U.S. patent application number 10/963238 was filed with the patent office on 2005-06-02 for gene silencing.
This patent application is currently assigned to E.I. du Pont de Nemours and Company. Invention is credited to Aukerman, Milo J..
Application Number | 20050120415 10/963238 |
Document ID | / |
Family ID | 34435040 |
Filed Date | 2005-06-02 |
United States Patent
Application |
20050120415 |
Kind Code |
A1 |
Aukerman, Milo J. |
June 2, 2005 |
Gene silencing
Abstract
The invention provides methods and compositions useful in target
sequence suppression and target sequence validation. The invention
provides polynucleotide constructs useful for gene silencing, as
well as cells, plants and seeds comprising the polynucleotides. The
invention also provides a method for using microRNA to silence a
target sequence.
Inventors: |
Aukerman, Milo J.; (Newark,
DE) |
Correspondence
Address: |
PIONEER HI-BRED INTERNATIONAL INC.
7100 N.W. 62ND AVENUE
P.O. BOX 1000
JOHNSTON
IA
50131
US
|
Assignee: |
E.I. du Pont de Nemours and
Company
|
Family ID: |
34435040 |
Appl. No.: |
10/963238 |
Filed: |
October 12, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60509958 |
Oct 9, 2003 |
|
|
|
Current U.S.
Class: |
800/286 ;
435/419; 435/468 |
Current CPC
Class: |
C12N 15/8218 20130101;
C12N 15/827 20130101; C12N 15/8216 20130101; C12N 15/8201
20130101 |
Class at
Publication: |
800/286 ;
435/468; 435/419 |
International
Class: |
A01H 001/00; C12N
015/82; C12N 005/04 |
Claims
What is claimed:
1. A method of inhibiting expression of a target sequence in a cell
comprising: (a) introducing into the cell a nucleic acid construct
comprising a promoter operably linked to a polynucleotide, the
polynucleotide comprising in the following order: (i) at least
about 20 contiguous nucleotides in the region from nucleotides 1-38
of SEQ ID NO: 3, (ii) a first oligonucleotide of 10 to about 50
contiguous nucleotides, wherein the first oligonucleotide is
substantially complementary to a second oligonucleotide, (iii) at
least about 20 contiguous nucleotides in the region from
nucleotides 60-106 of SEQ ID NO: 3, (iv) the second oligonucleotide
of about 10 to about 50 contiguous nucleotides, wherein the second
oligonucleotide encodes a mRNA, and wherein the second
oligonucleotide is substantially complementary to the target
sequence, and (v) at least about 20 contiguous nucleotides in the
region from nucleotides 128-159 of SEQ ID NO:3; wherein the
polynucleotide encodes an RNA precursor capable of forming a
hairpin, and (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
2. The method of claim 1, wherein the nucleic acid construct
further comprises a promoter operably linked to the
polynucleotide
3. The method of claim 1, wherein the cell is a plant cell.
4. A cell comprising the nucleic acid construct of claim 1.
5. The cell of claim 4, wherein the cell is a plant cell.
6. The method of claim 1, wherein target sequence expression is
inhibited by at least 10%.
7. The method of claim 1, wherein inhibition of the target sequence
generates a loss-of-function phenotype.
8. The method of claim 2, wherein the promoter is a
pathogen-inducible promoter and inhibition of the target sequence
confers resistance to a pathogen.
9. An isolated polynucleotide comprising in the following order at
least 20 contiguous nucleotides in the region from nucleotides 1-38
of SEQ ID NO: 3, a first oligonucleotide of about 10 to about 50
contiguous nucleotides, wherein the first oligonucleotide is
substantially complementary to a second oligonucleotide, at least
about 20 contiguous nucleotides in the region from nucleotides
60-106 of SEQ ID NO: 3, a second oligonucleotide of about 10 to
about 50 contiguous nucleotides, wherein the second oligonucleotide
encodes a mRNA, and the second oligonucleotide is substantially
complementary to the target sequence, and at least about 20
contiguous nucleotides in the region from nucleotides 128-159 of
SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor
capable of forming a hairpin.
10. The isolated polynucleotide of claim 9, further comprising an
operably linked promoter.
11. A cell comprising the isolated polynucleotide of claim 9.
12. The cell of claim 11, wherein the cell is a plant cell.
13. A transgenic plant comprising the isolated polynucleotide of
claim 9.
14. A transgenic seed comprising the isolated polynucleotide of
claim 9.
15. The isolated polynucleotide of claim 10, wherein the promoter
is a pathogen-inducible promoter.
16. The isolated polynucleotide of claim 9, wherein the
polynucleotide suppresses expression of a target sequence.
17. A method of inhibiting expression of a target sequence in a
cell comprising: (a) introducing into the cell a nucleic acid
construct comprising a promoter operably linked to a
polynucleotide, wherein the polynucleotide comprises in the
following order: (i) nucleotides 1-38 of SEQ ID NO: 3, (ii) a first
oligonucleotide of 21 contiguous nucleotides, wherein the first
oligonucleotide is substantially complementary to a second
oligonucleotide, (iii) nucleotides 60-106 of SEQ ID NO: 3, (iv) a
second oligonucleotide of 21 contiguous nucleotides, wherein the
second oligonucleotide encodes a mRNA, and wherein the second
oligonucleotide is substantially complementary to the target
sequence, and (v) nucleotides 128-159 of SEQ ID NO:3; wherein the
polynucleotide encodes an RNA precursor capable of forming a
hairpin, and (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
18. An isolated polynucleotide comprising in the following order
nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of 21
contiguous nucleotides, wherein the first oligonucleotide is
substantially complementary to a second oligonucleotide,
nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of 21
contiguous nucleotides, wherein the second oligonucleotide encodes
a mRNA, and the second oligonucleotide is substantially
complementary to the target sequence, and nucleotides 128-159 of
SEQ ID NO:3, wherein the polynucleotide encodes an RNA precursor
capable of forming a hairpin.
19. A method of inhibiting expression of a target sequence in a
cell comprising: (a) introducing into the cell a nucleic acid
construct comprising a promoter operably linked to a polynucleotide
encoding a modified plant mRNA precursor comprising a first and a
second oligonucleotide, wherein at least one of the first or the
second oligonucleotides is heterologous to the precursor, wherein
the first oligonucleotide is substantially complementary to the
second oligonucleotide, and the second oligonucleotide encodes a
mRNA substantially complementary to the target sequence, wherein
the precursor is capable of forming a hairpin; and (b) expressing
the nucleic acid construct for a time sufficient to produce the
mRNA, wherein the mRNA inhibits expression of the target
sequence.
20. A method of inhibiting expression of a target sequence in a
cell comprising: (a) introducing into the cell a nucleic acid
construct comprising a promoter operably linked to a polynucleotide
encoding a modified plant miR172 mRNA precursor comprising a first
and a second oligonucleotide, wherein at least one of the first or
the second oligonucleotides is heterologous to the precursor,
wherein the first oligonucleotide is substantially complementary to
the second oligonucleotide, and the second oligonucleotide encodes
a mRNA substantially complementary to the target sequence, wherein
the precursor is capable of forming a hairpin; and (b) expressing
the nucleic acid construct for a time sufficient to produce the
mRNA, wherein the mRNA inhibits expression of the target
sequence.
21. The method of claim 20, wherein the plant miR172 mRNA precursor
is from a dicot or a monocot.
22. The method of claim 20, wherein the plant miR172 mRNA precursor
is from a plant selected from the group consisting of Arabidopsis,
tomato, soybean, rice, and corn.
23. The method of claim 20, wherein the plant miR172 mRNA precursor
comprises SEQ ID NO: 3.
24. A method of inhibiting expression of a target sequence in a
cell comprising: (a) introducing into the cell a nucleic acid
construct comprising a promoter operably linked to a polynucleotide
encoding a modified Arabidopsis miR172 mRNA precursor comprising a
first and a second oligonucleotide, wherein at least one of the
first or the second oligonucleotides is heterologous to the
precursor, wherein the first oligonucleotide is substantially
complementary to the second oligonucleotide, and the second
oligonucleotide encodes a mRNA substantially complementary to the
target sequence, wherein the precursor is capable of forming a
hairpin; and (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
25. The method of claim 24, wherein the Arabidopsis miR172 mRNA
precursor comprises SEQ ID NO: 3.
26. A cell produced by the method of claim 1.
27. The cell of claim 26, wherein the cell is a plant cell.
28. The cell of claim 27, wherein the plant cell is from a monocot
or a dicot.
29. The cell of claim 28, wherein the cell is selected from the
group consisting of corn, wheat, rice, barley, oats, sorghum,
millet, sunflower, safflower, cotton, soy, canola, alfalfa,
Arabidopsis, and tobacco.
30. The cell of claim 29, wherein the cell is from Arabidopsis.
31. The cell of claim 29, wherein the cell is from corn.
32. A cell produced by the method of claim 19.
33. The cell of claim 32, wherein the cell is a plant cell.
34. The cell of claim 33, wherein the plant cell is from a monocot
or a dicot.
35. The cell of claim 34, wherein the cell is selected from the
group consisting of corn, wheat, rice, barley, oats, sorghum,
millet, sunflower, safflower, cotton, soy, canola, alfalfa,
Arabidopsis, and tobacco.
36. The cell of claim 35, wherein the cell is from Arabidopsis.
37. The cell of claim 35, wherein the cell is from corn.
38. A cell produced by the method of claim 20.
39. The cell of claim 38, wherein the cell is a plant cell.
40. The cell of claim 39, wherein the plant cell is from a monocot
or a dicot.
41. The cell of claim 40, wherein the cell is selected from the
group consisting of corn, wheat, rice, barley, oats, sorghum,
millet, sunflower, safflower, cotton, soy, canola, alfalfa,
Arabidopsis, and tobacco.
42. The cell of claim 41, wherein the cell is from Arabidopsis.
43. The cell of claim 41, wherein the cell is from corn.
44. A cell produced by the method of claim 24.
45. The cell of claim 44, wherein the cell is a plant cell.
46. The cell of claim 45, wherein the plant cell is from a monocot
or a dicot.
47. The cell of claim 46, wherein the cell is selected from the
group consisting of corn, wheat, rice, barley, oats, sorghum,
millet, sunflower, safflower, cotton, soy, canola, alfalfa,
Arabidopsis, and tobacco.
48. The cell of claim 47, wherein the cell is from Arabidopsis.
49. The cell of claim 47, wherein the cell is from corn.
50. The method of claim 3, the method further comprising producing
a transformed plant, wherein the plant comprises the nucleic acid
construct which encodes the mRNA.
51. A plant produced by the method of claim 50.
52. The method of claim 19, wherein the cell is a plant cell, the
method further comprising producing a transformed plant, wherein
the plant comprises the nucleic acid construct which encodes the
mRNA.
53. A plant produced by the method of claim 52.
54. The method of claim 20, wherein the cell is a plant cell, the
method further comprising producing a transformed plant, wherein
the plant comprises the nucleic acid construct which encodes the
mRNA.
55. A plant produced by the method of claim 50.
56. The method of claim 24, wherein the cell is a plant cell, the
method further comprising producing a transformed plant, wherein
the plant comprises the nucleic acid construct which encodes the
mRNA.
57. A plant produced by the method of claim 56.
58. The plant of claim 57, wherein the plant is a monocot or a
dicot.
59. The plant of claim 58, wherein the plant is selected from the
group consisting of corn, wheat, rice, barley, oats, sorghum,
millet, sunflower, safflower, cotton, soy, canola, alfalfa,
Arabidopsis, and tobacco.
60. The plant of claim 59, wherein the plant is Arabidopsis.
61. The plant of claim 59, wherein the plant is corn.
62. An isolated polynucleotide comprising a polynucleotide which
encodes a modified plant mRNA precursor, the modified precursor
comprising a first and a second oligonucleotide, wherein at least
one of the first or the second oligonucleotides is heterologous to
the precursor, wherein the first oligonucleotide is substantially
complementary to the second oligonucleotide, and the second
oligonucleotide comprises a mRNA substantially complementary to the
target sequence, wherein the precursor is capable of forming a
hairpin.
63. A cell comprising the isolated polynucleotide of claim 62.
64. The cell of claim 63, wherein the cell is a plant cell.
65. An isolated polynucleotide comprising a polynucleotide encoding
a modified plant miR172 mRNA precursor, the modified precursor
comprising a first and a second oligonucleotide, wherein at least
one of the first or the second oligonucleotides is heterologous to
the precursor, wherein the first oligonucleotide is substantially
complementary to the second oligonucleotide, and the second
oligonucleotide comprises a mRNA substantially complementary to the
target sequence, wherein the precursor is capable of forming a
hairpin.
66. A cell comprising the isolated polynucleotide of claim 65.
67. The cell of claim 66, wherein the cell is a plant cell.
68. An isolated polynucleotide comprising polynucleotide encoding a
modified Arabidopsis miR172 mRNA precursor, the modified precursor
comprising a first and a second oligonucleotide, wherein at least
one of the first or the second oligonucleotides is heterologous to
the precursor, wherein the first oligonucleotide is substantially
complementary to the second oligonucleotide, and the second
oligonucleotide comprises a mRNA which is substantially
complementary to the target sequence, wherein the precursor is
capable of forming a hairpin.
69. A cell comprising the isolated polynucleotide of claim 68.
70. The cell of claim 69, wherein the cell is a plant cell.
71. The cell of claim 70, wherein the plant cell is from a dicot or
a monocot.
72. The cell of claim 71, wherein the cell is from Arabidopsis.
73. The cell of claim 71, wherein the cell is from corn.
74. The isolated polynucleotide of claim 62, wherein the first and
the second oligonucleotides are heterologous to the precursor.
75. The isolated polynucleotide of claim 65, wherein the first and
the second oligonucleotides are heterologous to the precursor.
76. The isolated polynucleotide of claim 68, wherein the first and
the second oligonucleotides are heterologous to the precursor.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/509,958, filed Oct. 9, 2003. The entire contents
of the above application is herein incorporated by reference.
FIELD OF THE INVENTION
[0002] The field of the present invention relates generally to
plant molecular biology. More specifically it relates to constructs
and methods to suppress the expression of targeted genes.
BACKGROUND
[0003] Reduction of the activity of specific genes (also known as
gene silencing, or gene suppression) is desirable for several
aspects of genetic engineering in plants. There is still a need for
methods and constructs that induce gene suppression against a wide
selection of target genes, and that result in effective silencing
of the target gene at high efficiency.
BRIEF DESCRIPTION OF THE FIGURES
[0004] FIG. 1. Predicted hairpin structure formed by the sequence
surrounding miR172a-2. The mature microRNA is indicated by a grey
box.
[0005] FIG. 2. miR172a-2 overexpression phenotype. a, Wild type
(Columbia ecotype) plant, 3.5 weeks old. b, EAT-D plant, 3.5 weeks
old. c, Wild type flower. d, EAT-D flower. Note absence of second
whorl organs (petals). Arrow indicates sepal with ovules along the
margins and stigmatic papillae at the tip. e, Cauline leaf margin
from a 35S-EAT plant. Arrows indicate bundles of stigmatic papillae
projecting from the margin. f, Solitary gynoecium (arrow) emerging
from the axil of a cauline leaf of a 35S-EAT plant.
[0006] FIG. 3. The EAT gene contains a mRNA that is complementary
to APETALA2 (AP2). a, Location of the EAT gene on chromosome 5. The
T-DNA insertion and orientation of the 35S enhancers is indicated.
The 21-nt sequence corresponding to miR172a-2 is shown below the
EAT gene (SEQ ID NO: 86). b, Putative 21-nt miR172a-2/AP2 RNA
duplex is shown below the gene structure of AP2. The GU wobble in
the duplex is underlined. c, Alignment of AP2 21-nt region (black
bar) and surrounding sequence with three other Arabidopsis AP2
family members, and with two maize AP2 genes (IDS1 and GL15). d,
Alignment of miR172a-2 mRNA (black bar) and surrounding sequence
with miR172-like sequences from Arabidopsis, tomato, soybean,
potato and rice.
[0007] FIG. 4. miR172a-2 mRNA expression. a, Northern blot of total
RNA from wild type (lanes 3 and 7) and EAT-D (lanes 4 and 8). Blots
were probed with sense (lanes 14) or antisense (lanes 5-8) oligo to
miR172a-2 mRNA. 100 pg of sense oligo (lanes 2 and 6) and antisense
oligo (lanes 1 and 5) were loaded as hybridization controls.
Nucleotide size markers are indicated on the left. b, S1 nuclease
mapping of miR172a-2 mRNA. A 5'-end-labeled probe undigested (lane
1) or digested after hybridization to total RNA from wild-type
(lane 2), EAT-D (lane 3), or tRNA (lane 4).
[0008] FIG. 5. Developmental expression pattern of miR172 family
members. a, RT-PCR of total RNA from wild type seedlings harvested
at 2, 5, 12, and 21 days after germination (lanes 1-4,
respectively), or from mature leaves (lane 5) and floral buds (lane
6). Primers for PCR are indicated on the left. b, Northern analysis
of mirR172 expression in the indicated mutants, relative to wild
type (Col). Blot was probed with an oligo to miR172a-2; however,
all miR172 members should cross hybridize.
[0009] FIG. 6. Expression analysis of putative EAT target genes. a,
Northern blot analysis of polyA+ RNA isolated from wild type (Col)
or EAT-D floral buds. Probes for hybridization are indicated on the
right. b, Western blot of proteins from wild type or EAT-D floral
buds, probed with AP2 antibody. RbcL, large subunit of ribulose
1,5-bisphosphate carboxylase as loading control.
[0010] FIG. 7. Identification of LAT-D. a, Location of the T-DNA
insert in LAT-D, in between At2g28550 and At2g28560. The 4.times.
35S enhancers are approximately 5 kb from At2g28550. b, RT-PCR
analysis of At2g28550 expression in wild type versus LAT-D
plants.
[0011] FIG. 8. EAT-D is epistatic to LAT-D. Genetic cross between
EAT-D and LAT-D plants, with the resultant F1 plants shown, along
with their flowering time (measured as rosette leaf number).
[0012] FIG. 9. Loss-of-function At2g28550 (2-28550) and At5g60120
(6-60120) mutants. Location of T-DNA in each line is indicated,
along with intron/exon structure.
