (pyranose) monosaccharide residue. More
preferably, at least one of the at least two monosaccharide
residues comprises at least one amine group and/or at least one
aminoalkyl group. Most preferably, the at least one amine group is
at position 2 of a pyranose monosaccharide residue. Also most
preferably, the at least one aminoalkyl group is at position 5 of a
pyranose monosaccharide residue.
[0041] Optionally and preferably, the oligosaccharide comprises a
furanose monosaccharide linked to a pyranose monosaccharide.
[0042] Optionally, each of the at least two monosaccharide residues
is independently a D-monosaccharide or an L-monosaccharide.
[0043] Alternatively, the oligosaccharide residue comprises at
least four monosaccharide residues, each being independently a
five-membered (furanose) or a six-membered (pyranose)
monosaccharide residue. Preferably, the oligosaccharide residue is
a neomycin B residue. Other oligosaccharide residues include, for
example, a Paromomycin residue, a Ribostamycin residue, a
Gentamycin residue, a Amikacin residue, a Neamine residue, a
Nebramine residue and a Tobramine residue.
[0044] According to other preferred embodiments of the present
invention, X is sulfur and R.sub.1 is a monosaccharide residue.
Preferably, the monosaccharide is a furanose monosaccharide
residue.
[0045] According to still other preferred embodiments of the
present invention, there are provided novel compounds each having
the general formula II: 2
[0046] wherein:
[0047] Y is oxygen or sulfur;
[0048] R.sub.2 and R.sub.3 are each independently hydrogen,
hydroxy, thiol, amine, alkyl, cycloalkyl, aryl, alkoxy, aryloxy,
thioalkoxy and thioaryloxy; and
[0049] wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration;
[0050] and pharmaceutically acceptable salts thereof.
[0051] Preferably, Y is oxygen, and R.sub.2 and R.sub.3 are both
hydroxy.
[0052] According to still other preferred embodiments of the
present invention, there are provided novel compounds each having
the general formula III: 3
[0053] wherein:
[0054] R.sub.1 is a monosaccharide residue or an oligosaccharide
residue;
[0055] X is disulfide;
[0056] R.sub.2 and R.sub.3 are each independently selected from the
group consisting of hydrogen, hydroxy, thiol, amine, alkyl,
cycloalkyl, aryl, alkoxy, aryloxy, thioalkoxy and thioaryloxy;
and
[0057] wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration;
[0058] and pharmaceutically acceptable salts thereof.
[0059] As used herein, the term "disulfide" refers to a compound
having two sulfur atoms mutually bonded by a single bond.
[0060] Preferably, R.sub.1 is an oligosaccharide residue and more
preferably an oligosaccharide residue having at least four
monosaccharide residues, as described hereinabove.
[0061] Optionally and preferably, the oligosaccharide residue is a
Neomycin B residue.
[0062] It should be noted that wherever reference is made to a
general formula or a specific compound according to the present
invention, pharmaceutically acceptable salts are also optionally
included.
[0063] All of the different structures of the preferred compounds
according to the present invention are shown in FIG. 16.
[0064] Without wishing to be limited by a single hypothesis, the
present invention is believed to have better stability and greater
resistance to bacterial enzymes for a number of reasons, including
the optional presence of a thiol moiety at X, which is more
resistant to hydrolysis. The presence of a monosaccharide or
oligosaccharide at R.sub.1 also increases resistance to hydrolysis.
Again without wishing to be limited by a single hypothesis,
resistance to hydrolysis is also believed to decrease toxicity, as
the compounds of the present invention are expected to hydrolyze
within the body (outside of bacterial cells) at a lower rate, and
hence to potentially produce fewer toxic degradation products.
[0065] Some background for the rational design of antibiotics is
now provided. The first rationally designed semisynthetic
aminoglycoside which was selected for chemotherapeutic use is
dibekacin (3',4'-dideoxykanamycin B), developed in 1975 by Umezawa
and co-workers (23a). The rationale behind the development of this
aminoglycoside variant was to overcome the resistance to kanamycins
due to bacterial enzymes that modify them by 3'-O-phosphorylation
[APH(3')]. Indeed dibekacin showed strong activity not only against
resistant staphylococci and Gram-negative bacteria, but also
against Pseudomonas. This successful result boosted the synthesis
of numerous 3'-deoxy and 3',4'-dideoxy derivatives of other
aminoglycosides, some of which were active against resistant
bacteria producing APH(3'). Another approach to rationally designed
semi-synthetic aminoglycosides active against resistant bacteria is
the acylation or alkylation of one or several amino groups of
aminoglycoside. This approach lead to the development of amikacin
by 1-N-acylation of kanamycin B with (S)-4-amino-2-hydroxybutiric
acid (AHB), developed by Kawaguchi and co-workers and has been used
in market since 1977 (23b). Similar approaches lead to the
development of netilimicin (1985), isepamicin (1988), and arbekacin
(1990), which are marketed as chemotherapeutic agents, and were
produced by 1--N-acylation with different acylating groups (24).
However, novel resistant bacteria emerged to these antibiotics and
again were shown to be dependent on new types of
aminoglycoside-modifying enzymes.
[0066] To overcome the emerged resistance to amikacin, recently,
Mobashery and co-workers (13) took advantage of the known 3D NMR
structure for paromomycin bound to the A-site rRNA (25), and, by
using docking experiments, a total of seven structures have been
selected and synthesized. AHB substitution at position N1 of
designed molecules was used, with the rationale that this group in
amikacin is responsible for the protection against a number of
aminoglycoside-modifying enzymes that cause N-acylation. Although
two of these structures showed considerably enhanced activity
against different pathogenic and resistant strains as compared to
those of several conventional antibiotics, still their activities
were mostly comparable to that of amikacin.
[0067] Most recently, Hanessian and co-workers (12g) used a similar
approach and tried to mimic rings III and IV of paromomycin by
attaching various aminoalkyl substituents at C5 of tobramycin. For
their design, they also employed the available NMR and X-ray
structural data of the complexes of paromomycin and tobramycin with
RNA sequences, as well as molecular modeling. The
5-O-(2-guanidylethyl) ether of tobramycin was found to be the most
active analogue of this series, having similar antibacterial
potency to that of paromomycin.
[0068] During the last decade, more examples of synthetic variants
of naturally occurring aminoglycosides have been reported (11). The
strategies used in the design of the majority of these mimetics
were to start from a pseudo-disaccharide (mostly neamine) as a
minimum basic structure and incorporate therein various basic
appendages at different positions. The choices of basic appendages,
in the cases of rational design, relied on the diversity of pKa,
chain length, branching, and flexible topologies. In most cases
however, the new analogs were either inactive or had significantly
lower activity than that of the parent structure, and only a few
new structures reported to date maintained an activity level
similar to that of the naturally occurring parent aminoglycosides.
Thus, the construction of synthetic molecules providing better
antibiotic performances than those of the naturally occurring drugs
remains a challenging task.
[0069] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, suitable methods and materials are described below. In
case of conflict, the patent specification, including definitions,
will control. In addition, the materials, methods, and examples are
illustrative only and not intended to be limiting.
[0070] As used herein, the term "treating" includes abrogating,
substantially inhibiting, slowing or reversing the progression of a
condition, substantially ameliorating clinical or aesthetical
symptoms of a condition or substantially preventing the appearance
of clinical or aesthetical symptoms of a condition.
[0071] The term "comprising" means that other steps and ingredients
that do not affect the final result can be added. This term
encompasses the terms "consisting of" and "consisting essentially
of".
[0072] The phrase "consisting essentially of" means that the
composition or method may include additional ingredients and/or
steps, but only if the additional ingredients and/or steps do not
materially alter the basic and novel characteristics of the claimed
composition or method.
[0073] The term "method" refers to manners, means, techniques and
procedures for accomplishing a given task including, but not
limited to, those manners, means, techniques and procedures either
known to, or readily developed from known manners, means,
techniques and procedures by practitioners of the chemical,
pharmacological, biological, biochemical and medical arts.
[0074] An advantage of the compounds and/or the methods of the
present invention is that bifunctional antibiotics are provided,
which both inactivate toxins and function as antibiotics.
[0075] Another object of the invention is to provide bifunctional
antibiotics which reduce or eliminate antibiotic resistance and
which further result in reduction of cytoxicity and other
side-effects.
[0076] Other objects and advantages of the present invention will
become apparent from the following description, taken in connection
with the accompanying figures and examples, wherein, by way of
illustration and example, an embodiment of the present invention is
disclosed.
BRIEF DESCRIPTION OF THE DRAWINGS
[0077] The invention is herein described, by way of example only,
with reference to the accompanying drawings. With specific
reference now to the drawings in detail, it is stressed that the
particulars shown are by way of example and for purposes of
illustrative discussion of the preferred embodiments of the present
invention only, and are presented in the cause of providing what is
believed to be the most useful and readily understood description
of the principles and conceptual aspects of the invention. In this
regard, no attempt is made to show structural details of the
invention in more detail than is necessary for a fundamental
understanding of the invention, the description taken with the
drawings making apparent to those skilled in the art how the
several forms of the invention may be embodied in practice.
IN THE DRAWINGS
[0078] FIG. 1 shows prior art aminoglycosides;
[0079] FIG. 2 shows prior art target sites of modifying
enzymes;
[0080] FIG. 3 shows some exemplary structures of compounds
according to the present invention;
[0081] FIG. 4 shows structures of some exemplary designed acceptors
according to the present invention;
[0082] FIG. 5 shows a general outline of a synthetic scheme
according to the present invention;
[0083] FIG. 6 shows preparation of an acceptor according to the
present invention;
[0084] FIG. 7 shows some exemplary donor structures according to
the present invention;
[0085] FIG. 8 shows an exemplary synthetic scheme for producing a
library of structures;
[0086] FIG. 9 shows two sets of exemplary neomycin derivatives
according to the present invention;
[0087] FIG. 10 shows an exemplary synthetic scheme according to the
present invention;
[0088] FIG. 11 shows an exemplary synthetic scheme for glycosyl
donors 5e, 5c and 8b according to the present invention;
[0089] FIG. 12 shows the synthesis of some compounds and
intermediates according to the present invention;
[0090] FIG. 13 shows synthesis of another exemplary group of
intermediates according to the present invention;
[0091] FIG. 14 shows an exemplary synthesis of set6 structures
according to an embodiment of the present invention;
[0092] FIG. 15 shows an additional exemplary synthesis of set6
structures according to an embodiment of the present invention;
and
[0093] FIG. 16 shows the structures of neomycin B (Compound I) and
Compounds II-XIII according to the present invention.
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0094] The present invention is of a novel group of aminoglycosides
which share some structural features of currently available
aminoglycosides with regard to the backbone, while also having
significant structural differences. The similarity enables these
aminoglycosides to be effective antibiotics, whilezzz the
significant differences enable these aminoglycosides to reduce or
even block antibiotic resistance. The aminoglycosides of the
present invention are suitable for inhibition of anthrax lethal
factor, hence are suitable for use as a cure for anthrax.
[0095] The anthrax lethal factor (LF), a Zn-dependent
endopeptidase, has a major role in the development and virulence of
anthrax. The compounds of the present invention have been found to
act as powerful inhibitors of the proteolytic activity of LF at
seemingly physiological conditions and simultaneously function as
antibiotics against Bacillus anthracis.
[0096] To find novel inhibitors of LF, a library of approximately
3000 compounds were tested, over 60 of which were synthetic and
commercial aminoglycosides (23). While a number of the tested
compounds demonstrated some level of inhibitory activity, neomycin
B was found to be the most potent inhibitor of LF with apparent
K.sub.i value in the low nM concentration range.
[0097] The compounds of the present invention were obtained through
rational design of antibiotics, based upon known aminoglycosides.
However, unlike the previously described rational design
strategies, which have many significant drawbacks with regard to
the potency and/or side effects of the designed compounds, the
compounds of the present invention were designed according to a new
and better strategy. Without wishing to be limited by a single
hypothesis, it would appear that since aminoglycoside antibiotics,
such as neomycin B, exert their antibacterial activity by
selectively recognizing and binding to the decoding A site on the
16S subunit of the bacterial rRNA, causing deleterious misreading
of the genetic code (24). At physiological pH, aminoglycosides are
highly charged and their RNA binding relies on electrostatic
interactions (25-26). Examination of the recently determined X-ray
crystal structure of LF shows that the active site of the protease
also consists of a broad, 40 .ANG. groove with a highly negative
electrostatic potential (27).
[0098] Docking experiments were performed, which showed that
neomycin B could reside within the vicinity of the catalytic zinc,
and multiple potential contacts could occur between the negatively
charged residues of LF and neomycin B (23).
[0099] Based on these data, it was hypothesized that since the
interaction of neomycin B with both the rRNA and LF is mainly
determined by electrostatic interactions, it is likely that by
maintaining the antibiotic backbone intact but adding one or more
additional recognition/binding elements, superior binding to both
rRNA and LF, and probably better antibacterial performance is
expected to result. Enhanced RNA binding by using dimerized
aminoglycosides (26), bifunctional aminoglycosides (27), and
amino-aminoglycosides (28), along with the inhibition of various
nucleic acids metabolizing enzymes by aminoglycosides (29), support
this hypothesis.
[0100] The compounds of FIG. 16 keep the whole antibiotic
constitution intact as a recognition element to both the rRNA and
LF. The extended sugar ring(s) of each structure was designed in a
manner that incorporates different combinations of hydroxyl and
amino groups as potential functionalities directed for the
recognition of the phosphodiester bond of rRNA (30) and in parallel
the Asp/Glu and Asn/Gln clusters in the active site of LF (23).
[0101] The principles and operation of the compositions, processes
and methods according to the present invention may be better
understood with reference to the Examples and accompanying
descriptions.
[0102] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not limited
in its application to the details set forth in the following
description or exemplified by the Examples. The invention is
capable of other embodiments or of being practiced or carried out
in various ways. Also, it is to be understood that the phraseology
and terminology employed herein is for the purpose of description
and should not be regarded as limiting.
[0103] The compounds of the present invention are based upon
neomycin B (Compound I, FIG. 3) as a base structure, with three
sets of designed bifunctional mimetics (set1-set3, FIG. 3).
[0104] Preferred compounds according to the present invention can
be collectively represented by general Formula I: 4
[0105] wherein:
[0106] R.sub.1 is a monosaccharide residue or an oligosaccharide
residue;
[0107] X and Y are independently oxygen or sulfur;
[0108] R.sub.2 and R.sub.3 are each independently selected from the
group consisting of hydrogen, hydroxy, thiol, amine, alkyl,
cycloalkyl, aryl, alkoxy, aryloxy, thioalkoxy and thioaryloxy, as
these terms are defined hereinabove; and
[0109] wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration;
[0110] and pharmaceutically acceptable salts thereof.
[0111] Preferably X is oxygen. Also preferably, Y is oxygen.
Optionally and preferably, R.sub.1 is a monosaccharide residue.
More preferably, the monosaccharide residue is a five-membered
(furanose) or a six-membered (pyranose) monosaccharide residue.
Also more preferably, the monosaccharide residue comprises at least
one amine group and/or at least one aminoalkyl group. Optionally
and more preferably, the at least one amine group and/or the at
least one aminoalkyl group is at one or more of positions 2, 3, 4
or 5. As used herein, the term "aminoalkyl" refers to an alkyl
group, as defined hereinabove, which is substituted by an amine
group, as defined hereinabove. Optionally, at least one aminoalkyl
group is an aminomethyl group (CH.sub.2--NH.sub.2).
[0112] Optionally and preferably, if the monosaccharide residue is
a pyranose monosaccharide residue, the aminomethyl group is at
position 5.
[0113] Also optionally and preferably, if the monosaccharide
residue is a pyranose monosaccharide residue, the amine group is at
one or more of positions 2, 3 or 4.
[0114] Also optionally and preferably, if the monosaccharide
residue is a furanose monosaccharide residue, the aminoalkyl group
is at position 4.
[0115] Optionally, the monosaccharide residue is a L-monosaccharide
or a D-monosaccharide.
[0116] According to preferred embodiments of the present invention,
R.sub.1 is an oligosaccharide residue. Preferably, the
oligosaccharide residue comprises at least two monosaccharide
residues, wherein each is independently a five-membered (furanose)
or a six-membered (pyranose) monosaccharide residue. More
preferably, at least one of the at least two monosaccharide
residues comprises at least one amine group and/or at least one
aminoalkyl group. Most preferably, the at least one amine group is
at position 2 of a pyranose monosaccharide residue. Also most
preferably, the at least one aminoalkyl group is at position 5 of a
pyranose monosaccharide residue.
[0117] Optionally and preferably, the oligosaccharide comprises a
furanose monosaccharide linked to a pyranose monosaccharide.
.Optionally, each of the at least two monosaccharide residues is
independently a D-monosaccharide or a L-monosaccharide.
[0118] Optionally, R.sub.1 comprises an oligosaccharide residue
consisting of at least four monosaccharide residues, whereby each
of the monosaccharide residues is a a five-membered (furanose) or a
six-membered (pyranose) monosaccharide residue.
[0119] Such oligosaccharide residues can be, for example, an
aminoglycoside residue such as a Neomycin B residue, a Paromomycin
residue, a Ribostamycin residue, a Gentamycin residue, a Amikacin
residue, a Neamine residue, a Nebramine residue and a Tobramine
residue.
[0120] Such oligosaccharide residues preferably further compirse a
free chemical group that is coupled to X in Formula I above.
Preferably, both X and the chemical group in the oligomers residue
are S, such that the olidosacchride residue is coupled via a
disulfide bond.
[0121] According to other preferred embodiments of the present
invention, X is sulfur and R.sub.1 is a monosaccharide residue.
Preferably, the monosaccharide is a furanose monosaccharide
residue.
[0122] According to still other preferred embodiments of the
present invention, there are provided novel compounds each having
the general formula II: 5
[0123] wherein:
[0124] Y is oxygen or sulfur;
[0125] R.sub.2 and R.sub.3 are each independently hydrogen,
hydroxy, thiol, amine, alkyl, cycloalkyl, aryl, alkoxy, aryloxy,
thioalkoxy and thioaryloxy; and
[0126] wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration;
[0127] and pharmaceutically acceptable salts thereof.
[0128] Preferably, Y is oxygen, and R.sub.2 and R.sub.3 are both
hydroxy.
[0129] According to still other preferred embodiments of the
present invention, there are provided novel compounds each having
the general formula III: 6
[0130] wherein:
[0131] X is disulfide, as defined hereinabove;
[0132] Y is oxygen or sulfur;
[0133] R.sub.1 is an oligosaccharide residue having at least four
monosacchride residues, as described hereinabove;
[0134] R.sub.2 and R.sub.3 are each independently hydrogen,
hydroxy, thiol, amine, alkyl, cycloalkyl, aryl, alkoxy, aryloxy,
thioalkoxy and thioaryloxy, as these terms are defined hereinabove;
and
[0135] wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration;
[0136] and pharmaceutically acceptable salts thereof.
[0137] It should be noted that wherever reference is made to a
general formula or a specific compound according to the present
invention, pharmaceutically acceptable salts are also optionally
included.
[0138] All of the different structures of the preferred compounds
according to the present invention are shown in FIG. 16.
[0139] In selecting the modification site in neomycin B and the
degree of modification, recent structural information has been
included in the design process, again without wishing to be limited
by a single hypothesis, as follows. Superposition of neomycin B
bound to the aminoglycoside kinase APH(3') ternary complex with ADP
(10), and paromomycin I (contains C6'--OH instead of C6'--NH.sub.2
in neomycin B, FIG. 1) bound to A-site bacterial ribosome (25)
reveals that all the functional groups of aminoglycosides that are
utilized for binding are identical in both antibiotics, with the
exception of two groups, which are not employed for binding in the
antibiotic-resistance enzyme.
[0140] One of these different groups is the C5"--OH of neomycin B
which is phased towards the second substrate, ATP, and may have a
crucial role for the formation of the reactive ternary complex
prior to occurrence of the phosphorylation step. Therefore, without
wishing to be limited by a single hypothesis, incorporation of
gross changes, such as the addition of extra rigid sugar ring in
this region, is expected to have a dramatic effect on the formation
of a precise ternary complex required for enzymatic catalysis. For
a number of reasons, including the above hypothesis and also ease
of synthesis, position C5" in neomycin B was selected as the base
for the new generation of pseudo-pentasaccharides of set1 (FIG. 3),
with the expectation that they will function better than neomycin B
against both the resistant and non-resistant organisms.
[0141] These structures maintain the antibiotic backbone intact as
a recognition element to the rRNA, while the extended sugar ring
(R.sub.1) in each structure is designed in a manner that
incorporates either plain pyranose sugar, a single amino group at
various positions, cis-1,2-diamine, flexible 1,3-diamine,
cis-1,3-hydroxyamine, or ribofuranose ring as potential
functionalities directed for the recognition of the phosphodiester
bond of RNA (29-31) (For the detailed structures at ring R.sub.1
see structures of the designed donors in FIG. 7).
[0142] The designed structures of set2 (FIG. 3) are similar to that
of set1 except for the sulfur atom at C5". These structures were
specially designed, again without wishing to be limited by a single
hypothesis, to avoid in vivo enzymatic hydrolysis of the added
sugars (ring E) by various exoglycosidases (especially in those
structures in which ring E contain either plain sugar or
2-aminohexose). The structures of set3 are similar to that of set1
except for the ring A. In the structures of set3, ring A is
3',4'-dideoxy sugar, again without wishing to be limited by a
single hypothesis, to combat against the action of various APH(3')
enzymes.
[0143] Additional objects, advantages, and novel features of the
present invention will become apparent to one ordinarily skilled in
the art upon examination of the following examples, which are not
intended to be limiting. Additionally, each of the various
embodiments and aspects of the present invention as delineated
hereinabove and as claimed in the claims section below finds
experimental support in the following examples.
EXAMPLE I
General Synthesis of the Compounds of the Present Invention and
Syntheses of Specific Exemplary Intermediates
[0144] The strategy for the construction of all three sets of
compounds in FIG. 3 featured the use of a common acceptor for each
set (acceptors 1-3 in FIG. 4), to which the monosaccharide donors
were connected, followed by a two-step deprotection to yield the
target C5"-branched derivatives. The protecting groups used in this
study served admirably in terms of ease of attachment and removal
and survivability under the reaction conditions, whereas the
thioglycoside-NIS (31) and trichloroacetimidate-BF.sub.3 (32)
glycosidation methods proved to be both rapid and efficient.
[0145] This Example describes the overall synthetic procedure with
optional variations; the following Examples include specific
non-limiting examples of the synthetic process as it was performed
for the present invention.
[0146] The neomycin acceptor 1 is readily accessible from the
commercial neomycin B (49). The C5"--SH acceptor 2 can easily be
prepared from the selectively protected hexaazido derivative of
neomycin B (acceptor 1) in two steps as outlined in FIG. 5.
Briefly, acceptor 2 was prepared as follows: Triphenylphosphine
(1.153 grams, 4.4 mmol) was dissolved in dry THF (10 mL) under
argon and was stirred at 0.degree. C. for 15 minutes. The mixture
was then added dropwise with diisopropylazodicarboxylate (0.627 mL,
4.4 mmol). The mixture was stirred for 45 minutes at 0.degree. C.
and a white precipitate of the betaine was observed. In an
additional flask acceptor 1 (1.5 gram, 1.467 mmol) and thioacetic
acid (0.23 mL, 4.4 mmol) were dissolved in THF (4 mL) under argon,
and added dropwise in to the flask containing the betaine.
Propagation of the reaction was monitored by TLC (EtOAc 50%, Hexane
50%), which indicated completion after 4.5 hours. The mixture was
diluted with EtOAc and washed with brine. The combined organic
layer was dried over MgSO.sub.4, evaporated and purified by column
chromatography (silica, EtOAc/Hexane) to yield the corresponding
thioacetate 2a as white solid 1.36 gram (86%).
[0147] .sup.1H NMR (500 MHz, CDCl.sub.3) data of this thioacetate
are summarized in Table 12 hereinbelow.
[0148] .sup.13C NMR: .delta.=20.4, 20.6, 20.7, 20.9, 31.0 (C-2),
31.2 (C-5"), 50.5 (C-6"), 50.9 (C-6'), 56.6, 57.9, 59.1, 60.6,
65.5, 68.7, 69.1, 69.2, 69.9, 73.1, 74.9, 75.2, 75.7, 77.8, 80.2,
81.4, 96.2 (C-1'), 99.9 (C-1'"), 105.6 (C-1"), 168.5, 169.5, 169.7,
169.9, 170.0, 195.1
[0149] ESIMS: m/z=1119.3 (M+K.sup.+,
C.sub.37H.sub.48N.sub.18O.sub.19S requires 1119.5).
[0150] The pure thioacetate 2a from the above (250 mg, 0.231 mmol)
was dissolved in dry DMF under argon, and added with
hydraziniumacetate (42.6 mg, 0.463 mmol). Propagation of the
reaction was monitored by TLC (EtOAc 50%, Hexane 50%), which
indicated completion after 3 hours. The mixture was diluted with
EtOAc and washed with brine. The combined organic layer was dried
over MgSO.sub.4, evaporated and purified by column chromatography
(silica, EtOAc/Hexane) to yield the thiol acceptor 2 as white solid
156 mg (65%).
[0151] .sup.1H NMR (500 MHz, CDCl.sub.3) data of acceptor 2 are
summarized in Table 13 hereinbelow.
[0152] .sup.13C NMR: .delta.=20.4, 20.5, 20.6, 20.7, 26.5 (C-5"),
31.3 (C-2), 50.6 (C-6'"), 50.8(C-6'), 56.3, 57.9, 59.0, 60.5, 65.5,
68.6, 69.2, 69.7, 73.4, 75.0, 75.3, 75.9, 77.1, 81.3, 81.6, 96.2
(C-1'), 99.0 (C-1'"), 106.3 (C-1"), 168.4, 169.4, 169.6, 169.6,
169.9, 169.9
[0153] MALDI-TOFMS: m/z=1077.0 (M+K.sup.+,
C.sub.35H.sub.46N.sub.18O.sub.1- 8S requires 1077.6).
[0154] The dideoxy acceptor 3 can be prepared from compound 4 (FIG.
6) by selective protection of C3' and C4' hydroxyls by
cyclohexylidene, followed by acetylation, selective removal of
cyclohexylidene, and two-step simultaneous deoxygenation of C3' and
C4' hydroxyls according the reported procedure (32). As an
alternative to acetate protection which may not be stable under
Bu.sub.3SnH treatment, benzyl protection is used.
[0155] These newly designed acceptors can be represented by the
general formula IV: 7
[0156] wherein:
[0157] each of Z.sub.1 and Z.sub.2 is independently selected from
the group consisting of hydrogen, alkyl, cycloalkyl, aryl, a
hydroxy protecting group, an amino protecting group and a thiol
protecting group; each of T.sub.1-T.sub.4 is independently a
hydroxy protecting group; each of Q.sub.1-Q.sub.6 is independently
an amino protecting group;
[0158] X is oxygen or sulfur; Y is oxygen or sulfur; and
[0159] wherein the carbon at the fifth position of ring B has an R
configuration or an S configuration.
[0160] As is exemplified hereinabove, the hydroxy protecting group
can be, for example, an O-acetyl group, whereas the amino
protecting group can be, for example, an azido group.
[0161] As used herein, the phrase "an O-acetyl group" refers to a
--O--C(.dbd.O)CH.sub.3 group, in which the hydroxy group is
protected by an acetyl group.
[0162] The phrase "an azido group" refers to a --N.sub.3 group, in
which the amino group is protected by an azo group.
[0163] However, other hydroxy and amino protecting groups commonly
used in chemical syntheses in general and in saccharide syntheses
in particular are also usable in this context of the present
invention.
[0164] Acceptors 1-3, according to the present invention, are
compounds having the general formula IV above, wherein, for
acceptor 1, X is oxygen, each of Z.sub.1, Z.sub.2 and
OT.sub.1-OT.sub.4 is an O-acetyl group and each of
NQ.sub.1-NQ.sub.6 is an azido group; for acceptor 2, X is sulfur,
each of Z.sub.1, Z.sub.2 and OT.sub.1-OT.sub.4 is an O-acetyl group
and each of NQ.sub.1-NQ.sub.6 is an azido group; and, for acceptor
3, X is oxygen, each of Z.sub.1, Z.sub.2 is hydrogen, each of
OT.sub.1-OT.sub.4 is an O-acetyl group and each of
NQ.sub.1-NQ.sub.6 is an azido group.
