U.S. patent application number 10/865683 was filed with the patent office on 2005-06-16 for asynchronous primed pcr.
This patent application is currently assigned to Applera Corporation. Invention is credited to Chen, Caifu, Egholm, Michael, Haff, Lawrence A..
Application Number | 20050130178 10/865683 |
Document ID | / |
Family ID | 26904613 |
Filed Date | 2005-06-16 |
United States Patent
Application |
20050130178 |
Kind Code |
A1 |
Chen, Caifu ; et
al. |
June 16, 2005 |
Asynchronous primed PCR
Abstract
An asynchronous thermal cycling protocol for nucleic acid
amplification uses two primers with thermal melting temperatures
different by about 10 to 30.degree. C. After the higher melting
primer has annealed and polymerase mediated extension, the
uncopied, single-stranded target sequence may be hybridized and
detected by a probe. DNA probes may be cleaved by the exonuclease
activity of a polymerase. The probe may be a non-cleaving analog
such as PNA. When a probe is labelled with a reporter dye and a
quencher selected to undergo energy transfer, e.g. FRET,
fluorescence from the reporter dye may be effectively quenched when
the probe is unbound. Upon hybridization of the probe to
complementary target or upon cleavage while bound to target, the
reporter dye is no longer quenched, resulting in a detectable
amount of fluorescence. The second, lower-melting primer may be
annealed and extended to generate a double-stranded nucleic acid.
Amplification may be monitored in real time, including each cycle,
or at the end point. The asynchronous PCR thermal cycling protocol
can generate a preponderance of the PCR amplicon in single-stranded
form by repetition at the end of the protocol of annealing and
extension of the higher melting primer.
Inventors: |
Chen, Caifu; (Palo Alto,
CA) ; Egholm, Michael; (Woodbridge, CT) ;
Haff, Lawrence A.; (Westborough, MA) |
Correspondence
Address: |
MILA KASAN, PATENT DEPT.
APPLIED BIOSYSTEMS
850 LINCOLN CENTRE DRIVE
FOSTER CITY
CA
94404
US
|
Assignee: |
Applera Corporation
Foster City
CA
|
Family ID: |
26904613 |
Appl. No.: |
10/865683 |
Filed: |
June 9, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10865683 |
Jun 9, 2004 |
|
|
|
09875211 |
Jun 5, 2001 |
|
|
|
6887664 |
|
|
|
|
60209883 |
Jun 6, 2000 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 2527/113 20130101;
C12Q 2527/107 20130101; C12Q 2561/101 20130101; C12Q 1/686
20130101; C12Q 1/686 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 001/68; C12P
019/34 |
Claims
We claim:
1. A method of nucleic acid amplification comprising the steps of:
annealing a first primer to a first strand of a denatured target
nucleic acid at a first annealing temperature; extending the first
primer with primer extension reagents at an extension temperature
or the first annealing temperature to generate a double-stranded
nucleic acid, wherein the primer extension reagents comprise a
polymerase, nucleotide 5'-triphosphates, and a buffer; annealing a
detectable probe to a second strand of the denatured target nucleic
acid at a probe hybridization temperature; annealing a second
primer to the second strand of the denatured target nucleic acid at
a second annealing temperature wherein the second annealing
temperature is lower than the first annealing temperature and
extension temperature; extending the second primer with primer
extension reagents at the extension temperature to generate a
double-stranded nucleic acid; and denaturing the double-stranded
target nucleic acid into a first strand and a second strand at a
denaturing temperature.
2. The method of claim 1 wherein the detectable probe includes a
fluorescent moiety and a quencher moiety.
3. The method of claim 2 wherein the fluorescent moiety is attached
to the 5' or 3' terminus of the probe and the quencher moiety is
attached to the 5' or 3' terminus of the probe.
4. The method of claim 1 wherein the probe is detected prior to
extension of the second primer.
5. The method of claim 1 wherein the steps are repeated for 2 to 50
cycles.
6. The method of claim 1 wherein the probe is enzymatically
cleaved.
7. The method of claim 1 wherein the probe is not enzymatically
cleaved.
8. The method of claim 1 wherein the target nucleic acid is
selected from a plasmid, a cDNA, an amplicon, genomic DNA, a
restriction digest, and a ligation product.
9. The method of claim 1 wherein the target nucleic acid comprises
single nucleotide polymorphisms.
10. The method of claim 1 wherein the first primer and second
primer are DNA.
11. The method of claim 1 wherein the first primer or the second
primer is a PNA/DNA chimera.
12. The method of claim 1 wherein the first primer or the second
primer comprises a covalently attached fluorescent dye.
13. The method of claim 1 wherein the first primer or the second
primer comprises a covalently attached mobility-modifier.
14. The method of claim 1 wherein the first primer or the second
primer comprises a covalently attached minor groove binder.
15. The method of claim 1 wherein the probe comprises a
target-binding sequence and two intramolecularly base-paired
sequences.
16. The method of claim 15 wherein the probe forms a hairpin stem
and loop structure.
17. The method of claim 15 wherein the intramolecularly base-paired
sequences are at the 5' terminus and 3' terminus of the probe.
18. The method of claim 1 wherein the probe comprises one or more
nucleotide analogs selected from a nucleobase analog, a
2'-deoxyribose analog, an internucleotide analog and an optical
isomer.
19. The method of claim 18 wherein the nucleobase analog is
selected from 7-deazaadenine, 7-deazaguanine, 7-deaza-8-azaguanine,
7-deaza-8-azaadenine, inosine, nebularine, nitropyrrole,
nitroindole, 2-amino-purine, 2,6-diamino-purine, hypoxanthine,
pseudouridine, pseudocytidine, pseudoisocytidine,
5-propynyl-cytidine, isocytidine, isoguanine, 7-deaza-quanine,
2-thio-pyrimidine, 6-thio-guanine, 4-thio-thymine, 4-thio-uracil,
O.sup.6-methyl-guanine, N.sup.6-methyl-adenine,
O.sup.4-methyl-thymine, 5,6-dihydrothymine, 5,6-dihydrouracil,
4-methyl-indole, and ethenoadenine.
20. The method of claim 18 wherein the nucleotide analog is a
2'-deoxyribose analog that is substituted at the 2'-carbon atom
with Cl, F, --R, --OR, or --NR.sub.2, where each R is independently
--H, C.sub.1-C.sub.6 alkyl or C.sub.5-C.sub.14 aryl.
21. The method of claim 18 wherein the nucleotide analog is an
LNA.
22. The method of claim 18 wherein the nucleotide analog is an
L-form optical isomer of 2'-deoxyribose.
23. The method of claim 1 wherein the probe comprises one or more
2-aminoethylglycine (PNA) monomer units.
24. The method of claim 23 wherein the probe is a PNA/DNA
chimera.
25. The method of claim 1 wherein the probe has the structure:
15wherein: R is a fluorescent moiety; L.sub.1 and L.sub.2 are
linkers; B is a nucleobase; Q is a quencher moiety; and n is an
integer between 5 to 25.
26. The method of claim 25 wherein L.sub.1 or L.sub.2 comprise one
or more amino acid units.
27. The method of claim 26 wherein L.sub.1 and L.sub.2 are
independently selected from aspartic acid, glutamic acid, and
lysine.
28. The method of claim 27 wherein L.sub.1 is one or more aspartic
acid or glutamic acid units, and L.sub.2 is one or more lysine
units.
29. The method of claim 25 wherein B is selected from uracil,
thymine, cytosine, adenine, 7-deazaadenine, guanine,
7-deazaguanosine, 7-deaza-8-azaguanine, and
7-deaza-8-azaadenine.
30. The method of claim 2 wherein the fluorescent moiety is a
fluorescein dye, a rhodamine dye, or a cyanine dye.
31. The method of claim 2 wherein the quencher moiety is a
rhodamine dye.
32. The method of claim 2 wherein the quencher moiety is a
nitro-substituted cyanine dye.
33. The method of claim 2 wherein the quencher moiety is selected
from the structures: 16wherein Z is selected from H, Cl, F,
C.sub.1-C.sub.6 alkyl, C.sub.5-C.sub.14 aryl, nitro, cyano,
sulfonate, NR.sub.2, --OR, and CO.sub.2H, where each R is
independently H, C.sub.1-C.sub.6 alkyl or C.sub.5-C.sub.14
aryl.
34. The method of claim 2 wherein a change in fluorescence
intensity is detected at the end-point of target amplification.
35. The method of claim 2 wherein a change in fluorescence
intensity is monitored in real-time.
36. The method of claim 2 wherein a change in fluorescence
intensity is detected as an indication of the presence of the
target sequence.
37. The method of claim 1 wherein the first annealing temperature
is 10 to 30.degree. C. higher than the second annealing
temperature.
38. The method of claim 1 wherein the first annealing temperature
is 12 to 16.degree. C. higher than the second annealing
temperature.
39. The method of claim 1 wherein the first annealing temperature
is 60 to 75.degree. C.
40. The method of claim 1 wherein the second annealing temperature
is 45 to 55.degree. C.
41. The method of claim 1 wherein the first primer has a (GC).sub.n
or a (CG).sub.n sequence at the 5' terminus, where n is 1 to 4.
42. The method of claim 1 wherein a label is covalently attached to
one or more of the nucleotide 5'-triphosphates at the 8-C of a
purine nucleobase, the 7-C or 8-C of a 7-deazapurine nucleobase, or
the 5-position of a pyrimidine nucleobase.
43. The method of claim 1 wherein a label is covalently attached to
the first primer or the second primer at a 5' terminus, a sugar, an
internucleotide linkage, or a nucleobase.
44. A method for producing complementary polynucleotide strands of
a target polynucleotide comprising: obtaining a mixture comprising
first and second target polynucleotide strands which are capable of
hybridizing with each other to form a base-paired structure that
contains a target sequence, a first primer that is complementary to
a first region in the first target polynucleotide strand, and a
second primer that is complementary to a second region in the
second target polynucleotide strand, such that the first and second
regions flank the target sequence, extending the first primer at a
first temperature to form a first complex comprising a first
complementary strand that is hybridized to the first target strand,
under conditions such that the second primer does not substantially
hybridize to the second region, and extending the second primer at
a second temperature that is lower than the first temperature, to
form a second complex comprising a second complementary strand that
is hybridized to the second target strand, wherein before extending
the second primer, a detectable probe is hybridized to a
complementary binding region in the second target strand, and the
hybridized probe is detected as a measure of second target
strand.
45. A method of nucleic acid amplification comprising the steps of:
annealing a first primer to a first strand of a denatured target
nucleic acid at a first annealing temperature; extending the first
primer with primer extension reagents at an extension temperature
or the first annealing temperature to generate a double-stranded
nucleic acid, wherein the primer extension reagents comprise a
polymerase, nucleotide 5'-triphosphates, and a buffer; annealing a
second primer to a second strand of the denatured target nucleic
acid at a second annealing temperature wherein the second annealing
temperature is lower than the first annealing temperature and
extension temperature; extending the second primer with primer
extension reagents at the extension temperature to generate a
double-stranded nucleic acid; and denaturing the double-stranded
target into a first strand and a second strand at a denaturing
temperature.
46. The method of claim 45 wherein the steps are repeated for 2 to
50 cycles.
47. The method of claim 46 wherein the concentration of the first
primer is 2 to 10 times higher than the concentration of the second
primer.
48. The method of claim 46 wherein the steps of annealing the
second primer to the second strand of the denatured target and
extending the second primer are omitted in the last 1-25 cycles,
whereby a mixture of single-stranded and double-stranded DNA is
produced.
49. The method of claim 46 wherein the steps of annealing the
second primer to the second strand of the denatured target and
extending the second primer are omitted in the last 1-10 cycles so
as to produce a preponderance of ss DNA.
50. The method of claim 45 wherein the target is a cDNA.
51. The method of claim 45 wherein the first primer is labelled
with a fluorescent dye.
52. The method of claim 45 further comprising the step of
hybridizing the single-stranded and double-stranded DNA product
mixture to a plurality of probes immobilized on an array.
53. The method of claim 52 wherein the probes are FRET probes.
54. A method for producing complementary polynucleotide strands of
a target polynucleotide comprising: obtaining a mixture comprising
a first and second target polynucleotides which are capable of
hybridizing with each other to form a base-paired structure that
contains a target sequence, a first primer that is complementary to
a first region in the first target polynucleotide, and a second
primer that is complementary to a second region in the second
target polynucleotide, such that the first and second regions flank
the target sequence, extending the first primer at a first
temperature to form a first complex comprising a first
complementary strand that is hybridized to the first target strand,
under conditions such that the second primer does not substantially
hybridize to the second region, and extending the second primer at
a second temperature that is lower than the first temperature, to
form a second complex comprising a second complementary strand that
is hybridized to the second target strand.
55. The method of claim 54, which further comprises denaturing the
first and second complexes after the second primer has been
extended.
56. The method of claim 55, which further comprises repeating the
first primer extension, second primer extension, and denaturation
steps in one or more cycles.
57. The method of claim 55, wherein after said denaturation, first
primer is extended at the first temperature to form a mixture
comprising the second target polynucleotide in single-stranded form
and the first complex in duplex form.
58. A kit for amplifying a target polynucleotide comprising two or
more primers, wherein a first primer and a second primer have a Tm
difference of 10 to 30.degree. C.
59. The kit of claim 58 wherein a said primer is labelled with a
fluorescent dye.
60. The kit of claim 58 further comprising a polymerase.
61. The kit of claim 58 further comprising a detectable probe.
62. The kit of claim 61 wherein the detectable probe is DNA and the
probe includes a fluorescent moiety and a quencher moiety.
63. The kit of claim 61 wherein the detectable probe is PNA and the
probe includes a fluorescent moiety and a quencher moiety.
64. The kit of claim 61 wherein the probe comprises a nucleic acid
analog selected from a nucleobase analog, a 2'-deoxyribose analog,
an internucleotide analog and an optical isomer.
65. The kit of claim 58 further comprising one or more
enzymatically-extendable nucleotides.
66. The kit of claim 65 wherein a nucleotide is labelled with a
fluorescent dye.
Description
I. CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/875,211, filed Jun. 5, 2001, which claims
the benefit under 35 USC .sctn. 119(e) of Provisional U.S.
Application No. 60/209,883, filed Jun. 6, 2000, both of which are
incorporated herein by reference.
II. FIELD OF THE INVENTION
[0002] The invention relates generally to the field of nucleic acid
hybridization, and more particularly, to methods of nucleic acid
amplification.
III. INTRODUCTION
[0003] Nucleic acid amplification assays comprise an important
class of specific target sequence detection methods in modem
biology, with diverse applications in diagnosis of inherited
disease, human identification, identification of microorganisms,
paternity testing, virology, and DNA sequencing. The polymerase
chain reaction (PCR) amplification method allows the production and
detection of target nucleic acid sequences with great sensitivity
and specificity. PCR methods are integral to cloning, analysis of
genetic expression, DNA sequencing, genetic mapping, drug
discovery, and the like (Gilliland (1990) Proc. Natl. Acad. Sci.,
87:2725-2729; Bevan (1992) PCR Methods and Applications 1:222-228;
Green (1991) PCR Methods and Applications, 1:77-90; McPherson, M.
J., Quirke, P., and Taylor, G. R. in PCR 2: A Practical Approach
(1995) Oxford University Press, Oxford). Methods for detecting a
PCR product (amplicon) using an oligonucleotide probe capable of
hybridizing with the target sequence or amplicon are described in
Mullis, U.S. Pat. Nos. 4,683,195 and 4,683,202; EP No. 237,362.
[0004] In traditional PCR, oligonucleotide primers are annealed to
sequences in complementary target strands that flank a target
sequence of interest, and the annealed primers are extended
simultaneously to generate double-stranded (ds) copies of the
target sequence. The primers are extended by a polymerase,
preferably a thermal-stable polymerase (McPherson, M. Ed. (1995)
PCR 2: A Practical Approach, IRL Press at Oxford University Press,
Oxford). Traditionally, the sequences of the two oligonucleotide
primers used in a PCR are designed and selected to have equal, or
similar, Tm values to promote similar annealing and extension
efficiencies.