[0013] FIG. 10. Potential function of the miR172 mRNA family. a,
Temporal expression of miR172a-2 and its relatives may cause
temporal downregulation of AP2 targets (e.g. At2g28550 and
At5g60120), which may trigger flowering once the target proteins
drop below a critical threshold (dotted line). b, Dicer cleavage at
various positions may generate at least four distinct mRNAs from
the miR172 family (indicated as a single hairpin with a mRNA
consensus sequence). Sequences at the 5' and 3' ends of each mRNA
are indicated, with the invariant middle 15 nt shown as ellipses.
The putative targets recognized by the individual mRNAs are in
parentheses below each.
SUMMARY OF THE INVENTION
[0014] The invention provides methods and compositions useful in
target sequence suppression and target sequence validation. The
invention provides polynucleotide constructs useful for gene
silencing, as well as cells, plants and seeds comprising the
polynucleotides. The invention also provides a method for using
microRNA to silence a target sequence.
DETAILED DESCRIPTION
[0015] Recently discovered small RNAs play an important role in
controlling gene expression. Regulation of many developmental
processes including flowering is controlled by small RNAs. It is
now possible to engineer changes in gene expression of plant genes
by using transgenic constructs which produce small RNAs in the
plant.
[0016] The invention provides methods and compositions useful for
suppressing targeted sequences. The compositions can be employed in
any type of plant cell, and in other cells which comprise the
appropriate processing components (e.g., RNA interference
components), including invertebrate and vertebrate animal cells.
The compositions and methods are based on an endogenous mRNA
silencing process discovered in Arabidopsis, a similar strategy can
be used to extend the number of compositions and the organisms in
which the methods are used. The methods can be adapted to work in
any eukaryotic cell system. Additionally, the compositions and
methods described herein can be used in individual cells, cells or
tissue in culture, or in vivo in organisms, or in organs or other
portions of organisms.
[0017] The compositions selectively suppress the target sequence by
encoding a mRNA having substantial complementarity to a region of
the target sequence. The mRNA is provided in a nucleic acid
construct which, when transcribed into RNA, is predicted to form a
hairpin structure which is processed by the cell to generate the
mRNA, which then suppresses expression of the target sequence.
[0018] A nucleic acid construct is provided to encode the mRNA for
any specific target sequence. Any mRNA can be inserted into the
construct, such that the encoded mRNA selectively targets and
suppresses the target sequence. The construct is modeled on the EAT
(mir-172a) mRNA precursor from Arabidopsis.
[0019] A method for suppressing a target sequence is provided. The
method employs the constructs above, in which a mRNA is designed to
a region of the target sequence, and inserted into the construct.
Upon introduction into a cell, the mRNA produced suppresses
expression of the targeted sequence. The target sequence can be an
endogenous plant sequence, or a heterologous transgene in the
plant. The target gene may also be a gene from a plant pathogen,
such as a pathogenic virus, nematode, insect, or mold or
fungus.
[0020] A plant, cell, and seed comprising the construct and/or the
mRNA is provided. Typically, the cell will be a cell from a plant,
but other prokaryotic or eukaryotic cells are also contemplated,
including but not limited to viral, bacterial, yeast, insect,
nematode, or animal cells. Plant cells include cells from monocots
and dicots. The invention also provides plants and seeds comprising
the construct and/or the mRNA.
[0021] Units, prefixes, and symbols may be denoted in their SI
accepted form. Unless otherwise indicated, nucleic acids are
written left to right in 5' to 3' orientation; amino acid sequences
are written left to right in amino to carboxyl orientation,
respectively. Numeric ranges recited within the specification are
inclusive of the numbers defining the range and include each
integer within the defined range. Amino acids may be referred to
herein by either commonly known three letter symbols or by the
one-letter symbols recommended by the IUPAC-IUB Biochemical
Nomenclature Commission. Nucleotides, likewise, may be referred to
by their commonly accepted single-letter codes. Unless otherwise
provided for, software, electrical, and electronics terms as used
herein are as defined in The New IEEE Standard Dictionary of
Electrical and Electronics Terms (5.sup.th edition, 1993). The
terms defined below are more fully defined by reference to the
specification as a whole.
[0022] As used herein, "nucleic acid construct" or "construct"
refers to an isolated polynucleotide which is introduced into a
host cell. This construct may comprise any combination of
deoxyribonucleotides, ribonucleotides, and/or modified nucleotides.
The construct may be transcribed to form an RNA, wherein the RNA
may be capable of forming a double-stranded RNA and/or hairpin
structure. This construct may be expressed in the cell, or isolated
or synthetically produced. The construct may further comprise a
promoter, or other sequences which facilitate manipulation or
expression of the construct.
[0023] As used here "suppression" or "silencing" or "inhibition"
are used interchangeably to denote the down-regulation of the
expression of the product of a target sequence relative to its
normal expression level in a wild type organism. Suppression
includes expression that is decreased by about 10%, 15%, 20%, 25%,
30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%, or 100% relative to the wild type expression level.
[0024] As used herein, "encodes" or "encoding" refers to a DNA
sequence which can be processed to generate an RNA and/or
polypeptide.
[0025] As used herein, "expression" or "expressing" refers to the
generation of an RNA transcript from an introduced construct, an
endogenous DNA sequence, or a stably incorporated heterologous DNA
sequence. The term may also refer to a polypeptide produced from an
mRNA generated from any of the above DNA precursors.
[0026] As used herein, "heterologous" in reference to a nucleic
acid is a nucleic acid that originates from a foreign species, or
is synthetically designed, or, if from the same species, is
substantially modified from its native form in composition and/or
genomic locus by deliberate human intervention. A heterologous
protein may originate from a foreign species or, if from the same
species, is substantially modified from its original form by
deliberate human intervention.
[0027] By "host cell" is meant a cell which contains an introduced
nucleic acid construct and supports the replication and/or
expression of the construct. Host cells may be prokaryotic cells
such as E. coli, or eukaryotic cells such as fungi, yeast, insect,
amphibian, nematode, or mammalian cells. Alternatively, the host
cells are monocotyledonous or dicotyledonous plant cells. An
example of a monocotyledonous host cell is a maize host cell.
[0028] The term "introduced" means providing a nucleic acid or
protein into a cell. Introduced includes reference to the
incorporation of a nucleic acid into a eukaryotic or prokaryotic
cell where the nucleic acid may be incorporated into the genome of
the cell, and includes reference to the transient provision of a
nucleic acid or protein to the cell. Introduced includes reference
to stable or transient transformation methods, as well as sexually
crossing.
[0029] The term "isolated" refers to material, such as a nucleic
acid or a protein, which is: (1) substantially or essentially free
from components which normally accompany or interact with the
material as found in its naturally occurring environment or (2) if
the material is in its natural environment, the material has been
altered by deliberate human intervention to a composition and/or
placed at a locus in the cell other than the locus native to the
material.
[0030] As used herein, "mRNA" refers to an oligoribonucleic acid,
which suppresses expression of a polynucleotide comprising the
target sequence transcript. A "mRNA precursor" refers to a larger
polynucleotide which is processed to produce a mature mRNA, and
includes a DNA which encodes an RNA precursor, and an RNA
transcript comprising the mRNA. A "mature mRNA" refers to the mRNA
generated from the processing of a mRNA precursor. A "mRNA
template" is an oligonucleotide region, or regions, in a nucleic
acid construct which encodes the mRNA. The "backside" region of a
mRNA is a portion of a polynucleotide construct which is
substantially complementary to the mRNA template and is predicted
to base pair with the mRNA template. The mRNA template and backside
may form a double-stranded polynucleotide, including a hairpin
structure.
[0031] As used herein, the phrases "target sequence" and "sequence
of interest" are used interchangeably. Target sequence is used to
mean the nucleic acid sequence that is selected for suppression of
expression, and is not limited to polynucleotides encoding
polypeptides. The target sequence comprises a sequence that is
substantially or completely complementary to the mRNA. The target
sequence can be RNA or DNA, and may also refer to a polynucleotide
comprising the target sequence.
[0032] As used herein, "nucleic acid" means a polynucleotide and
includes single or double-stranded polymer of deoxyribonucleotide
or ribonucleotide bases. Nucleic acids may also include fragments
and modified nucleotides.
[0033] By "nucleic acid library" is meant a collection of isolated
DNA or RNA molecules which comprise and substantially represent the
entire transcribed fraction of a genome of a specified organism or
of a tissue from that organism. Construction of exemplary nucleic
acid libraries, such as genomic and cDNA libraries, is taught in
standard molecular biology references such as Berger and Kimmel,
Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol.
152, Academic Press, Inc., San Diego, Calif. (Berger); Sambrook et
al., Molecular Cloning--A Laboratory Manual, 2nd ed., Vol. 1-3
(1989); and Current Protocols in Molecular Biology, F. M. Ausubel
et al., Eds., Current Protocols, a joint venture between Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc.
(1994).
[0034] As used herein "operably linked" includes reference to a
functional linkage of at least two sequences. Operably linked
includes linkage between a promoter and a second sequence, wherein
the promoter sequence initiates and mediates transcription of the
DNA sequence corresponding to the second sequence.
[0035] As used herein, "plant" includes plants and plant parts
including but not limited to plant cells, plant tissue such as
leaves, stems, roots, flowers, and seeds.
[0036] As used herein, "polypeptide" means proteins, protein
fragments, modified proteins, amino acid sequences and synthetic
amino acid sequences. The polypeptide can be glycosylated or
not.
[0037] As used herein, "promoter" includes reference to a region of
DNA that is involved in recognition and binding of an RNA
polymerase and other proteins to initiate transcription.
[0038] The term "selectively hybridizes" includes reference to
hybridization, under stringent hybridization conditions, of a
nucleic acid sequence to a specified nucleic acid target sequence
to a detectably greater degree (e.g., at least 2-fold over
background) than its hybridization to non-target nucleic acid
sequences and to the substantial exclusion of non-target nucleic
acids. Selectively hybridizing sequences typically have about at
least 80% sequence identity, or 90% sequence identity, up to and
including 100% sequence identity (i.e., fully complementary) with
each other.
[0039] The term "stringent conditions" or "stringent hybridization
conditions" includes reference to conditions under which a probe
will selectively hybridize to its target sequence. Stringent
conditions are sequence-dependent and will be different in
different circumstances. By controlling the stringency of the
hybridization and/or washing conditions, target sequences can be
identified which are 100% complementary to the probe (homologous
probing). Alternatively, stringency conditions can be adjusted to
allow some mismatching in sequences so that lower degrees of
similarity are detected (heterologous probing). Generally, a probe
is less than about 1000 nucleotides in length, optionally less than
500 nucleotides in length.
[0040] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na ion, typically about
0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to
8.3 and the temperature is at least about 30.degree. C. for short
probes (e.g., 10 to 50 nucleotides) and at least about 60.degree.
C. for long probes (e.g., greater than 50 nucleotides). Stringent
conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringency conditions
include hybridization with a buffer solution of 30 to 35%
formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37.degree.
C., and a wash in 1.times. to 2.times.SSC (20.times.SSC=3.0 M
NaCl/0.3 M trisodium citrate) at 50 to 55.degree. C. Exemplary
moderate stringency conditions include hybridization in 40 to 45%
formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.5.times. to 1.times.SSC at 55 to 60.degree. C. Exemplary high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C.
[0041] Specificity is typically the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation of Meinkoth and Wahl,
Anal. Biochem., 138:267-284 (1984): T.sub.m=81.5.degree. C.+16.6
(log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of
monovalent cations, % GC is the percentage of guanosine and
cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. The T.sub.m is the temperature (under defined
ionic strength and pH) at which 50% of a complementary target
sequence hybridizes to a perfectly matched probe. T.sub.m is
reduced by about 1.degree. C. for each 1% of mismatching; thus,
T.sub.m, hybridization and/or wash conditions can be adjusted to
hybridize to sequences of the desired identity. For example, if
sequences with .gtoreq.90% identity are sought, the T.sub.m can be
decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11, 12, 13, 14, 15, or 20.degree. C.
lower than the thermal melting point (T.sub.m). Using the equation,
hybridization and wash compositions, and desired T.sub.m, those of
ordinary skill will understand that variations in the stringency of
hybridization and/or wash solutions are inherently described. If
the desired degree of mismatching results in a T.sub.m of less than
45.degree. C. (aqueous solution) or 32.degree. C. (formamide
solution) it is preferred to increase the SSC concentration so that
a higher temperature can be used. An extensive guide to the
hybridization of nucleic acids is found in Tijssen, Laboratory
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles
of hybridization and the strategy of nucleic acid probe assays",
Elsevier, New York (1993); and Current Protocols in Molecular
Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and
Wiley-Interscience, New York (1995). Hybridization and/or wash
conditions can be applied for at least 10, 30, 60, 90, 120, or 240
minutes.
[0042] As used herein, "transgenic" includes reference to a plant
or a cell which comprises a heterologous polynucleotide. Generally,
the heterologous polynucleotide is stably integrated within the
genome such that the polynucleotide is passed on to successive
generations. Transgenic is used herein to include any cell, cell
line, callus, tissue, plant part or plant, the genotype of which
has been altered by the presence of heterologous nucleic acid
including those transgenics initially so altered as well as those
created by sexual crosses or asexual propagation from the initial
transgenic. The term "transgenic" as used herein does not encompass
the alteration of the genome (chromosomal or extra-chromosomal) by
conventional plant breeding methods or by naturally occurring
events such as random cross-fertilization, non-recombinant viral
infection, non-recombinant bacterial transformation,
non-recombinant transposition, or spontaneous mutation.
[0043] As used herein, "vector" includes reference to a nucleic
acid used in introduction of a polynucleotide of the invention into
a host cell. Expression vectors permit transcription of a nucleic
acid inserted therein.
[0044] Polynucleotide sequences may have substantial identity,
substantial homology, or substantial complementarity to the
selected region of the target gene. As used herein "substantial
identity" and "substantial homology" indicate sequences that have
sequence identity or homology to each other. Generally, sequences
that are substantially identical or substantially homologous will
have about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99%, or 100% sequence identity wherein the percent sequence
identity is based on the entire sequence and is determined by GAP
alignment using default parameters (GCG, GAP version 10, Accelrys,
San Diego, Calif.). GAP uses the algorithm of Needleman and Wunsch
(J. Mol. Biol. 48:443-453, 1970) to find the alignment of two
complete sequences that maximizes the number of matches and
minimizes the number of sequence gaps. Sequences which have 100%
identity are identical. "Substantial complementarity" refers to
sequences that are complementary to each other, and are able to
base pair with each other. In describing complementary sequences,
if all the nucleotides in the first sequence will base pair to the
second sequence, these sequences are fully complementary.
[0045] Through a forward genetics approach, a microRNA that confers
a developmental phenotype in Arabidopsis was identified. This mRNA,
miR172a-2 (Park et al., Curr. Biol. 12:1484-1495 2002), causes
early flowering and defects in floral organ identity when
overexpressed. The predicted target of miR172a-2 is a small
subfamily of APETALA2-like transcription factors (Okamuro et al.
1997). Overexpression of miR172a-2 downregulates at least one
member of this family. In addition, overexpression of one of the
AP2-like target genes, At2g28550, causes late flowering. This
result, in conjunction with loss-of-function analyses of At2g28550
and another target gene, At5g60120, indicates that at least some of
the AP2-like genes targeted by miR172a-2 normally function as
floral repressors. The EAT-D line overexpressing miR172-a2 has a
wild-type response to photoperiod. The genomic region encoding the
mRNA was also identified (SEQ ID NO: 1) and used to produce a
cassette into which other mRNAs to target sequences can be inserted
(SEQ ID NO: 3), and to produce an expression vector (SEQ ID NO: 44)
useful for cloning the cassettes and expressing the mRNA. The
expression vector comprises the 1.4 kb region encoding the mRNA.
Expression of this region is processed in the cell to produce the
mRNA which suppresses expression of the target gene. Alternatively,
the mRNA may be synthetically produced and introduced to the cell
directly.
[0046] In one embodiment, there is provided a method for the
suppression of a target sequence comprising introducing into a cell
a nucleic acid construct encoding a mRNA substantially
complementary to the target. In some embodiments the mRNA comprises
about 10-200 nucleotides, about 10-15,15-20, 19, 20, 21, 22, 23,
24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200
nucleotides. In some embodiments the nucleic acid construct encodes
the mRNA. In some embodiments the nucleic acid construct encodes a
polynucleotide precursor which may form a double-stranded RNA, or
hairpin structure comprising the mRNA. In some embodiments,
nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the
backside of the mRNA template and the mRNA template respectively.
In some embodiments, this new sequence replaces the equivalent
region of SEQ ID NO: 1. In further embodiments, this new sequence
replaces the equivalent region of SEQ ID NO: 44.
[0047] In some embodiments, the nucleic acid construct comprises a
modified endogenous plant mRNA precursor, wherein the precursor has
been modified to replace the endogenous mRNA encoding regions with
sequences designed to produce a mRNA directed to the target
sequence. In some embodiments the mRNA precursor template is a
miR172a mRNA precursor. In some embodiments, the miR172a precursor
is from a dicot or a monocot. In some embodiments the miR172a
precursor is from Arabidopsis thaliana, tomato, soybean, rice, or
corn. In some embodiments the mRNA precursor is SEQ ID NO: 1, SEQ
ID NO: 3, or SEQ ID NO: 44.