[0165] The donors in FIG. 7 were designed as thioglycosides since
the thioglycoside-NIS glycosidation method proved to be both rapid
and efficient. The N-phth and ester protections at C-2 of the
monosaccharide donors were designed to allow, through neighboring
group participation, selective .beta.-glycoside bond formation
between rings E and C (33-34).
[0166] The donors, according to preferred embodiments of the
present invention, are therefore compounds having the general
formula V, VI or VII: 8
[0167] wherein each of G, I, J, K, U and V is independently
selected from the group consisting of a hydroxy protecting group
(e.g., O-acetyl group, O-chloroacetyl group, and O-benzoyl group)
and an amino protecting group (e.g., an azido group and a
N-phtalimido group); SL is a thiolated leaving group (e.g.,
thioethyl and para-thiotoluene); and each of the carbons at
positions 1, 3 and 4 in Formula I and at position I in Formula II
has an R configuration or an S configuration.
[0168] The overall synthesis of each of the pseudo-pentasaccharides
of the present invention having the general formula I above is
therefore effected, according to preferred embodiments of the
present invention, by:
[0169] (i) providing an acceptor having the general formula IV
described hereinabove;
[0170] (ii) providing a donor having the general formula V, VI or
VII;
[0171] (iii) coupling the acceptor and the donor, to thereby
provide a protected pseudo-pentasaccharide; and
[0172] (iv) removing the protecting groups, to thereby provide the
desired compound.
[0173] Preferably, the assembly of the designed protected
pseudo-pentasaccharides (set1-set3) is performed by NIS-promoted
coupling of each of the acceptors 1-3 with the thioglycoside donors
(5a-f, 6a-f, 7a-c, and 8a-d, FIG. 7). The resulting protected
compounds are then subjected to a two-step deprotection process:
removal of all the ester and phtalimido groups by treatment with
methylamine (33% solution in EtOH) and reduction of all the azido
groups by Staudinger reaction, to furnish a library of 57
pseudo-pentasaccharide derivatives of neomycin B, as generally
illustrated in FIG. 8. Note that for the preparation of set2
structures, the thioglycoside donors are converted to the
corresponding trichloroacetimidates and the coupling steps are
performed under acidic conditions
(BF.sub.3-Et.sub.2O.CH.sub.2Cl.sub.2).
[0174] The overall synthesis of each of the compounds of the
present invention having the general formula II described above is
effected, according to preferred embodiments of the present
invention, by:
[0175] (i) providing an acceptor having the general formula IV, as
described hereinabove, wherein X is sulfur; and
[0176] (ii) removing the protecting groups.
[0177] The overall synthesis of each of the compounds of the
present invention having the general formula III described above is
effected, according to preferred embodiments of the present
invention, by:
[0178] (a) providing a compound having the general formula IV, as
described hereinabove, wherein X is preferably sulfur;
[0179] (b) providing an oligosaccharide comprised of at least four
monosaccharide residues and having at least one free thiol group
attached to at least one of the monosaccharide residues, wherein
any hydroxy group or amino group attached to the monosaccharide
resiudes is protected by a hydroxy protecting group or an amino
protecting group, respectively;
[0180] (c) coupling the compound having general formula IV with the
oligosaccharide, to form a disulfide bond therebetween; and
[0181] (d) removing each of the hydroxy protecting groups and amino
protecting groups, to provide the compound of general formula
III.
[0182] The reacting oligosaccharide can thus be a compound having
the general formula IV, such that this synthesis results is a
Neomycin B "dimer" in which the two units are linked by a disulfide
bond. Alternatively, the reacting oligosaccharide can be, for
example, Neamine, Tobramine, Tobramycin, or Gentamycin, which can
preferably be modified as described herein with respect to
acceptors 1-3 so as to have a free thiol group. The hydroxy or
amino protecting groups, present in cases where the oligosaccharide
bears hydroxy or amino groups, are as described herein.
[0183] Coupling is preferably effected by Lewis acid
(BF.sub.3-Et.sub.2O) promoted coupling, which after two-steps
deprotection as above provided the desired thioglycoside.
EXAMPLE 2
Selection of Structures for Compounds of the Present Invention
[0184] The previous Example related to a general scheme which may
optionally be used for any compound according to the present
invention, as well as optionally for generating a library of
compounds according to the present invention. This Example
describes the selection of some non-limiting, illustrative
structures for compounds according to the present invention.
[0185] One important aspect of the present invention is the use of
functional aminoglycosides to solve the problem of cytotoxicity.
Without wishing to be limited by a single hypothesis, these
structures were selected to ameliorate this problem. One of the
major drawbacks of aminoglycosides is their relatively high
toxicity. Neomycin B is the most toxic of aminoglycosides, yet it
is primarily used for topical infections. It is highly nephrotoxic
and ototoxic and is by far the most potent in the area of
neuromuscular blockage. Aminoglycosides are nephrotoxic because a
small but sizable proportion of the administered dose (about 5%) is
retained in the epithelial cells (35). Aminoglycosides accumulated
by these cells are mainly localized with endosomal and lysosomal
vacuoles but are also localized with the Golgi complex, causing an
array of morphological and functional alterations of increasing
severity. It is also believed that aminoglycosides cause the
formation of free radicals, which lead to cell death (36).
[0186] Very recently (37), however, it has been shown that
aminoglycosides stabilize DNA and RNA triplexes. A clear
correlation between the toxicity (LD.sub.50 values, the lethal
dose, or dose sufficient to kill half the test population) of these
antibiotics and their ability to stabilize DNA triple helix was
demonstrated and suggested that aminoglycosides may be able to aid
H-DNA formation in vivo, which might be one of the reasons for
their toxicity. Interestingly, these results also showed that
neomycin B, which is most toxic among all aminoglycosides, is also
the most active of all aminoglycosides in stabilizing triple
helices, and that neomycin B does not influence the double helical
structures of DNA structures. Paromomycin (FIG. 1), which differs
from neomycin B in that it has one less amino group,. is much less
toxic than neomycin B (LD.sub.50 of neomycin=24 mg/kg,
paromomycin=160 mg/kg). Thus, this difference of one charge makes a
great difference in the toxicity of the two compounds. Further
deletion of charged amino groups in ribostamycin makes it least
toxic (LD.sub.50 of ribostamycin=260 mg/kg). On the other hand,
lividomycin, which differs from paromomycin by an additional
mannose, is much less toxic, with a LD.sub.50 value of 280 mg/kg.
From these data it seems that two factors that significantly reduce
the toxicity of aminoglycoside are: reduction of the number of
amino groups and/or addition of an extra saccharide.
[0187] Without wishing to be limited by a single hypothesis, the
above features of aminoglycosides and their different levels of
cytotoxicity were considered when selecting suitable structures for
the compounds of the present invention. Since neomycin B is at the
"head of the peak" with lowest LD.sub.50 value, this structure was
selected for designing two sets of derivatives, set4 and set5 (FIG.
9). The rationale in designing set4 structures is to generate new
analogs of neomycin B, "thio-neomycins," with superior acid
stability, which can lead to a reduction in the required dose for
administration and subsequently a lowering of the associated
toxicity. The choice of the thioglycosidic linkage between the
rings B and C in set4 structures is based on the fact that the
glycosidic bond of a furanose is more acid sensitive than that of
pyranose. Indeed, this is the reason that neomycin B and all the
members of neomycin family suffer a high acid sensitivity. To solve
this problem, Chang and co-workers (12f) have recently reported on
the new class of "pyranmycins" in which the furanose ring of
ribostamycin has been replaced by various pyranose structures. Some
of the resulted pseoudo-trisaccharides have indeed showed increased
acid stability and substantial antibacterial activity. The
suggested production of the "thio-neomycins" is an improved,
elegant solution to this problem.
[0188] The rationale behind the design of set5 structures is
largely based on the recent structural information obtained by Fong
and Berghuis (10). This work has shown that while the conformation
of aminoglycosides and the functional groups utilized for the
binding are effectively identical when comparing the neomycin
B-bound structure of APH(3')-IIIa and the paromomycin I-bound
structure of the 30S ribosome, there are significant differences
when examining the van der Waals interactions. The most striking
difference found is that the face of the aminoglycoside that forms
most of the van der Waals interactions with APH(3')-IIIa is
opposite to that which interacts with the 16S ribosomal RNA.
[0189] Without wishing to be limited by a single hypothesis, this
observation was used to design novel variant(s) of neomycin B which
can interact with the ribosome A-site but which are unable to be
detoxified by APH(3')-IIIa and related enzymes. Examples of these
variants according to the present invention include the set5
structures, "epi-neomycins". In these structures, the configuration
of neomycin is inverted at C5, which is the branch point between
two parts of the molecule, rings A-B and C-D. Such an inversion of
configuration in neomycin is expected to result in broad effects.
Without wishing to be limited by a single hypothesis, the change of
orientation at C5 (from equatorial in neomycin to axial in
epi-neomycin) should allow more rotational freedom between rings A
and B, and between A-B and C-D. Consequently, but again without
wishing to be limited by a single hypothesis, the face of the
resulted epi-neomycins is expected to be preferentially recognized
by rRNA, while it will be highly hindered for the recognition by
aminoglycoside-modifying enzymes. In addition, the resulted
conformational changes in set5 structures, relative to neomycin,
should affect the stabilization of DNA triple helix and
subsequently decrease the toxicity of this set of compounds.
Optionally, the two concepts of these structures may be combined to
obtain variants of "thio-epi-neomycins."
EXAMPLE 3
Specific Synthesis of Selected Compounds of the Present
Invention
[0190] Example 1 included a general synthetic scheme which may
optionally be used for any compound according to the present
invention, as well as optionally for generating a library of
compounds according to the present invention. This Example provides
an illustrative, non-limiting synthetic process that was performed
for selected compounds according to the present invention.
[0191] As shown in FIGS. 10-12, a compound was prepared according
to a synthetic scheme which started with neomycin B being converted
to a general acceptor, as described with regard to Example 1. FIGS.
10 and 11 show the syntheses of the monosaccharide donors. Neomycin
B (Compound I) is shown in FIG. 12 after being converted to an
acceptor 1 to which the monosaccharide donors of FIG. 7 can be
coupled.
[0192] The protecting groups used in this study served admirably in
terms of the ease of attachment and removal and survivability under
the reaction conditions, whereas the thioglycoside-NIS
glycosidation method (Veeneman, G. H.; van Leeuwen, S. H.; van
Boom, J. H. Tetrahedron Lett. 1990, 31, 1331-1334) proved to be
both rapid and efficient. The N-phth and ester protections at C-2
of the monosaccharide donors were designed to allow, through
neighboring group participation, selective, glycoside bond
formation between rings E and C.
[0193] For FIG. 10, the following reagents and conditions were
used: for stage a, (i) TBDPSCl, pyridine, DMAP, 60.degree. C.; (ii)
2,2-dimethoxypropane, acetone, CSA; (iii) BzCl, pyridine, DMAP;
(iv) AcOH/H.sub.2O 9:1, THF, 60.degree. C., 55% for four steps. For
stage b, (i) Tf.sub.2O, pyridine; (ii) NaN.sub.3, DMF, HMPA, 63%
for two steps; (iii) HF/pyridine; (iv) ClAcCl, pyridine, 91% for
two steps. For stage c, (i) Anisaldehyde-dimethylacetal, CSA, THF;
(ii) BzCl, pyridine; (iii) AcOH/H.sub.2O 9:1, THF, 60.degree. C.,
58% for three steps. For stage d, (i) Tf.sub.2O, pyridine; (ii)
NaN.sub.3, DMF, HMPA, 86% for two steps.
[0194] As a general note for all procedures described herein
(unless otherwise noted), reactions were monitored by TLC on Silica
Gel 60 F254 (0.25 mm, Merck), and spots were visualized by charring
with a yellow solution containing
(NH.sub.4)Mo.sub.7O.sub.24.4H.sub.2O (120 grams) and
(NH.sub.4).sub.2Ce(NO.sub.3).sub.6 (5 grams) in 10% H.sub.2SO.sub.4
(800 mL). Flash column chromatography was performed on Silica Gel
60 (70-230 mesh). All reactions were carried out under an argon
atmosphere with anhydrous solvents, unless otherwise noted. All
chemicals unless otherwise stated, were obtained from commercial
sources.
[0195] The diazido monosaccharides 9 and 5f, having D-allo and
D-gluco configurations, respectively, were constructed from the
common D-galactose derivatives (FIG. 10) by selectively inverting
the configurations at C3 and C4 (in 9) and at C4 (in 5f). Briefly,
the diol 14 was prepared from the known thioglycoside 12 (Pozsgay,
V.; Jennings, H. J. Tetrahedron Lett. 1987, 28, 1375-1376) in four
steps (selective silylation of the primary hydroxyl, acetonide
formation at C3--OH and C4--OH, benzoylation, and removal of the
acetonide) without isolation of intermediate products in an overall
yield of 55%.
[0196] More specifically, ethyl
2-O-benzoyl-6-O-tert-butyldiphenylsilyl-1--
thio-.beta.-D-galactopyranoside (compound 14) was prepared from
ethyl 2,3,4,6-tetra-O-acetyl-1-thio-.beta.-D-galactopyranoside
(Pozsgay, V.; Jennings, H. J. Tetrahedron Lett. 1987, 28,
1375-1376), by using the following five steps procedure.
[0197] To a suspension of ethyl
2,3,4,6-tetra-O-acetyl-1-thio-.beta.-D-gal- actopyranoside (6.25
grams, 16 mmol) in dry MeOH (70 mL) and dry dichloromethane (70 mL)
was added catalytic amount of NaOMe (0.5M solution in MeOH) at
0.degree. C.. Propagation of the reaction was monitored by TLC
(MeOH 10%, dichloromethane 90%). After 2 hours the reaction mixture
was neutralized by Dowex H+ and evaporated to dryness. The
resultant crude preparation of 12 (3.2 grams, 14.3 mmol) was used
for the next step without further purification.
[0198] The crude of 12 from the previous step (3.2 grams, 14.3
mmol) in dry pyridine (35 mL) was added with a catalytic amount of
DMAP and stirred under argon at 60.degree. C. for 10 minutes. The
mixture was added with tert-butyldiphenylsilylchloride (6.7 mL,
25.7 mmol) and the reaction progress was monitored by TLC (EtOAc
65%, Hexane 35%). After 30 minutes the mixture was diluted with
EtOAc and washed with brine, 1.5% H.sub.2SO.sub.4, NaHCO.sub.3
(saturated), and finally with brine. The organic layer was dried
over MgSO.sub.4 and evaporated to give a pale yellow syrup (8.2
grams) that was used for the next step without further
purification.
[0199] The crude from the previous step (8.2 grams) in acetone (50
mL) and 2,2-dimethoxypropane (25 mL) was stirred at ambient
temperature for 5 minutes and then added with a catalytic amount of
camphorsulfonic acid. Propagation of the reaction was monitored by
TLC (EtOAc 30%, Hexane 70%). After 3 hours the reaction mixture was
neutralized by NH.sub.4OH (2.5%) and evaporated to dryness. The
crude was diluted with EtOAc and washed with brine. The combined
organic layer was dried over MgSO.sub.4 and evaporated to give a
pale yellow syrup (8.7 grams).
[0200] The crude from the previous step (8.7 grams) was added with
a catalytic amount of DMAP in dry pyridine (50 mL) and stirred at
ambient temperature for 5 minutes. The reaction mixture was added
with benzoylchloride (4.14 mL, 35.7 mmol) and the propagation of
the reaction was monitored by TLC (Et.sub.2O 20 percentages, Hexane
80%). After 4 hours the mixture was diluted with EtOAc and the
organic phase was washed as follows: brine, HCl (2%), NaHCO.sub.3
(sat.) and brine. The combined organic layer was then dried over
MgSO.sub.4 and evaporated to give a pale yellow syrup (9.3
grams).
[0201] The crude from the previous step (9.3 grams) was dissolved
in THF (10 mL), AcOH (50 mL) and water (5 mL). The reaction mixture
was stirred at 60.degree. C. for 5 hours. Propagation of the
reaction was monitored by TLC (EtOAc 30%, Hexane 70%). The reaction
mixture was diluted with EtOAc and the organic phase was
neutralized with NaHCO.sub.3 (sat.), and washed with brine. The
combined organic layer was dried over MgSO.sub.4, evaporated and
purified by flash chromatography (silica, EtOAc/Hexane) to yield
compound 14 as pale-yellow syrup (4.34 grams, 48% yield for the
five steps).
[0202] .sup.1H NMR (500 MHz, CDCl.sub.3): .delta.=1.05 (s, 9H,
t-Bu), 1.25 (t, 3H, J=7.5 Hz, SCH.sub.2CH.sub.3), 2.68 (m, 2H,
SCH.sub.2CH.sub.3), 3.59 (m, 1H, H-5), 3.76 (dd, 1H, J.sub.1=3,
J.sub.2=9.5 Hz, H-3), 3.97 (m, 2H, H'-6, H-6), 4.14 (d, 1H, J=2.18
Hz, H-4), 5.01 (d, 1H, J=10 Hz, H-1), 5.14 (t, 1H, J=9, Hz, H-2),
7.38-8.12 (m, 15H, aromatic).
[0203] .sup.13C NMR (125 MHz, CDCl.sub.3):
.delta.=26.8(C(CH.sub.3).sub.3)- , 63.7(C-6), 69.7(C-4), 72.2(C-2),
74.2(C-3), 78.0(C-5), 80.1(C-1), 127.6, 127.7, 128.6, 129.7, 129.8,
130.1, 133.7, 135.6, 135.8.
[0204] ESIMS: m/z=605.1 (M+K.sup.+ C.sub.31H.sub.38O.sub.6SSi
requires 605.3).
[0205] Simultaneous triflation of both hydroxyls in 14 was followed
by nucleophilic displacement with azide (without isolation of the
intermediate ditriflate) to afford the corresponding diazide (63%
isolated yield for two steps). Desilylation was then followed with
a chloracetylation step to produce the allo-donor 9. Ethyl
2-O-Benzoyl-3,4-dideoxy-3,4-diazido-6-O-chloroacetyl-1-thio-.beta.-D-allo-
pyranoside (compound 9) was prepared as follows. Compound 14 (1.68
gram, 2.97 mmol) was dissolved in dichloromethane (8 mL) and
pyridine (0.73 mL, 7.4 mmol), and was stirred at 0.degree. C. for
10 minutes. To this mixture was added Tf.sub.2O (1.08 mL, 6.4 mmol)
and the propagation of the reaction was monitored by TLC (EtOAc
20%, Hexane 80%), which indicated completion after 15 minutes. In
an additional flask a mixture of NaN.sub.3 (3.795 grams, 58.3
mmol), dry DMF, (40 mL) and HMPA (5 mL) was vigorously stirred
under argon, and added at once in to the reaction mixture. The
reaction was heated to 50.degree. C., and propagation was monitored
by TLC (EtOAc 20%, Hexane 80%). After 3 hours the mixture was
diluted with EtOAc and washed with brine, HCl (2%), NaHCO.sub.3
(sat.), brine. The combined organic layer was dried over
MgSO.sub.4, evaporated and purified by flash chromatography
(silica, Diethylether/Hexane) to yield the corresponding
3,4-diazido product as a pale yellow syrup (1.15 gram, 63%).
[0206] .sup.1H NMR (500 MHz, CDCl.sub.3): .delta.=1.07 (s, 9H,
t-Bu), 1.24 (t, 3H, J=9.5, SCH.sub.2CH.sub.3), 2.68 (m, 2H,
SCH.sub.2CH.sub.3), 3.73 (broad d, 1H, J=9.5, Hz, H-5), 3.88 (dd,
1H, J.sub.1=3.0, J.sub.2=12.0 Hz, H-6), 3.97 (d, 1H, J=11.5 Hz,
H-6'), 4.51 (dd, 1H, J.sub.1=3.0, J.sub.2=6.0 Hz, H-3), 4.06 (dd,
1H, J.sub.1=3.0, J.sub.2=9.5 Hz, H-4), 4.95 (d, 1H, J=9.5 Hz, H-1),
5.19 (dd, 1H, J.sub.1=3.0, J.sub.2=10, H-2), 7.38-8.11 (m, 15H,
aromatic).
[0207] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=26.8
(C(CH.sub.3).sub.3), 57.7 (C-4), 63.0 (C-6), 63.1 (C-3), 70.2
(C-2), 75.7 (C-5), 79.6 (C-1), 127.6, 127.7, 128.6, 129.7, 129.8,
130.1, 133.7, 135.6, 135.8.
[0208] ESIMS: m/z=655.2 (M+K.sup.+
C.sub.31H.sub.36N.sub.6O.sub.4SSi requires 655.3).
[0209] The di-azido product (1.15 gram, 1.87 mmol) was dissolved in
pyridine (4 mL) and stirred in a polyethylene vessel at 0.degree.
C. for 10 minutes. The mixture was added with HF/Pyr (4 mL) and its
propagation was monitored by TLC (EtOAc 20%, Hexane 80%). After 5
minutes the mixture was diluted with EtOAc and neutralized with
NaHCO.sub.3 (sat.). The combined organic layer was dried over
MgSO.sub.4 and evaporated to dryness. The residue was dissolved in
pyridine (10 mL) and added with a catalytic amount of DMAP,
followed by the addition of chloroacetylchloride (0.286 mL, 3.73
mmol). Propagation was monitored by TLC (EtOAc 20%, Hexane 80%).
After 25 minutes the mixture was diluted with EtOAc, washed with
brine, HCl (2%), NaHCO.sub.3 (sat.), and brine. The combined
organic layer was dried over MgSO.sub.4, evaporated and purified by
flash chromatography (silica, EtOAc/Hexane) to yield the titled
compound 9 as a pale yellow syrup (777 mg, 91%).
[0210] .sup.1H NMR (500 MHz, CDCl.sub.3): .delta.=1.23 (t, 3H,
J=10.0, SCH.sub.2CH.sub.3), 2.68 (m, 2H, SCH.sub.2CH.sub.3), 3.73
(dd, 1H, J.sub.1=3.0, J.sub.2=10.0 Hz, H-4), 3.94 (ddd 1H,
J.sub.1=2.5, J.sub.2=4.5, 1H, J.sub.3=10.0 Hz, H-5), 4.1 (s, 2H,
COCH.sub.2Cl) 4.29 (dd, 1H, J.sub.1=5, J.sub.2=12.5 Hz, H-6), 4.51
(m, 2H, H-3,H-6), 4.97 (d, 1H, J=10 Hz, H-1), 5.16 (dd, 1H,
J.sub.1=3.5, J.sub.2=10.0 Hz, H-2), 7.44-8.08 (5H, aromatic).
[0211] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=15
(SCH.sub.2CH.sub.3), 24.2 (SCH.sub.2CH.sub.3), 40.6 (COCH.sub.2Cl),
58 (C-4), 62.5 (C-3), 64.7 (C-6), 70.0 (C-2), 72.6 (C-5), 80.4
(C-1), 127.6, 127.7, 128.6, 129.7, 129.8, 130.1, 133.7, 135.6,
135.8.
[0212] ESIMS: m/z=493.5 (M+K.sup.+
C.sub.17ClH.sub.19N.sub.6.sub.O.sub.5S requires 493.6).
[0213] Alternatively, selective protection of C6 and C4 hydroxyls
in the galactoside 13 by p-methoxybenzylidene, followed by
benzoylation and hydrolysis of the benzylidene, gave the diol 15 in
an overall 58% yield for three steps.
[0214] p-Methylphenyl
2,3-Di-O-benzoyl-1-thio-.beta.-D-galactopyranoside (compound 15)
was prepared as follows: To a solution of
p-methylphenyl-1-thio-.beta.-D-galactopyranoside (Zhang, Z.;
Ollmann, I. R.; Ye, X-S.; Wischnat, R.; Baasov, T.; Wong, C-H. J.
Am. Chem. Soc., 1999, 121, 734.) (4.7 g, 16 mmol) in DMF (30 mL)
and anisaldehyde dimethylacetal (3.6 mL, 21 mmol) was added a
catalytic amount of camphorsulfonic acid and stirred at ambient
temperature. The reaction was monitored by TLC (EtOAc 70%, Hexane
30%). After 2 hours the mixture was diluted with EtOAc, and washed
with brine, NaHCO.sub.3 (sat.), and once again with brine. The
combined organic layer was dried over MgSO.sub.4, evaporated and
purified by flash chromatography (silica, EtOAc/Hexane) to yield
the corresponding 4,6-O-benzylidene (4.9 grams, 76%).
[0215] .sup.1H NMR (125 MHz, CDCl.sub.3): .delta.=2.47 (s, 3H,
Me-STol), 3.62 (broad s, 1H, Hz, H-5), 3.75 (dd 1H,
J.sub.1=J.sub.2=9.5 Hz, H-2), 3.79 (dd, 1H, J.sub.1=3, J.sub.2=9.5
Hz, H-3), 3.92 (s, 3H, Me-OMP), 4.10 (d, 1H, J=11.5 Hz, H-6), 4.28
(d, 1H, J=3 Hz, H-4) 4.45 (d, 1H, J=11.5 Hz, H-6'), 4.10 (d, 1H,
J=9.5 Hz, H-1), 5.55 (s, 1H, Benzylic Proton), 6.96-7.70 (m, 8H,
aromatic).
[0216] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=21.2 (Me-STol),
55.2 (Me-OMP), 68.6, 69.2, 69.9, 73.7, 75.3, 87, 101.1(C-1), 113.4,
127.8, 129.6, 131.9, 132.1, 134.2, 138.3.
[0217] Positive CIMS: m/z=405.1 (M+H.sup.+ C.sub.21H.sub.24O.sub.6S
requires 404.2).
[0218] The product from the previous step (4.9 grams, 12.2 mmol)
was dissolved in dry pyridine under argon and added with a
catalytic amount of DMAP. After being stirred at ambient
temperature for 5 minutes, the reaction mixture was added with
benzoylchloride (3.7 mL, 31.4 mmol). Propagation of the reaction
was monitored by TLC (EtOAc 30%, Hexane 70%), which indicated
completion after 4 hours. The reaction mixture was diluted with
EtOAc and the organic phase was washed as follows: brine, HCl (2%),
NaHCO.sub.3 (sat.), brine. The combined organic layer was dried
over MgSO.sub.4, and evaporated to dryness to yield 6.3 grams of
crude that was used for the next step without further
purification.
[0219] The crude from the previous step (6.3 grams) was added with
THF (10 mL), AcOH (50 mL), and water (5 mL). The reaction mixture
was stirred at 50.degree. C. for 3 hours. Propagation of the
reaction was monitored by TLC (EtOAc 30%, Hexane 70%). The reaction
mixture was diluted with EtOAc and the organic phase was
neutralized by NaHCO.sub.3 (sat.), and washed with brine. The
combined organic layer was dried over MgSO.sub.4, evaporated and
purified by flash chromatography (silica, EtOAc/Hexane) to yield
compound 15 (4.62 grams, 58% for the three steps).
[0220] .sup.1H NMR (500 MHz, CDCl.sub.3/CD.sub.3OD 10/1):
.delta.=2.21 (s, 3H, Me-STol), 3.50-3.90 (m, 3H, H-5, H-6, H-6'),
4.27 (d, 1H, J=3.5 Hz, H-4), 4.80(d, 1H, J=9.9 Hz, H-1), 5.17 (dd,
1H, J.sub.1=4.5, J.sub.2=9.9 Hz, H-3), 5.64 (t, 1H, J=4.2 Hz, H-2)
6.98-7.90(m, 14H, aromatic).
[0221] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=20.9 (Me-STol),
61.4, 67.3, 68.2, 75.6, 78.5, 87.2(C-1), 128.2, 128.8, 129.3,
129.6, 132.6, 133.1, 133.2, 138.1, 165.5, 166.0.
[0222] Negative CIMS: m/z=494.3 (M+H.sup.+ C.sub.26H.sub.20O.sub.7S
requires 495.3).
