U.S. patent application number 10/741119 was filed with the patent office on 2005-06-23 for methods and systems for characterizing a polymer.
Invention is credited to Myerholtz, Carl, Pittaro, Richard J., Tom-Moy, May.
Application Number | 20050136408 10/741119 |
Document ID | / |
Family ID | 34523220 |
Filed Date | 2005-06-23 |
United States Patent
Application |
20050136408 |
Kind Code |
A1 |
Tom-Moy, May ; et
al. |
June 23, 2005 |
Methods and systems for characterizing a polymer
Abstract
Methods and systems for characterizing a polymer in a sample are
provided. In the subject methods, a sample that includes a polymer
labeled with at least one nanoparticle is contacted with a nanopore
under conditions so that the polymer translocates through the
nanopore. A signal is read from the nanopore to characterize the
translocated polymer. The subject systems include a nanopore device
and a polymer that is labeled with at least one nanoparticle. Also
provided is programming stored on a computer-readable medium for
use in practicing the subject methods. Kits for use in practicing
the subject methods are also provided.
Inventors: |
Tom-Moy, May; (San Carlos,
CA) ; Pittaro, Richard J.; (San Carlos, CA) ;
Myerholtz, Carl; (Cupertino, CA) |
Correspondence
Address: |
AGILENT TECHNOLOGIES, INC.
INTELLECTUAL PROPERTY ADMINISTRATION, LEGAL DEPT.
P.O. BOX 7599
M/S DL429
LOVELAND
CO
80537-0599
US
|
Family ID: |
34523220 |
Appl. No.: |
10/741119 |
Filed: |
December 19, 2003 |
Current U.S.
Class: |
435/6.12 ;
435/287.2; 435/6.1; 702/20 |
Current CPC
Class: |
C12Q 1/6816 20130101;
C12Q 1/6816 20130101; C12Q 1/6874 20130101; C12Q 2565/631 20130101;
C12Q 2563/155 20130101; C12Q 2563/155 20130101; C12Q 2565/631
20130101; C12Q 1/6874 20130101; G01N 33/48721 20130101 |
Class at
Publication: |
435/006 ;
435/287.2; 702/020 |
International
Class: |
C12Q 001/68; G06F
019/00; G01N 033/48; G01N 033/50; C12M 001/34 |
Claims
What is claimed is:
1. A method of characterizing a polymer in a sample, said method
comprising: (a) contacting said sample comprising said polymer with
a nanopore under conditions so that said polymer translocates
through said nanopore, wherein said polymer is labeled with at
least one nanoparticle label; and (b) reading a signal from said
nanopore to characterize said polymer in said sample.
2. The method of claim 1, wherein said at least one nanoparticle
label is chosen from gold, silver, copper, tin, titanium, iron,
cobalt, aluminum, zinc, bismuth, zirconia, cerium, magnesium,
copper oxide, tin oxide, titanium dioxide, indium tin oxide,
antimony tin oxide, barium titanate and calcium oxide.
3. The method of claim 1, wherein said at least one nanoparticle
label has a diameter that ranges from about 0.5 nm to about 35
nm.
4. The method of claim 2, wherein said polymer is labeled with a
plurality of said nanoparticle labels.
5. The method of claim 4, wherein all of said nanoparticle labels
produce the same detectable signal.
6. The method of claim 4, wherein two or more of said nanoparticle
labels produce different detectable signals.
7. The method of claim 6, wherein said polymer is a nucleic acid
that comprises at least two different types of sub-units and each
different sub-unit is labeled with a different type of nanoparticle
label.
8. The method of claim 1, wherein said at least one nanoparticle
label is a conductive nanoparticle label.
9. The method of claim 1, wherein said at least one nanoparticle
label is a semiconductive nanoparticle label.
10. The method of claim 1, wherein said at least one nanoparticle
label is a magnetic nanoparticle label.
11. The method of claim 1, wherein said reading step comprises
observing the tunneling current effect of said translocation.
12. The method of claim 1, wherein said reading step comprises
observing the resonance tunneling current effect of said
translocation.
13. The method of claim 1, wherein said reading step comprises
observing the ionic current effect of said translocation.
14. The method of claim 1, wherein said reading step comprises
observing the change in magnetic susceptibility.
15. The method of claim 1, wherein said method is a method of
sequencing a nucleic acid.
16. The method of claim 1, wherein said method is a method of
detecting polymorphisms in a nucleic acid.
17. A system for characterizing a polymer in a sample, said system
comprising: (a) a nanopore device; and (b) a polymer that is
labeled with at least one nanoparticle label.
18. The system of claim 16, wherein said polymer is labeled with a
plurality of nanoparticle labels.
19. The system of claim 18, wherein all of said nanoparticle labels
produce the same detectable signal.
20. The system of claim 18, wherein two or more of said
nanoparticle labels produce different detectable signals.
21. The system of claim 20, wherein said polymer comprises at least
two different types of sub-units and each different type of
sub-unit is labeled with a different nanoparticle label, wherein
each different nanoparticle label produces a different detectable
signal.
22. The system of claim 17, further comprising a computer readable
medium comprising programming for characterizing a polymer
according to the method of claim 1.
23. The system of claim 17, wherein said nanopore device is capable
of producing ionic current.
24. The system of claim 17, wherein said nanopore device is capable
of producing electron tunneling current.
25. The system of claim 17, wherein said nanopore device is capable
of producing resonant electron tunneling current.
26. The system of claim 17, wherein said nanopore device is capable
of producing a magnetic circuit.
27. The system of claim 17, wherein said polymer is a nucleic
acid.
28. A computer-readable medium comprising programming for
characterizing a polymer according to claim 1.
29. A kit for use in the characterization of a polymer in a sample,
said kit comprising: (a) at least one nanoparticle label that is
conductive, semiconductive, magnetic or a combination of two or
more thereof; and (b) instructions for using said at least one
nanoparticle label in a method according to claim 1.
30. The kit of claim 29, wherein said kit comprises a plurality of
different types of nanoparticle labels.
31. The kit of claim 29, wherein said kit further includes an
algorithm recorded on a computer-readable medium for practicing
some or all of the method according to claim 1.
Description
FIELD OF THE INVENTION
[0001] The field of this invention is polymer characterization,
particularly nanoparticles for use as detectable labels in nanopore
polymer characterization protocols.
BACKGROUND OF THE INVENTION
[0002] Polymer characterization, including detection and
sequencing, has recently been facilitated by the use of "nanopore"
technology. This technology utilizes nanopores which are
characterized by having dimensions on the order of nanometers.
These nanopores may be naturally occurring pores in cell membranes
(see, for example, U.S. Pat. No. 5,795,782) or
artificially-produced nanopores such as solid state nanopores. Both
types of nanopores have been used to "sense" or "read" the passage
(i.e., translocation) of individual polymers through the nanopores,
which passage yields information, e.g., in the form of electronic
signals, about the passed polymer.
[0003] One way of sensing the passage of a polymer through the pore
is to monitor ionic current through a solution filling the pore
when a voltage is applied across the pore. Monitoring electron
tunneling current and resonance electron tunneling current may also
be employed for this purpose. For example, using ionic current the
polymer of interest enters and passes through the pore, an
electronic signature is generated (for example a reduction in a
maximum current), and the electronic signature is detected, which
indicates that the pore is partly or completely blocked by the
polymer passing therethrough. These electronic signatures, which
are characteristic of a particular polymer, may be used to
distinguish molecules from each other and/or to distinguish the
size of a polymer, e.g., distinguish different lengths of DNA.
[0004] There continues to be an interest in the development of new
methods and systems to characterize polymers using nanopore
technology. Of particular interest is the development of such
methods and systems that employ unique labels that are easy to use
and which provide unique electronic signals.
SUMMARY OF THE INVENTION
[0005] Methods and systems for characterizing a polymer in a sample
are provided. In the subject methods, a sample that includes a
polymer labeled with at least one nanoparticle is contacted with a
nanopore under conditions so that the polymer translocates through
the nanopore. A resultant signal is read from the nanopore to
characterize the translocated polymer. The subject systems include
a nanopore device and a polymer that is labeled with at least one
nanoparticle. Also provided is programming stored on a
computer-readable medium for use in practicing the subject methods.
Kits for use in practicing the subject methods are also
provided.
BRIEF DESCRIPTIONS OF THE DRAWINGS
[0006] FIGS. 1A-1C show exemplary embodiments of a nucleic acid
labeled with one or more nanoparticle labels according to a
representative embodiment of the subject invention. Specifically,
FIG. 1A shows an exemplary embodiment of a nucleic acid labeled
with a single nanoparticle label, FIG. 1B shows an exemplary
embodiment of a nucleic acid labeled with a plurality of the same
type of nanoparticle labels and FIG. 1C shows an exemplary
embodiment of a nucleic acid labeled with four different types of
nanoparticle labels.
[0007] FIG. 2 shows an exemplary embodiment of a nucleic acid
hybridized to a nanoparticle-labeled probe nucleic acid molecule
according to a representative embodiment of the subject
invention.
[0008] FIG. 3 shows an exemplary embodiment of a nucleic acid
hybridized to a plurality of identical nanoparticle labeled
oligonucleotides according to a representative embodiment of the
subject invention.
[0009] FIG. 4 shows an exemplary embodiment of a nucleic acid
hybridized to two different nanoparticle labeled oligonucleotides
according to a representative embodiment of the subject
invention.
[0010] FIG. 5 shows another exemplary embodiment of a nucleic acid
hybridized to a plurality of distinct nanoparticle labeled
oligonucleotides according to a representative embodiment of the
subject invention.
[0011] FIG. 6A shows an exemplary embodiment of a nucleic acid
labeled in accordance with the subject invention being passed
through a pore of a nanopore device according to a representative
embodiment of the subject invention and FIG. 6B shows the signal
produced thereby.
[0012] FIGS. 7A and 7B show an exemplary embodiment of the subject
invention employed to determine the size of a polymer of interest
by labeling the ends of the polymer with nanoparticle labels
according to a representative embodiment of the subject invention.
Specifically, FIG. 7A shows the nanoparticle labeled polymers
passing through a pore of a nanopore device and FIG. 7B shows the
output signal produced thereby.
[0013] FIG. 8 shows an exemplary embodiment of the subject
invention employed as an alternative to a restriction fragment
polymorphism protocol to determine whether any polymorphisms are
present in a nucleic acid according to a representative embodiment
of the subject invention.
[0014] FIGS. 9A and 9B show an exemplary embodiment of the subject
invention employed to sequence a nucleic acid of interest by
labeling each nucleotide with a nanoparticle label according to a
representative embodiment of the subject invention. Specifically,
FIG. 9A shows the nanoparticle labeled nucleic acid passing through
a pore of a nanopore device and FIG. 9B shows an exemplary output
signal produced produced by such a passing.
[0015] FIGS. 10A and 10B show an exemplary embodiment of a nucleic
acid strand labeled in accordance with the subject invention
passing through a pore of a nanopore device (FIG. 10A) and the
output signal produced thereby (FIG. 10B) according to a
representative embodiment of the subject invention.
[0016] FIG. 11 shows an exemplary embodiment of the subject
invention employed in an electron tunneling current protocol
according to a representative embodiment of the subject
invention.
[0017] FIGS. 12A and 12B show exemplary embodiments of unlabeled
DNA passing through tunneling current electrodes and the output
signal produced thereby (FIG. 12A) and nanoparticle labeled DNA
passing through tunneling current electrodes and the output signal
produced thereby (FIG. 12B) according to a representative
embodiment of the subject invention.
[0018] FIGS. 13A and 13B shows an exemplary embodiment of
nanoparticle labeled DNA passing through resonant tunneling current
electrodes and the output signal produced thereby according to a
representative embodiment of the subject invention.
[0019] FIG. 14 shows an exemplary embodiment of a magnetic
detection circuit for detecting magnetic nanoparticle labels in
accordance with the subject invention.
DEFINITIONS
[0020] The term "polymer" refers to any compound that is made up of
two or more monomeric units covalently bonded to each other, where
the monomeric units may be the same or different, such that the
polymer may be a homopolymer or a heteropolymer. Polymers include,
but are not limited to, peptides and polypeptides, polysaccharides,
nucleic acids carbohydrates, polyurethanes, polycarbonates,
polyureas, polyethyleneimines, polyarylene sulfides, polysiloxanes,
polyimides, polyacetates, polyamides, polyesters, polythioesters
and the like, where the polymers may be naturally occurring or
synthetic.