[0005] Asymmetric PCR has found use for production of
single-stranded copies of DNA from target sequences (Gyllensten
(1988) Proc. Natl. Acad. Sci USA, 85:7652; McCabe, P. (1990)
"Production of single-stranded DNA by asymmetric PCR" in PCR
Protocols: A guide to Methods and Applications, Innis, M. Ed.,
Academic Press, Inc., San Diego, pp. 76-83). Unequal amounts of the
two amplification primers are used, e.g. 1-5 pmoles and 50-100
pmoles, respectively for the low- and high-concentration primers.
During the first 20-25 cycles, double-stranded DNA is exponentially
generated and, when the limiting primer is exhausted,
single-stranded DNA accumulates linearly for the remaining 5-10
cycles. A disadvantage is that the PCR must be run under suboptimal
conditions, i.e. low concentration of one of the primers. Thus the
amplification may be inefficient or may be non-reproducible
(Hopgood (1992) BioTechniques, 13:82; Hunkapiller (1991) Current
Opinion in Biotechnology, 2:92). Other PCR methods that generate
single stranded amplicons include enzymatic digestion of one strand
of a double stranded amplicon, multiplexed sets of primer pairs,
nested sets of primers, and inverse amplification. However, each
method is cumbersome or has limitations (Higuchi (1989) Nucleic
Acids Res., 17:5865; Sarkar (1989) Nucleic Acids Res, 16:5197;
Stoflet (1988) Science, 239:491; Bevan (1992) PCR Methods and
Applications, 1:22; Gyllensten, U. (1989) "Direct sequencing of in
vitro amplified DNA" in PCR Technology: Principles and Applications
for DNA Amplification, Erlich, H. Ed., Stockton Press, New York,
pp. 50-53).
IV. SUMMARY OF THE INVENTION
[0006] The present invention relates to methods of nucleic acid
amplification, which include novel thermal cycling protocols for
nucleic acid amplification. Detection of the progress, i.e.
production of amplification product, may be facilitated and
improved by hybridizing a detectable probe to a single-stranded
form of the target sequence. The single-stranded target is an
intermediate in the two stage annealing and extension protocol. A
first, higher melting primer is selectively annealed to one strand
of the target and extended, resulting in a double-stranded copy and
the uncopied, single-stranded target.
[0007] In a first aspect, the invention includes a method for
producing complementary polynucleotide strands of a target
polynucleotide. A mixture is obtained comprising first and second
target polynucleotide strands which are capable of hybridizing with
each other to form a base-paired structure that contains a target
sequence, a first primer that is complementary to a first region in
the first target polynucleotide strand, and a second primer that is
complementary to a second region in the second target
polynucleotide strand, such that the first and second regions flank
the target sequence. The first primer is extended at a first
temperature to form a first complex comprising a first
complementary strand that is hybridized to the first target strand,
under conditions such that the second primer does not substantially
hybridize to the second region. The second primer is extended at a
second temperature that is lower than the first temperature, to
form a second complex comprising a second complementary strand that
is hybridized to the second target strand. Before extending the
second primer, a detectable probe is hybridized to a complementary
binding region in the second target strand, and the hybridized
probe is detected as a measure of second target strand.
[0008] In another aspect, an asynchronous thermal cycling protocol
comprises the steps of:
[0009] annealing a first primer to a first strand of a denatured
target nucleic acid at a first annealing temperature;
[0010] extending the first primer with primer extension reagents at
an extension temperature or the first annealing temperature to
generate a double-stranded nucleic acid, wherein the primer
extension reagents comprise a polymerase, nucleotide
5'-triphosphates, and a buffer;
[0011] annealing a detectable probe to a second strand of the
denatured target nucleic acid at a probe hybridization
temperature;
[0012] annealing a second primer to the second strand of the
denatured target nucleic acid at a second annealing temperature
wherein the second annealing temperature is lower than the first
annealing temperature and extension temperature;
[0013] extending the second primer with primer extension reagents
at the extension temperature to generate a double-stranded nucleic
acid; and
[0014] denaturing the double-stranded target nucleic acid into a
first strand and a second strand at a denaturing temperature.
[0015] By the above method of the invention, a detectable probe is
annealed to the uncopied, single-stranded target. This
hybridization event is detected, e.g. by FRET when the probe has a
reporter/quencher pair of labels. The probe may be DNA and cleaved
by nuclease activity of the polymerase. Alternatively, the probe
may be non-cleavable. The probe may be a nucleic acid analog or
chimera comprising nucleic acid analog monomer units, such as
2-aminoethylglycine. The probe may be PNA or a PNA/DNA chimera. PNA
FRET probes may be comprised of a sequence of 2-aminoethylglycine
with nucleobase units, flanked by a reporter and quencher pair.
[0016] The probe may be detected while hybridized to target.
Detection of the probe may be conducted each cycle during a PCR
(real-time). Alternatively, probe may be detected or quantitated at
the end of PCR, e.g. after completion of 2 to 50 cycles, or more,
of geometric or linear amplification (end-point).
[0017] After probe detection, a second primer with a lower Tm than
the first primer is selectively annealed to the single-stranded
target and extended to make a copy of the target. The asynchronous
thermal cycling method with probe detection can be repeated through
a number of cycles where the mixture undergoes temperature changes
to effect the steps of denaturation, annealing, and primer
extension at defined temperatures for defined timed periods.
[0018] During one embodiment of an asynchronous thermal cycling
protocol, a probe specifically hybridizes to the amplified nucleic
acid. When hybridized, the nuclease activity of the polymerase may
degrade the probe by internucleotide cleavage, thereby eliminating
the intramolecular quenching maintained by the intact probe.
Because the probe is designed to hybridize specifically to the
amplified target nucleic acid (amplicon), the increase in
fluorescence intensity from the PCR reaction mixture, caused by
cleavage of the probe, can be correlated with the progress of
amplification, i.e. the amount of target sequence and amount of
amplification.
[0019] In general, the target nucleic acid in the sample will be a
sequence of DNA, most usually genomic DNA. However, the present
invention can also be practiced with other nucleic acids, such as a
synthetic oligonucleotide, messenger RNA, ribosomal RNA, viral RNA,
cDNA, or cloned DNA. Suitable target nucleic acid samples include
single or double-stranded DNA or RNA for use in the present
invention.
[0020] In another aspect, the invention includes a method for
producing complementary polynucleotide strands of a target
polynucleotide. A mixture is obtained comprising a first and second
target polynucleotides which are capable of hybridizing with each
other to form a base-paired structure that contains a target
sequence, a first primer that is complementary to a first region in
the first target polynucleotide, and a second primer that is
complementary to a second region in the second target
polynucleotide, such that the first and second regions flank the
target sequence. The first primer is extended at a first
temperature to form a first complex comprising a first
complementary strand that is hybridized to the first target strand,
under conditions such that the second primer does not substantially
hybridize to the second region. The second primer is extended at a
second temperature that is lower than the first temperature, to
form a second complex comprising a second complementary strand that
is hybridized to the second target strand. The first and second
complexes may be denatured. The steps of first primer extension,
second primer extension, and denaturation steps may be repeated in
one or more cycles.
[0021] In another aspect, the invention includes an asynchronous
thermal cycling method for producing an excess of ss amplicon,
comprising steps of:
[0022] annealing a first primer to a first strand of a denatured
target nucleic acid at a first annealing temperature;
[0023] extending the first primer with primer extension reagents at
an extension temperature or the first annealing temperature to
generate a double-stranded nucleic acid, wherein the primer
extension reagents comprise a polymerase, nucleotide
5'-triphosphates, and a buffer;
[0024] annealing a second primer to a second strand of the
denatured target nucleic acid at a second annealing temperature
wherein the second annealing temperature is lower than the first
annealing temperature and extension temperature;
[0025] extending the second primer with primer extension reagents
at the extension temperature to generate a double-stranded nucleic
acid; and
[0026] denaturing the double-stranded target into a first strand
and a second strand at a denaturing temperature.
[0027] The cycle of steps can be repeated for 2 to 50 cycles or
more to produce double stranded (ds) amplicon. The steps of
annealing the second primer and extending the second primer can be
omitted in the last 1 or more cycles to produce an excess of
single-stranded (ss) amplicon.
[0028] In another aspect, the invention includes a method of
characterizing cDNA libraries by sequence determination, viz.
sequencing by hybridization (SBH).
[0029] In another embodiment, this invention is related to kits
suitable for performing a PCR assay by an asynchronous thermal
cycling protocol which detects the presence or absence of a target
sequence in a sample nucleic acid. The kits may allow real-time or
end-point detection or quantitation of one or more target sequences
in a sample. In one embodiment, the kits comprise primers with
melting point differences of about 10 to 30.degree. C. The kits may
also include one or more probes, nucleotides, polymerase, and other
reagents or compositions which are selected to perform the PCR, or
measure and detect a target.
V. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] FIG. 1 shows a schematic for an asynchronous PCR thermal
cycling method according to one embodiment of the present
invention, including steps of: (i) denaturing double stranded
target, (ii) annealing a first primer, (iii) extension of the first
primer, (iv) probe hybridization, (v) annealing a second primer,
and (vi) extension of the second primer. The temperatures and times
are exemplary.
[0031] FIG. 2 shows a schematic for hybridization of a first primer
(long arrow) at a higher temperature than a second primer (short
arrow) to a target nucleic acid according to one embodiment of the
present invention.
[0032] FIG. 3 shows a schematic for hybridizing a primer and probe
to double-stranded (partially) target during traditional PCR (top)
and hybridizing a primer and FRET probe (F=reporter dye,
Q=quencher) to single-stranded target during asynchronous PCR by a
probe (bottom) according to one embodiment of the present
invention.
[0033] FIG. 4a shows asynchronous PCR (top), according to one
embodiment of the present invention, and traditional PCR (bottom)
thermal cycling protocols, with sequential and cyclical duration at
specific temperatures.
[0034] FIG. 4b shows polyacrylamide (15%) gel electrophoresis
analysis under denaturing conditions (about 55-60.degree. C., 7M
urea) and SYBR-Green staining of amplicons after three PCR
protocols: asynchronous, traditional, and asymmetric (top), and a
schematic of amplification of target DNA with three combinations of
forward and reverse primers (bottom). Forward primers are 5'
labelled with an electrophoretic mobility modifier, e.g. biotin or
FAM.
[0035] FIG. 5 shows an exemplary PNA FRET probe including a
reporter dye (F) and a quencher (Q) with glutamic acid and lysine
linkages (top). The probe exists in at least one conformation when
unhybridized to a complementary target which causes quenching of
the reporter dye (bottom left). Upon hybridization to target,
quenching is diminished and fluorescence intensity increases
(bottom right).
[0036] FIG. 6 shows fluorescence intensity measurements over time
on the ABI 7700 Sequence Detection System (Applied Biosystems,
Foster City, Calif.) of a 16 nt PNA FRET probe (SEQ ID NO:1):
without complementary DNA (top); hybridized to the duplex form of
complementary 68 nt DNA (SEQ ID NO:2) and 74 nt DNA (SEQ ID NO:3)
(middle); and hybridized to complementary 68 nt ss DNA (SEQ ID
NO:2) (bottom).
[0037] FIG. 7a shows the change in fluorescence (.DELTA.Rn)
measured on the ABI 7700 during asynchronous PCR when a 14 nt PNA
FRET probe (SEQ ID NO:8) hybridizes to its perfect match, single
G-T mismatch, and single C-T mismatch complementary targets.
[0038] FIG. 7b shows the change in fluorescence (.DELTA.Rn)
measured on the ABI 7700 during asynchronous PCR when a 16 nt PNA
FRET probe (SEQ ID NO:1) hybridizes to its perfect match, single
G-T mismatch, and single C-T mismatch complementary targets.
[0039] FIG. 8 shows the change in fluorescence (.DELTA.Rn) measured
on the ABI 7700 during asynchronous PCR with an 8 nt PNA FRET probe
(SEQ ID NO:11) and a 9 nt PNA FRET probe (SEQ ID NO:12) amplified
by an asynchronous thermal cycling protocol according to one
embodiment of the present invention, at the bottom.
[0040] FIG. 9 shows the two-fold increase in fluorescence intensity
from a 16 nt PNA FRET probe (SEQ ID NO:1) during the course of an
exemplary, averaged asynchronous PCR thermal cycle and an averaged
traditional PCR thermal cycle. Each plot is averaged from cycles
25-30 of 40 total cycles. The temperature profile is shown.
[0041] FIG. 10 shows the change in fluorescence (.DELTA.Rn)
measuring real-time quantification using PNA probes on the ABI 7700
during PCR when 15 nt (SEQ ID NO:14), 16 nt (SEQ ID NO:1), and 17
nt (SEQ ID NO:15) PNA FRET probes each detect 6 samples: 10.sup.4,
10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, and 10.sup.9 starting
copies of 68 nt synthetic ss DNA target during an asynchronous PCR
thermal cycling protocol according to one embodiment of the present
invention.
[0042] FIG. 11 shows the linear correlation between a threshold
cycle of detectable geometric amplification (C.sub.T) and starting
copy number of 68 nt synthetic ss DNA target from FIG. 10 during an
asynchronous PCR thermal cycling protocol according to one
embodiment of the present invention.
[0043] FIG. 12 shows the display of data from the ABI 7700 for
real-time quantification of PCR using a traditional PCR thermal
cycling protocol on with a 16 nt PNA FRET probe (SEQ ID NO:1),
10.sup.4 to 10.sup.9 starting copies of 68 nt synthetic ss DNA
target, and the same other reagents as in FIG. 10.
[0044] FIG. 13 shows a schematic for an asynchronous PCR thermal
cycling protocol, according to one embodiment of the present
invention, with low temperature hybridization temperature
(30-37.degree. C.) of low Tm, short PNA FRET probes.
[0045] FIG. 14a shows a schematic example of the first two cycles
of a PCR thermal cycling protocol with a 5' (GC).sub.4 clamp
primer, followed by an asynchronous thermal cycling protocol.
[0046] FIG. 14b shows the change in fluorescence (.DELTA.Rn)
measured on the ABI 7700 during PCR when 16 nt PNA FRET probe (SEQ
ID NO:16) hybridizes to its perfect match complementary target in
the K-ras gene during an asynchronous PCR thermal cycling protocol
with: (A) equal Tm primers, (B) a 5' (GC).sub.4 clamp primer, and
(C) disparate Tm primers.
[0047] FIG. 15a (top) shows the change in fluorescence (.DELTA.Rn)
measured on the ABI 7700 during the traditional PCR thermal cycling
protocol with equal Tm primers and eight target samples containing
amounts of .beta.-actin genomic target ds DNA differing by
increments of 5 (left to right: 50,000, 10,000, 2000, 400, 80, 16,
3, 0.6 pg. Amplicon was detected by the nuclease cleavage method
with a DNA FRET probe (SEQ ID NO:23).
[0048] FIG. 15b (bottom) shows the change in fluorescence
(.DELTA.Rn) measured on the ABI 7700 during an asynchronous PCR
thermal cycling protocol with disparate Tm primers and the eight
target samples from 0.6 to 50,000 pg (right to left) of
.beta.-actin genomic target ds DNA of FIG. 15a. Amplicon was
detected by a nuclease cleavage assay with a DNA FRET probe (SEQ ID
NO:23).
[0049] FIG. 15c shows a schematic for PCR detection by nuclease
cleavage of a DNA FRET probe using primers of equal Tm and the
traditional PCR thermal cycling protocol (top) and exemplary
primers of disparate Tm and an exemplary asynchronous PCR thermal
cycling protocol (bottom).
[0050] FIG. 16 shows the thermal cycling protocols for the
traditional PCR thermal cycling in FIG. 15a and the exemplary
asynchronous PCR thermal cycling protocol employed in FIG. 15b.
[0051] FIG. 17 shows homogeneous detection of PCR cDNA clones with
PNA FRET probes by sequencing-by-hybridization (SBH).
[0052] FIG. 18 shows a schematic for a method of PCR including
exponential amplification with two disparate Tm primers by an
exemplary asynchronous thermal cycling protocol, followed by a
number of cycles of a high-temperature protocol where hybridization
and extension are conducted at a temperature high enough such that
only the higher Tm primer anneals and extends.
[0053] FIG. 19 shows an experimental design and comparison of a
traditional PCR protocol and an exemplary asynchronous thermal
cycling protocol with detection and quantitation of ss and ds
amplicons by denaturing polyacrylamide gel electrophoresis
(PAGE).
