U.S. patent application number 10/937949 was filed with the patent office on 2005-06-23 for humanised antibodies.
This patent application is currently assigned to Celltech R&D Limited. Invention is credited to Adair, John Robert, Athwal, Diljeet Singh, Emtage, John Spencer.
Application Number | 20050136054 10/937949 |
Document ID | / |
Family ID | 10668300 |
Filed Date | 2005-06-23 |
United States Patent
Application |
20050136054 |
Kind Code |
A1 |
Adair, John Robert ; et
al. |
June 23, 2005 |
Humanised antibodies
Abstract
CDR-grafted antibody heavy and light chains comprise acceptor
framework and donor antigen binding regions, the heavy chains
comprising donor residues at at least one of positions (6, 23)
and/or (24, 48) and/or (49, 71) and/or (73, 75) and/or (76) and/or
(78) and (88) and/or (91). The CDR-grafted light chains comprise
donor residues at at least one of positions (1) and/or (3) and (46)
and/or (47) or at at least one of positions (46, 48, 58) and (71).
The CDR-grafted antibodies are preferably humanised antibodies,
having non human, e.g. rodent, donor and human acceptor frameworks,
and may be used for in vivo therapy and diagnosis. A generally
applicable protocol is disclosed for obtaining CDR-grafted
antibodies.
Inventors: |
Adair, John Robert; (High
Wycombe, GB) ; Athwal, Diljeet Singh; (London,
GB) ; Emtage, John Spencer; (Marlow, GB) |
Correspondence
Address: |
COZEN O'CONNOR, P.C.
1900 MARKET STREET
PHILADELPHIA
PA
19103-3508
US
|
Assignee: |
Celltech R&D Limited
Slough
GB
|
Family ID: |
10668300 |
Appl. No.: |
10/937949 |
Filed: |
September 10, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10937949 |
Sep 10, 2004 |
|
|
|
08846658 |
May 1, 1997 |
|
|
|
08846658 |
May 1, 1997 |
|
|
|
08303569 |
Sep 7, 1994 |
|
|
|
5859205 |
|
|
|
|
08303569 |
Sep 7, 1994 |
|
|
|
07743329 |
Sep 17, 1991 |
|
|
|
Current U.S.
Class: |
424/144.1 ;
435/320.1; 435/334; 435/69.1; 435/7.2; 530/388.22; 536/23.53 |
Current CPC
Class: |
C07K 2319/00 20130101;
A61P 37/00 20180101; C07K 16/465 20130101; C07K 16/2803 20130101;
C07K 2317/24 20130101; C07K 16/2812 20130101; C07K 16/241 20130101;
C07K 2319/02 20130101; C07K 16/461 20130101; A61K 38/00 20130101;
C07K 14/7051 20130101; C07K 16/2809 20130101; C07K 16/18
20130101 |
Class at
Publication: |
424/144.1 ;
435/007.2; 435/069.1; 435/334; 435/320.1; 530/388.22;
536/023.53 |
International
Class: |
G01N 033/53; G01N
033/567; C07H 021/04; A61K 039/395; C12N 005/06 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 21, 1989 |
GB |
89/28874.0 |
Dec 21, 1990 |
WO |
PCT/GB90/02017 |
Claims
1-23. (canceled)
24. First and second polynucleotides respectively encoding heavy
and light chain variable regions of a humanized immunoglobulin
having complementarity determining regions (CDRs) from a donor
immunoglobulin and heavy and light chain variable region frameworks
from acceptor immunoglobulin heavy and light chain frameworks,
which humanized immunoglobulin specifically binds to an antigen
with an affinity constant of at least about 10.sup.8 M.sup.-1 and a
binding affinity similar to that of the donor immunoglobulin,
wherein the sequence of the acceptor immunoglobulin heavy chain
variable region framework is a consensus sequence of human
immunoglobulin heavy chain variable region frameworks.
25. A vector comprising first and second polynucleotides according
to claim 24.
26. A cell line transfected with a vector according to claim
25.
27. First and second polynucleotides respectively encoding heavy
and light chain variable regions of a humanized immunoglobulin
having complementarity determining regions (CDRs) from a donor
immunoglobulin and heavy and light chain variable region frameworks
from human acceptor immunoglobulin heavy and light chains, which
humanized immunoglobulin specifically binds to an antigen with an
affinity constant of at least about 10.sup.8 M.sup.-1 and a binding
affinity similar to that of the donor immunoglobulin, wherein said
humanized immunoglobulin heavy chain comprises one or more amino
acids from the donor immunoglobulin heavy chain framework outside
the Kabat CDRs and the structural loop CDRs of the variable
regions, wherein the donor amino acids substitute for corresponding
amino acids in the acceptor immunoglobulin heavy chain framework,
and each of these said donor amino acids is adjacent to a CDR in
the donor immunoglobulin sequence or contributes to antigen binding
as determined by X-ray crystallography.
28. First and second polynucleotides respectively encoding heavy
and light chain variable regions of a humanized immunoglobulin
having complementarity determining regions (CDRs) from a donor
immunoglobulin and heavy and light chain variable region frameworks
from acceptor immunoglobulin heavy and light chain frameworks,
which humanized immunoglobulin specifically binds to an antigen
with a binding affinity similar to that of the donor
immunoglobulin, wherein the sequence of the acceptor immunoglobulin
heavy chain variable region framework is a consensus sequence of
human immunoglobulin heavy chain variable region frameworks.
29. First and second polynucleotides respectively encoding heavy
and light chain variable regions of a humanized immunoglobulin
having complementarity determining regions (CDRs) from a donor
immunoglobulin and heavy and light chain variable region frameworks
from human acceptor immunoglobulin heavy and light chains, which
humanized immunoglobulin specifically binds to an antigen with an
affinity constant of at least about 10.sup.8 M.sup.-1 and a binding
affinity similar to that of the donor immunoglobulin, wherein the
sequence of the humanized immunoglobulin heavy chain variable
region framework has 66 variable region framework residues
identical to the variable region framework residues of the donor
immunoglobulin heavy chain variable region framework and at least
74 residues identical to an acceptor human immunoglobulin heavy
chain variable region amino acid sequence.
30. First and second polynucleotides respectively encoding heavy
and light chain variable regions of a humanized immunoglobulin
having complementarity determining regions (CDRs) from a donor
immunoglobulin and heavy and light chain variable region frameworks
from human acceptor immunoglobulin heavy and light chains, which
humanized immunoglobulin specifically binds to an antigen with a
binding affinity similar to that of the donor immunoglobulin,
wherein the sequence of the humanized immunoglobulin heavy chain
variable region framework has 66 variable region framework residues
identical to the variable region framework residues of the donor
immunoglobulin heavy chain variable region framework and at least
74 residues identical to an acceptor human immunoglobulin heavy
chain variable region amino acid sequence.
31. First and second polynucleotides respectively encoding heavy
and light chain variable regions of a humanized immunoglobulin
having complementarity determining regions (CDRs) from a donor
immunoglobulin and heavy and light chain variable region frameworks
from human acceptor immunoglobulin heavy and light chains, which
humanized immunoglobulin specifically binds to an antigen with a
binding affinity similar to that of the donor immunoglobulin,
wherein said humanized immunoglobulin heavy chain comprises one or
more amino acids from the donor immunoglobulin heavy chain
framework outside the Kabat CDRs and the structural loop CDRs of
the variable regions, and each of said donor amino acids is
adjacent to a CDR in the donor immunoglobulin sequence or
contributes to antigen binding as determined by X-ray
crystallography.
32. First and second polynucleotides respectively encoding heavy
and light chain variable regions of a humanized immunoglobulin
having complementarity determining regions (CDRs) in and heavy and
light chain variable region frameworks from human acceptor
immunoglobulin heavy and light chains, which humanized
immunoglobulin specifically binds to an antigen with a binding
affinity similar to that of the donor immunoglobulin, wherein said
humanized immunoglobulin heavy chain comprises one or more amino
acids from the donor immunoglobulin heavy chain framework outside
the Kabat CDRs and the structural loops of the variable region, and
wherein the donor amino acids substitute for corresponding amino
acids in the acceptor immunoglobulin heavy chain framework.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to humanised antibody
molecules, to processes for their production using recombinant DNA
technology, and to their therapeutic uses.
[0002] The term "humanised antibody molecule" is used to describe a
molecule having an antigen binding site derived from an
immunoglobulin from a non-human species, and remaining
immunoglobulin-derived parts of the molecule being derived from a
human immunoglobulin. The antigen binding site typically comprises
complementarity determining regions (CDRs) which determine the
binding specificity of the antibody molecule and which are carried
on appropriate framework regions in the variable domains. There are
3 CDRs (CDR1, CDR2 and CDR3) in each of the heavy and light chain
variable domains.
[0003] In the description, reference is made to a number of
publications by number. The publications are listed in numerical
order at the end of the description.
BACKGROUND OF THE INVENTION
[0004] Natural immunoglobulins have been known for many years, as
have the various fragments thereof, such as the Fab, (Fab').sub.2
and Fc fragments, which can be derived by enzymatic cleavage.
Natural immunoglobulins comprise a generally Y-shaped molecule
having an antigen-binding site towards the end of each upper arm.
The remainder of the structure, and particularly the stem of the Y,
mediates the effector functions associated with
immunoglobulins.
[0005] Natural immunoglobulins have been used in assay, diagnosis
and, to a more limited extent, therapy. However, such uses,
especially in therapy, were hindered until recently by the
polyclonal nature of natural immunoglobulins. A significant step
towards the realisation of the potential of immunoglobulins as
therapeutic agents was the discovery of procedures for the
production of monoclonal antibodies (MAbs) of defined specificity
(1).
[0006] However, most MAbs are produced by hybridomas which are
fusions of rodent spleen cells with rodent myeloma cells. They are
therefore essentially rodent proteins. There are very few reports
of the production of human MAbs.
[0007] Since most available MAbs are of rodent origin, they are
naturally antigenic in humans and thus can give rise to an
undesirable immune response termed the HAMA (Human Anti-Mouse
Antibody) response. Therefore, the use of rodent MAbs as
therapeutic agents in humans is inherently limited by the fact that
the human subject will mount an immunological response to the MAb
and will either remove it entirely or at least reduce its
effectiveness. In practice, MAbs of rodent origin may not be used
in patients for more than one or a few treatments as a HAMA
response soon develops rendering the MAb ineffective as well as
giving rise to undesirable reactions. For instance, OKT3 a mouse
IgG2a/k MAb which recognises an antigen in the T-cell receptor-CD3
complex has been approved for use in many countries throughout the
world as an immunosuppressant in the treatment of acute allograft
rejection [Chatenoud et al (2) and Jeffers et al (3)]. However, in
view of the rodent nature of this and other such MAbs, a
significant HAMA response which may include a major anti-idiotype
component, may build up on use. Clearly, it would be highly
desirable to diminish or abolish this undesirable HAMA response and
thus enlarge the areas of use of these very useful antibodies.
[0008] Proposals have therefore been made to render non-human MAbs
less antigenic in humans. Such techniques can be generically termed
"humanisation" techniques. These techniques typically involve the
use of recombinant DNA technology to manipulate DNA sequences
encoding the polypeptide chains of the antibody molecule.
[0009] Early methods for humanising MAbs involved production of
chimeric antibodies in which an antigen binding site comprising the
complete variable domains of one antibody is linked to constant
domains derived from another antibody. Methods for carrying out
such chimerisation procedures are described in EP0120694 (Celltech
Limited), EP0125023 (Genentech Inc. and City of Hope), EP-A-0
171496 (Res. Dev. Corp. Japan), EP-A-0 173 494 (Stanford
University), and WO 86/01533 (Celltech Limited). This latter
Celltech application (WO 86/01533) discloses a process for
preparing an antibody molecule having the variable domains from a
mouse MAb and the constant domains from a human immunoglobulin.
Such humanised chimeric antibodies, however, still contain a
significant proportion of non-human amino acid sequence, i.e. the
complete non-human variable domains, and thus may still elicit some
HAMA response, particularly if administered over a prolonged period
[Begent et al (ref. 4)].
[0010] In an alternative approach, described in EP-A-0239400
(Winter), the complementarity determining regions (CDRs) of a mouse
MAb have been grafted onto the framework regions of the variable
domains of a human immunoglobulin by site directed mutagenesis
using long oligonucleotides. The present invention relates to
humanised antibody molecules prepared according to this alternative
approach, i.e. CDR-grafted humanised antibody molecules. Such
CDR-grafted humanised antibodies are much less likely to give rise
to a MM response than humanised chimeric antibodies in view of the
much lower proportion of non-human amino acid sequence which they
contain.