[0021] The term "nucleic acid" as used herein means a polymer
composed of nucleotides, e.g., deoxyribonucleotides or
ribonucleotides, or compounds produced synthetically (e.g., PNA as
described in U.S. Pat. No. 5,948,902 and the references cited
therein) which can hybridize with naturally occurring nucleic acids
in a sequence specific manner analogous to that of two naturally
occurring nucleic acids, e.g., can participate in hybridization
reactions, i.e., cooperative interactions through Pi electrons
stacking and hydrogen bonds, such as Watson-Crick base pairing
interactions, Wobble interactions, etc. Nucleic acids may be single
or double stranded.
[0022] The terms "ribonucleic acid" and "RNA" as used herein mean a
polymer composed of ribonucleotides.
[0023] The terms "deoxyribonucleic acid" and "DNA" as used herein
mean a polymer composed of deoxyribonucleotides.
[0024] The term "oligonucleotide" as used herein denotes single
stranded nucleotide multimers of from about 10 to 100 nucleotides
and up to 200 nucleotides in length.
[0025] The term "polynucleotide" as used herein refers to single or
double stranded polymer composed of nucleotide monomers of
generally greater than 100 nucleotides in length.
[0026] The term "oligomer" is used herein to indicate a chemical
entity that contains a plurality of monomers. As used herein, the
terms "oligomer" and "polymer" are used interchangeably. Examples
of oligomers and polymers include polydeoxyribonucleotides (DNA),
polyribonucleotides (RNA), other polynucleotides which are
C-glycosides of a purine or pyrimidine base, polypeptides
(proteins), polysaccharides (starches, or polysugars), and other
chemical entities that contain repeating units of like chemical
structure.
[0027] The terms "nucleoside" and "nucleotide" are intended to
include those moieties which contain not only the known purine and
pyrimidine bases, but also other heterocyclic bases that have been
modified. Such modifications include methylated purines or
pyrimidines, acylated purines or pyrimidines, alkylated riboses or
other heterocycles. In addition, the terms "nucleoside" and
"nucleotide" include those moieties that contain not only
conventional ribose and deoxyribose sugars, but other sugars as
well. Modified nucleosides or nucleotides also include
modifications on the sugar moiety, e.g., wherein one or more of the
hydroxyl groups are replaced with halogen atoms or aliphatic
groups, or are functionalized as ethers, amines, or the like.
[0028] "Optional" or "optionally" means that the subsequently
described circumstance may or may not occur, so that the
description includes instances where the circumstance occurs and
instances where it does not.
[0029] "Quantum dots" or "nanocrystals" herein used interchangeably
are known in the art and are generally nanosized semiconductors
that fluoresce (see, for example, Bruchez et al (1998)
Semiconductor nanocrystals as fluorescent biological labels.
Science 281, 2013-2016 and Chan, W. C. et al (1998) Quantum dot
bioconjugates for ultrasensitive nonisotopic detection. Science
281, 2016-2018).
[0030] A "computer-based system" refers to the hardware means,
software means, and data storage means used to perform certain
functions and/or analyze the information of the present invention.
The minimum hardware of the computer-based systems of the present
invention may include a central processing unit (CPU), input means,
output means, and data storage means. A skilled artisan can readily
appreciate that any one of the currently available computer-based
systems are suitable for use in the present invention. The data
storage means may include any manufacture including a recording of
information relating to the subject invention, or memory access
means that can access such a manufacture.
[0031] To "record" data, programming or other information on a
computer-readable medium refers to a process for storing
information, using any such methods as are known in the art. Any
convenient storage structure may be chosen, based on the means to
access the stored information. A variety of data processor programs
and formats may be used for data storage, e.g., word processing
text file, databases format, etc.
[0032] A "processor" references any hardware and/or software
combination that will perform the functions required of it. For
example, a processor herein may be a programmable digital
microprocessor such as available in the form of an electronic
controller, mainframe, server or personal computer (desktop or
portable). Suitable programming may be communicated from a remote
location to the processor, or previously saved in a computer
program product (such as a portable or fixed computer-readable
storage medium, whether magnetic, optical or solid state device
based). For example, a magnetic or optical disk may carry the
programming, and can be read by a suitable disk reader
communicating with a respective processor at its corresponding
station.
DETAILED DESCRIPTION OF THE INVENTION
[0033] Methods and systems for characterizing a polymer in a sample
are provided. In the subject methods, a sample that includes a
polymer labeled with at least one nanoparticle is contacted with a
nanopore under conditions so that the polymer translocates through
the nanopore. A signal is read from the nanopore to characterize
the translocated polymer. The subject systems include a nanopore
device and a polymer that is labeled with at least one nanoparticle
to provide a nanoparticle label. Also provided is programming
stored on a computer-readable medium for use in practicing the
subject methods. Kits for use in practicing the subject methods are
also provided.
[0034] Before the present invention is described, it is to be
understood that this invention is not limited to particular
embodiments described, as such may, of course, vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
be limiting, since the scope of the present invention will be
limited only by the appended claims.
[0035] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range is encompassed within the invention. The
upper and lower limits of these smaller ranges may independently be
included in the smaller ranges also encompassed within the
invention, subject to any specifically excluded limit in the stated
range. Where the stated range includes one or both of the limits,
ranges excluding either or both of those included limits are also
included in the invention.
[0036] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited.
[0037] It must be noted that as used herein and in the appended
claims, the singular forms "a", "an", and "the" include plural
referents unless the context clearly dictates otherwise.
[0038] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
[0039] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which may be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present invention.
[0040] The figures shown herein are not necessarily drawn to scale,
with some components and features being exaggerated for
clarity.
[0041] Overview
[0042] As noted above, a feature of the subject invention is that
the nanopore detected polymers, e.g., nanopore detected nucleic
acids, are labeled with one or more nanoparticles. In general, the
nanoparticle labeled polymers of the subject invention are capable
of generating a distinctive, reproducible signal when passed or
translocated through a nanopore. Translocation may be accomplished
by employing an applied electric field, using atomic force
tweezers, a magnetic force, and the like, i.e., any suitable method
of moving a polymer through a nanopore. Signal generated from the
nanoparticle labeled polymer upon passage through a nanopore is
unique such that it is substantially different from a signal
detected from the nanopore without a polymer therein or different
from signal detected from the nanopore having the same polymer
absent such a nanoparticle label translocated therethrough or
different from the nanopore having the same polymer labeled with a
different nanoparticle label. This detectable signal may be used in
a variety of polymer characterization protocols, e.g., to determine
the size of a polymer (e.g., a label positioned at the first and
last positions of a polymer) and/or to identify each unit of a
multi unit polymer and/or unit type and/or unit position within the
polymer, etc. As such, the subject methods may be used in a variety
of different applications.
[0043] In further describing the subject invention, the subject
methods are described first, followed by a review of representative
applications in which the subject methods find use, as well as a
review of representative systems and kits that may be used in the
practice of the subject methods.
[0044] Methods
[0045] As summarized above, the subject methods include labeling a
polymer of interest with one or more nanoparticle labels to produce
a nanoparticle labeled polymer. Once labeled, the polymer is passed
or translocated through a nanopore providing distinctive,
reproducible signals corresponding to each particular nanoparticle
label attached to the polymer. Passage or translocation of the
nanoparticle labeled polymer through the nanopore generates a
detectable signal, which may be detected according to a variety of
different protocols. The resultant detected signal is then employed
to characterize the labeled polymer. As such, the subject methods
can be viewed as including the following four substeps:
[0046] a) providing a nanoparticle labeled polymer;
[0047] b) translocating the nanoparticle labeled polymer through a
nanopore;
[0048] c) detecting a signal generated by the translocation of the
polymer; and
[0049] d) employing the detected signal to characterize the
polymer.
[0050] Each of the above substeps is now described separately in
greater detail below.
[0051] Provision of Nanoparticle Labeled Polymer
[0052] As indicated above, generally the first step in the subject
methods is to label a polymer of interest with one or more
nanoparticles to produce a nanoparticle labeled polymer. Before
elaborating further on various representative embodiments of
producing a nanoparticle labeled polymer, representative types of
polymers and nanoparticles that may be employed to label the same
are reviewed first in greater detail.
[0053] Representative Polymers
[0054] The term "polymer" as described above, refers to any
compound that is made up of two or more units or monomeric units or
subunits covalently bonded to each other, where the monomeric units
may be the same or different, such that the polymer may be a
homopolymer or a heteropolymer. Representative polymers include,
but are not limited to, peptides and polypeptides, polysaccharides,
nucleic acids (double and single stranded), carbohydrates,
polyurethanes, polycarbonates, polyureas, polyethyleneimines,
polyarylene sulfides, polysiloxanes, polyimides, polyacetates,
polyamides, polyesters, polythioesters and the like, where the
polymers may be naturally occurring or synthetic. The polymer to be
characterized may be of any suitable size, with the only limitation
being that it is able to translocate through a nanopore.
[0055] The subject invention is particularly well suited for
characterizing a nucleic acid, e.g., the subject invention may be
employed to identify and/or discriminate between sequences of a
nucleic acid or nucleotides of a nucleic acid. The term "nucleic
acid" as used herein means a polymer composed of nucleotides, e.g.,
deoxyribonucleotides or ribonucleotides, or compounds produced
synthetically (e.g., PNA as described in U.S. Pat. No. 5,948,902
and the references cited therein) which can hybridize with
naturally occurring nucleic acids in a sequence specific manner
analogous to that of two naturally occurring nucleic acids, e.g.,
can participate in hybridization reactions, i.e., cooperative
interactions through Pi electrons stacking and hydrogen bonds, such
as Watson-Crick base pairing interactions, Wobble interactions,
etc. The subject invention may be used with any nucleic acid either
naturally occurring or synthetic and may be single or double
stranded.
[0056] While the subject nanoparticle labels are primarily
described herein with respect to the characterization of nucleic
acids, it will be readily apparent to those of skill in the art
that a wide variety of polymers or constituents or analytes may be
employed other than nucleic acids. Other constituents include both
naturally occurring and synthetic constituents, e.g., biological
analytes such as antibodies, receptors, ligands, proteins, viruses,
bacteria, toxins, etc., and environmental constituents, e.g.,
toxins, pollutants, etc., and the like.
[0057] A polymer to be characterized in accordance with the subject
invention may be naturally occurring or synthetic. For example, the
sample that is screened in the subject invention, i.e., the sample
containing or suspected of containing the polymer to be
characterized, may be obtained from a variety of sources. Samples,
as used herein, include, but are not limited to, biological fluids
such as blood, cerebrospinal fluid, tears, saliva, lymph, dialysis
fluid, semen and the like; organ or tissue culture derived fluids;
food and fluids extracted from cells or physiological tissues,
where the cells may be dissociated, in the case of solid tissues,
or tissue sections may be analyzed. In some embodiments, a lysate
of the cells may be prepared. Other samples of interest include
environmental samples, such as plant tissue samples, ground water
samples, soil samples, and derivatives of such samples.
[0058] Nanoparticle Labels
[0059] A number of different types of nanoparticle labels, each
having a distinctive, reproducible signal are provided by the
subject invention and thus a wide variety of polymer labeling
schemes may be employed. For example, a polymer may be labeled with
more than one nanoparticle label where the various nanoparticle
labels employed may provide the same or different signals. For
example, in certain embodiments two or more different types of
nanoparticle labels may be employed to label a given polymer. By
different type of nanoparticle label it is meant that the different
types of nanoparticle labels provide different or rather distinct,
detectable signals upon detection so that the respective signals
may be attributed to the respective nanoparticles. To this end,
different portions or different units of a polymer may be labeled
with a different type of nanoparticle label. As such, each portion
or each labeled unit may be differentially detected as it is passed
through a nanopore by observing, for example ionic, tunneling and
resonance tunneling current. Accordingly, nanoparticle labels may
be considered to be of different types if they provide different,
distinct, detectable signals during translocation through a
nanopore such that their signals are distinguishable from each
other.
[0060] A feature of the subject invention is that the distinctive
signal generated by each different type of nanoparticle label is a
function of at least one of one or more physical and/or chemical
properties of that type of nanoparticle label, e.g., a function of
at least one of (1) the material of the nanoparticle label, and/or
(2) the size of the nanoparticle label. The materials of interest
in the subject invention include those that are conductive,
semi-conductive, magnetic (including superparamagnetic), both
conductive (or semi-conductive) and magnetic. The sizes of the
nanoparticle labels fall within a wide range, thus further
increasing the number of different, distinguishable labels of the
subject invention. Generally, the subject nanoparticle labels are
sized to be stably associated with a polymer and translocated
through a nanopore. Accordingly, the nanoparticle labels of the
subject invention are of nanometer dimensions.