[0054] FIG. 20a shows polyacrylamide (15%) gel electrophoresis
analysis under denaturing conditions (about 55-60.degree. C., 7M
urea) and SYBR-Green staining of the products from asynchronous
PCR. The resulting ss DNA separated from duplex are quantitated by
densitometry and expressed as a ratio of the upper to lower bands
in each lane.
[0055] FIG. 20b shows the asynchronous PCR thermal cycling protocol
for the experiment of FIG. 20a.
[0056] FIG. 21 shows the structure of an exemplary FAM and DABCYL
labelled PNA FRET probe structure:
6-FAM-Glu-NH-PNA-C(O)-Lys-Lys-DABCYL, where n is the number of
2-aminoethylglycine units.
[0057] FIG. 22 shows array fluorescent signal image results of a
comparison of hybridization of 5' labelled PCR products, generated
by a traditional thermal cycling protocol (left) and an
asynchronous thermal cycling protocol (right) according to one
embodiment of the present invention.
VI. DETAILED DESCRIPTION
[0058] Reference will now be made in detail to certain embodiments
of the invention, examples of which are illustrated in the
accompanying drawings. While the invention will be described in
conjunction with the exemplary embodiments, it will be understood
that they are not intended to limit the invention to those
embodiments. On the contrary, the invention is intended to cover
all alternatives, modifications, and equivalents, which may be
included within the scope of the claimed invention.
[0059] VI.1 Definitions
[0060] "Nucleobase" means a nitrogen-containing heterocyclic moiety
capable of forming Watson-Crick hydrogen bonds in pairing with a
complementary nucleobase or nucleobase analog, e.g. a purine, a
7-deazapurine, or a pyrimidine. Typical nucleobases are the
naturally occurring nucleobases adenine, guanine, cytosine, uracil,
thymine, and analogs of the naturally occurring nucleobases, e.g.
7-deazaadenine, 7-deazaguanine, 7-deaza-8-azaguanine,
7-deaza-8-azaadenine, inosine, nebularine, nitropyrrole,
nitroindole, 2-amino-purine, 2,6-diamino-purine, hypoxanthine,
pseudouridine, pseudocytidine, pseudoisocytidine,
5-propynyl-cytidine, isocytidine, isoguanine, 7-deaza-quanine,
2-thio-pyrimidine, 6-thio-guanine, 4-thio-thymine, 4-thio-uracil,
O.sup.6-methyl-guanine, N.sup.6-methyl-adenine,
O.sup.4-methyl-thymine, 5,6-dihydrothymine, 5,6-dihydrouracil,
4-methyl-indole, and ethenoadenine (Fasman (1989) Practical
Handbook of Biochemistry and Molecular Biology, pp. 385-394, CRC
Press, Boca Raton, Fla.).
[0061] "Nucleoside" refers to a compound consisting of a nucleobase
linked to the C-1' carbon of a ribose sugar. The ribose may be
substituted or unsubstituted. Substituted ribose sugars include,
but are not limited to, those riboses in which one or more of the
carbon atoms, for example the 2'-carbon atom, is substituted with
one or more of the same or different Cl, F, --R, --OR, --NR.sub.2
or halogen groups, where each R is independently H, C.sub.1-C.sub.6
alkyl or C.sub.5-C.sub.14 aryl. Ribose examples include ribose,
2'-deoxyribose, 2',3'-dideoxyribose, 2'-haloribose,
2'-fluororibose, 2'-chlororibose, and 2'-alkylribose, e.g.
2'-O-methyl, 4'-.alpha.-anomeric nucleotides, 1'-.alpha.-anomeric
nucleotides, 2'-4'- and 3'-4'-linked and other "locked" or "LNA",
bicyclic sugar modifications (WO 98/22489; WO 98/39352; WO
99/14226). LNA sugar analogs within an oligonucleotide are
represented by the structures: 1
[0062] where B is any nucleobase.
[0063] Modifications at the 2'- or 3'-position of ribose include
hydrogen, hydroxy, methoxy, ethoxy, allyloxy, isopropoxy, butoxy,
isobutoxy, methoxyethyl, alkoxy, phenoxy, azido, amino, alkylamino,
fluoro, chloro and bromo. Nucleosides and nucleotides include the
natural D optical isomer, as well as the L optical isomer forms
(Garbesi (1993) Nucl. Acids Res. 21:4159-65; Fujimori (1990) J.
Amer. Chem. Soc. 112:7435; Urata, (1993) Nucleic Acids Symposium
Ser. No. 29:69-70). When the nucleobase is purine, e.g. A or G, the
ribose sugar is attached to the N.sup.9-position of the nucleobase.
When the nucleobase is pyrimidine, e.g. C, T or U, the pentose
sugar is attached to the N.sup.1-position of the nucleobase
(Kornberg and Baker, (1992) DNA Replication, 2.sup.nd Ed., Freeman,
San Francisco, Calif.).
[0064] "Nucleotide" refers to a phosphate ester of a nucleoside, as
a monomer unit or within a nucleic acid. Nucleotides are sometimes
denoted as "NTP", or "dNTP" and "ddNTP" to particularly point out
the structural features of the ribose sugar. "Nucleotide
5'-triphosphate" refers to a nucleotide with a triphosphate ester
group at the 5' position. The triphosphate ester group may include
sulfur substitutions for the various oxygens, e.g.
.alpha.-thio-nucleotide 5'-triphosphates.
[0065] As used herein, the terms "polynucleotide" or
"oligonucleotide" are used interchangeably and mean single-stranded
and double-stranded polymers of nucleotide monomers, including
2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by
internucleotide phosphodiester bond linkages, or internucleotide
analogs, and associated counter ions, e.g., H.sup.+,
NH.sub.4.sup.+, trialkylammonium, Mg.sup.2+, Na.sup.+ and the like.
A polynucleotide may be composed entirely of deoxyribonucleotides,
entirely of ribonucleotides, or chimeric mixtures thereof.
Polynucleotides may be comprised of nucleobase and sugar analogs.
Polynucleotides typically range in size from a few monomeric units,
e.g. 5-40 when they are frequently referred to in the art as
oligonucleotides, to several thousands of monomeric nucleotide
units. Unless denoted otherwise, whenever a polynucleotide sequence
is represented, it will be understood that the nucleotides are in
5' to 3' order from left to right and that "A" denotes
deoxyadenosine, "C" denotes deoxycytidine, "G" denotes
deoxyguanosine, and "T" denotes thymidine, unless otherwise
noted.
[0066] "Internucleotide analog" means a phosphate ester analog or a
non-phosphate analog of an oligonucleotide. Phosphate ester analogs
include: (i) (C.sub.1-C.sub.4) alkylphosphonate, e.g.
methylphosphonate; (ii) phosphoramidate; (iii) (C.sub.1-C.sub.6)
alkyl- or substituted alkyl-phosphotriester; (iv) phosphorothioate;
and (v) phosphorodithioate. Non-phosphate analogs include wherein
the sugar/phosphate moieties are replaced by an amide linkage, such
as a 2-aminoethylglycine unit, commonly referred to as PNA (Nielsen
(1991) Science 254:1497-1500).
[0067] "Attachment site" refers to a site on a moiety or a
molecule, e.g. a dye, an oligonucleotide, or a PNA, to which is
covalently attached, or capable of being covalently attached, a
linker.
[0068] "Linker" refers to a chemical moiety comprising a covalent
bond or a chain of atoms that covalently attaches a one moiety or
molecule, e.g. a dye to a polynucleotide, or one dye to
another.
[0069] "Reactive linking group" refers to a chemically reactive
substituent or moiety, e.g. a nucleophile or electrophile, capable
of reacting with another molecule to form a covalent bond.
[0070] "Heterocycle" refers to a molecule with a ring system in
which one or more ring atoms is a heteroatom, e.g. nitrogen,
oxygen, and sulfur (as opposed to carbon).
[0071] "Enzymatically extendable" refers to a nucleotide which is:
(i) capable of being enzymatically incorporated onto the terminus
of a polynucleotide chain through the action of a polymerase
enzyme, and (ii) capable of supporting further primer extension.
Enzymatically extendable nucleotides include nucleotide
5'-triphosphates, i.e. dNTP and NTP.
[0072] "Enzymatically incorporatable" refers to a nucleotide which
is capable of being enzymatically incorporated onto the terminus of
a polynucleotide chain through the action of a polymerase enzyme.
Enzymatically incorporatable nucleotides include dNTP, NTP, and
2',3'-dideoxy, nucleotide 5'-triphosphates, i.e. ddNTP.
[0073] "Target sequence" means a polynucleotide sequence that is
the subject of hybridization with a complementary polynucleotide,
e.g. a primer or probe. The target sequence can be composed of DNA,
RNA, an analog thereof, and including combinations thereof.
[0074] The term "probe" means an oligonucleotide that forms a
duplex structure by complementary base pairing with a sequence of a
target nucleic acid. In the present invention, probes may be
labelled, e.g. with a fluorescent dye, or a pair of labels
comprised of a fluorescent reporter dye and quencher, to enable
detection.
[0075] The term "label" refers to any moiety which can be attached
to a molecule and: (i) provides a detectable signal; (ii) interacts
with a second label to modify the detectable signal provided by the
second label, e.g. FRET; (iii) stabilizes hybridization, i.e.
duplex formation; or (iv) provides a capture moiety, i.e. affinity,
antibody/antigen, ionic complexation. Labelling can be accomplished
using any one of a large number of known techniques employing known
labels, linkages, linking groups, reagents, reaction conditions,
and analysis and purification methods. Labels include
light-emitting compounds which generate a detectable signal by
fluorescence, chemiluminescence, or bioluminescence (Kricka, L. in
Nonisotopic DNA Probe Techniques (1992), Academic Press, San Diego,
pp. 3-28). Another class of labels are hybridization-stabilizi- ng
moieties which serve to enhance, stabilize, or influence
hybridization of duplexes, e.g. intercalators, minor-groove
binders, and cross-linking functional groups (Blackburn, G. and
Gait, M. Eds. "DNA and RNA structure" in Nucleic Acids in Chemistry
and Biology, 2.sup.nd Edition, (1996) Oxford University Press, pp.
15-81). Yet another class of labels effect the separation or
immobilization of a molecule by specific or non-specific capture,
for example biotin, digoxigenin, and other haptens (Andrus, A.
"Chemical methods for 5' non-isotopic labelling of PCR probes and
primers" (1995) in PCR 2: A Practical Approach, Oxford University
Press, Oxford, pp. 39-54).
[0076] The term "quenching" refers to a decrease in fluorescence of
a first moiety (reporter dye) caused by a second moiety (quencher)
regardless of the mechanism.
[0077] "Chimera" as used herein refers to an oligonucleotide
including one or more nucleotide and one or more nucleotide analog
units.
[0078] The terms "annealing" and "hybridization" are used
interchangeably and mean the base-pairing interaction of one
nucleic acid with another nucleic acid that results in formation of
a duplex or other higher-ordered structure. The primary interaction
is base specific, i.e. A/T and G/C, by Watson/Crick and
Hoogsteen-type hydrogen bonding.
[0079] The term "end-point analysis" refers to a method where data
collection occurs only when a reaction is substantially
complete.
[0080] The term "real-time analysis" refers to periodic monitoring
during PCR. Certain systems such as the ABI 7700 Sequence Detection
System (Applied Biosystems, Foster City, Calif.) conduct monitoring
during each thermal cycle at a pre-determined or user-defined
point. Real-time analysis of PCR with FRET probes measures
fluorescent dye signal changes from cycle-to-cycle, preferably
minus any internal control signals.
[0081] VI.2a Synthesis of Primers and Probes
[0082] Oligonucleotides are commonly synthesized on solid supports
by the phosphoramidite method (Caruthers, U.S. Pat. No. 4,973,679;
Beaucage (1992) Tetrahedron 48:2223-2311), using commercially
available phosphoramidite nucleosides (Caruthers, U.S. Pat. No.
4,415,732), supports, e.g. silica, controlled-pore-glass
(Caruthers, U.S. Pat. No. 4,458,066) and polystyrene (Andrus, U.S.
Pat. Nos. 5,047,524 and 5,262,530) and automated synthesizers
(Caruthers, U.S. Pat. No. 4,458,066; Models 392, 394, 3948, 3900
DNA/RNA Synthesizers, Applied Biosystems, Foster City, Calif.).
[0083] VI.2b Primer and Probe Design and Selection
[0084] PCR primers and probes to practice the asynchronous thermal
cycling protocols and for comparative experiments with the
traditional and asymmetric thermal cycling protocols may be
designed using Primer Express.TM. (Version 1.0, Applied Biosystems,
CA). Other oligonucleotide selection and evaluation software
programs have been reported or are commercially available. A target
nucleic acid sequence is entered or imported from a database, e.g.
genetic code such as GenBank (http://www.ncbi.nlm.nih.gov/; Nuc.
Acids Res. 2000 Jan. 1;28(1):15-8). In some embodiments, the
binding site location of primers complementary to a target are
selected to amplify amplicons of a particular length at a
particular site. In other embodiments, the binding site of a primer
may be unknown, as in the use of universal primers, i.e. a set of
random-priming primers, or primers with redundant-base or
promiscuous base-pairing nucleotides.
[0085] Upon heating, a duplex melts and undergoes a hyperchromic
shift. The Tm for a particular primer or probe is that temperature
at which half the population is hybridized to target. The Tm is
noted as an inflection point in the characteristic sinusoidal curve
which results from plotting the absorbance, e.g. at 260 nm, versus
temperature. Hybridization affinity is affected by primer length,
G+C content, salt concentration, chemical modifications of the
primers, e.g. 2'-O-methyl (Stump (1999) Nucleic Acids Res.
27:4642-48), labels on the primers, and reagents which may
stabilize, e.g. intercalators, or destabilize, i.e. denaturants,
duplex formation. Tm values of the primers and probes may be
designed by selection of some combination of parameters including
sequence, length, G+C content, and hybridization stabilizing
modifications to have particular Tm values to effect efficient
amplification in a particular asynchronous thermal cycling
protocol.
[0086] The sequence and length of primers used in the asynchronous
PCR methods are selected such that annealing to target of a first,
higher-melting primer occurs at a first annealing temperature where
a second, lower-melting primer does not anneal to the target. A
pair, or set of pairs, of primers are selected to establish an
approximate 10 to 30.degree. C. difference in the Tm between the
higher-melting and lower-melting primer. As an example, FIG. 2
shows a higher-melting primer of a pair may be designed to have a
Tm of about 60-75.degree. C. and the lower-melting primer may be
selected to have a Tm of about 45-55.degree. C. The Tm values may
be estimated using standard base-pairing and nearest-neighbor
algorithms. Typically, annealing of primers and probes to target is
conducted at temperatures at, or up to 10.degree. C. below, the
estimated melting temperature of the duplex (Ausubel, et al Eds.
"Preparation and Analysis of DNA", and "The Polymerase Chain
Reaction" in Current Protocols in Molecular Biology, (1993) John
Wiley & Sons, New York.
[0087] The Tm value for a probe may be 68-70.degree. C., except
shorter high-affinity probes, e.g. PNA FRET probes, which may have
a lower Tm. Probe sequences are selected to be complementary to the
target polynucleotide and in between the primer binding sites of
the target. The probe sequence should be selected to be
complementary to the strand which is extended by the second, lower
Tm primer. This strand will be substantially single-stranded after
annealing and extension of the first, higher Tm primer to copy the
other strand (FIG. 1). Probe sequences may be designed to include
non-target specific, self-complementary sequences that favor
enforced proximity of a reporter dye label and a quencher label.
The self-complementary sequences may be located at the 5' and 3'
termini of the probe. Such "hairpin" sequences have an
intramolecular "stem" region and a non base-paired "loop" region.
Upon binding to target, the reporter dye and quencher are spatially
separated and fluorescence increases.
[0088] Probes are designed to be not extendable by polymerase
during PCR. PNA FRET probes are generally not substrates for
polymerase. DNA probes may be rendered non-extendable by blocking
the 3' termini with a 3' phosphate or other group at the 3'
hydroxyl or nucleobase of the 3' terminal nucleotide (Livak, U.S.
Pat. No. 5,723,591).