[0011] The earliest work on humanising MAbs by CDR-grafting was
carried out on MAbs recognising synthetic antigens, such as the NP
or NIP antigens. However, examples in which a mouse MAb recognising
lysozyme and a rat MAb recognising an antigen on human T-cells were
humanised by CDR-grafting have been described by Verhoeyen et al
(5) and Riechmann et al (6) respectively. The preparation of
CDR-grafted antibody to the antigen on human T cells is also
described in WO 89/07452 (Medical Research Council).
[0012] In Riechmann et al/Medical Research Council it was found
that transfer of the CDR regions alone [as defined by Kabat refs.
(7) and (8)] was not sufficient to provide satisfactory antigen
binding activity in the CDR-grafted product. Riechmann et al found
that it was necessary to convert a serine residue at position 27 of
the human sequence to the corresponding rat phenylalanine residue
to obtain a CDR-grafted product having improved antigen binding
activity. This residue at position 27 of the heavy chain is within
the structural loop adjacent to CDR1. A further construct which
additionally contained a human serine to rat tyrosine change at
position 30 of the heavy chain did not have a significantly altered
binding activity over the humanised antibody with the serine to
phenylalanine change at position 27 alone. These results indicate
that changes to residues of the human sequence outside the CDR
regions, in particular in the structural loop adjacent to CDR1, may
be necessary to obtain effective antigen binding activity for
CDR-grafted antibodies which recognise more complex antigens. Even
so the binding affinity of the best CDR-grafted antibodies obtained
was still significantly less than the original MAb.
[0013] Very recently Queen et al (9) have described the preparation
of a humanised antibody that binds to the interleukin 2 receptor,
by combining the CDRs of a marine MAb (anti-Tac) with human
immunoglobulin framework and constant regions. The human framework
regions were chosen to maximise homology with the anti-Tac MAb
sequence. In addition computer modelling was used to identify
framework amino acid residues which were likely to interact with
the CDRs or antigen, and mouse amino acids were used at these
positions in the humanised antibody.
[0014] In WO 90/07861 Queen et al propose four criteria for
designing humanised immunoglobulins. The first criterion is to use
as the human acceptor the framework from a particular human
immunoglobulin that is unusually homologous to the non-human donor
immunoglobulin to be humanised, or to use a consensus framework
from many human antibodies. The second criterion is to use the
donor amino acid rather than the acceptor if the human acceptor
residue is unusual and the donor residue is typical for human
sequences at a specific residue of the framework. The third
criterion is to use the donor framework amino acid residue rather
than the acceptor at positions immediately adjacent to the CDRs.
The fourth criterion is to use the donor amino acid residue at
framework positions at which the amino acid is predicted to have a
side chain atom within about 3 .ANG. of the CDRs in a
three-dimensional immunoglobulin model and to be capable of
interacting with the antigen or with the CDRs of the humanised
immunoglobulin. It is proposed that criteria two, three or four may
be applied in addition or alternatively to criterion one, and may
be applied singly or in any combination.
[0015] WO 90/07861 describes in detail the preparation of a single
CDR-grafted humanised antibody, a humanised antibody having
specificity for the p55 Tac protein of the IL-2 receptor. The
combination of all four criteria, as above, were employed in
designing this humanised antibody, the variable region frameworks
of the human antibody Eu (7) being used as acceptor. In the
resultant humanised antibody the donor CDRs were as defined by
Kabat et al (7 and 8) and in addition the mouse donor residues were
used in place of the human acceptor residues, at positions 27, 30,
48, 66, 67, 89, 91, 94, 103, 104, 105 and 107 in the heavy chain
and at positions 48, 60 and 63 in the light chain, of the variable
region frameworks. The humanised anti-Tac antibody obtained is
reported to have an affinity for p55 of 3.times.10.sup.9 M.sup.-1,
about one-third of that of the murine MAb.
[0016] We have further investigated the preparation of CDR-grafted
humanised antibody molecules and have identified a hierarchy of
positions within the framework of the variable regions (i.e.
outside both the Kabat CDRs and structural loops of the variable
regions) at which the amino acid identities of the residues are
important for obtaining CDR-grafted products with satisfactory
binding affinity. This has enabled us to establish a protocol for
obtaining satisfactory CDR-grafted products which may be applied
very widely irrespective of the level of homology between the donor
immunoglobulin and acceptor framework. The set of residues which we
have identified as being of critical importance does not coincide
with the residues identified by Queen et al (9).
SUMMARY OF THE INVENTION
[0017] Accordingly, in a first aspect the invention provides a
CDR-grafted antibody heavy chain having a variable region domain
comprising acceptor framework and donor antigen binding regions
wherein the framework comprises donor residues at at least one of
positions 6, 23 and/or 24, 48 and/or 49, 71 and/or 73, 75 and/or 76
and/or 78 and 88 and/or 91.
[0018] In preferred embodiments, the heavy chain framework
comprises donor residues at positions 23, 24, 49, 71, 73 and 78 or
at positions 23, 24 and 49. The residues at positions 71, 73 and 78
of the heavy chain framework are preferably either all acceptor or
all donor residues.
[0019] In particularly preferred embodiments the heavy chain
framework additionally comprises donor residues at one, some or all
of positions 6, 37, 48 and 94. Also it is particularly preferred
that residues at positions of the heavy chain framework which are
commonly conserved across species, i.e. positions 2, 4, 25, 36, 39,
47, 93, 103, 104, 106 and 107, if not conserved between donor and
acceptor, additionally comprise donor residues. Most preferably the
heavy chain framework additionally comprises donor residues at
positions 2, 4, 6, 25, 36, 37, 39, 47, 48, 93, 94, 103, 104, 106
and 107.
[0020] In addition the heavy chain framework optionally comprises
donor residues at one, some or all of positions:
[0021] 1 and 3,
[0022] 72 and 76,
[0023] 69 (if 48 is different between donor and acceptor),
[0024] 38 and 46 (if 48 is the donor residue),
[0025] 80 and 20 (if 69 is the donor residue),
[0026] 67,
[0027] 82 and 18 (if 67 is the donor residue),
[0028] 91,
[0029] 88, and
[0030] any one or more of 9, 11, 41, 87, 108, 110 and 112.
[0031] In the first and other aspects of the present invention
reference is made to CDR-grafted antibody products comprising
acceptor framework and donor antigen binding regions. It will be
appreciated that the invention is widely applicable to the
CDR-grafting of antibodies in general. Thus, the donor and acceptor
antibodies may be derived from animals of the same species and even
same antibody class or sub-class. More usually, however, the donor
and acceptor antibodies are derived from animals of different
species. Typically the donor antibody is a non-human antibody, such
as a rodent MAb, and the acceptor antibody is a human antibody.
[0032] In the first and other aspects of the present invention, the
donor antigen binding region typically comprises at least one CDR
from the donor antibody. Usually the donor antigen binding region
comprises at least two and preferably all three CDRs of each of the
heavy chain and/or light chain variable regions. The CDRs may
comprise the Kabat CDRs, the structural loop CDRs or a composite of
the Kabat and structural loop CDRs and any combination of any of
these. Preferably, the antigen binding regions of the CDR-grafted
heavy chain variable domain comprise CDRs corresponding to the
Kabat CDRs at CDR2 (residues 50-65) and CDR3 (residues 95-100) and
a composite of the Kabat and structural loop CDRs at CDR1 (residues
26-35).
[0033] The residue designations given above and elsewhere in the
present application are numbered according to the Kabat numbering
[refs. (7) and (8)]. Thus the residue designations do not always
correspond directly with the linear numbering of the amino acid
residues. The actual linear amino acid sequence may contain fewer
or additional amino acids than in the strict Kabat numbering
corresponding to a shortening of, or insertion into, a structural
component, whether framework or CDR, of the basic variable domain
structure. For example, the heavy chain variable region of the
anti-Tac antibody described by Queen et al (9) contains a single
amino acid insert (residue 52a) after residue 52 of CDR2 and a
three amino acid insert (residues 82a, 82b and 82c) after framework
residue 82, in the Kabat numbering. The correct Kabat numbering of
residues may be determined for a given antibody by alignment at
regions of homology of the sequence of the antibody with a
`standard` Kabat numbered sequence.
[0034] The invention also provides in a second aspect a CDR-grafted
antibody light chain having a variable region domain comprising
acceptor framework and donor antigen binding regions wherein the
framework comprises donor residues at at least one of positions 1
and/or 3 and 46 and/or 47. Preferably the CDR grafted light chain
of the second aspect comprises donor residues at positions 46
and/or 47.
[0035] The invention also provides in a third aspect a CDR-grafted
antibody light chain having a variable region domain comprising
acceptor framework and donor antigen binding regions wherein the
framework comprises donor residues at at least one of positions 46,
48, 58 and 71.
[0036] In a preferred embodiment of the third aspect, the framework
comprises donor residues at all of positions 46, 48, 58 and 71.
[0037] In particularly preferred embodiments of the second and
third aspects, the framework additionally comprises donor residues
at positions 36, 44, 47, 85 and 87. Similarly positions of the
light chain framework which are commonly conserved across species,
i.e. positions 2, 4, 6, 35, 49, 62, 64-69, 98, 99, 101 and 102, if
not conserved between donor and acceptor, additionally comprise
donor residues. Most preferably the light chain framework
additionally comprises donor residues at positions 2, 4, 6, 35, 36,
38, 44, 47, 49, 62, 64-69, 85, 87, 98, 99, 101 and 102.
[0038] In addition the framework of the second or third aspects
optionally comprises donor residues at one, some or all of
positions:
[0039] 1 and 3,
[0040] 63,
[0041] 60 (if 60 and 54 are able to form at potential
saltbridge),
[0042] 70 (if 70 and 24 are able to form a potential
saltbridge),
[0043] 73 and 21 (if 47 is different between donor and
acceptor),
[0044] 37 and 45 (if 47 is different between donor and acceptor),
and
[0045] any one or more of 10, 12, 40, 80, 103 and 105.
[0046] Preferably, the antigen binding regions of the CDR-grafted
light chain variable domain comprise CDRs corresponding to the
Kabat CDRs at CDR1 (residue 24-34), CDR2 (residues 50-56) and CDR3
(residues 89-97).
[0047] The invention further provides in a fourth aspect a
CDR-grafted antibody molecule comprising at least one CDR-grafted
heavy chain and at least one CDR-grafted light chain according to
the first and second or first and third aspects of the
invention.
[0048] The humanised antibody molecules and chains of the present
invention may comprise: a complete antibody molecule, having full
length heavy and light chains; a fragment thereof, such as a Fab,
(Fab').sub.2 or FV fragment; a light chain or heavy chain monomer
or diner; or a single chain antibody, e.g. a single chain FV in
which heavy and light chain variable regions are joined by a
peptide linker; or any other CDR-grafted molecule with the same
specificity as the original donor antibody. Similarly the
CDR-grafted heavy and light chain variable region may be combined
with other antibody domains as appropriate.
[0049] Also the heavy or light chains or humanized antibody
molecules of the present invention may have attached to them an
effector or reporter molecule. For instance, it may have a
macrocycle, for chelating a heavy metal atom, or a toxin, such as
ricin, attached to it by a covalent bridging structure.
Alternatively, the procedures of recombinant DNA technology may be
used to produce an immunoglobulin molecule in which the Fe fragment
or CH3 domain of a complete immunoglobulin molecule has been
replaced by, or has attached thereto by peptide linkage, a
functional non-immunoglobulin protein, such as an enzyme or toxin
molecule.
[0050] Any appropriate acceptor variable region framework sequences
may be used having regard to class/type of the donor antibody from
which the antigen binding regions are derived. Preferably, the type
of acceptor framework used is of the same/similar class/type as the
donor antibody. Conveniently, the framework may be chosen to
maximise/optimise homology with the donor antibody sequence
particularly at positions close or adjacent to the CDRs. However, a
high level of homology between donor and acceptor sequences is not
important for application of the present invention. The present
invention identifies a hierarchy of framework residue positions at
which donor residues may be important or desirable for obtaining a
CDR-grafted antibody product having satisfactory binding
properties. The CDR-grafted products usually have binding
affinities of at least 10.sup.5 M.sup.-1, preferably at least about
10.sup.8 M.sup.-1, or especially in the range 10.sup.8-10.sup.12
M.sup.-1. Inn principle, the present invention is applicable to any
combination of donor and acceptor antibodies irrespective of the
level of homology between their sequences. A protocol for applying
the invention to any particular donor-acceptor antibody pair is
given hereinafter. Examples of human frameworks which may be used
are KOL, NEWM, REI, EU, LAY and POM (refs. 4 and 5) and the like;
for instance KOL and NEWM for the heavy chain and REX for the light
chain and EU, LAY and POM for both the heavy chain and the light
chain.