[0061] As described above, in certain embodiments the detectable
change in signal is due at least in part to the material of a
subject nanoparticle label. Accordingly, the subject nanoparticle
labels include a material that is able to elicit or produce a
detectable change in the current, e.g., the ionic current and/or
tunneling and/or resonant tunneling current and/or a change in a
magnetic field or magnetic circuit, during translocations (e.g.,
voltage-driven translocations or the like) of the nanoparticle
label through a nanopore. Accordingly, the nanoparticle labels of
the subject invention include, i.e., are fabricated in whole or in
part from, any suitable material that is capable of eliciting a
detectable change in the current flow, whether ionic, electron, or
the like, or a detectable change in a magnetic circuit through a
nanopore. Such materials may generally be characterized as
conductors, semiconductors, magnetic materials--including materials
that posses more than one of these properties. Accordingly, any
material (or combination of materials) that is conductive,
semiconductive, magnetic, both conductive (or semiconductive) and
magnetic, may be employed as a nanoparticle label in the subject
invention, e.g., any material that is capable of acting like a
conductor or a metal or semiconductor in regards to conductivity
may be employed, as may be any material that is capable of acting
like a magnetic particle in regards to, e.g., modifying magnetic
susceptibility, e.g., such as a ferromagnetic nanoparticle label
and the like. Accordingly, in many embodiments the nanoparticle
labels are highly conductive particles, e.g., high conductivity
metals, where by "high conductivity" is meant that the resistivity
is less than about 10.times.10.sup.-8 Ohm-Meters.
[0062] Representative nanoparticle label materials include, but are
not limited to, metals and metal alloys and oxides thereof, e.g.,
gold, silver, copper, tin, titanium, iron, cobalt, chromium,
molybdeneum, vanadium, aluminum, zinc, bismuth, zirconia, tungsten
carbide, magnesium, cerium, nanoparticle-polymer hybrids, and the
like, alloys thereof and oxides thereof (e.g., copper oxide, tin
oxide, titanium dioxide, indium tin oxide, antimony tin oxide,
barium titanate, calcium oxide), where a given nanoparticle label
may be fabricated from a combination of such materials such that a
given nanoparticle label may be fabricated from two or more
materials. In certain embodiments the nanoparticle label is a
nanocrystal or quantum dot.
[0063] The nanoparticle labels of the subject invention may be a
composite, a laminate, etc. A "composite" is a composition made of
different materials. A nanoparticle composite may be a block
composite, e.g., an A-B block composite, an A-B-A block composite,
an A-B-C block composite, and the like, where the number of
different materials that may be employed may vary depending on the
particular nanoparticle. The composite may be heterogeneous, i.e.,
in which the materials are distinct or in separate phases, or a
homogeneous combination of unlike materials. As used herein, the
term "composite" is used to include a "laminate" composite. A
"laminate" refers to a composite material formed from several
different bonded layers of same or different materials. In certain
embodiments, a nanoparticle label may be fabricated from gold and
silver, e.g., gold coated or layered with silver or vice versa.
Nanoparticles that may be employed in the subject invention
include, but are not limited to, nanoparticles such as Nanotek.RTM.
Copper Oxide, Nanotek.RTM. Indium Tin Oxide, Nanotek.RTM. Titanium
Oxide from Nanophase Technologies Corporation in Illinois and
nanoparticles, such as Nanogold.RTM., from Nanoprobes, Inc., in New
York. Commercially available magnetic nanoparticles may be employed
in certain embodiments, e.g., available from Reade Advanced
Materials, Seradyn, Inc., and Bangs Laboratories, Inc.
[0064] As noted above, one or more nanoparticle labels may be in
the form of semiconductor which may be in the form of a quantum
dot. In certain embodiments, a given nanoparticle label may include
a particle, e.g., a latex bead or the like, filled with a plurality
of quantum dots. Thus, by combining a variety of quantum dots in a
single particle and varying the number and/or type of quantum dots
employed, a variety of different, distinguishable nanoparticle
labels may be provided.
[0065] In many embodiments, a plurality of the subject nanoparticle
labels are stably associated with a given polymer (e.g., different
portions of the polymer or different units that make up the
polymer), where some or all of the nanoparticle labels may be of
different materials (and/or sizes). In such instances, because
these nanoparticle labels differ at least in regards to material,
each interferes with the current or magnetic field or circuit in a
unique way allowing it to be singled-out or distinguished from the
other nanoparticle labels that are of different materials (and/or
sizes) during detection. Accordingly, the nanoparticle labels
associated with a polymer or one or more monomers may be distinctly
detected in their order of appearance through a nanopore. In this
regard, the signals obtained from the different materials of the
nanoparticle labels as they are translocated through a nanopore
differ due at least in part to the different materials of the
nanoparticle labels, e.g., by modifying the electron current flow
within the nanopore with a conductive or semiconductive
nanoparticle, e.g., in tunneling and resonant tunneling protocols.
For example, in certain embodiments at least two nanoparticles
stably associated with a given polymer may be of different
materials such that each interferes with the current or magnetic
field in a unique way due at least in part to the particular
material, e.g., different conductivity properties (e.g., one or
more nanoparticles may be gold and one or more may be silver),
where both are bound to the polymer of interest, e.g., at different
positions or locations of the polymer. For example, one
nanoparticle label may be positioned at one end of a polymer such
as at a first end of a single or double strand length of DNA and
the other nanoparticle label at the other or second end of the
polymer. Accordingly, the length of the DNA may be determined based
on the detection of the nanoparticle labels, e.g., based on the
time differential between detection of the nanoparticle labels. An
analogous protocol may be employed for other types of detection.
For example, in using magnetic particles, one magnetic nanoparticle
label having a first material composition (and/or first
nanoparticle size) may be positioned at one end of a polymer such
as at a first end of a single or double strand length of DNA and a
second magnetic nanoparticle label having the same or having a
second material composition (and/or second nanoparticle size) at
the other or second end of the polymer. Accordingly, the length of
the polymer such as DNA may be determined based on the detection of
the nanoparticle labels, e.g., based on the time differential
between detection of the nanoparticle labels.
[0066] As noted above, the nanoparticle labels of the subject
invention may also be electronically distinguishable due to their
size (and/or material), where the size of a given nanoparticle
label causes a detectable partial or complete blockage of current
flow through the nanopore. As the subject labels are nanoparticles,
they have nanometer dimensions. Specifically, while the size of a
given nanoparticle is large enough to produce a detectable effect
in the current flow or magnetic susceptibility through a nanopore,
the size is small enough to be able to translocate through the
nanopore from one side of the nanopore to another. In other words,
each of the nanoparticle labels are large enough to elicit a
distinctive, reproducible signal and yet small enough that they are
of nanometer proportions.
[0067] For example, the size of a nanoparticle label according to
the subject invention is usually small enough to fit through a
nanopore (either naturally or synthetically produced) having a
diameter that ranges from about 2 nm to about 35 nm, e.g., about
0.5 nm to about 1 nm for a nanopore having a size that is able to
accommodate, e.g., amino acids, sugars and nucleotides. Thus, the
only limitation with respect to the physical dimensions of a
nanoparticle label is that it be able to pass or translocate
through a nanopore from a first side to a second side and also that
it be able to elicit a distinctive, reproducible signal or current
signature (where the signal may be amplified in certain
embodiments) such as a blockade signal or blockade signature or
signal related to a change in magnetic susceptibility, etc.
Accordingly, the nanoparticles have a size that is at least
somewhat smaller than the diameter of the nanopore through which it
is passed. As such, the size of a nanoparticle according to the
subject invention may range from about 0.5 nm to about 35.0 nm,
e.g., from about 0.8 nm to about 30 nm, e.g., from about 0.5 nm to
about 15.0 nm, e.g., from about 0.8 nm to about 5.0 nm.
[0068] In many embodiments, a plurality of the subject nanoparticle
labels are stably associated with a given polymer (e.g., different
portions of the polymer or different units that make up the
polymer) where some or all of the nanoparticle labels may be of
different sizes (and/or materials). In such instances, because
these nanoparticle labels differ at least in regards to size, each
interferes with the current or magnetic field or circuit in a
unique way allowing it to be singled out or distinguished from the
other nanoparticle labels. Accordingly, the nanoparticle labels
associated with a polymer or one or more monomers may be detected
in their order of appearance through a nanopore. In this regard,
the signals obtained from the different sizes of nanoparticles
differ due at least in part to the size differential of the
nanoparticle labels. For example, in certain embodiments at least
two nanoparticle labels may be of different sizes (and/or
materials). For example, in certain embodiments at least two
nanoparticle labels stably associated with a given polymer may be
of different sizes where the sizes differ by an amount that is at
least great enough to provide a distinguishable or unique change in
current such that each interferes with the current in a unique way
due at least in part to size. For example, in certain embodiments
at least two nanoparticle labels stably associated with a given
polymer are of different sizes, e.g., one or more nanoparticles may
be about 0.8 nm and one or more may be about 1.4 nm, where both are
bound to the polymer of interest, e.g., at different positions or
locations of the polymer. Particular sizes of magnetic nanoparticle
labels (and/or material compositions) or ranges thereof may be
accomplished by various techniques such as employing one or more
surfactants such as a combination of oleic acid/oleyl amine to
control the nanoparticle growth during fabrication of the
nanoparticle and/or by varying metal/surfactant ratio or synthesis
temperature during fabrication of a nanoparticle (see, for example,
Baselt, et al., Biosens. Bioelectron 13, 731 (1998)).
[0069] As will be apparent, a number of distinctive nanoparticle
labels, i.e., different nanoparticle types, may be provided by
exploiting one or more physical or chemical properties of the
nanoparticle labels. For example, in certain embodiments signal
obtained from each nanoparticle label employed in a given protocol
may be distinguishable based solely on the sizes, e.g., the
differential in sizes, of the nanoparticle labels employed while in
certain other embodiments signal obtained from each nanoparticle
label employed in a given protocol may be distinguishable based
solely on the material, e.g., the differential in the materials, of
the nanoparticle labels employed. Signal differentiation may also
be accomplished by exploiting two or more properties of the
nanoparticle labels. For example, both nanoparticle size and
nanoparticle material properties may be exploited to interfere with
the current in a unique way such that each nanoparticle label
provides a distinct, distinguishable signal. In other words, by
employing different sized nanoparticle labels with nanoparticle
labels of different sizes, e.g., different sized nanoparticle
labels made of different materials, a variety of detectably
distinguishable nanoparticle labels may be provided.
[0070] Still further, a variety of nanoparticle labels may be
provided by combining different materials with different sizes in a
given protocol so as to increase the number of different
distinguishable nanoparticles that may be employed in a given
protocol, each having unique properties such that the current
signature obtained from a given nanoparticle label is distinct to
that nanoparticle label and is based on the material and size
properties of the nanoparticle label and thus distinguishable from
the signal generated from any other nanoparticle label. For
example, by just permuting two different materials, e.g., gold and
silver, with two different sizes, e.g., 0.8 nm and 1.4 nm, four
different nanoparticle labels may be provided (gold/0.8 nm,
gold/1.4 nm, silver/0.8 run and silver/1.4 nm) where each
nanoparticle label will elicit a reproducible, distinguishable
signal as it translocates through a nanopore. This labeling scheme
may be used, for example, to differentiate between specific
sequences of oligonucleotides or to differentiate between different
units or monomers of a polymer such that each different unit of a
polymer may be labeled with a different, distinguishable
nanoparticle label. Such a labeling scheme may be employed to label
the four different nucleotide types of a nucleic acid such as DNA,
e.g., by stably associating each different nucleotide type with a
specific nanoparticle label to provide differentiation between the
nucleotides, e.g., for sequencing or other characterization
analysis. As a number of different materials and sizes may be
employed in the fabrication of the subject nanoparticle labels in
accordance with the subject invention as described above, it will
be apparent that a large number of different, distinguishable
nanoparticle labels may be employed such that each interferes with
the current in a unique way.
[0071] Nanoparticle Labeling of Polymers
[0072] To produce nanoparticle labeled polymers, each nanoparticle
label is stably bound to a polymer of interest, e.g., bound to a
particular nucleic acid sequence or particular unit or monomeric
residue of a polymer (e.g., a particular nucleotide type). The
nanoparticle labels may be directly or indirectly associated with
the polymer of interest, depending at least in part on the nature
of the polymer to be characterized and the particular application
in which the subject methods are being employed. In direct labeling
approaches, one or more nanoparticles are directly bound to one or
more residues of the polymer. In indirect labeling approaches, one
or more nanoparticles are stably associated with a polymer by
having the nanoparticles stably associated with a polymer binding
moiety that specifically binds to a portion or some or all of the
units of the polymer, e.g., one or more specific nucleotide bases
or residues, e.g., a defined region, of a nucleic acid.