[0089] VI.2c Nucleic Acid Analogs
[0090] Nucleic acid analogs are structural analogs of DNA and RNA
and which are designed to hybridize to complementary nucleic acid
sequences. Through modification of the internucleotide linkage, the
sugar, and/or the nucleobase, nucleic acid analogs of the invention
may attain any or all of the following desired properties: 1)
optimized hybridization specificity or affinity, 2) nuclease
resistance, 3) chemical stability, 4) solubility, 5)
membrane-permeability, and 6) ease or low costs of synthesis and
purification.
[0091] One useful and accessible class of nucleic acid analogs is
the family of peptide nucleic acids (PNA) in which the
sugar/phosphate backbone of DNA or RNA has been replaced with
acyclic, achiral, and neutral polyamide linkages. The
2-aminoethylglycine polyamide linkage with nucleobases attached to
the linkage through an amide bond has been well-studied as an
embodiment of PNA and shown to possess exceptional hybridization
specificity and affinity (Buchardt, WO 92/20702; Nielsen (1991)
Science 254:1497-1500; Egholm (1993) Nature, 365:566-68).
[0092] VI.2d PNA Fret Probes
[0093] PNA can hybridize to its target complement in either a
parallel or anti-parallel orientation. However, the anti-parallel
duplex (where the carboxyl terminus of PNA is aligned with the 5'
terminus of DNA, and the amino terminus of PNA is aligned with the
3' terminus of DNA) is typically more stable (Egholm (1993) Nature
365:566-68). PNA probes are known to bind to target DNA sequences
with high specificity and affinity (Coull, U.S. Pat. No.
6,110,676). The PNA FRET probe examples of the present invention,
with reporter and quencher moieties, are designed such that the PNA
anneals in the anti-parallel orientation with the target sequences.
Whereas PNA probes bound to complementary target sequences are
generally not appreciably cleaved by nuclease activity of a
polymerase during PCR, hybridization alone may cause sufficient
separation of the reporter and quencher moieties to result in an
increase in fluorescence by a decrease in quenching (FIG. 5).
[0094] PNA may be synthesized at any scale. Most conveniently, PNA
is synthesized at the 2 .mu.mole scale, using Fmoc/Bhoc, tBoc/Z, or
MMT protecting group monomers on an Expedite Synthesizer (Applied
Biosystems) on XAL or PAL support; or on the Model 433A Synthesizer
(Applied Biosystems) with MBHA support; or on other automated
synthesizers. The PNA FRET probes may be synthesized on many of the
solid supports commonly used for peptide synthesis. For reviews of
solid-phase peptide synthesis, see: J. Stewart and J. Young, "Solid
Phase Peptide Synthesis", Pierce Chemical Co. Rockford, Ill., 1984;
E. Atherton and R. C. Sheppard, "Solid phase peptide synthesis: A
practical approach", IRL Press, Oxford, 1989; M. W. Pennington and
B. M. Dunn (Eds.) "Methods in molecular biology, Vol. 35: Peptide
synthesis protocols", Humana Press, Totowa, N.J. (1994), pp. 91; G.
Grant (Ed.), "Synthetic peptides", W.H. Freeman & Co., New
York, N.Y., 1992; G. B. Fields, Int. J. Peptide Protein Res. (1990)
35:161; A. J. Smith in "techniques in protein chemistry III", R.
Angeletti (Ed.), Academic Press, Orlando, Fla., 1992, pp. 219; G.
B. Fields (Eds.), "Methods in enzymology: Vol. 289", Academic
Press, New York, N.Y., 1997; W. C. Chan and P. D. White, "Fmoc
solid phase peptide synthesis: a practical approach, Oxford
University Press, Oxford, UK, 2000; P. Lloyd-Williams and F.
Albericio (Eds.), "Chemical approaches to the synthesis of peptides
and proteins", CRC Press, New York, N.Y. 1997.
[0095] After synthesis is complete, the crude PNA may be cleaved
from the support, e.g. with trifluoroacetic acid, and then
precipitated with diethylether and washed twice in diethylether.
PNA may be purified by reverse-phase HPLC, analyzed by mass
spectroscopy, and quantitated by correlating absorbance at 260 nm
with mass. Fluorescent-labelled PNA probes have demonstrated
desirable properties in hybridization assays (Hyldig-Nielsen, U.S.
Pat. No. 5,985,563; Coull, WO 98/24933; Coull, WO 99/22018; Gildea,
WO 99/21881; Coull, WO 99/49293).
[0096] PNA-DNA chimera are oligomer molecules with discrete PNA and
nucleotide moieties. They can be synthesized by covalently linking
PNA monomers and nucleotides in virtually any combination or
sequence. Efficient and automated methods have been developed for
synthesizing PNA-DNA chimera (Vinayak (1997) Nucleosides &
Nucleotides 16:1653-56; Uhlmann (1996) Angew. Chem., Intl. Ed. Eng.
35:2632-35; Uhlmann, EP 829542; Van der Laan (1997) Tetrahedron
Lett. 38:2249-52; Van der Laan (1998) Bioorg. Med. Chem. Lett.
8:663-68. PNA-DNA chimera are designed to have desirable properties
found in PNA and DNA, e.g. superior hybridization properties of PNA
and biological functions like DNA, including primer extension
through the 3' OH terminus of the DNA moiety (Uhlmann (1998) Biol.
Chem. 379:1045-52).
[0097] The linker between the PNA monomer units and labels include:
(i) a covalent bond; (ii) an alkyldiyl spacer --(CH.sub.2).sub.n--,
where n is 1 to 12; (iii) ethyleneoxy
--(CH.sub.2CH.sub.2O).sub.n--, where n is 1 to 12, (iv) aryldiyl
(C.sub.6-C.sub.20); or (v) one or more amino acids. Lysine,
aspartic acid, and glutamic acid side chains may be linkage sites
in PNA FRET probes. The .epsilon.-amino group of the sidechain of
lysine may be the reactive linking group for attachment of a label,
e.g. reporter dye or quencher. Linkers are typically attached to
the amino and/or carboxyl terminus of the PNA by the corresponding
monomer units with compatible protecting groups and reactive
functionality for condensation with PNA monomer units and the solid
support. For example, the "O linker", units of
2-(2-aminoethoxy)acetic acid, can be attached to the amino terminus
of any PNA backbone amino group, or on amino functionality of a
solid support.
[0098] VI.2e Labelling
[0099] Labelled oligonucleotides may be formed by reacting an
appropriate reactive label and an oligonucleotide in a suitable
solvent in which both are soluble, using methods well-known in the
art, for example, see Hermanson, Bioconjugate Techniques, (1996)
Academic Press, San Diego, Calif. pp. 40-55, 643-71. The crude,
labelled oligonucleotides may be purified from any starting
materials or unwanted by-products, and stored dry or in solution
for later use, preferably at low temperature.
[0100] The label may bear a reactive linking group at one of the
substituent positions, e.g. 5- or 6-carboxy of fluorescein or
rhodamine, for covalent attachment to an oligonucleotide or
nucleotide through a linkage. Generally, the linkage linking a
label and the oligonucleotide or nucleotide should not (i)
interfere with primer extension, (ii) inhibit polymerase activity,
or (iii) adversely affect the fluorescence properties of a dye
label, e.g. quenching or bleaching. Reactive linking groups are
moieties capable of forming a covalent bond, typically
electrophilic functional groups capable of reacting with
nucleophilic groups on an oligonucleotide such as amines and
thiols. Examples of reactive linking groups include active esters,
e.g., isothiocyanate, sulfonyl chloride, sulfonate ester, silyl
halide, 2,6-dichlorotriazinyl, phosphoramidite, maleimide,
haloacetyl, epoxide, alkylhalide, allyl halide, aldehyde, ketone,
acylazide, anhydride, and iodoacetamide. Active esters include
succinimidyl (NHS), hydroxybenzotriazolyl (HOBt) and
pentafluorophenyl esters.
[0101] One reactive linking group of a fluorescent dye is an
N-hydroxysuccinimidyl ester (NHS) of a carboxyl group substituent
of the fluorescent dye. The NHS ester of the dye may be preformed,
isolated, purified, and/or characterized, or it may be formed in
situ and reacted with a nucleophilic group of an oligonucleotide.
Typically, a carboxyl form of the dye is activated by reacting with
some combination of: (1) a carbodiimide reagent, e.g.
dicyclohexylcarbodiimide, diisopropylcarbodiimide, or a uronium
reagent, e.g. TSTU (O-(N-Succinimidyl)-N,N,N',N'-tetramethyluronium
tetrafluoroborate, HBTU
(O-benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate), or HATU
(O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate); (2) an activator, such as
1-hydroxybenzotriazole (HOBt); and (3) N-hydroxysuccinimide to give
the NHS ester of the dye.
[0102] Another reactive linking group of a label is a
phosphoramidite form of fluorescent dyes, quenchers, minor groove
binders, and mobility modifiers. Phosphoramidite dye reagents are
particularly useful for the automated synthesis of labelled
oligonucleotides. The phosphoramidite reagents can be nucleosidic
or non-nucleosidic. Non-nucleosidic forms of phosphoramidite dye
reagents having the general formula: 2
[0103] effect labelling of an oligonucleotide with a single
fluorescent dye. DYE is a protected or unprotected fluorescent dye.
Alternatively, instead of a fluorescent dye, DYE may be a quencher,
a minor groove binder, or a mobility modifier. L is a linker.
R.sup.24 and R.sup.25 taken separately are C.sub.1-C.sub.12 alkyl,
C.sub.4-C.sub.10 aryl, and cycloalkyl containing up to 10 carbon
atoms, or R.sup.24 and R.sup.25 taken together with the
phosphoramidite nitrogen atom form a saturated nitrogen
heterocycle. R.sup.26 is a phosphite ester protecting group which
prevents unwanted extension of the oligonucleotide. Generally,
R.sup.26 is stable to oligonucleotide synthesis conditions yet is
able to be removed from a synthetic oligonucleotide product with a
reagent that does not adversely affect the integrity of the
oligonucleotide or the dye. R.sup.26 may be: (i) methyl, (ii)
2-cyanoethyl; --CH.sub.2CH.sub.2CN, or (iii)
2-(4-nitrophenyl)ethyl; --CH.sub.2CH.sub.2(p-NO.sub.2Ph).
[0104] The general phosphoramidite dye reagent above reacts with a
hydroxyl group, e.g. 5' terminal OH of an oligonucleotide bound to
a solid support, under mild acid activation, to form an
internucleotide phosphite group which is then oxidized to an
internucleotide phosphate group. In some instances, the dye may
contain functional groups that require protection either during the
synthesis of the phosphoramidite reagent or during its subsequent
use to label molecules such as oligonucleotides. The protecting
group(s) used will depend upon the nature of the functional groups,
and will be apparent to those having skill in the art (Greene, T.
and Wuts, P. Protective Groups in Organic Synthesis, 2nd Ed., John
Wiley & Sons, New York, 1991). The dye will be attached at the
5' terminus of the oligonucleotide, as a consequence of the 3' to
5' direction of synthesis. Other phosphoramidite dye reagents,
nucleosidic and non-nucleosidic allow for labelling at other sites
of an oligonucleotide, e.g. 3' terminus, nucleobase,
internucleotide linkage, sugar. Labelling at the nucleobase,
internucleotide linkage, and sugar sites allows for internal and
multiple labelling with fluorescent dyes.
[0105] Nucleotide 5'-triphosphates may be labelled for use in
certain embodiments of the invention. The sugar or nucleobase
moieties of the nucleotides may be labelled. Nucleobase labelling
sites include the 8-C of a purine nucleobase, the 7-C or 8-C of a
7-deazapurine nucleobase, and the 5-position of a pyrimidine
nucleobase. The labelled nucleotide is enzymatically incorporatable
and enzymatically extendable. Labelled nucleotide 5'-triphosphates
have the following formula: 3
[0106] where DYE is a protected or unprotected dye, including
energy transfer dye. Alternatively, DYE may be a quencher, biotin,
a minor groove binder, or a mobility modifier. B is a nucleobase,
e.g. uracil, thymine, cytosine, adenine, 7-deazaadenine, guanine,
and 8-deazaguanosine. R.sup.19 is triphosphate, thiophosphate, or
phosphate ester analog. R.sup.20 and R.sup.21, when taken alone,
are each independently H, HO, and F. Linker L may include alkynyl,
propargyl, propargylethoxyamido, vinyl, and allyl groups. For
example, L may be: 4
[0107] wherein n is 0, 1, or 2 (Khan, U.S. Pat. Nos. 5,770,716 and
5,821,356; Hobbs, U.S. Pat. No. 5,151,507).
[0108] A nucleobase-labelled oligonucleotide primer or probe may
have the following formula: 5
[0109] where the primer or probe comprises 2 to 100 nucleotides.
DYE is a fluorescent dye, including energy transfer dye. B is a
nucleobase, e.g. uracil, thymine, cytosine, adenine,
7-deazaadenine, guanine, and 8-deazaguanosine. L is a linker, e.g.
propargyl, propargylethoxyamido, allyl, vinyl, or C.sub.1-C.sub.12
alkyldiyl. R.sup.21 is H, OH, halide, azide, amine, C.sub.1-C.sub.6
aminoalkyl, C.sub.1-C.sub.6 alkyl, allyl, C.sub.1-C.sub.6 alkoxy,
--OCH.sub.3, or --OCH.sub.2CH.dbd.CH.sub.2. R.sup.22 is H,
phosphate, internucleotide phosphodiester, or internucleotide
analog. R.sup.23 is H, phosphate, internucleotide phosphodiester,
or internucleotide analog. In this embodiment, the
nucleobase-labelled oligonucleotide may bear multiple fluorescent
labels, e.g. dyes, attached through the nucleobases.
Nucleobase-labelled oligonucleotides may be formed by: (i)
enzymatic incorporation of enzymatically incorporatable nucleotide
reagents where R.sup.19 is triphosphate, by a DNA polymerase or
ligase, and (ii) coupling of a nucleoside phosphoramidite reagent
by automated synthesis (Theisen (1992) "Fluorescent dye
phosphoramidite labelling of oligonucleotides", in Nucleic Acid
Symposium Series No. 27, Oxford University Press, Oxford, pp.
99-100). Whereas, nucleobase-labelled oligonucleotides may be
multiply labelled by incorporation of more than one incorporatable
nucleotide, labelling with a phosphoramidite dye label reagent
leads to singly 5'-labelled oligonucleotides, according to the
following formula: 6
[0110] where X is O, NH, or S; R.sup.21 is H, OH, halide, azide,
amine, C.sub.1-C.sub.6 aminoalkyl, C.sub.1-C.sub.6 alkyl, allyl,
C.sub.1-C.sub.6 alkoxy, --OCH.sub.3, or --OCH.sub.2CH.dbd.CH.sub.2;
R.sup.22 is H, phosphate, internucleotide phosphodiester, or
internucleotide analog; and R.sup.23 is H, phosphate,
internucleotide phosphodiester, or internucleotide analog. L is a
linker, including C.sub.1-C.sub.12 alkyldiyl, e.g. n-hexyldiyl,
aryldiyl, or polyethyleneoxy (U.S. Pat. No. 4,757,141; Andrus,
"Chemical methods for 5' non-isotopic labelling of PCR probes and
primers" (1995) in PCR 2: A Practical Approach, Oxford University
Press, Oxford, pp. 39-54; Hermanson, Bioconjugate Techniques,
(1996) Academic Press, San Diego, Calif. pp. 40-55, 643-71; Mullah
(1998) Nucl. Acids Res. 26:1026-1031.
[0111] A variety of labels may be covalently attached at the 3'
terminus of oligonucleotide probes. A solid support bearing a
label, or bearing functionality which can be labelled by a
post-synthesis reaction, can be utilized as a solid support for
oligonucleotide synthesis (U.S. Pat. Nos. 5,141,813; 5,231,191,
5,401,837; 5,736,626). By this approach, the label or the
functionality is present during synthesis of the oligonucleotide.
During cleavage and deprotection, the label or the functionality
remains covalently attached to the oligonucleotide. Oligonucleotide
probes labelled at the 3' terminus may have the following formula:
7
[0112] where the probe comprises 2 to 100 nucleotides. DYE may be a
fluorescent dye, a quencher, a minor groove binder or other label.