[0051] Also the constant region domains of the products of the
invention may be selected having regard to the proposed function of
the antibody in particular the effector functions which may be
required. For example, the constant region domains may be human
IgA, IgE, IgG or IgM domains. In particular, IgG human constant
region domains may be used, especially of the IgG1 and IgG3
isotypes, when the humanised antibody molecule is intended for
therapeutic uses, and antibody effector functions are required.
Alternatively, IgG2 and IgG4 isotypes may be used when the
humanised antibody molecule is intended for therapeutic purposes
and antibody effector functions are not required, e.g. for simple
blocking of lymphokine activity.
[0052] However, the remainder of the antibody molecules need not
comprise only protein sequences from immunoglobulins. For instance,
a gene may be constructed in which a DNA sequence encoding part of
a human immunoglobulin chain is fused to a DNA sequence encoding
the amino acid sequence of a functional polypeptide such as an
effector or reporter molecule.
[0053] Preferably the CDR-grafted antibody heavy and light chain
and antibody molecule products are produced by recombinant DNA
technology.
[0054] Thus in further aspects the invention also includes DNA
sequences coding for the CDR-grafted heavy and light chains,
cloning and expression vectors containing the DNA sequences, host
cells transformed with the DNA sequences and processes for
producing the CDR-grafted chains and antibody molecules comprising
expressing the DNA sequences in the transformed host cells.
[0055] The general methods by which the vectors may be constructed,
transfection methods and culture methods are well known per se and
form no part of the invention. Such methods are shown, for
instance, in references 10 and 11.
[0056] The DNA sequences which encode the donor amino acid sequence
may be obtained by methods well known in the art. For example the
donor coding sequences may be obtained by genomic cloning, or cDNA
cloning from suitable hybridoma cell lines. Positive clones may be
screened using appropriate probes for the heavy and light chain
genes in question. Also PCR cloning may be used.
[0057] DNA coding for acceptor, e.g. human acceptor, sequences may
be obtained in any appropriate way. For example DNA sequences
coding for preferred human acceptor frameworks such as KOL, REI, EU
and NEWM, are widely available to workers in the art.
[0058] The standard techniques of molecular biology may be used to
prepare DNA sequences coding for the CDR-grafted products. Desired
DNA sequences may be synthesised completely or in part using
oligonucleotide synthesis techniques. Site-directed mutagenesis and
polymerase chain reaction (PCR) techniques may be used as
appropriate. For example oligonucleotide directed synthesis as
described by Jones et al (ref. 20) may be used. Also
oligonucleotide directed mutagenesis of a pre-exising variable
region as, for example, described by Verhoeyen et al (ref. 5) or
Riechmann et al (ref. 6) may be used. Also enzymatic filling in of
gapped oligonucleotides using T.sub.4 DNA polymerase as, for
example, described by Queen et al (ref. 9) may be used.
[0059] Any suitable host cell/vector system may be used for
expression of the DNA sequences coding for the CDR-grafted heavy
and light chains. Bacterial e.g. E. coli, and other microbial
systems may be used, in particular for expression of antibody
fragments such as FAb and (Fab').sub.2 fragments, and especially FV
fragments and single chain antibody fragments e.g. single chain
FVs. Eucaryotic e.g. mammalian host cell expression systems may be
used for production of larger CDR-grafted antibody products,
including complete antibody molecules. Suitable mammalian host
cells include CEO cells and myeloma or hybridoma cell lines.
[0060] Thus, in a further aspect the present invention provides a
process for producing a CDR-grafted antibody product
comprising;
[0061] (a) producing in an expression vector an operon having a DNA
sequence which encodes an antibody heavy chain according to the
first aspect of the invention; and/or
[0062] (b) producing in an expression vector an operon having a DNA
sequence which encodes a complementary antibody light chain
according to the second or third aspect of the invention;
[0063] (c) transfecting a host cell with the or each vector;
and
[0064] (d) culturing the transfected cell line to produce the
CDR-grafted antibody product.
[0065] The CDR-grafted product may comprise only heavy or light
chain derived polypeptide, in which case only a heavy chain or
light chain polypeptide coding sequence is used to transfect the
host cells.
[0066] For production of products comprising both heavy and light
chains, the cell line may be transfected with two vectors, the
first vector may contain an operon encoding a light chain-derived
polypeptide and the second vector containing an operon encoding a
heavy chain-derived polypeptide. Preferably, the vectors are
identical, except in so far as the coding sequences and selectable
markers are concerned, so as to ensure as far as possible that each
polypeptide chain is equally expressed. Alternatively, a single
vector may be used, the vector including the sequences encoding
both light chain- and heavy chain-derived polypeptides.
[0067] The DNA in the coding sequences for the light and heavy
chains may comprise cDNA or genomic DNA or both. However, it is
preferred that the DNA sequence encoding the heavy or light chain
comprises at least partially, genomic DNA, preferably a fusion of
cDNA and genomic DNA.
[0068] The present invention is applicable to antibodies of any
appropriate specificity. Advantageously, however, the invention may
be applied to the humanisation of non-human antibodies which are
used for in vivo therapy or diagnosis. Thus the antibodies may be
site-specific antibodies such as tumour-specific or cell
surface-specific antibodies, suitable for use in in vivo therapy or
diagnosis, e.g. tumour imaging. Examples of cell surface-specific
antibodies are anti-T cell antibodies, such as anti-CD3, and CD4
and adhesion molecules, such as CR3, ICAM and ELAM. The antibodies
may have specificity for interleukins (including lymphokines,
growth factors and stimulating factors), hormones and other
biologically active compounds, and receptors for any of these. For
example, the antibodies may have specificity for any of the
following: Interferons .alpha., .beta., .gamma. or .delta., IL1,
IL2, IL3, or IL4, etc., TNF, GCSF, GMCSF, RPO, hGK, or insulin,
etc.
[0069] The the present invention also includes therapeutic and
diagnostic compositions comprising the CDR-grafted products of the
invention and uses of such compositions in therapy and
diagnosis.
[0070] Accordingly in a further aspect the invention provides a
therapeutic or diagnostic composition comprising a CDR-grafted
antibody heavy or light chain or molecule according to previous
aspects of the invention in combination with a pharmaceutically
acceptable carrier, diluent or excipient.
[0071] Accordingly also the invention provides a method of therapy
or diagnosis comprising administering an effective amount of a
CDR-grafted antibody heavy or light chain or molecule according to
previous aspects of the invention to a human or animal subject.
[0072] A preferred protocol for obtaining CDR-grafted antibody
heavy and light chains in accordance with the present invention is
set out below together with the rationale by which we have derived
this protocol. This protocol and rationale are given without
prejudice to the generality of the invention as hereinbefore
described and defined.
[0073] Protocol
[0074] It is first of all necessary to sequence the DNA coding for
the heavy and light chain variable regions of the donor antibody,
to determine their amino acid sequences. It is also necessary to
choose appropriate acceptor heavy and light chain variable regions,
of known amino acid sequence. The CDR-grafted chain is then
designed starting from the basis of the acceptor sequence. It will
be appreciated that in some cases the donor and acceptor amino acid
residues may be identical at a particular position and thus no
change of acceptor framework residue is required.
[0075] 1. As a first step donor residues are substituted for
acceptor residues in the CDRs. For this purpose the CDRs are
preferably defined as follows:
[0076] Heavy chain
[0077] CDR1: residues 26-35
[0078] CDR2: residues 50-65
[0079] CDR3: residues 95-102
[0080] Light chain
[0081] CDR1: residues 24-34
[0082] CDR2: residues 50-56
[0083] CDR3: residues 89-97
[0084] The positions at which donor residues are to be substituted
for acceptor in the framework are then chosen as follows, first of
all with respect to the heavy chain and subsequently with respect
to the light chain.
[0085] 2. Heavy Chain
[0086] 2.1 Choose donor residues at all of positions 23, 24, 49,
71, 73 and 78 of the heavy chain or all of positions 23, 24 and 49
(71, 73 and 78 are always either all donor or all acceptor).
[0087] 2.2 Check that the following have the same amino acid in
donor and acceptor sequences, and if not preferably choose the
donor: 2, 4, 6, 25, 36, 37, 39, 47, 48, 93, 94, 103, 104, 106 and
107.
[0088] 2.3 To further optimize affinity consider choosing donor
residues at one, some or any of:
[0089] i. 1, 3
[0090] ii. 72, 76
[0091] iii. If 48 is different between donor and acceptor
sequences, consider 69
[0092] iv. If at 48 the donor residue is chosen, consider 38 and
46
[0093] v. If at 69 the donor residue is chosen, consider 80 and
then 20
[0094] vi. 67
[0095] vii. If at 67 the donor residue is chosen, consider 82 and
then 18
[0096] viii. 91
[0097] ix. 88
[0098] x. 9, 11, 41, 87, 108, 110, 112
[0099] 3. Light Chain
[0100] 3.1 Choose donor at 46, 48, 58 and 71
[0101] 3.2 Check that the following have the same amino acid in
donor and acceptor sequences, if not preferably choose donor:
[0102] 2, 4, 6, 35, 38, 44, 47, 49, 62, 64-69-inclusive, 85, 87,
98, 99, 101 and 102
[0103] 3.3 To further optimise affinity consider choosing donor
residues at one, some or any of:
[0104] i. 1, 3
[0105] ii. 63
[0106] iii. 60, if 60 and 54 are able to form potential
saltbridge
[0107] iv. 70, if 70 and 24 are able to form potential
saltbridge
[0108] v. 73, and 21 if 47 is different between donor and
acceptor
[0109] vi. 37, and 45 if 47 is different between donor and
acceptor
[0110] vii. 10, 12, 40, 80, 103, 105
[0111] Rationale
[0112] In order to transfer the binding site of an antibody into a
different acceptor framework, a number of factors need to be
considered.
[0113] 1. The Extent of the CDRs
[0114] The CDRs (Complementary Determining Regions) were defined by
Wu and Kabat (refs. 4 and 5) on the basis of an analysis of the
variability of different regions of antibody variable regions.
Three regions per domain were recognised. In the light chain the
sequences are 24-34, 50-56, 89-97 (numbering according to Kabat
(ref. 4), Eu Index) inclusive and in the heavy chain the sequences
are 31-35, 50-65 and 95-102 inclusive.
[0115] When antibody structures became available it became apparent
that these CDR regions corresponded in the main to loop regions
which extended from the .beta. barrel framework of the light and
heavy variable domains. For H1 there was a discrepancy in that the
loop was from 26 to 32 inclusive and for H2 the loop was 52 to 56
and for L2 from 50 to. 53. However, with the exception of H1 the
CDR regions encompassed the loop regions and extended into the
.beta. strand frameworks. In H1 residue 26 tends to be a serine and
27 a phenylalanine or tyrosine, residue 29 is a phenylalanine in
most cases. Residues 28 and 30 which are surface residues exposed
to solvent might be involved in antigen-binding. A prudent
definition of the H1 CDR therefore would include residues 26-35 to
include both the loop region and the hypervariable residues
33-35.
[0116] It is of interest to note the example of Riechmann et al
(ref. 3), who used the residue 31-35 choice for CDR-H1. In order to
produce efficient antigen binding, residue 27 also needed to be
recruited from the donor (rat) antibody.
[0117] 2. Non-CDR Residues Which Contribute to Antigen Binding
[0118] By examination of available X-ray structures we have
identified a number of residues which may have an effect on net
antigen binding and which can be demonstrated by experiment. These
residues can be sub-divided into a number of groups.
[0119] 2.1 Surface residues near CDR [all numbering as in Kabat et
al (ref. 7).sub.3.
[0120] 2.1.1. Heavy Chain--Key residues are 23, 71 and 73. Other
residues which may contribute to a lesser extent are 1, 3 and 76.
Finally 25 is usually conserved but the murine residue should be
used if there is a difference.
[0121] 2.1.2 Light Chain--Many residues close to the CDRs, e.g. 63,
65, 67 and 69 are conserved. If conserved none of the surface
residues in the light chain are likely to have a major effect.
However, if the murine residue at these positions is unusual, then
it would be of benefit to analyse the likely contribution more
closely. Other residues which may also contribute to binding are 1
and 3, and also 60 and 70 if the residues at these positions and at
54 and 24 respectively are potentially able to form a salt bridge
i.e. 60+54; 70+24.