[0223] This diol (compound 15) was then subjected to a similar
triflation and azidation steps as for compound 14 to afford the
4,6-diazido donor 5f in an isolated yield of 86% for two steps.
[0224]
p-Methylphenyl-4,6-Dideoxy-4,6-diazido-2,3-O-benzoyl-1-thio-.beta.--
D-glucopyranoside (compound 5f) was prepared as follows. Compound
15 (4.62 grams, 9.35 mmol) in dry pyridine (20 mL) was stirred
under argon at 0.degree. C. for 10 minutes and added with Tf.sub.2O
(1.97 mL, 11.7 mmol). The mixture was allowed to warm to room
temperature. Propagation of the reaction was monitored by TLC
(EtOAc 20%, Hexane 80%), which indicated completion after 15
minutes. In an additional flask, a mixture of NaN.sub.3 (12.17
grams, 187 mmol) in dry DMF, (40 mL) and HMPA (5 mL) was vigorously
stirred under argon, and added at once into the reaction mixture.
Propagation was monitored by TLC (EtOAc 20%, Hexane 80%), which
indicated completion after 3 hours. The mixture was diluted with
EtOAc and washed with brine, HCl (2%), NaHCO.sub.3 (sat.), and
brine. The combined organic layer was dried over MgSO.sub.4,
evaporated and purified by flash chromatography (silica,
EtOAc/Hexane) to yield compound 5f (3.66 grams, 72 percentages
yield).
[0225] .sup.1H NMR (500 MHz, CDCl.sub.3): .delta.=2.33 (s, 3H,
Me-STol), 3.51 (dd, 1H, J.sub.1=4.5, J.sub.2=13.5 Hz, H-6), 3.56
(ddd 1H, J.sub.1=1.5, J.sub.2=4.5, 1H, J.sub.3=15.0 Hz, H-5), 3.70
(dd, 1H, J.sub.1=1.5, J.sub.2=13.0 Hz, H-6'), 3.83 (t, 1H, J=9.5
Hz, H-4), 4.82 (d, 1H, J=10.0 Hz, H-1), 5.26 (t, 1H, J=9.5 Hz,
H-2), 5.61 (d, 1H, J=9.5 Hz, H-3), 7.10-7.95 (m, 14H,
aromatic).
[0226] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=21.2 (Me-STol),
51.5 (C-6), 60.5 (C-4), 70.1 (C-2), 74.9 (C-3), 77.4 (C-5), 86.1
(C-1), 126.6, 128.4, 128.5, 129.0, 129.7, 129.8, 133.4, 133.5,
134.6, 134.7, 139.1, 165.0, 165.6.
[0227] ESIMS: m/z=583.1 (M+K.sup.+ C.sub.27H.sub.24O.sub.5N.sub.6S
requires 583.3).
[0228] Ethyl
3,4-Di-O-benzoyl-6-O-chloroacetyl-2-deoxy-2-phthalimido-1-thi-
o-.beta.-D-glucopyranose (compound 10) was prepared by the same
synthetic path which was used for the preparation of phenyl
6-O-acetyl-3,5-di-O-ben-
zoyl-2-deoxy-2-phthalimido-1-thio-.beta.-D-glucopyranose (Solomon,
D.; Fridman, M.; Zhang, J.; Baasov, T. Organic Letters 2001, 3,
4311-4314).
[0229] Ethyl 2,3,5-Tri-O-acetyl-1-thio-D-ribofuranose (compound 11)
was prepared as follows. The commercial
1,2,3,5-tetra-O-acetyl-.beta.-D-ribof- uranose (3.5 grams, 11 mmol)
in dichloromethane (30 mL) was added with ethylthiotrimethylsilane
(4.44 mL, 27.5 mmol) and TMSOTf (2 mL, 11 mmol). The mixture was
stirred at ambient temperature and the reaction progress was
monitored by TLC (EtOAc/Hexane 1:1), which indicated completion
after 3.5 hours. The mixture was diluted by EtOAc (200 mL),
neutralized by NaHCO.sub.3 (sat.), and washed with brine. The
combined organic layer was dried over MgSO.sub.4, evaporated and
purified by flash chromatography (silica, EtOAc/Hexane) to yield
compound 11 3.4 grams, (96% yield) as a mixture of anomers
(.alpha./.beta.; 1:3).
[0230] .sup.1H NMR (500 MHz, CDCl.sub.3) for 9-.alpha.-anomer:
.delta.=4.07 (dd, 1H, J.sub.1=4.0, J.sub.2=11.5 Hz, H-5), 4.17 (dd,
1H, J.sub.1=4.0, J.sub.2=9.5 Hz, H-4), 4.28 (dd, 1H, J.sub.1=3.0,
J.sub.2=12.0 Hz, H-5), 5.09 (d, 1H, J.sub.1=3.0 Hz, H-1), 5.16 (dd,
1H, J.sub.1=J.sub.2=5.0 Hz, H-2), 5.26(dd, 1H, J.sub.1=J.sub.2=5.5
Hz, H-3).
[0231] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=14.7, 20.37,
20.4, 20.7, 24.5, 63.5 (C-5), 71.6, 74.4, 79.5, 85.5 (C-1), 169.4,
169.5, 170.3.
[0232] .sup.1H NMR (500 MHz, CDCl.sub.3) for 9-.alpha.-anomer:
.delta.=4.12 (dd, 1H, J.sub.13.5, J.sub.2=12.0 Hz, H-5), 4.25(dd,
1H, J.sub.1=3.5, J.sub.2=12.0 Hz, H-5'), 4.27 (dd, 1H, J.sub.1=4.0,
J.sub.2=8.0 Hz, H-4), 5.08 (t, 1H, J=6.0 Hz, H-3), 5.30 (d, 1H,
J=6.5 Hz, H-2), 5.53 (d, 1H, J=4.5 Hz, H-1). .sup.13C NMR (125 MHz,
CDCl.sub.3) , 14.9, 20.3, 20.4, 20.6, 25.3, 62.8 (C-5), 70.4, 71.3,
74.4, 86.7 (C-1), 169.3, 169.7, 170.4.
[0233] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=21.2 (Me-STol),
51.5 (C-6), 60.5 (C-4), 70.1 (C-2), 74.9 (C-3), 77.4 (C-5), 86.1
(C-1), 126.6, 128.4, 128.5, 129.0, 129.7, 129.8, 133.4, 133.5,
134.6, 134.7, 139.1, 165.0, 165.6.
[0234] Negative CIMS: m/z=319.1 (M-H.sup.+ C.sub.13H.sub.20O.sub.7S
requires 320.1).
[0235]
p-Methylphenyl-2-deoxy-2-phthalimido-6-deoxy-6-azido-3,4-di-O-benzo-
yl-1-thio-.beta.-D-glucopyranoside (5e) was prepared from
p-Methylphenyl-2-deoxy-2-phthalimido-1-thio-.beta.-D-glucopyranoside
(Wong, Chi-Huey; Zhang, Zhiyuan; Ollmann, Ian; Baasov, Timor; Ye,
Xin-Shan, J. Am. Chem. Soc, 1999, 121, 734-753.), by the following
four steps:
[0236]
p-Methylphenyl-2-deoxy-2-phthalimido-1-thio-.beta.-D-glucopyranosid-
e (2 grams, 4.8 mmol) in dry pyridine (35 mL), was added with a
catalytic amount of DMAP and stirred under argon at 60.degree. C.
for 10 minutes. The mixture was added with
tert-butyldiphenylsilylchloride (2.51 mL, 9.63 mmol) and the
reaction progress was monitored by TLC (EtOAc 65%, Hexane 35%).
After 2 hours the mixture was allowed to cool back to room
temperature, and added with benzoyl chloride (1.67 mL, 14.45 mmol)
and the propagation of the reaction was monitored by TLC (EtOAc
40%, Hexane 60%). After 4 hours the mixture was diluted with EtOAc
and the organic phase was washed as follows: brine, HCl (2%),
NaHCO.sub.3 (sat.) and brine. The combined organic layer was then
dried over MgSO.sub.4 and evaporated to afford a pale yellow
syrup.
[0237] The crude from the previous step was dissolved in pyridine
(15 mL) and stirred under argon at 0.degree. C. for 10 minutes in a
polyethylene vessel. The mixture was added with HF/Pyr (15 mL) and
its propagation was monitored by TLC (EtOAc 20%, Hexane 80%). After
5 minutes the mixture was diluted with EtOAc and neutralized with
NaHCO.sub.3 (sat.). The combined organic layer was dried over
MgSO.sub.4, evaporated to dryness and purified by flash
chromatography (silica, EtOAc/Hexane) to yield the titled compound
as 2.52 grams (84% for the 3 steps).
[0238] .sup.1H NMR (200 MHz): .delta.=1.63 (broad s, 1H, 6--OH),
2.31 (s, 3H, SPhCH.sub.3), 3.69 (dd, 1H, J.sub.1=4.7, J.sub.2=12.7
Hz, H-6), 3.82-3.93 (m, 2H, H-5, H-6'), 4.54 (t, 1H, J=10.4 Hz,
H-2), 5.46 (t, 1H, J=9.8 Hz, H-4), 5.81 (d, 1H, J=10.6 Hz, H-1),
6.28 (t, 1H, J=10.2, Hz, H-3), 6.91-7.92 (m, 18H, aromatic).
[0239] Positive CIMS: m/z=623.3 (M.sup.+ C.sub.35H.sub.29NO.sub.8S
requires 623.1).
[0240] The pure alcohol from the above (1.5 gram, 2.4 mmol) was
dissolved in pyridine (30 mL), and was stirred at 50.degree. C. for
10 minutes followed by the addition of freshly crystallized
p-toluenesulfonyl chloride (1.15 gram, 6.01 mmol). Propagation of
the reaction was monitored by TLC (EtOAc 20%, Hexane 80%), which
indicated completion after 15 minutes. The mixture was diluted with
EtOAc and the organic phase was washed as follows: brine, HCl (2%),
NaHCO.sub.3 (sat.) and again with brine. The combined organic layer
was then dried over MgSO.sub.4 and evaporated to afford a pale
yellow syrup. The tosylation product was then put under argon and
added NaN.sub.3 (1.562 gram, 24 mmol), dry DMF (40 mL) and HMPA (5
mL). The reaction was heated to 50.degree. C., and propagation was
monitored by TLC (EtOAc 20%, Hexane 80%). After 3 hours the mixture
was diluted with EtOAc and washed with brine, HCl (2%), NaHCO.sub.3
(sat.), brine. The combined organic layer was dried over
MgSO.sub.4, evaporated and purified by flash chromatography
(silica, EtOAc/Hexane) to yield 5e as white solid (2.23 grams, 93%
yield).
[0241] .sup.1H NMR (500 MHz, CDCl.sub.3): .delta.=2.36 (s, 3H,
SPhCH.sub.3), 3.44 (dd, 1H, J.sub.1=2.5, J.sub.2=13.5 Hz, H-6),
3.50 (dd, 1H, J.sub.1=6.0, J.sub.2=13.5 Hz, H-6'), 4.06 (ddd, 1H,
J.sub.1=3.0, J.sub.2=6.5, J.sub.3=13.0 Hz H-5), 4.55 (t, 1H, J=10.5
Hz, H-2), 5.48 (t, 1H, J=9.5 Hz, H-4), 5.83 (d, 1H, J=10.5 Hz,
H-1), 6.23 (t, 1H, J=10.0, Hz, H-3), 7.13-7.90 (m, 18H,
aromatic).
[0242] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=21.2
(SPhCH.sub.3), 51.4, 53.7, 70.3, 71.9, 77.4, 83.4, 123.7, 128.3,
128.4, 128.5, 129.8, 131.2, 131.6, 134.2, 134.3, 134.5, 139.1,
165.2, 165.6, 166.9, 168.0.
[0243] ESIMS: m/z=687.4 (M+K.sup.+ C.sub.35H.sub.28N.sub.4O.sub.7S
requires 687.2).
[0244]
p-Methylphenyl-5-deoxy-5-azido-2,3-di-O-benzoyl-1-thio-D-ribofurano-
se (8b) was prepared from the commercially available
1,2,3,5-tetra-O-acetyl-.beta.-D-ribofuranose (Sigma) by the
following 5 steps:
[0245] 1,2,3,5-Tetra-O-acetyl-.beta.-D-ribofuranose (3 grams, 9.43
mmol) in dry dichloromethane (35 mL) was added with
4-methylbenzenethiol (1.4 gram, 11.78 mmol), treated with TMSOTf
(0.35 mL, 1.925 mmol) and stirred at ambient temperature under
argon. Propagation of the reaction was monitored by TLC
(EtOAc/Hexane 1:1), which indicated completion after 11 hours. The
mixture was diluted by EtOAc (200 mL), neutralized by NaHCO.sub.3
(sat.), and washed with brine. The combined organic layer was dried
over MgSO.sub.4, evaporated and used for the next step without
further purification.
[0246] A suspension of the crude from the previous step in dry MeOH
(40 mL) and dry dichloromethane (40 mL) was added a catalytic
amount of NaOMe (0.5M solution in MeOH) at 0.degree. C..
Propagation of the reaction was monitored by TLC (MeOH 10%,
dichloromethane 90%). After 2 hours the reaction mixture was
neutralized by Dowex H.sup.+ and evaporated to dryness. The
resulted crude was used for the next step without further
purification.
[0247] The crude from the previous step was dissolved under argon
in dry dichloromethane (60 mL) and added with dry triethylamine (3
mL). The mixture was then added with freshly crystallized
p-toluenesulfonyl chloride (2.16 grams, 11.31 mmol) and stirred
4.degree. C.. Propagation of the reaction was monitored by TLC
(MeOH 10%, dichloromethane 90%) and indicated completion after 12
hours. The mixture was then evaporated to dryness and added
NaN.sub.3 (1.562 gram, 24 mmol), dry DMF (30 mL) and HMPA (3 mL).
The reaction was heated to 50.degree. C., and propagation was
monitored by TLC (EtOAc 40%, Hexane 60%). After 3 hours the mixture
was diluted with EtOAc and washed with brine, HCl (2%), NaHCO.sub.3
(sat.), brine. The combined organic layer was dried over
MgSO.sub.4, evaporated to dryness to afford the crude product as a
pale orange colored oil.
[0248] The crude from the previous step was dissolved in dry
pyridine (40 mL) under argon. The mixture was added with benzoyl
chloride (3.27 mL, 27.4 mmol) and propagation was monitored by TLC
(EtOAc 30%, Hexane 70%). After 4 hours, the mixture was diluted
with EtOAc and washed with brine, HCl (2%), NaHCO.sub.3 (sat.),
brine. The combined organic layer was dried over MgSO.sub.4,
evaporated and purified by column chromatography (silica,
EtOAc/Hexane) to yield 8b 2.63 grams, (57% yield for the five
steps) as a mixture of anomers (.alpha./.beta.; 1:4).
[0249] .sup.1H NMR (500 MHz, CDCl.sub.3) for the .beta.-anomer:
.delta.=2.36 (s, 3H, Me-STol), 3.58 (d, 2H, J=4.5 Hz, H-5, H-5'),
4.40 (dd, 1H, J.sub.1=4.5, J.sub.2=9.5 Hz, H-4), 5.47 (t, 1H, J=5.5
Hz, H-3), 5.34 (s, 1H, H-1), 5.58(t, 1H, J=5.0 Hz, H-2),
7.17-8.11(17.5H. aromatic protons of both anomers).
[0250] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=21.1 (Me-Stol),
52.7(C-5), 72.5(C-3), 74.6(C-2), 81.6(C-4), 88.6(C-1), 128.4,
128.8, 128.9, 129.8, 129.9, 130.6, 165.0, 165.3.
[0251] For the .alpha.-anomer .sup.1H NMR (500 MHz, CDCl.sub.3):
.delta.=2.33 (s, 3H, Me-STol), 3.65 (dd, 1H, J.sub.1=4.0,
J.sub.2=13.0 Hz, H-5), 3.75(dd, 1H, J.sub.1=3.0, J.sub.2=13.5 Hz,
H-5'), 4.67 (dd, 1H, J.sub.1=4.0, J.sub.2=7.0 Hz, H-4), 5.59 (dd,
1H, J.sub.1=4.5, J.sub.2=5.5 Hz, H-3), 5.74 (t, 1H, J=6.0 Hz, H-2),
6.03 (d, 1H, J=6.0 Hz, H-1) 7.17-8.11(17.5H. aromatic protons of
both anomers).
[0252] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=21.1 (Me-Stol),
51.8(C-5), 71.8(C-3), 72.2(C-2), 80.2(C-4), 90.9(C-1), 127.7,
128.5, 128.9, 129.0, 129.7, 138.8, ESIMS m/z 528.3
(M+K.sup.30C.sub.26H.sub.23N.- sub.3O.sub.5S requires 528.5).
[0253]
p-Methylphenyl-6-O-Acetyl-4-deoxy-4-azido-3,4-di-O-benzoyl-1-thio-.-
beta.-D-glucopyranoside (5c) was prepared from
p-Methylphenyl-2,3-di-O-ben- zoyl-1-thio-.beta.-D-galactopyranoside
15 by the following four steps:
[0254]
p-Methylphenyl-2,3-di-O-benzoyl-1-thio-.beta.-D-galactopyranoside
(900 mg, 1.82 mmol) in dry pyridine (12 mL), was added with a
catalytic amount of DMAP and stirred under argon at 50.degree. C.
for 10 minutes. The mixture was added with
tert-butyldiphenylsilylchloride (1.07 mL, 4.09 mmol) and the
reaction progress was monitored by TLC (EtOAc 50%, Hexane 50%).
After 30 minutes, the mixture was diluted with EtOAc and washed
with brine, HCl (2%), NaHCO.sub.3 (sat.), brine. The combined
organic layer was dried over MgSO.sub.4, evaporated and purified by
column chromatography (silica, EtOAc/Hexane) to yield the product
as white solid 1.1 gram (82% yield).
[0255] .sup.1H NMR (500 MHz, CDCl.sub.3): .delta.=1.06 (s, 9H,
tert-butylSiPh.sub.2), 2.30 (s, 3H, SPhCH.sub.3), 3.76 (t, 1H,
J=5.5 Hz, H-5), 3.93 (dd, 1H, J.sub.1=4.5, J.sub.2=15.5 Hz, H-6),
4.02 (dd, 1H, J.sub.1=4.5, J.sub.2=16.0 Hz, H-6'), 4.45 (d, 1H,
J=3.0 Hz, H-4), 4.85 (d, 1H, J=10.0 Hz, H-1), 5.28 (dd, 1H,
J.sub.1=3.0, J.sub.2=10.0 Hz, H-3), 5.78 (t, 1H, J=9.5 Hz, H-2) ,
6.98-7.98 (24H, aromatic).
[0256] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=21.2
(SPhCH.sub.3), 26.8 (tert-butylSiPh.sub.2), 64.0, 68.0, 68.5, 75.8,
77.9, 86.9 (C-1), 127.8, 127.9, 128.3, 128.4, 128.6, 129.2, 129.6,
129.8, 129.9, 132.7, 133.1, 133.3, 135.6, 135.7, 138.2, 165.2,
165.9.
[0257] ESIMS: m/z=771.2 (M+K.sup.+ C.sub.43H.sub.44O.sub.7SiS
requires 771.8).
[0258] The product of the previous step (1 gram, 1.36 mmol) was
dissolved in pyridine (8 mL), and stirred at 0.degree. C. for 15
minutes followed by the dropwise addition of
trifluoromethanesulfonic anhydride (0.26 mL, 1.564 mmol).
Propagation of the reaction was monitored by TLC (EtOAc 20%, Hexane
80%), which indicated completion after 15 minutes. The mixture was
evaporated under vacuum to afford a pale yellow syrup, and was then
put under argon and added NaN.sub.3 (1.848 gram, 28 mmol), dry DMF
(30 mL) and HMPA (5 mL) and stirred at room temperature.
Propagation was monitored by TLC (EtOAc 15%, Hexane 85%). After 10
hours and the mixture was diluted with EtOAc and washed with brine,
HCl (2%), NaHCO.sub.3 (sat.), brine. The combined organic layer was
dried over MgSO.sub.4 evaporated and used for the next step without
further purification.
[0259] The crude from the previous step was dissolved in pyridine
(8 mL) and stirred under argon at 0.degree. C. for 10 minutes in a
polyethylene vessel. The mixture was added with HF/Pyr (4 mL) and
its propagation was monitored by TLC (EtOAc 25%, Hexane 75%). After
5 minutes the mixture was diluted with EtOAc and neutralized with
NaHCO.sub.3 (sat.). The combined organic layer was dried over
MgSO.sub.4, evaporated to dryness and used for the next step
without further purification.
[0260] The crude from the previous step was dissolved in pyridine
(8 mL). The mixture was then added with a catalytic amount of
4-DMAP and acetic anhydride (0.258 mL, 2.8 mmol) with HF/Pyr (4 mL)
and its propagation was monitored by TLC (EtOAc 20%, Hexane 80%).
After 2 hours the mixture was diluted with EtOAc and neutralized
with NaHCO.sub.3 (sat.). The combined organic layer was dried over
MgSO.sub.4, evaporated to dryness and used for the next step
without further purification. The mixture was diluted with EtOAc
and washed with brine, HCl (2%), NaHCO.sub.3 (sat.), brine. The
combined organic layer was dried over MgSO.sub.4, evaporated and
purified by column chromatography (silica, EtOAc/Hexane) to yield
the 5c as white solid 615 mg (73% yield for the four steps).
[0261] .sup.1H NMR (500 MHz, CDCl.sub.3): .delta.=2.14 (s, 3H,
OCOMe), 2.32 (s, 3H, SPhCH.sub.3), 3.63 (ddd, 1H, J.sub.1=2.0,
J.sub.1=4.5, J.sub.1=10.0 Hz, H-5), 3.79 (t, 1H, J=10.0 Hz, H-4),
4.30 (dd, 1H, J.sub.1=5.0 J.sub.2=12.5 Hz, H-6), 4.52 (dd, 1H,
J.sub.1=2.0, J.sub.2=12.0 Hz, H-6'), 4.45 (d, 1H, J=3.0 Hz, H-4),
4.80 (d, 1H, J=9.5 Hz, H-1), 5.29 (t, 1H, J=9.5 Hz, H-2), 5.60.(t,
1H, J=9.5 Hz, H-3), 7.07-7.94 (14H, aromatic).
[0262] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=20.8.7
(SPhCH.sub.3), 21.2 (OCOMe), 60.5, 63.0, 70.3, 79.4, 76.2, 76.9,
86.3 (C-1), 127.6, 128.4, 128.7, 129.1, 129.7, 129.8, 129.9, 133.4,
133.5, 134.0, 138.8, 165.1, 165.6, 170.5.
[0263] ESIMS: m/z=600.1 (M+K.sup.+ C.sub.29H.sub.27N.sub.3O.sub.7S
requires 600.7).
[0264] Turning now to FIG. 12, the neomycin acceptor 1 was readily
prepared in four chemical steps from the commercial neomycin B
(Compound I) in an overall yield of 57% (briefly, these steps
included perazidation of the commercial neomycin B (obtained from
Sigma Israel) with TfN.sub.3 according to the procedure of Wong
(Kumar, V.; Jones, G. S., Jr.; Blacksberg, I.; Remers, W. A. J.
Med. Chem. 1980, 23, 42-49; Yoshikawa, M.; Ikeda, Y.; Takenaka, K.
Chem. Lett. 1984, 13, 2097-2100), selective silylation of the
primary hydroxyl at C5", acetylation of all the remaining
hydroxyls, and desilylation as depicted in FIG. 12).
[0265] The neomycin acceptor 1 was prepared as follows:
Hexaazido-neomycin was prepared from the commercial neomycin B
(tri-sulfate salt, 5 grams, 5.5 mmol) following the published
procedure (Alper, P. B.; Hendrix, M.; Sears, P.; Wong, C.-H. J. Am.
Chem. Soc. 1998, 120, 1965-1978) and was used for the next step
without purification. The crude hexaazido-product was dissolved in
pyridine (40 mL), added with DMAP (cat.) and stirred at 70.degree.
C. for 15 minutes. The reaction was then added with
tert-butyldimethylsilylchloride (1.66 gram, 11 mmol), and TLC
(EtOAc 100%) indicated completion after 30 minutes. The mixture was
allowed to stir for additional 10 minutes and then added with
pyridine (20 mL), DMAP (cat), and Ac.sub.2O (7.8 mL, 82.5 mmol).
Propagation of the reaction was monitored by TLC (EtOAc 30%, Hexane
70%), which indicated completion after 3 hours. The mixture was
diluted with EtOAc and washed with brine, HCl (2%), NaHCO.sub.3
(sat.), and brine. The combined organic layer was dried over
MgSO.sub.4, evaporated and purified by flash chromatography
(silica, EtOAc/Hexane) to yield the corresponding silyl ether as a
white powder (3.5 grams, 62% yield for 3 steps).
[0266] .sup.1H NMR (500 MHz, CDCl.sub.3) data for this compound is
summarized in Table 1 hereinbelow.
[0267] .sup.13C NMR (150.92 MHz): .delta.=18.2, 20.5, 20.6, 20.7,
20.9, 25.8, 29.6, 31.4, 50.7, 51.1, 56.7, 58.1, 59.2, 60.8, 63, 65,
68.7, 69, 70, 73.1, 75.2, 76, 76.7, 76.9, 77, 77.2, 81.6, 83.3,
96.0 (anomeric carbon), 99.6 (anomeric carbon), 106.3 (anomeric
carbon), 168.5, 169.5, 169.7, 167.9, 170.2, 170.3.
[0268] ESIMS: m/z=1175.6 (M+K.sup.+,
C.sub.41H.sub.60O.sub.19N.sub.18Si requires 1175.4).
[0269] The silyl ether from the above (1.06 gram, 0.93 mmol) was
dissolved in pyridine (8 mL) and stirred in a polyethylene vessel
at 0.degree. C. for 10 minutes. The mixture was added with HF/Pyr
(4 mL). Propagation of the reaction was monitored by TLC (EtOAc
20%, Hexane 80%), which indicated completion after 5 minutes. The
mixture was diluted with EtOAc, neutralized with NaHCO.sub.3
(sat.). The combined organic layer was dried over MgSO.sub.4,
evaporated and purified by flash chromatography (silica,
EtOAc/Hexane) to yield acceptor 1 as a white powder (884 mg, 93%
yield).
[0270] .sup.1H NMR (500 MHz, CDCl.sub.3) data of acceptor 1 is
summarized in Table 2 hereinbelow.
[0271] .sup.13C NMR: .delta.=15.9, 16, 22.3, 22.4, 22.5, 22.6,
33.3, 52.6, 52.7, 58.3, 59.7, 60.8, 62.1, 67.4, 70.5, 70.9, 71,
71.1, 75.2, 77.8, 83.2, 83.6, 99.0 (anomeric carbon), 101.2
(anomeric carbon), 108.0 (anomeric carbon), 170.4, 171.2, 171.4,
171.6, 171.7, 171.9.
[0272] ESIMS: m/z=1061.2 (M+K.sup.+,
C.sub.35H.sub.46O.sub.19N.sub.18 requires 1061.4).
[0273] NIS-promoted coupling of acceptor 1 with various
thioglycosides furnished the designed protected
pseudo-pentasaccharides 16a-h in 58-89% yields. Purity and
exclusive stereochemistry of new glycosidic bonds in 16a-d were
confirmed by .sup.1H NMR spectroscopy (16a: H-1, .delta. 4.86 ppm,
J.sub.1,2=8.0 Hz. 16b: H-1, .delta. 4.81 ppm, J.sub.1,2=7.5 Hz.
16c: H-1, .delta. 5.62 ppm, J.sub.1,2=8.5 Hz. 16d: H-1, .delta.
5.95 ppm, J.sub.1,2=4.5 Hz; see below for a more detailed
description and tables).