[0073] In direct labeling protocols as summarized above, one or
more residues of the polymer are bound to a nanoparticle label. A
particular monomeric residue of a polymer may be attached either
directly or indirectly to a given nanoparticle label. For example,
a nanoparticle may be directly bound, either covalently or
non-covalently, to a monomeric residue of the polymer.
Alternatively, a linking group may be used for binding a
nanoparticle label to a monomeric residue of the polymer. Certain
linking groups may react with specific moieties of the polymer of
interest, e.g., with thiol, primary amino and carbohydrate groups,
etc. Commercially available linkers of this sort include, but are
not limited to monomaleimido-undecagold, mono-sulfo-NHS-undecagold
and mon-amino undecagold available from Nanoprobes, Inc. The
linking group may be a variety of different moieties, where such
linking groups include, but are not limited to disulfide groups,
restriction sites, photocleavable groups, avidin-biotin conjugates,
strepavidin-biotin conjugates, and the like.
[0074] In a representative embodiment, guanine residues of a
nucleic acid may be labeled with a nanoparticle label as follows.
In this representative embodiment, the Universal Linking System
("ULS"), e.g., Biotin-Chem-Link available from Roche, is employed
to specifically functionalize the guanine residues with biotin. In
this step, to be functionalized nucleic acids are contacted with
Biotin-Chem-Link and nuclease-free water under conditions suitable
to provide for the covalent binding of the biotin to guanine
residues of the nucleic acid. The incubation time for this protocol
should be sufficient for the biotin to bind available guanine
residues. Generally, from about 30 minutes to about 1 hr is
sufficient, usually 30 minutes sufficing. Incubation is generally
performed at temperatures that range from about 75.degree. C. to
about 90.degree. C., usually about 85.degree. C. After incubation,
the reaction is stopped with a suitable stop reagent. The
biotin-conjugated probes are then contacted with
strepavidin-conjugated nanoparticle labels under conditions
sufficient for the biotin-conjugated probes to bind available
strepavidin-conjugated nanoparticle labels. Generally, from about
30 minutes to about 1 hr is sufficient, usually 30 minutes
sufficing. Incubation is generally performed at room temperature.
In certain embodiments, the nanoparticle label may be enhanced
further, e.g., by using the nanoparticle label as a "seed" for the
development of another material, e.g., silver, about the
nanoparticle label seed to easily transform the starting
nanoparticle label from a first material having a first size to a
second material having a second size thus providing distinct
electronic signatures between the first, original nanoparticle
label and the second, transformed nanoparticle label and due to the
differences in size and/or material.
[0075] Where one wishes to bind a nanoparticle label to non-guanine
residues of a nucleic acid polymer, analogous approaches are known
and may be employed (see for example "Protocols for Oligonucleotide
Conjugates", Methods in Molecular Biology, Vol. 26, Humana Press,
Totowa, N.J. (1994). For example, for nanoparticle attachment to
nucleotide (adenine, cytosine, guanine and thymine/uracil)
residues, one may modify nucleobases, e.g., to provide attached
side chains which may bind a nanoparticle label, e.g., using a
binding agent or linker. These modified nucleobases may be used in
the synthesis of a oligonucleotide, e.g., which may be used as a
nanoparticle labeled probe. A variety of positions or sites of a
base (indicated below by arrows) may be employed for modifying a
nucleic acid base, as shown below: 1
[0076] where base no. 1 shows a position that may be modified for
uracil (thymine), base no. 2 shows positions that may be modified
for cytosine, base no. 3 shows a position that may be modified
guanine, and base no. 4 shows a position that may be modified for
adenine.
[0077] The above-described nucleic acid bases show positions that
may be modified for, e.g., introducing side arms into nucleic acid
bases which side arms may then be employed in the attachment of a
nanoparticle label such as by employing suitable linker (e.g., a
biotin-strepavidin or the like). For example, in many embodiments
the produced side arms include an attached amino group which
enables attachment of, e.g., biotin conjugates.
[0078] For example, modified bases that may be employed include the
following: 2
[0079] where base no. 5 is 5-(3-aminopropynyl)-2'-deoxyuridine,
base no. 6 is 3 aminopropyl 2' deoxyuridine, base no. 7 is
5-(carbamoylethyl)-2'-deo- xyuridine, base no. 8 is 3 deaza 3
substituted 2'-deoxyguanidine, base no. 9 is a deoxyadenosine base,
and base no. 10 is pyrazole [3,4-d]deoxyadeosine.
[0080] Accordingly, a suitable nanoparticle may then be stably
associated with a modified base and, either prior or subsequent to
nanoparticle association, the modified bases may be incorporated
into a synthesized oligonucleotide.
[0081] To stably associate a nanoparticle label with a modified
base, a variety of linking groups may be employed, e.g., biotin
conjugates. In certain embodiments, to attach a nanoparticle label
to a modified base, e.g., used to synthesis a oligonucleotide, a
suitable linking molecule such as biotin may be contacted with a
given side arm of the modified oligonucleotide base under
conditions suitable to stably associate or attach the linking group
such as biotin to the base. A linking group labeled nanoparticle
(e.g., strepavidin labeled gold or silver nanoparticles), for
example, may then be contacted with the modified oligonucleotides
under suitable conditions to attach the nanoparticle to the
corresponding linker (e.g., biotin) of the base.
[0082] Where a given polymer is indirectly labeled with one or more
nanoparticle labels, the polymer is contacted under suitable
conditions with a nanoparticle labeled binding agent that
specifically binds to the polymer. In these embodiments, the
binding agent may be a variety of different moieties, depending on
the nature of the polymer to be indirectly labeled, where
representative binding agents include, but are not limited to: a
ligand or receptor, proteins, including antibodies and binding
fragments thereof, and nucleic acids, e.g., oligonucleotides,
including deoxyribo-oligonucleotides and ribo-oligonucleotides. The
nanoparticle labeled binding agent may be prepared using any
convenient protocol, including the direct labeling protocols
discussed above.
[0083] Methodology known in the art may be employed for chemically
modifying and derivitizing a nanoparticle, see for example
"Synthesis, Functionalization and Surface Treatment of
Nanoparticles" edited by Marie-Isabelle Baraton, American
Scientific Publishers, Los Angeles (2002) and "Surface Modification
of Functional Nanoparticles Controlled Drug Delivery", J. of
Dispersion Science and Technology Vol. 24(2003). Functionalized
nanoparticles that may be employed in the subject invention include
carbohydrate or PEG functionalized nanoparticles, peptide
functionalized nanoparticles (e.g., from Alnis Biosciences, Inc.),
carboxy functionalized magnetic nanoparticles (e.g., from Bang
Laboratories, Inc. and Seradyn, Inc.), and the like. For example, a
3-thiol or 5-thiol linker may be employed to attach a nanoparticle
(e.g., gold nanoparticle, silver nanoparticle, etc.) to an end of a
nucleic acid. (see, e.g., Chad Mirkin et al. Storhoff et. al, J.
Am. Chem. Soc 120, 1959 (1998)). In certain embodiments,
nanoparticles, e.g., gold nanoparticles, may be functionalized with
alkanethiols using ligand exchange reaction of phosphine-stabilized
nanoparticle precursors with .omega.-functionalized alkanethiols,
e.g., to prepare .omega.-functionalized nanoparticles with
diameters of 0.8 nm to 1.5 nm (see, e.g., Gerd H. Woehrle, et al.
"Improved Synthesis of Small (dCORE=1.5 nm) Phosphine-stabilized
Nanoparticles" J. Am. Chem. Soc., 2000, 122, 12890-12891). In
certain embodiments, nanoparticle, e.g., a gold nanoparticle, may
be provided with carboxy functional groups by contacting the
nanoparticle with an organosilane. Thereafter, following activation
of the nanoparticle with carbodiimide a suitable moiety such as
strepavidin or the like may be stably attached to the nanoparticle
via the provided functionalization. Methodology for functionalizing
magnetic nanoparticles may also be found, e.g., in Catherine C.
Berry and Adam S. G. Curtis, Functionalisation of magnetic
nanoparticles for applications in biomedicine, J. Phys. D: Appl.
Phys. 36 (2003) R198-R206.
[0084] Following preparation of a nanoparticle labeled binding
agent, the polymer, e.g., nucleic acid of interest, is then
contacted with the nanoparticle labeled binding agent under
conditions sufficient for specific binding to occur to produce the
desired nanoparticle labeled polymer. In general, following contact
of one or more nanoparticle labeled binding agents with the polymer
of interest, the resultant reaction mixture is incubated for a
sufficient period time for the nanoparticle labeled binding agents
to bind to the available polymers of interest, e.g., for any
specific binding interactions, e.g., ligand-receptor binding,
hybridization, etc., between a nanoparticle label and polymer or
specific portion of the polymer, e.g., a particular sequence of a
nucleic acid (if present), to occur. The particular incubation
conditions will vary depending on the specifics of the polymer of
interest and the nanoparticle label, where such conditions can be
readily determined by those of skill in the art. For example, where
the polymer of interest is nucleic acid such as DNA and the
specific binding agent is a nanoparticle labeled probe having a
sequence complementary to the sequence of the DNA of interest,
conditions sufficient for hybridization of the nanoparticle labeled
probe and the DNA of interest are employed, where the conditions
will generally, though not always, be stringent conditions, for
example, at 50.degree. C. or higher and 0.1.times.SSC (15 mM sodium
chloride/01.5 mM sodium citrate). In this manner, the nanoparticle
labeled probe is hybridized to its complementary sequence of the
nucleic acid of interest (i.e., hybridized to a "target" nucleic
acid) to provide a nanoparticle labeled target nucleic acid.
[0085] Regardless of whether a direct or indirect nanoparticle
labeling scheme is employed, in certain embodiments following
complex formation between nanoparticle labels and the polymer of
interest, any unbound or free nanoparticle labels are separated
from the population of nanoparticle labeled polymers. Any
convenient separation protocol may be employed, where the
particular separation protocol that is chosen in a given assay will
depend, e.g., on the nature of the polymer. For example,
centrifugation protocols, methods that discriminate based on size,
etc. may be employed. Once the unbound nanoparticle labels are
separated from the nanoparticle label/polymer complexes, the
nanoparticle label/polymer complexes may then be translocated
through a nanopore for characterization.
[0086] As indicated above, a variety of nanoparticle labeling
schemes may be employed ranging from using a single nanoparticle
label for a given polymer to a plurality of nanoparticle labels for
a given polymer, where some or all of the nanoparticle labels
employed may be different types of nanoparticle labels such that
each different type of nanoparticle labels provides a unique,
characteristic detectable signal during translocation. For example,
a single nanoparticle label may be employed or a plurality of the
same type or different type (or a mix of the same type and
different type) of nanoparticle labels may be employed at various
positions of the polymer. Accordingly, a given polymer, e.g., a
nucleic acid molecule, may be labeled in a number of locations
along the molecule's length. Because the individual sub-units of
the polymer, e.g., nucleotides in the case of a nucleic acid,
interact with the nanopore detector in sequential order,
information regarding the location and composition of a plurality
of labeled sites along a single molecule can be obtained using the
subject invention.
[0087] FIGS. 1-5 illustrate exemplary embodiments of various
labeling schemes for a given nucleic acid, where such labeling
schemes are exemplary only and are in no way intended to limit the
scope of the invention. As noted above, the nanoparticle labels may
be directly bound to specific nucleotide residues (A, C, T or G) or
indirectly bound by way of a binding agent, e.g., complementary
oligonucleotide or the like, to specific sequences of a nucleic
acid. FIG. 1A shows a nucleic acid (ATCGATCGATCGATCG (SEQ ID
NO:01)) having only a first nanoparticle label 20 represented by a
square and which is bound directly to a residue at a first end
(e.g., 5' or 3') of the nucleic acid (of course the nanoparticle
label need not be positioned on an end). FIG. 1B shows the nucleic
acid of FIG. 1A labeled with a plurality of nanoparticle labels to
a specific nucleotide. In the embodiment of FIG. 1B, all A bases
are labeled with the same nanoparticle label 20, but it will be
apparent that one or more of the other bases (C, T or G) may be
analogously labeled with different nanoparticle labels such as
shown in the embodiment of FIG. 1C wherein each type of nucleotide
is labeled with a different nanoparticle label (represented by
nanoparticle labels 20, 27, 28 and 29) and signals provided from
the different nanoparticle labels are detectably distinguishable
from each other due to the materials and/or sizes of the
labels.