[0122] 2.2 Packing residues near the CDRs.
[0123] 2.2.1. Heavy Chain--Key residues are 24, 49 and 78. Other
key residues would be 36 if not a tryptophan, 94 if not an
arginine, 104 and 106 if not glycines and 107 if not a threonine.
Residues which may make a further contribution to stable packing of
the heavy chain and hence improved affinity are 2, 4, 6, 38, 46, 67
and 69. 67 packs against the CDR residue 63 and this pair could be
either both mouse or both human. Finally, residues which contribute
to packing in this region but from a longer range are 18, 20, 80,
82 and 86. 82 packs against 67 and in turn 18 packs against 82. 80
packs against 69 and in turn 20 packs against 80. 86 forms an H
bond network with 38 and 46. Many of the mouse-human differences
appear minor egg. Leu-Ile, but could have an minor impact on
correct packing which could translate into altered positioning of
the CDRs.
[0124] 2.2.2. Light Chain--Key residues are 48, 58 and 71. Other
key residues would be 6 if not glutamine, 35 if not tryptophan, 62
if not phenylalanine or tryosine, 64, 66, 68, 99 and 101 if not
glycines and 102 if not a threonine. Residues which make a further
contribution are 2, 4, 37, 45 and 47. Finally residues 73 and 21
and 19 may make long distance packing contributions of a minor
nature.
[0125] 2.3. Residues at the variable domain interface between heavy
and light chains--In both the light and heavy chains most of the
non-CDR interface residues are conserved. If a conserved residue is
replaced by a residue of different character, e.g. size or charge,
it should be considered for retention as the murine residue.
[0126] 2.3.1. Heavy Chain--Residues which need to be considered are
37 if the residue is not a valine but is of larger side chain
volume or has a charge or polarity. Other residues are 39 if not a
glutamine, 45 if not a leucine, 47 if not a tryptophan, 91 if not a
phenylalanine or tyrosine, 93 if not an alanine and 103 if not a
tryptophan. Residue 89 is also at the interface but is not in a
position where the side chain could be of great impact.
[0127] 2.3.2. Light Chain--Residues which need to be considered are
36, if not a tyrosine, 38 if not a glutamine, 44 if not a proline,
46, 49 if not a tyrosine, residue 85, residue 87 if not a tyrosine
and 98 if not a phenylalanine.
[0128] 2.4. Variable-Constant region interface--The elbow angle
between variable and constant regions may be affected by
alterations in packing of key residues in the variable region
against the constant region which may affect the position of
V.sub.L and V.sub.H with respect to one another. Therefore it is
worth noting the residues likely to be in contact with the constant
region. In the heavy chain the surface residues potentially in
contact with the variable region are conserved between mouse and
human antibodies therefore the variable region contact residues may
influence the V-C interaction. In the light chain the amino acids
found at a number of the constant region contact points vary, and
the V & C regions are not in such close proximity as the heavy
chain. Therefore the influences of the light chain V-C interface
may be minor.
[0129] 2.4.1. Heavy Chain--Contact residues are 7, 11, 41, 87, 108,
110, 112.
[0130] 2.4.2. Light Chain--In the light chain potentially
contacting residues are 10, 12, 40, 80, 83, 103 and 105.
[0131] The above analysis coupled with our considerable practical
experimental experience in the CDR-grafting of a number of
different antibodies have lead us to the protocol given above.
[0132] The present invention is now described, by way of example
only, with reference to the accompanying FIGS. 1-13.
BRIEF DESCRIPTION OF THE FIGURES
[0133] FIG. 1 shows DNA and amino acid sequences of the OKT3 light
chain;
[0134] FIG. 2 shows DNA and amino acid sequences of the OKT3 heavy
chain;
[0135] FIG. 3 shows the alignment of the OKT3 light variable region
amino acid sequence with that of the light variable region of the
human antibody REI;
[0136] FIG. 4 shows the alignment of the OKT3 heavy variable region
amino acid sequence with that of the heavy variable region of the
human antibody KOL;
[0137] FIG. 5 shows the heavy variable region amino acid sequences
of OKT3, KOL and various corresponding CDR grafts;
[0138] FIG. 6 shows the light variable region amino acid sequences
of OKT3, REI and various corresponding CDR grafts;
[0139] FIG. 7 shows a graph of binding assay results for various
grafted OKT3 antibodies'
[0140] FIG. 8 shows a graph of blocking assay results for various
grafted OKT3 antibodies;
[0141] FIG. 9 shows a similar graph of blocking assay results;
[0142] FIG. 10 shown similar graphs for both binding assay and
blocking assay results;
[0143] FIG. 11 shown further similar graphs for both binding assay
and blocking assay results;
[0144] FIG. 12 shows a graph of competition assay results for a
minimally grafted OKT3 antibody compared with the OKT3 murine
reference standard, and
[0145] FIG. 13 shows a similar graph of competition assay results
comparing a fully grafted OKT3 antibody with the marine reference
standard.
DETAILED DESCRIPTION OF EMBODIMENTS OF THE INVENTION
EXAMPLE 1
[0146] CDR-Grafting of OKT3
[0147] Material and Methods
[0148] 1. Incoming Cells
[0149] Hybridoma cells producing antibody OKT3 were provided by
Ortho (seedlot 4882.1) and were grown up in antibiotic free
Dulbecco's Modified Eagles Medium (DMEM) supplemented with
glutamine and St foetal calf serum, and divided to provide both an
overgrown supernatant for evaluation and cells for extraction of
RNA. The overgrown supernatant was shown to contain 250 ug/mL
marine IgG2a/kappa antibody. The supernatant was negative for
marine lambda light chain and IgG1, IgG2b, IgG3, IgA and IgM heavy
chain. 20 mL of supernatant was assayed to confirm that the
antibody present was OKT3.
[0150] 2. Molecular Biology Procedures
[0151] Basic molecular biology procedures were as described in
Maniatis et al (ref. 9) with, in some cases, minor modifications.
DNA sequencing was performed as described in Sanger et al (ref. 11)
and the Amersham International Plc sequencing handbook. Site
directed mutagenesis was as described in Kramer et al (ref. 12) and
the Anglian Biotechnology Ltd. handbook. COS cell expression and
metabolic labelling studies were as described in Whittle et al
(ref. 13).
[0152] 3. Research Assays
[0153] 3.1. Assembly Assays
[0154] Assembly assays were performed on supernatants from
transfected COS cells to determine the amount of intact IgG
present.
[0155] 3.1.1. COS Cells Transfected with Mouse OKT3 Genes
[0156] The assembly assay for intact mouse IgG in COS cell
supernatants was an ELISA with the following format:
[0157] 96 well microtitre plates were coated with F(ab').sub.2 goat
anti-mouse IgG Fc. The plates were washed in water and samples
added for 1 hour at room temperature. The plates were washed and
F(ab').sub.2 goat anti-mouse IgG F(ab').sub.2 (HRPO conjugated) was
then added. Substrate was added to reveal the reaction. UPC10, a
mouse IgG2a myeloma, was used as a standard.
[0158] 3.1.2. COS and CEO Cells Transfected with Chimeric or
CDR-Grafted OKT3 Genes
[0159] The assembly assay for chimeric or CDR-grafted antibody in
COS cell supernatants was an ELISA with the following format:
[0160] 96 well microtitre plates were coated with F(ab').sub.2 goat
anti-human IgG Fc. The plates were washed and samples added and
incubated for 1 hour at room temperature. The plates were washed
and monoclonal mouse anti-human kappa chain was added for 1 hour at
room temperature.
[0161] The plates were washed and F(ab').sub.2 goat anti-mouse IgG
Fc (HRPO conjugated) was added. Enzyme substrate was added to
reveal the reaction. Chimeric B72.3 (IgG4) (ref. 13) was used as a
standard. The use of a monoclonal anti-kappa chain in this assay
allows grafted antibodies to be read from the chimeric
standard.
[0162] 3.2. Assay for Antigen Binding Activity
[0163] Material from COS cell supernatants was assayed for OKT3
antigen binding activity onto CD3 positive cells in a direct assay.
The procedure was as follows:
[0164] HUT 78 cells (human T cell line, CD3 positive) were
maintained in culture. Monolayers of MUT 78 cells were prepared
onto 96 well ELISA plates using poly-L-lysine and glutaraldehyde.
Samples were added to the monolayers for 1 hour at room
temperature.
[0165] The plates were washed gently using PBS. F(ab').sub.2 goat
anti-human IgG Fc (HRPO conjugated) or F(ab').sub.2 goat anti-mouse
IgG Fc (HRPO conjugated) was added as appropriate for humanised or
mouse samples. Substrate was added to reveal the reaction.
[0166] The negative control for the cell-based assay was chimeric
B72.3. The positive control was mouse Orthomune OKT3 or chimeric
OKT3, when available. This cell-based assay was difficult to
perform, and an alternative assay was developed for CDR-grafted
OKT3 which was more sensitive and easier to carry out.
[0167] In this system CDR-grafted OKT3 produced by COS cells was
tested for its ability to bind to the CD3-positive HPB-ALL (human
peripheral blood acute lymphocytic leukemia) cell line. It was also
tested for its ability to block the binding of murine OKT3 to these
cells. Binding was measured by the following procedure: HPB-ALL
cells were harvested from tissue culture. Cells were incubated at
4.degree. C. for 1 hour with various dilutions of test antibody,
positive control antibody, or negative control antibody. The cells
were washed once and incubated at 4.degree. C. for 1 hour with an
FITC-labelled goat anti-human IgG (Fc-specific, mouse absorbed).
The cells were washed twice and analysed by cytofluorography.
Chimeric OKT3 was used as a positive control for direct binding.
Cells incubated with mock-transfected COS cell supernatant,
followed by the FITC-labelled goat anti-human IgG, provided the
negative control. To test the ability of CDR-grafted OKT3 to block
murine OKT3 binding, the BPS-ALL cells were incubated at 4.degree.
C. for 1 hour with various dilutions of test antibody or control
antibody. A fixed saturating amount of FITC OKT3 was added. The
samples were incubated for 1 hour at 4.degree. C., washed twice and
analysed by cytofluorography. FITC-labelled OKT3 was used as a
positive control to determine maximum binding. Unlabelled murine
OKT3 served as a reference standard for blocking. Negative controls
were unstained cells with or without mock-transfected cell
supernatant. The ability of the CDR-grafted OKT3 light chain to
bind CD3-positive cells and block the binding of marine OKT3 was
initially tested in combination with the chimeric OKT3 heavy chain.
The chimeric OKT3 heavy chain is composed of the murine OKT3
variable region and the human IgG4 constant region. The chimeric
heavy chain gene is expressed in the same expression vector used
for the CDR-grafted genes. The CDR-grafted light chain expression
vector and the chimeric heavy chain expression vector were
co-transfected into COS cells. The fully chimeric OKT3 antibody
(chimeric light chain and chimeric heavy chain) was found to be
fully capable of binding to CD3 positive cells and blocking the
binding of marine OKT3 to these cells.
[0168] 3.3 Determination of Relative Binding Affinity
[0169] The relative binding affinities of CDR-grafted anti-CD3
monoclonal antibodies were determined by competition binding (ref.
6) using the HPB-ALL human T cell line as a source of CD3 antigen,
and fluorescein-conjugated marine OKT3 (F1-OKT3) of known binding
affinity as a tracer antibody. The binding affinity of F1-OKT3
tracer antibody was determined by a direct binding assay in which
increasing amounts of F1-OKT3 were incubated with HPB-ALL
(5.times.10.sup.5) in PBS with 5% foetal calf serum for 60 min. at
4.degree. C. Cells were washed, and the fluorescence intensity was
determined on a FACScan flow cytometer calibrated with quantitative
microbead standards (Flow Cytometry Standards, Research Triangle
Park, N.C.). Fluorescence intensity per antibody molecule (F/P
ratio) was determined by using microbeads which have a
predetermined number of mouse IgG antibody binding sites (Simply
Cellular beads, Flow Cytometry Standards). F/P equals the
fluorescence intensity of beads saturated with F1-OKT3 divided by
the number of binding sites per bead. The amount of bound and free
F1-OKT3 was calculated from the mean fluorescence intensity per
cell, and the ratio of bound/free was plotted against the number of
moles of antibody bound. A linear fit was used to determine the
affinity of binding (absolute value of the slope).