[0274] Compound 16a was prepared as follows: To powdered, flame
dried 4 .ANG. molecular sieves (0.4 gram) was added
CH.sub.2Cl.sub.2 (4 mL), followed by the addition of acceptor 1
(100 mg, 0.098 mmol) and donor 9 (65 mg, 0.143 mmol). After being
stirred for 10 minutes at room temperature, the mixture was treated
with NIS (64.3 mg, 0.286 mmol). After an additional 5 minutes at
room temperature, TfOH (cat.) was added. Propagation of the
reaction was monitored by TLC (EtOAc 50%, Hexane 50%), which
indicated completion after 10 minutes. The reaction was diluted
with EtOAc, and filtered through celite. After thorough washing
with EtOAc, the washes were combined and extracted with 10%
Na.sub.2S.sub.2O.sub.3, saturated (aq.) NaHCO.sub.3, brine, dried
over MgSO.sub.4 and concentrated. The crude was purified by flash
chromatography to yield 16a (112 mg, 81% yield).
[0275] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16a are summarized
in Table 3 hereinbelow.
[0276] .sup.13C NMR: .delta.=20.4, 20.6, 20.7, 29.6, 31, 40.7, 50,
50.9, 56.3, 58, 58.8, 60.6, 6.60, 62.5, 65, 68.1, 68.4, 69, 70.3,
71, 72.4, 74.8, 75, 75.5, 76.4, 80.2, 83.5, 96.4 (anomeric carbon),
98.8 (anomeric carbon), 99.0 (anomeric carbon), 108.2 (anomeric
carbon), 128.9, 129.3, 129.7, 133.7, 167.7, 167.1, 168.3, 169.5,
169.6, 169.8, 170.1.
[0277] ESIMS: m/z=1453.2 (M.sup.+K.sup.+, C.sub.50ClH.sub.59
N.sub.24O.sub.24 requires 1453).
[0278] Compound 16b. The titled compound was prepared as was
described for the preparation of compound 16a. The conditions used
were: donor 5f (430 mg, 0.79 mmol), acceptor 1 (646 mg, 0.63 mmol),
NIS (430 mg, 1.9 mmol), TfOH (cat.) CH.sub.2Cl.sub.2 (15 mL), and 4
.ANG. molecular sieves (1.5 gram). The reaction was performed at
0.degree. C. to yield 16b (780 mg, 86%) as a mixture of anomers
(.alpha./.beta. 1:2) as determined by NMR.
[0279] ESIMS: m/z=1481.7 (M.sup.+K.sup.+,
C.sub.55H.sub.62N.sub.24O.sub.24 requires 1481.6).
[0280] The above mixture could not be separated until after the
next step. Thus, compound 16b (200 mg, 0.138 mmol, as a mixture of
anomers) was dissolved in 33% solution of MeNH.sub.2 in EtOH (40
mL) and stirred at room temperature for 48 hours. Propagation of
the reaction was monitored by TLC (MeOH 20%, CHCl.sub.3 80%). The
reagent and the solvent were removed by evaporation and the residue
was purified by flash chromatography (silica, MeOH/CHCl.sub.3) to
yield the corresponding octaazido-octaol as a .beta.-anomer
16b.beta.(72.7 mg, 53%), and the
octaazido-heptaol-C.sub.2V-O-benzoyl as an .alpha.-anomer
16b.alpha.(49.2 mg, 36%).
[0281] .sup.1H NMR (500 MHz, CDCl.sub.3/CD.sub.3OD; 10:1) data of
the .beta.-anomer and of the .alpha.-anomer are summarized in Table
4 and Table 5 hereinbelow, respectively.
[0282] .sup.13C NMR (.beta.-anomer): .delta.=29.5, 38.1, 51.1,
51.2, 51.5, 59.6, 59.8, 60.6, 62.3, 62.5, 68.7, 68.9, 69.4, 71.1,
71.1, 73.6, 73.6, 73.7, 74.1, 75.3, 75.4, 75.9, 76.1, 80.6, 84.3,
96.2 (anomeric carbon), 98.3 (anomeric carbon), 102.8 (anomeric
carbon), 108.5 (anomeric carbon).
[0283] ESIMS: m/z=1021.3 (M+K.sup.+,
C.sub.29H.sub.42N.sub.24O.sub.16 requires 1021.8).
[0284] .sup.13C NMR (.beta.-anomer): .delta.=29.5, 39.1, 51.0,
51.4, 51.7, 59.4, 59.7, 60.9, 62.9, 62.9, 68.5, 69.7, 70.8, 71.0,
71.2, 74.1, 75.0, 75.6, 75.9, 76.2, 80.6, 84.2, 96.5 (anomeric
carbon), 97.7 (anomeric carbon), 98.4 (anomeric carbon), 107.3
(anomeric carbon), 120.1, 125.9, 128.3, 129.4, 135.9.
[0285] ESIMS: m/z=1125.3 (M.sup.+K.sup.+,
C.sub.36H.sub.47N.sub.24O.sub.17 requires 1125.8).
[0286] Compound 16c. The titled compound was prepared as described
for the preparation of compound 16a. The conditions used were:
donor 10 (467.2 mg, 0.73 mmol), acceptor 1 (250 mg, 0.24 mmol), NIS
(330 mg, 1.47 mmol), TfOH (cat.). CH.sub.2Cl.sub.2 (5 mL), 4 .ANG.
molecular sieves (500 mg), to yield 226 mg of 16c (58%).
[0287] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16c are summarized
Table 6 hereinbelow.
[0288] .sup.13C NMR: .delta.=20.4, 20.7, 20.8, 20.9, 29.6, 40.8,
50.5, 54.7, 56.6, 58.2, 59.0, 60.7, 65.5, 69.0, 69.8, 70.2, 70.8,
72.0, 73.0, 75.1, 75.3, 76.4, 76.9, 81.0, 81.2, 96.4 (anomeric
carbon), 98.6 (anomeric carbon), 99.5 (anomeric carbon), 107.2
(anomeric carbon), 128.3, 128.4, 128.5, 128.6, 129.7, 129.9, 133.3,
133.5, 165.2, 165.7, 167.1, 168.4, 169.5, 169.7, 169.8, 169.9,
170.1.
[0289] ESIMS: m/z=1636.3(M+K.sup.+,
C.sub.65H.sub.68N.sub.19O.sub.28Cl requires 1637.1).
[0290] Compound 16d: The titled compound was prepared as was
described for the preparation of compound 16a with the following
modifications: Donor 11 (157 mg, 0.49 mmol), acceptor 1 (200 mg,
0.196 mmol), NIS (110 mg, 0.49 mmol), TfOH (cat.), 4 .ANG.
molecular sieves (400 mg). In an attempt to increase the beta
selectivity, acetonitrile (4 mL) was used as a solvent and the
reaction temperature was -35.degree. C. Under these conditions, 16d
was isolated as a mixture of anomers .alpha./.beta.; 1:11 (238 mg,
(95%). This mixture was further separated to afford 178 mg (71%) of
the pure .beta.-anomer.
[0291] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16d are summarized
in Table 7 hereinbelow.
[0292] .sup.13C NMR: d=20.4, 20.6, 20.7, 20.8, 23.8, 29.5, 29.7,
50.6, 50.7, 56.7, 57.9, 59.2, 60.43, 60.86, 62.1, 63.44, 64.45,
65.62, 68.6, 68.9, 69.2, 70.0, 70.7, 70.9, 71.2, 72, 73.2, 75.2,
75.3, 76.1, 77.3, 77.8, 78.5, 79.1, 81.3, 81.7, 97.9 (anomeric
carbon), 101.4 (anomeric carbon), 106.1 (anomeric carbon), 108.5
(anomeric carbon), 170.4, 171.5, 171.6, 171.8, 171.9, 172.5.
[0293] ESIMS: m/z=1319.3(M+K.sup.+,
C.sub.46H.sub.60N.sub.18O.sub.26 requires 1319.5).
[0294] These protected compounds (16a-d) were subjected to a
two-step deprotection, removal of all the ester and phthalimido
groups by treatment with methylamine (33% solution in EtOH) and
reduction of all the azido groups by Staudinger reaction, to
furnish the final products, compounds II-V, with high purity and
isolated yields, as described in greater detail below after the
preparation of compounds 16e-h.
[0295] Compound 16i: To a powdered, flame dried 4 .ANG. molecular
sieves (0.7 gram) was added CH.sub.2Cl.sub.2 (7 mL) containing
donor 8e (298 mg, 0.491 mmol) (prepared according to the published:
Ivan Chiu-Machado, Julio C Castro-Palomino, Madrazo-Alonso, Carlos
Lopetegui-Palacios and Vicente Veers-Bencomo J. Carbohydr. Chem.
1995, 14, 551-561.) and acceptor 2 (127.6 mg, 0.123 mmol). After
being stirred for 20 minutes at room temperature, the mixture was
cooled to -10.degree. C. and treated with BF.sub.3OEt.sub.2 (40
.mu.L). Propagation of the reaction was monitored by TLC (EtOAc
45%, Hexane 55%), which indicated completion after 45 minutes. The
reaction was quenched with triethylamine, diluted with EtOAc, and
filtered through celite. After thorough washing of the celite with
EtOAc, the washes were combined and extracted with saturated (aq.)
NaHCO.sub.3, brine, dried over MgSO.sub.4 and concentrated. The
crude was purified by flash chromatography (silica, EtOAc/Hexane)
to yield 16i compound (164 mg, 90% yield).
[0296] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16i are summarized
in Table 14 hereinbelow.
[0297] .sup.13C NMR: .delta.=20.5, 20.6, 20.7, 20.9, 31.3 (C-2),
33.6 (C-5"), 50.5 (C-6'"), 51.0 (C-6'), 60.75, 64.3 (C-5""), 65.6,
68.8, 69.2, 69.5, 70.0, 72.5, 73.7, 74.4, 75.3, 76.2, 76.3, 78.1,
79.4, 80.9, 81.1, 86.9 (C-1""), 96.4 (C-1'), 98.9 (C-1'"), 106.3
(C-1"), 128.4, 128.5, 128.6, 128.8, 129.1, 129.6, 129.7, 129.8,
128.9, 133.1, 133.4, 133.6, 165.1, 165.2, 166.1, 168.5, 169.5,
169.6, 169.8, 170.1, 170.1.
[0298] MALDI-TOFMS: m/z=1522.0 (M+K.sup.+,
C.sub.61H.sub.66N.sub.18O.sub.2- 5S requires 1521.9).
[0299] Compound 19a was prepared according to the procedure
published by Swayze et al. (Baogen Wu, Jun Yang, Yun He and Eric E.
Swayze, Organic Letters, 2002, 4(20), 3455-3458). Acceptor 1 (250
mg, 0.2445 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (9.8 mL)
under argon, and added with 4-methylbenzenethiol (33.1 mg, 0.269
mmol) and stirred at 0.degree. C. for 15 minutes. The mixture was
then treated with BF.sub.3OEt.sub.2 (0.093 mL, 0.733 mmol), stirred
at 0.degree. C. for 20 minutes and then allowed to warm to room
temperature. Propagation of the reaction was monitored by TLC
(EtOAc/Hexane; 1:1) and indicated termination after 45 minutes.
[0300] The reaction was quenched with triethylamine, diluted with
EtOAc, and extracted with saturated (aq.) NaHCO.sub.3, brine, dried
over MgSO.sub.4 and concentrated. The crude was purified by flash
chromatography (silica, EtOAc/Hexane) to yield the neamine moiety
(18, FIG. 13), 133.4 mg (99% yield) (full NMR and mass spectra data
are given in the reference above) and compound 19a (FIG. 13), 47 mg
(32% yield).
[0301] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 19a: .delta.=2.12
(s, 3H, OCOMe), 2.16 (s, 3H, OCOMe), 2.17 (s, 3H, OCOMe) 2.35 (s,
3H, MeSTol), 3.33 (dd, 1H, J.sub.1=4.5, J.sub.2=13.0 Hz, HII-6),
3.45 (bs, 1H, HII-2), 3.59 (dd, 1H, J.sub.1=7.0, J.sub.2=12.5 Hz,
HII-6'), 3.78 (dd, 1H, J.sub.1=2.5, J.sub.2=12.5 Hz, HI-5), 3.85
(dd, 1H, J.sub.1=2.5, J.sub.2=12.5 Hz, HI-5'), 4.07 (dd, 1H,
J.sub.1=J.sub.2=6.0 Hz, HII-5), 4.20 (m, 1H, HI-4), 4.53 (dd, 1H,
J.sub.1=J.sub.2=5.5 Hz, HI-3), 4.72 (bs, 1H, HII-4), 4.90 (s, 1H,
HII-1), 5.45 (bs, 1H, HII-3), 5.20 (dd, 1H, J.sub.1=J.sub.2=3.5 Hz,
HI-2'), 5.38 (d, 1H, J=3.0 Hz, HI-1), 7.16 (d, J=7.5 Hz, 2H, ortho
to the methyl of S-Tol), 7.41 (d, J=8.0 Hz, 2H, ortho to the sulfur
of S-Tol).
[0302] .sup.13C NMR: .delta.=20.7, 20.7, 20.8, 50.7 (CI-6), 56.6
(CII-2), 61.3 (CII-5), 65.6 (CII-4), 68.7, 73.2 (CI-2), 75.3
(CI-2), 76.5 (CI-3), 83.1 (CI-4), 88.6 (CI-1), 99.3 (CII-1), 128.3,
130.0, 133.1, 138.6, 168.5, 169.8, 170.2.
[0303] MALDI-TOFMS: m/z=633.1 (M+K.sup.+,
C.sub.24H.sub.30N.sub.6O.sub.10S requires 633.3).
[0304] Compound 19b (FIG. 13) was prepared by deacetylation of
compound 19a, using sodium methoxide in methanol, followed by
selective protection of the primary alcohol by TBDPS and treatment
with acetic anhydride in pyridine.
[0305] General procedure for the coupling of donors 5c, 5e, 8b, 19a
and acceptor 1: To a powdered, flame dried 4 .ANG. molecular sieves
(0.5 gram) was added CH.sub.2Cl.sub.2 (5 mL), followed by the
addition of acceptor 1 (150 mg, 0.147 mmol) and donor 5e (65 mg,
0.293 mmol). After being stirred for 10 minutes at room
temperature, the mixture was treated with NIS (66.0 mg, 0.286
mmol). After additional 5 minutes at room temperature, TfOH (cat)
was added. Propagation of the reaction was monitored by TLC (EtOAc
50%, Hexane 50%), which indicated completion after 10 minutes. The
reaction was diluted with EtOAc, and filtered through celite. After
thorough washing of the Celite with EtOAc, the washes were combined
and extracted with 10% Na.sub.2S.sub.2O.sub.3, saturated (aq.)
NaHCO.sub.3, brine, dried over MgSO.sub.4 and concentrated. The
crude was purified by flash chromatography to yield 16g (207 mg,
91% yield).
[0306] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16g are summarized
in Table 8 hereinbelow.
[0307] .sup.13C NMR: .delta.=20.3, 20.7, 20.8, 21.0, 31.3 (C-2),
50.3 (C-6'"), 51.2 and 51.4 (C6' and C-6""), 54.6, 56.7, 58.3,
59.0, 60.6, 65.4, 68.6 (C-5"), 68.9, 69.8, 70.3, 70.4, 70.7, 72.7,
73.7, 75.3, 75.5, 77.4, 81.1, 82.3, 96.5 (C-1'), 98.3 (C-1""), 99.6
(C-1'"), 107.4 (C-1), 122.8, 123.1, 128.3, 128.4, 128.6, 129.7,
129.8, 129.9, 130.4, 133.3, 133.5, 165.1, 165.7, 168.4, 169.6,
169.7, 169.8, 169.9, 170.3, 177.1.
[0308] ESIMS: m/z=1585.3 (M+K.sup.+, C.sub.63H.sub.66
N.sub.22O.sub.26 requires 1585.8).
[0309] Compound 16f: The titled compound was prepared as was
described for the preparation of compound 16g. The conditions used
were: Donor 5c (149 mg, 0.306 mmol), acceptor 1 (250 mg, 0.245
mmol), NIS (68 mg, 0.302 mmol), TfOH (cat.), acetonitrile anhydrous
(7 mL), 4 .ANG. molecular sieves (500 mg) to yield 16f (271 mg,
80%).
[0310] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16f are summarized
in Table 9 hereinbelow.
[0311] .sup.13C NMR: .delta.=20.7, 20.8, 20.9, 30.2 (C-2), 50.3 and
51.0 (C-6'"), C-6'" could not be distinguished), 53.6 (C-5""),
56.3, 58.1, 58.8, 60.9, 64.6, 65.4, 67.3 (C-5"), 68.6, 69.2, 69.4,
70.1, 72.6, 73.3, 74.2, 75.4, 75.4, 80.1, 80.3, 81.3, 96.3 (C-1'),
98.9 (C-1'"), 105.6 (C-1"), 107.3 (C-1'""), 124.8, 128.4, 128.5,
128.7. 129.1, 129.7, 129.7, 133.5, 133.6, 165.3, 165.5, 168.6,
169.4, 169.7, 169.8, 170.2, 170.3.
[0312] ESIMS: m/z=1426.4 (M+K.sup.+,
C.sub.54H.sub.61N.sub.21O.sub.24 requires 1426.2).
[0313] Compound 16e: The titled compound was prepared as described
for the preparation of compound 16g. The conditions used were:
Donor 8b (207 mg, 0.36 mmol), acceptor 1 (250 mg, 0.24 mmol), NIS
(81 mg, 0.36 mmol), TfOH (cat.), acetonitrile anhydrous (8 mL), 4
.ANG. molecular sieves (800 mg), -40.degree. C., to yield 16e (226
mg, 87%).
[0314] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16e are summarized
in Table 10 hereinbelow.
[0315] .sup.13C NMR: .delta.=20.5, 20.7, 20.8, 31.0 (C-2), 49.9
(C-6'"), 51.1 (C-6'), 56.2, 58.1, 58.9, 60.5, 60.8 (C-5"), 65.2,
67.7 (C-6""), 68.4, 68.5, 69.4, 70.4, 71.9, 72.3, 72.6, 73.6, 74.7,
74.9, 75.5, 76.6, 80.2, 83.4, 96.6 (C-1), 98.7 (C-1'"), 101.1
(C-1""), 108.2 (C-1"), 128.5, 128.7, 129.5, 129.7, 129.8, 133.1,
133.5, 164.9, 169.6, 169.7, 169.9, 170.2, 170.7.
[0316] ESIMS: m/z=1498.3 (M+K.sup.+,
C.sub.57H.sub.64N.sub.21O.sub.26 requires 1497.8).
[0317] Compound 16h: The titled compound was prepared as described
for the preparation of compound 16g. The conditions used were:
Donor 19a (135 mg, 0.212 mmol), acceptor 1 (150 mg, 0.147 mmol),
NIS (52 mg, 0.231 mmol), TfOH (cat.), acetonitrile anhydrous (5
mL), 4 .ANG. molecular sieves (600 mg), to yield 16h (101.7 mg,
67%).
[0318] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16h are summarized
in Table 11 hereinbelow.
[0319] .sup.13C NMR: .delta.=20.5, 20.6, 20.7, 20.8, 31.4 (C-2),
50.5 and 50.6 (C-6'"" and C-6'"), 51.0 (C-6'), 56.1, 56.4, 58.0,
59.0, 60.6, 64.4 (C-5""), 65.6, 65.7, 68.6 (C-5"), 68.7, 68.8,
69.3, 69.3, 69.9, 73.4, 73.9, 74.1, 74.2, 75.3, 75.4, 76.2, 76.3,
78.8, 79.9, 81.1, 96.3 (C-1'), 98.6 (C-1'""), 98.8 (C-1'"), 105.1
(C-1""), 106.8 (C-1"), 168.5, 168.6, 169.5, 169.6, 169.8, 169.8,
169.9, 170.0, 170.2, 170.8.
[0320] MALDI-TOFMS: m/z=1574.3 (M+K.sup.+,
C.sub.54H.sub.70N.sub.24O.sub.3- 0 requires 1574.3).
[0321] Compound 16j: The titled compound was prepared as was
described for the preparation of compound 16g. The conditions used
were: Donor 5a (150 mg, 0.372 mmol), acceptor 1 (250 mg, 0.245
mmol), NIS (104.6 mg, 0.465 mmol), TfOH (cat.). Acetonitrile (8
mL), 4 .ANG. molecular sieves (800 mg), -40.degree. C., to yield
16j (282 mg, 85%).
[0322] .sup.1H NMR (500 MHz, CDCl.sub.3) data of 16j are summarized
in Table 16 hereinbelow.
[0323] .sup.13C NMR (125 MHz, CDCl.sub.3): .delta.=20.4, 20.5,
20.6, 20.7, 20.8, 31.7 (C-2), 50.8 (C-6'"), 52.4 (C-6'), 57.3,
58.3, 59.0, 60.5, 61.2 (C-5"), 65.2, 68.1 (C-6""), 68.4, 68.5,
69.4, 71.1, 71.7, 72.3, 72.6, 73.8, 74.5, 75.1, 75.8, 76.6, 80.8,
83.4, 97.1 (C-1), 98.1 (C-1'"), 101.4 (C-1""), 110.2 (C-1"), 163.9,
164.2, 166.9, 169.1, 169.4, 169.6, 169.7, 169.9, 170.2, 170.7.
[0324] MALDI-TOFMS m/z 1392.4 (M+K.sup.+,
C.sub.49H.sub.64N.sub.18O.sub.28 requires 1392.1).
[0325] The preparation of compounds II-XIII according to the
present invention is now described.
[0326] Compound II was prepared as follows: Compound 16a (0.11
gram, 0.078 mmol) was dissolved in 33% solution of MeNH.sub.2 in
EtOH (40 mL) and the mixture was stirred at room temperature for 30
hours. The reagent and the solvent were removed by evaporation and
the residue was dissolved in THF (10 mL), NaOH 0.1M (2 mL) and
stirred at 60.degree. C. for 10 minutes after which PMe.sub.3 (1 M
solution in THF, 3.73 mL, 3.73 mmol) was added. Propagation of the
reaction was monitored by TLC
(CH.sub.2Cl.sub.2/MeOH/H.sub.2O/MeNH.sub.2, 33% solution in EtOH,
10:15:6:15, R.function.=0.33), which indicated completion after 3.5
hours. The reaction mixture was purified by flash chromatography on
a short column of silica and the column was washed as follows: THF,
EtOAc, MeOH/EtOAc (1:1), MeOH, and finally with MeNH.sub.2 (33%
solution in EtOH). The fractions containing the product were
evaporated under vacuum, re-dissolved in water and evaporated again
to afford the product as a free amine (48.7 mg, 81%). This product
was then dissolved in water, the pH was adjusted to 7.5 with 0.01 M
H.sub.2SO.sub.4 and the solution was then lyophilized to give the
sulfate salt of Compound II (88.5 mg) as a white foamy solid.
[0327] .sup.1H NMR (500 MHz, D.sub.2O, pH 4.5, sulfate salt):
.delta.=1.85 (ddd, 1H, J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H-2 axial),
2.38 (dt, 1H, J.sub.1=4.5 J.sub.2=12.5, H-2 equatorial), 3.07-4.53
(m, 26H), 4.78 (d, 1H, J=7.0 Hz, anomeric proton), 5.21 (d, 1H,
J=1.5 Hz, anomeric proton), 5.34 (d, 1H, J=3.0 Hz, anomeric
proton), 5.97 (d, 1H, J=4.0 Hz, anomeric proton).
[0328] .sup.13C NMR (125.8 MHz, D.sub.2O, pH 4.5, sulfate salt):
.delta.=29.8, 34.6, 42.2, 42.3, 49.9, 50.3, 51.2, 51.6, 52.6, 55.1,
62.3, 64.3, 69.2, 69.4, 69.5, 69.9, 71.3, 71.9, 72.8, 73.8, 74.1,
74.9, 77.1, 82.0, 86.8, 96.9 (anomeric carbon), 97.1 (anomeric
carbon), 102.0 (anomeric carbon), 112.1 (anomeric carbon).
[0329] ESIMS: m/z=781.2(M+Li.sup.+, C.sub.29H.sub.58N.sub.8O.sub.16
requires 781.2).
[0330] Compound III was prepared as was described for the
preparation of Compound II with the following quantities: the
product (.beta.-anomer) that was obtained by the partial
deprotection of compound 16b (122.4 mg, 0.124 mmol), THF (9 mL),
NaOH 0.1M (3 mL), PMe.sub.3 (1M solution in THF, 6.8 mL, 6.8 mmol),
gave the product as a free amine (93.1 mg, 96%). This product was
dissolved in water, the pH was adjusted to 7.5 with 0.01 M
H.sub.2SO.sub.4, and the solution was lyophilized to afford the
sulfate salt of Compound III (134.5 mg) as a white foamy solid.
[0331] .sup.1H NMR (500 MHz, D.sub.2O, pH 4.5, sulfate salt):
.delta.=1.77 (ddd, 1H, J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H-2 axial),
2.38 (bd, 1H, H-2 equatorial), 2.83-4.39 (m, 26H), 4.54 (d, 1H,
J=7.5 Hz, anomeric proton), 5.17 (s, 1H, anomeric proton), 5.31 (s,
1H, anomeric proton), 5.98 (s, 1H, anomeric proton).
[0332] .sup.13C NMR (125.8 MHz, D.sub.2O, pH 4.5, sulfate salt):
.delta.=20.8, 23.6, 30.0, 42.2, 42.3, 42.5, 50.2, 51.8, 52.7, 55.1,
55.2, 55.8, 69.3, 69.4, 69.6, 69.9, 71.1, 71.6, 72.0, 73.7, 74.3,
74.4, 75.0, 77.1, 81.3, 86.9, 96.4 (anomeric carbon), 97.0
(anomeric carbon), 105.1 (anomeric carbon), 112.5 (anomeric
carbon).
[0333] ESIMS: m/z=813.2 (M+K.sup.+, C.sub.29H.sub.58N.sub.8O.sub.16
requires 813.8).
[0334] Compound IV was prepared as was described for the
preparation of Compound II with the following quantities: 16c (180
mg, 0.113 mmol) was treated in the first step with 33% solution of
MeNH.sub.2 in EtOH (40 mL) for 40 hours; the product from this step
was dissolved in THF (10 mL), NaOH 0.1M (2 mL), and treated with
PMe.sub.3 (1M solution in THF, 4.05 mL, 4.05 mmol) to yield
Compound IV as a free amine (73.1 mg, 84%). The amine was dissolved
in water, the pH was adjusted to 7.5 with H.sub.2SO.sub.4 (0.01 M),
and the solution lyophilized to give the sulfate salt of Compound
IV (117 mg) as a white foamy solid.
[0335] .sup.1H NMR (500 MHz, D.sub.2O, pH 3.75, sulfate salt):
.delta.=1.94 (ddd, 1H, J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H-2 axial),
2.35 (broad dt, H-2 equatorial), 2.96 (t, 1H, J=10.0 Hz, H-2""),
2.97 (broad t, 1H, H-3'"), 3.05 (dd, 1H, J.sub.1=8.5 J.sub.2=13.0
Hz), 3.21-3.33 (m, 5H, H-4""), 3.37-3.47 (m, 5H, H-2', H-2'"),
H-5""), 3.61-3.70 (m, 4H, H-4'"), H-3""), 3.76-3.80 (m, 2H),
3.83-3.90 (m, 2H), 3.96 (t, 1H, J=10.0 Hz, H-3'), 4.14-4.20 (m, 2H,
H-5"), 4.23 (broad t, 1H), 4.31 (broad t, 1H, H-3"), 4.41 (broad t,
1H, H-2"), 4.79 (d, J=8.5 Hz , 1H, H-1'"), 5.19 (s, 1H, H-1'"),
5.32 (s, 1H, H-1"), 5.98 (d, J=4.0 Hz, 1H, H-1').
[0336] .sup.13C NMR: .delta.=26.4, 29.6, 42.2, 42.5, 50.3, 51.6,
52.6, 55.1, 57.4, 61.8, 68.9, 69.4, 69.7, 70.8, 71.4, 71.6, 72.3,
73.2, 73.6, 74.0, 74.6, 76.2, 76.6, 77.9, 81.7, 87.3, 96.70
(anomeric carbon), 96.73 (anomeric carbon), 101.0 (anomeric
carbon), 112.5 (anomeric carbon).