[0088] FIG. 2 shows nanoparticle labels 20 and 21 bound to both
ends of a known sequence probe 22 (the binding agent) to label the
polymer sequence ATCGATCGATCGATCG (SEQ ID NO:01), where the labeled
sequence may correspond to the entire length of a particular
nucleic acid molecule or may be a portion thereof. While the
nanoparticle labels are shown as different (represented as an open
square 20 and closed square 21) such that the signal provided from
the different nanoparticle labels are detectably distinguishable
from each other due to the materials and/or sizes of the labels,
the nanoparticle labels may be the same in certain embodiments.
Furthermore, it will be apparent that a number of nanoparticle
labels may be employed with a given binding agent which may be the
same or different, depending on the size of the binding agent,
etc.
[0089] FIG. 3 shows another exemplary embodiment of a labeling
scheme wherein a plurality of first nanoparticle labeled binding
agents 12 having nanoparticle label 20 are employed to label all of
regions of a nucleic acid having the specific sequence ATCG.
[0090] FIG. 4 shows another exemplary embodiment of a labeling
scheme for labeling a polymer (SEQ ID NO:06). This labeling scheme
employs a second nanoparticle label 32 having a second nanoparticle
label 27 represented, where signal provided from the first and
second labels, 20 and 27 respectively, are detectably
distinguishable from each other due to the materials and/or sizes
of the labels. For example, the two different nanoparticle labels
20 and 27 may differ in material and/or size such that the
nanoparticle labels may be of the same material but differ in size
(e.g., 0.8 nm and 1.4 nm), or may be of different material (e.g.,
gold and silver), but have the same size or may be of different
materials and different sizes.
[0091] FIG. 5 shows yet another labeling scheme for labeling a
polymer (SEQ ID NO:07). This labeling scheme employs three
different nanoparticle labeled probes 102, 104 and 106, each
labeled with a different type of nanoparticle label 27, 20 and 28
respectively, are employed to label a given polymer such that
signal provided from the different nanoparticle labels are
detectably distinguishable from each other due to the materials
and/or sizes of the labels. Such a labeling scheme may be employed,
e.g., to sequence a nucleic acid.
[0092] Nanoparticle Labeled Polymer Translocation
[0093] Regardless of the particular labeling scheme employed, once
labeled the nanoparticle labeled polymer is translocated through a
nanopore. In many embodiments the nanoparticle labeled polymer is
translocated during this step under an applied electric field,
using atomic force tweezers, using a magnetic force, and the
like.
[0094] The nanopore device that is employed in the translocation
step may be a device that includes a nanopore inserted into a thin
film with means for applying an electric field across the nanopore
and for measuring the resultant signal at the nanopore or may be a
solid state device, e.g., nanopores in materials such as a
silicon-based chip (e.g., Si.sub.3N.sub.4) fabricated using ion
beam sculpting and having nanoelectrodes positioned adjacent the
pore (see for example Li, J., D. Stein, C. McMullan, D. Branston,
M. J. Aziz, and J. A. Golovchenko; Ion Beam Sculpting at Nanometre
Length Scales. Nature 412: 166-169 (2001). Representative nanopore
devices are also disclosed in U.S. Pat. Nos. 6,465,193; 6,428,959;
6,267,872 and 6,015,874; the disclosures of which are herein
incorporated by reference. By "nanopore" is meant a structure
having a channel or pore with a diameter of "nano" dimensions,
where the inner diameter of the pore or channel typically ranges
from about 1 to 10, usually from about 1 to 5 and more usually from
about 1 to 2 nm. The nanopore may be synthetic or naturally
occurring, where naturally occurring nanopores include oligomeric
protein channels, such as porins, gramicidins, and synthetic
peptides and the like, where a particularly preferred protein
channel is the self-assembled heptameric channel of
.alpha.-hemolysin. In one embodiment, the thin film into which the
nanopore is inserted is a lipid bilayer fabricated from a wide
variety of one or more different lipids, where suitable lipids
include: phosphatidlycholine, phosphatidylserine,
phosphatidylethanolamine, glycerol mono-oleate, and cholesterol. A
variety of suitable thin film support devices have been reported in
the literature that may be used to support a nanopore used to
detect the subject nanoparticle labels. Such devices include those
described in: Brutyan et al., Biochimica et Biophysica Acta (1995)
1236:339-344; Wonderlin et al., Biophys. J. (1990) 58:289-297;
Suarez-Isla et al. Biochemistry (1983) 22:2319-2323; as well as in
U.S. Pat. Nos. 6,465,193; 6,428,959; 6,267,872 and 6,015,874; the
disclosures of which are herein incorporated by reference.
[0095] In translocating the nanoparticle labeled polymer through
the nanopore, the first step is to place a labeled nanoparticle
label/polymer complex, on a first side of a suitable nanopore. The
nanoparticle label/polymer complex may be in an aqueous solution,
e.g., a buffered solution, where the solution may include one or
more dissolved salts (e.g., in protocols measuring ionic current),
such as potassium chloride and the like, and the pH ranges from
about 6.0 to 9.0, and more usually from about 7.0 to 8.5. The
solution on a first side of the nanopore may be the same or
different from the solution on the second side and may also be an
ionic buffered solution. In tunneling current protocols, the
polymer may be in air, methanol, propanol or butanol, water, or in
suitable buffer such as a suitable buffer such as one that includes
1.0 M KCl, 10 mM Tris-Cl pH 8.5, 1 mM EDTA and 0.05% Triton XL-80N
or variations of such a buffer, e.g., nanopore buffer and methanol
(e.g., 20% methanol) or the nanopore buffer with higher percentages
of surfactant, e.g., 1% or 2% Triton XL-80N). Suitable solvents may
also be employed, e.g., used with a nanopore buffer or other
solution, such as polyethylene glycol. After the labeled
nanoparticle label/polymer complex is placed on the first side of
the nanopore, the labeled nanoparticle label/polymer complex is
moved or translocated through the nanopore and the signal provided
by the labeled nanoparticle label/polymer complex in the nanopore
is detected.
[0096] For example, in certain embodiments an electric field is
applied across the pore using electrodes positioned in the first
and second side of the pore. The electric field that may be applied
is sufficient to move or translocate the labeled nanoparticle
label/polymer complex through the nanopore, where field strengths
that range from about 10.sup.5 volts per centimeter to about
10.sup.6 volts per cm may be employed to cause a polymer such as a
nucleic acid to translocate the nanopore. Field strengths up to
about 10.sup.9 Volts per cm may be employed for tunneling and
resonant tunneling measurements. In magnetic nanoparticle
detection, a change of magnetic susceptibility (or reluctance) or
the like through the nanopore, caused by the magnetic nanoparticle
label, may be detected. For example, in certain embodiments a
magnetic circuit may be provided about the nanopore, and the
passage of a subject magnetic nanoparticle label interacts with the
circuit in a manner to provide an observable change in magnetic
susceptibility.
[0097] Nanopore Signal Detection
[0098] During translocation of a subject nanoparticle label through
a nanopore, a reproducible, characteristic signal, such as a
reproducible, characteristic electronic and/or magnetic signal, may
be detected due at least in part to the particular size and/or
material of a given nanoparticle label. For example, in certain
embodiments a distinct current signature or current profile may be
obtained based on a particular nanoparticle label. For example, the
passage of a labeled polymer such as an individual nanoparticle
labeled nucleic acid strand through a nanopore may be observed as a
transient decrease or spike in current, e.g., in ionic current,
and/or the current blockage caused by a labeled-polymer
translocation may be observed. In regards to detecting magnetic
nanoparticle labels, such may be accomplished by using a spin valve
sensor or giant magnetoresistive ("GMR") head.
[0099] Due to the particular characteristics and properties of a
subject nanoparticle label(s) employed with the polymer of
interest, when translocated through a nanopore, these nanoparticle
labels are able to cause a detectable change in the electronic
signature and thus are easily and readily detectable. In many
embodiments, during translocation of the labeled nanoparticle
label/polymer complex through the nanopore, the ion current through
the pore is measured. Measurement rates may vary, e.g., measurement
rates may range from about a few kHz (e.g., for a sizing
application) to tens of MHz (e.g., for a sequencing
application).
[0100] While the subject invention is described primarily with
respect to reading signals representative of ionic current, it is
to be understood that such is for ease of description only and is
not intended to limit the scope of the invention. It will be
apparent to one of skill in the art that the subject invention is
applicable for detecting a variety of signals such as those
representative of ionic current flow, electron tunneling current
flow, electron resonance tunneling current flow, changes in a
magnetic field or circuit, variations in ionic and tunneling
current flow, etc., such that in at least some embodiments, a
current tunneling that is characteristic of the labeled polymer of
interest is detected. For example, certain embodiments include
employing an appropriate voltage bias to drive a polymer or the
units or monomers of a polymer, such as DNA, to move in strictly
single-file order through a nanopore's very small volume of space.
A suitable detector is employed to probe this small volume and
convert the physical and chemical properties of the passing
nanoparticle labeled polymer or polymer units or monomers into an
electrical signal.
[0101] In ionic current protocols, as the labeled polymer is
translocated through a nanopore, any attached labels partially or
totally block the current flow through the nanopore device such
that each label may be detected, e.g., as a modification of
current, e.g., a drop in current. In electron tunneling protocols,
as the nanoparticle labeled polymer (e.g., a polymer labeled with a
nanoparticle label that is conductive) moves between suitably
placed tunneling electrodes associated with a nanopore, any
attached nanoparticle label modifies the tunneling current that may
be observed from the first electrode, across the nanoparticle
labeled polymer, to the second electrode. In resonant tunneling
protocols, a resonant tunneling electrode arrangement may be
associated with a nanopore and the presence and energy band
properties of the nanoparticle labeled polymer (e.g., a polymer
labeled with a semi-conductible nanoparticle label) may be
observed. Accordingly, ionic current, tunneling current and
resonance tunneling current are but at least a few detector modes
that are contemplated by the subject invention. In certain
embodiments, the subject invention includes providing a magnetic
field or circuit about a nanopore and detecting the change in the
magnetic field or circuit caused by the translocation of a subject
nanoparticle label (e.g., a nanoparticle label that is a magnet or
has magnetic properties) through the nanopore.
[0102] By "signature" or "profile" (used herein interchangeably) is
meant a collection of data points over time, in raw or processed
form, e.g., in the form of a plot, such as in the form of a
graphical representation, that includes a collection or series of
data points obtained from a nanopore during a translocation of a
nanoparticle labeled polymer versus a given time period during
which an appropriate applied field or force (depending on the
particular protocol performed) is applied to a nanopore and/or
polymer to move the polymer into and through a nanopore. Signatures
may include, but are not limited to, current profiles, magnetic
field profiles, and the like. For example, by "current signature"
or "current profile" (used herein interchangeably) is meant a
collection of data points over time, in raw or processed form,
e.g., in the form of a plot, such as in the form of a graphical
representation, that includes a collection or series of current
data points versus a given time period during which a polymer is
translocated through a nanopore. For example, by "magnetic field
signature" or "magnetic field profile" (used herein
interchangeably) is meant a collection of data points over time, in
raw or processed form, e.g., in the form of a plot, such as in the
form of a graphical representation, that includes a collection or
series of magnetic field data points versus a given time period
during which a polymer is translocated through a nanopore.
[0103] Components or characteristics of the data points that may be
employed include amplitude or magnitude, duration, pattern, and the
like, and combinations thereof. In other words, a given data point
may represent a signal that is related to the amplitude or
magnitude of the detected current at given time point, etc., and
the signature is a collection or series of such data points. In
many embodiments two or more of these characteristics are detected
when observing a nanoparticle labeled polymer translocation through
a nanopore.
[0104] The given period of time that a single-nanoparticle label of
the subject invention is examined or detected may vary, where a
given period of time may range from tens of microseconds to tens of
nanoseconds, where such is at least dependant on the particular
translocation rate of a given polymer through the nanopore. For
example, in certain embodiments translocation rates measured may
exceed about 10.times.10.sup.6 base-pairs/sec for double stranded
DNA, where in certain embodiments the current measurement may
deviate from (may be less or greater than) about 10.times.10.sup.6
base-pairs/sec for double stranded DNA due, for example to fluid
viscosities, etc. Fluids having a viscosity near that of water may
result in rates on the order of about 10.times.10.sup.6
base-pairs/sec.
[0105] The data points of a current signature or other analogous
signature are derived from the observed or detected modulation or
change in current (or magnetic field), e.g., the change in ionic,
tunneling current, or resonance tunneling current through the
nanopore (also referred to herein as a detector) from a first side
of the nanopore, e.g., the cis side, to a second side, e.g., the
trans side, upon occupancy of the nanopore by a nanoparticle
labeled polymer. Suitable current measurement devices, as well as
hardware and software necessary for generating the current
signature from the detected changes in the current, including where
necessary signal amplifiers and analog/digital converters, are well
known in the art and thus will not be described in detail herein.