[0170] For competitive binding, increasing amounts of competitor
antibody were added to a sub-saturating dose of F1-OKT3 and
incubated with 5.times.10.sup.5 HPB-ALL in 200 ml of PBS with 5%
foetal calf serum, for 60 min at 4.degree. C. The fluorescence
intensities of the cells were measured on a FACScan flow cytometer
calibrated with quantitative microbead standards. The
concentrations of bound and free F1-OKT3 were calculated. The
affinities of competing antibodies were calculated from the
equation [X]-[OKT3]=(1/Kx)-(1/Ka), where Ka is the affinity of
marine OKT3, Kx is the affinity of competitor X, [ ] in the
concentration of competitor antibody at which bound/free binding is
R/2, and R is the maximal bound/free binding.
[0171] 4. cDNA Library Construction
[0172] 4.1. mRNA Preparation and cDNA Synthesis
[0173] OKT3 producing cells were grown as described above and
1.2.times.10.sup.9 cells harvested and mRNA extracted using the
guanidinium/LiCl extraction procedure. cDNA was prepared by priming
from Oligo-dT to generate full length cDNA. The cDNA was methylated
and EcoR1 linkers added for cloning.
[0174] 4.2. Library Construction
[0175] The cDNA library was ligated to pSP65 vector DNA which had
been EcoR1 cut and the 5' phosphate groups removed by calf
intestinal phosphatase (EcoR1/CIP). The ligation was used to
transform high transformation efficiency Escherichia coli (E. coli)
HB101. A cDNA library was prepared. 3600 colonies were screened for
the light chain and 10000 colonies were screened for the heavy
chain.
[0176] 5. SCREENING
[0177] E. coli colonies positive for either heavy or light chain
probes were identified by oligonucleotide screening using the
oligonucleotides: 5' TCCAGATGTTAACTGCTCAC for the light chain,
which is complementary to a sequence in the mouse kappa constant
region, and 5'CAGGGGCCAGTGGATGGATAGA- C for the heavy chain which
is complementary to a sequence in the mouse IgG2a constant CH1
domain region. 12 light chain and 9 heavy chain clones were
identified and taken for second round screening. Positive clones
from the second round of screening were grown up and DNA prepared.
The sizes of the gene inserts were estimated by gel electrophoresis
and inserts of a size capable of containing a full length cDNA were
subcloned into M13 for DNA sequencing.
[0178] 6. DNA Sequencing
[0179] Clones representing four size classes for both heavy and
light chains were obtained in M13. DNA sequence for the 5'
untranslated regions, signal sequences, variable regions and 3'
untranslated regions of full length cDNAs [(FIGS. 1(a) and 2(a)]
were obtained and the corresponding amino acid sequences predicted
[(FIGS. 1(b) and 2(b)]. In FIG. 1(a) the untranslated DNA regions
are shown in uppercase, and in both FIGS. 1 and 2 the signal
sequences are underlined.
[0180] 7. Construction of cDNA Expression Vectors
[0181] Celltech expression vectors are based on the placid pEE6hCMV
(ref. 14). A polylinker for the insertion of genes to be expressed
has been introduced after the major immediate early
promoter/enhancer of the human Cytomegalovirus (hCMV). Marker genes
for selection of the plasmid in transfected eukaryotic cells can be
inserted as BamH1 cassettes in the unique BamH1 site of pEE6 hCMV;
for instance, the neo marker to provide pEE6 hCMV neo. It is usual
practice to insert the neo and gpt markers prior to insertion of
the gene of interest, whereas the GS marker is inserted last
because of the presence of internal EcoR1 sites in the
cassette.
[0182] The selectable markers are expressed from the SV40 late
promoter which also provides an origin of replication so that the
vectors can be used for expression in the COS cell transient
expression system.
[0183] The mouse sequences were excised from the M13 based vectors
described above as EcoR1 fragments and cloned into either
pEE6-hCMV-neo for the heavy chain and into EE6-hCMV-gpt for the
light chain to yield vectors pJA136 and pJA135 respectively.
[0184] 8. Expression of cDNAS in COS Cells
[0185] Plasmids pJA135 and pJA136 were co-transfected into COS
cells and supernatant from the transient expression experiment was
shown to contain assembled antibody which bound to T-cell enriched
lymphocytes. Metabolic labelling experiments using .sup.35S
methionine showed expression and assembly of heavy and light
chains.
[0186] 9. Construction of Chimeric Genes
[0187] Construction of chimeric genes followed a previously
described strategy (Whittle et al (ref. 13)]. A restriction site
near the 3' end of the variable domain sequence is identified and
used to attach an oligonucleotide adapter coding for the remainder
of the mouse variable region and a suitable restriction site for
attachment to the constant region of choice.
[0188] 9.1. Light Chain Gene Construction
[0189] The mouse light chain cDNA sequence contains an Aval site
near the 3' end of the variable region [FIG. 1(a)]. The majority of
the sequence of the variable region was isolated as a 396 bp.
[0190] EcoR1-Aval fragment. An oligonucleotide adapter was designed
to replace the remainder of the 3' region of the variable region
from the Aval site and to include the 5' residues of the human
constant region up to and including a unique Nar1 site which had
been previously engineered into the constant region.
[0191] A Hind111 site was introduced to act as a marker for
insertion of the linker.
[0192] The linker was ligated to the V.sub.L fragment and the 413
bp EcoR1-Nar1 adapted fragment was purified from the ligation
mixture.
[0193] The constant region was isolated as an Nar1-BamH1 fragment
from an M13 clone NW361 and was ligated with the variable region
DNA into an EcoR1/BamH1/C1P pSP65 treated vector in a three way
reaction to yield plasmid JA143. Clones were isolated after
transformation into E. coli and the linker and junction sequences
were confirmed by the presence of the Hind111 site and by DNA
sequencing.
[0194] 9.2 Light Chain Gene Construction--Version 2
[0195] The construction-of the first chimeric light chain gene
produces a fusion of mouse and human amino acid sequences at the
variable-constant region junction. In the case of the OKT3 light
chain the amino acids at the chimera junction are: 1
[0196] This arrangement of sequence introduces a potential site for
Asparagine (Asn) linked (N-linked) glycosylation at the V-C
junction. Therefore, a second version of the chimeric light chain
oligonucleotide adapter was designed in which the threonine (Thr),
the first amino acid of the human constant region, was replaced
with the equivalent amino acid from the mouse constant region,
Alanine (Ala).
[0197] An internal Hind111 site was not included in this adapter,
to differentiate the two chimeric light chain genes.
[0198] The variable region fragment was isolated as a 376 bp
EcoR1-Aval fragment. The oligonucleotide linker was ligated to Nar1
cut pNW361 and then the adapted 396 bp constant region was isolated
after recutting the modified pNW361 with EcoR1. The variable region
fragment and the modified constant region fragment were ligated
directly into EcoR1/CIP treated pEE6hCMVneo to yield pJA137.
Initially all clones examined had the insert in the incorrect
orientation. Therefore, the insert was re-isolated and recloned to
turn the insert round and yield plasmid pJA141. Several clones with
the insert in the correct orientation were obtained and the adapter
sequence of one was confirmed by DNA sequencing.
[0199] 9.3. Heavy Chain Gene Construction
[0200] 9.3.1. Choice of Heavy Chain Gene Isotype
[0201] The constant region isotype chosen for the heavy chain was
human IgG4.
[0202] 9.3.2. GENE CONSTRUCTION
[0203] The heavy chain cDNA sequence showed a Ban1 site near the 3'
end of the variable region [FIG. 2(a)]. The majority of the
sequence of the variable region was isolated as a 426 bp.
EcoR1/C1P/Ban1 fragment. An oligonucleotide adapter was designated
to replace the remainder of the 3' region of the variable region
from the Ban1 site up to and including a unique HindIII site which
had been previously engineered into the first two amino acids of
the constant region.
[0204] The linker was ligated to the V.sub.H fragment and the
EcoR1-Hind111 adapted fragment was purified from the ligation
mixture.
[0205] The variable region was ligated to the constant region by
cutting pJA91 with EcoR1 and Hind111 removing the intron fragment
and replacing it with the V.sub.H to yield pJA142. Clones were
isolated after transformation into E. coli JM101 and the linker and
junction sequences were confirmed by DNA sequencing. (N.B. The
Hind111 site is lost on cloning).
[0206] 10. Construction of Chimeric Expression Vectors
[0207] 10.1. neo and gpt Vectors
[0208] The chimeric light chain (version 1) was removed from pJA143
as an EcoR1 fragment and cloned into EcoR1/C1P treated pEE6hCMVneo
expression vector to yield pJA145. Clones with the insert in the
correct orientation were identified by restriction mapping.
[0209] The chimeric light chain (version 2) was constructed as
described above.
[0210] The chimeric heavy chain gene was isolated from pJA142 as a
2.5 Kbp EcoR1/BamH1 fragment and cloned into the EcoR1/Bcl1/C1P
treated vector fragment of a derivative of pEE6hCMVgpt to yield
plasmid pJA144.
[0211] 10.2. GS Separate Vectors
[0212] GS versions of pJA141 and pJA144 were constructed by
replacing the neo and gpt cassettes by a BamH1/Sa11/C1P treatment
of the plasmids, isolation of the vector fragment and ligation to a
GS-containing fragment from the plasmid pRO49 to yield the light
chain vector pJA179 and the heavy chain vector pJA180.
[0213] 10.3. GS Single Vector Construction
[0214] Single vector constructions containing the cL (chimeric
light), cH (chimeric heavy) and GS genes on one plasmid in the
order cL-cH-GS, or cH-cL-GS and with transcription of the genes
being head to tail e.g. cL>cH>GS were constructed. These
plasmids were made by treating pJA179 or pJA180 with BamH1/C1P and
ligating in a Bgl11/Hind111 hCMV promoter cassette along with
either the Hind111/BamH1 fragment from pJA141 into pJA180 to give
the cH-cL-GS plasmid pJA182 or the Hind111/BamH1 fragment from
pJA144 into pJA179 to give the cL-cH-GS plasmid pJA181.
[0215] 11. Expression of Chimeric GENES
[0216] 11.1. Expression in COS Cells
[0217] The chimeric antibody plasmid pJA145 (cL) and pJA144 (cH)
were co-transfected into COS cells and supernatant from the
transient expression experiment was shown to contain assembled
antibody which bound to the HUT 78 human T-cell line. Metabolic
labelling experiments using .sup.35S methionine showed expression
and assembly of heavy and light chains. However the light chain
mobility seen on reduced gels suggested that the potential
glycosylation site was being glycosylated. Expression in COS cells
in the presence of tunicamycin showed a reduction in size of the
light chain to that shown for control chimeric antibodies and the
OKT3 mouse light chain. Therefore JA141 was constructed and
expressed. In this case the light chain did not show an aberrant
mobility or a size shift in the presence or absence of tunicamycin.
This second version of the chimeric light chain, when expressed in
association with chimeric heavy (cH) chain, produced antibody which
showed good binding to NUT 78 cells. In both cases antigen binding
was equivalent to that of the mouse antibody.
[0218] 11.2 Expression in Chinese Hamster Ovary (CEO) Cells
[0219] Stable cell lines have been prepared from plasmids
pJA141/pJA144 and from pJA179/pJA180, pJA181 and pJA182 by
transfection into CEO cells.
[0220] 12. CDR-Grafting
[0221] The approach taken was to try to introduce sufficient mouse
residues into a human variable region framework to generate antigen
binding activity comparable to the mouse and chimeric
antibodies.
[0222] 12.1. Variable Region Analysis
[0223] From an examination of a small database of structures of
antibodies and antigen-antibody complexes it is clear that only a
small number of antibody residues make direct contact with antigen.
Other residues may contribute to antigen binding by positioning the
contact residues in favourable configurations and also by inducing
a stable packing of the individual variable domains and stable
interaction of the light and heavy chain variable domains.
[0224] The residues chosen for transfer can be identified in a
number of ways:
[0225] (a) By examination of antibody X-ray crystal structures the
antigen binding surface can be predominantly located on a series of
loops, three per domain, which extend from the B-barrel
framework.
[0226] (b) By analysis of antibody variable domain sequences
regions of hypervariability (termed the Complementarity Determining
Regions (CDRs) by Wu and Kabat (ref. 5)] can be identified. In the
most but not all cases these CDRs correspond to, but extend a short
way beyond, the loop regions noted above.
[0227] (c) Residues not identified by (a) and (b) may contribute to
antigen binding directly or indirectly by affecting antigen binding
site topology, or by inducing a stable packing of the individual
variable domains and stabilizing the inter-variable domain
interaction. These residues may be identified either by
superimposing the sequences for a given antibody on a known
structure and looking at key residues for their contribution, or by
sequence alignment analysis and noting idiosyncratic residues
followed by examination of their structural location and likely
effects.