[0048] In another embodiment the method comprises:
[0049] A method of inhibiting expression of a target sequence in a
cell comprising:
[0050] (a) introducing into the cell a nucleic acid construct
comprising a promoter operably linked to a polynucleotide, wherein
the polynucleotide comprises in the following order:
[0051] (i) at least about 20 contiguous nucleotides in the region
of nucleotides 1-38 of SEQ ID NO: 3,
[0052] (ii) a first oligonucleotide of 10 to about 50 contiguous
nucleotides, wherein the first oligonucleotide is substantially
complementary to a second oligonucleotide
[0053] (iii) at least about 20 contiguous nucleotides in the region
of nucleotides 60-106 of SEQ ID NO: 3,
[0054] (iv) the second oligonucleotide of about 10 to about 50
contiguous nucleotides, wherein the second oligonucleotide encodes
a mRNA, and the second oligonucleotide is substantially
complementary to the target sequence, and
[0055] (v) at least about 20 contiguous nucleotides in the region
of nucleotides 128-159 of SEQ ID NO:3;
[0056] wherein the polynucleotide encodes an RNA precursor capable
of forming a hairpin, and
[0057] (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
[0058] In another embodiment the method comprises:
[0059] A method of inhibiting expression of a gene comprising a
target sequence in a cell comprising:
[0060] (a) introducing into the cell a nucleic acid construct
comprising a promoter operably linked to a polynucleotide, wherein
the polynucleotide comprises in the following order:
[0061] (i) nucleotides 1-38 of SEQ ID NO: 3,
[0062] (ii) a first oligonucleotide of 21 contiguous nucleotides,
wherein the first oligonucleotide is substantially complementary to
a second oligonucleotide,
[0063] (iii) nucleotides 60-106 of SEQ ID NO: 3,
[0064] (iv) the second oligonucleotide of 21 contiguous
nucleotides, wherein the second oligonucleotide encodes a mRNA, and
wherein the second oligonucleotide is substantially complementary
to the target sequence, and
[0065] (v) nucleotides 128-159 of SEQ ID NO:3;
[0066] wherein polynucleotide encodes an RNA precursor capable of
forming a hairpin, and
[0067] (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
[0068] In another embodiment, the method comprises selecting a
target sequence of a gene, and designing a nucleic acid construct
comprising polynucleotide encoding a mRNA substantially
complementary to the target sequence. In some embodiments, the
target sequence is selected from any region of the gene. In some
embodiments, the target sequence is selected from an untranslated
region. In some embodiments, the target sequence is selected from a
coding region of the gene. In some embodiments, the target sequence
is selected from a region about 50 to about 200 nucleotides
upstream from the stop codon, including regions from about 50-75,
75-100, 100-125, 125-150, or 150-200 upstream from the stop codon.
In further embodiments, the target sequence and/or the mRNA is
based on the polynucleotides and process of EAT suppression of
Apetela2-like genes in Arabidopsis thaliana. In some embodiments,
nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the
backside of the mRNA template (first oligonucleotide) and the mRNA
template (second oligonucleotide) respectively. In some
embodiments, this new sequence replaces the equivalent region of
SEQ ID NO: 1. In further embodiments, this new sequence replaces
the equivalent region of SEQ ID NO: 44.
[0069] In some embodiments, the mRNA template, (i.e. the
polynucleotide encoding the mRNA), and thereby the mRNA, may
comprise some mismatches relative to the target sequence. In some
embodiments the mRNA template has .gtoreq.1 nucleotide mismatch as
compared to the target sequence, for example, the mRNA template can
have 1, 2, 3, 4, 5, or more mismatches as compared to the target
sequence. This degree of mismatch may also be described by
determining the percent identity of the mRNA template to the
complement of the target sequence. For example, the mRNA template
may have a percent identity including about at least 70%, 75%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to
the complement of the target sequence.
[0070] In some embodiments, the mRNA template, (i.e. the
polynucleotide encoding the mRNA) and thereby the mRNA, may
comprise some mismatches relative to the mRNA backside. In some
embodiments the mRNA template has .gtoreq.1 nucleotide mismatch as
compared to the mRNA backside, for example, the mRNA template can
have 1, 2, 3, 4, 5, or more mismatches as compared to the mRNA
backside. This degree of mismatch may also be described by
determining the percent identity of the mRNA template to the
complement of the mRNA backside. For example, the mRNA template may
have a percent identity including about at least 70%, 75%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to
the complement of the mRNA backside.
[0071] In some embodiments, the target sequence is selected from a
plant pathogen. Plants or cells comprising a mRNA directed to the
target sequence of the pathogen are expected to have decreased
sensitivity and/or increased resistance to the pathogen. In some
embodiments, the mRNA is encoded by a nucleic acid construct
further comprising an operably linked promoter. In some
embodiments, the promoter is a pathogen-inducible promoter.
[0072] In another embodiment, the method comprises replacing the
mRNA encoding sequence in the polynucleotide of SEQ ID NO: 3 with a
sequence encoding a mRNA substantially complementary to the target
region of the target gene.
[0073] In another embodiment a method is provided comprising a
method of inhibiting expression of a target sequence in a cell
comprising:
[0074] (a) introducing into the cell a nucleic acid construct
comprising a promoter operably linked to a polynucleotide encoding
a modified plant mRNA precursor comprising a first and a second
oligonucleotide, wherein at least one of the first or the second
oligonucleotides is heterologous to the precursor, wherein the
first oligonucleotide is substantially complementary to the second
oligonucleotide, and the second oligonucleotide encodes a mRNA
substantially complementary to the target sequence, wherein the
precursor is capable of forming a hairpin; and
[0075] (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
[0076] In another embodiment a method is provided comprising a
method of inhibiting expression of a target sequence in a cell
comprising:
[0077] (a) introducing into the cell a nucleic acid construct
comprising a promoter operably linked to a polynucleotide encoding
a modified plant miR172 mRNA precursor comprising a first and a
second oligonucleotide, wherein at least one of the first or the
second oligonucleotides is heterologous to the precursor, wherein
the first oligonucleotide is substantially complementary to the
second oligonucleotide, and the second oligonucleotide encodes a
mRNA substantially complementary to the target sequence, wherein
the precursor is capable of forming a hairpin; and
[0078] (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
[0079] In another embodiment a method is provided comprising a
method of inhibiting expression of a target sequence in a cell
comprising:
[0080] (a) introducing into the cell a nucleic acid construct
comprising a promoter operably linked to a polynucleotide encoding
a modified Arabidopsis miR172 mRNA precursor comprising a first and
a second oligonucleotide, wherein at least one of the first or the
second oligonucleotides is heterologous to the precursor, wherein
the first oligonucleotide is substantially complementary to the
second oligonucleotide, and the second oligonucleotide encodes a
mRNA substantially complementary to the target sequence, wherein
the precursor is capable of forming a hairpin; and
[0081] (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
[0082] In another embodiment a method is provided comprising a
method of inhibiting expression of a target sequence in a cell
comprising:
[0083] (a) introducing into the cell a nucleic acid construct
comprising a promoter operably linked to a polynucleotide encoding
a modified corn miR172 mRNA precursor comprising a first and a
second oligonucleotide, wherein at least one of the first or the
second oligonucleotides is heterologous to the precursor, wherein
the first oligonucleotide is substantially complementary to the
second oligonucleotide, and the second oligonucleotide encodes a
mRNA substantially complementary to the target sequence, wherein
the precursor is capable of forming a hairpin; and
[0084] (b) expressing the nucleic acid construct for a time
sufficient to produce the mRNA, wherein the mRNA inhibits
expression of the target sequence.
[0085] In another embodiment, there is provided a nucleic acid
construct for suppressing a target sequence. The nucleic acid
construct encodes a mRNA substantially complementary to the target.
In some embodiments, the nucleic acid construct further comprises a
promoter operably linked to the polynucleotide encoding the mRNA.
In some embodiments, the nucleic acid construct lacking a promoter
is designed and introduced in such a way that it becomes operably
linked to a promoter upon integration in the host genome. In some
embodiments, the nucleic acid construct is integrated using
recombination, including site-specific recombination. See, for
example, WO 99/25821, herein incorporated by reference. In some
embodiments, the nucleic acid construct is an RNA. In some
embodiments, the nucleic acid construct comprises at least one
recombination site, including site-specific recombination sites. In
some embodiments the nucleic acid construct comprises at least one
recombination site in order to facilitate integration,
modification, or cloning of the construct. In some embodiments the
nucleic acid construct comprises two site-specific recombination
sites flanking the mRNA precursor. In some embodiments the
site-specific recombination sites include FRT sites, lox sites, or
att sites, including attB, attL, attP or attR sites. See, for
example, WO 99/25821, and U.S. Pat. Nos. 5,888,732, 6,143,557,
6,171,861, 6,270,969, and 6,277,608, herein incorporated by
reference.
[0086] In some embodiments, the nucleic acid construct comprises a
modified endogenous plant mRNA precursor, wherein the precursor has
been modified to replace the mRNA encoding region with a sequence
designed to produce a mRNA directed to the target sequence. In some
embodiments the mRNA precursor template is a miR172a mRNA
precursor. In some embodiments, the miR172a precursor is from a
dicot or a monocot. In some embodiments the miR172a precursor is
from Arabidopsis thaliana, tomato, soybean, rice, or corn. In some
embodiments the mRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or
SEQ ID NO: 44.
[0087] In another embodiment, the nucleic acid construct comprises
an isolated polynucleotide comprising a polynucleotide which
encodes a modified plant mRNA precursor, the modified precursor
comprising a first and a second oligonucleotide, wherein at least
one of the first or the second oligonucleotides is heterologous to
the precursor, wherein the first oligonucleotide is substantially
complementary to the second oligonucleotide, and the second
oligonucleotide comprises a mRNA substantially complementary to the
target sequence, wherein the precursor is capable of forming a
hairpin.
[0088] In another embodiment, the nucleic acid construct comprises
an isolated polynucleotide comprising a polynucleotide which
encodes a modified plant miR172 mRNA precursor, the modified
precursor comprising a first and a second oligonucleotide, wherein
at least one of the first or the second oligonucleotides is
heterologous to the precursor, wherein the first oligonucleotide is
substantially complementary to the second oligonucleotide, and the
second oligonucleotide comprises a mRNA substantially complementary
to the target sequence, wherein the precursor is capable of forming
a hairpin.
[0089] In another embodiment, the nucleic acid construct comprises
an isolated polynucleotide comprising a polynucleotide which
encodes a modified Arabidopsis miR172 mRNA precursor, the modified
precursor comprising a first and a second oligonucleotide, wherein
at least one of the first or the second oligonucleotides is
heterologous to the precursor, wherein the first oligonucleotide is
substantially complementary to the second oligonucleotide, and the
second oligonucleotide comprises a mRNA substantially complementary
to the target sequence, wherein the precursor is capable of forming
a hairpin.
[0090] In another embodiment, the nucleic acid construct comprises
an isolated polynucleotide comprising a polynucleotide which
encodes a modified corn miR172 mRNA precursor, the modified
precursor comprising a first and a second oligonucleotide, wherein
at least one of the first or the second oligonucleotides is
heterologous to the precursor, wherein the first oligonucleotide is
substantially complementary to the second oligonucleotide, and the
second oligonucleotide comprises a mRNA substantially complementary
to the target sequence, wherein the precursor is capable of forming
a hairpin.
[0091] In some embodiments the mRNA comprises about 10-200
nucleotides, about 10-15,15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27,
25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides. In
some embodiments the nucleic acid construct encodes the mRNA. In
some embodiments the nucleic acid construct encodes a
polynucleotide precursor which may form a double-stranded RNA, or
hairpin structure comprising the mRNA. In some embodiments,
nucleotides 39-59 and/or 107-127 of SEQ ID NO: 3 are replaced by
the backside of the mRNA template and the mRNA template
respectively. In some embodiments, this new sequence replaces the
equivalent region of SEQ ID NO: 1. In further embodiments, this new
sequence replaces the equivalent region of SEQ ID NO: 44. In some
embodiments, the target region is selected from any region of the
target sequence. In some embodiments, the target region is selected
from a untranslated region. In some embodiments, the target region
is selected from a coding region of the target sequence. In some
embodiments, the target region is selected from a region about 50
to about 200 nucleotides upstream from the stop codon, including
regions from about 50-75, 75-100,100-125, 125-150, or 150-200
upstream from the stop codon. In further embodiments, the target
region and/or the mRNA is based on the polynucleotides and process
of EAT suppression of Apetela2-like sequences in Arabidopsis
thaliana.
[0092] In another embodiment the nucleic acid construct comprises
an isolated polynucleotide comprising in the following order at
least 20 contiguous nucleotides in the region from nucleotides 1-38
of SEQ ID NO: 3, a first oligonucleotide of about 10 to about 50
contiguous nucleotides, wherein the first oligonucleotide is
substantially complementary to a second oligonucleotide, at least
about 20 contiguous nucleotides in the region from nucleotides
60-106 of SEQ ID NO: 3, a second oligonucleotide of about 10 to
about 50 contiguous nucleotides, wherein the second oligonucleotide
encodes a mRNA, and the second oligonucleotide is substantially
complementary to the target sequence, and at least about 20
contiguous nucleotides in the region from nucleotides 128-159 of
SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor
capable of forming a hairpin structure.
[0093] In another embodiment the nucleic acid construct comprises
an isolated polynucleotide comprising in the following order
nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of 21
contiguous nucleotides, wherein the first oligonucleotide is
substantially complementary to a second oligonucleotide,
nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of 21
contiguous nucleotides, wherein the second oligonucleotide encodes
a mRNA, and the second oligonucleotide is substantially
complementary to the target sequence, and nucleotides 128-159 of
SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor
capable of forming a hairpin.
[0094] In some embodiments there are provided cells, plants, and
seeds comprising the introduced polynucleotides, and/or produced by
the methods of the invention. The cells include prokaryotic and
eukaryotic cells, including but not limited to bacteria, yeast,
fungi, viral, invertebrate, vertebrate, and plant cells. Plants,
plant cells, and seeds of the invention include gynosperms,
monocots and dicots, including but not limited to, for example,
rice, wheat, oats, barley, millet, sorghum, soy, sunflower,
safflower, canola, alfalfa, cotton, Arabidopsis, and tobacco.
[0095] In some embodiments, the cells, plants, and/or seeds
comprise a nucleic acid construct comprising a modified plant mRNA
precursor, wherein the precursor has been modified to replace the
endogenous mRNA encoding regions with sequences designed to produce
a mRNA directed to the target sequence. In some embodiments the
mRNA precursor template is a miR172a mRNA precursor. In some
embodiments, the miR172a precursor is from a dicot or a monocot. In
some embodiments the miR172a precursor is from Arabidopsis
thaliana, tomato, soybean, rice, or corn. In some embodiments the
mRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44. In
some embodiments the mRNA precursor is encoded by SEQ ID NO: 1, SEQ
ID NO: 3, or SEQ ID NO: 44. In some embodiments, the nucleic acid
construct comprises at least one recombination site, including
site-specific recombination sites. In some embodiments the nucleic
acid construct comprises at least one recombination site in order
to facilitate modification or cloning of the construct. In some
embodiments the nucleic acid construct comprises two site-specific
recombination sites flanking the mRNA precursor. In some
embodiments the site-specific recombination sites include FRT
sites, lox sites, or att sites, including attB, attL, attP or attR
sites. See, for example, WO 99/25821, and U.S. Pat. Nos. 5,888,732,
6,143,557, 6,171,861, 6,270,969, and 6,277,608, herein incorporated
by reference.
[0096] The present invention concerns methods and compositions
useful in suppression of a target sequence and/or validation of
function. The invention also relates to a method for using microRNA
(mRNA) mediated RNA interference (RNAi) to silence or suppress a
target sequence to evaluate function, or to validate a target
sequence for phenotypic effect and/or trait development.
Specifically, the invention relates to constructs comprising small
nucleic acid molecules, mRNAs, capable of inducing silencing, and
methods of using these mRNAs to selectively silence target
sequences.
[0097] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire et al., Nature 391:806 1998). The
corresponding process in plants is commonly referred to as
post-transcriptional gene silencing (PTGS) or RNA silencing and is
also referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes and is commonly shared by diverse
flora and phyla (Fire et al., Trends Genet. 15:358 1999). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or from the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA of viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response through a mechanism that has yet to be fully
characterized.
[0098] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease III enzyme referred to as dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Berstein et al., Nature
409:363 2001). Short interfering RNAs derived from dicer activity
are typically about 21 to about 23 nucleotides in length and
comprise about 19 base pair duplexes (Elbashir et al., Genes Dev.
15:188 2001). Dicer has also been implicated in the excision of 21-
and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA
of conserved structure that are implicated in translational control
(Hutvagner et al., 2001, Science 293:834). The RNAi response also
features an endonuclease complex, commonly referred to as an
RNA-induced silencing complex (RISC), which mediates cleavage of
single-stranded RNA having sequence complementarity to the
antisense strand of the siRNA duplex. Cleavage of the target RNA
takes place in the middle of the region complementary to the
antisense strand of the siRNA duplex (Elbashir et al., Genes Dev.
15:188 2001). In addition, RNA interference can also involve small
RNA (e.g., microRNA, or mRNA) mediated gene silencing, presumably
through cellular mechanisms that regulate chromatin structure and
thereby prevent transcription of target gene sequences (see, e.g.,
Allshire, Science 297:1818-1819 2002; Volpe et al., Science
297:1833-1837 2002; Jenuwein, Science 297:2215-2218 2002; and Hall
et al., Science 297:2232-2237 2002). As such, mRNA molecules of the
invention can be used to mediate gene silencing via interaction
with RNA transcripts or alternately by interaction with particular
gene sequences, wherein such interaction results in gene silencing
either at the transcriptional or post-transcriptional level.
[0099] RNAi has been studied in a variety of systems. Fire et al.
(Nature 391:806 1998) were the first to observe RNAi in C. elegans.
Wianny and Goetz (Nature Cell Biol. 2:70 1999) describe RNAi
mediated by dsRNA in mouse embryos. Hammond et al. (Nature 404:293
2000) describe RNAi in Drosophila cells transfected with dsRNA.
Elbashir et al., (Nature 411:494 2001) describe RNAi induced by
introduction of duplexes of synthetic 21-nucleotide RNAs in
cultured mammalian cells including human embryonic kidney and HeLa
cells.
[0100] Small RNAs play an important role in controlling gene
expression. Regulation of many developmental processes, including
flowering, is controlled by small RNAs. It is now possible to
engineer changes in gene expression of plant genes by using
transgenic constructs which produce small RNAs in the plant.
[0101] Small RNAs appear to function by base-pairing to
complementary RNA or DNA target sequences. When bound to RNA, small
RNAs trigger either RNA cleavage or translational inhibition of the
target sequence. When bound to DNA target sequences, it is thought
that small RNAs can mediate DNA methylation of the target sequence.
The consequence of these events, regardless of the specific
mechanism, is that gene expression is inhibited.
[0102] It is thought that sequence complementarity between small
RNAs and their RNA targets helps to determine which mechanism, RNA
cleavage or translational inhibition, is employed. It is believed
that siRNAs, which are perfectly complementary with their targets,
work by RNA cleavage. Some mRNAs have perfect or near-perfect
complementarity with their targets, and RNA cleavage has been
demonstrated for at least a few of these mRNAs. Other mRNAs have
several mismatches with their targets, and apparently inhibit their
targets at the translational level. Again, without being held to a
particular theory on the mechanism of action, a general rule is
emerging that perfect or near-perfect complementarity favors RNA
cleavage, whereas translational inhibition is favored when the
mRNA/target duplex contains many mismatches. The apparent exception
to this is microRNA 172 (miR172) in plants. One of the targets of
miR172 is APETALA2 (AP2), and although miR172 shares near-perfect
complementarity with AP2 it appears to cause translational
inhibition of AP2 rather than RNA cleavage.