Suitable magnetic field or circuit devices, as well as hardware and
software necessary for generating the signature from the detected
changes in the magnetic field, are also well known in the art and
thus will not be described in detail herein.
[0106] Polymer Characterization
[0107] As reviewed above, the nanoparticle labeled polymer is
"read" by translocating the nanoparticle label through a nanopore
and observing the effect over time of the translocation on a
measurable signal. Data points in the form of a measurable signal
may be obtained by observing the ion current, tunneling current,
resonant tunneling current or change in magnetic field, e.g., by
changing the susceptibility, through a nanopore as the subject
nanoparticle labels are translocated therethrough. In this manner,
a unique profile or signature such as a unique current profile or
signature, magnetic field profile or signature, and the like, is
generated for each nanoparticle labeled polymer, e.g., a blockade
current-profile and the like.
[0108] Once the current or other analogous profile is obtained by
reading the nanoparticle labeled polymer as it passes through a
nanopore, the resultant signature, e.g., current or other analogous
profile such as magnetic field profile, may be used to provide
information about the polymer such as the size of the polymer
(e.g., the length of a nucleic acid sequence), analyte detection
(i.e., whether a particular polymer is present or absent in a
sample), identification of the polymer (e.g., identification of a
nucleic acid sequence or specific nucleotide, etc.) to which the
nanoparticle label was bound, whether any mutations are present,
etc. These comparing and identification steps may be done manually,
but are ideally performed by an appropriate computer
hardware/software system. This general translocation step is shown
schematically in FIGS. 6A and 6B as a nucleic acid nucleotide C, or
a sequence of a nucleic acid that includes this C nucleotide, is
labeled with a nanoparticle label 40. The nucleic acid of interest
is passed through a suitable nanopore 110 of a nanopore device 100
under conditions suitable for a signal to be detected from the
nanoparticle label as it passes through the nanopore. FIG. 6B
schematically shows the signal produced from the nanopore as the
labeled C nucleotide is translocated through the nanopore.
[0109] Information obtained from reading the nanoparticle labeled
polymer as it passes through a nanopore may be compared against
reference outputs such that the presence, absence, identity, etc.,
of the nanoparticle label may be determined by this comparison (or
other analogous methods). Accordingly, analyte (if any) in the
sample may be characterized by analyzing one or more components of
the obtained signature i.e., translocation data, where components
of interest include: time, amplitude, etc.
[0110] For example, reference measurements with homopolymers or
heteropolymers of known composition may be made such that a
decrease in ionic current observed (or a decrease or change in an
analogous signal) in a given protocol may be compared to the
reference to determine the identity of a polymer of interest. For
example, a reference measurement (e.g., a decrease in ionic current
flow) of a polymer containing stacked cytosines entering and
traversing the nanopore may be made or, e.g., a reference
measurement (e.g., the decrease in ionic current) of a polymer
containing unstacked adenines as it enters and traverses the
nanopore may be made--or any other suitable reference measurement.
Accordingly, an observed decrease in current drop produced by a
nanoparticle labeled polymer (e.g., DNA) of interest as it enters
and traverses the nanopore may be compared to such references to
determine if the polymer, e.g., DNA of interest produces the same
or similar decrease in ionic current as it enters and traverses the
nanopore.
[0111] Utility
[0112] The subject methods find use in a variety of applications in
which the detection/characterization of one or more polymers (e.g.,
single or double stranded nucleic acids), or sub-units of a polymer
(e.g., nucleotides of a oligonucleotide) in a sample, is desired.
Specific representative applications in which the subject methods
find use include, but are not limited to: 1) nucleic acid size
characterization applications; 2) nucleic acid analyte detection
applications; 3) nucleic acid domain detection applications; and 4)
nucleic acid sequencing applications. Each of these representative
applications is now described in greater detail below.
[0113] Size Characterization
[0114] As noted above, the subject invention may be employed to
determine the size of a particular polymer or distinguish between
different lengths of polymer in a given population of polymers. In
general, nanoparticle labeled polymers may be translocated through
a nanopore and the resultant signal or signature detected from the
nanopore during this translocation may be related to the size of
the translocated polymer. This size characterization may be
accomplished, for example, by labeling two ends of a polymer with
the same or different nanoparticle labels. Of course, other
labeling schemes may be employed as well and will depend, e.g., on
the particular polymer being characterized, etc. Because the
signals provided by the nanoparticle labels are read in a
sequential manner as they pass through the nanopore, the time
period between detected signals provides information about the size
of the polymer to which the nanoparticle labels are bound.
[0115] FIGS. 7A and 7B illustrate an exemplary embodiment of
employing the subject invention for this application. As shown in
FIG. 7A, a plurality of nanoparticle labeled polymers 340, 342 and
344', 344", and 344'" of various sizes are translocated through a
nanopore 350 one at a time, e.g., under an applied electric field.
During translocation, detectable signals may be obtained from the
nanopore due to the nanoparticle labels. As noted above, a variety
of different labeling schemes may be employed in the "sizing" of a
polymer. For example, only the ends of a polymer may be labeled as
illustrated by polymers 340 and 344', 344", and 344'" having first
and second labels 322 and 324 and 302 and 304, respectively,
(represented by filled-in circles), where the first and second
nanoparticle labels associated with a given polymer may be the same
type or may be different types due to differences in material
and/or size. As described above, in certain embodiments
end-labeling DNA with a subject nanoparticle label may be
accomplished by employing a 3-thiol or 5-thiol linker.
Alternatively, more than just the ends of a given polymer may be
labeled such as polymer 342 which has each individual residue of
the polymer labeled, where the nanoparticle labels employed may be
the same type or different types (e.g., some may be the same type
and/or some may be different types) based on material and/or size
of the nanoparticle labels.
[0116] FIG. 7B shows an output that may be obtained by employing
the subject methods to size polymers. As shown, the signals
obtained may be related to the time required to translocate a given
polymer through a nanopore, where the translocation time is
proportional to the size of the translocated polymer. Accordingly,
the subject invention provides a means to easily and quickly
determine the size of a polymer or a population of polymers.
[0117] Analyte Detection
[0118] The subject invention may also be employed in analyte
detection protocols. In general, such analyte detection protocols
include providing a nanoparticle labeled probe (binding agent) of
known identity (e.g., having a known sequence in the case of a
nanoparticle labeled nucleic acid probe) and contacting the probe
with a sample containing, or suspected of containing, an analyte
(e.g., a complementary nucleic acid sequence) to which the
nanoparticle labeled probe will bind if present. Such contact is
performed under conditions sufficient to promote any such binding
(e.g., under stringent hybridization conditions where the
nanoparticle labeled binding agent is a nucleic acid).
[0119] Following complex formation between any nanoparticle labeled
probes and analyte in the sample, in certain embodiments any
unbound nanoparticle labeled probes are separated from the
analyte/nanoparticle labeled probe complexes, i.e. the bound
nanoparticle labeled probes, using any suitable separation
technique. Following separation of the nanoparticle labeled
probe/analyte complexes from the unbound or free nanoparticle
labels (if performed), as well as from any other sample
constituents, the nanoparticle labeled probe/analyte complexes, (if
any) may be detected and related to the presence of the analyte(s)
of interest in the sample. As noted above, this detection may be
accomplished by translocating the nanoparticle labeled
probe/analyte complexes through a nanopore, e.g., under the
influence of an applied electric field or the like and observing
the effect over time of the translocation on a measurable signal,
e.g., in the form of a signature. One such measurable signal is
modification of ion current (or tunneling or resonant tunneling
current) through a nanopore based on each unique nanoparticle
label. Another such measurable signal is modification of a magnetic
field (or tunneling or resonant tunneling current) through a
nanopore, e.g., by changing susceptibility, based on each unique
nanoparticle label. In any event, the nanoparticle labeled
probe/analyte complexes are "scanned" or "read" by being
translocated through a nanopore.
[0120] Once the signal output or signature, such as a current or
magnetic field profile, is obtained by the translocation, the
presence, absence and exact identity of the analyte to which a
particular nanoparticle label probe is bound may be determined
because the identity of the nanoparticle labeled probe is known.
The signal obtained may be compared to reference signals to
identify a particular analyte. This comparing step and
identification step can be done manually, but is ideally performed
by an appropriate computer hardware/software system.
[0121] Accordingly, since a signal will only be detected if a
nanoparticle label is bound to an analyte and since each
nanoparticle label has a unique signal and the identity of each
probe is known, the identity of any probe bound analyte may be
determined by relating a particular detected signal to a certain
analyte. For example, the presence of a particular analyte may be
determined if a particular signal is detected or alternatively if a
particular signal is not detected the absence of that particular
analyte may be determined. The amplitude of a particular signal may
be related to the amount of a given analyte in the sample.
[0122] Domain Detection--An Alternative to Restriction Fragment
Length Polymorphism
[0123] The subject invention may be employed to easily encode a DNA
molecule of interest. Specifically, the subject nanoparticle labels
may be attached to one or more known sequences of a DNA molecule of
interest via one or more complementary nanoparticle labeled
oligonucletide probes hybridized thereto. Since the nanoparticle
labels are attached to known sequences of DNA, important
information about the DNA molecule may be easily obtained from the
detection (or lack of detection) of one or more nanoparticle
labels.
[0124] A specific use of such an approach is as an alternative to
Restriction Fragment Length Polymorphism ("RFLP"). For example,
regional sequence information may be obtained about the DNA
molecule without employing the labor intensive method of RFLP which
is conventionally used. RFLP is one way to detect base
substitutions, deletions, additions and sequence re-arrangements
and requires a number of time consuming and labor intensive steps.
In general, RFLP requires that the DNA must first be fragmented
using restriction endonucleases. The fragments are then resolved
using gel electrophoresis. Differences in sequences lead to
distinguishable restriction fragments, where the detection of such
is employed to deduce the presence of the sequence or base of
interest in the analyzed sequence.
[0125] In contrast to RFLP, using the subject invention to encode
the DNA, the DNA does not have to be fragmented and the DNA may be
"read" as a whole molecule to obtain analogous information as that
obtainable using RFLP. For example, in using RFLP, a length of DNA
of interest is cut with a restriction endonuclease. By way of
example, an exemplary strand of DNA before being subject to cutting
by EcoR1 may be represented as:
AATCTAGGGAATTCACAGCGATGCGAATTCGCAATTA (SEQ ID NO: 02); and the same
DNA after being subjected to cutting by EcoR1 may be represent as:
AATCTAGGG (SEQ ID NO: 03)-AATTCACAGCGATGCG (SEQ ID NO:
04)-AATTCGCAATTA (SEQ ID NO: 05) such that the restriction
endonuclease has cut the thirty-seven bases that made up the DNA
strand of interest into three smaller strands of DNA having nine,
sixteen and twelve bases. However, if another strand of DNA (e.g.,
from another person) has slightly different DNA (e.g., due to a
base substitution, deletion, addition, sequence re-arrangement,
etc.) the same endonuclease EcoR1 may cut that particular DNA
strand into pieces of different lengths. For example, in the other
strand of DNA the second GAATTC may be GAATTT instead and thus the
endonuclease will cut this other strand of DNA in only one place,
producing only two strands of DNA of nine and twenty-eight bases
each. In order to visualize these differences in DNA strands or to
see if two pieces of DNA are different (i.e., whether any base
substitutions, additions, deletions, sequence re-arrangements,
etc.) are present, the pieces of DNA produced by a restriction
endonuclease must be visualized, e.g., by performing gel
electrophoresis.
[0126] In contrast, the subject methods may be employed to provide
analogous information as that which may be obtained with RFLP. As
shown in FIG. 8, a DNA strand of interest 400 is provided and
contacted with known sequences of nanoparticle labeled probes 402,
404 and 406 wherein the nanoparticle labels are represented by
filled-in circles. The known probes may represent, e.g.,
polymorphisms (e.g., single nucleotide polymorphisms) or variant
forms of a particular gene (e.g., may represent the complementary
sequences of particular polymorphisms). The nanoparticle labeled
probes are contacted with the DNA under conditions sufficient to
promote the hybridization of the nanoparticle labeled probes to any
complementary sequences, if any, of DNA strand 400. Accordingly,
complexes formed between the probe and DNA will be indicative of
the presence of a particular polymorphism (i.e., base substitution,
deletion, addition, sequence re-arrangements, etc.) present within
the DNA.