[0228] 12.1.1. Light Chain
[0229] FIG. 3 shows an alignment of sequences for the human
framework region RE1 and the OKT3 light variable region. The
structural loops (LOOP) and CDRs (KARAT) believed to correspond to
the antigen binding region are marked. Also marked are a number of
other residues which may also contribute to antigen binding as
described in 13.1(c). Above the sequence in FIG. 3 the residue type
indicates the spatial location of each residue side chain, derived
by examination of resolved structures from X-ray crystallography
analysis.
[0230] The key to this residue type designation is as follows:
[0231] N--near to CDR (From X-ray Structures)
[0232] P--Packing B--Buried Non-Packing
[0233] S--Surface E--Exposed
[0234] I--Interface *--Interface
[0235] --Packing/Part Exposed
[0236] ?--Non-CDR Residues which may require to be left as Mouse
sequence.
[0237] Residues underlined in FIG. 3 are amino acids. RE1 was
chosen as the human framework because the light chain is a kappa
chain and the kappa variable regions show higher homology with the
mouse sequences than a lambda light variable region, e.g. KOL (see
below). RE1 was chosen in preference to another kappa light chain
because the X-ray structure of the light chain has been determined
so that a structural examination of individual residues could be
made.
[0238] 12.1.2. Heavy Chain
[0239] Similarly FIG. 4 shows an alignment of sequences for the
human framework region KOL and the OKT3 heavy variable region. The
structural loops and CDRs believed to correspond to the antigen
binding region are marked. Also marked are a number of other
residues which may also contribute to antigen binding as described
in 12.1(c). The residue type key and other indicators used in FIG.
4 are the same as those used in FIG. 3. KOL was chosen as the heavy
chain framework because the X-ray structure has been determined to
a better resolution than, for example, NEWM and also the sequence
alignment of OKT3 heavy variable region showed a slightly better
homology to KOL than to NEWM.
[0240] 12.2. Design of Variable Genes
[0241] The variable region domains were designed with mouse
variable region optimal codon usage [Grantham and Perrin (ref. 15)]
and used the B72.3 signal sequences [Whittle et al (ref. 13)]. The
sequences were designed to be attached to the constant region in
the same way as for the chimeric genes described above. Some
constructs contained the "Kozak consensus sequence" [Kozak (ref.
16)] directly linked to the 5' of the signal sequence in the gene.
This sequence motif in believed to have a beneficial role in
translation initiation in eukaryates.
[0242] 12.3. Gene Construction
[0243] To build the variable regions, various strategies are
available. The sequence may be assembled by using oligonucleotides
in a manner similar to Jones et al (ref. 17) or by simultaneously
replacing all of the CDRs or loop regions by oligonucleotide
directed site specific mutagenesis in a manner similar to Verhoeyen
et al (ref. 2). Both strategies were used and a list of
constructions is set out in Tables 1 and 2 and FIGS. 4 and 5. It
was noted in several cases that the mutagenesis approach led to
deletions and rearrangements in the gene being remodelled, while
the success of the assembly approach was very sensitive to the
quality of the oligonucleotides.
[0244] 13. Construction of Expression Vectors
[0245] Genes were isolated from M13 or SP65 based intermediate
vectors and cloned into pEE6hCMVneo for the light chains and
pEE6hCMVgpt for the heavy chains in a manner similar to that for
the chimeric genes as described above.
1TABLE 1 CDR-GRAFTED GENE CONSTRUCTS KOZAK SEQUENCE CODE MOUSE
SEQUENCE CONTENT METHOD OF CONSTRUCTION - + LIGHT CHAIN ALL HUMAN
FRAMEWORK RE1 121 26-32, 50-56, 91-96 inclusive SDM and gene
assembly + n.d. 121A 26-32, 50-56, 91-96 inclusive Partial gene
assembly n.d. + +1, 3, 46, 47 121B 26-32, 50-56, 91-96 inclusive
Partial gene assembly n.d. + +46, 47 221 24-24, 50-56, 91-96
inclusive Partial gene assembly + + 221A 24-34, 50-56, 91-96
inclusive Partial gene assembly + + +1, 3, 46, 47 221B 24-34,
50-56, 91-96 inclusive Partial gene assembly + + +1, 3 221C 24-34,
50-56, 91-96 inclusive Partial gene assembly + + HEAVY CHAIN ALL
HUMAN FRAMEWORK KOL 121 26-32, 50-56, 95-100B inclusive Gene
assembly n.d. + 131 26-32, 50-58, 95-100B inclusive Gene assembly
n.d. + 141 26-32, 50-65, 95-100B inclusive Partial gene assembly +
n.d. 321 26-35, 50-56, 95-100B inclusive Partial gene assembly +
n.d. 331 26-35, 50-58, 95-100B inclusive Partial gene assembly +
Gene assembly + 341 26-35, 50-65, 95-100B inclusive SDM + Partial
gene assembly + 341A 26-35, 50-65, 95-100B inclusive Gene assembly
n.d. + +6, 23, 24, 48, 49, 71, 73, 76, 78, 88, 91 (+63 = human)
341B 26-35, 50-65, 95-100B inclusive Gene assembly n.d. + +48, 49,
71, 73, 76, 78, 88, 91 (+63 + human) KEY n.d. not done SDM Site
directed mutagenesis Gene assembly Variable region assembled
entirely from oligonucleotides Partial gene assembly Variable
region assembled by combination of restriction fragments either
from other genes originally created by SDM and gene assembly or by
oligonucleotide assembly of part of the variable region and
reconstruction with restriction fragments from other genes
originally created by SDM and gene assembly
[0246] 14. Expression op CDR-Grafted Genes
[0247] 14.1. Production of Antibody Consisting of Grafted Light
(gL) Chains with Mouse Heavy (mH) or Chimeric Heavy (cH) Chains
[0248] All gL chains, in association with mH or cH produced
reasonable amounts of antibody. Insertion of the Kozak consensus
sequence at a position 5' to the ATG (kgL constructs) however, led
to a 2-5 fold improvement in net expression. Over an extended
series of experiments expression levels were raised from
approximately 200 ng/ml to approximately 500 ng/ml for kgL/cH or
kgL/mH combinations.
[0249] When direct binding to antigen on HUT 78 cells was measured,
a construct designed to include mouse sequence based on loop length
(gL121) did not lead to active antibody in association with mH or
cH. A construct designed to include mouse sequence based on Kabat
CDRs (gL221) demonstrated some weak binding in association with mH
or cH. However, when framework residues 1, 3, 46, 47 were changed
from the human to the murine OKT3 equivalents based on the
arguments outlined in Section 12.1 antigen binding was demonstrated
when both of the new constructs, which were termed 121A and 221A
were co-expressed with cH. When the effects of these residues were
examined in more detail, it appears that residues 1 and 3 are not
major contributing residues as the product of the gL221B gene shows
little detectable binding activity in association with ca. The
light chain product of gL221C, in which mouse sequences are present
at 46 and 47, shows good binding activity in association with
cH.
[0250] 14.2 Production of Antibody Consisting of Grafted Heavy (gH)
Chains with Mouse Light (mL) or Chimeric Light (cL) Chains
[0251] Expression of the gH genes proved to be more difficult to
achieve than for gL. First, inclusion of the Kozak sequence
appeared to have no marked effect on expression of gH genes.
Expression appears to be slightly improved but not to the same
degree as seen for the grafted light chain.
[0252] Also, it proved difficult to demonstrate production of
expected quantities of material when the loop choice (amino acid
26-32) for CDR1 is used, e.g. gH121, 131, 141 and no conclusions
can be drawn about these constructs.
[0253] Moreover, co-expression of the gH341 gene with cL or mL has
been variable and has tended to produce lower amounts of antibody
than the cH/cL or mH/mL combinations. The alterations to gH341 to
produce gH341A and gH341B lead to improved levels of
expression.
[0254] This may be due either to a general increase in the fraction
of mouse sequence in the variable region, or to the alteration at
position 63 where the residue is returned to the human amino acid
Valine (Val) from Phenylalanine (Phe) to avoid possible internal
packing problems with the rest of the human framework. This
arrangement also occurs in gH331 and gH321.
[0255] When gH321 or gH331 were expressed in association with cL,
antibody was produced but antibody binding activity was not
detected.
[0256] When the more conservative gH341 gene was used antigen
binding could be detected in association with cL or mL, but the
activity was only marginally above the background level.
[0257] When further mouse residues were substituted based on the
arguments in 12.1, antigen binding could be clearly demonstrated
for the antibody produced when kgH341A and kgH341B were expressed
in association with cL.
[0258] 14.3 Production of Fully CDR-Grafted Antibody
[0259] The kgL221A gene was co-expressed with kgH341, kgH341A or
kgH341B. For the combination kgH221A/kgH341 very little material
was produced in a normal COS cell expression.
[0260] For the combinations kgL221A/kgH341A or kgH221A/kgH341B
amounts of antibody similar to gL/cH was produced.
[0261] In several experiments no antigen binding activity could be
detected with kgH221A/gH341 or kgH221A/kgH341 combinations,
although expression levels were very low.
[0262] Antigen binding was detected when kgL221A/kgH341A or
kgH221A/kgH341B combinations were expressed. In the case of the
antibody produced from the kgL221A/kgH341A combination the antigen
binding was very similar to that of the chimeric antibody.
[0263] An analysis of the above results is given below.
[0264] 15. Discussion of CDR-Grafting Results
[0265] In the design of the fully humanised antibody the aim was to
transfer the minimum number of mouse Amino acids that would confer
antigen binding onto a human antibody framework.
[0266] 15.1. Light Chain
[0267] 15.1.1. Extent of the CDRs
[0268] For the light chain the regions defining the loops known
from structural studies of other antibodies to contain the antigen
contacting residues, and those hypervariable sequences defined by
Kabat et al (refs. 4 and 5) as Complementarity Determining Regions
(CDRs) are equivalent for CDR2. For CDR1 the hypervariable region
extends from residues 24-34 inclusive while the structural loop
extends from 26-32 inclusive. In the case of OKT3 there is only one
amino acid difference between the two options, at amino acid 24,
where the mouse sequence is a serine and the human framework RE1
has glutamine. For CDR3 the loop extends from residues 91-96
inclusive while the Kabat hypervariability extends from residues
89-97 inclusive. For OKT3 amino acids 89, 90 and 97 are the same
between OKT3 and RE1 (FIG. 3). When constructs based on the loop
choice for CDR1 (gL121) and the Kabat choice (gL221) were made and
co-expressed with mH or cH no evidence for antigen binding activity
could be found for gL121, but trace activity could be detected for
the gL221, suggesting that a single extra mouse residue in the
grafted variable region could have some detectable effect. Both
gene constructs were reasonably well expressed in the transient
expression system.
[0269] 15.1.2. Framework Residues
[0270] The remaining framework residues were then further examined,
in particular amino acids known from X-ray analysis of other
antibodies to be close to the CDRs and also those amino acids which
in OKT3 showed differences from the consensus framework for the
mouse subgroup (subgroup VI) to which OKT3 shows most homology.
Four positions 1, 3, 46 and 47 were identified and their possible
contribution was examined by substituting the mouse amino acid for
the human amino acid at each position. Therefore gL221A (gL221+D1Q,
Q3V, L46R, L47W, see FIG. 3 and Table 1) was made, cloned in
EE6hCMVneo and co-expressed with cH (pJA144). The resultant
antibody was well expressed and showed good binding activity. When
the related genes gL221B (gL221+D1Q, Q3V) and gL221C (gL221+L46R,
L47W) were made and similarly tested, while both genes produced
antibody when co-expressed with cH, only the gL221C/cH combination
showed good antigen binding. When the gL121A (gL221+D1Q, Q3V, L46R,
L47W) gene was made and co-expressed with cH, antibody was produced
which also bound to antigen.
[0271] 15.2. Heavy Chain
[0272] 15.2.1. Extent of the CDRs
[0273] For the heavy chain the loop and hypervariability analyses
agree only in CDR3. For CDR1 the loop region extends from residues
26-32 inclusive whereas the Kabat CDR extends from residues 31-35
inclusive. For CDR2 the loop region is from 50-58 inclusive while
the hypervariable region covers amino acids 50-65 inclusive.