[0103] MicroRNAs (mRNAs) are noncoding RNAs of about 19 to about 24
nucleotides (nt) in length that have been identified in both
animals and plants (Lagos-Quintana et al., Science 294:853-858
2001, Lagos-Quintana et al., Curr. Biol. 12:735-739 2002; Lau et
al., Science 294:858-862 2001; Lee and Ambros, Science 294:862-864
2001; Llave et al., Plant Cell 14:1605-1619 2002; Mourelatos et
al., Genes. Dev. 16:720-728 2002; Park et al., Curr. Biol.
12:1484-1495 2002; Reinhart et al., Genes. Dev. 16:1616-1626 2002).
They are processed from longer precursor transcripts that range in
size from approximately 70 to 200 nt, and these precursor
transcripts have the ability to form stable hairpin structures. In
animals, the enzyme involved in processing mRNA precursors is
called Dicer, an RNAse III-like protein (Grishok et al., Cell
106:23-34 2001; Hutvagner et al., Science 293:834-838 2001; Ketting
et al., Genes. Dev. 15:2654-2659 2001). Plants also have a
Dicer-like enzyme, DCL1 (previously named CARPEL FACTORY/SHORT
INTEGUMENTS1/SUSPENSOR1), and recent evidence indicates that it,
like Dicer, is involved in processing the hairpin precursors to
generate mature mRNAs (Park et al., Curr. Biol. 12:1484-1495 2002;
Reinhart et al., Genes. Dev. 16:1616-1626 2002). Furthermore, it is
becoming clear from recent work that at least some mRNA hairpin
precursors originate as longer polyadenylated transcripts, and
several different mRNAs and associated hairpins can be present in a
single transcript (Lagos-Quintana et al., Science 294:853-858 2001;
Lee et al., EMBO J 21:4663-4670 2002). Recent work has also
examined the selection of the mRNA strand from the dsRNA product
arising from processing of the hairpin by DICER (Schwartz et al.,
2003, Cell 115:199-208). It appears that the stability (i.e. G:C
vs. A:U content, and/or mismatches) of the two ends of the
processed dsRNA affects the strand selection, with the low
stability end being easier to unwind by a helicase activity. The 5'
end strand at the low stability end is incorporated into the RISC
complex, while the other strand is degraded.
[0104] In animals, there is direct evidence indicating a role for
specific mRNAs in development. The lin-4 and let-7 mRNAs in C.
elegans have been found to control temporal development, based on
the phenotypes generated when the genes producing the lin-4 and
let-7 mRNAs are mutated (Lee et al., Cell 75:843-854 1993; Reinhart
et al., Nature 403-901-906 2000). In addition, both mRNAs display a
temporal expression pattern consistent with their roles in
developmental timing. Other animal mRNAs display developmentally
regulated patterns of expression, both temporal and tissue-specific
(Lagos-Quintana et al., Science 294:853-853 2001, Lagos-Quintana et
al., Curr. Biol. 12:735-739 2002; Lau et al., Science 294:858-862
2001; Lee and Ambros, Science 294:862-864 2001), leading to the
hypothesis that mRNAs may, in many cases, be involved in the
regulation of important developmental processes. Likewise, in
plants, the differential expression patterns of many mRNAs suggests
a role in development (Llave et al., Plant Cell 14:1605-1619 2002;
Park et al., Curr. Biol. 12:1484-1495 2002; Reinhart et al., Genes.
Dev. 16:1616-1626 2002). However, a developmental role for mRNAs
has not been directly proven in plants, because to date there has
been no report of a developmental phenotype associated with a
specific plant mRNA.
[0105] MicroRNAs appear to regulate target genes by binding to
complementary sequences located in the transcripts produced by
these genes. In the case of lin-4 and let-7, the target sites are
located in the 3' UTRs of the target mRNAs (Lee et al., Cell
75:843-854 1993; Wightman et al., Cell 75:855-862 1993; Reinhart et
al., Nature 403:901-906 2000; Slack et al., Mol. Cell 5:659-669
2000), and there are several mismatches between the lin-4 and let-7
mRNAs and their target sites. Binding of the lin-4 or let-7 mRNA
appears to cause downregulation of steady-state levels of the
protein encoded by the target mRNA without affecting the transcript
itself (Olsen and Ambros, Dev. Biol. 216:671-680 1999). On the
other hand, recent evidence suggests that mRNAs can, in some cases,
cause specific RNA cleavage of the target transcript within the
target site, and this cleavage step appears to require 100%
complementarity between the mRNA and the target transcript
(Hutvagner and Zamore, Science 297:2056-2060 2002; Llave et al.,
Plant Cell 14:1605-1619 2002). It seems likely that mRNAs can enter
at least two pathways of target gene regulation: Protein
downregulation when target complementarity is <100%, and RNA
cleavage when target complementarity is 100%. MicroRNAs entering
the RNA cleavage pathway are analogous to the 21-25 nt short
interfering RNAs (siRNAs) generated during RNA interference (RNAi)
in animals and posttranscriptional gene silencing (PTGS) in plants
(Hamilton and Baulcombe 1999; Hammond et al., 2000; Zamore et al.,
2000; Elbashir et al., 2001), and likely are incorporated into an
RNA-induced silencing complex (RISC) that is similar or identical
to that seen for RNAi.
[0106] Identifying the targets of mRNAs with bioinformatics has not
been successful in animals, and this is probably due to the fact
that animal mRNAs have a low degree of complementarity with their
targets. On the other hand, bioinformatic approaches have been
successfully used to predict targets for plant mRNAs (Llave et al.,
Plant Cell 14:1605-1619 2002; Park et al., Curr. Biol. 12:1484-1495
2002; Rhoades et al., Cell 110:513-520 2002), and thus it appears
that plant mRNAs have higher overall complementarity with their
putative targets than do animal mRNAs. Most of these predicted
target transcripts of plant mRNAs encode members of transcription
factor families implicated in plant developmental patterning or
cell differentiation. Nonetheless, biological function has not been
directly demonstrated for any plant mRNA. Although Llave et al.
(Science 297:2053-2056 2002) have shown that a transcript for a
SCARECROW-like transcription factor is a target of the Arabidopsis
mRNA mir171, these studies were performed in a heterologous species
and no plant phenotype associated with mir171 was reported.
[0107] The methods provided can be practiced in any organism in
which a method of transformation is available, and for which there
is at least some sequence information for the target sequence, or
for a region flanking the target sequence of interest. It is also
understood that two or more sequences could be targeted by
sequential transformation, co-transformation with more than one
targeting vector, or the construction of a DNA construct comprising
more than one mRNA sequence. The methods of the invention may also
be implemented by a combinatorial nucleic acid library construction
in order to generate a library of mRNAs directed to random target
sequences. The library of mRNAs could be used for high-throughput
screening for gene function validation.
[0108] General categories of sequences of interest include, for
example, those genes involved in regulation or information, such as
zinc fingers, transcription factors, homeotic genes, or cell cycle
and cell death modulators, those involved in communication, such as
kinases, and those involved in housekeeping, such as heat shock
proteins.
[0109] Target sequences further include coding regions and
non-coding regions such as promoters, enhancers, terminators,
introns and the like, which may be modified in order to alter the
expression of a gene of interest. For example, an intron sequence
can be added to the 5' region to increase the amount of mature
message that accumulates (see for example Buchman and Berg, Mol.
Cell Biol. 8:4395-4405 (1988); and Callis et al., Genes Dev.
1:1183-1200 (1987)).
[0110] The target sequence may be an endogenous sequence, or may be
an introduced heterologous sequence, or transgene. For example, the
methods may be used to alter the regulation or expression of a
transgene, or to remove a transgene or other introduced sequence
such as an introduced site-specific recombination site. The target
sequence may also be a sequence from a pathogen, for example, the
target sequence may be from a plant pathogen such as a virus, a
mold or fungus, an insect, or a nematode. A mRNA could be expressed
in a plant which, upon infection or infestation, would target the
pathogen and confer some degree of resistance to the plant.
[0111] In plants, other categories of target sequences include
genes affecting agronomic traits, insect resistance, disease
resistance, herbicide resistance, sterility, grain characteristics,
and commercial products. Genes of interest also included those
involved in oil, starch, carbohydrate, or nutrient metabolism as
well as those affecting, for example, kernel size, sucrose loading,
and the like. The quality of grain is reflected in traits such as
levels and types of oils, saturated and unsaturated, quality and
quantity of essential amino acids, and levels of cellulose. For
example, genes of the phytic acid biosynthetic pathway could be
suppressed to generate a high available phosphorous phenotype. See,
for example, phytic acid biosynthetic enzymes including inositol
polyphosphate kinase-2 polynucleotides, disclosed in WO 02/059324,
inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides, disclosed
in WO 03/027243, and myo-inositol 1-phosphate synthase and other
phytate biosynthetic polynucleotides, disclosed in WO 99/05298, all
of which are herein incorporated by reference. Genes in the
lignification pathway could be suppressed to enhance digestibility
or energy availability. Genes affecting cell cycle or cell death
could be suppressed to affect growth or stress response. Genes
affecting DNA repair and/or recombination could be suppressed to
increase genetic variability. Genes affecting flowering time could
be suppressed, as well as genes affecting fertility. Any target
sequence could be suppressed in order to evaluate or confirm its
role in a particular trait or phenotype, or to dissect a molecular,
regulatory, biochemical, or proteomic pathway or network.
[0112] A number of promoters can be used, these promoters can be
selected based on the desired outcome. It is recognized that
different applications will be enhanced by the use of different
promoters in plant expression cassettes to modulate the timing,
location and/or level of expression of the mRNA. Such plant
expression cassettes may also contain, if desired, a promoter
regulatory region (e.g., one conferring inducible, constitutive,
environmentally- or developmentally-regulated, or cell- or
tissue-specific/selective expression), a transcription initiation
start site, a ribosome binding site, an RNA processing signal, a
transcription termination site, and/or a polyadenylation
signal.
[0113] Constitutive, tissue-preferred or inducible promoters can be
employed. Examples of constitutive promoters include the
cauliflower mosaic virus (CaMV) 35S transcription initiation
region, the 1'- or 2'-promoter derived from T-DNA of Agrobacterium
tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the
cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439),
the Nos promoter, the pEmu promoter, the rubisco promoter, the
GRP1-8 promoter and other transcription initiation regions from
various plant genes known to those of skill. If low level
expression is desired, weak promoter(s) may be used. Weak
constitutive promoters include, for example, the core promoter of
the Rsyn7 promoter (WO 99/43838 and U.S. Pat. No. 6,072,050), the
core 35S CaMV promoter, and the like. Other constitutive promoters
include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144;
5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and
5,608,142. See also, U.S. Pat. No. 6,177,611, herein incorporated
by reference.
[0114] Examples of inducible promoters are the Adh1 promoter which
is inducible by hypoxia or cold stress, the Hsp70 promoter which is
inducible by heat stress, the PPDK promoter and the pepcarboxylase
promoter which are both inducible by light. Also useful are
promoters which are chemically inducible, such as the In2-2
promoter which is safener induced (U.S. Pat. No. 5,364,780), the
ERE promoter which is estrogen induced, and the Axig1 promoter
which is auxin induced and tapetum specific but also active in
callus (PCT US01/22169).
[0115] Examples of promoters under developmental control include
promoters that initiate transcription preferentially in certain
tissues, such as leaves, roots, fruit, seeds, or flowers. An
exemplary promoter is the anther specific promoter 5126 (U.S. Pat.
Nos. 5,689,049 and 5,689,051). Examples of seed-preferred promoters
include, but are not limited to, 27 kD gamma zein promoter and waxy
promoter, Boronat, A. et al. (1986) Plant Sci. 47:95-102; Reina, M.
et al. Nucl. Acids Res. 18(21):6426; and Kloesgen, R. B. et al.
(1986) Mol. Gen. Genet. 203:237-244. Promoters that express in the
embryo, pericarp, and endosperm are disclosed in U.S. Pat. No.
6,225,529 and PCT publication WO 00/12733. The disclosures each of
these are incorporated herein by reference in their entirety.
[0116] In some embodiments it will be beneficial to express the
gene from an inducible promoter, particularly from a
pathogen-inducible promoter. Such promoters include those from
pathogenesis-related proteins (PR proteins), which are induced
following infection by a pathogen; e.g., PR proteins, SAR proteins,
beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et
al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992)
Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol.
4:111-116. See also WO 99/43819, herein incorporated by
reference.
[0117] Of interest are promoters that are expressed locally at or
near the site of pathogen infection. See, for example, Marineau et
al. (1987) Plant Mol. Biol. 9:335-342; Matton et al. (1989)
Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al.
(1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al.
(1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad.
Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J.
10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA
91:2507-2511; Warner et al. (1993) Plant J. 3:191-201; Siebertz et
al. (1989) Plant Cell 1:961-968; U.S. Pat. No. 5,750,386
(nematode-inducible); and the references cited therein. Of
particular interest is the inducible promoter for the maize PRms
gene, whose expression is induced by the pathogen Fusarium
moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol.
Plant Path. 41:189-200).
[0118] Additionally, as pathogens find entry into plants through
wounds or insect damage, a wound-inducible promoter may be used in
the constructions of the polynucleotides. Such wound-inducible
promoters include potato proteinase inhibitor (pin II) gene (Ryan
(1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature
Biotech. 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1
and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208);
systemin (McGurl et al. (1992) Science 225:1570-1573); WIP1
(Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et
al. (1993) FEBS Lett. 323:73-76); MPI gene (Corderok et al. (1994)
Plant J. 6(2):141-150); and the like, herein incorporated by
reference.
[0119] Chemical-regulated promoters can be used to modulate the
expression of a gene in a plant through the application of an
exogenous chemical regulator. Depending upon the objective, the
promoter may be a chemical-inducible promoter, where application of
the chemical induces gene expression, or a chemical-repressible
promoter, where application of the chemical represses gene
expression. Chemical-inducible promoters are known in the art and
include, but are not limited to, the maize In2-2 promoter, which is
activated by benzenesulfonamide herbicide safeners, the maize GST
promoter, which is activated by hydrophobic electrophilic compounds
that are used as pre-emergent herbicides, and the tobacco PR-1a
promoter, which is activated by salicylic acid. Other
chemical-regulated promoters of interest include steroid-responsive
promoters (see, for example, the glucocorticoid-inducible promoter
in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425
and McNellis et al. (1998) Plant J. 14(2):247-257) and
tetracycline-inducible and tetracycline-repressible promoters (see,
for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and
U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by
reference.
[0120] Tissue-preferred promoters can be utilized to target
enhanced expression of a sequence of interest within a particular
plant tissue. Tissue-preferred promoters include Yamamoto et al.
(1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell
Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet.
254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168;
Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341; Van Camp et
al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996)
Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell
Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ.
20:181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138;
Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590;
and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such
promoters can be modified, if necessary, for weak expression.
[0121] Leaf-preferred promoters are known in the art. See, for
example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al.
(1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell
Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18;
Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka
et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590. In
addition, the promoters of cab and ribisco can also be used. See,
for example, Simpson et al. (1958) EMBO J 4:2723-2729 and Timko et
al. (1988) Nature 318:57-58.
[0122] Root-preferred promoters are known and can be selected from
the many available from the literature or isolated de novo from
various compatible species. See, for example, Hire et al. (1992)
Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine
synthetase gene); Keller and Baumgartner (1991) Plant Cell
3(10):1051-1061 (root-specific control element in the GRP 1.8 gene
of French bean); Sanger et al. (1990) Plant Mol. Biol.
14(3):433-443 (root-specific promoter of the mannopine synthase
(MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991)
Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic
glutamine synthetase (GS), which is expressed in roots and root
nodules of soybean). See also Bogusz et al. (1990) Plant Cell
2(7):633-641, where two root-specific promoters isolated from
hemoglobin genes from the nitrogen-fixing nonlegume Parasponia
andersonii and the related non-nitrogen-fixing nonlegume Trema
tomentosa are described. The promoters of these genes were linked
to a .beta.-glucuronidase reporter gene and introduced into both
the nonlegume Nicotiana tabacum and the legume Lotus corniculatus,
and in both instances root-specific promoter activity was
preserved. Leach and Aoyagi (1991) describe their analysis of the
promoters of the highly expressed roIC and roID root-inducing genes
of Agrobacterium rhizogenes (see Plant Science (Limerick)
79(1):69-76). They concluded that enhancer and tissue-preferred DNA
determinants are dissociated in those promoters. Teeri et al.
(1989) used gene fusion to lacZ to show that the Agrobacterium
T-DNA gene encoding octopine synthase is especially active in the
epidermis of the root tip and that the TR2' gene is root specific
in the intact plant and stimulated by wounding in leaf tissue, an
especially desirable combination of characteristics for use with an
insecticidal or larvicidal gene (see EMBO J. 8(2):343-350). The
TR1' gene, fused to nptII (neomycin phosphotransferase II) showed
similar characteristics. Additional root-preferred promoters
include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant
Mol. Biol. 29(4):759-772); and roIB promoter (Capana et al. (1994)
Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 5,837,876;
5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and
5,023,179. The phaseolin gene (Murai et al. (1983) Science
23:476-482 and Sengopta-Gopalen et al. (1988) PNAS
82:3320-3324.
[0123] Transformation protocols as well as protocols for
introducing nucleotide sequences into plants may vary depending on
the type of plant or plant cell, i.e., monocot or dicot, targeted
for transformation. Suitable methods of introducing the DNA
construct include microinjection (Crossway et al. (1986)
Biotechniques 4:320-334; and U.S. Pat. No. 6,300,543), sexual
crossing, electroporation (Riggs et al. (1986) Proc. Natl. Acad.
Sci. USA 83:5602-5606), Agrobacterium-mediated transformation
(Townsend et al., U.S. Pat. No. 5,563,055; and U.S. Pat. No.
5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J.
3:2717-2722), and ballistic particle acceleration (see, for
example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al.,
U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244;
Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) "Direct
DNA Transfer into Intact Plant Cells via Microprojectile
Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental
Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and
McCabe et al. (1988) Biotechnology 6:923-926). Also see Weissinger
et al. (1988) Ann. Rev. Genet 22:421-477; Sanford et al. (1987)
Particulate Science and Technology 5:27-37 (onion); Christou et al.