[0337] ESIMS: m/z=798.2 (M+Na.sup.+,
C.sub.29H.sub.57N.sub.7O.sub.17 requires 798.3).
[0338] Compound V was prepared as follows: A catalytic amount of
NaOMe (0.5M solution in MeOH) was added to a suspension of compound
16d (140 mg, 0.11 mmol) in dry MeOH (10 mL) at 0.degree. C., and
the propagation of the reaction was monitored by TLC (MeOH 10%,
dichloromethane 90%). After 3 hours the mixture was neutralized
with Dowex H.sup.+ and evaporated to dryness. The resulted crude
was then treated as described for the preparation of Compound II to
yield the free amine of Compound V (57.1 mg, 70%).
[0339] .sup.1H NMR (500 MHz, D.sub.2O, pH 4.5, sulfate salt):
.delta.=1.86 (ddd, 1H, J1=J2=J3=12.5 Hz, H-2 axial), 2.33(broad dt,
H-2 equatorial), 3.10 (dd, 1H, J1=7.0 J2=13.0 Hz), 3.20-4.43 (m,
17H), 3.84 (s, 1H, anomeric proton), 5.16 (s, 1H, anomeric proton),
5.30 (s, 1H, anomeric proton), 5.93 (d, J=3.0 Hz, 1H, anomeric
proton).
[0340] .sup.13C NMR (125.8 MHz, D.sub.2O, pH 4.5, sulfate salt):
.delta.=30.2, 42.2, 42.2, 50.3, 51.8, 52.6, 55.5, 62.0, 69.0, 69.5,
69.9, 71.2, 72.1, 74.3, 75.1, 76.6, 77.1, 83.0, 83.6, 86.7
(anomeric carbon), 96.9 (anomeric carbon), 96.9 (anomeric carbon),
112.0 (anomeric carbon).
[0341] ESIMS: m/z=769.2 (M+Na.sup.+,
C.sub.28H.sub.54N.sub.6O.sub.17 requires 769.3).
[0342] Compound VIII: The titled compound was prepared as was
described for the preparation of Compound II with the following
quantities: 16g (207 mg, 0.134 mmol), in 33% solution of MeNH.sub.2
in EtOH (40 mL), THF (4.5 mL), NaOH 0.1M (1 mL), H.sub.2O (1 mL),
PMe.sub.3 (1M solution in THF, (2.68 mL, 2.68 mmol), to yield of
the free amine (81.9 mg, 79%). The product was dissolved in water
and the pH was adjusted to 6.8 by H.sub.2SO.sub.4 (0.01 M), and
lyophilized to afford the sulfate salt of Compound VIII as a white
foamy solid.
[0343] NMR analyses were performed at 500 MHz, in D.sub.2O, and at
pH 3.45, adjusted by H.sub.2SO.sub.4).
[0344] .sup.1H NMR: .delta.=1.93 (ddd, 1H,
J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H-2 axial) 2.35 (broad dt, 1H, H-2
equatorial), 2.98 (t, J=9.0 Hz 1H), 3.05-3.09 (m, 2H), 3.17-3.89
(m, 17H), 3.97 (t, J=9.5 Hz 1H), 4.13-4.16 (m, 2H), 4.23-4.30 (m,
3H), 4.41 (bs, 1H), 4.56 (dd, 1H, J.sub.1=J.sub.27.5 Hz), 4.89 (d,
1H, J=8.5 Hz, H-1""), 5.20 (s, 1H, H-1'"), 5.35 (s, 1H, H-1"), 6.00
(d, 1H, J=4.0 Hz, H-1').
[0345] .sup.13C NMR: .delta.=29.8 (C-2), 42.2 (C-6'") and C-6""),
42.5 (C-6'), 50.2, 51.7, 52.6, 55.2, 57.4, 69.0, 69.4, 69.8, 70.5,
71.2, 72.3, 73.3, 73.6, 73.8, 74.1, 74.2, 74.5, 75.9, 76.6, 81.4,
87.1, 96.6, 96.7, 101.4, 112.4.
[0346] ESIMS: m/z=813.3 (M+K.sup.+, C.sub.29H.sub.58N.sub.8O.sub.16
requires 813.3).
[0347] Compound VI: The titled compound was prepared as was
described for the preparation of Compound II with the following
quantities: compound 16e (261.2 mg, 0.188 mmol), in 33% solution of
MeNH.sub.2 in EtOH (40 mL), THF (6 mL), NaOH 0.1M (3 mL), H.sub.2O
(2 mL), PMe.sub.3 (1M solution in THF, (10.43 mL, 10.43 mmol), to
yield the free amine (79.4 mg, 57%). The product was dissolved in
water and the pH was adjusted to 6.8 by H.sub.2SO.sub.4 (0.01 M),
and the solution lyophilized to afford the sulfate salt of Compound
VI as a white foamy solid.
[0348] NMR analyses were performed at 500 MHz, in D.sub.2O, and at
pH 4.49, adjusted by H.sub.2SO.sub.4).
[0349] .sup.1H NMR: .delta.=1.88 (ddd, 1H,
J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H-2 axial) 2.27 (broad dt, 1H, H-2
equatorial), 2.90-2.95 (m, 1H), 3.03 (dd, 1H, J.sub.1=8.5,
J.sub.2=13.5 Hz), 3.03 (dd, 1H, J.sub.1=3.5, J.sub.2=10.5 Hz),
2.20-2.29 (m, 4H), 3.32-3.37 (m, 2H), 3.44 (bs, 1H), 3.58 (t, 1H,
J=9.5 Hz), 3.66 (dd, 1H, J.sub.1=6.0, J.sub.2=11.0 Hz) 3.79-4.19
(m, 10H), 4.37 (d, 1H, J=4.0 Hz), 4.45 (dd, 1H, J.sub.1=4.5,
J.sub.2=7.5 Hz), 4.99 (s, 1H, H-1'"), 5.14 (s, 1H, H-1""), 5.27 (s,
1H, H-1"), 5.97 (d, 1H, J=4.0 Hz, H-1').
[0350] .sup.13C NMR: .delta.=27.5 (C-2), 42.3 (C-6'"), 42.4 (C-6'),
44.8 (C-5""), 50.3, 51.7, 52.6, 55.5, 68.7, 69.1 (C-5"), 69.4,
69.8, 71.2, 72.3, 73.2, 74.0, 74.1, 74.2, 75.8, 75.9, 76.9, 87.2,
96.4 (C-1'") and C-1'), 109.7 (C-1""), 112.4 (C-1").
[0351] ESIMS: m/z=784.4 (M+K.sup.+,
C.sub.28H.sub.55N.sub.7O.sub.16require- s 784.8).
[0352] Compound VII: The titled compound was prepared as was
described for the preparation of Compound II with the following
quantities: compound 16f (220 mg, 0.151 mmol), in 33% solution of
MeNH.sub.2 in EtOH (60 mL), THF (4.5 mL), NaOH 0.1M (1 mL),
H.sub.2O (1 mL), PMe.sub.3 (1M solution in THF, (2.64 mL, 2.64
mmol), to yield of the free amine (98.3 mg, 84%). The product was
dissolved in water and the pH was adjusted to 6.8 by
H.sub.2SO.sub.4 (0.01 M), and the solution was lyophilized to
afford the sulfate salt of Compound IV as a white foamy solid.
[0353] NMR analyses were performed at 500 MHz, in D.sub.2O, and at
pH 4.2, adjusted by H.sub.2SO.sub.4).
[0354] .sup.1H NMR: .delta.=1.92 (ddd, 1H,
J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H-2 axial) 2.32 (broad dt, 1H, H-2
equatorial), 2.98-3.05 (m, 2H), 3.20-3.47 (m, 10H), 3.56-3.86 (m,
10H), 3.92 (t, J=10.0 Hz 1H), 4.09-4.20 (m, 5H), 4.38 (d, 1H, J=3.5
Hz), 4.46 (d, 1H, J=8.0 Hz, H-1""), 5.16 (s, 1H, H-1'"), 5.29 (s,
1H, H-1 "), 5.96 (d, 1H, J=3.5 Hz, H-1').
[0355] .sup.13C NMR: .delta.=29.7 (C-2), 42.2 (C-6'"), 42.6 (C-6'),
50.2, 51.7, 52.6, 54.1, 55.1, 62.0 (C-6""), 69.2 (C-5"), 69.4,
69.8, 71.3, 72.0, 73.3, 73.7, 74.0, 74.2, 74.4, 75.2, 75.3, 76.9,
81.5, 87.0, 96.4 (C-1'"), 97.0 (C-1'), 104.8 (C-1""), 112.6
(C-1").
[0356] ESIMS m/z: 814.3 (M+K.sup.+,
C.sub.29H.sub.57N.sub.7O.sub.17require- s 814.3).
[0357] Compound X: The titled compound was prepared as was
described for the preparation of Compound II with the following
quantities: compound 16h (101.7 mg, 0.066 mmol), in 33% solution of
MeNH.sub.2 in EtOH (40 mL), THF (4.5 mL), NaOH 0.1M (0.5 mL),
H.sub.2O (0.5 mL), PMe.sub.3 (1M solution in THF, (1.6 mL, 1.6
mmol), to yield of the free amine (48.2 mg, 80%). The product was
dissolved in water and the pH was adjusted to 6.8 by
H.sub.2SO.sub.4 (0.01 M), and the solution was lyophilized to
afford the sulfate salt of Compound X as a white foamy solid.
[0358] NMR analyses were performed at 500 MHz, in D.sub.2O, and at
pH 3.45, adjusted by H.sub.2SO.sub.4).
[0359] .sup.1H NMR: .delta.=1.93 (ddd, 1H,
J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H-2 axial) 2.34 (broad dt, 1H, H-2
equatorial), 3.06-4.39 (m, 33H), 5.00 (d, 1H, J=2.5 Hz, H-1""),
5.17 (s, 2H, C-1'", C-1'""), 5.31 (d, 1H, J=2.5 Hz, H-1"), 5.98 (d,
1H, J=3.5 Hz, H-1').
[0360] .sup.13C NMR: .delta.=29.6 (C-2), 42.2 and 42.3 (C-6',
C-6'", C6'"" could not be distinguished), 50.6, 51.6, 52.6, 52.7,
55.4, 63.3 (C-5""), 69.0, 69.1, 69.4, 69.7, 70.5 (C-5"), 71.3,
72.0, 72.1, 72.9, 74.0, 74.7, 74.9, 76.5, 77.7, 79.0, 82.0, 80.1,
84.2, 87.0, 96.4 (C-1'), 97.0 and 97.5 (C-1'"), C-1'"" could not be
distinguished) 109.0 (C-1""), 112.4 (C-1").
[0361] MALDI-TOFMS: m/z=945.5 (M+K.sup.+,
C.sub.34H.sub.66N.sub.8O.sub.20r- equires 945.9).
[0362] Compound XI: Compound 16i (0.164 gram, 0.11 mmol) was
dissolved in 33% solution of MeNH.sub.2 in EtOH (40 mL) and the
mixture was stirred at room temperature for 24 hours. The reagent
and the solvent were removed by evaporation and the residue was
dissolved in THF (4 mL), NaOH 0.1M (1 mL) and stirred at room
temperature for 10 minutes after which PMe.sub.3 (1M solution in
THF, 1.66 mL, 1.66 mmol) was added. Propagation of the reaction was
monitored by TLC (CH.sub.2Cl.sub.2/MeOH/H.sub.2O/MeNH.sub.2, 33%
solution in EtOH; 10:15:6:15), which indicated completion after 4.5
hours. The reaction mixture was purified by flash chromatography on
a short column of silica and the column was washed as follows: THF,
EtOAc, MeOH/EtOAc (1:1), MeOH, and finally the product was eluted
with MeNH.sub.2 (33% solution in EtOH). The fractions containing
the product were evaporated under vacuum, re-dissolved in water and
evaporated again to afford the free amine compound (61.2 mg, 73%).
The product was then dissolved in water, and the pH was adjusted to
6.8 by H.sub.2SO.sub.4 (0.01 M), and the product was lyophilized to
give the sulfate salt of Compound XI as a white foamy solid.
[0363] .sup.1H NMR (500 MHz, D.sub.2O, pH=3.04) data of XI are
summarized in Table 15 hereinbelow.
[0364] .sup.13C NMR: .delta.=29.6 (C-2), 35.2 (C-5""), 42.2 (C-6'),
42.3 (C-6'"), 50.3, 51.6, 52.6, 55.3, 63.5 (C-5"), 69.0, 69.4,
69.7, 71.3, 72.1, 72.7, 73.0, 74.1, 75.0, 76.2, 76.4, 79.8, 82.1,
87.1, 87.2, 89.4 (C-1""), 96.2 (C-1'"), 97.1 (C-1'), 112.5
(C-1").
[0365] MALDI-TOFMS: m/z=801.1 (M+K.sup.+,
C.sub.28H.sub.54N.sub.6O.sub.16S requires 801.3).
[0366] Compound XII: The titled compound was prepared as was
described for the preparation of Compound XI with the following
quantities: 16j (282 mg, 0.208 mmol), in 33% solution of MeNH.sub.2
in EtOH (40 mL), THF (4.5 mL), NaOH 0.1M (1 mL), H.sub.2O (1 mL),
PMe.sub.3 (1M solution in THF, (1.87 mL, 1.87 mmol), to yield of
the free amine: 111.5 mg, (69%). The product was dissolved in water
and the pH was adjusted to 6.8 by H.sub.2SO.sub.4 (0.01 M), and
lyophilized to afford the sulfate salt of XII as a white foamy
solid.
[0367] .sup.1H NMR (500 MHz, D.sub.2O, pH 4.2, adjusted by
H.sub.2SO.sub.4 0.01M) data of Compound XII are summarized in the
attached Table 9.
[0368] .sup.13C NMR (125 MHz, D.sub.2O): .delta.=29.6 (C-2), 42.2
(C-6'"), 42.7 (C-6'), 50.1, 51.7, 52.6, 55.0, 62.3 (C-5"), 69.2
(C-6""), 69.3, 69.4, 69.6, 71.3, 71.5, 72.0, 73.5, 74.1, 74.4,
74.8, 75.0, 76.7, 77.4, 77.6, 81.4, 87.0, 96.4 (C-1'), 97.0
(C-1'"), 104.9 (C-1""), 112.6 (C-1"").
[0369] MALDI-TOFMS: m/z=815.2 (M+K.sup.+,
C.sub.29H.sub.56N.sub.6O.sub.16r- equires 815.7).
[0370] Compounds IX and XIII: Lewis acid (BF.sub.3.Et.sub.2O)
promoted coupling of the thiol acceptor 2 with the
trichloroacetimidate donor 8e furnished the corresponding protected
.beta.-thioglycoside, which after two-steps deprotection, provided
the designed thioglycoside 16i in 73% isolated yield. When the
chromatographically pure thioacetate 2a was directly subjected to
the same two-steps deprotection procedure, treatment with
methylamine followed by Staudinger reaction, a mixture (a ratio of
about 1:3) of Compound IX and the corresponding disulfide dimer
Compound XIII were obtained in an overall yield of 88%. This
mixture was purified on a Biogel P-2 column to yield the
sufficiently pure Compounds IX and XIII for biological tests.
[0371] Compound 2a (250 mg, 0.231 mmol) was dissolved in 33%
solution of MeNH.sub.2 in EtOH (40 mL) and the mixture was stirred
at room temperature for 24 hours. The reagent and the solvent were
removed by evaporation and the residue was dissolved in THF (4 mL),
NaOH 0.1M (1 mL) and stirred at 0.degree. C. After 10 minutes,
PMe.sub.3 (1M solution in THF, 1.66 mL, 1.66 mmol) was added.
Propagation of the reaction was monitored by TLC
(CH.sub.2Cl.sub.2/MeOH/H.sub.2O: MeNH.sub.2 (33% solution in EtOH);
10:15:6:15), which indicated the full consumption of the starting
material after 2.5 hours. At this point two products appeared on
the TLC. The polar dimmer product appeared with the
R.sub..function. value of 0.16 and the less polar monomer appeared
with the R.sub..function. value of 0.54. The reaction mixture was
purified by flash chromatography on a short column of silica gel
and the column was washed as follows: THF, EtOAc, MeOH/EtOAc (1:1),
MeOH, and finally the product was eluted with MeNH.sub.2 (33%
solution in EtOH). The fractions containing the mixture of monomer
and dimmer products were evaporated under vacuum, re-dissolved in
water and evaporated again to afford the mixture of free amines
(128.3 mg, 88%). The mixture was then dissolved in water, the pH
was adjusted to 6.8 by H.sub.2SO.sub.4 (0.01 M), and lyophilized to
give the sulfate salts of the amines as a white foamy solid. The
monomer and dimer were then separated using size exclusion
chromatography (P-2 gel was packed in a column 47 cm length, 1.2 cm
diameter column). The pure dimer Compound XIII and monomer Compound
IX were then lyophilized.
[0372] Following are the data obtained in NMR and MS measurements
of the pure thiol, Compound IX.
[0373] .sup.1H NMR (500 MHz, D.sub.2O pD=6.8): .delta.=1.45 (ddd,
1H, J.sub.1=J.sub.2=J.sub.3=12.5 Hz, H2-ax), 2.08 (bd, 1H, J=12.0
Hz, H2-eq), 2.54 (dd, 1H, J.sub.1=3.0, J.sub.2=13.0 Hz, H5"), 2.66
(dd, 1H, J.sub.1=9.0, J.sub.2=13.0 Hz, H5"), 2.90-3.13 (m, 5H,),
3.20-3.33 (m, 4H), 3.38 (bs, 1H), 3.47 (bt, 1H, J=9.0 Hz), 3.58
(bt, 1H, J=9.0 Hz), 3.64-3.75 (m, 3H), 3.87 (m, 1H), 4.06 (bs, 1H),
4.17 (bs, 1H), 4.27-4.37 (m, 3H), 5.11 (bs, 1H, H1'), 5.23 (bs, 1H,
H1'"), 5.78 (bd, 1H, J=3.5 Hz, H1").
[0374] .sup.13C NMR (125 MHz, D.sub.2O): .delta.=40.5, 40.7, 49.3,
50.6, 51.3, 54.3, 64.6, 68.0, 68.3, 69.2, 70.5, 71.2, 73.6, 73.7,
77.9, 80.1, 85.8, 96.6, 96.8, 110.6.
[0375] MALDI-TOF MS m/z 669.2(M+K.sup.+,
C.sub.28H.sub.54N.sub.6O.sub.16S requires 669.5).
[0376] Following are the data obtained in NMR and MS measurements
of the pure thiol, Compound XIII.
[0377] .sup.1H NMR (500 MHz, D.sub.2O pD=6.8): .delta.=1.82 (m, 2H,
H2axial), 2.26 (bd, J=12.0 Hz, 2H, H.sub.2 equatorial), 2.80 (dd,
1H, J.sub.1=8.5, J.sub.2=13.0 Hz, H5"), 3.08 (dd, 1H, J.sub.1=8.0,
J.sub.2=13.0 Hz, H5"), 3.13-3.36 (m, 12H), 3.60 (bt, 2H, J=10.0
Hz), 3.68 (bs, 2H), 3.83-3.92 (m, 2H), 3.99 (bt, 2H, J=9.5 Hz),
4.10 (bs, 2H), 4.19 (bs, 2H), 4.36-4.40 (m, 6H), 5.18 (bs, 2H,
H1'), 5.33 (bs, 2H, H1'"), 5.93 (bd, 2H, J=3.0 Hz, H1').
[0378] .sup.13C NMR (125 MHz, D.sub.2O ): .delta.=40.3, 48.5, 49.8,
50.7, 53.6, 67.2, 67.6, 68.4, 69.2, 70.3, 70.9, 72.4, 73.2, 75.5,
78.4, 78.9, 85.3, 94.4(C-1'), 95.3 (C-1'"), 110.1 (C-1").
[0379] MALDI-TOF MS m/z 1298.5 (M+K.sup.+,
C.sub.28H.sub.54N.sub.6O.sub.16- S requires 1298.2).
NMR Methods and Results
[0380] .sup.1H NMR, .sup.13C NMR, DEPT, COSY, 2D TOCSY, 1D TOCSY,
HMQC, HMBC spectra were recorded on a Bruker Advance 500
spectrometer, and chemical shifts reported (in ppm) are relative to
internal Me.sub.4Si (.delta.=0.0) with CDCl.sub.3 as the solvent,
and to HOD (.delta.=4.63) with D.sub.2O as the solvent. Mass
spectrometric analysis was performed using a Bruker Daltonix Apex 3
mass spectrometer using electron spray ionization (ESI), using a
TSQ-70B mass spectrometer (Finnigan-MAT) or using matrix assisted
laser desorption ionization with a time of flight mass detector
(MALDI-TOF by Micromass) using .alpha.-cyano-4-hydrocinnami- c acid
as a matrix. Reactions were monitored by TLC on Silica Gel 60
F.sub.254 (0.25 mm, Merck), and spots were visualized by charring
with a yellow solution containing
(NH.sub.4)Mo.sub.7O.sub.244H.sub.2O (120 grams) and
(NH.sub.4).sub.2Ce(NO.sub.3).sub.6 (5 grams) in 10% H.sub.2SO.sub.4
(800 mL). Flash column chromatography was performed on Silica Gel
60 (70-230 mesh). All reactions were carried out under an argon
atmosphere with anhydrous solvents, unless otherwise noted. All
chemicals unless otherwise stated, were obtained from commercial
sources.
[0381] Chemical structures corresponding to the previously
described compounds, followed by the NMR results for those
structures, are given below.
1TABLE 1 9 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 6.09 3.14 5.45 4.92 4.42 3.25-3.32 3.25-3.32 d dd t
t ddd m m J = 3.5 J = 3.5, J = 9.5 J = 10.0 J = 3.0, 10.5 5.0, 8.5
C 5.36 4.77 4.36 4.23 3.71 3.86 d t t dd dd m J = 4.5 J = 4.5 J =
4.7 J = 4.0, J = 4.5, 6.0 11.5 D 4.79 3.25-3.32 5.00 4.67 3.49
3.25-3.32 3.54 d m t s ddd. m dd J = 2.0 J = 3.0 J = 2.0, J = 8.5,
4.5, 6.5 13.0 H1 H2eq H2ax H3 H4 H5 H6 B 4.92 1.58 2.34 3.49 3.67
3.86 3.39 t ddd dt ddd t m ddd J = 1.0 J.sub.1 = J.sub.2 = J.sub.3
J = 4.0, J.sub.1 = J.sub.2 = J = 9.0 J = 4.0, = 12.5 13.5 J.sub.3 =
5.0 10.0, 12.5 .sup.aValues of chemical shifts are in ppm and
values of coupling constants. are in Hz. The additional peaks in
the spectrum were identified as follow: .delta. 0.06 (s, 3H, Me),
0.08 (s, 3H, Me), 1.07 (s, 9H, t-Bu), 2.01 (s, 3H, acetate), 2.03
(s, 3H, acetate), 2.06 (s, 3H, acetate), 2.12 (s, 3H, acetate),
2.14 (s, 3H, acetate), 2.16 (s, 3H, acetate).
[0382]
2TABLE 2 10 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the neomycin acceptor 1..sup.a Ring H1 H2 H3
H4 H5 H5' H6 H6' A 6.02 3.21 5.61 5.08-5.15 4.60 3.47 3.40-3.42 d
dd dd m ddd dd m J = 4.0 J = 3.5, J = 9.5, J = 3.0, J = 2.5, 10.5
10.5 5.5, 10.0 13.5 C 5.46 4.93 4.51 4.19-4.24 4.02 3.83 d dd t m
dd dd J = 2.5 J = 3.0, J = 6.5 J = 4.0, J = 6.0, 5.5 12.5 12.5 D
4.99 3.40-3.42 5.08-5.15 4.80 4.19-4.24 3.70 3.40-3.42 d m m s m dd
m J = 1.5 J = 8.5, 13.0 H1 H2eq H2ax H3 H4 H5 H6 B 3.57 2.51 1.74
3.65 3.82 4.06 5.08-5.15 ddd dt ddd ddd t t m J = 4.5, J = 4.5,
J.sub.1 = J.sub.2 = J.sub.3 J = 4.5, J = 9.0 J = 9.0 10.5, 14.5
13.0 = 12.5 10.0, 14.0 .sup.aValues of chemical shifts are in ppm
and values of coupling constants are in Hz. The additional peaks in
the spectrum were identified as follow: .delta. 1.85 (broad s, 1H,
OH), 2.17 (s, 3H, acetate), 2.20 (s, 3H, acetate), 2.22 (s, 3H,
acetate), 2.25 (s, 3H, acetate), 2.27 (s, 3H, acetate), 2.28 (s,
3H, acetate).
[0383]
3TABLE 3 11 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the protected pseudo-pentasaccharide
16a..sup.a Ring H1 H2 H3 H4 H5 H5' H6 H6' A 6.12 3.24-3.30 5.42
5.02 4.46-4.52 3.34-3.42 3.63-3.67 d m t t m m m J = 3.5 J = 10 J =
11.5 C 5.16 4.70 4.32 4.08 3.71 3.86 d d dd m dd bd J = 4.5 J = 5 J
= 6.5, J = 4.5, 11.5 11.5 D 4.46-4.52 3.12 4.96 4.64 3.63-3.67
3.34-3.42 3.52-3.56 m bs s s m m m E 4.86 5.28 4.46-4.52 4.91 4.96
4.46-4.52 4.40 d dd m bdd dd m dd J = 8.0 J = 3.0, J.sub.1 = 2.0, J
= 4.5, 7.5 12.5 12.5 H1 H2eq H2ax H3 H4 H5 H6 B 3.34-3.42 2.31 1.55
3.24-3.30 4.73 3.75 3.69 m m ddd m t t t J.sub.1 = J.sub.2 =
J.sub.3 J = 11.0 J = 9.5 J = 9.0 = 12.5 aValues of chemical shifts
are in ppm and values of coupling constants are in Hz. The
additional peaks in the spectrum were identified as follow: .delta.
2.04 (s, 3H, acetate), 2.05 (s, 3H, acetate), 2.06 (s, 3H,
acetate), 2.08 (s, 3H, acetate), 2.14 (s, 3H, acetate), 2.15 (s,
3H, acetate) 4.23 (s, 2H, chloroacetate), 7.57 (t, 2H, meta benzoyl
protons), 7.65(t, 1H, para benzoyl proton), 8.06 (d, 2H, ortho
benzoyl protons).
[0384]
4TABLE 4 12 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 5.77 3.22-3.29 3.77 3.22-3.29 3.98 3.49 3.40 d m t
m ddd dd dd J = 4.0 J = 9.0 J = 3.0, J = 2.5, J = 4.5, 6.0, 9.5 9.5
13.0 C 5.18 4.04 4.24 4.13-4.14 3.43-3.49 3.43-3.49 d dd dd m m m J
= 4 J.sub.1 = J.sub.2 = J.sub.1 = J.sub.2 = 4.0 4.5 D 4.98 3.68
3.87 3.21-3.25 3.90-3.92 3.54-3.59 3.21-3.29 d bs s m m m m J = 1.0
E 4.21 3.24-3.3 3.46-3.49 3.24-3.3 3.36-3.39 3.36-3.39 3.36-3.39 d
m m m m m m J = 8.5 H1 H2eq H2ax H3 H4 H5 H6 B 3.24-3.36 2.13 1.55
3.24-3.36 3.24-3.36 3.54-3.57 3.48 m dt ddd m m m t J = 4.5,
J.sub.1 = J.sub.2 = J.sub.3 J = 8.5 13.0 = 12.5 .sup.aValues of
chemical shifts are in ppm and values of coupling constants are in
Hz.