Therefore humanised heavy chains were constructed using the
framework from antibody KOL and with various combinations of these
CDR choices, including a shorter choice for CDR2 of 50-56 inclusive
as there was some uncertainty as to the definition of the end point
for the CDR2 loop around residues 56 to 58. The genes were
co-expressed with mL or cL initially. In the case of the gH genes
with loop choices for CDR1 e.g. gH121, gH131, gH141 very little
antibody was produced in the culture supernatants. As no free light
chain was detected it was presumed that the antibody was being made
and assembled inside the cell but that the heavy chain was aberrant
in some way, possibly incorrectly folded, and therefore the
antibody was being degraded internally. In some experiments trace
amounts of antibody could be detected in .sup.35S labelling
studies.
[0274] As no net antibody was produced, analysis of these
constructs was not pursued further.
[0275] When, however, a combination of the loop choice and the
Kabat choice for CDR1 was tested (mouse amino acids 26-35
inclusive) and in which residues 31 (Ser to Arg), 33 (Ala to Thr),
and 35 (Tyr to His) were changed from the human residues to the
mouse residue and compared to the first series, antibody was
produced for gH321, kgH331 and kgH341 when co-expressed with cL.
Expression was generally low and could not be markedly improved by
the insertion of the Kozak consensus sequence 5' to the ATG of the
signal sequence of the gene, as distinct from the case of the gL
genes where such insertion led to a 2-5 fold increase in net
antibody production. However, only in the case of gH341/mL or
kgH341/cL could marginal antigen binding activity be demonstrated.
When the kgH341 gene was co-expressed with kgL221A, the net yield
of antibody was too low to give a signal above the background level
in the antigen binding assay.
[0276] 15.2.2. Framework Residues
[0277] An in the case of the light chain the heavy chain frameworks
were re-examined. Possibly because of the lower initial homology
between the mouse and human heavy variable domains compared to the
light chains, more amino acid positions proved to be of interest.
Two genes kgH341A and kgH341B were constructed, with 11 or 8 human
residues respectively substituted by mouse residues compared to
gH341, and with the CDR2 residue 63 returned to the human amino
acid potentially to improve domain packing. Both showed antigen
binding when combined with CL or kgL221A, the kgH341A gene with all
11 changes appearing to be the superior choice.
[0278] 15.3 Interim Conclusions
[0279] It has been demonstrated, therefore, for OKT3 that to
transfer antigen binding ability to the humanised antibody, mouse
residues outside the CDR regions defined by the Kabat
hypervariability or structural loop choices are required for both
the light and heavy chains. Fewer extra residues are needed for the
light chain, possibly due to the higher initial homology between
the mouse and human kappa variable regions.
[0280] Of the changes seven (1 and 3 from the light chain and 6,
23, 71, 73 and 76 from the heavy chain) are predicted from a
knowledge of other antibody structures to be either partly exposed
or on the antibody surface. It has been shown here that residues 1
and 3 in the light chain are not absolutely required to be the
mouse sequence; and for the heavy chain the gH341B heavy chain in
combination with the 221A light chain generated only weak binding
activity. Therefore the presence of the 6, 23 and 24 changes are
important to maintain a binding affinity similar to that of the
murine antibody. It was important, therefore, to further study the
individual contribution of the other 8 mouse residues of the
kgH341A gene compared to kgH341.
[0281] 16. Further CDR-Grafting Experiments
[0282] Additional CDR-grafted heavy chain genes were prepared
substantially as described above. With reference to Table 2 the
further heavy chain genes were based upon the gh341 (plasmid
pJA178) and gH341A (plasmid pJA1851 with either mouse OKT3 or human
KOL residues at 6, 23, 24, 48, 49, 63, 71, 73, 76, 78, 88 and 91,
as indicated. The CDR-grafted light chain genes used in these
further experiments were gL221, gL221A, gL221B and gL221C as
described above.
2TABLE 2 OKT3 HEAVY CHAIN CDR GRAFTS 1. gH341 and derivatives 2
OKT3 LIGHT CHAIN CDR GRAFTS 2. gL221 and derivatives 3 MURINE
RESIDUES ARE UNDERLINED
[0283] The CDR-grafted heavy and light chain genes were
co-expressed in COS cells either with one another in various
combinations but also with the corresponding murine and chimeric
heavy and light chain genes substantially as described above. The
resultant antibody products were then assayed in binding and
blocking assays with EPS-ALL cells as described above.
[0284] The results of the assays for various grafted heavy chains
co-expressed with the gL221C light chain are given in FIGS. 7 and 8
(for the JA184, JA185, JA197 and JA198 constructs--see Table 2), in
FIG. 9 (for the JA183, JA184, JA185 and JA197. constructs) in FIG.
10 (for the chimeric, JA185, JA199, JA204, JA205, JA207, JA208 and
JA209 constructs) and in FIG. 11 (for the JA183, JA184, JA185,
JA198, JA203, JA205 and JA206 constructs).
[0285] The basic grafted product without any human to murine
changes in the variable frameworks, i.e. gL221 co-expressed with
gh341 (JA178), and also the "fully grafted" product, having most
human to murine changes in the grafted heavy chain framework, i.e.
gL221C co-expressed with gh341A (JA185), were assayed for relative
binding affinity in a competition assay against murine OKT3
reference standard, using HPB-ALL cells. The assay used was as
described above in section 3.3. The results obtained are given in
FIG. 12 for the basic grafted product and in FIG. 13 for the fully
grafted product. These results indicate that the basic grafted
product has neglibible binding ability as compared with the OKT3
murine reference standard; whereas the "fully grafted" product has
a binding ability very similar to that of the OKT3 murine reference
standard.
[0286] The binding and blocking assay results indicate the
following:
[0287] The JA198 and JA207 constructs appear to have the best
binding characteristics and similar binding abilities, both
substantially the same as the chimeric and fully grafted gH341A
products. This indicates that positions 88 and 91 and position 76
are not highly critical for maintaining the OKT3 binding ability;
whereas at least some of positions 6, 23, 24, 48, 49, 71, 73 and 78
are more important.
[0288] This is borne out by the finding that the JA209 and JA199,
although of similar binding ability to one another, are of lower
binding ability than the JA198 and JA207 constructs. This indicates
the importance of having mouse residues at positions 71, 73 and 78,
which are either completely or partially human in the JA199 and
JA209 constructs respectively.
[0289] Moreover, on comparing the results obtained for the JA205
and JA183 constructs it is seen that there is a decrease in binding
going from the JA205 to the JA183 constructs. This indicates the
importance of retaining a mouse residue at position 23, the only
position changed between JA205 and JA183.
[0290] These and other results lead us to the conclusion that of
the 11 mouse framework residues used in the gH341A (JA185)
construct, it is important to retain mouse residues at all of
positions 6, 23, 24, 48 and 49, and possibly for maximum binding
affinity at 71, 73 and 78.
[0291] Similar Experiments were carried out to CDR-graft a number
of the rodent antibodies including antibodies having specificity
for CD4 (OKT4), ICAM-1 (R6-5), TAG72 (B72.3), and TNF.alpha.(61E71,
101.4, hTNF1, hTNF2 and hTNF3).
EXAMPLE 2
[0292] CDR-Grafting of a Murine Anti-CD4 T Cell Receptor Antibody,
OKT4A
[0293] Anti OKT4A CDR-grafted heavy and light chain genes were
prepared, expressed and tested substantially as described above in
Example 1 for CDR-grafted OKT3. The CDR grafting of OKT4A is
described in detail in Ortho patent application PCT/GB 90 . . . of
even date herewith entitled "Humanised Antibodies". The disclosure
of this Ortho patent application PCT/GB 90 . . . is incorporated
herein by reference. A number of CDR-grafted OKT4 antibodies have
been prepared. Presently the CDR-grafted OKT4A of choice is the
combination of the grafted light chain LCDR2 and the grafted heavy
chain HCDR10.
[0294] The Light Chain
[0295] The human acceptor framework used for the grafted light
chains was RE1. The preferred LCDR2 light chain has human to mouse
changes at positions 33, 34, 38, 49 and 89 in addition to the
structural loop CDRs. Of these changed positions, positions 33, 34
and 89 fall within the preferred extended CDRs of the present
invention (positions 33 and 34 in CDR1 and position 89 in CDR3).
The human to marine changes at positions 38 and 49 corresponds to
positions at which the amino acid residues are preferably donor
marine amino acid residues in accordance with the present
invention.
[0296] A comparison of the amino acid sequences of the donor murine
light chain variable domain and the RE1 human acceptor light chain
variable further reveals that the murine and human residues are
identical at all of positions 46, 48 and 71 and at all of positions
2, 4, 6, 35, 36, 44, 47, 62, 64-69, 85, 87, 98, 99 and 101 and 102.
However the amino acid residue at position 58 in LCDR2 is the human
RE1 framework residue not the mouse OKT4 residue an would be
preferred in accordance with the present invention.
[0297] The Heavy Chain
[0298] The human acceptor framework used for the grafted heavy
chains was KOL.
[0299] The preferred CDR graft HCDR10 heavy chain has human to
mouse changes at positions 24, 35, 57, 58, 60, 88 and 91 in
addition to the structural loop CDRs.
[0300] Of these positions, positions 35 (CDR1) and positions 57, 58
and 60 (CDR2) fall within the preferred extended CDRs of the
present invention. Also the human to mouse change at position 24
corresponds to a position at which the amino acid residue is a
donor murine residue in accordance with the present invention.
Moreover, the human to mouse changes at positions 88 and 91
correspond to positions at which the amino acid residues are
optionally donor murine residues.
[0301] Moreover, a comparison of the murine OKT4A and human KOL
heavy chain variable amino acid sequences reveals that the murine
and human residues are identical at all of positions 23, 49, 71, 73
and 78 and at all of positions 2, 4, 6, 25, 36, 37, 39, 47, 48, 93,
94, 103, 104, 106 and 107.
[0302] Thus the OKT4A CDR-grafted heavy chain HCDR10 corresponds to
a particularly preferred embodiment according to the present
invention.
EXAMPLE 3
[0303] CDR-Grafting of an Anti-Mucin Specific Murine Antibody,
B72.3
[0304] The cloning of the genes coding for the anti-mucin specific
murine monoclonal antibody B72.3 and the preparation of 572.3
mouse-human chimeric antibodies has been described previously (ref.
13 and WO 89/01783). CDR-grafted versions of B72.3 were prepared as
follows.
[0305] (a) B72.3 Light Chain
[0306] CDR-grafting of this light chain was accomplished by direct
transfer of the murine CDRs into the framework of the human light
chain RE1. The regions transferred were:
3 CDR Number Residues 1 24-34 2 50-56 3 90-96
[0307] The activity of the resulting grafted light chain was
assessed by co-expression in COS cells, of genes for the
combinations:
[0308] B72.3 cH/B72.3 cL
[0309] and B72.3 cH/B72.3 gL
[0310] Supernatants were assayed for antibody concentration and for
the ability to bind to microtitre plates coated with mucin. The
results obtained indicated that, in combination with the B72.3 cH
chain, B72.3 cL and B72.3 gL had similar binding properties.
[0311] Comparison of the murine 572.3 and RE1 light chain amino
acid sequences reveals that the residues are identical at positions
46, 58 and 71 but are different at position 48.
[0312] Thus changing the human residue to the donor mouse residue
at position 48 may further improve the binding characteristics of
the CDR-grafted light chain, (B72.3 gL) in accordance with the
present invention.
[0313] (b) B72.3 Heavy Chain
[0314] i. Choice of framework
[0315] At the outset it was necessary to make a choice of human
framework. Simply put, the question was as follows: Was it
necessary to use the framework regions from an antibody whose
crystal structure was known or could the choice be made on some
other criteria?
[0316] For B72.3 heavy chain, it was reasoned that, while knowledge
of structure was important, transfer of the CDRs from mouse to
human frameworks might be facilitated if the overall homology
between the donor and receptor frameworks was maximised. Comparison
of the B72.3 heavy chain sequence with those in Kabat (ref. 4) for
human heavy chains showed clearly that B72.3 had poor homology for
KOL and NEWM (for which crystal structures are available) but was
very homologous to the heavy chain for EU.
[0317] On this basis, EU was chosen for the CDR-grafting and the
following residues transferred as CDRs.
4 CDR Number Residues 1 27-36 2 50-63 3 93-102
[0318] Also it was noticed that the FR4 region of EU was unlike
that of any other human (or mouse) antibody. Consequently, in the
grafted heavy chain genes this was also changed to produce a
"consensus" human sequence. (Preliminary experiments showed that
grafted heavy chain genes containing the EU FR4 sequence expressed
very poorly in transient expression systems.)