(1988) Plant Physiol. 87:671-674 (soybean); Finer and McMullen
(1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh et al.
(1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al.
(1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc.
Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988)
Biotechnology 6:559-563 (maize); Tomes, U.S. Pat. No. 5,240,855;
Buising et al., U.S. Pat. Nos. 5,322,783 and 5,324,646; Klein et
al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990)
Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al.
(1984) Nature (London) 311:763-764; Bowen et al., U.S. Pat. No.
5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci.
USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The
Experimental Manipulation of Ovule Tissues, ed. Chapman et al.
(Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990)
Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor.
Appl. Genet. 84:560-566 (whisker-mediated transformation);
D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation);
Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and
Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al.
(1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium
tumefaciens); and U.S. Pat. No. 5,736,369 (meristem
transformation), all of which are herein incorporated by
reference.
[0124] The nucleotide constructs may be introduced into plants by
contacting plants with a virus or viral nucleic acids. Generally,
such methods involve incorporating a nucleotide construct of the
invention within a viral DNA or RNA molecule. Further, it is
recognized that useful promoters encompass promoters utilized for
transcription by viral RNA polymerases. Methods for introducing
nucleotide constructs into plants and expressing a protein encoded
therein, involving viral DNA or RNA molecules, are known in the
art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190,
5,866,785, 5,589,367 and 5,316,931; herein incorporated by
reference.
[0125] In some embodiments, transient expression may be desired. In
those cases, standard transient transformation techniques may be
used. Such methods include, but are not limited to viral
transformation methods, and microinjection of DNA or RNA, as well
other methods well known in the art.
[0126] The cells from the plants that have stably incorporated the
nucleotide sequence may be grown into plants in accordance with
conventional ways. See, for example, McCormick et al. (1986) Plant
Cell Reports 5:81-84. These plants may then be grown, and either
pollinated with the same transformed strain or different strains,
and the resulting hybrid having constitutive expression of the
desired phenotypic characteristic imparted by the nucleotide
sequence of interest and/or the genetic markers contained within
the target site or transfer cassette. Two or more generations may
be grown to ensure that expression of the desired phenotypic
characteristic is stably maintained and inherited and then seeds
harvested to ensure expression of the desired phenotypic
characteristic has been achieved.
[0127] Initial identification and selection of cells and/or plants
comprising the DNA constructs may be facilitated by the use of
marker genes. Gene targeting can be performed without selection if
there is a sensitive method for identifying recombinants, for
example if the targeted gene modification can be easily detected by
PCR analysis, or if it results in a certain phenotype. However, in
most cases, identification of gene targeting events will be
facilitated by the use of markers. Useful markers include positive
and negative selectable markers as well as markers that facilitate
screening, such as visual markers. Selectable markers include genes
carrying resistance to an antibiotic such as spectinomycin (e.g.
the aada gene, Svab et al. 1990 Plant Mol. Biol. 14:197),
streptomycin (e.g., aada, or SPT, Svab et al. 1990 Plant Mol. Biol.
14:197; Jones et al. 1987 Mol. Gen. Genet. 210:86), kanamycin
(e.g., nptII, Fraley et al. 1983 PNAS 80:4803), hygromycin (e.g.,
HPT, Vanden Elzen et al. 1985 Plant Mol. Biol. 5:299), gentamycin
(Hayford et al. 1988 Plant Physiol. 86:1216), phleomycin, zeocin,
or bleomycin (Hille et al. 1986 Plant Mol. Biol. 7:171), or
resistance to a herbicide such as phosphinothricin (bar gene), or
sulfonylurea (acetolactate synthase (ALS)) (Charest et al. (1990)
Plant Cell Rep. 8:643), genes that fulfill a growth requirement on
an incomplete media such as HIS3, LEU2, URA3, LYS2, and TRP1 genes
in yeast, and other such genes known in the art. Negative
selectable markers include cytosine deaminase (codA) (Stougaard
1993 Plant J. 3:755-761), tms2 (DePicker et al. 1988 Plant Cell
Rep. 7:63-66), nitrate reductase (Nussame et al. 1991 Plant J.
1:267-274), SU1 (O'Keefe et al. 1994 Plant Physiol. 105:473-482),
aux-2 from the Ti plasmid of Agrobacterium, and thymidine kinase.
Screenable markers include fluorescent proteins such as green
fluorescent protein (GFP) (Chalfie et al., 1994 Science 263:802;
U.S. Pat. No. 6,146,826; U.S. Pat. No. 5,491,084; and WO 97/41228),
reporter enzymes such as .beta.-glucuronidase (GUS) (Jefferson R.
A. 1987 Plant Mol. Biol. Rep. 5:387; U.S. Pat. No. 5,599,670; and
U.S. Pat. No. 5,432,081), .beta.-galactosidase (lacZ), alkaline
phosphatase (AP), glutathione S-transferase (GST) and luciferase
(U.S. Pat. No. 5,674,713; and Ow et al. 1986 Science
234(4778):856-859), visual markers like anthocyanins such as CRC
(Ludwig et al. (1990) Science 247(4841):449-450) R gene family
(e.g. Lc, P, S), A, C, R-nj, body and/or eye color genes in
Drosophila, coat color genes in mammalian systems, and others known
in the art.
[0128] One or more markers may be used in order to select and
screen for gene targeting events. One common strategy for gene
disruption involves using a target modifying polynucleotide in
which the target is disrupted by a promoterless selectable marker.
Since the selectable marker lacks a promoter, random integration
events are unlikely to lead to transcription of the gene. Gene
targeting events will put the selectable marker under control of
the promoter for the target gene. Gene targeting events are
identified by selection for expression of the selectable marker.
Another common strategy utilizes a positive-negative selection
scheme. This scheme utilizes two selectable markers, one that
confers resistance (R+) coupled with one that confers a sensitivity
(S+), each with a promoter. When this polynucleotide is randomly
inserted, the resulting phenotype is R+/S+. When a gene targeting
event is generated, the two markers are uncoupled and the resulting
phenotype is R+/S-. Examples of using positive-negative selection
are found in Thykjaer et al. (1997) Plant Mol. Biol. 35:523-530;
and WO 01/66717, which are herein incorporated by reference.
EXAMPLES
[0129] The following are non-limiting examples intended to
illustrate the invention. Although the present invention has been
described in some detail by way of illustration and example for
purposes of clarity of understanding, it will be obvious that
certain changes and modifications may be practiced within the scope
of the appended claims.
Example 1
[0130] The Example Describes the Identification of a microRNA
[0131] The following experiments were carried out on the
Arabidopsis thaliana Col-0 ecotype. Plants were grown in long days
(16 h light, 8 h dark) under cool white light at 22.degree. C.
[0132] Arabidopsis plants were transformed by a modified version of
the floral dip method, in which Agrobacterium cell suspension was
applied to plants by direct watering from above. The T-DNA vector
used, pHSbarENDs, contained four copies of the CAMV 35S enhancer
adjacent to the right border, an arrangement similar to that
described by Weigel et al. (Plant Physiol. 122:1003-1013, 2000).
Transformed plants were selected with glufosinate (BASTA) and
screened for flowering time, which resulted in the identification
of the early-flowering EAT-D mutant. A single T-DNA cosegregating
with early flowering was identified in EAT-D, and TAIL-PCR was
performed to amplify sequences adjacent to the left and right
borders of the T-DNA. To identify transcripts upregulated in the
EAT-D mutant, we probed Northern blots containing RNA extracted
from wild type (Col-0) and EAT-D plants. Probes for the genes
At5g04270 and At5g04280 (GenBank NC.sub.--003076) did not detect
any difference between wild type and EAT-D, whereas a probe from
the intergenic region identified an .about.1.4 kb transcript that
was expressed at significantly higher levels in EAT-D than in wild
type.
[0133] To isolate the full-length EAT cDNA, we performed 5'- and
3'-RACE-PCR with a GeneRacer kit (Invitrogen) that selects for
5'-capped mRNAs. Reverse transcription was carried out using an
oligo-dT primer, and PCR utilized a gene-specific primer (SEQ ID
NO: 45 5'-CTGTGCTCACGATCTTGTTGTTCTTGATC-3') paired with the 5' kit
primer, or a second gene-specific primer (SEQ ID NO: 46
5'-GTCGGCGGATCCATGGAAGAAAGCTCA- TC-5') paired with the 3' kit
primer.
[0134] The Arabidopsis EAT-D (Early Activation Tagged-Dominant)
mutant was identified in an activation tagging population (Weigel
et al., Plant Physiol. 122:1003-1013, 2000). As evidenced by visual
inspection and by measuring rosette leaf number (Table 1), the
EAT-D mutant flowers extremely early. In addition, EAT-D displays
floral defects that are virtually identical to those observed for
strong apetala2 (ap2) mutant alleles (Bowman et al., Development
112:1-20, 1991), including the complete absence of petals and the
transformation of sepals to carpels. This ap2-like phenotype is
only observed in EAT-D homozygotes, whereas both EAT-D
heterozygotes and homozygotes are early flowering, indicating that
the flowering time phenotype is more sensitive to EAT-D dosage than
the ap2-like floral phenotype.
1TABLE 1 Rosette leaf numbers for Arabidopsis lines Genotype
rosette leaf no. floral phenotype Col-0 11.4 +/- 1.2 wild type
EAT-D 3.1 +/- 0.8 ap2 EAT-OX 2.0 +/- 0.2 ap2 + additional eatdel
11.1 +/- 1.1 wild type miR172a1-OX 2.1 +/- 0.3 ap2 + additional
LAT-D 22.5 +/- 2.1 wild type At2g28550-OX 28.6 +/- 3.6 wild type
5-60120 10.2 +/- 1.4 wild type 2-28550 8.7 +/- 0.6 wild type
5-60120; 2-28550 6.0 +/- 0.8 wild type
[0135] We mapped the activation-tagged T-DNA insert in EAT-D to
chromosome 5, in between the annotated genes At5g04270 and
At5g04280. We then used 5'- and 3'-RACE PCR with primers located
within this region to identify a 1.4 kb transcript (SEQ ID NO: 1),
which we named EAT, that is upregulated in EAT-D. When the 1.4 kb
EAT cDNA was fused to the constitutive CAMV 35S promoter and the
resultant 35S::EAT construct was introduced into wild type (Col-0)
plants by Agrobacterium-mediated transformation (Clough and Bent,
Plant J. 16:735-743 1998), the 35S::EAT transformants displayed the
identical early-flowering and ap2-like phenotypes seen for EAT-D
(Table 1). Many of the 35S::EAT transformants occasionally
displayed additional defects, including stigmatic papillae on
cauline leaf margins and the formation of a complete or partial
flower rather than a secondary inflorescence in the axils of
cauline leaves. Ectopic expression of the EAT gene in 35S::EAT
plants, therefore, affects both flowering time and the
specification of floral organ identity.
[0136] The EAT gene produces a 1417-nucleotide noncoding RNA that
is predicted to be 5'-capped and polyadenylated, based on our
RACE-PCR methodology. BLASTN and BLASTX searches of several
databases with the EAT cDNA did not reveal extensive nucleotide or
predicted amino acid sequence identity between EAT and any other
gene. We did, however, identify a 21-nucleotide (nt) (SEQ ID NO: 4)
stretch in the middle of the EAT transcript that is identical to
miR172a-2, a recently identified mRNA (Park et al., Curr. Biol.
12:1484-1495, 2002). To confirm the functional importance of the
miR172a-2 sequence within the EAT cDNA, we generated a mutant form
of EAT in which the miR172a-2 sequence was deleted, and made a
construct consisting of this mutant EAT cDNA, eatdel, driven by the
35S promoter. Transgenic plants carrying this 35S::eatdel construct
flowered with the same number of leaves as wild-type and had normal
flowers (Table 1), indicating that the miR172a-2 sequence is
necessary to confer both the flowering time and floral organ
identity phenotypes seen in EAT-overexpressing lines.
[0137] As noted by Park et al. (Curr. Biol. 12:1484-1495, 2002),
the 21-nt miR172a-2 mRNA has the potential to form an RNA duplex
with a sequence near the 3' end of the coding region of AP2 (Table
2).
2TABLE 2 Putative 21-nt miR172a-2/AP2 RNA duplex Sequence Duplex
SEQ ID NO: AP2 RNA 5'-CUGCAGCAUCAUCAGGAUUCU-3' 47 EAT miRNA
3'-UACGUCGUAGUAGUUCUAAGA-5' 48 The GU wobble in the duplex is
underlined.
[0138] This particular region of the AP2 gene is poorly conserved
at the nucleotide level among the AP2 family; nevertheless, the AP2
sequence (SEQ ID NO: 49) that is complementary to miR172a-2 is
found in a similar location in three other Arabidopsis AP2 family
members, At5g60120 (SEQ ID NO: 50), At2g28550 (SEQ ID NO: 51),
At5g67180 (SEQ ID NO: 52). In addition, the sequence can be found
at the corresponding positions of the maize AP2 genes indeterminate
spikelet1 (Chuck et al., Genes. Dev. 12:1145-1154 1998) (IDS1 (SEQ
ID NO: 53)) and glossy15 (Moose and Sisco, Genes. Dev. 10:3018-3027
1996) (GL15 (SEQ ID NO: 54)), and in AP2 family members from many
other plant species, including soybean, rice, wheat, tomato and pea
(not shown). The alignment of three Arabidopsis and two maize AP2
family members is shown in Table 3 below.
3TABLE 3 Alignment of AP2 21-nt region (black bar) and surrounding
sequence AP2 ACCAAGTGTTGACAAATG{overscore
(CTGCAGCATCATCAGGATTCT)}CTCCTCATCATCACAATCAG At5g60120
CACCGGCACTGTTTTCAAATGCAGCATCATCAGGATTCTCACTCTC- AGCTACACGCCCT
At2g28550 CACCATTGTTCTCAGTTGCAGCAGCATCATCAGG-
ATTCTCACATTTCCGGCCACAACCT At5g67180
GAAATCGAGTGGTGGGAATGGCAGCATCATCAGGATTCTCTCCTCAACCTTCCCCTTAC IDS1
ACGTGCGGTTGCACCACTCTGCAGCATCATCAGGATTCTGTACCGCCGCCGGGGCCAAC GL15
ACGCCAGCAGCGCCGCCGCTGCAGCATCATCAGGATTCCCACTGTGGCAGCTGGGTGCG
[0139] There is an additional copy of the miR172a-2 mRNA in the
Arabidopsis genome on chromosome 2 (miR172a-1, FIG. 2d), and
miR172a-2 is highly similar to three other Arabidopsis loci. Like
the miR172a-2 mRNA, all four reiterations of the sequence are in
intergenic regions, i.e. in between the Arabidopsis genes currently
annotated in GenBank. In addition, the sequence is found in ESTs
from tomato, potato and soybean, and four copies were found in the
genomic sequence of rice.
Example 2
[0140] This Example Describes the Construction of Expression
Vectors
[0141] To overexpress the EAT gene, we designed primers containing
XhoI sites (SEQ ID NO: 55 5'-GACTACTCGAGCACCTCTCACTCCCTTTCTCTAAC-3'
and SEQ ID NO: 56 5'-GACTACTCGAGGTTCTCAAGTTGAGCACTTGAAAAC-3') to
amplify the entire EAT gene from Col-0 DNA. The PCR product was
digested with XhoI and inserted into a modified pBluescriptSK+
vector (Stratagene, La Jolla, Calif.) that lacked BamHI and HindIII
sites, to generate EATX4 (SEQ ID NO: 44). To generate the 35S::EAT
transformants, the XhoI-cut EAT gene was inserted into the binary
vector pBE851 in between a CAMV 35S promoter and b-phaseolin
terminator, and Col-0 was transformed by floral dip. To generate
the eatdel construct, two oligonucleotides were synthesized (SEQ ID
NO: 57 5' GATCCATGGAAGAAAGCTCATCTGTCGTTGTTTGTAGGCGCAGCACCATTAAGA
TTCACATGGAAATTGATAAATAC-3' and SEQ ID NO: 58
5'-CCTAAATTAGGGTTTTGATATGTAT- ATTCAACAATCGACGGCTACAAATACCTAA-3')
that completely recreated the BamHI/HindIII fragment of the EAT
cDNA except that it lacked the 21 nt miR172a-2 sequence located
within the fragment. These two oligos were annealed to their
synthesized complementary strands (SEQ ID NO: 59
5'-TAGGGTATTTATCAATTTCCATGTGAATCTTAATGGTGCTGCGCCTACAAACAAC
GACAGATGAGCTTTCTTCCATG-3' and SEQ ID NO: 60
5'-AGCTTTAGGTATTTGTAGCCGTCGAT- TGTTGAATATACATATCAAAACCCTAATT-3')
and ligated to EATX4 that had been digested with BamHI and HindIII,
in a trimolecular ligation reaction. This resulted in the
replacement of 159 bp of wild-type EAT sequence with the 138 bp
mutant sequence. The eatdel cDNA was then subcloned into pBE851 and
transformed as described above. BASTA was used to select in plants
for both the EAT and eatdel overexpression constructs.
[0142] To test whether another member of the miR172 family,
miR172a-1, would confer a phenotype similar to that of miR172a-2,
we generated a construct containing the .sup.35S promoter fused to
the genomic region surrounding miR172a-1. Plants containing the
35S::miR172a-1 construct flowered early and displayed an ap2
phenotype (Table 1), indicating that miR172a-1 behaves in an
identical manner to miR172a-2 when overexpressed.
[0143] All of the miR172 mRNA family members are located within a
sequence context that allows an RNA hairpin to form (FIG. 1).
Presumably this hairpin is the substrate which is subsequently
cleaved by a plant Dicer homolog to generate the mature mRNA. The
location of the mRNA within the hairpin, i.e. on the 3' side of the
stem, is conserved amongst all the members of the miR172 family,
and this may reflect a structural requirement for processing of
this particular mRNA family. The 21-nt miR172a-2 mRNA, therefore,
is predicted to be a member of a family of mRNAs that have the
capacity to regulate a subset of AP2 genes by forming an RNA duplex
with a 21-nt cognate sequence in these genes.