[0385]
5TABLE 5 13 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 5.73 3.09-3.13 3.77 3.26-3.3 3.98 3.47 3.39 d m t m
ddd bd dd J = 4.0 J = 8.5 J = 2.0, J = 5.5, 5.5, 8.5 14.5 C 5.36
4.77 4.36 4.23 3.71 3.86 d t t dd dd m J = 4.5 J = 4.5 J = 4.7 J =
4.0, J = 4.5, 6.0 11.5 D 4.99 3.66 3.86 3.27 3.41-3.52 3.41-3.52
3.41-3.52 d bs bs bs m m m J = 1.0 E 5.86 4.85 4.85 3.33-3.39
3.42-3.46 3.33-3.39 3.23 d dd dd m m m dd J = 5.5 J.sub.1 = J.sub.2
= J = 5.2, 5.3 J = 3.0, 4.5 17.0 H1 H2eq H2ax H3 H4 H5 H6 B
3.26-3.36 2.12 1.31 3.26-3.36 3.51-3.61 3.51-3.61 3.41 m dt ddd m m
m. t J = 4.0, J.sub.1 = J.sub.2 = J.sub.3 J = 9.0 13.0 = 12.5
.sup.aValues of chemical shifts are in ppm and values of coupling
constants are in Hz. The additional peaks in the spectrum were
identified as follow: .delta. 7.2-7.32 (m, 3H, benzoyl),
7.53-7.55(m, 2H, benzoyl).
[0386]
6TABLE 6 14 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the protected pseudo-pentasaccharide
16c..sup.a Ring H1 H2 H3 H4 H5 H5' H6 H6' A 6.04 3.38-3.42 5.51
5.08 4.50-4.59 3.42-3.53 3.42-3.53 d m dd t m m m J = 4.0 J = 9.5,
10.5 J = 9.5 C 5.23 4.50-4.59 4.13-4.16 4.28 3.73 4.13-4.16 d m m
ddd dd m J = 3.0 J = 3.0, J = 4.5, 5.0, 6.5 12.5 D 4.68 3.25 5.08
4.70 4.03 3.42-3.53 3.38-3.42 d bs t bs ddd m m J = 2.5 J = 3.0 J =
1.5, 5.0, 6.0 E 5.62 4.64 6.62 5.62 4.13-4.16 4.40 4.50-4.59 d dd
dd dd m dd m J = 8.5 J = 8.5, J = 9.0, 10.5 J = 9.5, J = 3.0, 11.0
13.0 12.5 H1 H2eq H2ax H3 H4 H5 H6 B 3.38-3.42 2.12 1.75 3.42-3.53
4.92 3.89 3.82 m dt ddd m t t t J = 4.5, J.sub.1= J.sub.2 = J.sub.3
J = 10.0 J = 8.5 J = 8.5 13.0 = 12.5 .sup.aValues of chemical
shifts are in ppm and values of coupling constants are in Hz. The
additional peaks in the spectrum were identified as follow: .delta.
1.98 (s, 3H, acetate), 2.09 (s, 3H, acetate), 2.10 (s, 3H,
acetate), 2.16 (s, 3H, acetate), 2.165 (s, 3H, acetate), 2.19 (s,
3H, acetate) 4.17 (s, 2H, chloroacetate), 7.24-7.92(m, 14H,
aromatic).
[0387]
7TABLE 7 15 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the protected pseudo-pentasaccharide
16d..sup.a Ring H1 H2 H3 H4 H5 H5' H6 H6' A 6.06 3.21-3.31 3.71
4.89-4.95 3.40 3.27-3.34 3.27-3.34 d m dd m ddd m m J = 4.0 J =
9.5, J = 3.5, 5.0, 11.0 10.0 C 5.33 4.79 4.35-4.37 4.28-4.31 3.45
3.74 d dd m m dd dd J = 4.5 J.sub.1 = J.sub.2 = J = 3.5, 10.0 J =
2.0, 4.5 10.0 D 4.83 3.27-3.34 4.66 4.97 4.05 3.59 3.74 d m bs dd
ddd dd dd J = 4.0 J.sub.1 = J.sub.2 = 4.5 J = 2.0, 5.0, J = 8.5, J
= 4.0, 6.5 13.0 12.0 E 5.95 4.92 4.92 4.12-4.20 4.12-4.20 4.35-4.37
d dd dd m m m J = 4.5 J = 3.5, 5.5 J = 3.5, 5.5 H1 H2eq H2ax H3 H4
H5 H6 B 3.40 2.33 1.58 3.50 4.93 3.88 3.66 ddd dt ddd ddd t t t J =
4.5, J = 4.0, J.sub.1 = J.sub.2 = J.sub.3 J = 4.0, J = 12.0 J = 9.5
J = 9.0 10.5, 12.0 13.5 = 12.5 10.0, 12.5 .sup.aValues of chemical
shifts are in ppm and values of coupling constants are in Hz. The
additional peaks in the spectrum were identified as follow: .delta.
2.00 (s, 3H, acetate), 2.05 (s, 6H, 2 acetates), 2.06 (s, 3H,
acetate), 2.07 (s, 3H, acetate), 2.10 (s, 3H, acetate), 2.11 (s,
3H, acetate), 2.13 (s, 3H, acetate), 2.16 (s, 3H, acetate).
[0388]
8TABLE 8 16 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 6.15 3.44-3.62 5.52 5.18 4.60-4.64 3.44-3.62
3.44-3.62 d m t t m m m J = 3.5 J = 10.5 J = 10.0 C 5.24 4.47 4.16
4.33 3.73 4.22 d dd t bdd dd dd J = 2.5 J = 2.5, J = 4.5 J = 3.5, J
= 2.5, 4.5 11.0 11.0 D 4.99 3.23 3.86 4.66-4.70 3.98-4.03 3.41-3.52
3.44-3.62 d bs bs m m m m J = 1.0 E 4.60-4.64 4.66-4.70 6.26 5.57
4.10 3.27 3.44-3.62 m m t t ddd dd m J = 10.5 J = 9.5 J = 2.5, J =
5.5, 7.5, 13.5 13.0 H1 H2eq H2ax H3 H4 H5 H6 B 3.37 2.41 1.81
3.44-3.62 3.98-4.03 3.82 4.96 ddd dt ddd m m t t J = 4.5, J = 4.5,
J.sub.1 = J.sub.2 = J.sub.3 J = 9.0 J = 10.0 10.5, 13.5 13.0 = 12.5
.sup.aValues of chemical shifts are in ppm and values of coupling
constants are in Hz. The additional peaks in the spectrum were
identified as follow: .delta. 1.94 (s, 3H, acetate), 2.08 (s, 3H,
acetate), 2.10 (s, 3H, acetate), 2.14 (s, 3H, acetate), 2.17 (s,
3H, acetate), 2.18 (s, 3H, acetate), 7.29-8.10 (14H, aromatic
protons).
[0389]
9TABLE 9 17 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 6.14 328-3.35 5.47 5.09 3.98 3.41-3.52 3.41-3.52 d
m t t ddd m m J = 3.5 J = 9.0 J = 9.5 J = 3.0, 3.0, 10.0 C 5.17
4.71 4.27 4.08 4.25 3.55-3.65 s d dd m dd m J = 5.0 J = 4.5, J =
1.0, 7.0 11.0 D 4.36 4.92 4.60 3.41-3.52 3.13 3.28-3.35 3.41-3.52 d
t bs m bt m m J = 1.5 J = 2.0 E 4.66 5.45 5.59 3.99 3.55-3.65 4.45
4.40 d t t t m dd dd J = 8.0 J = 10.0 J = 10.0 J = 10.0 J = 1.5, J
= 5.0, 11.5 12.0 H1 H2eq H2ax H3 H4 H5 H6 B 3.28-3.35 2.34 1.65
3.41-3.52 3.93 377 3.86 m dt ddd m t t t J = 4.0, J.sub.1 = J.sub.2
= J.sub.3 J = 9.5 J = 9.0 J = 9.5 13.0 = 12.5 .sup.aValues of
chemical shifts are in ppm and values of coupling constants are in
Hz. The additional peaks in the spectrum were identified as follow:
.delta. 1.98 (s, 3H, acetate), 2.06 (s, 3H, acetate), 2.07 (s, 3H,
acetate), 2.10 (s, 3H, acetate), 2.12 (s, 3H, acetate), 2.14 (s,
3H, acetate), 2.19 (s, 3H, acetate), 7.60 (t, J = 7.5 Hz, 2H, meta
benzoyl protons), 7.69 (t, J = 8.0 Hz, 2H, meta benzoyl protons),
7.77 (t, J = 7.5 Hz, 1H, para benzoyl proton), 7.84 (t, # J = 7.5
Hz, 1H, para benzoyl proton), 8.15 (d, J = 8.5 Hz, 1H, ortho
benzoyl proton). 8.30 (d, J = 7.5 Hz, 1H, ortho benzoyl
proton).
[0390]
10TABLE 10 18 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 5.73 3.09-3.13 3.77 3.26-3.3 3.98 3.47 3.39 d m t m
ddd bd dd J = 4.0 J = 8.5 J = 2.0, J = 5.5, 5.5, 8.5 14.5 C 5.36
4.77 4.36 4.23 3.71 3.86 d t t dd dd m J = 4.5 J = 4.5 J = 4.7 J =
4.0, J = 4.5, 6.0 11.5 D 4.99 3.66 3.86 3.27 3.41-3.52 3.41-3.52
3.41-3.52 d bs bs bs m m m J = 1.0 E 5.86 4.85 4.85 3.33-3.39
3.42-3.46 3.33-3.39 3.23 d dd dd m m m dd J = 5.5 J.sub.1 = J.sub.2
= J = 5.2, 5.3 J = 3.0, 4.5 17.0 H1 H2eq H2ax H3 H4 H5 H6 B
3.26-3.36 2.12 1.31 3.26-3.36 3.51-3.61 3.51-3.61 3.41 m dt ddd m m
m t J = 4.0, J.sub.1 = J.sub.2 = J.sub.3 J = 9.0 13.0 = 12.5
.sup.aValues of chemical shifts are in ppm and values of coupling
constants are in Hz. The additional peaks in the spectrum were
identified as follow: .delta. 1.99 (s, 3H, acetate), 2.02 (s, 3H,
acetate), 2.03 (s, 3H, acetate), 2.04 (s, 3H, acetate), 2.12 (s,
3H, acetate), 2.13 (s, 3H, acetate), 7.29-8.10 (10H, meta aromatic
benzoyl protons).
[0391]
11TABLE 11 16h 19 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts
and coupling constants for the titled structure..sup.a Ring H1 H2
H3 H4 H5 H5' H6 H6' A 5.91 3.24-3.35 5.49 4.93-5.04 4.43-4.46
3.24-3.35 3.24-3.35 d m dd m m m m J = 3.5 J.sub.1 = J.sub.2 = 10.5
C 5.34 4.93-5.04 4.07-4.24 4.07-4.24 3.59-3.66 4.07-4.24 d m m m m
m J = 1.0 D 4.89 3.24-3.35 4.93-5.04 4.71-4.72 4.07-4.24 3.48 3.19
d m m m m dd dd J = 1.5 J = 5.0, J.sub.1 = 4.0 13.0 J.sub.2 = 13.0
E 5.17 5.23 4.61 4.29-4.32 4.43-4.46 4.07-4.24 s d dd m m m J = 4.5
J = 4.5, 7.5 F 4.93-5.04 3.24-3.35 4.93-5.04 4.71-4.72 4.07-4.24
3.59-3.66 3.24-3.35 m m m m m m m H1 H2eq H2ax H3 H4 H5 H6 B 3.59
2.39 1.64 3.48 3.71 3.91 4.93-5.04 m dt ddd m t t m J = 4.5, J =
J.sub.2 = J.sub.3 = J = 9.0 J = 9.0 13.0 13.0 .sup.aValues of
chemical shifts are in ppm and values of coupling constants are in
Hz. The additional peaks in the spectrum were identified as follow:
.delta. 2.07 (s, 3H, acetate), 2.09 (s, 3H, acetate), 2.11 (s, 3H,
acetates), 2.12 (s, 3H, acetate), 2.14 (s, 3H, acetate), 2.16 (s,
6H, acetate), 2.17 (s, 6H, acetates), 2.18 (s, 6H, acetate), 2.19
(s, 6H, acetate).
[0392]
12TABLE 12 20 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 5.93 3.26-3.45 5.48 5.02-5.05 4.44 3.26-3.45
3.26-3.45 d m t m ddd m m J = 3.5 J = 10.0 J = 3.5, 6.5, 10.0 C
5.28 4.69-4.71 5.48 4.30 4.05-4.08 4.05-4.08 d m t dd m m J = 4.0 J
= 6.0 J = 4.0, 8.0 D 4.81 3.26-3.45 4.69-4.71 5.02-5.05 3.64
3.26-3.45 3.26-3.45 s m m m dd m m J = 7.5, 13.0 H1 H2ax H2eq H3 H4
H5 H6 B 3.26-3.45 1.59 2.39 3.49 3.70 3.88 3.69 m ddd m ddd t t t
J.sub.1 = J.sub.2 = J.sub.3 = J = 4.5, J = 9.5 J = 9.0 J = 10.5
12.5 8.5, 16.5 .sup.aValues of chemical shifts are in ppm and
values of coupling constants are in Hz. The additional peaks in the
spectrum were identified as follow: .delta. 2.05 (s, 3H, acetate),
2.08 (s, 6H, acetate), 2.14 (s, 3H, acetate), 2.15 (s, 3H,
acetate), 2.16 (s, 3H, acetate), 2.36 (s, 3H, MeSAc).
[0393]
13TABLE 13 2 21 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts
and coupling constants for the titled structure..sup.a Ring H1 H2
H3 H4 H5 H5' H6 H6' A 5.94 3.20-3.28 5.45 4.96-4.98 4.40 3.20-3.28
3.31 d m t m ddd m dd J = 4.0 J = 10.0 J = 3.0, 6.0, J = 2.0, 10.0
13.0 C 5.28 4.83 4.29 4.11 2.76 2.91 d s t m ddd ddd J = 2.5
(broad) J = 5.5 J = 7.5, J = 3.0, 14.0, 18.5 8.5, 18.0 D 4.99 3.47
4.96-4.98 4.65 4.06 3.20-3.28 3.54 d dd m s m m dd J = 1.5 J = 2.5,
J = 8.0, 13.5 13.0 H1 H2eq H2ax H3 H4 H5 H6 B 3.40 2.51 1.56 3.50
3.67 3.87 4.91 ddd dt ddd ddd t t t J = 4.5, J = 4.0, J.sub.1 =
J.sub.2 = J.sub.3 = J = 4.5, J = 9.0 J = 9.0 J = 9.5 10.5, 14.5
13.0 12.5 10.0, 14.0 .sup.aValues of chemical shifts are in ppm and
values of coupling constants are in Hz. The additional peaks in the
spectrum were identified as follow: .delta. 1.78 (t, J = 8.0 Hz,
1H, SH), 2.00 (s, 3H, acetate), 2.04 (s, 3H, acetate), 2.05 (s, 3H,
acetate), 2.10 (s, 6H, acetate), 2.12 (s, 3H, acetate),
[0394]
14TABLE 14 16i 22 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts
and coupling constants for the titled structure..sup.a Ring H1 H2
H3 H4 H5 H5' H6 H6' A 5.91 3.24-3.33 5.44 4.96-5.04 3.41 3.24-3.33
3.24-3.33 d m t m ddd m m J = 5.5 J = 10.5 J = 3.0, 5.5, 9.5 C 5.23
4.87-4.91 4.28 4.28 3.14 3.01 d m bs bs m dd J = 1.0 J = 7.5, 13.5
D 4.87-4.91 3.24-3.33 4.96 4.64 3.63-3.67 3.14 3.52-3.56 m m s s m
m m E 5.61 5.76 5.95 4.65-4.73 4.65-4.73 4.60 d dd dd m m dd J =
2.0 J = 2.0, J = 5.5, 6.0 J = 5.0, 5.0 12.0 H1 H2eq H2ax H3 H4 H5
H6 B 3.24-3.33 2.51 1.55 3.41 3.76 3.62 4.87-4.91 m dt ddd ddd t t
m J = 5.0, J.sub.1 = J.sub.2 = J.sub.3 = J = 4.5, J = 9.0 J = 9.0
13.0 12.5 10.0, 14.0 .sup.aValues of chemical shifts are in ppm and
values of coupling constants are in Hz. The additional peaks in the
spectrum were identified as follow: .delta. 1.99 (s, 3H, acetate),
2.02 (s, 3H, acetate), 2.03 (s, 3H, acetate), 2.04 (s, 3H,
acetate), 2.12 (s, 3H, acetate), 2.13 (s, 3H, acetate), 7.29-8.10
(10H, aromatic benzoyl protons).
[0395]
15TABLE 15 XI 23 .sup.1H NMR (500 MHz, D.sub.2O pH = 3.04) chemical
shifts and coupling constants for the titled structure..sup.a Ring
H1 H2 H3 H4 H5 H5' H6 H6' A 6.03 3.43-3.47 3.95-3.99 3.23-3.39
3.80-3.89 3.14 3.23-3.39 d m m m m dd m J = 4.0 J = 7.5, 13.5 C
5.31 4.37 4.40 4.26 3.53 3.61-3.65 bs bs bt bdd dd m J = 5.0 J =
6.0, 12.5 D 5.19 3.43-3.47 4.11-4.15 3.68 4.21 3.23-3.39 3.23-3.39
bs m m bs bt m m E 4.96 3.95-3.99 4.03 3.80-3.89 3.36-3.39 2.86 d m
t m m dd J = 6.0 J = 4.0 J = 8.0, 13.5 H1 H2eq H2ax H3 H4 H5 H6 B
3.23-3.39 2.35 1.95 3.43-3.47 3.61-3.65 3.80-3.89 4.11-4.15 m bdt
ddd m m m m J.sub.1 = J.sub.2 = J.sub.3 = 12.5 .sup.aValues of
chemical shifts are in ppm and values of coupling constants are in
Hz.
[0396]
16TABLE 16 24 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 6.21 3.31-3.38 5.47 5.09 3.98 3.40-3.48 3.42 d m t
t ddd m dd J = 3.5 J = 9.0 J = 9.5 J = 3.0, J = 2.5, 3.0, 10.0 11.5
C 5.22 4.74 4.27 4.30 4.25 3.58-3.67 d d dd dd dd m J = 1.0 J = 5.0
J = 5.0, 6.5 J = 5.0, J = 1.0, 7.5 11.0 D 4.38 4.89 4.60 3.41-3.52
3.15 3.31-3.38 3.41-3.52 d t bs t m m J = 1.5 J = 2.0 m J = 2.5 E
4.72 5.06 5.34 5.18 3.58-3.67 4.47 4.42 d t t t m dd dd J = 9.5 J =
10.0 J = 10.0 J = 10.0 J = 1.5, J = 4.0, 11.5 11.5 H1 H2eq H2ax H3
H4 H5 H6 B 3.31-3.38 2.37 1.58 3.41-3.52 3.93 3.77 3.86 m dt ddd m
t t t J = 4.5, J.sub.1 = J.sub.2 = J.sub.3 = J = 9.5 J = 9.0 J =+09
.5 12.5 12.5 .sup.aValues of chemical shifts are in ppm and values
of coupling constants are in Hz. The additional peaks in the
spectrum were identified as follow: .delta. 1.97 (s, 3H, acetate),
1.99 (s, 3H, acetate) 2.08 (s, 3H, acetate), 2.10 (s, 6H, acetate),
2.13 (s, 3H, acetate), 2.14 (s, 3H, acetate), 2.16 (s, 6H,
acetate), 2.18 (s, 3H, acetate),
[0397]
17TABLE 17 25 .sup.1H NMR (500 MHz, CDCl.sub.3) chemical shifts and
coupling constants for the titled structure..sup.a Ring H1 H2 H3 H4
H5 H5' H6 H6' A 5.95 3.49-3.68 3.91 3.15-3.44 3.71-3.91 3.49-3.68
3.15-3.44 d m t m m m m J = 3.5 J = 10.0 C 5.28 4.37 4.64 4.08-4.25
3.49-3.65 4.08-4.25 d d m m m m J = 2.5 J = 2.0 D 5.15 3.15-3.44
4.08-4.25 3.49-3.68 4.08-4.25 3.15-3.44 3.15-3.44 d m m m m m m J =
1.0 E 4.36 3.15-3.44 3.15-3.44 3.15-3.44 3.49-3.68 3.71-3.91
3.44-3.62 d m m m m m m J = 8.0 H1 H2eq H2ax H3 H4 H5 H6 B
3.15-3.44 2.32 1.94 3.15-3.44 3.15-3.44 3.71-3.91 4.08-4.25 m m ddd
m m m m J.sub.1 = J.sub.2 = J.sub.3 = 12.5 .sup.aValues of chemical
shifts are in ppm and values of coupling constants are in Hz.
EXAMPLE 4
Additional Synthetic Strategies for Other Selected Compounds of the
Present Invention
[0398] Example 3 above related to a synthetic strategy for specific
selected compounds according to the present invention. However,
this strategy may optionally be generalized to obtain any member of
the set4-set5 structures shown in FIG. 9.
[0399] FIG. 13 shows the overall synthetic protocol for the
assembly of set4-set5 structures. The protected perazido-neomycin B
(compound 17a, FIG. 13) can be sufficiently hydrolyzed in the
presence of TolSH and BF.sub.3-OEt.sub.2 to yield the neamine
fragment 18 and the thioglycoside 19a in 90% and 82% yields,
respectively (38). Inversion of configuration at C5 of 18 provides
the protected epi-neamine 20. While this step can be accomplished
in various methods, the approach of Moriarty et al (39), that uses
triflation of the alcohol followed by treatment with sodium
nitrite, has been proved to be very successful when examined for
different oligosaccharides. The 5-epi-neamine derivative 20 can be
easily transformed to the corresponding 5-thio-neamine 21 in two
simple steps: Conversion of the 5" hydroxyl in to the corresponding
S-acetyl by the Mitsunobu procedure, followed by S-deacetylation
using hydrazinium acetate in DMF. Treatment of 20 with the
thioglycoside 19a will provide the core structure of the protected
5-epi-neomycin B (22a), which after subsequent deprotection steps
will afford the epi-neomycin B. Similarly, treatment of the
protected 5-thio-neamine 21 with the corresponding bromide of 19a
and deprotection steps of the intermediate 23a will afford the
5-thio-neomycin B.
[0400] In summary, the synthetic strategy outlined in FIG. 13
involves the conversion of the natural neomycin B to the
corresponding 5-epi-neomycin B (22a) and 5-thio-neomycin B (23a)
with a maximum efficiency: no loss of neomycin fragments and no
addition of extra sugars. This strategy is very advantageous,
especially because of the relatively low cost of the commercial
neomycin B. In addition, this strategy also provides an efficient
method for the preparation of epi-ribostamycin and
5-thio-ribostamycin (FIG. 1). Thus, coupling of 20 with 8a,
followed by simple deprotection steps as outlined above will result
the 5-epi-ribostamycin. Similarly, coupling of 21 with the
corresponding anomeric bromide of 8a after subsequent deprotection
will afford a 5-thio-ribostamycin.
[0401] Furthermore, by starting this pathway with compound 17b
(instead of 17a) it is possible to generate the corresponding 5-epi
and 5-thio derivatives of neomycin, 22b and 23b, respectively.
Selective deprotection of the silyl group in these compounds will
result the corresponding C5"--OH derivatives, 22 (R.dbd.H) and 23
(R.dbd.H), which will be used as common acceptors for the
preparation of set4 and set5 compounds.
[0402] Optionally, it is possible to further modify these
structures and to thereby generate a library of set4 and set5
compounds. For this purpose optionally and preferably the general
strategy outlined in FIG. 8 for the preparation of set1-set3
compounds is followed, but instead of 1-3 as acceptors compounds 22
and 23 are employed.
EXAMPLE 5
Antibiotic Activities of the Compounds According to the Present
Invention
[0403] The new analogs have been tested for antibacterial
activities against both Gram-negative and Gram-positive bacteria
including pathogenic and resistant strains by determining minimal
inhibitory concentrations (MICs). FIG. 16 shows the structures of
neomycin B (Compound I) and Compounds II-XIII according to the
present invention, which were tested as described in greater detail
below.
[0404] In addition to the standard resistant strains, for which
their mechanisms of resistance are well known, the activity of
these neomycin B derivatives have been studied on multiple
antibiotic resistant "natural" strains collected from human and
farm origin. One exemplary model is the food-borne pathogen
Salmonella, since it is among the leading cause of foodborne
disease, foodborne-related hospitalization and foodborne-related
deaths. The salmonellae bacteria are responsible for an estimated
16 million annual instances of typhoid fever, primarily in
developing countries, and untold millions of cases of
gastroenteritis in both industrialized and developing countries.
This is a zoonotic pathogen that usually exposed to a variety of
antibiotics in the farm, including a wide range of
aminoglycosides.
[0405] This Example describes experiments which were performed to
test the efficacy of the compounds of the present invention against
different microorganisms, including strains of those microorganisms
which were already shown to be antibiotic resistant.
[0406] The compounds were tested for antibacterial activities
against both Gram-negative and Gram-positive bacteria, including
pathogenic and resistant strains, and the minimal inhibitory
concentrations (MIC) were determined using a microdilution assay
with neomycin B and kanamycin as controls (see Phillips, I.;
Williams, D. In Laboratory Methods in Antimicrobial Chemotherapy;
Gerrod, L., Ed.; Churchill Livingstone Press: Edinburg 1978; pp
3-30).
[0407] Resistant strains included E. coli XL1(pET9d), Pseudomonas
aeruginosa (ATCC 27853), and Salmonella virchow (SV49). E. coli
XL1-(pET9d) is an antibiotic-sensitive laboratory strain of E. coli
that harbors plasmid pET9d with the cloned orf2 gene, which codes
for aminoglycoside kinase APH(3'). P. aeruginosa is a Gram-negative
pathogen. The aph(3')-IIb gene, which codes for APH(3'), is a
chromosomal gene that was found in many clinical isolates of P.
aeruginosa, including the ATCC 27853 strain, and likely accounts at
least partly for the resistance of Pseudomonas to aminoglycosides
(Hachler, H.; Santanam, P.; Kayser, F. H. Antimicrob. Agen.
Chemother. 1996, 40, 1254-1256). S. virchow (SV49) is a clinical
multidrug-resistant strain obtained from poultry and found to be
resistant to streptomycin, tetracycline, ampicillin, sulfa,
kanamycin, and neomycin. The mechanism(s) of resistance of this
strain is still not known.
[0408] The results are shown in Table 18 below.
[0409] From the MIC values, it turns out that among the four
analogs, only Compound V having a ribose substituent at ring E is
as potent as neomycin B against E. coli strains. The activity of
this analogue against E. coli XL1(pET9d) having kanamycin
resistance is even more impressive, exhibiting better activity than
neomycin B. The analogue Compound V is also effective against
Gram-positive bacteria, Staphylococcus epidermidis and Bacillus
subtilis. Furthermore, Compound V demonstrates better activity than
other analogues against pathogenic bacterium Salmonella virchow
that is resistant to kanamycin and neomycin B. In this case
Compound V is about 5 times more effective than kanamycin and 2
times more effective than neomycin B. The susceptibility of
enterobacterium Pseudomonas aeruginosa was also examined, which is
often very difficult to treat, sometimes requiring use of a
combination of aminoglycosides with other antibiotics (Haddad, J.;
Kotra, L. P.; Liano-Sotel, B.; Kim, C.; Azucena, E. F., Jr.; Liu,
M.; Vakulenko, S. B.; Chow, C. S.; Mobashery, S. J. Am. Chem. Soc.
2002, 124, 3229-3237). Interestingly, in this particular case,
while Compound V demonstrates activity close to that of neomycin B,
while the 2-glucosamino derivative Compound IV is even more
effective than Compound V and the diamino derivative Compound III
is superior to both.
18TABLE 18 MICs of Compound I-V against Various Bacterial Strains
MIC (.mu.g/mL) bacterial strain KAN.sup.a I II III IV V E. coli
(R47-100) ND.sup.b 4-5.5 85 40-50 35-40 4.5-6 E. coli (ATCC 25922)
ND 8-10 95 40-50 25-30 10-11 E. coli XL1 blue (pET9d) 260- 50-60
>200 >200 >200 35-45 270 Staphylococcus epidermidis (ATCC
ND 0.3-0.4 5.5-7 1.5- 1.4- 0.2- 12228) 1.8 1.8 0.4 Bacillus
subtilis (ATCC 6633) ND 0.8-0.9 8.5-10 3.5-4 1.4- 0.6- 1.8 0.8
Salmonella virchow (SV49) 500- 200- >1250 >1250 >1250 75-
570 250 125 Pseudomonas aeruginosa (ATCC 450- 55-60 110- 30-35
40-50 60-65 27853) 500 130 .sup.aKAN = kanamycin. .sup.bND = not
determined.