DYE may be a combination of labels, such as a minor groove binder
and a quencher. B is a nucleobase, e.g. uracil, thymine, cytosine,
adenine, 7-deazaadenine, guanine, and 8-deazaguanosine. L is a
linker, e.g. propargyl, propargylethoxyamido, allyl, vinyl, or
C.sub.1-C.sub.12 alkyldiyl. R.sup.21 is H, OH, halide, azide,
amine, C.sub.1-C.sub.6 aminoalkyl, C.sub.1-C.sub.6 alkyl, allyl,
C.sub.1-C.sub.6 alkoxy, --OCH.sub.3, or --OCH.sub.2CH.dbd.CH.sub.2.
R.sup.23 is internucleotide phosphodiester or internucleotide
analog.
[0113] In one post-synthesis chemical labelling method an
oligonucleotide is labelled as follows: An NHS form of 6-carboxy
fluorescein is dissolved or suspended in DMSO and added in excess
(10-20.times.) to a 5'-aminohexyl oligonucleotide in 0.25 M
bicarbonate/carbonate buffer at about pH 9 and allowed to react for
6 hours (Fung, U.S. Pat. No. 4,757,141). The dye labelled
oligonucleotide product can be separated from unreacted dye by
passage through a size-exclusion chromatography column eluting with
buffer, e.g., 0.1 molar triethylamine acetate (TEAA). The fraction
containing the crude labelled oligonucleotide can be further
purified by reverse phase HPLC employing gradient elution.
[0114] Oligonucleotide primers and probes of the present invention
may be labelled with moieties that affect the rate of
electrophoretic migration, i.e. mobility-modifying labels.
Mobility-modifying labels include, but are not limited to biotin,
fluorescent dyes, cholesterol, and polyethyleneoxy units,
--CH.sub.2CH.sub.2O).sub.n-- where n may be 1 to 100 (Grossman,
U.S. Pat. No. 5,624,800). Preferably, n is from 2 to 20. The
polyethyleneoxy units may be interspersed with phosphate groups.
Specifically labelling fluorescent-labelled primers with additional
labels of polyethyleneoxy of discrete and known size allows for
separation by electrophoresis of amplicons, substantially
independent of the size, i.e. number of nucleotides, of the
amplicon. That is, polynucleotides of the same length may be
discriminated by detection of spectrally resolvable dye labels and
separated on the basis of mobility-modifying labels.
Polynucleotides bearing both dye labels and mobility-modifying
labels may be formed enzymatically by ligation or polymerase
extension, e.g. asynchronous PCR, of the single-labelled
oligonucleotide or nucleotide constituents.
[0115] One class of labels provides signals for detection of
labelled extension and amplification products by fluorescence,
chemiluminescence, and electrochemical luminescence (Kricka, L. in
Nonisotopic DNA Probe Techniques (1992), Academic Press, San Diego,
pp. 3-28). Chemiluminescent labels include 1,2-dioxetane compounds
(U.S. Pat. No. 4,931,223; Bronstein (1994) Anal. Biochemistry
219:169-81). Fluorescent dyes useful for labelling probes, primers,
and nucleotide 5'-triphosphates include fluoresceins, rhodamines
(U.S. Pat. Nos. 5,366,860; 5,936,087; 6,051,719), cyanines
(Kubista, WO 97/45539), and metal porphyrin complexes (Stanton, WO
88/04777).
[0116] Fluorescent reporter dyes include xanthene compounds such as
fluoresceins I and rhodamines II: 8
[0117] The ring positions of I and II may be substituted. The amino
R groups of II may be substituted. The substituents include
covalent attachments to the primers, probes and nucleotides of the
invention. Examples of I and II include where X is phenyl
substituted with carboxyl, chloro, and other groups (U.S. Pat. Nos.
5,847,162; 6,025,505; 5,654,442; 5,188,934; 5,885,778; 6,008,379;
6,020,481; 5,936,087), and where X is hydrogen (Benson, U.S. Pat.
No. 6,051,719).
[0118] Another class of probe labels include fluorescence
quenchers. The emission spectra of a quencher overlaps with an
intermolecular fluorescent dye such that the fluorescence of the
fluorescent dye is substantially diminished, or quenched, by the
phenomena of fluorescence resonance energy transfer "FRET" (Clegg
(1992) Meth. Enzymol., 211:353-388). A fluorescent reporter dye and
quencher joined on a probe in a configuration that permits energy
transfer from the fluorophore to the quencher may result in a
reduction of the fluorescence by the fluorescent dye. The reporter
is a luminescent compound that can be excited either by chemical
reaction, producing chemiluminescence, or by light absorption,
producing fluorescence. The quencher can interact with the reporter
to alter its light emission, usually resulting in the decreased
emission efficiency of the reporter. The efficiency of this
quenching phenomenon is directly correlated with the distance
between the reporter molecule and the quencher molecule (Yaron
(1979) Analytical Biochemistry, 95:228-35). This self-quenching
effect may be diminished or lost upon hybridization of the probe to
its complement or upon nuclease cleavage whereupon the fluorescent
reporter and the quencher are separated (FIG. 5).
[0119] Particular quenchers include but are not limited to (i)
rhodamine dyes selected from the group consisting of
tetramethyl-6-carboxyrhodamine (TAMRA),
tetrapropano-6-carboxyrhodamine (ROX) (Bergot, U.S. Pat. No.
5,366,860): 9
[0120] (ii) aryldiazo compounds, e.g. DABSYL and DABCYL, homologs
containing one more additional diazo groups; e.g. Fast Black,
(Nardone, U.S. Pat. No. 6,117,986), and substituted compounds where
Z is a substituent such as Cl, F, Br, C.sub.1-C.sub.6 alkyl,
C.sub.5-C.sub.14 aryl, nitro, cyano, sulfonate, NR.sub.2, --OR, and
CO.sub.2H, where each R is independently H, C.sub.1-C.sub.6 alkyl
or C.sub.5-C.sub.14 aryl according to the structures: 10
[0121] (iii) cyanine dyes (Lee, U.S. Pat. No. 6,080,868) such as
NTB: 11
[0122] and, (iv) other chromophores e.g. anthraquinone, malachite
green, nitrothiazole, and nitroimidazole compounds and the like.
The group X is the covalent attachment site on the primers, probes,
and nucleotide 5'-triphosphates of the methods of the
invention.
[0123] Another class of labels serve to effect the separation or
immobilization of labelled amplicons by specific or non-specific
capture means, e.g. biotin; 2,4-dinitrophenyl (DNP); and
digoxigenin (Andrus, A. "Chemical methods for 5' non-isotopic
labelling of PCR probes and primers" (1995) in PCR 2: A Practical
Approach, Oxford University Press, Oxford, pp. 39-54).
[0124] Another class of labels are mobility modifiers, e.g.
polyethyleneoxy (PEO) units. The PEO label may be comprised of
charged groups, such as phosphodiester to impart charge and
increase electrophoretic mobility (velocity). The PEO label may be
uncharged and act to retard electrophoretic or chromatographic
mobility. Such modifiers may serve to influence or normalize the
electrophoretic velocity of amplification products during analysis,
e.g. by fluorescent detection, to improve resolution and separation
(U.S. Pat. No. 5,470,705)
[0125] Another class of probe and primer labels, referred to herein
as hybridization-stabilizers, include but are not limited to minor
groove binders, intercalators, polycations, such as poly-lysine and
spermine, and cross-linking functional groups.
Hybridization-stabilizers may increase the stability of
base-pairing, i.e. affinity, or the rate of hybridization (Corey
(1995) J. Amer. Chem. Soc. 117:9373-74) of the primer and target,
or probe and target. Hybridization-stabilizers serve to increase
the specificity of base-pairing, exemplified by large differences
in Tm between perfectly complementary oligonucleotide and target
sequences and where the resulting duplex contains one or more
mismatches of Watson/Crick base-pairing (Blackburn, G. and Gait, M.
Eds. "DNA and RNA structure" in Nucleic Acids in Chemistry and
Biology, 2.sup.nd Edition, (1996) Oxford University Press, pp.
15-81 and 337-46). Minor groove binders include Hoechst 33258
(Rajur (1997) J. Org. Chem. 62:523-29), MGB1 (Gong (1997) Biochem.
and Biophys. Res. Comm. 240:557-60), and CDPI.sub.1-3 (U.S. Pat.
No. 5,801,155; WO 96/32496), e.g. CDPI3: 12
[0126] VI.3 Asynchronous Thermal Cycling Protocols
[0127] The invention includes novel asynchronous thermal cycling
methods for PCR amplification of a target nucleic acid. Targets may
be any polynucleotide capable of primer extension and
amplification. Target nucleic acids include, for example, plasmids,
cDNA, amplicons, genomic DNA, restriction digest DNA, and ligation
products. Target nucleic acids may be polymorphic, including
variable repeat sequences and single nucleotide polymorphisms
(SNP). The methods utilize a multi-stage annealing and extension
process using primers of disparate Tm values. The PCR amplification
reagents include primer extension reagents, such as a polymerase,
nucleotide 5'-triphosphates, and a buffer. Two significant
advantages may be realized from the methods: (1) targetting ss
target rather than ds target with probes present in the PCR
mixture, and (2) production of an excess or majority of ss
amplicon.
[0128] The thermal cycling protocols of the invention typically
comprise a series of timed steps at defined temperatures. The
series of steps may be repeated until the PCR process is complete
or a desired outcome is achieved, such as detection of certain
signals or collection of data. The individual parameters of the
steps are selected to optimize the events in a PCR including: (1)
denaturation (thermal melting of a duplex into single strands); (2)
annealing (hybridization of primer to target); and (3) primer
extension (incorporation of enzymatically-extendable nucleotides).
In some protocols, a probe hybridization step may be incorporated
into the cycle. Also, some of the events may be conducted in a
single step. For example, probe hybridization and annealing of one
or more of the primers may occur at the same temperature. Annealing
and extension of a primer may occur at a single temperature.
[0129] The parameters of the steps, e.g. order, duration and
temperature, are selected to optimize the outcome and are largely
guided by factors including: the Tm of the primers and a probe, if
present, the length of the amplicon, the amount or purity of target
and the detection method. Genomic DNA target sequences of low copy
number may necessitate long duration of certain steps or a high
number of cycles.
[0130] Certain embodiments of the method of the invention includes
the step of denaturing a double-stranded target nucleic acid at a
denaturing temperature into two strands. FIG. 1 shows a schematic
for an asynchronous PCR thermal cycling method according to one
embodiment of the present invention, including steps of: (i)
denaturing double stranded target, (ii) annealing a first primer,
(iii) extension of the first primer, (iv) probe hybridization, (v)
annealing a second primer, and (vi) extension of the second primer.
The temperatures and times are merely exemplary. In other
embodiments, the method may begin with a single stranded target
nucleic acid.
[0131] A first, higher-affinity primer is annealed to its
complementary sequence of one strand of target at a first annealing
temperature (Annealing I in FIG. 1). The higher-affinity primer has
a higher Tm than the second, lower affinity primer in the reaction
vessel. At the first annealing temperature, the second primer
anneals to its complementary sequence on the other strand of target
to a lesser extent than the first primer anneals to its
complementary target sequence because the second primer/target
duplex does not have sufficient stability at the first annealing
temperature. The first primer is extended by nucleotide
incorporation, i.e. addition of nucleotide 5'-triphosphates
mediated by polymerase, at the first annealing temperature, or at
an extension temperature (Extension I in FIG. 1). The first
annealing temperature and the extension temperature may be a single
temperature, at which annealing and extension of the first primer
occur at a common temperature. At this stage of the method of this
embodiment of the invention, one strand of the target is part of a
duplex and the other strand is single-stranded.
[0132] The temperature may be lowered to a probe hybridization
temperature (Hybridization in FIG. 1) at which a detectable probe
hybridizes to the single-stranded form of the target nucleic acid.
The detectable probe may exhibit an increase in fluorescence, e.g.
by FRET, upon hybridization or upon cleavage by nuclease activity
of the polymerase.
[0133] The temperature is then changed to a second annealing
temperature (Annealing II in FIG. 1) or kept constant at the probe
hybridization temperature whereby the second primer anneals to its
complementary strand of the target. The second annealing
temperature is lower than the first annealing temperature and lower
than the extension temperature of the first primer. The second
primer extends at the second annealing temperature, or at a higher
extension temperature. Extension II temperature may be the same or
different as Extension I temperature. At this point in the cycle, a
copy of each strand of target has been made. FIG. 1 graphically
portrays a cycle of one embodiment of an asynchronous thermal
cycling protocol. The temperatures and times of the steps are
merely exemplary.
[0134] In the embodiment of the invention illustrated in FIG. 1,
the second and subsequent cycles begin again with denaturing the
double stranded target, followed by the aforementioned other steps.
The cycle may be repeated as many times as desired, but is
typically repeated until detectable signals are evident or
stabilize, or until sufficient quantities of amplicon are produced.
Typically, 50 cycles are sufficient to detect or produce amplicon.
The duration of each step in the cycle is sufficient for the
completion of the events, i.e. substantially complete denaturation,
annealing, extension, and probe hybridization.
[0135] An alternative embodiment of an asynchronous thermal cycling
protocol does not employ a detectable probe or a probe
hybridization step. This embodiment may be useful when the
temporally sequential annealing and extension steps of the first
and second primers are conducted in a first stage; Denaturing,
Annealing I, Extension I, Annealing II, and Extension II, followed
by a second stage of a cycle of only the Denaturing, Annealing I
and Extension I steps. The first stage may be conducted for 2 to 50
cycles, followed by the second stage for 1 to 25 cycles as the
latter portion of the protocol. Omission of the Annealing II and
Extension II steps in the second stage allows only, or
predominantly, copying of the complement to the first primer. The
resulting amplicon will thus be a preponderance of single-stranded
nucleic acid.
[0136] In one embodiment, the Tm difference (.DELTA.Tm) between the
first and second primers is large enough such that during the
first, higher temperature annealing and extension steps, only the
higher Tm primer undergoes annealing and extension. Typically,
annealing temperatures are set 0-10.degree. C. below the Tm of the
primer to be annealed and extended. The first annealing temperature
may be any temperature that allows annealing of the first primer to
target, and that substantially disfavors annealing of the second
primer to target. The extension temperature for the first primer
may be any temperature that allows extension of the first primer to
target, and that substantially disfavors annealing of the second
primer to target for the first primer. The extension temperature of
the second primer is any temperature that allows extension of the
second primer to target. The extension temperature of the second
primer may be the same as or different from the second annealing
temperature. During the annealing and extension steps of the
second, lower Tm primer, most or substantially all of the target
sequence complementary to the first, higher Tm primer has been
extended and exists as a duplex, as illustrated in FIG. 1. FIG. 2
shows exemplary Tm ranges for a first primer, e.g. Tm=60 to
75.degree. C., and a second primer, e.g. Tm=45 to 55.degree. C.
[0137] More than one pair of primers may be present in a PCR
reaction conducted by an asynchronous thermal cycling protocol of
the invention. More than one pair of primers may amplify a
particular amplicon. When more than one pair of primers are present
in a PCR reaction of the invention, more than one amplicon may
result, i.e. more than one target sequence may be amplified. A
particular primer, e.g. a first, higher-melting primer or a second,
lower-melting primer, may form more than one pair of primers and
amplify more than one target sequence. For example, a
higher-melting primer may produce a 100 bp amplicon with one
lower-melting primer, and a 200 bp amplicon with a different
lower-melting primer. More than probe may be present in a PCR
reaction conducted by an asynchronous thermal cycling protocol of
the invention. Each probe may have a unique dye and have a sequence
designed to detect a particular target sequence complement, e.g. to
detect two allelic forms of a gene.
[0138] PCR reactions may be conducted in any enclosure or site
capable of thermal cycling. Vessels include tubes, flasks, wells,
depressions, frits, porous sites, and addressable locations on
surfaces, i.e. arrays.
[0139] VI.4 Monitoring Asynchronous PCR with PNA Fret Probes
[0140] In one embodiment of the invention, PNA FRET probes labelled
with a reporter dye and quencher can detect and monitor the
real-time amplification of target polynucleotides by hybridization.