Example 3
[0144] The Example Describes the Analysis of microRNA Expression
and AP2 Expression
[0145] Total RNA was isolated from wild type and EAT-D whole plants
that had already flowered, using TRIZOL reagent (Sigma). 50 mg of
each RNA was subjected to electrophoresis on a 15% TBE-Urea
Criterion gel (BioRad), electroblotted onto Hybond-N+ filter paper
(Amersham) using a TransBlot-SD apparatus (BioRad). The filter was
then hybridized at 37.degree. C. overnight in UltraHyb-Oligo buffer
(Ambion) with 32P-labeled oligos. The oligos were 30-mers that
corresponded to either the sense or antisense strands of the
miR172a-2 mRNA, with 4-5 nt of flanking sequence on each side. The
filter was washed twice at 37.degree. C., in buffer containing
2.times.SSC and 0.5% SDS. For S1 analysis, probe was made by
end-labeling an oligo (SEQ ID NO: 61) (5'-ATGCAGCATCATCAAGATT-
CTCATATACAT-3') with T4 polynucleotide kinase and 32P.
Hybridization and processing of S1 reactions were carried out using
standard protocols. For developmental analysis of miR172a-2 and
miR172a-1, total RNA was isolated from plants at the various stages
and tissues indicated in Example 4, using an Rneasy kit (Qiagen).
RT-PCR was carried out using standard protocols, and utilized
oligos specific for sequences adjacent to miR172a-2 (SEQ ID NO: 62)
(5'-GTCGGCGGATCCATGGAAGAAAGCTCATC-3' and (SEQ ID NO: 63)
5'-CAAAGATCGATCCAGACTTCAATCAATATC-3') or sequences adjacent to
miR172a-1 (SEQ ID NO: 64) (5'-TAATTTCCGGAGCCACGGTCGTTGTTG-3' and
(SEQ ID NO: 65) 5'-AATAGTCGTTGATTGCCGATGCAGCATC-3'). Oligos used to
amplify the ACT11 (Actin) transcript were: (SEQ ID NO: 66)
5'-ATGGCAGATGGTGAAGACATTCA- G-3', and (SEQ ID NO: 67)
5'-GAAGCACTTCCTGTGGACTATTGATG-3'. RT-PCR analysis of AP2 was
performed on RNA from floral buds, and utilized the following
oligos: (SEQ ID NO: 68) 5'-TTTCCGGGCAGCAGCAACATTGGTAG-3', and (SEQ
ID NO: 69) 5'-GTTCGCCTAAGTTAACAAGAGGATTTAGG-3'. Oligos used to
amplify the ANT transcript were: (SEQ ID NO: 70)
5'-GATCAACTTCAATGACTAACT- CTGGTTTTC-3', and (SEQ ID NO: 71)
5'-GTTATAGAGAGATTCATTCTGTTTCACATG-3'.
[0146] Immunoblot analysis of AP2 was performed on proteins
extracted from floral buds. Following electrophoresis on a 10%
SDS-PAGE gel, proteins were transferred to a Hybond-P membrane
(Amersham) and incubated with an antibody specific for AP2 protein
(aA-20, Santa Cruz Biotechnology). The blot was processed using an
ECL-plus kit (Amersham).
[0147] Northern analysis using probes both sense and antisense to
the miR172a-2 mRNA identified a small single-stranded RNA of 21-25
nucleotides accumulating too much higher levels in EAT-D mutant
plants relative to wild type. The small amount of transcript seen
in wild type presumably represents endogenous levels of not only
the miR172a-2 mRNA but also its family members, which are similar
enough to cross-hybridize with the probe. The predicted miR172a-2
hairpin is 117 nt in length (FIG. 1), a small amount of an
.about.100 nt transcript accumulating is detected in EAT-D, this
likely represents partially processed miR172a-2 hairpin precursor.
S1 nuclease mapping of the miR172a-2 mRNA provides independent
confirmation of the 5' end of miR172a-2 reported by Park et al.
(Curr. Biol. 12:1484-1495, 2002).
Example 4
[0148] The Example Describes the Developmental Pattern of EAT mRNA
Expression.
[0149] To address the wild-type expression pattern of miR172a-2
separate from its other Arabidopsis family members, RT-PCR was used
to specifically detect a fragment of the 1.4 kb EAT full-length
precursor transcript containing miR172a-2. EAT precursor transcript
expression is temporally regulated, with little or no transcript
detected two days after germination, and progressively more
steady-state transcript accumulation seen as the plant approaches
flowering. The precursor transcript of miR172a-1 showed a similar
temporal pattern of expression. Both miR172a-2 and miR172a-1
precursor transcripts continue to be expressed after flowering has
occurred, and accumulate in both leaves and floral buds. We were
unable to detect expression of the precursors for the other miR172
family members, perhaps due to their exclusive expression in tissue
types not included in this analysis, or because their precursor
transcripts are too transient to detect. The temporal expression
pattern seen for miR172a-2 and miR172a-1 is reminiscent of that
observed for let-7 and lin-4, two mRNAs that control developmental
timing in C. elegans (Feinbaum and Ambros, Dev. Biol. 210:87-95
1999; Reinhart et al., Nature 403:901-906 2000).
Example 5
[0150] We assessed the levels of miR172 in various flowering time
mutants, in an attempt to position miR172 within the known
flowering time pathways. The levels of miR172 were not altered in
any of the mutants tested, and the levels of the EAT transcript
were identical in plants grown in long days versus plants grown in
short days.
Example 6
[0151] The Example Describes Evaluation of Protein Expression
[0152] Immunoblot analysis indicates that AP2 protein is reduced
3.5-fold in the EAT-D mutant relative to wild type, whereas the AP2
transcript is unaffected. This data suggests that the miR172a-2
mRNA negatively regulates AP2 by translational inhibition. The
predicted near-perfect complementarity between the miR172a-2 mRNA
and the AP2 target site would be predicted to trigger AP2 mRNA
cleavage by the RNA interference (RNAi) pathway (Llave et al.,
Plant Cell 14:1605-1619 2002; Hutvagner and Zamore, Science
297:2056-2060 2002). Indeed, others have proposed that many plant
mRNAs enter the RNAi pathway exclusively due to their near-perfect
complementarity to putative targets (Rhoades et al., Cell
110:513-520 2002). While there is no evidence regarding the GU
wobble base pair in the predicted miR172a-2/AP2 RNA duplex, it is
conserved in all predicted duplexes between miR172 family members
and their AP2 targets. Regardless of the mechanism, it is apparent
from the AP2 expression data and the observed phenotype of EAT-D
that AP2 is a target of negative regulation by miR172a-2, at least
when miR172a-2 is overexpressed.
Example 7
[0153] In the same genetic screen that identified the
early-flowering EAT-D mutant, we identified an activation-tagged
late-flowering mutant, called LAT-D. The LAT-D mutant displays no
additional phenotypes besides late flowering (Table 1), and the
late-flowering phenotype cosegregated with a single T-DNA
insertion. Sequence analysis of the T-DNA insert in LAT-D indicated
that the 4.times. 35S enhancer was located approximately 5 kb
upstream of At2g28550, which is one of the AP2-like target genes
that are potentially regulated by miR172. RT-PCR analysis using
primers specific for At2g28550 indicates that the transcript
corresponding to this gene is indeed expressed at higher levels in
the LAT-D mutant relative to wild type. To confirm that
overexpression of At2g28550 causes late flowering, we fused a
genomic region containing the entire At2g28550 coding region (from
start to stop codon) to the 35S promoter, and created transgenic
plants containing this construct. Transgenic 35S::At2g28550 plants
flowered later than wild type plants, and were slightly later than
the LAT-D mutant (Table 1). This late flowering phenotype was
observed in multiple independent transformants.
[0154] The fact that overexpression of At2g28550 causes late
flowering suggests that miR172 promotes flowering in part by
downregulating At2g28550. However, because miR172 appears to affect
protein rather than transcript accumulation of its target genes,
and because we do not have an antibody to the At2g28550 gene
product, we decided to test this regulation indirectly via a
genetic cross. A plant heterozygous for LAT-D was crossed to a
plant homozygous for EAT-D, such that all F1 progeny would contain
one copy of EAT-D and 50% of the F1 progeny would also have one
copy of LAT-D. F1 progeny were scored for the presence or absence
of the LAT-D allele by PCR, and also were scored for flowering
time. All of the F1 plants were early flowering, regardless of
whether or not they contained a copy of the LAT-D allele,
indicating that EAT-D is epistatic to LAT-D. This result is
consistent with the idea that miR172a-2, which is overexpressed in
EAT-D, directly downregulates At2g28550, which is overexpressed in
LAT-D.
Example 8
[0155] To assess the effects of reducing At2g28550 function, we
identified plants containing a T-DNA insertion in the At2g28550
gene. In addition, we identified a T-DNA mutant for At2g60120, a
closely related AP2-like gene that also contains the miR172 target
sequence. Plants homozygous for either the At2g28550 insert or the
At5g60120 insert were slightly early flowering relative to wild
type (Table 1). The two mutants were crossed, and the double mutant
was isolated by PCR genotyping. The At2g28550/At5g60120 double
mutant was earlier flowering than either individual mutant (Table
1), suggesting that the genes have overlapping function. The early
flowering phenotype of the At2g28550/At5g60120 double mutant is
consistent with the idea that the early flowering phenotype of
miR172-overexpressing lines is due to downregulation of several
AP2-like genes, including At2g28550 and At5g60120. Interestingly,
the At2g28550/At5g60120 double mutant is not as early as
miR172-overexpressing lines (c.f. EAT-OX, Table 1), which suggests
that other AP2-like targets of miR172, for example AP2 itself or
At5g67180, also contribute to flowering time control. Because ap2
mutants are not early flowering, any potential negative regulation
of flowering by AP2 must be normally masked by genetic
redundancy.
Example 9
[0156] This example describes a method of target selection and
method to design DNA constructs to generate mRNAs using the
constructs of SEQ ID NOS: 3 and 44. Any sequence of interest can be
selected for silencing by mRNA generated using the following
method:
[0157] 1. Choose a region from the coding strand in a gene of
interest to be the target sequence. Typically, choose a region of
about 10-50 nucleotides found in a similar location to the region
targeted by EAT in AP2-like genes, which are regions about 100 nt
upstream of the stop codon. The exact location of the target,
however, does not appear to be critical. It is recommended to
choose a region that has .about.50% GC and is of high sequence
complexity, i.e. no repeats or long polynucleotide tracts. It is
also recommended that the chosen region ends with a T or A, such
that the complementary mRNA will start with an A or U. This is to
help ensure a lower stability at the 5' end of the mRNA in its
double-stranded Dicer product form (Schwartz, et al. 2003 Cell
115:199-208). For example, in the miR172a-2 precursor, the mRNA
sequence starts with an A, and many other mRNAs start with a U.
[0158] 2. To use the construct of SEQ ID NO: 3, create a 21
nucleotide sequence complementary to the 21 nt target region
(mRNA). Optionally, change a C in the mRNA to a T, which will
generate a GU wobble with the target sequence, which mimics the GU
wobble seen in EAT.
[0159] 3. Create the 21 nucleotide "backside" sequence of the
hairpin. This will be substantially complementary to the mRNA from
step 2. Note, this backside sequence will also be substantially
identical to the target sequence. Typically, introduce a few
mismatches to make some bulges in the stem of the hairpin that are
similar to the bulges in the original EAT hairpin. Optionally,
introduce an A at the 3' end of the backside, to create mismatch at
the 5' end of the mRNA. This last step may help ensure lower
stability at the 5' end of the mRNA in its double-stranded Dicer
product form (Schwartz, et al. 2003 Cell 115:199-208).
[0160] 4. Replace the 21 nucleotide mRNA sequence and the 21
nucleotide "backside" sequence in the EAT BamHI/HindIII DNA
construct (SEQ ID NO: 3) with the new mRNA and "backside" sequences
from steps 2 and 3.
[0161] 5. Use MFOLD (GCG, Accelrys, San Diego, Calif.), or an
equivalent program, to compare the new hairpin from Step 4 with the
original hairpin. Generally, the sequence substantially replicate
the structure of the original hairpin (FIG. 1). It is predicted
that the introduced bulges need not be exactly identical in length,
sequence or position to the original. Examine the mRNA sequence in
the hairpin for the relative stability of the 5' and 3' ends of the
predicted dsRNA product of Dicer.
[0162] 6. Generate four synthetic oligonucleotides of 76-77
nucleotides in length to produce two double-stranded fragments
which comprise the BamHI and HindIII restriction sites, and a 4
nucleotide overhang to facilitate directional ligation which will
recreate the BamHI/HindIII fragment. Design of the overhang can be
done by one of skill in the art, the current example uses the 4
nucleotide region of positions 79-82 (CCTA) of SEQ ID NO: 3. Hence,
for example:
[0163] Oligo 1 will have an unpaired BamHI site at the 5' end, and
will end with the nucleotide at position 78 of SEQ ID NO: 3.
[0164] Oligo 2 will have the nucleotides of position 79-82 (CCTA)
unpaired at the 5' end, and will terminate just before the HindIII
site (or positions 151-154 in SEQ ID NO: 3).
[0165] Oligo 3 will be essentially complementary to Oligo 1,
(nucleotides 5-78 of SEQ ID NO: 3), and will terminate with 4
nucleotides complementary to nucleotides 14 (CCTA) of Oligo 2.
[0166] Oligo 4 will be essentially complementary to Oligo 2
beginning at the nucleotide of position 5, and will terminate with
the HindIII site at the 3' end.
[0167] Anneal the oligonucleotides to generate two fragments to be
used in a subsequence ligation reaction with the plasmid
sequence.
[0168] Optionally, two synthetic oligonucleotides comprising attB
sequences can be synthesized and annealed to create an attB-flanked
mRNA precursor that is then integrated into a vector using
recombinational cloning (GATEWAY, InVitrogen Corp., Carlsbad,
Calif.).
[0169] 7. Ligate the two DNA fragments from Step 6 in a
trimolecular ligation reaction with a plasmid cut with
BamHI/HindIII. The current example uses the modified pBluescript
SK+ plasmid of SEQ ID NO: 44, which comprises the 1.4 kb EAT
sequence of SEQ ID NO: 1, digested with BamHI/HindIII and gel
purified away from the small fragment using standard molecular
biological techniques. The new designed mRNA to the gene of
interest has replaced the previous mRNA.
[0170] If an attB-flanked sequence is used from Step 6, the BP and
LR recombination reactions (GATEWAY, InVitrogen Corp., Carlsbad,
Calif.) can be used to insert the modified hairpin into a
destination vector comprising the full-length miR172a-2
precursor.
[0171] 8. The plasmid from Step 7, subject to any other
preparations or modifications as needed, is used to transform the
target organism using techniques appropriate for the target.
[0172] 9. Silencing of the target gene can be assessed using
techniques well-known in the art, for example, Northern blot
analysis, immunoblot analysis if the target gene of interest
encodes a polypeptide, and any phenotypic screens relevant to the
target gene, for example flowering time, or floral morphology.
Example 10
[0173] Described in this example are methods one may use for
introduction of a polynucleotide or polypeptide into a plant
cell.
[0174] A. Maize Particle-Mediated DNA Delivery
[0175] A DNA construct can be introduced into maize cells capable
of growth on suitable maize culture medium. Such competent cells
can be from maize suspension culture, callus culture on solid
medium, freshly isolated immature embryos or meristem cells.
Immature embryos of the Hi-II genotype can be used as the target
cells. Ears are harvested at approximately 10 days
post-pollination, and 1.2-1.5 mm immature embryos are isolated from
the kernels, and placed scutellum-side down on maize culture
medium.
[0176] The immature embryos are bombarded from 18-72 hours after
being harvested from the ear. Between 6 and 18 hours prior to
bombardment, the immature embryos are placed on medium with
additional osmoticum (MS basal medium, Musashige and Skoog, 1962,
Physiol. Plant 15:473-497, with 0.25 M sorbitol). The embryos on
the high-osmotic medium are used as the bombardment target, and are
left on this medium for an additional 18 hours after
bombardment.
[0177] For particle bombardment, plasmid DNA (described above) is
precipitated onto 1.8 mm tungsten particles using standard
CaCl2-spermidine chemistry (see, for example, Klein et al., 1987,
Nature 327:70-73). Each plate is bombarded once at 600 PSI, using a
DuPont Helium Gun (Lowe et al., 1995, Bio/Technol 13:677-682). For
typical media formulations used for maize immature embryo
isolation, callus initiation, callus proliferation and regeneration
of plants, see Armstrong, C., 1994, In "The Maize Handbook", M.
Freeling and V. Walbot, eds. Springer Verlag, NY, pp 663-671.
[0178] Within 1-7 days after particle bombardment, the embryos are
moved onto N6-based culture medium containing 3 mg/l of the
selective agent bialaphos. Embryos, and later callus, are
transferred to fresh selection plates every 2 weeks. The calli
developing from the immature embryos are screened for the desired
phenotype. After 6-8 weeks, transformed calli are recovered.
[0179] B. Soybean Transformation
[0180] Soybean embryogenic suspension cultures are maintained in 35
ml liquid media SB196 or SB172 in 250 ml Erlenmeyer flasks on a
rotary shaker, 150 rpm, 26 C with cool white fluorescent lights on
16:8 hr day/night photoperiod at light intensity of 30-35 uE/m2s.
Cultures are subcultured every two weeks by inoculating
approximately 35 mg of tissue into 35 ml of fresh liquid media.
Alternatively, cultures are initiated and maintained in 6-well
Costar plates.
[0181] SB 172 media is prepared as follows: (per liter), 1 bottle
Murashige and Skoog Medium (Duchefa # M 0240), 1 ml B5 vitamins
1000.times. stock, 1 ml 2,4-D stock (Gibco 11215-019), 60 g
sucrose, 2 g MES, 0.667 g L-Asparagine anhydrous (GibcoBRL
11013-026), pH 5.7. SB 196 media is prepared as follows: (per
liter) 1 0 ml MS FeEDTA, 10 ml MS Sulfate, 10 ml FN-Lite Halides,
10 ml FN-Lite P, B, Mo, 1 ml B5 vitamins 1000.times. stock, 1 ml
2,4-D, (Gibco 11215-019), 2.83 g KNO3, 0.463 g (NH4).sub.2SO4, 2 g
MES, 1 g Asparagine Anhydrous, Powder (Gibco 11013-026), 10 g
Sucrose, pH 5.8. 2,4-D stock concentration 10 mg/ml is prepared as
follows: 2,4-D is solubilized in 0.1 N NaOH, filter-sterilized, and
stored at -20.degree. C. B5 vitamins 1000.times. stock is prepared
as follows: (per 100 ml)-store aliquots at -20.degree. C., 10 g
myo-inositol, 100 mg nicotinic acid, 100 mg pyridoxine HCl, 1 g
thiamin.