[0127] Following contact, any unbound nanoparticle labeled probes
may be separated (or not) from the hybridized nanoparticle labeled
probe/DNA complexes 410 using any suitable separation technique and
any nanoparticle labeled probe/DNA complexes 410 may be detected in
a manner analogous to that described above. Specifically, the
complexes are detected by translocation through a nanopore 420.
Translocation may be accomplished by an applied electric field,
using atomic force tweezers, a magnetic force, and the like, or
other suitable method of moving a polymer into and through a
nanopore. Accordingly, if a nanoparticle labeled probe has
hybridized to the DNA a signal may be detected from the nanopore
during translocation due to the presence of the detectable
nanoparticle label. The detected signal may then be related to a
particular probe and thus indicative of a particular polymorphism
present within DNA strand 40. Conversely, the absence of a
detectable signal may be indicative of the lack of a probe and thus
the absence of a polymorphism within DNA strand 40.
[0128] Sequencing Applications
[0129] Since the subject nanoparticle labels may be discriminated
from each other, the detection or lack thereof (along with the
ordered sequence of detection) of the nanoparticle labels using the
subject invention not only enables the determination of whether a
given sequence is present or not, but also enables the order of the
sequences to be easily determined. Accordingly, the subject
invention may be employed to sequence all or part of a target
nucleic acid molecule by determining the sequence of all or a
portion of the nucleic acid molecule and/or obtaining information
relating to the position of that portion of nucleic acid.
[0130] FIGS. 9A and 9B show an exemplary embodiment wherein each
nucleotide of a nucleic acid 460 (SEQ ID NO:08) is labeled with a
nanoparticle label of the subject invention (of course, different
labeling schemes may be employed such as those that label specific
sequences as opposed to individual nucleotides). Specifically, each
type of nucleotide is labeled with a particular nanoparticle label.
As shown, a first type of nanoparticle label is represented as a
square, a second type of nanoparticle label is represented as a
triangle, a third type of nanoparticle label is represented as a
circle and a fourth type of nanoparticle label is represented as an
asterisk. Accordingly, the sequence of the nucleic acid 460 may be
determined by detecting the nucleic acid in a manner analogous to
that described above. Specifically, the nanoparticle labeled
nucleic acid may be translocated through a nanopore under, e.g., an
applied electric or magnetic field. Particular, detectable signals
may be obtained due to the presence of the nanoparticle labels. As
shown in the output of such a translocation in FIG. 9B for example
a translocation of eight of the nucleotides of FIG. 9A, the
detected signal may be related to a particular nucleotide.
Furthermore, the order in which the signals are detected provides
information about the sequential order of the nucleotides.
Accordingly, as shown in FIGS. 9A and 9B specific bases of a DNA of
interest may be distinguishably labeled with the subject
nanoparticle labels such that, as shown in FIG. 9B, different
signals are provided for each base type due to different
nanoparticle labels employed for each different type of base.
Accordingly, current will flow in a characteristic and identifiable
fashion that may be equated with a specific nucleotide (A, T, C, or
G).
[0131] Specific applications in which the subject methods find use
include, but are not limited to, forensics, gene mapping,
diagnostic and screening applications. Diagnostic applications
include applications in which the detection of one or more specific
analytes in a complex physiological mixture, such as the samples
described above, is desired. In such applications, the presence of
the analyte(s) of interest will generally be indicative of a
particular disease or condition in the host from which the screened
sample is derived. Thus, in diagnostic applications according to
the subject invention, the presence of one or more analytes of
interest is detected in a sample from the subject being diagnosed
using the methods described above and then related to the presence
or absence of a disease or condition.
[0132] Other applications will be apparent to those of skill in the
art. For example, the subject invention may be employed in the
discovery of mutations and polymorphisms including single
nucleotide polymorphisms (SNP), where these discovered mutations
and polymorphisms may be in a selected portion of a gene, the full
gene, the entire genome, or a subset of the genome. Such
information may be valuable in the identification of mutations
responsible for genetic disorders and other traits, in the
identification of nucleic acid fragments, infectious agents, and
the like. Still further, the subject invention may be employed in
the identification of nucleic acid in parental identification. As
noted above, the subject invention may be useful in forensic
applications such as in the identification of nucleic acid in
samples for forensic purposes.
[0133] While numerous advantages of the subject invention will be
apparent to those of skill in the art upon reading this disclosure,
one advantage is that the subject methods may be used to
characterize polymers in a sample at very low levels. For example,
in sequencing applications, the amount of polymer in a sample may
be as low as about 0.05 .mu.g/ml or lower, e.g., about 0.5 .mu.g/ml
or more, e.g., about 1 .mu.g/ml or more in certain embodiments. For
example, in detection applications, the amount of polymer in a
sample may be as low as about 0.05 .mu.g/ml or lower, e.g., about
0.5 .mu.g/ml or more, e.g., about 1 .mu.g/ml or more. Another
advantage of the subject invention is that polymers may be
characterized rapidly. For example, in sequencing applications, a
polymer having a length ranging from about 50 base pairs to about
10 mega base pairs, may be sequenced rapidly, usually in less than
about 30 minutes, e.g., less than about 1 minute, where the time
required for sequencing may be as short as about 10 seconds or
shorter, e.g., may be as short as about 1 second. In analyte
detection applications, the presence of the analyte can be detected
rapidly, usually in less than about 1 hour, e.g., less than about
30 minutes, where the time required for analyte detection may be as
short as about 5 minutes or shorter.
[0134] Computer Readable Mediums and Programming Stored Thereon
[0135] One or more aspects of the subject invention may be in the
form of computer readable media having programming stored thereon
for implementing the subject methods. Accordingly, programming
according to the subject invention may be recorded on
computer-readable media, e.g., any medium that can be read and
accessed directly or indirectly by a computer. Such media include,
but are not limited to, computer disk or CD, a floppy disc, a
magnetic "hard card", a server, magnetic tape, optical storage such
as CD-ROM and DVD, electrical storage media such as RAM and ROM,
and the hybrids of these categories such as magnetic/optical
storage media. One of skill in the art can readily appreciate how
any of the presently known computer readable mediums may be used to
provide a manufacture that includes a recording of the present
programming/algorithm for carrying out the above-described
methodology. Thus, the computer readable media may be, for example,
in the form of any of the above-described media or any other
computer readable media capable of containing programming, stored
electronically, magnetically, optically or by other means. As such,
stored programming embodying steps for carrying-out some or all of
the subject methods may be transferred to a computer-operated
apparatus such as a personal computer (PC) or the like, by physical
transfer of a CD, floppy disk, or like medium, or may be
transferred using a computer network, server, or other interface
connection, e.g., the Internet.
[0136] More specifically, a computer readable medium may include
stored programming embodying an algorithm for carrying out some or
all of the subject methods, where such an algorithm is used to
direct a processor or series of processors to execute the steps
necessary to perform the task(s) required of it and as such the
subject invention includes a computer-based system for carrying-out
some or all of the subject methods. For example, such a stored
algorithm may be configured to, or otherwise be capable of,
directing a microprocessor to receive the output signal resulting
from a given translocation protocol, e.g., directly or indirectly
from a signal detector, and identify the nanoparticle label and/or
the polymer or polymer subunit to which the label was bound.
Programming may direct a processor to provide other relevant
information about a nanoparticle or a polymer or polymer subunit
such as translocation time, polymer size, nucleic acid sequencing
information, and the like. The algorithm may also include steps or
functions for generating a variety of current profile graphs and
plots. The subject invention may also include a data set of known
or reference values such as current profiles or the like stored on
a computer readable medium to which an output obtained from the
translocation of a nanoparticle labeled polymer according to the
subject invention may be compared for use in identifying a given
nanoparticle and/or polymer. The data may be stored or configured
in a variety of arrangements known to those of skill in the
art.
[0137] Systems
[0138] The subject invention also provides systems for use in
practicing the subject methods. A system of the invention may
include a suitable nanopore-device, a nanoparticle labeled polymer
and programming for carrying out some or all of the subject
methods, which programming may be recorded on a computer readable
medium as described above. In certain embodiments a subject system
includes a computer or computer-based system for carrying out some
or all of the methods of subject invention, e.g., for reading and
implementing the algorithm.
[0139] For example, a system may include a suitable nanopore, a
nanoparticle labeled polymer and a suitable single computer or
suitable computer-based system or the like with a stored algorithm
capable of carrying out some or all of the polymer characterization
methods of the subject invention and may also include a stored data
set of reference current profiles. Of course, any programming or
data sets, reference values, etc., may be provided separately on a
computer readable medium such that the computer or computer-based
system includes means for reading the programming. In another
embodiment, a system of the invention may include a suitable
nanopore, a nanoparticle labeled polymer and a single computer or
suitable computer-based system with a stored algorithm capable of
carrying out some or all of the polymer characterization methods of
the subject invention and that is configured to access a server or
database that includes the data set of reference current
profiles.
[0140] In certain embodiments, the system is further characterized
in that it provides a user interface, where the user interface
presents to a user the option of selecting amongst a plurality of
different functions for evaluating a polymer according to the
subject methods, for example choosing amongst one or more
different, including multiple different, inputs such as voltage
applied, properties of a magnetic field, the particular
characteristic(s) evaluated, and the like.
[0141] Kits
[0142] Also provided by the subject invention are kits that include
the subject nanoparticle labels and instructions for using the
nanoparticle labels in the subject methods. The number of different
types of nanoparticle labels in the kit may range widely depending
on the intended use of the kit, where the number may range from
about 1 to about 16 or higher, where any nanoparticle labels are
considered to be of different type if they provide different,
detectable signals during translocation through a nanopore such
that their signals are distinguishable from each other. Thus, kits
according to the subject invention may include a single type of
nanoparticle labels or two or more different types of nanoparticle
labels, including sets of four or more different types of
nanoparticle labels, e.g., sets of ten or more different types of
nanoparticle labels, e.g., sets of sixty-four or more different
types of nanoparticle labels, e.g., sets of one hundred or more
different types of nanoparticle labels, e.g., sets of one thousand
or more different types of nanoparticle labels, e.g., sets of one
hundred thousand or more different types of nanoparticle labels and
sets of five hundred thousand or more different types of
nanoparticle labels. Thus, of interest are kits with at least about
five, usually at least about ten, e.g., at least about fifteen
different nanoparticle labels. In addition to nanoparticle labels,
the kits may further include one or more additional assay
components, such as suitable buffer media, and the like. The
instructions for using the nanoparticle labels in the subject
methods may be printed on a suitable recording medium. For example,
the instructions may be printed on a substrate, such as paper or
plastic, etc. As such, the instructions may be present in the kits
as a package insert, in the labeling of the container of the kit or
components thereof (i.e., associated with the packaging or
sub-packaging) etc. In other embodiments, the instructions are
present as an electronic, magnetic or optical storage data file
present on a suitable computer readable storage medium, e.g.,
CD-ROM, diskette, etc.
[0143] In yet other embodiments, the instructions for using the
subject nanoparticle labels in the subject methods may not
themselves be present in the kit, but means for obtaining the
instructions from a remote source, e.g., via the Internet, are
provided. An example of this embodiment is a kit that includes a
World Wide Web address where the instructions may be viewed and/or
from which the instructions may be downloaded. Some form of access
security or identification protocol may be used to limit access to
those entitled to use the subject invention.
[0144] The subject kits may also include programming embodied on a
computer readable medium as described above for carrying out one or
more steps of the subject invention. The kits may also include a
device for detecting and scanning or reading the nanoparticle
labels, such as those described above. The kit may further include
one or more additional assay components such as suitable buffer
media, denaturing reagents, and the like.
Experimental
[0145] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention. Efforts have been made to ensure accuracy with
respect to numbers used (e.g. amounts, temperature, etc.) but some
experimental errors and deviations should be accounted for. Unless
indicated otherwise, parts are parts by weight, molecular weight is
weight average molecular weight, temperature is in degrees
Centigrade, and pressure is at or near atmospheric.
[0146] 1. Preparing Labeled Probes--binding gold nanoparticle
labels to nucleotides
[0147] The following details how to bind gold nanoparticle labels
to nucleotides. In certain embodiments the ULS, e.g., as
distributed by Roche as Biotin-Chem-Link, may be employed, e.g., to
bind guanine with a nanoparticle. In general, reagents for
accomplishing a ULS (e.g., Biotin-Chem-Link) is incubated in
aqueous solution with the nucleic acid template which leads to the
cleavage of the nitrate and to the formation of a coordinative
binding to the N7 position of guanosine bases.