PNA probes, complementary to an amplicon sequence internal to the
primer sequences, hybridize to ss amplicon after the higher Tm
primer has annealed and extended. PNA probes hybridized to
complement target are not appreciably cleaved by enzymes, e.g. the
exonuclease activity of Taq polymerase, during PCR. When unbound to
complement, the reporter dye is quenched. When hybridized to a
complementary sequence, the reporter dye and quencher are spatially
separated and an increase in fluorescence may be detected. FIG. 5
shows an exemplary 8-18 nt PNA FRET probe in quenched (separated,
unhybridized) and unquenched (hybridized) states. The fluorescent
intensity change may be correlated with hybridization, and thus the
presence and quantity of complementary polynucleotide, i.e.
amplicon. The PNA FRET probe may be designed to optimize quenching
in the unbound state by incorporating oppositely charged linkers,
such as carboxylate amino acid chains, e.g. glutamic acid and
aspartic acid, and ammonium amino acid side chains, e.g. lysine.
Alternatively, the sequence of the probe may be designed to include
non-target complementary sequences at the 5' and 3' termini that
enforce an intramolecular base-paired conformation, i.e. a hairpin
structure, which brings the fluorescent dye moiety and the quencher
moiety in proximity.
[0141] VI.5 Applications of Asynchronous PCR with Real-Time
Detection
[0142] A step in the real time monitoring of one embodiment of an
asynchronous PCR protocol is the hybridization of a detectable
probe under high specificity conditions, i.e. relatively high
temperature. Higher specificity makes single base pair
discrimination feasible. The probe may be cleaving, e.g. DNA, or
non-cleaving, e.g. PNA or another analog. The probe hybridization
and detection step can be conducted at any temperature and permits
the use of very short probes which are intrinsically more specific
than corresponding longer ones. As an illustration, FIG. 13 shows a
30-37.degree. C. probe annealing step employed before the second
primer annealing step. Such a low temperature probe annealing step
may be conducted with PNA probes as short as 8 and 9 nt (Example 5,
FIG. 8).
[0143] A PNA FRET probe binds to DNA target more effectively during
the asynchronous thermal cycling PCR protocol than the traditional
thermal cycling protocol. FIG. 9 shows the averaged fluorescence
changes at cycles 25-30 during each of asynchronous PCR (A-PCR) and
traditional (Normal) PCR. At the annealing step at 65.degree. C.,
the fluorescent intensity increases only slightly for traditional
PCR, indicating less binding of PNA probes to target, compared to
the two-fold signal increase for the A-PCR protocol. The greater
increase in signal means more detection sensitivity, i.e. higher
signal/noise at lower copy number of target.
[0144] An alternative embodiment of the asynchronous PCR method is
to perform a few cycles of a traditional thermal cycling protocol
where one of the two primers is designed with a high G or C content
tail, or "clamp", such as a 5' (GC).sub.n or (CC).sub.n where n is
1 to 4. Alternatively, the tail can be a poly G or poly C motif.
The GC or CG tail units are designed to be non-complementary to any
particular target sequence. The tail serves to increase the Tm of
the primer relative to the "untailed" sequence. During the first
few cycles, both primers anneal to target equally well, resulting
in relatively synchronous extension during a traditional thermal
cycling protocol where the single annealing temperature is equal or
nearly equal to the Tm of the untailed primer. FIG. 14a shows two
cycles of a traditional thermal cycling protocol with the
replication of a GC tail into the amplicon. After several cycles,
the majority of amplicons have incorporated the GC tail at the 5'
terminus and the complement to the GC tail at the 3' terminus. The
GC tail of the primer is then complementary to the amplicon and
will anneal at a higher temperature, at which the untailed primer
will not. After several cycles, e.g. 1 to 5, of the traditional
protocol, the thermal cycling protocol can transition to an
asynchronous protocol whereby ss amplicon can be targeted by a
probe in between the primer annealing and extension steps, or to
produce an excess of ss amplicon. Alternatively, the asynchronous
protocol may be employed solely. One advantage of the GC tail
primer method may be in designing primers or amplicons.
[0145] An asynchronous PCR cycle also has utility in a nuclease
cleavage assay with a cleaving DNA FRET probe. One embodiment of
the invention provides improvements to the 5'-exonuclease
(TAQMAN.RTM.) amplification and detection process (Holland (1991)
Proc. Natl. Acad. Sci., 88:7276-80; Livak, U.S. Pat. No. 5,538,848;
Gelfand, U.S. Pat. Nos. 5,210,015 and 5,538,848). A polymerase that
conducts primer extension and amplifies the polynucleotide may also
possess a nuclease activity that serves to cleave the
phosphodiester bond of a target-annealed probe with an attached
"reporter" dye and a "quencher" and where the sequence is
complementary to the target DNA. Cleavage may release unquenched,
labelled fragments for detection. Cleavage of the probe is not
necessary in some assays where detection of a hybridization event
is accomplished by designing a FRET probe in which the spacing
between a reporter and a quencher is modulated as a result of the
hybridization. (Morrison (1992) in Nonisotopic DNA Probe
Techniques, Kricka, ed., Academic Press, Inc., San Diego, Calif.,
chapter 13; Heller and Morrison (1985) in Rapid Detection and
Identification of Infectious Agents, Academic Press, Inc., San
Diego, Calif., pages 245-256). The methods rely on the change in
fluorescence that occurs when suitable fluorescent labels are
brought into close proximity, variously described in the literature
as FRET, fluorescence energy transfer (FET), nonradiative energy
transfer, long-range energy transfer, dipole-coupled energy
transfer, or Forster energy transfer. FRET probes may contain
self-complementary, "hairpin" sequences to enforce the "dark" state
when unbound to target and increase specificity in hybridization
assays (Tyagi, U.S. Pat. Nos. 5,925,517; 6,037,130; 6,103,476;
6,150,097). Examples of systems that perform the exonuclease assay
and other quantitative fluorescent-based arrays are the ABI
PRISM.TM. 7700, 7200, and 7900HT Sequence Detection Systems
(Applied Biosystems).
[0146] VI.6 Applications of Asynchronous PCR with End-Point
Detection
[0147] The advantages of increased sensitivity and specificity by
asynchronous PCR thermal cycling protocols can be realized in
assays for human disease diagnostics, food-borne pathogen
detection, and microbial detection. The resulting amplicons can be
detected at the end-point of PCR by electrophoresis systems such as
the ABI PRISM 310, ABI PRISM 377, ABI PRISM 3100, and ABI PRISM
3700 (Applied Biosystems), or on fluorescent plate readers,
fluorescence scanners or imaging devices. Amplicons can be detected
by PCR with fluorescent dye labelled primers or by intercalator dye
staining, e.g. SYBR Green (Molecular Probes, Eugene, Oreg.).
[0148] End-point analysis of PCR entails fluorescent dye signal
measurement when thermal cycling and amplification is complete.
Results are reported in terms of the change in fluorescence, i.e.
fluorescence intensity units, of the fluorescent dye signal from
start to finish of the PCR thermal cycling, preferably minus any
internal control signals.
[0149] Asynchronous PCR thermal cycling protocols of the invention
are useful for allelic discrimination of target DNA. Probes
specific for each allele can be monitored in a closed-tube,
homogeneous PCR assay. For example, in a bi-allelic system, two
probes can be labelled each with a different dye, e.g. FAM and TET,
and with sequences specific for each allelic form (Livak (1995)
Nature Genetics 9:341-2; Livak (1999) "Allelic discrimination using
fluorogenic probes and the 5' nuclease assay" Genetic Analysis:
Biomolecular Engineering, Elsevier Press, 14:143-49). A mismatch
between probe and target greatly reduces the efficiency of probe
hybridization, whether the probe is a PNA FRET probe or a
nuclease-cleavable DNA FRET probe. Thus, substantial increase in
FAM or TET fluorescent signals indicates homozygosity for the FAM-
or TET-specific allele. An increase in both signals indicates
heterozygosity.
[0150] Asynchronous PCR thermal cycling protocols of the invention
may also be useful for genotyping and gene expression analysis.
Genotyping with FRET probes requires that fluorescence measurements
be made after PCR is completed (end-point). These types of
experiments are conveniently conducted on the ABI 7200 or 7700
Sequence Detection Systems (Applied Biosystems). The Systems
measure a complete fluorescence spectrum from about 500-650 nm
directly in PCR reaction tubes. The System software automatically
processes the fluorescence data to make genotype
determinations.
[0151] VI.6.a cDNA Library Screening, Homogeneous
Sequencing-by-Hybridizat- ion (SBH)
[0152] Asynchronous PCR may be useful to generate ss cDNA amplicons
to characterize cDNA libraries. cDNA clones can be grown by normal
laboratory procedures on agar plates and inoculated in 96 or 384
well plates to generate master cultures. DNA purification may be
performed using from 10 to 20 .mu.l cultures on new plates with a
corresponding number of wells by the boiling method. These
procedures can be automated (ABI 6700, Applied Biosystems, Foster
City, Calif.). The cDNA inserts may then be amplified by
asynchronous PCR, e.g. in a volume of approximately 100 .mu.l in
plates. The DNA can be sheared physically into <100 bp fragments
if necessary. Each PCR product may then be diluted in distilled,
deionized water, e.g. 2.times., and aliquotted into 32 identical
microtiter plates. The PCR product may then be mixed with one or
more unique PNA FRET probes. Each probe is labelled with unique
dyes, e.g. 6FAM, TET, HEX, ROX at the amino terminus and a quencher
such as NTB, DABCYL at the carboxyl terminus. Fluorescence may then
be measured on a fluorescence multi-well plate reader, e.g.
CytoFluor II (Applied Biosystems). The resulting normalized and
properly scaled fluorescence intensities of 98 probes to a single
clone are indicative of hybridization and defined as a
"hybridization signature" (Drmanac (1993) Science 260:1649-52). The
sequence of the hybridizing portion of a cDNA amplicon can be
determined by deconvolution of the fluorescence intensities due to
hybridization to a number FRET probes of different and known
sequences (Drmanac (1994) BioTechniques 17:328-9; Milosavljevic
(1996) Genome Res. 6:143-141). The normalization of the signal may
be realized by using ratios of the signal for each dye over the
signal from internal control probe targetting a specific plasmid
sequence. Hybridization signatures are used to assign the sequence
similarity between individual clones or cDNA sequences. Clones with
similar hybridization signatures are grouped into a
gene-representing cluster. Clusters are useful to identify specific
full-length cDNA or novel genes based on the difference of cDNA
signature profiling among tissues or treatments.
[0153] FIG. 17 shows a schematic of homogeneous SBH using PNA FRET
probes. The steps of an exemplary method include: (i) cDNA
amplified by asynchronous PCR to make ss cDNA amplicons; (ii) ss
cDNA amplicons are arrayed; (iii) PNA probes hybridize to each ss
cDNA amplicon; (iv) fluorescent detection gives hybridization
signatures. The advantages of the method include: (i) homogeneous
conditions; (ii) multiplexed for high-throughput applications, i.e.
processing many samples in parallel; (iii) rapid hybridization
kinetics with short, high Tm PNA probes, and (iv) the cost
advantage of shorter probes.
[0154] A typical mammalian cell contains between 10,000 to 30,000
different mRNA sequences. Not all of these mRNA are represented
equally in a cDNA library. Low-abundance mRNAs (less than about 10
copies/cell) constitute approximately 30% of all the mRNAs, and
hence there are about 11,000 different mRNA that falls into this
low-abundance class (Wood (1984) Nature 312:330-7). To achieve a
probability of at least 99% of obtaining any rare cDNA clone
present in a given cDNA library, up to one million clones must be
screened. FIG. 8 shows the efficient detection with specificity of
sequences with 8 nt and 9 nt PNA FRET probes. A complete library of
8 nt PNA FRET probes consists of 4.sup.8/2=32,000 probes;
sufficient to detect the more than one million SNP in the human
genome by cDNA library screening. This library would also be
applicable to gene expression monitoring.
[0155] The advantage of the SBH method to cDNA screening is the
ability to characterize all genes in a cDNA library at once.
Assuming one million clones are needed to characterize a cDNA
library, then 2604 plates in the 384 well format are required for
the one million PCR reactions. Asynchronous PCR provides a
significant advantage by efficient production of single-stranded
amplicon ready for hybridization and precluding amplicon isolation,
denaturation and purification. Generation of ss target sequences is
often required for efficient hybridization to probes on an
array.
[0156] VI.7 Applications for SS DNA Generated by Asynchronous
PCR
[0157] Asynchronous PCR allows amplification of either + or -
strand of DNA target, depending on the choice of primer sequence.
High Tm primer complement strand will be formed relative to the low
Tm primer complement strand. Each asynchronous cycle includes two
annealing and two extension steps. The primers have significantly
disparate Tm values, effected largely by primer length. Affinity,
as measured by Tm, is also affected by base content (G+C content),
sequence, and hybridization-stabilizing labels.
[0158] A method to generate a majority of single-stranded DNA
amplicon was developed with a pair of disparate Tm primers.
Asynchronous PCR was conducted for a number of cycles to effect
exponential amplification, followed by one or more cycles of
thermal cycling with annealing and extension temperatures that only
allow hybridization and extension by the higher melting primer
(FIG. 20b). This serves to linearly amplify only one strand of the
DNA amplicon, generating an excess, or majority, of ss DNA (FIG.
20a).
[0159] VI.8 Kits
[0160] The invention includes kits comprising reagents for
amplifying a target nucleic acid according to the asynchronous PCR
methods of the invention. The kits contain a first primer and a
second primer. The first primer and second primer have a Tm
difference disparate enough such that while the first primer
anneals and extends to target, the second primer does not.
Typically, the .DELTA.Tm will be about 10 to 30.degree. C. One of
the first primer or the second primer may be labelled. The label
may be a fluorescent dye, a mobility modifier, or a
hybridization-stabilizing moiety.
[0161] The kits may also contain a detectable probe, a polymerase,
and nucleotides. The probe and/or the nucleotides may be
fluorescent-labelled. The probe may be labelled with a fluorescent
moiety and a quencher moiety. The probe may be DNA, PNA, or a
nucleic acid analog.
[0162] The kit may contain a set of four different nucleotides, one
each that bears a A, G, C, or T nucleobase. The set may be designed
such that the combination of nucleobases, linkers, and fluorescent
dyes yields the set of four nucleotides that result in amplicons
that separate under electrophoresis conditions.
VI.9 EXAMPLES
[0163] The invention having been described, the following Examples
are offered by way of illustration, and not limitation. For primer,
probe and target sequences, DNA nucleotides are denoted in upper
case letters with mutation sites underlined and in bold. PNA probe
sequences are denoted in lower case letters. Unless noted
alternatively, the orientation of DNA sequences is 5' terminus at
the left and 3' terminus at the right. The orientation of PNA
sequences is amino terminus at the left and carboxyl terminus at
the right.
[0164] PCR primers and probes in the following examples were
designed using Primer Express.TM. (Version 1.0, Applied Biosystems,
CA). Thermal melting, Tm, values were estimated for DNA primers and
DNA probes by calculations using the basic formula:
Tm=81.5-16.6(log.sub.10[Na.sup.+]+0.41(% G+C)-(600/N),
[0165] where N=oligonucleotide length in number of nucleotides
(Bolton (1962) Proc. Natl. Acad. Sci., 48:1390; Sambrook, J.,
Fritsch, E. F., Maniatis, T., Eds. (1989) Molecular Cloning, A
Laboratory Manual, Second Edition, Volume 2, pp. 11.46, 9.50-9.51.
Refinements to the basic formula may be made for nearest-neighbor
and solvent effects.
Example 1
Melting Temperature Tm Determination of Primers and PNA FRET
Probes
[0166] Melting temperature (Tm) measurements of PNA FRET probes
were performed on either a Lambda 14 spectrophotometer
(Perkin-Elmer, Norwalk, Conn.) equipped with a Peltier temperature
controller. Temperature ramp rates were 1.degree. C./min with
continuous monitoring at 260 nm. Tm values were calculated using
the maximum values of the first derivative curves of the A260 vs.
temperature plots using software provided by the manufacturer. Tm
determinations were conducted in buffer containing 100 mM sodium
phosphate and 100 mM sodium chloride. Prior to each Tm measurement,
each strand of the various DNA templates and PNA probes were
quantified using UV spectroscopy and diluted into the final melting
buffer at a final concentration of 1 .mu.M. The final optical
density range was between 0.2 and 0.8 OD (optical density units) at
260 nm. The samples were "pre-melted" by heating to 90.degree. C.
for 5 min and allowing to slow cool to ambient temperature prior to
running the melting profiles. Alternatively, the pre-melts were
done on the spectrophotometer by rapidly ramping (5.degree. C./min)
up to the high temperature and ramping the temperature back down to
the starting temperature (2-3.degree. C./min) prior to running the
melting profile.