[0182] Soybean embryogenic suspension cultures are transformed with
various plasmids by the method of particle gun bombardment (Klein
et al., 1987 Nature 327:70. To prepare tissue for bombardment,
approximately two flasks of suspension culture tissue that has had
approximately 1 to 2 weeks to recover since its most recent
subculture is placed in a sterile 60.times.20 mm petri dish
containing 1 sterile filter paper in the bottom to help absorb
moisture. Tissue (i.e. suspension clusters approximately 3-5 mm in
size) is spread evenly across each petri plate. Residual liquid is
removed from the tissue with a pipette, or allowed to evaporate to
remove excess moisture prior to bombardment. Per experiment, 4-6
plates of tissue are bombarded. Each plate is made from two
flasks.
[0183] To prepare gold particles for bombardment, 30 mg gold is
washed in ethanol, centrifuged and resuspended in 0.5 ml of sterile
water. For each plasmid combination (treatments) to be used for
bombardment, a separate micro-centrifuge tube is prepared, starting
with 50 .mu.l of the gold particles prepared above. Into each tube,
the following are also added; 5 .mu.l of plasmid DNA (at 1
.mu.g/.mu.l), 50 .mu.l CaCl2, and 20 .mu.l 0.1 M spermidine. This
mixture is agitated on a vortex shaker for 3 minutes, and then
centrifuged using a microcentrifuge set at 14,000 RPM for 10
seconds. The supernatant is decanted and the gold particles with
attached, precipitated DNA are washed twice with 400 .mu.l aliquots
of ethanol (with a brief centrifugation as above between each
washing). The final volume of 100% ethanol per each tube is
adjusted to 40 .mu.l, and this particle/DNA suspension is kept on
ice until being used for bombardment.
[0184] Immediately before applying the particle/DNA suspension, the
tube is briefly dipped into a sonicator bath to disperse the
particles, and then 5 .mu.L of DNA prep is pipetted onto each
flying disk and allowed to dry. The flying disk is then placed into
the DuPont Biolistics PDS1000/HE. Using the DuPont Biolistic
PDS1000/HE instrument for particle-mediated DNA delivery into
soybean suspension clusters, the following settings are used. The
membrane rupture pressure is 1100 psi. The chamber is evacuated to
a vacuum of 27-28 inches of mercury. The tissue is placed
approximately 3.5 inches from the retaining/stopping screen (3rd
shelf from the bottom). Each plate is bombarded twice, and the
tissue clusters are rearranged using a sterile spatula between
shots.
[0185] Following bombardment, the tissue is re-suspended in liquid
culture medium, each plate being divided between 2 flasks with
fresh SB196 or SB172 media and cultured as described above. Four to
seven days post-bombardment, the medium is replaced with fresh
medium containing a selection agent. The selection media is
refreshed weekly for 4 weeks and once again at 6 weeks. Weekly
replacement after 4 weeks may be necessary if cell density and
media turbidity is high.
[0186] Four to eight weeks post-bombardment, green, transformed
tissue may be observed growing from untransformed, necrotic
embryogenic clusters. Isolated, green tissue is removed and
inoculated into 6-well microtiter plates with liquid medium to
generate clonally-propagated, transformed embryogenic suspension
cultures.
[0187] Each embryogenic cluster is placed into one well of a Costar
6-well plate with 5 mls fresh SB196 media with selection agent.
Cultures are maintained for 2-6 weeks with fresh media changes
every 2 weeks. When enough tissue is available, a portion of
surviving transformed clones are subcultured to a second 6-well
plate as a back-up to protect against contamination.
[0188] To promote in vitro maturation, transformed embryogenic
clusters are removed from liquid SB196 and placed on solid agar
media, SB 166, for 2 weeks. Tissue clumps of 2-4 mm size are plated
at a tissue density of 10 to 15 clusters per plate. Plates are
incubated in diffuse, low light (<10 .mu.E) at 26+/-1.degree. C.
After two weeks, clusters are subcultured to SB 103 media for 3-4
weeks.
[0189] SB 166 is prepared as follows: (per liter), 1 pkg. MS salts
(Gibco/BRL-Cat# 111117-017), 1 ml B5 vitamins 1000.times. stock, 60
g maltose, 750 mg MgCl2 hexahydrate, 5 g activated charcoal, pH
5.7, 2 g gelrite. SB 103 media is prepared as follows: (per liter),
1 pkg. MS salts (Gibco/BRL-Cat# 11117-017), 1 ml B5 vitamins
1000.times. stock, 60 g maltose, 750 mg MgCl2 hexahydrate, pH 5.7,
2 g gelrite. After 5-6 week maturation, individual embryos are
desiccated by placing embryos into a 100.times.15 petri dish with a
1 cm2 portion of the SB103 media to create a chamber with enough
humidity to promote partial desiccation, but not death.
[0190] Approximately 25 embryos are desiccated per plate. Plates
are sealed with several layers of parafilm and again are placed in
a lower light condition. The duration of the desiccation step is
best determined empirically, and depends on size and quantity of
embryos placed per plate. For example, small embryos or few
embryos/plate require a shorter drying period, while large embryos
or many embryos/plate require a longer drying period. It is best to
check on the embryos after about 3 days, but proper desiccation
will most likely take 5 to 7 days. Embryos will decrease in size
during this process.
[0191] Desiccated embryos are planted in SB 71-1 or MSO medium
where they are left to germinate under the same culture conditions
described for the suspension cultures. When the plantlets have two
fully-expanded trifoliate leaves, germinated and rooted embryos are
transferred to sterile soil and watered with MS fertilizer. Plants
are grown to maturity for seed collection and analysis. Healthy,
fertile transgenic plants are grown in the greenhouse.
[0192] SB 71-1 is prepared as follows: 1 bottle Gamborg's B5 salts
w/sucrose (Gibco/BRL-Cat# 21153-036),10 g sucrose, 750 mg MgCl2
hexahydrate, pH 5.7, 2 g gelrite. MSO media is prepared as follows:
1 pkg Murashige and Skoog salts (Gibco 11117-066), 1 ml B5 vitamins
1000.times. stock, 30 g sucrose, pH 5.8, 2 g Gelrite.
Example 11
[0193] This example describes the design and synthesis of mRNA
targets and hairpins directed to various gene targets found in
maize, soy, and/or Arabidopsis, using the method described in
Example 9.
[0194] A. Targeting Arabidopsis AGAMOUS, At4g18960
[0195] The mRNA sequence of SEQ ID NO: 4 was selected and designed.
The sequence is put into the BamHI/HindIII hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 12-15, and
ligating them into the BamHI/HindIII backbone fragment of SEQ ID
NO: 44.
[0196] Arabidopsis thaliana Col-0 was transformed and grown as
described in Example 1. After transformation with a vector
comprising the mRNA of SEQ ID NO: 4, 88% of the transformants
exhibited a mutant AGAMOUS (ag) floral phenotype, characterized by
the conversion of stamens to petals in whorl 3, and carpels to
another ag flower in whorl 4 (Bowman, et al. (1991) The Plant Cell
3:749-758). The mutant phenotype varied between transformants, with
approximately {fraction (1/3)} exhibiting a strong ag phenotype,
1/3 exhibiting an intermediate ag phenotype, and 1/3 exhibiting a
weak ag phenotype. Gel electrophoresis and Northern Blot analysis
of small RNAs isolated from the transformants demonstrated that the
degree of the mutant ag phenotype was directly related to the level
of antiAG mRNA, with the strongest phenotype having the highest
accumulation of the processed mRNA (.about.21 nt).
[0197] B. Targeting Arabidopsis Apetela3 (AP3), At3g54340
[0198] Two mRNA targets from AP3 were selected and oligonucleotides
designed.
[0199] The mRNA sequence of SEQ ID NO: 5 was selected and designed.
The sequence is put into the BamHI/HindIII hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 16-19, and
ligating them into the BamHI/HindIII backbone fragment of SEQ ID
NO: 44.
[0200] The mRNA sequence of SEQ ID NO: 6 was selected and designed.
The sequence is put into the BamHI/HindIII hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and
ligating them into the BamHI/HindIII backbone fragment of SEQ ID
NO: 44.
[0201] Arabidopsis thaliana Col-0 was transformed and grown as
described in Example 1. After transformation with a vector
comprising the mRNA of SEQ ID NO: 5, the transformants had novel
leaf and floral phenotypes, but did not exhibit any mutant AP3
phenotype. Gel electrophoresis and Northern analysis of RNA
isolated from 2 week old rosette leaf tissue from the transformants
demonstrated that the highest accumulation of the processed mRNA
(.about.21 nt) corresponded to the "backside" strand of the
precursor, which evidently silenced a different target sequence to
produce the novel leaf and floral phenotypes.
[0202] A new target sequence was selected, with the correct
asymmetry in order for the mRNA target strand to be selected during
incorporation into RISC (Schwartz et al., 2003, Cell 115:199-208).
The mRNA sequence of SEQ ID NO: 6 was selected and designed. The
sequence is put into the BamHI/HindIII hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and
ligating them into the BamHI/HindIII backbone fragment of SEQ ID
NO: 44. Greater than 90% of the transformants showed silencing for
the AP3 gene, as demonstrated by floral phenotype and
electrophoretic analysis. An approximately 21 nt mRNA (antiAP3b)
was detected at high levels in the transgenic plants, and not in
wild type control plants. RT-PCR analysis confirmed that the amount
of AP3 transcript was reduced in the transformants, as compared to
wild type control plants.
[0203] C. Targeting Maize Phytoene Desaturase
[0204] Two mRNA targets from phytoene desaturase (PDS) were
selected and oligonucleotides designed.
[0205] The mRNA sequence of SEQ ID NO: 7 was selected and designed.
The sequence is put into the BamHI/HindIII hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 24-27, and
ligating them into the BamHI/HindIII backbone fragment of SEQ ID
NO: 44.
[0206] The mRNA sequence of SEQ ID NO: 8 was selected and designed.
The sequence is put into the BamHI/HindIII hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 28-31, and
ligating them into the BamHI/HindIII backbone fragment of SEQ ID
NO: 44.
[0207] D. Targeting Maize Phytic Acid Biosynthetic Enzymes
[0208] Three maize phytic acid biosynthetic enzyme gene targets
were selected and mRNA and oligonucleotides designed. Inositol
polyphosphate kinase-2 polynucleotides are disclosed in WO
02/059324, herein incorporated by reference. Inositol
1,3,4-trisphosphate 5/6-kinase polynucleotides are disclosed in WO
03/027243, herein incorporated by reference. Myo-inositol
1-phosphate synthase polynucleotides are disclosed in WO 99/05298,
herein incorporated by reference.
[0209] Inositol Polyphosphate Kinase-2 (IPPK2)
[0210] The mRNA sequence of SEQ ID NO: 9 was selected and designed.
The sequence is put into the BamHI/HindIII hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 32-35, and
ligating them into the BamHI/HindIII backbone fragment of SEQ ID
NO: 44.
[0211] Inositol 1,3,4-trisphosphate 5/6-kinase-5 (ITPK5)
[0212] The mRNA sequence of SEQ ID NO: 10 was selected and
designed. The sequence is put into the BamHI/HindIII hairpin
cassette by annealing the synthetic oligonucleotides of SEQ ID NOS:
36-39, and ligating them into the BamHI/HindIII backbone fragment
of SEQ ID NO: 44.
[0213] Myo-Inositol 1-phosphate Synthase (mi1ps)
[0214] The mRNA sequence of SEQ ID NO: 11 was selected and
designed. The sequence is put into the BamHI/HindIII hairpin
cassette by annealing the synthetic oligonucleotides of SEQ ID NOS:
40-43, and ligating them into the BamHI/HindIII backbone fragment
of SEQ ID NO: 44.
[0215] E. Targeting Soy Apetela2-Like Sequences (AP2)
[0216] The same EAT (miR172a-2) construct, comprising SEQ ID NO: 1,
used for Arabidopsis transformation was used to transform soybean.
This construct has a mRNA template sequence which encodes the mRNA
of SEQ ID NO: 48. The construct was created using a PCR
amplification of miR172a-2 precursor sequence from Arabidopsis,
restriction digestion, and ligation as described in Example 2.
[0217] Soybean tissue was transformed and grown essentially as
described in Example 10. After transformation, 42% of the
transformants exhibited a mutant phenotype, characterized by the
conversion of sepals to leaves. Plants exhibiting the strongest
phenotypes were sterile, and produced no seed. Both the homeotic
conversion of the organs and the effects on fertility are similar
to that seen for ap2 mutant alleles in Arabidopsis. Small RNA gel
electrophoresis and Northern analysis, probed with an
oligonucleotide probe antisense to miR172, showed accumulation of
miR172 in the transgenic lines. A small amount of endogenous soy
miR172 is also detected in the soy control line. The degree of the
mutant phenotype was directly related to the level of mRNA, with
the strongest phenotype having the highest accumulation of the
processed mRNA (.about.21 nt).
[0218] F. Targeting Arabidopsis AP2-Like Genes
[0219] The mRNA sequence of SEQ ID NO: 72 was selected and
designed. The sequence is put into the attB hairpin cassette by
annealing the synthetic oligonucleotides of SEQ ID NOS: 73-74, and
performing the BP recombination reaction (GATEWAY) to generate the
attL intermediate. This intermediate is used in the LR reaction to
recombine with the destination vector, generally described in
Example 12, comprising the EAT full-length precursor containing
attR sites, and negative selection markers in place of the hairpin.
The product of this reaction comprises the miR172a-2 precursor
hairpin cassette flanked by attR sites (i.e., the hairpin replaces
the marker cassette).
[0220] G. Targeting Arabidopsis Fatty Acid Desaturase (FAD2)
[0221] The mRNA sequence of SEQ ID NO: 75 was selected and designed
based on the sequence of NM.sub.--112047 (At3g12120). The sequence
is put into the attB hairpin cassette by annealing the synthetic
oligonucleotides of SEQ ID NOS: 76-77, and performing the BP
recombination reaction (GATEWAY) to generate the attL intermediate.
This intermediate is used in the LR reaction to recombine with the
destination vector, generally described in Example 12, comprising
the EAT full-length precursor containing attR sites, and negative
selection markers in place of the hairpin. The product of this
reaction comprises the FAD2 mRNA precursor hairpin cassette flanked
by attR sites (i.e., the hairpin replaces the marker cassette). The
effect of the anti-FAD2 mRNA can be determined by fatty acid
analysis to determine the change in the fatty acid profile, for
example, see Wu, et al. (1997) Plant Physiol. 113:347-356, herein
incorporated by reference.
[0222] H. Targeting Arabidopsis Phytoene Desaturase (PDS)
[0223] The mRNA sequence of SEQ ID NO: 78 was selected and designed
based on the sequence of NM.sub.--202816 (At4g14210). The sequence
is put into the attB hairpin cassette by annealing the synthetic
oligonucleotides of SEQ ID NOS: 79-80, and performing the BP
recombination reaction (GATEWAY) to generate the attL intermediate.
This intermediate is used in the LR reaction to recombine with the
destination vector, generally described in Example 12, comprising
the EAT full-length precursor containing attR sites, and negative
selection markers in place of the hairpin. The product of this
reaction comprises the PDS mRNA precursor hairpin cassette flanked
by attR sites (i.e., the hairpin replaces the marker cassette).
Transgenic plants containing the antiPDS construct were
photobleached upon germination in greater than about 90% of the
lines, indicating silencing of PDS.
Example 12
[0224] This example describes the construction of expression
vectors using recombinational cloning technology.
[0225] The vector described in Example 2 (SEQ ID NO: 44) was
modified to incorporate aft recombination sites to facilitate
recombinational cloning using GATEWAY technology (InVitrogen,
Carlsbad, Calif.). The BamHI/HindIII segment was replaced with a
sequence comprising in the following order: attR1-CAM-ccdB-attR2.
Upon recombination (BP+LR) with oligos containing attB sites
flanking the mRNA hairpin precursor construct, the selectable
markers are replaced by the mRNA hairpin precursor.
Example 13
[0226] This example summarizes the target sequences and oligos used
for mRNA silencing constructs as described in the examples.
4TABLE 4 Precursor oligos Target miRNA miRNA SEQ Organism gene name
template ID NOS Arabidopsis AP2-like miR172-a2 SEQ ID NO: 86 55-56
(PCR) none EATdel none 57-60 AGAMOUS antiAG SEQ ID NO: 4 12-15
APETELA3 antiAP3a SEQ ID NO: 5 16-19 (a) APETELA3 antiAP3b SEQ ID
NO: 6 20-23 (b) Corn PDS1 antiPDS1 SEQ ID NO: 7 24-27 PDS2 antiPDS1
SEQ ID NO: 8 28-31 IPPK2 antiIPPK2 SEQ ID NO: 9 32-35 ITPK5
antiITPK5 SEQ ID NO: 10 36-39 MI1PS antiMI1PS SEQ ID NO: 11 40-43
Soybean AP2-like miR172a-2 SEQ ID NO: 86 55-56 (PCR) Arabidopsis
AP2-like miR172a-2 SEQ ID NO: 72 73-74 FAD2 antiFAD2 SEQ ID NO: 75
76-77 PDS antiAtPDS SEQ ID NO: 78 79-80 Corn miR172b miR172 SEQ ID
NO: 92 91 PDS antiZmPDS SEQ ID NO: 95 94
Example 14
[0227] This example describes the identification and isolation of
genomic corn miR172 precursors.
[0228] The Genome Survey Sequence (GSS) database of the National
Center for Biotechnology Information (NCBI) was searched using the
21 nt miR172a-2 sequence in order to identify genomic corn
sequences containing miR172 precursor sequence. Several corn miR172
precursors were identified, and named miR172a-miR172e (SEQ ID NOS:
81-85) as summarized in Table 5. Each sequence was imported into
Vector NTI (InVitrogen, Carlsbad, Calif.) and contig analyses done.
The analysis identified four distinct loci, each with a unique
consensus sequence. A region of about 200 nucleotides surrounding
the mRNA sequence from each locus was examined for secondary
structure folding using RNA Structure software (Mathews, et al.,
2004, PNAS USA 101:7287-7292, herein incorporated by reference).
The results of this analysis identified the hairpin precursors of
each of the corn sequences miR172a-e.