[0148] Using purified oligonucleotides or nucleic acid templates
(nucleotide bases), mix 2 .mu.l of DNA (1 ug) with 1 .mu.l of
Biotin-Chem-Link. Add 18 .mu.l of nuclease-free water and incubate
for 30 minutes at 85.degree. C. with mixing. Centrifuge briefly to
collect condensate. Stop the reaction by adding 5 .mu.l of a
suitable stop solution. Store the biotin-conjugated probes at
-15.degree. C. Incubate 1 .mu.g of biotin-conjugated probes with
1:50 strepavidin-gold (of any suitable size, e.g., 1.4 nm) and
incubate for 30 minutes at room temperature. Wash three times with
phosphate buffered saline ("PBS") by adding equal volumes of PBS
and centrifuging briefly to remove supernatant.
[0149] In certain embodiments, bases may be labeled by providing
side arms at certain positions of nucleic acid bases to which a
suitable linker may be attached. Accordingly, the following
protocol may be employed to modify a nucleic acid base and attach a
nanoparticle via a linker such as biotin-strepavidin.
[0150] Modify one or more type of bases to provide a side arm as
shown: 3
[0151] Once one or more bases have been modified to provide a
suitable side arm, contact the one or more modified bases with
biotin conjugate under conditions to promote the binding of the
biotin conjugates to appropriate side arms. For example, one or
more side arm modified bases may be incorporated into a synthesized
oligonucleotide. Accordingly, following synthesis contact the
synthesized oligonucleotide with biotin conjugates under conditions
sufficient to promote the binding of the biotin conjugates to
appropriate side arms.
[0152] Once biotin labeled, contact the biotin labeled
oligonucleotides with one or more strepavidin labeled nanoparticles
under conditions sufficient for biotin-strepavidin binding to
occur. For example, using purified oligonucleotides or nucleic acid
templates (nucleotide bases), mix 2 .mu.l of DNA (lug) with 1 .mu.l
of Biotin-Chem-Link. Add 18 .mu.l of nuclease-free water and
incubate for 30 minutes at 85.degree. C. with mixing. Centrifuge
briefly to collect condensate. Stop the reaction by adding 5 .mu.l
of a suitable stop solution. Store the biotin-conjugated probes at
-15.degree. C. Incubate 1 .mu.g of biotin-conjugated probes with
1:50 strepavidin-gold (of any suitable size, e.g., 1.4 nm) and
incubate for 30 minutes at room temperature. Wash three times with
phosphate buffered saline ("PBS") by adding equal volumes of PBS
and centrifuging briefly to remove supernatant.
[0153] 2. Silver Enhancement of Gold Nanoparticles
[0154] The above-described protocol may also be used to bind
strepavidin-gold which may be further developed to form silver
around the previously produced strepavidin-gold nanoparticle label.
The silver enhancement may be used, for example, to generate silver
nanoparticle labels having sizes larger than the original "seed".
As a result, the resultant strepavidin-silver nanoparticle labels
will have a distinct electronic signature (i.e., different from the
strepavidin-gold nanoparticle label seeds) due to differences in
size and/or material from the "seed" strepavidin-gold nanoparticle
label. The strepavidin-silver nanoparticle labels may range in size
from about 2 to about 10 nm. Materials for such silver enhancement
may be found commercially, e.g., from Nanoprobes.
[0155] 3. Linker-Conjugated Nanoparticle Labels
[0156] As described above, nanoparticle labels may be conjugated to
different linkers, e.g., for the incorporation of the nanoparticle
label into dNTP's.
[0157] For example, using silanization, covalently couple carboxy
functional groups to the surface of a gold nanoparticle. Activate
the carboxy functionalized surface with carbodiimide. Once
activated, contact the nanoparticle with strepavidin under
conditions sufficient to bind the strepavidin to the activated
nanoparticle surface. Alternatively, a thiol linker may be
employed. For example, to provide a thiol linked DNA molecule to a
nanoparticle, modify a nanoparticle such as a gold nanoparticle by
contacting it with 3' or 5' thiol functionalized DNA having a
length at least about 25 bases, under conditions sufficient to
stably attach the 3' or 5' thiol functionalized DNA to the
nanoparticle to provide a DNA linker. Still further, modification
of nanoparticles may be accomplished by employing ligand exchange
reactions of phosphine-stabilized nanoparticles with
co-functionalized alkanethiols to modify gold nanoparticles with
.omega.-functionalized alkanethiols.
[0158] 4. Encoded DNA
[0159] The subject nanoparticle labels may be used to encode
specific sequences of DNA which then enables the identification of
particular segments of the DNA of interest. FIGS. 10A and 10B
illustrate this protocol. The encoding may take the form of various
nanoparticle labels associated with a probe, e.g., the nanoparticle
labels may be positioned at opposing ends of a probe of known
sequence or the like.
[0160] Accordingly, suitably label one or more probe molecules of
known sequence with one or more nanoparticle labels of the subject
invention, e.g., 1.4 nm and 0.8 nm gold and/or silver nanoparticle
labels. Contact with a sample containing or suspected of containing
DNA of interest under conditions sufficient to promote the
hybridization of the nanoparticle labeled probe(s) to the DNA of
interest which has been denatured into single stranded DNA.
Following the hybridization of the nanoparticle labeled probe(s) to
the DNA of interest, translocate the hybridized complex through a
nanopore by applying a DC current of about 120 mV across the
nanopore in the presence of an electrolyte buffer such as 1 m KCL
in 10 mM Tris-Cl pH 8.5 for a period of time sufficient to
translocate the hybridized complex through (or partially through in
certain embodiments) the nanopore, e.g., for a period of time that
ranges from about 10 minutes to about several hours.
[0161] As shown in FIG. 10A, a plurality of nanoparticle labeled
probes 62, 64 and 66 are hybridized to the DNA of interest and are
translocated through pore 72 of nanopore device 70 by applying a
voltage across the pore in the presence of an electrolyte buffer.
As shown in FIG. 10B, the signal from this translocation is
observed as a blockage of ionic current indicating the DNA and
label are blocking the nanopore resulting in a decrease in ionic
current. The degree or magnitude of blocking is due in part to the
properties (i.e., the sizes) of the subject nanoparticle labels
employed and thus each different nanoparticle label imparts a
unique blocking signal. The graph of FIG. 10B shows exemplary time
and amplitude components of the translocation which is related to
the length and type of DNA being translocated. For example, longer
lengths of DNA will have longer translocation times and the
amplitude of blockage may be related to the conformation of the DNA
and/or to the labeled state of the DNA. Furthermore, since the
subject nanoparticle labels are hybridized to known sequences of
DNA, sequencing information may be obtained about the DNA of
interest using an intact DNA molecule (as opposed to fragmenting
the DNA using restriction endonucleases) and without the need to
employ conventional protocols that may be more labor-intensive such
as restriction length polymorphism ("RLP").
[0162] 5. Tunneling Current and Resonant Tunneling Current
Examples
[0163] Characterization of a polymer (DNA, RNA, protein, etc.) may
be accomplished using the subject nanoparticle labels in tunneling
current protocols and resonant tunneling current protocols as shown
schematically in FIG. 11. Accordingly, nanoparticle labels having
different conductivities may be employed as labels for a given
polymer to enable discrimination of the different nanoparticle
labels and thus discrimination of the respective unit or sequence,
etc., of the polymer to which a given label is associated, e.g.,
nanoparticle labels of different materials and/or sizes may be
employed.
[0164] Analogous to that described above, label probes of known
sequence (labels represented by filled-in circles) with
nanoparticle labels that are conductive or semiconductive. Once
labeled, hybridize the labeled probes to DNA of interest. The
hybridized, labeled complex is passed through two tunneling current
electrodes 74 and 76 positioned at the periphery of the nanopore 78
of nanopore device 73. During movement of the hybridized, labeled
complex through the nanopore, the hybridized, labeled complex
provides a signal output due to the conductive/semiconductive
properties of the nanoparticle labels.
[0165] In the case of tunneling current, the use of conductive or
semiconductive nanoparticle labels increases the likelihood that
electrons will conduct across the electrodes, as shown in FIGS. 12A
and 12B. As shown in FIG. 12A, the magnitude of the current
conducting across tunneling electrodes 92 and 94 is relatively low
as compared to the current conducting across electrodes 92 and 94
when nanoparticle labeled DNA 96, generally represented as circle
96, is moved through the nanopore, as shown in FIG. 12B.
[0166] In the case of resonant tunneling current, the nanoparticle
labeled DNA traverses a plurality of energy barriers or levels as
it moves through the nanopore where such movement across the
various energy barriers produces a spectrum of current that is a
unique signature for a given nanoparticle label. In this case, the
nanoparticle may be conductive or semiconductive, e.g., a quantum
dot. This is schematically illustrated in FIGS. 13A and 13B. FIG.
13A shown resonant tunneling electrodes 82 and 84, energy bands 86
generally represented as dashed lines and nanoparticle labeled DNA
83, generally represented as circle 83, moving through the various
energy bands 86. FIG. 13B shows an exemplary signal output produced
from such a resonant tunneling current protocol such that a
spectrum of currents is detected as the nanoparticle labeled DNA
passes through the various energy levels.
[0167] 6. Magnetic Detection Circuit for Detecting Magnetic
Nanoparticle Labels
[0168] Characterization of a polymer (DNA, RNA, protein, etc.) may
be accomplished using one or more of the magnetic nanoparticle
labels of the subject invention associated with the polymer and
detecting signal from a magnetic circuit associated-nanopore during
translocation of the magnetic particle-labeled polymer through the
nanopore, e.g., by sensing magnetic susceptibility or rather a
change thereof, or the like, as shown schematically in FIG. 14
which shows an end view of a nanopore device having a nanopore
associated with a magnetic circuit. In certain embodiments a
plurality of magnetic nanoparticle labels that provide different
signals are employed as labels for a given polymer to enable
discrimination of the different magnetic nanoparticle labels and
thus discrimination of the respective unit or sequence, etc., of
the polymer to which a given label is associated, e.g., magnetic
nanoparticle labels of different materials and/or sizes may be
employed.
[0169] As shown in FIG. 14, polymer 120 labeled with magnetic
nanoparticle labels 121, 122 and 123 (which may be the same type of
magnetic nanoparticle labels or may be different) is passed through
nanopore 111 of nanopore device 110 (labeled polymer 120 is
depicted as moving through the nanopore in the direction that
corresponds to movement of the polymer out of the page). The
magnetic circuit 125 includes coil 112 that is magnetically coupled
(via ferrite or other suitable magnetic material) to stripes of
magnetic film 130 and 131 which in turn localize the field in the
proximity of nanopore 111, thereby enabling the magnetic
nanoparticle labels associated with the polymer to affect the field
by changing the susceptibility. Accordingly, contact the labeled
polymer with the nanopore to cause the traversal of the magnetic
nanoparticle labeled polymer through the nanopore. Detect a signal
which is indicative of this change in magnetic susceptibility
caused by the traversed nanoparticle label and characterize the
polymer based on this detected signal.
[0170] It is evident from the above results and discussion that the
above described invention provides effective methods and devices
for characterizing a polymer. The subject invention provides for a
number of advantages including, but not limited to, unique labels
that are easy to use and which provide unique signals. Furthermore,
in certain embodiments the nanoparticle labels may be read rapidly
in much shorter times than that required for methods in which other
labels, such as radioactive or fluorescent labels are employed. As
such, the subject invention represents a significant contribution
to the art.
[0171] All publications and patents cited in this specification are
herein incorporated by reference as if each individual publication
or patent were specifically and individually indicated to be
incorporated by reference. The citation of any publication is for
its disclosure prior to the filing date and should not be construed
as an admission that the present invention is not entitled to
antedate such publication by virtue of prior invention.
[0172] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adapt a particular situation,
material, composition of matter, process, process step or steps, to
the objective, spirit and scope of the present invention. All such
modifications are intended to be within the scope of the claims
appended hereto.
Sequence CWU 1
1
8 1 16 DNA Artificial Sequence synthetic DNA 1 atcgatcgat cgatcg 16
2 37 DNA Artificial Sequence synthetic DNA 2 aatctaggga attcacagcg
atgcgaattc gcaatta 37 3 9 DNA Artificial Sequence synthetic DNA 3
aatctaggg 9 4 16 DNA Artificial Sequence synthetic DNA 4 aattcacagc
gatgcg 16 5 12 DNA Artificial Sequence synthetic DNA 5 aattcgcaat
ta 12 6 12 DNA Artificial Sequence synthetic DNA 6 atcggttcgc at 12
7 13 DNA Artificial Sequence synthetic DNA 7 tacgcgttga cga 13 8 13
DNA Artificial Sequence synthetic DNA 8 tacgcgttga cga 13
* * * * *