[0410] The observed preliminary data obtained with Compounds II-V
indicate that, without wishing to be limited by a single
hypothesis, merely increasing the number of amino groups on the
natural drug may not lead to an increase in antibacterial activity,
even though the binding affinity of these analogues to RNA is
likely to increase in vitro. However, the excellent activities
observed for the amino derivatives III and IV against Pseudomonas
but significantly weak activities against other bacterial strains
imply that the structural and functional requirements for this
family of drugs are not similar in order to reach analogous high
antibacterial performance against different organisms, again
without wishing to be limited by a single hypothesis.
[0411] Additional data has been obtained with other compounds
according to the present invention, as shown with regard to Table
19 below. These experiments were performed in a manner similar to
those described above.
19TABLE 19 MICs of Compounds VI-XI against various bacterial
strains MIC (.mu.g/mL) Bacterial strain KAN.sup.a I VI VII VIII IX
X XI E. coli (R47-100) ND.sup.b 4-5.5 35-50 45-50 50-70 90-100
150-200 30-40 E. coli (ATCC 25922) ND 8-10 35-40 45-60 30-50
100-150 100-150 25-40 E. coli XL1 blue (pET9d).sup.c 260-270 50-60
200-250 250-400 150-200 700-800 250-500 >200 Staphylococcus ND
0.3-0.4 4-5 4.5-5.5 5.5-6.0 10-11 4-5 1.5-3 epidermidis (ATCC
12228) Bacillus subtilis ND 0.8-0.9 5-7 6-7 5-7 10-11 5-10 1-2.5
(ATCC 6633) Salmonella virchow 500-570 200-250 >1000 >1000
>1000 >800 >1000 >250 (SV49) Pseudomonas 400-500 55-60
55-60 45-50 10-15 350-400 40-60 200-400 aeruginosa (ATCC 27853)
.sup.aKAN, kanamycin; .sup.bND, not determined.
[0412] As can be seen from these additional results, several of the
compounds provide results which are at least as good as kanamycin
and/or neomycin B for particular strains, such as certain strains
of E. coli. Compounds VI-VIII and X provided improved results over
kanamycin and similar results to neomycin B for other strains, such
as resistant forms of Pseudomonas aeruginosa. Indeed for this
strain, Compound VIII provided significantly better results than
either kanamycin or neomycin B. Overall good results against
different strains were demonstrated for all of the compounds for at
least certain strains.
[0413] Overall, the neomycin B derivatives prepared in this study
represent a new class of branched aminoglycoside antibiotics that
show antibacterial activity superior to that of neomycin B and/or
kanamycin against pathogenic and resistant bacterial strains,
although the breadth of activity across different strains differed
between the compounds.
EXAMPLE 6
Treatment of Genetic Disorder With Compounds According to the
Present Invention
[0414] The previous Example discussed the antibiotic activities of
some exemplary compounds of the present invention. However, these
compounds are expected to have other effects as well, some of which
are discussed below.
[0415] One illustrative use of the compounds of the present
invention is for treatment of genetic disorder, such as cystic
fibrosis for example. The treatment of cystic fibrosis with the
aminoglycosaccharide gentamicin has been shown (Wilschanski et al,
"Gentamicin-induced correction of CFTR function in patients with
cystic fibrosis and CFTR stop mutations", New Eng. J. Med., vol
349, pp. 1433-41 Oct. 9, 2003; hereby incorporated by reference as
if fully set forth herein). It is believed that this effect is
obtained by blocking a premature stop codon which leads to a
shortened version of CFTR (cystic fibrosis transmembrane
conductance regulator); this mutation causes the effects of cystic
fibrosis, which cause the lungs of the affected subject to fill
with mucous, leading to bacterial infection, severely reduced
pulmonary function and often premature death. Blocking the
premature stop codon causes "read through", such that a longer
protein is transcribed which has at least additional activity
compared to the mutated protein. In the previously described
reference, treatment with gentamicin was shown to result in full
length CFTR in a number of patients.
[0416] Without wishing to be limited by a single hypothesis, it is
believed that as the compounds of the present invention are also
aminoglycoside derivatives, the compounds of the present invention
should also be useful for treatment of cystic fibrosis. Such
treatment may be effective for a number of reasons, including but
not limited to, one or more of reduction or elimination of
bacterial infection through the antibiotic effect of the compounds
according to the present invention; and/or also blocking the
premature stop codon.
[0417] Treatment would preferably include administration of a
therapeutically effective amount of a compound according to the
present invention to a subject. Dosing and administration routes
could easily be determined by one of ordinary skill in the art, and
would optionally include such routes as oral, topical, nasal,
inhaled, optical, parenteral and so forth, as described in greater
detail below; however, for cystic fibrosis treatment, optionally
and preferably treatment would include administration of the
compound according to the present invention directly to the lungs,
for example through an inhaled spray or mist, and/or powder
inhaler. Preferably, the compound would be provided in a suitable
formulation, also as described in greater detail below. The
compound may also optionally be combined with other type(s) of
treatment for cystic fibrosis, for example by including treatment
with one or more other medications that are known in the art.
[0418] Non-limiting examples of other genetic disorders for which
treatment with a compound according to the present invention may be
useful include Duchenne's muscular dystrophy or Hurler's syndrome
which are also characterized by truncation mutations.
EXAMPLE 7
Other Activities of the Compounds According to the Present
Invention
[0419] The previous Example discussed the antibiotic activities and
also anti-cystic fibrosis activity of some exemplary compounds of
the present invention. However, these compounds are expected to
have other effects as well, some which are discussed below.
[0420] Aminoglycoside variants as potential ribonucleases
[0421] Since aminoglycoside antibiotics exert their antibacterial
activity by selectively recognizing and binding to a ribosomal RNA,
it is hypothesized that the combination of this already existing
recognition element in natural drugs with a catalytic element into
a single molecule would significantly increase the activity of the
resulted structure. The following observations supported this
hypothesis. First, Wong and co-workers demonstrated a nearly linear
relationship between the IC.sub.50 of in vitro translation
inhibition and the MIC values for a series of natural
aminoglycosides and their synthetic analogs (12e, 14). In general,
MIC values were at about 100-fold higher concentrations than the
corresponding IC.sub.50 values.
[0422] To explain these differences it was suggested that since the
ribosomal RNA is the most dominant RNA in the cell, at low drug
concentrations, a tight ribosome-binding drug titrates only a small
fraction of the very large number of ribosomes and only at higher
concentrations of drug are all ribosomes saturated and protein
synthesis impaired. These data imply that an increasing binding
affinity of the drug to target RNA should not merely result in
better antibiotic function in the sense of required administered
dose of the drug, and that most potent ribosome-targeting
antibiotics could be envisioned if they were designed to be
catalytic inhibitors (12e, 14).
[0423] Second, several examples of site-directed RNA cleaving
agents that combine a reactive moiety capable of cleaving
phosphodiester bond with a recognition element capable of
sequence-specifically hybridizing to target RNA, have been reported
(41). Third, in analogy to earlier observations in which several
simple oligoamines, (42), as well as basic polypeptides (43) have
been shown to catalyze RNA hydrolysis, it was likely that
aminoglycosides that represent polycationic molecules could exhibit
similar effect. Indeed, it has recently been shown that neomycin B,
which has three times as many amines as 1,3-propanediame, catalyzes
hydrolysis of adenylyl(3'-5')-adenosine (ApA) 3-fold faster than
1,3-propanediamine (44). Neomycin B consists of the
meso-1,3-diaminocyclitol (2-deoxystreptamine) ring for which the
pK.sub.a values of 5.74 and 8.04 were reported. This may lead to a
higher population of a monocationic form at a given pH compared to
1,3-propanediamine, and therefore to a faster hydrolysis.
[0424] However, the observed first-order rate constants for
neomycin was over 1000-fold lower than those reported for natural
ribozymes. It is clear that further increase of the catalytic
activity of natural aminoglycosides should be plausible if the
molecular design will be more precise. The simplicity and stability
of aminoglycosides, in conjunction with the recent progress in 3D
structure determination of aminoglycosides bound to rRNA, are
undoubtedly advantageous for this purpose.
[0425] Design and synthesis of neomycin variants as potential
ribonucleases
[0426] Based on the results obtained with various oligoamines as a
motif for the molecular recognition and hydrolysis of the
phosphodiester bond of RNA, briefly introduced in the previous
section, two series of neomycin analogs are prepared: (1)
structures of set1-set5 that contain 1,2-diamino and 1,3-diamino
moieties as "catalytic warheads"; (2) structures of set5 and set6
that represent pseudo-hexasaccharide variants.
[0427] (1) Variants with "catalytic warheads." For this purpose the
diamine building blocks 5f, 6f, 7a, (FIG. 7) and 24 (FIG. 14) were
specially designed. Structures 7a and 24 consist of 1,2-diamino
moieties in a cis configuration. Such vic-cis-diamino moieties in
7a and 24 exhibit rigid spatial orientation of two neighboring
amino groups and might be more advantageous for catalysis than
highly flexible amines in 1,2-ethylenediamine. In addition, N-C-C-N
torsion angle in ribofuranoside 24 (eclipsed relationship) is
different than that in allopyranoside 7a (gauche relationship).
Structures 5f and 6f contain 1,3-diamino moieties and have gluco
and galacto configurations, respectively. It is noteworthy that
although 1,3-diamino moiety is very common in aminoglycoside
antibiotics, this moiety is mostly present in the
2-deoxystreptamine unit (meso-1,3-diamino cyclitol, ring B in
neomycin B) and is different from the flexible diamine such as in
5f and 6f. Therefore, investigation of 5f and 6f, along with 7a and
24, is very challenging from both points of view: they represent
new "catalytic warheads" for the cleavage of phosphodiester bond,
and their incorporation into appropriate oligosaccharides, may
result novel antibiotics.
[0428] A description of this synthetic scheme is described with
regard to FIG. 14.
[0429] These monosaccharide building blocks can be incorporated
into the above designed set1-set5 structures as variable sugar
rings to yield corresponding pseudo-pentasaccharides, which will be
tested for ribonuclease activity as outlined below.
[0430] (2) pseudo-hexasaccharide variants. Electrostatic
interactions have been shown to be critically important in RNA
binding (45). Increasing the number of positively charged ammonium
groups in ligands resulted enhanced binding affinities by RNA host.
Since binding affinity of substrate to the catalyst is very
important and strongly contributes to the overall efficiency of any
catalytic system, it is clear that by increasing the binding
affinities of our designed structures to RNA substrate we should
subsequently increase their probability as catalysts. Therefore, in
attempts to improve the catalytic power of the above designed
pseudo-pentasaccharides (set1-set5), a new set, set6, of the
pseudo-hexasaccharides are prepared (FIGS. 14 and 15). The two
pseudo-hexasaccharides 25 and 26 can be easily assembled by
coupling of the disaccharide donor 19a (FIG. 13) with either 1 or 2
as acceptors and subsequent deprotection steps as illustrated in
FIG. 14. (Note added: As an illustrative example, compound 25
(which is also the final product Compound X in FIG. 16) has been
successfully synthesized and the data of this synthesis and
antibacterial tests are summarized in the previous sections.) These
two compounds remain the original neomycin structure, so that the
likelihood of their binding to the rRNA A-site is very high. The
other structure of set 6, compound 27, has the epi-neomycin core,
and can be easily assembled from the neomycin fragments discussed
above. Thus, coupling of neamine derivative 20 with 19b will afford
the corresponding epi-neamine derivative, which after deprotection
of the primary alcohol, coupling with 19a, and deprotection steps
will furnish the epi-neomycin hexasaccharide derivative 27 (FIG.
15).
EXAMPLE 8
Antibacterial Activity Against Bacillus anthracis and Inhibition of
Anthrax Lethal Factor By the Compounds of the Present Invention
[0431] Example 5 above showed that the compounds according to the
present invention can be used for treatment of a subject suffering
from infection by an infectious microorganism, including
gram-negative and gram-positive bacteria for example.
[0432] This Example provides an illustrative, non-limiting example
of use of selected compounds according to the present invention
against the Gram-positive bacterium, Bacillus anthracis for
treatment of anthrax, and for inhibition of Anthrax Lethal
Factor.
[0433] The new derivatives of neomycin B, Compounds II-XIII of FIG.
16, were synthesized according to the general strategy described in
Example 1 for compounds of Formula I (FIG. 8), via the
corresponding intermediates. The synthetic strategy and preparation
of the exemplary intermediates are set forth in Example 1.
[0434] Using an in vitro fluorescent assay (22), the novel
Compounds II-XIII according to the present invention were examined
for the protease activity inhibition of LF, at both high and low
salt concentrations.
[0435] Low-salt conditions comprised potassium
2-[4-(2-hydroxyethyl)-1-pip- erazinyl]ethanesulfonic acid (HEPES)
buffer at pH 7.4 (10 mM), LF (about 33 nM), varying concentrations
(4, 6, 10, and 20 .mu.M) of a fluorescent substrate, and varying
concentrations of Compounds II-XIII (the concentrations of Compound
XII were 0, 16.2, 32.5, and 54.1 nM; the concentrations of all
other compounds were 0, 165, 330, and 550 nM). The K.sub.i values
were estimated from double-reciprocal plots of initial velocities
as a function of substrate concentration.
[0436] High-salt conditions comprised potassium HEPES buffer at pH
7.4 (10 mM), KCl (150 mM), LF (about 33 nM), varying concentrations
(10, 20, 40, and 100 .mu.M) of a fluorescent substrate, and varying
concentrations of Compounds II-XIII (as described above for the
low-salt conditions). The K.sub.i values were estimated as in the
low-salt conditions. Each experiment was performed also in the
presence of 0.1 mg/mL BSA (data presented in parantheses). All
assays were performed in triplicate and analogous results were
obtained in at least two or three experiments.
20TABLE 20 Apparent inhibition constants (K.sub.i) of the
commercial neomycin B (I) and its synthetic derivatives II-XIII for
the protease activity of LF at various assay conditions. K.sub.i
(nM) K.sub.i (.mu.M) Aminoglycosides Low salt High salt Neomycin B
(I) 37 .+-. 2 (34 .+-. 0.4) 59 .+-. 6 (64 .+-. 8) II 11 .+-. 2 50
.+-. 7 III 0.5 .+-. 0.1 (17 .+-. 4) 28 .+-. 6 (30 .+-. 5) IV 13
.+-. 2 66 .+-. 9 V 28 .+-. 2 134 .+-. 17 VI 1.3 .+-. 0.4 39 .+-. 6
VII 15 .+-. 2 (36 .+-. 5) 85 .+-. 11 (58 .+-. 8) VIII 0.6 .+-. 0.1
(15 .+-. 3) 20 .+-. 3 (24 .+-. 3) IX 0.2 .+-. 0.1 10 .+-. 2 X 0.4
.+-. 0.1 21 .+-. 4 XI 52 .+-. 5 81 .+-. 21 XII 23 .+-. 2 125 .+-.
25 XIII 0.7 .+-. 0.2 (33 .+-. 6) 1.1 .+-. 0.2 (1.2 .+-. 0.2)
[0437] As is shown in Table 20, all the tested compounds were found
to be competitive inhibitors. From the measured apparent K.sub.i
values at low ionic strength assay conditions (low salt), it was
found that among the analogues tested, 6 compounds (III, VI, VIII,
IX, X, XIII), having K.sub.i values in the range of 0.2-1.3 nM, are
predominantly better inhibitors than the neomycin B itself
(K.sub.i=37 mM). It was further found that the binding affinity of
the analogues of gluco series (having a glucose substituent at ring
V) increases gradually with increasing number of amino groups on
the ring: (2NH.sub.2)glucose (II, VIII)>(1NH.sub.2)glucose (III,
VIII)>glucose (IV, VII). In this series of compounds, no
particular influence on the position of the amino group(s) on the
glucose ring is observed. The ring configuration, however, has a
more significant effect: the ribosamino derivative VI binds about
10-fold tighter than two monoamino derivatives of glucose (IV and
VII), and the diamino-D-allose derivative 1, which consists of an
unusual cis-1,2-diamine substitution at ring E, binds about 20-fold
weaker than the amino-D-glucose derivatives III and VIII. These
data suggest that, although the number of amino groups on the
ligand is in general critical for LF binding affinity, structural
features of the ligand play an important role in the proper
recognition of LF.
[0438] Without wishing to be bound to a particular theory, it was
hypothesized that since the disulfide dimer XIII has twice as many
amino groups as its parent "monomeric" IX, its binding affinity to
LF would be expected to be significantly higher. The observed
similar extent of inhibition of XIII and IX was, however, very
intriguing suggesting that in the case of the dimer XIII, in
addition to a "specific" active site binding, an additional
"nonspecific interaction" with the LF protein may occur.
[0439] Various studies dealing with many different
protein-polyelectrolyte interactions (31) and the interactions of
aminoglycosides with a number of ribozymes (12, 21), support this
assumption. To test this possibility, the Compounds IX and XIII,
along with neomycin B, were evaluated in the presence of 0.1 mg/mL
of BSA. Again without wishing to be bound by theory, it was found
that while the binding affinities of both neomycin B and Compound
IX were not significantly affected, the binding of Compound XIII
was reduced 47-fold by the addition of BSA, implying a nonspecific
protein-ligand association in the case of Compound XIII which
increases with increased protein concentration.
[0440] Although, to date, no direct structural data on the
interaction of aminoglycosides with LF is available, and without
wishing to be bound by theory, a preliminary investigation of the
binding mechanism suggests that the inhibitory activity of
aminoglycosides is ionic strength dependent, supporting the
possibility that the predominant interaction between the LF and
aminoglycosides may be electrostatic in origin (35). Increasing the
ionic strength from 0 to 150 mM KCl drastically shifts the K.sub.i
values of all aminoglycosides towards higher concentrations by
factors of about 1500-53,000 (Table 20). These data suggest that
the compounds of the present invention, including the parent
neomycin B, can be replaced from their LF binding site even at a
relatively low ionic strength. A possible reason for the observed
different sensitivities of different aminoglycosides to changes in
ionic strength may be their different numbers of amino groups and
their individual pKa values. In addition, it is likely that the pKa
values of individual ammonium groups of neomycin B and of the dimer
XIII are the same, resulting in XIII behaving like a "monomer" and
displaying the same sensitivity as neomycin B towards ionic
strength (about 1500-fold, Table 20) (38).
[0441] Without wishing to be bound by theory, the observed 53-fold
higher affinity of Compound XIII compared to that of the neomycin
B, both at the low and high salt concentrations, suggests that the
presence of twice the number of charged groups in XIII may be
responsible for its increased affinity. Such high ionic strength
conditions may also be able to overcome the nonspecific LF-XIII
association, as suggested by the same K.sub.i value observed for
XI, with and without the presence of BSA. Furthermore, since 150 mM
KCl best resembles the physiological ionic strength into the
mammalian cell (39), XIII can be considered as a preferred
aminoglycoside inhibitor of LF at seemingly physiological
conditions.
[0442] When the new derivatives II-XIII were tested by means of
surface plasmon resonance (SPR) against immobilized 27-mer RNA
construct (AS-wt) (25), binding constants in the range of 0.4-2.9
.mu.M were determined, with no obvious dependence of K.sub.d on
modification type (Table 21). Several of these derivatives,
including the dimer XIII (K.sub.d=0.4 .mu.M), displayed apparently
similar extent of binding affinity to that of the parent neomycin B
(K.sub.j=0.3 .mu.M), showing no apparently significant contribution
of the number of amino groups on the ligand to RNA binding; Without
wishing to be bound by theory, it is suggested that, unlike the
binding affinity to LF, in which increasing number of amino groups
on the natural drug lead to increased binding, a more subtle
balance of interactions may govern the binding affinity of these
ligands to RNA.
[0443] To compare the observed RNA binding affinities to
antibacterial activity, the Compounds II-XIII were further
investigated against B. anthracis (Sterne strain) (40), and the
minimal inhibitory concentrations (MIC) were determined using a
microdilution assay with neomycin B as a control (Table 21). No
previous studies on aminoglycoside drugs have been performed to
make such a comparison between rRNA binding and antibacterial
activity for B. anthracis.
[0444] Minimal inhibitory concentrations (MIC) against B. anthracis
and binding constants (K.sub.d) to 16S A site RNA were tested for
the commercial neomycin B and its synthetic derivatives II-XIII.
For the MIC measurements, the concentrated stock solutions of
aminoglycosides were prepared in distilled water with known
concentration. Two-fold dilutions were used in a concentration
range from 0.015 to 1024 mg/L diluted in 100 .mu.L of BHI broth and
poured into wells of microtitre plates (Nunc 96-well flat-bottomed
microtitre plates; Nunc, Roskilde, Denmark). A 10 .mu.L volume of
culture containing 10.sup.5 cfu/mL of B. anthracis Sterne strain
was then added. Following incubation of the plates for 18 h at
37.degree. C. in ambient air, the MICs were determined as the
lowest concentration of an antibacterial agent that completely
inhibited visible growth of the bacteria.
[0445] The sequence of 27-mer 16S A site RNA construct used in this
study was 5' BiGGCGUCACACCUUCGGGUGAAGUCGCC 3', and the binding
assays were performed as previously described (11).
[0446] From the MIC values, it appears that all of the synthetic
derivatives possess significant antibacterial activity against B.
anthracis, some of them displaying activity levels comparable to
that of neomycin B. In spite of the similar binding affinities of
the neomycin B and the dimer XIII to 16S A site RNA, their
antimicrobial activities differed by a factor of eight, suggesting
that no direct correlation between rRNA binding and antibacterial
activity can be made. While this is in agreement with earlier
reported data on other aminoglycoside analogues (41), further
structure-activity studies within more diverse structures of
neomycin B analogues are clearly required to better understand this
issue in detail.
21TABLE 21 Minimal inhibitory concentrations (MIC) against B.
anthracis and binding constants (K.sub.d) to 16S A site RNA for the
commercial neomycin B and its synthetic derivatives II-XIII. MIC
K.sub.d Aminoglycosides (.mu.g mL.sup.-1) (.mu.M) Neomycin B (I)
0.25 0.3 .+-. 0.1 II 8 2.0 .+-. 0.2 III 2 1.3 .+-. 0.3 IV 2 0.9
.+-. 0.1 V 1 0.7 .+-. 0.1 VI 2 0.7 .+-. 0.1 VII 2 0.7 .+-. 0.1 VIII
1 0.6 .+-. 0.1 IX 8 2.9 .+-. 0.6 X 2 1.9 .+-. 0.3 XI 2 1.0 .+-. 0.2
XII 8 1.1 .+-. 0.2 XIII 2 0.4 .+-. 0.1
EXAMPLE 9
Treatment with Compounds According to the Present Invention
[0447] The above results show that the compounds according to the
present invention can be used for treatment of a subject suffering
from infection by an infectious microorganism. Optionally, the
compounds of the present invention can be used to treat a subject
suffering from a genetic disorder, including but not limited to,
cystic fibrosis, Duchenne's muscular dystrophy, or Hurler's
syndrome for example. Alternatively, the compounds of the present
invention can be used to treat a subject suffering from anthrax.
The method preferably includes administering the compound of the
present invention to the subject through a suitable route of
administration.
[0448] The compounds of the present invention are potentially
useful for the treatment of a wide spectrum of different types
and/or species of bacteria, such as gram negative and gram-positive
bacteria for example.
[0449] The organisms potentially amenable to therapy with one or
more of the compounds according to the present invention include a
wide variety of Gram-positive and Gram-negative organisms with a
variety of growth circumstances and requirements ranging from
aerobic to anaerobic growth, including but not limited to:
[0450] (a) Gram-positive bacteria, including but not limited to,
Strep.pyogenes (Group A), Strep.pneumoniae, Strep.GpB,
Strep.viridans, Strep.GpD-(Enterococcus), Strep.GpC and GpG,
Staph.aureus, Staph.epidermidis, Bacillus subtilis, Bacillus
anthraxis, Listeria monocytogenes, Anaerobic cocci, Clostridium
spp., and Actinomyces spp; and
[0451] (b) Gram-negative bacteria, including but not limited to,
Escherichia coli, Enterobacter aerogenes, Kiebsiella pneumoniae,
Proteus mirabilis, Proteus vulgaris, Morganella morganii,
Providencia stuartii, Serratia marcescens, Citrobacter freundii,
Salmonella typhi, Salmonella paratyphi, Salmonella typhi murium,
Salmonella virchow, Shigella spp., Yersinia enterocolitica,
Acinetobacter calcoaceticus, Flavobacterium spp., Haemophilus
influenzae, Pseudomonas aeruginosa, Campylobacter jejuni, Vibrio
parahaemolyticus, Brucella spp., Neisseria meningitidis, Neisseria
gonorrhoea, Bacteroides fragilis, and Fusobacterium spp.;
[0452] (c) optionally including other organisms such as a
Mycobacteria strain, including but not limited to, Mycobacterium
tuberculosis, Mycobaterium smegmatis and other Mycobacteria.
[0453] It should be noted that the term "treatment" also includes
amelioration or alleviation of a pathological condition and/or one
or more symptoms thereof, curing such a condition, or preventing
the genesis of such a condition.
[0454] The compounds of the present invention can be used to
produce a pharmaceutical composition. Thus, according to another
aspect of the present invention there is provided a pharmaceutical
composition which includes, as an active ingredient thereof, a
compound and a pharmaceutical acceptable carrier. As used herein a
"pharmaceutical composition" refers to a preparation of one or more
of the active ingredients described herein, either compounds or
physiologically acceptable salts thereof, with other chemical
components such as traditional drugs, physiologically suitable
carriers and excipients. The purpose of a pharmaceutical
composition is to facilitate administration of a compound or cell
to an organism. Pharmaceutical compositions of the present
invention may be manufactured by processes well known in the art,
e.g., by means of conventional mixing, dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping
or lyophilizing processes.
[0455] In a preferred embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. Hereinafter, the phrases "physiologically
suitable carrier" and "pharmaceutically acceptable carrier" are
interchangeably used and refer to an approved carrier or a diluent
that does not cause significant irritation to an organism and does
not abrogate the biological activity and properties of the
administered conjugate.
[0456] The term "carrier" refers to a diluent, adjuvant, excipient,
or vehicle with which the therapeutic is administered. Such
pharmaceutical carriers can be sterile liquids, such as water and
oils, including those of petroleum, animal, vegetable or synthetic
origin, such as peanut oil, soybean oil, mineral oil, sesame oil
and the like. Water is a preferred carrier when the pharmaceutical
composition is administered intravenously. Saline solutions and
aqueous dextrose and glycerol solutions can also be employed as
liquid carriers, particularly for injectable solutions. Suitable
pharmaceutical excipients include starch, glucose, lactose,
sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium
stearate, glycerol monostearate, talc, sodium chloride, dried skim
milk, glycerol, propylene, glycol, water, ethanol and the like. The
composition, if desired, can also contain minor amounts of wetting
or emulsifying agents, or pH buffering agents. These compositions
can take the form of solutions, suspensions, emulsion, tablets,
pills, capsules, powders, sustained-release formulations and the
like. The composition can be formulated as a suppository, with
traditional binders and carriers such as triglycerides. Oral
formulation can include standard carriers such as pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, etc. Examples of
suitable pharmaceutical carriers are described in "Remington's
Pharmaceutical Sciences" by E. W. Martin. Such compositions will
contain a therapeutically effective amount of the compound,
preferably in purified form, together with a suitable amount of
carrier so as to provide the form for proper administration to the
patient. The formulation should be suitable for the mode of
administration.
[0457] Herein the term "excipient" refers to an inert substance
added to a pharmaceutical composition to further facilitate
processes and administration of the active ingredients. Examples,
without limitation, of excipients include calcium carbonate,
calcium phosphate, various sugars and types of starch, cellulose
derivatives, gelatin, vegetable oils and polyethylene glycols.
[0458] Further techniques for formulation and administration of
active ingredients may be found in "Remington's Pharmaceutical
Sciences," Mack Publishing Co., Easton, Pa., latest edition, which
is incorporated herein by reference as if fully set forth
herein.