Example 2
PNA FRET Probe Binding Kinetics to ss DNA and ds DNA (FIG. 6)
[0167] The kinetics of hybridization of a FRET PNA probe to ss and
ds DNA was measured (FIG. 6). When the probe is unbound to target,
or below the Tm of the probe in the presence of target, the
fluorescent dye and the quencher are in an averaged conformation
that allows essentially complete quenching of the fluorescent dye
(FIG. 5). When the probe is hybridized to target, the fluorescent
dye and quencher are spatially separated and an increase in
fluorescence may be measured due to loss of quenching. Measurement
of the fluorescence intensity of a 16 nt PNA FRET probe (SEQ ID
NO:1) gave a baseline of fluorescence. The control experiment
contains only PNA probe and no target (FIG. 6, top). Quenching is
virtually complete throughout the temperature expanse. A mixture of
the probe and ds target DNA was held at 95.degree. C. ds DNA was
formed by annealing 68 nt (SEQ ID NO:2) and 74 nt complement (SEQ
ID NO:3) to form a 68 bp duplex with 3 nt overhangs. Then the
temperature was dropped to 60.degree. C. (FIG. 6, middle).
[0168] The fluorescence was measured as a function of time in about
5 to 10 second intervals over 10 minutes (ABI 7700, Applied
Biosystems, Foster City, Calif.). Fluorescence intensity increased
about four times, indicating some hybridization. As the temperature
drops to about 60.degree. C., in the presence of both template
strands the binding of the PNA to the complementary template strand
is out-competed by the other complementary DNA strand, as seen from
the smaller increase in fluorescence (FIG. 6 middle). It is also
noted that signal slowly drops indicating that the PNA bound is
slowly displaced. Finally, a mixture of the probe and ss target DNA
(SEQ ID NO:2) was held at 95.degree. C., then the temperature was
dropped to 60.degree. C. (FIG. 6, bottom). The 16 nt PNA probe
binds to ss DNA target within a minute, as seen by the eight-fold
increase in fluorescence (FIG. 6 bottom). However, the same probe
binds to ds DNA target less. Both ss DNA and ds DNA templates
ranged from 25, 50, to 100 nM. The concentration range was chosen
to emulate the PCR stages from exponential phase to plateau. The
results thus show that a probe, e.g. PNA FRET 16 nt hybridizes more
rapidly to ss DNA than ds DNA (FIG. 3). The results also
demonstrate that probe binding to ds template is both kinetically
and thermodynamically disfavored.
1 PNA 16 nt: FAM-Glu-tgttgccacttcagcc-Lys(dabcyl)-N- H2 SEQ ID NO:1
DNA(+ strand)68 nt(probe binding region is underlined):
5'TGCGATCCCGCTTGTGATACAGA SEQ ID NO:2 GGCTGAAGTGGCAACA G
AGAAGGAAGGAGAAGACGGGGACCAGCC 3' DNA(- strand)74 nt:
5'TTTGGCTGGTCCCCGTCTTCTCCTTCCTTCTCTG SEQ ID NO:3
TTGCCACTTCAGCCTCTGTATCACAAGCGGGAT CGCATTT 3' 13 14 FAM dabcyl
Example 3
Comparison of Asynchronous, Traditional, and Asymmetric PCR Thermal
Cycling Protocols (FIGS. 4a and 4b)
[0169] An asynchronous thermal cycling protocol was directly
compared with a traditional thermal cycling protocol. PCR reactions
were conducted by independently varying the following conditions:
(i) asynchronous and traditional (single annealing and single
extension steps) thermal cycling protocols; (ii) Tm of the primers;
and (iii) concentration of the primers. Other conditions were held
constant. Target DNA was amplified with three combinations of
forward and reverse primers.
[0170] The cycle for asynchronous PCR (A-PCR) is outlined in FIG.
4a where the primers are designed so that the Tm values are
approximately 15 degrees apart. In the first half of the
amplification cycle, the high Tm primer is annealing to the target
and then extended fully. Thereafter the temperature is lowered,
e.g. 52.degree. C., and the fluorescence is measured at this part
of the cycle. In this part of the cycle, the low temperature primer
will bind to the target sequence but may not extend the primer to a
substantial extent. The cycle is completed by raising the
temperature and completing the extension of the second primer.
[0171] The results from synchronous, traditional, and asymmetric
PCR thermal cycling protocols were compared (FIG. 4b). Two forward
primers and two reverse primers were compared in three of the four
possible combinations (66/52; 66/61; 60/61), to create pairs of
disparate and nearly equal Tm. Asymmetric PCR was conducted with
primers at 200 nM and 20 nM concentrations. The amplicon and target
size was 68 nt. The forward primers (Tm=66.degree. C. and
60.degree. C. in each pair of primers) were 5' labelled with
6-carboxy fluorescein (FAM) as an electrophoretic mobility
modifier. The FAM label retards electrophoresis of the amplicons
and allow resolution of the strands under denaturing analytical gel
conditions. Resolution of labelled (slower migrating) and
unlabelled (faster migrating) bands in each lane indicates the
presence of double-stranded (FAM labelled, slower migrating, upper
band) and single-stranded (unlabelled, faster migrating, lower
band) amplicons resulting from PCR under the varied conditions. The
electrophoresis was conducted on 15% polyacrylamide under
denaturing conditions (about 55 to 60.degree. C. gel temperature
during electrophoresis and 7M urea) in the presence of a SYBR
Green.TM. intercalator (Molecular Probes, Inc., Eugene, Oreg.) to
stain and visualize the amplicons.
[0172] FIG. 4b shows the gel electrophoretic analysis of the PCR
products upon amplification of the target. The asynchronous PCR
with 66.degree. C. and 52.degree. C. Tm primers (3rd lane from the
left) gave a 4:1 ratio of upper to lower bands by densitometry
quantitation, and resulted in more amplicon than the corresponding
traditional PCR with the 66.degree. C. and 52.degree. C. primers.
In fact, the asynchronous protocol gave abundant product with all
three combinations of primers whereas the traditional protocol
(middle lanes) was only efficient for the nearly equal Tm primer
pair (61.degree. C. and 60.degree. C.). The asymmetric thermal
cycling protocol (right lanes) was relatively inefficient with all
three primer combinations. Therefore, FIG. 4b shows that the
asynchronous thermal cycling protocol conducts efficient
amplification and allows production of an excess of ss amplicon
when disparate Tm primers are employed and the protocol ends with
annealing only at the higher temperature.
2 Primers: F1: FAM-TGCGATCCCGCTTGTGATAC SEQ ID NO:4 (Tm =
60.degree. C.) R1: GCTGGTCCCCGTCTTCTCCT SEQ ID NO:5 (Tm =
61.degree. C.) F2: FAM-TGCGATCCCGCTTGTGATACAGA SEQ ID NO:6 (Tm =
66.degree. C.) R2: GGCTGGTCCCCGTC (Tm = 52.degree. C.) SEQ ID NO:7
DNA target, 68 nt: TGCGATCCCGCTTGTGATACAGAGGCTGAAGTGGCAA- CAG
AGAAGGAAGGAGAAGACGGGGACCAGCC SEQ ID NO:2
[0173] PCR primers and double dye-labelled probes were designed
using Primer Express.TM. (Version 1.0, Applied Biosystems, CA).
Primers were selected with varying, disparate Tm and used in three
of the four possible combinations of the forward and reverse
primers. The Tm ranged from 58 to 60.degree. C. for primers and 68
to 70.degree. C. for the probes, except shorter PNA FRET probes.
Asynchronous PCR primers were designed by adding or deleting bases
of the PCR primers from the 5' end. At least 15.degree. C.
difference in Tm between one (66-75.degree. C.) and the other
(50-55.degree. C.) was expected.
[0174] PCR amplification reactions (50 .mu.l) contained a DNA or
RNA target nucleic acid, 2.times. Master mix (25 .mu.l) including
PCR buffer, dNTPs (dATP, dGTP, dCTP, TTP), and MgCl.sub.2 (Applied
Biosystems), AmpliTaq Gold DNA polymerase, forward and reverse
primers (200 to 900 nM each), and a probe (200-250 nM).
[0175] Asymmetric PCR:
[0176] The 50 .mu.l mixture for asymmetric PCR contained all the
reaction components in identical amount as that in the traditional
and asynchronous protocols except that the amount of one primer
(25-50 pmol) was one twentieth of the other primer (1.25-2.5 pmol).
The thermal cycling protocol of the asymmetric PCR was identical to
the symmetric, traditional PCR protocol (FIG. 4b, bottom).
[0177] Denaturing PAGE and Image Analysis:
[0178] PCR product amplicon (0.5-5 .mu.l) was mixed with a final
concentration of 1.times. loading buffer (45 mM Tris base, 45 mM
boric acid, 0.4 mM EDTA, 3% Ficoll, 0.02% bromophenol blue, 0.02%
xylene cyanol) and denatured at 95.degree. C. for 10 to 20 min. The
sample was loaded onto a 10-15% denaturing PAGE gel and
electrophoresed in 1.times.TBE (89 mM Tris base, 89 mM boric acid,
2 mM EDTA, pH 8.3) at 100 to 160 V, 70.degree. C. for 25 to 60 min.
The extended product was visualized by staining the gel with
1.times. SYBR Green (Molecular Probes, Eugene, Oreg.) in a volume
of 40 to 120 ml in 1.times.TBE for 10 to 30 min. The image was
captured by a ChemiImaging 2000 gel documentation system. The
relative amounts of DNA within the bands on the gel could be
compared and ratios calculated by the SpotDenso program (Alpha
Innotech Corp., CA).
Example 4
Real-Time Detection of Amplification of Perfect Match and Mismatch
Targets with Short PNA FRET Probes on the ABI 7700 System (FIGS. 7a
and 7b)
[0179] To demonstrate the achievement of high specificity using an
asynchronous PCR method, two different mismatches were installed in
the synthetic target templates; a C.sub.T mismatch that is poorly
tolerated and a GT mismatch that is generally well accepted, i.e.,
difficult to discriminate against. The PNA FRET 16 nt probe (SEQ ID
NO:1) readily discriminates between the mismatches and the perfect
template with several cycles between them (FIG. 7b). Fluorescence
is detected during each cycle and the logarithmic change in
fluorescence (.DELTA.Rn) is plotted versus the cycle number. The
cycle within the PCR protocol at which the change in fluorescence
(.DELTA.Rn) rises above a threshold value is denoted as C.sub.T. A
relatively low C.sub.T value indicates efficient detection of
amplicon. The threshold cycle is highly correlated to the amount of
copy number, or amount of target polynucleotide present in the
sample. The perfect match experiment in FIG. 7b showed probe/target
detection whereas the mismatch target experiments did not reach the
C.sub.T threshold. Thus, the 16 nt PNA FRET probe showed single
base-pair mismatch specificity. A 14 nt PNA FRET probe (SEQ ID
NO:8) complementary to the same target was prepared and employed
with the same cycle and same primer set as above. The 14 nt PNA
FRET probe displayed even better discrimination with amplicons with
either mismatched target. Neither mismatch experiment reached the
C.sub.T threshold and .DELTA.Rn is barely evident even in the late
rounds of amplification (FIG. 7a).
[0180] For real-time PCR, the traditional thermal cycling protocol
began with 2 min at 50.degree. C. and 10 min at 95.degree. C., then
proceeded with 40 cycles of 95.degree. C. for 15 sec and 60.degree.
C. for 1 min. For real-time asynchronous PCR, each cycle had two
annealing and extension steps including 30 sec at 95 .degree. C.,
30-120 sec at 66-69.degree. C., 30-60 sec at 72.degree. C., 60-120
sec at 52-55.degree. C., and 60 sec at 72.degree. C. All reactions
were performed on the ABI 7700 (Applied Biosystems, Foster City,
Calif.). Reaction conditions were programmed on a Power Macintosh
G3 (Apple Computer, CA) linked directly to the ABI 7700 Sequence
Detector. Analysis of data was also performed on a Macintosh
computer with collection and analysis software (Applied
Biosystems).
3 PNA FRET probe 14 nt: FAM-Glu- gt tgc cac ttc agc- SEQ ID NO:8
Lys(dabcyl)-NH.sub.2 PNA FRET probe 16 nt: FAM-Glu-tgt tgc cac ttc
agc c- SEQ ID NO:1 Lys(dabcyl)-NH.sub.2 Primers: F2:
TGCGATCCCGCTTGTGATACAGA SEQ ID NO:6 (Tm = 66.degree. C.) R2:
GGCTGGTCCCCGTC (Tm = 52.degree. C.) SEQ ID NO:7 DNA targets: Wild
type (perfectly matched) TGCGATCCCGCTTGTGATACAGAGGCTGAAGTGGCAACAG
AGAAGGAAGGAGAAGACGGGGACCAGCC SEQ ID NO:2 Single-base G-T mismatched
TGCGATCCCGCTTGTGATACAGAGGCTGAAGTGGCGACAG
AGAAGGAAGGAGAAGACGGGGACCAGCC SEQ ID NO:9 Single-base C-T mismatched
TGCGATCCCGCTTGTGATACAGAGGCTGAAGTGGCCAC- AG
AGAAGGAAGGAGAAGACGGGGACCAGCC SEQ ID NO:10
Example 5
Real-Time Detection by Asynchronous PCR with Short PNA FRET Probes
(FIG. 8)
[0181] Specificity was demonstrated from the sinusoidal correlation
between the change in fluorescence (.DELTA.Rn) and the C.sub.T
threshold (FIG. 8). PCR was conducted on the ABI 7700 and under the
same conditions as in Examples 3 and 4.
4 PNA FRET probes: 8 nt: FAM-Glu-tgttgcca-Lys- SEQ ID NO:11
Lys(dabcyl)-NH.sub.2 9 nt: FAM-Glu-tgttgccac-Lys- SEQ ID NO:12
Lys(dabcyl)-NH.sub.2 Primers: Forward: GCCCGCCCTGCGATCCCGCTTGTGATAC
SEQ ID NO:13 Reverse: GGCTGGTCCCCGTC SEQ ID NO:7 DNA target:
TGCGATCCCGCTTGTGATACAGAGGCTGAAGTGGCAACAG
AGAAGGAAGGAGAAGACGGGGACCAGCC SEQ ID NO:2
Example 6
Real-Time Detection by Asynchronous PCR with PNA FRET Probes (FIGS.
10, 11, 12)
[0182] A series of three PNA FRET probes, 15-17 nt, and
complementary to a synthetic ss 68 nt target DNA (FIG. 21, n=15,
16, 17) were prepared with carboxyfluorescein as the reporter dye
(F) at the N-terminal (equivalent to the 5'-end on DNA) and dabcyl
as quencher (Q) on the C-terminal. The PNA FRET probes were further
equipped with a negatively charged glutamic acid moiety between the
PNA oligomer and F, and an additional positively charged lysine
inserted between Q and the PNA oligomer. The oppositely charged
amino acids may tend to enforce proximity of the fluorescent dye
and the quencher and thus a higher degree of quenching when the
probe is not hybridized to a complementary sequence, i.e. target
nucleic acid. PCR was conducted on the ABI 7700 and under the same
conditions as in Examples 3 and 4.
[0183] The PNA FRET probes were used for real-time detection of a
synthetic DNA target by the asynchronous thermal cycling protocol.
The Tm of the primers differed by 14.degree. C. Target samples were
prepared by dilution to contain 6 different concentrations:
10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, and 10.sup.9
starting copies. Each of the three probes (15, 16, 17 nt) were used
to detect each target sample concentration by annealing the probe a
the probe annealing step in the protocol and measuring
fluorescence, subtracted from background, created by the loss of
FRET quenching upon hybridization of probe to target. FIG. 10 shows
each probe efficiently detects amplicon above a threshold
fluorescence level as a function of the concentration of target.
Each amplification is detected by about a 20.times. increase in
fluorescence (.DELTA.Rn) at the end-point (40 cycles). FIG. 11 is a
plot of the threshold cycle C.sub.T and starting copy number,
showing linear correlation with high correlation coefficiency
between the target samples and standard controls. By contrast, the
same PNA FRET probe and primers were used to amplify the same
target with a traditional thermal cycling protocol (60) cycles.
FIG. 12 shows that only the highest copy number target samples,
10.sup.8 and 10.sup.9, gave efficient amplification and detection.