[0319] ii. Results with Grafted Heavy Chain Genes
[0320] Expression of grafted heavy chain genes containing all human
framework regions with either gL or cL genes produced a grafted
antibody with little ability to bind to mucin. The grafted antibody
had about 1% the activity of the chimeric antibody. In these
experiments, however, it was noted that the activity of the grafted
antibody could be increased to .about.10% of B72.3 by exposure to
pHs of 2-3.5.
[0321] This observation provided a clue as to how the activity of
the grafted antibody could be improved without acid treatment. It
was postulated that acid exposure brought about the protonation of
an acidic residue (pa of aspartic acid=3.86 and of glutamine
acid=4.25) which in turn caused a change in structure of the CDR
loops, or allowed better access of antigen.
[0322] From comparison of the sequences of B72.3 (ref. 13) and EU
(refs. 4 and 5), it was clear that, in going from the mouse to
human frameworks, only two positions had been changed in such a way
that acidic residues had been introduced. These positions are at
residues 73 and 81, where K to B and Q to E changes had bean made,
respectively.
[0323] Which of these positions might be important was determined
by examining the crystal structure of the KOL antibody. In KOL
heavy chain, position 81 is far removed from either of the CDR
loops.
[0324] Position 73, however, is close to both CDRs 1 and 3 of the
heavy chain and, in this position it was possible to envisage that
a K to E change in this region could have a detrimental effect on
antigen binding.
[0325] iii. Framework Changes in B72.3 gH Gene
[0326] On the basis of the above analysis, E73 was mutated to a
lysine (K). It was found that this change had a dramatic effect on
the ability of the grafted Ab to bind to mucin. Further the ability
of the grafted B72.3 produced by the mutated gH/gL combination to
bind to mucin was similar to that of the B72.3 chimeric
antibody.
[0327] iv. Other Framework Changes
[0328] In the course of the above experiments, other changes were
made in the heavy chain framework regions. Within the accuracy of
the assays used, none of the changes, either alone or together,
appeared beneficial.
[0329] V. Other
[0330] All assays used measured the ability of the grafted Ab to
bind to mucin and, as a whole, indicated that the single framework
change at position 73 is sufficient to generate an antibody with
similar binding properties to B72.3.
[0331] Comparison of the B72.3 murine and EU heavy chain sequences
reveals that the mouse and human residues are identical at
positions 23, 24, 71 and 78.
[0332] Thus the mutated CDR-grafted B72.3 heavy chain corresponds
to a preferred embodiment of the present invention.
EXAMPLE 4
[0333] CDR-Grafting of a Murine Anti-ICAM-1 Monoclonal Antibody
[0334] A marine antibody, R6-5-D6 (EP 0314863) having specificity
for Intercellular Adhesion Molecule 1 (ICAM-1) was CDR-grafted
substantially as described above in previous examples. This work is
described in greater detail in co-pending application, British
Patent Application No. 9009549.8, the disclosure of which is
incorporated herein by reference.
[0335] The human EU framework was used as the acceptor framework
for both heavy and light chains. The CDR-grafted antibody currently
of choice is provided by co-expression of grafted light chain
gL221A and grafted heavy chain gH341D which has a binding affinity
for ICAM 1 of about 75% of that of the corresponding mouse-human
chimeric antibody.
[0336] Light Chain
[0337] gL221A has murine CDRs at positions 24-34 (CDR1), 50-56
(CDR2) and 89-97 (CDR3). In addition several framework residues are
also the murine amino acid. These residues were chosen after
consideration of the possible contribution of these residues to
domain packing and stability of the conformation of the antigen
binding region. The residues which have been retained as mouse are
at positions 2, 3, 48 (?), 60, 84, 85 and 87. Comparison of the
murine anti-ICAM 1 and human EU light chain amino acid sequences
reveals that the murine and human residues are identical at
positions 46, 58 and 71.
[0338] Heavy Chain
[0339] gH341D has murine CDRs at positions 26-35 (CDR1), 50-56
(CDR2) and 94-100B (CDR3). In addition murine residues were used in
gH341D at positions 24, 48, 69, 71, 73, 80, 88 and 91. Comparison
of the marine anti-ICAM 1 and human EU heavy chain amino acid
sequences are identical at positions 23, 49 and 78.
EXAMPLE 5
[0340] CDR-Grafting of Murine Anti-TNFa Antibodies
[0341] A number of marine anti-TNFa monoclonal antibodies were
CDR-grafted substantially as described above in previous examples.
These antibodies include the murine monoclonal antibodies
designated 61 E71, hTNF1, hTNF3 and 101.4 A brief summary of the
CDR-grafting of each of these antibodies is given below.
[0342] 61E71
[0343] A similar analysis as described above (Example 1, Section
12.1.) was done for 61E71 and for the heavy chain 10 residues were
identified at 23, 24, 48, 49, 68, 69, 71, 73, 75 and 88 as residues
to potentially retain as murine. The human frameworks chosen for
CDR-grafting of this antibody, and the hTNF3 and 101.4 antibodies
were RE1 for the light chain and KOL for the heavy chain. Three
genes were built, the first of which contained 23, 24, 48, 49, 71
and 73 [gH341(6)] as murine residues. The second gene also had 75
and 88 as murine residues [gH341(8)] while the third gene
additionally had 68, 69, 75 and 88 as murine residues [gH341(10)].
Each was co-expressed with gL221, the minimum grafted light chain
(CDRs only). The gL221/gH341(6) and gL221/gH341(8) antibodies both
bound as well to TNF as murine 61E71. The gL221/gH341(10) antibody
did not express and this combination was not taken further.
[0344] Subsequently the gL221/gH341(6) antibody was assessed in an
L929 cell competition assay in which the antibody competes against
the TNF receptor on L929 cells for binding to TNF in solution. In
this assay the gL221/gH341(6) antibody was approximately 10% as
active as murine 61E71.
[0345] hTNF1
[0346] hTNF1 is a monoclonal antibody which recognises an epitope
on human TNF-. The BU human framework was used for CDR-grafting of
both the heavy and light variable domains
[0347] Heavy Chain
[0348] In the CDR-grafted heavy chain (ghTNF1) mouse CDRs were used
at positions 26-35 (CDR1), 50-65 (CDR2) and 95-102 (CDR3). Mouse
residues were also used in the frameworks at positions 48, 67, 69,
71, 73, 76, 89, 91, 94 and 108. Comparison of the TNF1 mouse and EU
human heavy chain residues reveals that these are identical at
positions 23, 24, 29 and 78.
[0349] Light Chain
[0350] In the CDR-grafted light chain (gLhTNF1) mouse CDRs wre used
at positions 24-34 (CDR1), 50-56 (CDR2) and 89-97 (CDR3). In
addition mouse residues were used in the frameworks at positions 3,
42, 48, 49, 83, 106 and 108. Comparison of the hTNF1 mouse and EU
human light chain residues reveals that these are identical at
positions 46, 58 and 71.
[0351] The grafted hTNF1 heavy chain was co-expressed with the
chimeric light chain and the binding ability of the product
compared with that of the chimeric light chain/chimeric heavy chain
product in a TNF binding assay. The grafted heavy chain product
appeared to have binding ability for TNF slightly better than the
fully chimeric product.
[0352] Similarly, a grafted heavy chain/grafted light chain product
was co-expressed and compared with the fully chimeric product and
found to have closely similar binding properties to the latter
product.
[0353] hTNF3
[0354] hTNF3 recognises an epitope on human TNF-.alpha.. The
sequence of hTNF3 shows only 21 differences compared to 61E71 in
the light and heavy chain variable regions, 10 in the light chain
(2 in the CDRs at positions 50, 96 and 8 in the framework at 1, 19,
40, 45, 46, 76, 103 and 106) and 11 in the heavy chain (3 in the
CDR regions at positions 52, 60 and 95 and 8 in the framework at 1,
10, 38, 40, 67, 73, 87 and 105). The light and heavy chains of the
61E71 and hTNF3 chimeric antibodies can be exchanged without loss
of activity in the direct binding assay. However 61E71 is an order
of magnitude less able to compete with the TNP receptor on L929
cells for TNF-a compared to hTNF3. Based on the 61E71 CDR grafting
data gL221 and gH341(+23, 24, 48, 49 71 and 73 as mouse) genes have
been built for hTNF3 and tested and the resultant grafted antibody
binds well to TNF-a, but competes very poorly in the L929 assay. It
is possible that in this case also the framework residues
identified for OKT3 programme may improve the competitive binding
ability of this antibody.
[0355] 101.4
[0356] 101.4 is a further marine monoclonal antibody able to
recognise human TNF-a. The heavy chain of this antibody shows good
homology to KOL and so the CDR-grafting has been based on RE1 for
the light chain and KOL for the heavy chain. Several grafted heavy
chain genes have been constructed with conservative choices for the
CDR's (gH341) and which have one or a small number of non-CDR
residues at positions 73, 78 or 77-79 inclusive, as the mouse amino
acids. These have been do-expressed with cL or gL221. In all cases
binding to TNP equivalent to the chimeric antibody is seen and when
co-expressed with cL the resultant antibodies are able to compete
well in the L929 assay. However, with gL221 the resultant
antibodies are at least an order of magnitude less able to compete
for TNF against the TNF receptor on L929 cells.
[0357] Mouse residues at other positions in the heavy chain, for
example, at 23 and 24 together or at 76 have been demonstrated to
provide no improvement to the competitive ability of the grafted
antibody in the L929 assay.
[0358] A number of other antibodies including antibodies having
specificity for interleukins e.g. IL1 and cancer markers such as
carcinoembryonic antigen (CEA) e.g. the monoclonal antibody A5B7
(ref. 21), have been successfully CDR-grafted according to the
present invention.
[0359] It will be appreciated that the foregoing examples are given
by way of illustration only and are not intended to limit the scope
of the claimed invention. Changes and modifications may be made to
the methods described whilst still falling within the spirit and
scope of the invention.
REFERENCES
[0360] 1. Kohler & Milstein, Nature, 265, 295-497, 1975.
[0361] 2. Chatenoud et al, (1986), J. Immunol. 137, 830-838.
[0362] 3. Jeffers et al, (1986), Transplantation, 41, 572-578.
[0363] 4. Begent et al, Br. J. Cancer 62: 487 (1990).
[0364] 5. Verhoeyen et al, Science, 239, 1534-1536, 1988.
[0365] 6. Riechmann et al, Nature, 332, 323-324, 1988.
[0366] 7. Kabat, E. A., Wu, T. T., Reid-Miller, M., Perry, H. M.,
Gottesman, K. S., 1987, in Sequences of Proteins of Immunological
Interest, US Department of Health and Human Services, NIH, USA.
[0367] 8. Wu, T. T., and Kabat, E. A., 1970, J. Exp. Med. 132
211-250.
[0368] 9. Queen et al, (1989), Proc. Natl. Acad. Sci. USA, 86,
10029-10033 and WO 90/07861
[0369] 10. Maniatis et al, Molecular Cloning, Cold Spring Harbor,
N.Y., 1989.
[0370] 11. Primrose and Old, Principles of Gene Manipulation,
Blackwell, Oxford, 1980.
[0371] 12. Sanger, F., Nicklen, S., Coulson, A. R., 1977, Proc.
Natl. Acad. Sci. USA, 74 5463
[0372] 13. Kramer, W., Drutsa, V., Janzlen, D.-W., Kramer, B.,
Plugfelder, K., Fritz, H.-J., 1984, Nucl. Acids Res. 12, 9441
[0373] 14. Whittle, N., Adair, J., Lloyd, J. C., Jenkins, E.,
Devine, J., Schlom, J., Raubitshek, A., Colcher, D., Bodmer, M.,
1987, Protein Engineering 1, 499.
[0374] 15. Sikder, S. S., Akolkar, P. N., Kaledaa, P. M., Morrison,
S. L., Kabat, E. A., 1985, J. Immunol. 135, 4215.
[0375] 16. Wallick, S. C., Kabat, E. A., Morrison, S. L., 1988, J.
Exp. Med. 168, 1099
[0376] 17. Bebbington, C. R., Published International Patent
Application WO 89/01036.
[0377] 18. Granthan and Perrin 1986, 1Immunology Today 7, 160.
[0378] 19. Kozak, M., 1987, J. Mol. Biol. 196, 947.
[0379] 20. Jones, T. P., Dear, P. R., Foote, J., Neuberger, M. S.,
Winter, G., 1986, Nature, 321, 522
[0380] 21. Earwood et al, Br. J. Cancer, 54, 75-82 (1986).
Sequence CWU 1
1
* * * * *