[0459] The pharmaceutical compositions herein described may also
comprise suitable solid or gel phase carriers or excipients.
Examples of such carriers or excipients include, but are not
limited to, calcium carbonate, calcium phosphate, various sugars,
starches, cellulose derivatives, gelatin and polymers such as
polyethylene glycols.
[0460] Suitable routes of administration may, for example, include
oral, rectal, transmucosal, transdermal, intestinal or parenteral
delivery, including intramuscular, subcutaneous and intramedullary
injections as well as intrathecal, direct intraventricular,
intravenous, intraperitoneal, intranasal, or intraocular
injections.
[0461] Pharmaceutical compositions for use in accordance with the
present invention thus may be formulated in conventional manner
using one or more pharmaceutically acceptable carriers comprising
excipients and auxiliaries, which facilitate processing of the
active ingredients into preparations which, can be used
pharmaceutically. Proper formulation is dependent upon the route of
administration chosen.
[0462] For injection, the active ingredients of the invention may
be formulated in aqueous solutions, preferably in physiologically
compatible buffers such as Hank's solution, Ringer's solution, or
physiological saline buffer. For transmucosal administration,
penetrants are used in the formulation. Such penetrants are
generally known in the art.
[0463] For oral administration, the active ingredients can be
formulated readily by combining the active ingredients with
pharmaceutically acceptable carriers well known in the art. Such
carriers enable the active ingredients of the invention to be
formulated as tablets, pills, dragees, capsules, liquids, gels,
syrups, slurries, suspensions, and the like, for oral ingestion by
a patient. Pharmacological preparations for oral use can be made
using a solid excipient, optionally grinding the resulting mixture,
and processing the mixture of granules, after adding suitable
auxiliaries if desired, to obtain tablets or dragee cores. Suitable
excipients are, in particular, fillers such as sugars, including
lactose, sucrose, mannitol, or sorbitol; cellulose preparations
such as, for example, maize starch, wheat starch, rice starch,
potato starch, gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or
physiologically acceptable polymers such as polyvinylpyrrolidone
(PVP). If desired, disintegrating agents may be added, such as
cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt
thereof such as sodium alginate.
[0464] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, titanium dioxide, lacquer
solutions and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active ingredient doses.
[0465] Pharmaceutical compositions, which can be used orally,
include push-fit capsules made of gelatin as well as soft, sealed
capsules made of gelatin and a plasticizer, such as glycerol or
sorbitol. The push-fit capsules may contain the active ingredients
in admixture with filler such as lactose, binders such as starches,
lubricants such as talc or magnesium stearate and, optionally,
stabilizers. In soft capsules, the active ingredients may be
dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. All formulations for oral administration
should be in dosages suitable for the chosen route of
administration.
[0466] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0467] For administration by inhalation, the active ingredients for
use according to the present invention are conveniently delivered
in the form of an aerosol spray presentation from a pressurized
pack or a nebulizer with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichloro-tetrafluoroethane or carbon dioxide. In the case of a
pressurized aerosol, the dosage unit may be determined by providing
a valve to deliver a metered amount. Capsules and cartridges of,
e.g., gelatin for use in an inhaler or insufflator may be
formulated containing a powder mix of the active ingredient and a
suitable powder base such as lactose or starch.
[0468] The active ingredients described herein may be formulated
for parenteral administration, e.g., by bolus injection or
continuous infusion. Formulations for injection may be presented in
unit dosage form, e.g., in ampoules or in multidose containers with
optionally, an added preservative. The compositions may be
suspensions, solutions or emulsions in oily or aqueous vehicles,
and may contain formulatory agents such as suspending, stabilizing
and/or dispersing agents.
[0469] Pharmaceutical compositions for parenteral administration
include aqueous solutions of the active preparation in
water-soluble form. Additionally, suspensions of the active
ingredients may be prepared as appropriate oily injection
suspensions. Suitable lipophilic solvents or vehicles include fatty
oils such as sesame oil, or synthetic fatty acids esters such as
ethyl oleate, triglycerides or liposomes. Aqueous injection
suspensions may contain substances, which increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol or
dextran. Optionally, the suspension may also contain suitable
stabilizers or agents which increase the solubility of the active
ingredients to allow for the preparation of highly concentrated
solutions.
[0470] In a preferred embodiment, the composition is formulated in
accordance with routine procedures as a pharmaceutical composition
adapted for intravenous administration to human beings. Typically,
pharmaceutical compositions for intravenous administration are
solutions in sterile isotonic aqueous buffer. Generally, the
ingredients are supplied either separately or mixed together in
unit dosage form, for example, as a dry lyophilized powder or water
free concentrate in a hermetically sealed container such as an
ampoule or sachette indicating the quantity of active agent. Where
the composition is to be administered by infusion, it can be
dispensed with an infusion bottle containing sterile pharmaceutical
grade water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0471] The pharmaceutical compositions of the invention can be
formulated as neutral or salt forms. Pharmaceutically acceptable
salts include those formed with anions such as those derived from
hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and
those formed with cations such as those derived from sodium,
potassium, ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0472] The active ingredients of the present invention may also be
formulated in rectal compositions such as suppositories or
retention enemas, using, e.g., conventional suppository bases such
as cocoa butter or other glycerides.
[0473] The pharmaceutical compositions herein described may also
comprise suitable solid of gel phase carriers or excipients.
Examples of such carriers or excipients include, but are not
limited to, calcium carbonate, calcium phosphate, various sugars,
starches, cellulose derivatives, gelatin and polymers such as
polyethylene glycols.
[0474] The topical route is optionally performed, and is assisted
by a topical carrier. The topical carrier is one which is generally
suited for topical active ingredient administration and includes
any such materials known in the art. The topical carrier is
selected so as to provide the composition in the desired form,
e.g., as a liquid or non-liquid carrier, lotion, cream, paste, gel,
powder, ointment, solvent, liquid diluent, drops and the like, and
may be comprised of a material of either naturally occurring or
synthetic origin. It is essential, clearly, that the selected
carrier does not adversely affect the active agent or other
components of the topical formulation, and which is stable with
respect to all components of the topical formulation. Examples of
suitable topical carriers for use herein include water, alcohols
and other nontoxic organic solvents, glycerin, mineral oil,
silicone, petroleum jelly, lanolin, fatty acids, vegetable oils,
parabens, waxes, and the like. Preferred formulations herein are
colorless, odorless ointments, liquids, lotions, creams and
gels.
[0475] Ointments are semisolid preparations, which are typically
based on petrolatum or other petroleum derivatives. The specific
ointment base to be used, as will be appreciated by those skilled
in the art, is one that will provide for optimum active ingredients
delivery, and, preferably, will provide for other desired
characteristics as well, e.g., emolliency or the like. As with
other carriers or vehicles, an ointment base should be inert,
stable, nonirritating and nonsensitizing. As explained in
Remington: The Science and Practice of Pharmacy, 19th Ed. (Easton,
Pa.: Mack Publishing Co., 1995), at pages 1399-1404, ointment bases
maybe grouped in four classes: oleaginous bases; emulsifiable
bases; emulsion bases; and water-soluble bases. Oleaginous ointment
bases include, for example, vegetable oils, fats obtained from
animals, and semisolid hydrocarbons obtained from petroleum.
Emulsifiable ointment bases, also known as absorbent ointment
bases, contain little or no water and include, for example,
hydroxystearin sulfate, anhydrous lanolin and hydrophilic
petrolatum. Emulsion ointment bases are either water-in-oil (W/O)
emulsions or oil-in-water (O/W) emulsions, and include, for
example, cetyl alcohol, glyceryl monostearate, lanolin and stearic
acid. Preferred water-soluble ointment bases are prepared from
polyethylene glycols of varying molecular weight; again, reference
may be made to Remington: The Science and Practice of Pharmacy for
further information.
[0476] Lotions are preparations to be applied to the skin surface
without friction, and are typically liquid or semiliquid
preparations, in which solid particles, including the active agent,
are present in a water or alcohol base. Lotions are usually
suspensions of solids, and may comprise a liquid oily emulsion of
the oil-in-water type. Lotions are preferred formulations herein
for treating large body areas, because of the ease of applying a
more fluid composition. It is generally necessary that the
insoluble matter in a lotion be finely divided. Lotions will
typically contain suspending agents to produce better dispersions
as well as active ingredients useful for localizing and holding the
active agent in contact with the skin, e.g., methylcellulose,
sodium carboxymethylcellulose, or the like.
[0477] Creams containing the selected active ingredients are, as
known in the art, viscous liquid or semisolid emulsions, either
oil-in-water or water-in-oil. Cream bases are water-washable, and
contain an oil phase, an emulsifier and an aqueous phase. The oil
phase, also sometimes called the "internal" phase, is generally
comprised of petrolatum and a fatty alcohol such as cetyl or
stearyl alcohol; the aqueous phase usually, although not
necessarily, exceeds the oil phase in volume, and generally
contains a humectant. The emulsifier in a cream formulation, as
explained in Remington, supra, is generally a nonionic, anionic,
cationic or amphoteric surfactant.
[0478] Gel formulations are preferred for application to the scalp.
As will be appreciated by those working in the field of topical
active ingredients formulation, gels are semisolid, suspension-type
systems. Single-phase gels contain organic macromolecules
distributed substantially uniformly throughout the carrier liquid,
which is typically aqueous, but also, preferably, contain an
alcohol and, optionally, an oil.
[0479] Various additives, known to those skilled in the art, may be
included in the topical formulations of the invention. For example,
solvents may be used to solubilize certain active ingredients
substances. Other optional additives include skin permeation
enhancers, opacifiers, anti-oxidants, gelling agents, thickening
agents, stabilizers, and the like.
[0480] The topical compositions of the present invention may also
be delivered to the skin using conventional dermal-type patches or
articles, wherein the active ingredients composition is contained
within a laminated structure, that serves as a drug delivery device
to be affixed to the skin. In such a structure, the active
ingredients composition is contained in a layer, or "reservoir",
underlying an upper backing layer. The laminated structure may
contain a single reservoir, or it may contain multiple reservoirs.
In one embodiment, the reservoir comprises a polymeric matrix of a
pharmaceutically acceptable contact adhesive material that serves
to affix the system to the skin during active ingredients delivery.
Examples of suitable skin contact adhesive materials include, but
are not limited to, polyethylenes, polysiloxanes, polyisobutylenes,
polyacrylates, polyurethanes, and the like. The particular
polymeric adhesive selected will depend on the particular active
ingredients, vehicle, etc., i.e., the adhesive must be compatible
with all components of the active ingredients-containing
composition. Alternatively, the active ingredients-containing
reservoir and skin contact adhesive are present as separate and
distinct layers, with the adhesive underlying the reservoir which,
in this case, may be either a polymeric matrix as described above,
or it may be a liquid or hydrogel reservoir, or may take some other
form.
[0481] The backing layer in these laminates, which serves as the
upper surface of the device, functions as the primary structural
element of the laminated structure and provides the device with
much of its flexibility. The material selected for the backing
material should be selected so that it is substantially impermeable
to the active ingredients and to any other components of the active
ingredients-containing composition, thus preventing loss of any
components through the upper surface of the device. The backing
layer may be either occlusive or non-occlusive, depending on
whether it is desired that the skin become hydrated during active
ingredients delivery. The backing is preferably made of a sheet or
film of a preferably flexible elastomeric material. Examples of
polymers that are suitable for the backing layer include
polyethylene, polypropylene, and polyesters.
[0482] During storage and prior to use, the laminated structure
includes a release liner. Immediately prior to use, this layer is
removed from the device to expose the basal surface thereof, either
the active ingredients reservoir or a separate contact adhesive
layer, so that the system may be affixed to the skin. The release
liner should be made from an active ingredients/vehicle impermeable
material.
[0483] Such devices may be fabricated using conventional
techniques, known in the art, for example by casting a fluid
admixture of adhesive, active ingredients and vehicle onto the
backing layer, followed by lamination of the release liner.
Similarly, the adhesive mixture may be cast onto the release liner,
followed by lamination of the backing layer. Alternatively, the
active ingredients reservoir may be prepared in the absence of
active ingredients or excipient, and then loaded by "soaking" in an
active ingredients/vehicle mixture.
[0484] As with the topical formulations of the invention, the
active ingredients composition contained within the active
ingredients reservoirs of these laminated system may contain a
number of components. In some cases, the active ingredients may be
delivered "neat," i.e., in the absence of additional liquid. In
most cases, however, the active ingredients will be dissolved,
dispersed or suspended in a suitable pharmaceutically acceptable
vehicle, typically a solvent or gel. Other components, which may be
present, include preservatives, stabilizers, surfactants, and the
like.
[0485] Pharmaceutical compositions suitable for use in context of
the present invention include compositions wherein the active
ingredients are contained in an amount effective to achieve the
intended purpose. More specifically, a therapeutically effective
amount means an amount of active ingredient effective to prevent,
alleviate or ameliorate symptoms of disease or prolong the survival
of the subject being treated.
[0486] Determination of a therapeutically effective amount is well
within the capability of those skilled in the art, especially in
light of the detailed disclosure provided herein.
[0487] For any active ingredient used in the methods of the
invention, the therapeutically effective amount or dose can be
estimated initially from activity assays in animals. For example, a
dose can be formulated in animal models to achieve a circulating
concentration range that includes the IC.sub.50 as determined by
activity assays.
[0488] Toxicity and therapeutic efficacy of the active ingredients
described herein can be determined by standard pharmaceutical
procedures in experimental animals, e.g., by determining the
IC.sub.50 and the LD.sub.50 (lethal dose causing death in 50% of
the tested animals) for a subject active ingredient. The data
obtained from these activity assays and animal studies can be used
in formulating a range of dosage for use in human. For example,
therapeutically effective doses suitable for treatment of genetic
disorders can be determined from the experiments with animal models
of these diseases.
[0489] The dosage may vary depending upon the dosage form employed
and the route of administration utilized. The exact formulation,
route of administration and dosage can be chosen by the individual
physician in view of the patient's condition. (See e.g., Fingl, et
al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.
1).
[0490] Dosage amount and interval may be adjusted individually to
provide plasma levels of the active moiety which are sufficient to
maintain the modulating effects, termed the minimal effective
concentration (MEC). The MEC will vary for each preparation, but
may optionally be estimated from whole animal data.
[0491] Dosage intervals can also be determined using the MEC value.
Preparations may optionally be administered using a regimen, which
maintains plasma levels above the MEC for 10-90% of the time,
preferable between 30-90% and most preferably 50-90%.
[0492] Depending on the severity and responsiveness of the
condition to be treated, dosing can also be a single administration
of a slow release composition described hereinabove, with course of
treatment lasting from several days to several weeks or until cure
is effected or diminution of the disease state is achieved.
[0493] Suppositories generally contain active ingredient in the
range of from about 0.5% to about 10% by weight; oral formulations
preferably contain from about 10% to about 95% active
ingredient.
[0494] The amount of a composition to be administered will, of
course, be dependent on the subject being treated, the severity of
the affliction, the manner of administration, the judgment of the
prescribing physician, etc.
[0495] Compositions of the present invention may, if desired, be
presented in a pack or dispenser device, such as an FDA approved
kit, which may contain one or more unit dosage forms containing the
active ingredient. The pack may, for example, comprise metal or
plastic foil, such as a blister pack. The pack or dispenser device
may be accompanied by instructions for administration. The pack or
dispenser may also be accompanied by a notice associated with the
container in a form prescribed by a governmental agency regulating
the manufacture, use or sale of pharmaceuticals, which notice is
reflective of approval by the agency of the form of the
compositions or human or veterinary administration. Such notice,
for example, may be of labeling approved by the U.S. Food and Drug
Administration for prescription drugs or of an approved product
insert. Compositions comprising an active ingredient of the
invention formulated in a compatible pharmaceutical carrier may
also be prepared, placed in an appropriate container, and labeled
for treatment of an indicated condition.
[0496] As used herein, the term "modulate" includes substantially
inhibiting, slowing or reversing the progression of a disease,
substantially ameliorating clinical symptoms of a disease or
condition, or substantially preventing the appearance of clinical
symptoms of a disease or condition. A "modulator" therefore
includes an agent which may modulate a disease or condition.
Modulation of viral, protozoa and bacterial infections includes any
effect which substantially interrupts, prevents or reduces any
viral, bacterial or protozoa activity and/or stage of the virus,
bacterium or protozoon life cycle, or which reduces or prevents
infection by the virus, bacterium or protozoon in a subject, such
as a human or lower animal.
[0497] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims. All
publications, patents and patent applications mentioned in this
specification are herein incorporated in their entirety by
reference into the specification, to the same extent as if each
individual publication, patent and patent application was
specifically and individually indicated to be incorporated herein
by reference. In addition, citation or identification of any
reference in this application shall not be construed as an
admission that such reference is available as prior art to the
present invention.
REFERENCES CITED BY NUMERALS
Other References are Cited Within the Text
[0498] 1. Cooper, H. L. Science 1994, 265, 590.
[0499] 2. Gross, L. J. Science 1994, 265, 590-1.
[0500] 3. Page, M. G. Science 1994, 265, 589-90.
[0501] 4. Kotra, L. P.; Haddad, J.; Mobashery, S. Antimicrob.
Agents Chemother. 2000, 44, 3249-3256.
[0502] 5. Davis, B. D. Microbiol. Rev. 1987, 51, 341-350.
[0503] 6. Umezawa, H., Hooper, I. R., Eds. Aminoglycoside
Antibiotics; Springer-Verlag: New York, Heidelberg, 1982.
[0504] 7. Moazed, D.; Noller, H. F. Nature 1987, 327, 389-394.
[0505] 8. Woodcock, J.; Moazed, D.; Cannon, M.; Davies, J.; Noller,
H. F. EMBO J. 1991, 10, 3099-3103.
[0506] 9. Wright, G. D.; Berghuis, A. M.; Mobashery, S. Adv. Exp.
Med. Biol. 1998, 456, 27-69.
[0507] 10. Fong, D. H.; Berghuis, A. M. EMBO J. 2002, 21,
2323-2331.
[0508] 11. For the recent review see: Ye, X.-S.; Zhang, L.-H. Curr.
Med. Chem. 2002, 9, 929-939.
[0509] 12. For representative studies see: (a) Kumar, V.; Jones, G.
S. Jr.; Blacksberg, I.; Remers, W. A. J. Med. Chem. 1980, 23,
42-49. (b) Yoshikawa, M.; Ikeda, Y.; Takenaka, K. Chem. Lett. 1984,
2097-2100. (c) Girodeau, J.-M.; Pineau, R.; Masson, M.; Le Goffic,
F. J. Antibiot. 1984, 37, 150-158. (d) Alper, P. B.; Hendrix, M.;
Sears, P.; Wong, C.-H. J. Am. Chem. Soc. 1998, 120, 1965-1978. (e)
Greenberg, W. A.; Priestley, E. S.; Sears, P. S.; Alper, P. B.;
Rosenbohm, C.; Hendrix, M.; Hung, S.-C.; Wong, C.-H. J. Am. Chem.
Soc. 1999, 121, 6527-6541. (f) Wang, J.; Li, J.; Tuttle, D.;
Takemoto, J. Y.; Chang, C.-W. T. Org. Lett. 2002, 3997-4000. (g)
Hanessian, S.; Tremblay, M.; Swayze, E. Tetrahedron 2003, 59,
983-993.
[0510] 13. Haddad, J.; Kotra, L. P.; Liano-Sotel, B.; Kim, C.;
Azucena, E. F., Jr.; Liu, M.; Vakulenko, S. B.; Chow, C. S.;
Mobashery, S. J. Am. Chem. Soc. 2002, 124, 3229-3237.
[0511] 14. Sucheck, S. J.; Wong, A. L.; Koeller, K. M.; Boehr, D.
D.; Draker, K.-a.; Sears, P.; Wright, G. D.; Wong, C.-H. J. Am.
Chem. Soc. 2000, 122, 523-524.
[0512] 15. Dixon, T. C.; Meselson, M.; Guillemin, J.; Hanna, P. C.
N. Engl. J. Med. 1999, 341, 815.
[0513] 16. Duesbery, N. S.; Vande Woude, G. F. Cell Mol. Life Sci.
1999, 55, 1599.
[0514] 17. Montecucco, C.; Tonello, F.; Zanotti, G. Trends Biochem.
Sci. 2004, 29, 282.
[0515] 18. Ascenzi, P.; Visca, P.; Ippolito, G.; Spallarossa, A.;
Bolognesi, M.; Montecucco, C. FEBS Lett. 2002, 531, 384.
[0516] 19. Duesbery, N. S.; Webb, C. P.; Leppla, S. H.; Gordon, V.
M.; Klimpel, K. R.; Copeland, T. D.; Ahn, N. G.; Oskarsson, M. K.;
Fukasawa, K.; Paull, K. D.; Vande Woude, G. F. Science 1998, 280,
734; Vitale, G.; Bernardi, L.; Napolitani, G.; Mock, M.;
Montecucco, C.; Biochem. J. 2000, 352 Pt 3, 739; H. Enslen, R. J.
Davis, Biol. Cell 2001, 93, 5.
[0517] 20. Maly, D. J.; Choong, I. C.; Ellman, J. A. Proc. Natl.
Acad. Sci. U.S.A. 2000, 97, 2419; Bunyapaiboonsri, T.; Ramstrom,
O.; Lohmann, S.; Lehn, J. M.; Peng, L.; Goeldner, M. ChemBiochem.
2001, 2, 438.
[0518] 21. Tonello, F.; Seveso, M.; Marin, O.; Mock, M.;
Montecucco, C. Nature 2002, 418, 386; Panchal, R. G.; Hermone, A.
R.; Nguyen, T. L.; Wong, T. Y.; Schwarzenbacher, R.; Schmidt, J.;
Lane, D.; McGrath, C.; Turk, B. E.; Burnett, J.; Aman, M. J.;
Little, S.; Sausville, E. A.; Zaharevitz, D. W.; Cantley, L. C.;.
Liddington, R. C ; Gussio, R.; Bavari, S. Nat. Struct. Mol. Biol.
2004, 11, 67; Dell'Aica, I.;. Dona, M.; Tonello, F.; Piris, A.;
Mock, M.; Montecucco, C.; Garbisa, S. EMBO Rep. 2004, 5, 418.
[0519] 22. Turk, B. E.; Wong, T. Y.; Schwarzenbacher, R.; Jarrell,
E. T.; Leppla, S. H.; Collier, R. J.; Liddington, R. C.; Cantley,
L. C. Nat. Struct. Mol. Biol. 2004, 11, 60.
[0520] 23. (a)Umezawa, H.; Umezawa, S.; Tsuchiya, T.; Okazaki, Y.
J. Antibiot. 1971, 24, 485-487. (b) Kawaguchi, H; Naito, T.;
Nakagawa, S.; Fujisawa, K. J. Antibiot. 1972, 25, 695-708.24.
Kondo, S.; Hotta, K. J. Infect. Chemother. 1999, 5, 1-9.
[0521] 25. Carter, A. P.; Clemons, W. M.; Brodersen, D. E.;
Morgan-Warren, .R. J.; Wimberly, B. T.; Ramakrishnan, V. Nature,
2000, 407, 340-348.
[0522] 26. Michael, K.; Wang, H.; Tor, Y. Bioorg. Med. Chem. 1999,
7, 1361-1371.
[0523] 27. Sucheck, S. J.; Wong, A. L.; Koeller, K. M.; Boehr, D.
D.; Draker, K.-a.; Sears, P.; Wright, G. D.; Wong, C.-H. J. Am.
Chem. Soc. 2000, 122, 523-524.
[0524] 28. Wang, H.; Tor, Y. Angew. Chem., Int. Ed. 1998, 32,
109-111.
[0525] 29. For the interaction of unstructured diamines with RNA
see: (a) Yoshinari, K.; Yamazaki, K.; Komiyama, M. J. Am. Chem.
Soc., 1991, 113, 5899. (b) Komiyama, M.; Yoshinari, K. J. Org.
Chem., 1997, 62, 2155-2160. (c) See also Kirk, S. R.; Tor, Y. Chem.
Commun. 1998, 147-148.
[0526] 30. For the favorable interaction of the .beta.-hydroxyamine
moiety in sugars with the phosphodiester group and the Hoogsteen
face of guanine residues in RNA see: Hendrix, M.; Alper, P. B.;
Priestley, E. S.; Wong, C.-H. Angew. Chem., Int. Ed. Engl. 1997,
36, 95-98.
[0527] 31. For the interaction of ribofuranoses see: (a) Han, M.
J.; Yoo, K. S.; Cho, T. J.; Chang, J. Y.; Cha, Y. J.; Nam, S. H.
Chem. Commun. 1997, 163-164. (b) Han, M. J.; Yoo, K. S.; Kim, K.H.;
Lee, G. H.; Chang, J. Y. Macromolecules 1997, 30, 5408-5415. (c)
Han, M. J.; Yoo, K. S.; Kim, Y. H.; Chang, J. Y. Tet. Lett. 2002,
43, 5597-5600.
[0528] 32. Kohen, A.; Jakob, A.; Baasov, T. Eur. J. Biochem. 1992,
208, 443-449.
[0529] 33. Solomon, D.; Fridman, M.; Zhang, J.; Baasov, T. Org.
Lett. 2001, 3, 4311-4314.
[0530] 34. Fridman, M.; Solomon, D.; Yogev, S.; Baasov, T. Org.
Lett. 2002, 4, 281-283.
[0531] 35. Mingeot-Leclercq, M-P.; Glupczynski, Y.; Tulkens, P. M.
Antimicrob. Agents Chemother. 1999, 43, 727-737.
[0532] 36. Forge, A.; Schacht, J. Audiol. Neuro-Otiol. 2000, 5,
3-22.
[0533] 37. Arya, D. P.; Micovoc, L.; Charles, I.; Lane Coffee, R
L.; Willis, Jr. B.; Xue, L. J. Am. Chem. Soc. 2003, 125,
3733-3744.
[0534] 38. Wu, B.; Yang, J.; He, Y.; Swayze, E. E. Org. Lett. 2002,
4, 3455-3458.
[0535] 39. Moriarty, R. M.; Zhuang, H.; Penamasta, R.; Liu, K.;
Awasthi, A. K.; Tuladhar, S. M.; Rao, M. S. C.; Singf, V. K.
Tetrahedron Lett. 1993, 34, 8029-8032.
[0536] 40. Bandgar, B. P.; Sadavarte, V. S.; Upalla, L. S. Chem.
Lett. 2000, 1304.
[0537] 41 (a) Komiyama, M.; Inokawa, T. J. Biochem. 1994, 116,
719-720; (b) Shinozuka, K.; Shimizu, K.; Nakashima, Y Bioorg. Med.
Chem. Lett. 1994, 4, 1979-1982.
[0538] 42. (a) Yoshinari, K.; Komiyama, M. Chem. Lett. 1990,
519-522; (b) Komiyama, M.; Yoshinari, K. J. Org. Chem. 1997, 62,
2155-2160.
[0539] 43. Oivanen, M.; Kuusela, S.; Lonnberg, H. Chem. Rev. 1998,
98, 961-990.
[0540] 44. Kirk, S. R.; Tor, Y. Chem. Commun. 1998, 147-148.
[0541] 45. Wang, H.; Tor, Y. J. Am. Chem. Soc. 1997, 119,
8734-8735.
[0542] 46. Breslow, R.; Chapman, W. H. Jr. Proc. Nat. Acad. Sci.
1996, 93, 10018-10021.
[0543] 47. Burk, D. L.; Hon, W. C.; Leung, A. K.-W.; Berghuis, A.
-M. Biochemistry 2001, 40, 8756-8764.
[0544] 48. Hon, W. C.; McKay, G. A.; Thompson, P. R.; Sweet, R. M.;
Yang, D. S.; Wright, G. D.; Berghuis, A. M. Cell 1997, 89,
887-895.
[0545] 49. Fridman, M.; Belakhov, V.; Yaron, S.; Baasov, T. Org.
Lett. 2003, 5, 3575-3578.
[0546] 50. Dixon, M., Meselson, J., Guillemin, P. C., Hanna C. N.
Engl. J. Med. 1999, 341, 815.
* * * * *