FIG. 12 also reveals a lack of correlation between C.sub.T and
starting copy number. None of the traditional protocol
amplifications showed more than about a 3.times. increase in
fluorescence.
5 PNA FRET probes: 15 nt: FAM-Glu-gttgccacttcagcc- SEQ ID NO:14
Lys(dabcyl)-NH.sub.2 (Tm = 70.1.degree. C.) 16 nt:
FAM-Glu-tgttgccacttcagcc- SEQ ID NO:1 Lys(dabcyl)-NH.sub.2 (Tm =
71.7.degree. C.) 17 nt: FAM-Glu-ctgttgccacttcagcc- SEQ ID NO:15
Lys-Lys(dabcyl)-NH.sub.2 (Tm = 72.8.degree. C.) Primers: Forward:
TGCGATCCCGCTTGTGATACAGA SEQ ID NO:6 (Tm = 66.degree. C.) Reverse:
GGCTGGTCCCCGTC SEQ ID NO:7 (Tm = 52.degree. C.) DNA target (68
bases): TGCGATCCCGCTTGTGATACAGAGGCTGAAGTGGCAACAG
AGAAGGAAGGAGAAGACGGGGACCAGCC SEQ ID NO:2
Example 7
Real-Time Detection of Asynchronous PCR with Three Sets of Primers
and a PNA FRET Probe on a K-ras Gene Target (FIG. 14b)
[0184] FIG. 14b shows a real-time detection assay of PCR with three
different pairs of primers and a 16 nt PNA FRET probe on the K-ras
gene as the target nucleic acid. The assay was conducted on the ABI
7700 with the cycles of FIG. 14a followed by 40 cycles of an
asynchronous thermal cycling protocol. The primer pairs included:
(A) equal Tm (52.degree. C.) forward and reverse primers, (B) 5'
(GC).sub.4 clamp forward primer (Tm 77.5.degree. C.) and reverse
primer (Tm 52.degree. C.), and (C) disparate Tm forward and reverse
primers (65.degree. C. and 52.degree. C.). It can be seen from the
plot of .DELTA.Rn during the course of PCR (FIG. 14b) that all
three primer pairs conducted efficient amplification, with nearly
equivalent CT values of about 16-17. The GC clamp pair (B) resulted
in the largest increase in fluorescence intensity. The disparate Tm
primer pair (C) gave a larger fluorescence intensity increase than
the equal Tm primer pair (A), which forecasts greater sensitivity
for low copy number target samples. PCR was conducted on the ABI
7700 and under the same conditions as in Examples 3 and 4.
6 PNA FRET probe: FAM-O-acg-cca-cca-gct-cca-dabcyl-E SEQ ID NO:16
Primers: A: Forward: TGCAGAATTCGGCTTAT SEQ ID NO:17 (Tm =
52.5.degree. C.) Reverse: TCGTCCACAAAATGATTC SEQ ID NO:18 (Tm =
52.4.degree. C.) B: Forward: GCGCGCGCTGCAGAATTCGGCTTA SEQ ID NO:19
(Tm = 77.5.degree. C.) Reverse: TCGTCCACAAAATGATTC SEQ ID NO:20 (Tm
= 52.4.degree. C.) C: Forward: GACGTTGTAAAACGACGGCCA SEQ ID NO:21
(Tm = 65.3.degree. C.) Reverse: GGATCATATTCGTCCACA SEQ ID NO:22 (Tm
= 52.1.degree. C.)
Example 8
Real-Time Detection of the Nuclease Cleavage Assay (FIGS.
15a,b,c)
[0185] The asynchronous and traditional thermal cycling protocols
were compared with a cleaving DNA FRET probe on the ABI 7700
System. Other than the probe, primers, and target, the PCR
amplification reactions contained the same reagents as Example 2.
The target nucleic acid was an amplicon within the .beta.-actin
gene of genomic DNA.
[0186] FIG. 15a shows the results from detection of PCR using a
commercial assay (Applied Biosystems, Foster City, Calif.) with
equal Tm primers for the human .beta.-actin gene in genomic DNA
when conducted by traditional PCR. A series of concentrations of
genomic DNA was used, ranging from 0.6 pg to 50,000 pg. Eight
target samples in this range were employed, at successive 5.times.
difference in concentration. The traditional PCR cycle has one
annealing step and one extension step (FIG. 16, bottom). Primers
with different lengths and disparate Tm values were designed for
the assay with the asynchronous thermal cycling protocol (FIG. 16,
top). FIG. 15b shows the results using the disparate Tm primers
with the asynchronous thermal cycling protocol and in the otherwise
same assay for the .beta.-actin gene at the eight different
concentrations. Both protocols were conducted with the same
cleavable, DNA FRET probe, SEQ ID NO:23 (FIG. 15c). Fluorescent
signal intensity increased significantly and the C.sub.T values
were considerably lower for the asynchronous protocol (FIG. 15b)
compared to the traditional protocol (FIG. 15a). The detection
limit by the asynchronous protocol allows for single copy
detection. In other words, the nuclease cleavage assay is
significantly enhanced by the asynchronous PCR method. The
asynchronous PCR method may also allow the use of shorter, cleaving
DNA FRET probes, i.e. low Tm, under certain conditions.
7 DNA Probe: FAM-ATGCCCTCCCCCATGCCATCCTGCGT-TAMRA SEQ ID NO:23
Primers: traditional PCR: Forward: ACTGTGCCCATCTACGAGGG SEQ ID
NO:24 Reverse: GTGATGACCTGGCAGACGC SEQ ID NO:25 asynchronous PCR:
Forward: TGTGCCCATCTACGA SEQ ID NO:26 Reverse:
CAGCGGAACCGCTCATTGCCAATGG SEQ ID NO:27
Example 9
End-Point Detection of PCR with 5'-Labelled Primers (FIG. 20a)
[0187] To prove that the amplification in A-PCR proceeds in an
asynchronous fashion, the forward, higher Tm, primer was 5'
labelled with biotin so that the two product strands would be well
separated during denaturing polyacrylamide gel electrophoresis. The
experimental design is outlined in FIG. 20a, bottom. The
asynchronous PCR cycle is carried out for first 25 cycles then
followed by the first half of one cycle whereby only the labelled
primer hybridizes and extends. The reaction was halted immediately
by adding 2.times. loading dye (Novex, San Diego, Calif.) and
denaturing at 95.degree. C. for 20 min. If the amplification is
truly asynchronous then product strands should theoretically be in
a 2:1 ratio. The ratio was 1:1 when stopped after 25 full cycles,
but progressed to 1:0.67 after the additional one half cycle (FIG.
20a). This proved that amplification is indeed asynchronous, the
higher melting primer preferentially extends, and an excess of
single-stranded amplicon is produced. PCR was conducted by 25
cycles of the asynchronous thermal cycling protocol and a final
annealing and extension at high temperature. PCR conditions and
analysis employed the conditions of Example 3.
8 Primers: F1: FAM-TGCGATCCCGCTTGTGATAC SEQ ID NO:4 (Tm =
60.degree. C.) R1: GCTGGTCCCCGTCTTCTCCT (Tm = 61.degree. C.) SEQ ID
NO:5 F2: FAM-TGCGATCCCGCTTGTGATACAG- A SEQ ID NO:6 (Tm = 66.degree.
C.) R2: GGCTGGTCCCCGTC (Tm = 52.degree. C.) SEQ ID NO:7 DNA target:
TGCGATCCCGCTTGTGATACAGAGGCTGAAGTGGCAACAG
AGAAGGAAGGAGAAGACGGGGACCAGCC SEQ ID NO:2
Example 10
ss DNA Amplification and Labeling by an Asynchronous PCR Protocol
(FIG. 22)
[0188] The advantage of hybridizing ss amplicons to an array of
complementary, solid-phase support bound probes was explored. Two
pairs of PCR primers were designed to compare traditional with
asynchronous PCR in generating amplicons to hybridize to probes
spotted on a glass slide array. The forward primer of each pair had
a 5' Cy5 dye label (Amersham Pharmacia Biotech, Piscataway, N.J.).
The reverse primers were unlabelled. The 21 nt forward primer and
the 20 nt reverse primer of the traditional pair had approximately
equal calculated Tm values. The 25 nt forward primer and the 18 nt
reverse primer of the asynchronous pair had a calculated .DELTA.Tm
of about 15-20.degree. C. The forward primer of the asynchronous
pair had a 5' CGGC non-target complementary tail, relative to the
forward primer of the traditional pair. PCR was conducted to
generate a 96 bp ds amplicon by the traditional thermal cycling
protocol and a 100 nt ss amplicon by the asynchronous thermal
cycling protocol. Each immobilized probe had a 24 nt sequence
complementary to each amplicon.
[0189] FIG. 22 shows the hybridization of Cy dye 5'-labelled A-PCR
(ss DNA mainly) and traditional PCR (ds DNA) products from four
different targets to a glass slide array. A representative row of
the four targets are enclosed by a rectangle on each array portion
for comparison. Signals were normalized by control hybridization.
The averaged median fluorescent signal from labeled A-PCR products
(right) was 3- to 4-times higher than that from the ds amplicons
generated by the traditional thermal cycling protocol (left). The
results suggest that the array probes attached to a glass surface
hybridize to ss DNA more effectively.
[0190] The target samples contained array probe-specific sequences.
PCR was conducted on the ABI 7700 System. PCR reactions contained
10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2-5 mM MgCl.sub.2, 0.01%
gelatin, 250 .mu.M each dNTP, 0.5 to 1 .mu.M forward primer, 0.05
to 0.1 .mu.M reverse primer, 10 .mu.l of 96 nt synthetic target DNA
(1:1000 dilution), 1-5 U of AmpliTaq Gold DNA polymerase (Applied
Biosystems, Foster City, Calif.) in a total volume of 50 .mu.l. The
96 nt synthetic target DNA was prepared by template-dependent
ligation of oligonucleotides. Asynchronous PCR included two thermal
cycling protocols conducted in series. The first protocol consisted
of an initial 10 min denaturation at 95.degree. C. followed by 15
to 25 cycles of: 95.degree. C. for 15 sec, 65.degree. C. for 60 sec
(forward priming), 52.5.degree. C. (50-55.degree. C.) for 60 sec
(reverse priming), 72.degree. C. for 60 sec, and an extra extension
of 7 min. The second protocol followed immediately to produce the
single-stranded form of dye-labeled amplicon and consisted of 10 to
80 cycles at 95.degree. C. for 30 sec, 67 (66 to 69).degree. C. for
90 sec, and 70.degree. C. for 60 sec. Traditional PCR was conducted
by the protocol in Example 4: 2 min at 50.degree. C. and 10 min at
95.degree. C., then 40 cycles at 95.degree. C. for 15 sec and
60.degree. C. for 1 min; or 2 min at 50.degree. C. and 10 min at
95.degree. C., then 40 cycles at 95.degree. C. for 15 sec,
60.degree. C. for 1 min and 72.degree. C. for 1 min. PCR products
were purified in three washes on a Microcon-100 (Millipore,
Medford, Mass.).
[0191] Microarray Hybridization, Washing, Data Collection &
Analysis
[0192] A total of 64 different 24 nt DNA oligonucleotide probes
were spotted on glass slides. Eight replicates of each probe were
spotted per slide. The hybridization mixture (20-30 .mu.l/slide)
contained 4.times.SSC (saline-sodium citrate), 0.3% SDS (sodium
dodecylsulfate), 1 .mu.g/.mu.l, yeast tRNA, 1 .mu.g/.mu.l poly(A),
and 1-2 .mu.l of 50-.mu.l PCR product. The mixture was denatured at
95.degree. C. for 2 to 4 min and applied 20-30 .mu.l each to
slides. The slide was placed inside an array chamber. Following
hybridization at 50-55.degree. C. in a waterbath for 16-20 h, the
microarrays were washed briefly in 4.times.SSC and 0.3% SDS at
50-55.degree. C., washed once for 2 min in 1.times.SSC and 0.3% SDS
at room temperature, followed by two washes in 0.06.times.SSC at
room temperature for 2 min each. Microarrays were imaged using an
Axon scanner, and images were analyzed in GenePix Pro 3.0 software
(Axon Instruments, Foster City, Calif.).
9 Traditional primers: Cy5-CCTAGCGTAGTGAGCATCCGT SEQ ID NO:28
ATGCCTCGTGACTGCTACCA SEQ ID NO:29 Asynchronous primers:
Cy5-CGGCCCTAGCGTAGTGAGCATCCGT SEQ ID NO:30 (Tm = 70.degree. C.)
ATGCCTCGTGACTGCTAC (Tm = 55.degree. C.) SEQ ID NO:31 DNA target:
CCTAGCGTAGTGAGCATCCGTAAGAGCATTCATCGTAGGGGT
CTTTGTCCTCTGAGCGTGTACCTGAGAACGGGGATGGTAGCA GTCACGAGGCAT SEQ ID
NO:32
[0193] All publications, patents and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent or patent
application was specifically and individually indicated to be
incorporated by reference.
[0194] The invention now having been fully described, it will be
apparent to one of ordinary skill in the art that many changes and
modifications can be made thereto without departing from the spirit
or scope of the invention.
Sequence CWU 1
1
32 1 16 DNA synthetic construct 1 tgttgccact tcagcc 16 2 68 DNA
synthetic construct 2 tgcgatcccg cttgtgatac agaggctgaa gtggcaacag
agaaggaagg agaagacggg 60 gaccagcc 68 3 74 DNA synthetic construct 3
tttggctggt ccccgtcttc tccttccttc tctgttgcca cttcagcctc tgtatcacaa
60 gcgggatcgc attt 74 4 20 DNA synthetic construct 4 tgcgatcccg
cttgtgatac 20 5 20 DNA synthetic construct 5 gctggtcccc gtcttctcct
20 6 23 DNA synthetic construct 6 tgcgatcccg cttgtgatac aga 23 7 14
DNA synthetic construct 7 ggctggtccc cgtc 14 8 14 DNA synthetic
construct 8 gttgccactt cagc 14 9 68 DNA synthetic construct 9
tgcgatcccg cttgtgatac agaggctgaa gtggcgacag agaaggaagg agaagacggg
60 gaccagcc 68 10 68 DNA synthetic construct 10 tgcgatcccg
cttgtgatac agaggctgaa gtggccacag agaaggaagg agaagacggg 60 gaccagcc
68 11 8 DNA synthetic construct 11 tgttgcca 8 12 9 DNA synthetic
construct 12 tgttgccac 9 13 28 DNA synthetic construct 13
gcccgccctg cgatcccgct tgtgatac 28 14 15 DNA synthetic construct 14
gttgccactt cagcc 15 15 17 DNA synthetic construct 15 ctgttgccac
ttcagcc 17 16 15 DNA Homo sapiens 16 acgccaccag ctcca 15 17 17 DNA
Homo sapiens 17 tgcagaattc ggcttat 17 18 18 DNA Homo sapiens 18
tcgtccacaa aatgattc 18 19 24 DNA Homo sapiens 19 gcgcgcgctg
cagaattcgg ctta 24 20 18 DNA Homo sapiens 20 tcgtccacaa aatgattc 18
21 21 DNA Homo sapiens 21 gacgttgtaa aacgacggcc a 21 22 18 DNA Homo
sapiens 22 ggatcatatt cgtccaca 18 23 26 DNA Homo sapiens 23
atgccctccc ccatgccatc ctgcgt 26 24 20 DNA Homo sapiens 24
actgtgccca tctacgaggg 20 25 19 DNA Homo sapiens 25 gtgatgacct
ggcagacgc 19 26 15 DNA Homo sapiens 26 tgtgcccatc tacga 15 27 25
DNA Homo sapiens 27 cagcggaacc gctcattgcc aatgg 25 28 21 DNA
synthetic construct 28 cctagcgtag tgagcatccg t 21 29 20 DNA
synthetic construct 29 atgcctcgtg actgctacca 20 30 25 DNA synthetic
construct 30 cggccctagc gtagtgagca tccgt 25 31 18 DNA synthetic
construct 31 atgcctcgtg actgctac 18 32 96 DNA synthetic construct
32 cctagcgtag tgagcatccg taagagcatt catcgtaggg gtctttgtcc
tctgagcgtg 60 tacctgagaa cggggatggt agcagtcacg aggcat 96
* * * * *
References