[0229] Oligonucleotides were designed in order amplify miR172a or
miR172b from a B73 genomic corn library, these primers also add
restriction enzyme recognition sites in order to facilitate cloning
(BamHI or EcoRV). Alternatively, PCR primers designed to create att
sites for recombinational cloning could be used. After PCR
amplification, the products were isolated, purified, and the
confirmed by sequence analysis. Once confirmed, these sequences
were inserted into a construct comprising the corn ubiquitin (UBI)
promoter. This construct can be used for further transformation
vector construction, for example, with the addition of att sites,
the GATEWAY system can be used.
[0230] The following PCR primers were used to amplify a sequence
comprising the hairpin precursor of corn miR172a
5 Forward primer: 5' GGATCCTCTGCACTAGTGGGGTTATT 3' (SEQ ID NO: 87)
Reverse primer: 5' GATATCTGCAACAGTTTACAGGC- GTT 3' (SEQ ID NO:
88)
[0231] The following PCR primers were used to amplify a sequence
comprising the hairpin precursor of corn miR172b
6 Forward primer: 5' GGATCCCATGATATAGATGATGCTTG 3' (SEQ ID NO: 89)
Reverse primer: 5' GATATCAAGAGCTGAGGACAAGT- TTT 3' (SEQ ID NO:
90)
[0232]
7TABLE 5 Corn miR172 precursors and positions of hairpin, &
miRNA duplex components Corn SEQ ID Precursor NCBI ID Line NO:
Length Hairpin Backside miRNA miR172a CG090465 B73 81 907 508-598
512-532 574-594 miR172b BZ401521 B73 82 1128 551-654 567-587
620-640 and (both) BZ4011525 miR172c CG247934 B73 83 912 230-400
250-270 364-384 miR172d CG097860 B73 84 1063 351-520 361-381
466-486 and BZ972414 miR172e CG065885 B73 85 1738 913-1072 931-951
1033-1053 and (both) CG334589
Example 15
[0233] This example describes the design and synthesis of mRNA
targets and hairpins directed to various gene targets found in
maize, for use with the corn miR172b mRNA precursor.
[0234] A. miR172b Target in Corn
[0235] Similar to the Arabidopsis EAT examples, the corn miR172b
hairpin precursor will be tested by overexpression in corn. The
precursor sequence comprising the mRNA template is shown in SEQ ID
NO: 91. The mRNA is shown in SEQ ID NO: 92, and the backside of the
mRNA duplex is shown in SEQ ID NO: 93. A double-stranded DNA
molecule comprising the mRNA precursor and restriction enzyme
overhangs, for BamHI and KpnI, is created by annealing the
oligonucleotides of SEQ ID NOS: 97 and 98.
[0236] B. Phytoene Desaturase (PDS)
[0237] An oligonucleotide comprising the mRNA template is shown in
SEQ ID NO: 94. The mRNA directed to PDS is shown in SEQ ID NO: 92,
and the backside of the mRNA duplex is shown in SEQ ID NO: 93. A
double-stranded DNA molecule comprising the mRNA precursor and
restriction enzyme overhangs, for BamHI and KpnI, is created by
annealing the oligonucleotides of SEQ ID NOS: 99 and 100.
[0238] The oligonucleotides of this example can be inserted into
vectors for transformation of corn using standard cloning
techniques, including restriction digestion and ligation, and/or
recombinational cloning such as GATEWAY.
[0239] The above examples are provided to illustrate the invention
but not to limit its scope. Other variants of the invention will be
readily apparent to one of ordinary skill in the art and are
encompassed by the appended claims. All publications, patents,
patent applications, and computer programs cited herein are hereby
incorporated by reference.
Sequence CWU 1
1
100 1 1417 DNA Arabidopsis thaliana 1 gcacctctca ctccctttct
ctaactagtc ttgtgtgcac ccatttatgt gtacgtacta 60 ttatctcata
aataaatatt tttaaaatta gatgcattta ttgatatgaa aaagttacaa 120
gattagtttg ttgtgtgtga gactttggat cgacagatcg aaaaattaac taaccggtca
180 gtattgaata tcaactatta tatgctccat gcattcgctt atagtttcac
acaatttgtt 240 ttcttcacgg tctaaaatca gaagattcca tatattttct
tatgacgtaa aaggaccact 300 tataagttga cacgtcagcc cttggattcg
tgaggttttt ctctctactt cacctatcta 360 cttttcctca tatcccactg
cttttctcct tcttgttctt gtttttctcg tttttttctt 420 cttcttctcc
aagaaaatag agatcgaaaa gattagatct attttgtgta gcaagaaatt 480
atcattttcg tttcttcatt catatattgt tctattatgt tgtacaataa tagatactcg
540 atctcttgtg cgtgcgtaaa ttttatacaa gttgtcggcg gatccatgga
agaaagctca 600 tctgtcgttg tttgtaggcg cagcaccatt aagattcaca
tggaaattga taaataccct 660 aaattagggt tttgatatgt atatgagaat
cttgatgatg ctgcatcaac aatcgacggc 720 tacaaatacc taaagcttga
gaaagaaact tgaagatatt gattgaagtc tggatcgatc 780 tttggtaaat
ctctctcttg attagtttta agaatcactt ttttttttct gtgtttgaac 840
atgtttacat atatcatcta tgtctcaata tatatatttt cttaatctag ggtcaatgac
900 ggattagggc gttaattaca atgaatatgg aaaaactatt ttgcctttga
tcttgacttg 960 agtgttgatg aacagatgta taatgttatg tagtatgtac
tgtatttttt ctagaatcat 1020 tctttagtct ccaactctcc attaatcaaa
tgaggtcctt ataggtaatg ctatgatcaa 1080 gaacaacaag atcgtgagca
cagatcggcc agttcggtca ctttttaaaa gagagatgtt 1140 atattgttaa
tttgttatta tcaggtataa taaatacaga atagttcgtc cagagaccag 1200
acattttata gtttcaattt tatgacagtc ttgtaataat atttgtttaa tagtgtgtca
1260 ccttctattt ctgggttatt acttggtccc gaaattttct tattgttcta
attttgtaat 1320 attagaaatt tggttttctt gccaaatcaa atcaaacatt
acggtgtgtt gtacattgta 1380 ccagaacttt tgttttcaag tgctcaactt gagaacc
1417 2 95 DNA Arabidopsis thaliana 2 aggcgcagca ccattaagat
tcacatggaa attgataaat accctaaatt agggttttga 60 tatgtatatg
agaatcttga tgatgctgca tcaac 95 3 159 DNA Artificial Sequence miRNA
template cassette 3 ggatccatgg aagaaagctc atctgtcgtt gtttgtaggc
gcagcaccat taagattcac 60 atggaaattg ataaataccc taaattaggg
ttttgatatg tatatgagaa tcttgatgat 120 gctgcatcaa caatcgacgg
ctacaaatac ctaaagctt 159 4 21 DNA Artificial Sequence miRNA
template to target At4g18960 4 taggttgtaa tgccgcgact t 21 5 21 DNA
Artificial Sequence miRNA template to target At3g54340 5 ggtggaaatg
aagagcgtaa g 21 6 21 DNA Artificial Sequence miRNA template to
target At3g54340 6 agagcgtaag cacgtgaccc t 21 7 21 DNA Artificial
Sequence miRNA template to target maize phytoene desaturase 7
tgctggcaga agtccgattg c 21 8 21 DNA Artificial Sequence miRNA
template to target maize phytoene desaturase 8 agcttcctgg
ataggactgc a 21 9 21 DNA Artificial Sequence miRNA template to
target is maize IPPK2 9 aagttgtggt taatcacccc a 21 10 21 DNA
Artificial Sequence miRNA template to target is maize ITPK5 10
gaggacagtt tcgtatcctg g 21 11 21 DNA Artificial Sequence miRNA
template to target is maize Mi1ps3 11 gagcgtttac caccggtgtg c 21 12
77 DNA Artificial Sequence Synthetic oligo1/4 for At4g18960 target
12 gatccatgga agaaagctca tctgtcgttg tttgtaggca gtcgcggcac
tacaaccaaa 60 tggaaattga taaatac 77 13 77 DNA Artificial Sequence
Synthetic oligo2/4 for At4g18960 target 13 tagggtattt atcaatttcc
atttggttgt agtgccgcga ctgcctacaa acaacgacag 60 atgagctttc ttccatg
77 14 76 DNA Artificial Sequence Synthetic oligo3/4 for At4g18960
target 14 cctaaattag ggttttgata tgtatattag gttgtaatgc cgcgactttc
aacaatcgac 60 ggctacaaat acctaa 76 15 76 DNA Artificial Sequence
Synthetic oligo4/4 for At4g18960 target 15 agctttaggt atttgtagcc
gtcgattgtt gaaagtcgcg gcattacaac ctaatataca 60 tatcaaaacc ctaatt 76
16 77 DNA Artificial Sequence Synthetic oligo1/4 for At3g54340
target 16 gatccatgga agaaagctca tctgtcgttg tttgtaggat tacgcccttc
attaccacca 60 tggaaattga taaatac 77 17 77 DNA Artificial Sequence
Synthetic oligo2/4 for At3g54340 target 17 tagggtattt atcaatttcc
atggtggtaa tgaagggcgt aatcctacaa acaacgacag 60 atgagctttc ttccatg
77 18 76 DNA Artificial Sequence Synthetic oligo3/4 for At3g54340
target 18 cctaaattag ggttttgata tgtatatggt ggaaatgaag agcgtaagtc
aacaatcgac 60 ggctacaaat acctaa 76 19 76 DNA Artificial Sequence
Synthetic oligo4/4 for At3g54340 target 19 agctttaggt atttgtagcc
gtcgattgtt gacttacgct cttcatttcc accatataca 60 tatcaaaacc ctaatt 76
20 77 DNA Artificial Sequence Synthetic oligo1/4 for At3g54340
target 20 gatccatgga agaaagctca tctgtcgttg tttgtaggcg gtcacgcgct
tacgctcaca 60 tggaaattga taaatac 77 21 77 DNA Artificial Sequence
Synthetic oligo2/4 for At3g54340 target 21 tagggtattt atcaatttcc
atgtgagcgt aagcgcgtga ccgcctacaa acaacgacag 60 atgagctttc ttccatg
77 22 76 DNA Artificial Sequence Synthetic oligo3/4 for At3g54340
target 22 cctaaattag ggttttgata tgtatatgag agcgtaagca cgtgaccctc
aacaatcgac 60 ggctacaaat acctaa 76 23 76 DNA Artificial Sequence
Synthetic oligo4/4 for At3g54340 target 23 agctttaggt atttgtagcc
gtcgattgtt gagggtcacg tgcttacgct ctcatataca 60 tatcaaaacc ctaatt 76
24 77 DNA Artificial Sequence Synthetic oligo1/4 for phytoene
desaturase target 24 gatccatgga agaaagctca tctgtcgttg tttgtaggca
atcggacttc tgccagcaca 60 tggaaattga taaatac 77 25 77 DNA Artificial
Sequence Synthetic oligo2/4 for phytoene desaturase target 25
tagggtattt atcaatttcc atgtgctggc agaagtccga ttgcctacaa acaacgacag
60 atgagctttc ttccatg 77 26 76 DNA Artificial Sequence Synthetic
oligo3/4 for phytoene desaturase target 26 cctaaattag ggttttgata
tgtatatgtg ctggcagaag tccgattgcc aacaatcgac 60 ggctacaaat acctaa 76
27 76 DNA Artificial Sequence Synthetic oligo4/4 for phytoene
desaturase target 27 agctttaggt atttgtagcc gtcgattgtt ggcaatcgga
cttctgccag cacatataca 60 tatcaaaacc ctaatt 76 28 77 DNA Artificial
Sequence Synthetic oligo1/4 for phytoene desaturase target 28
gatccatgga agaaagctca tctgtcgttg tttgtagtac agtcccatcc aggaagcaca
60 tggaaattga taaatac 77 29 77 DNA Artificial Sequence Synthetic
oligo2/4 for phytoene desaturase target 29 tagggtattt atcaatttcc
atgtgcttcc tggatgggac tgtactacaa acaacgacag 60 atgagctttc ttccatg
77 30 76 DNA Artificial Sequence Synthetic oligo3/4 for phytoene
desaturase target 30 cctaaattag ggttttgata tgtatatgag cttcctggat
aggactgcac aacaatcgac 60 ggctacaaat acctaa 76 31 76 DNA Artificial
Sequence Synthetic oligo4/4 for phytoene desaturase target 31
agctttaggt atttgtagcc gtcgattgtt gtgcagtcct atccaggaag ctcatataca
60 tatcaaaacc ctaatt 76 32 77 DNA Artificial Sequence Synthetic
oligo1/4 for IPPK2 target 32 gatccatgga agaaagctca tctgtcgttg
tttgtaggcg gggtgataaa ccacaacata 60 tggaaattga taaatac 77 33 77 DNA
Artificial Sequence Synthetic oligo2/4 for IPPK2 target 33
tagggtattt atcaatttcc atatgttgtg gtttatcacc ccgcctacaa acaacgacag
60 atgagctttc ttccatg 77 34 76 DNA Artificial Sequence Synthetic
oligo3/4 for IPPK2 target 34 cctaaattag ggttttgata tgtatataag
ttgtggttaa tcaccccatc aacaatcgac 60 ggctacaaat acctaa 76 35 76 DNA
Artificial Sequence Synthetic oligo4/4 for IPPK2 target 35
agctttaggt atttgtagcc gtcgattgtt gatggggtga ttaaccacaa cttatataca
60 tatcaaaacc ctaatt 76 36 77 DNA Artificial Sequence Synthetic
oligo1/4 for ITPK5 target 36 gatccatgga agaaagctca tctgtcgttg
tttgtaggac aggatacgta actgtccaca 60 tggaaattga taaatac 77 37 77 DNA
Artificial Sequence Synthetic oligo2/4 for ITPK5 target 37
tagggtattt atcaatttcc atgtggacag ttacgtatcc tgtcctacaa acaacgacag
60 atgagctttc ttccatg 77 38 76 DNA Artificial Sequence Synthetic
oligo3/4 for ITPK5 target 38 cctaaattag ggttttgata tgtatatgag
gacagtttcg tatcctggtc aacaatcgac 60 ggctacaaat acctaa 76 39 76 DNA
Artificial Sequence Synthetic oligo4/4 for ITPK5 target 39
agctttaggt atttgtagcc gtcgattgtt gaccaggata cgaaactgtc ctcatataca
60 tatcaaaacc ctaatt 76 40 77 DNA Artificial Sequence Synthetic
oligo1/4 for mi1ps target 40 gatccatgga agaaagctca tctgtcgttg
tttgtaggac acaccggcgg taaacgcaca 60 tggaaattga taaatac 77 41 77 DNA
Artificial Sequence Synthetic oligo2/4 for mi1ps target 41
tagggtattt atcaatttcc atgtgcgttt accgccggtg tgtcctacaa acaacgacag
60 atgagctttc ttccatg 77 42 76 DNA Artificial Sequence Synthetic
oligo3/4 for mi1ps target 42 cctaaattag ggttttgata tgtatatgag
cgtttaccac cggtgtgctc aacaatcgac 60 ggctacaaat acctaa 76 43 76 DNA
Artificial Sequence Synthetic oligo4/4 for mi1ps target 43
agctttaggt atttgtagcc gtcgattgtt gagcacaccg gtggtaaacg ctcatataca
60 tatcaaaacc ctaatt 76 44 4426 DNA Artificial Sequence Plasmid 44
ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc
60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag
aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca
ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca
gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt
cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt
agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360
agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac
420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat
tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta
ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt
aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc
gcgcgtaata cgactcacta tagggcgaat tgggtaccgg 660 gccctctaga
tgcatgctcg agcggccgcc agtgtgatgg atatctgcag aattcgccct 720
tgactactcg agcacctctc actccctttc tctaactagt cttgtgtgca cccatttatg
780 tgtacgtact attatctcat aaataaatat ttttaaaatt agatgcattt
attgatatga 840 aaaagttaca agattagttt gttgtgtgtg agactttgga
tcgacagatc gaaaaattaa 900 ctaaccggtc agtattgaat atcaactatt
atatgctcca tgcattcgct tatagtttca 960 cacaatttgt tttcttcacg
gtctaaaatc agaagattcc atatattttc ttatgacgta 1020 aaaggaccac
ttataagttg acacgtcagc ccttggattc gtgaggtttt tctctctact 1080
tcacctatct acttttcctc atatcccact gcttttctcc ttcttgttct tgtttttctc
1140 gtttttttct tcttcttctc caagaaaata gagatcgaaa agattagatc
tattttgtgt 1200 agcaagaaat tatcattttc gtttcttcat tcatatattg
ttctattatg ttgtacaata 1260 atagatactc gatctcttgt gcgtgcgtaa
attttataca agttgtcggc ggatccatgg 1320 aagaaagctc atctgtcgtt
gtttgtaggc gcagcaccat taagattcac atggaaattg 1380 ataaataccc
taaattaggg ttttgatatg tatatgagaa tcttgatgat gctgcatcaa 1440
caatcgacgg ctacaaatac ctaaagcttg agaaagaaac ttgaagatat tgattgaagt
1500 ctggatcgat ctttggtaaa tctctctctt gattagtttt aagaatcact
tttttttttc 1560 tgtgtttgaa catgtttaca tatatcatct atgtctcaat
atatatattt tcttaatcta 1620 gggtcaatga cggattaggg cgttaattac
aatgaatatg gaaaaactat tttgcctttg 1680 atcttgactt gagtgttgat
gaacagatgt ataatgttat gtagtatgta ctgtattttt 1740 tctagaatca
ttctttagtc tccaactctc cattaatcaa atgaggtcct tataggtaat 1800
gctatgatca agaacaacaa gatcgtgagc acagatcggc cagttcggtc actttttaaa
1860 agagagatgt tatattgtta atttgttatt atcaggtata ataaatacag
aatagttcgt 1920 ccagagacca gacattttat agtttcaatt ttatgacagt
cttgtaataa tatttgttta 1980 atagtgtgtc accttctatt tctgggttat
tacttggtcc cgaaattttc ttattgttct 2040 aattttgtaa tattagaaat
ttggttttct tgccaaatca aatcaaacat tacggtgtgt 2100 tgtacattgt
accagaactt ttgttttcaa gtgctcaact tgagaacctc gagtagtcaa 2160
gggcgaattc cagcacactg gcggccgtta ctagttctag agcggccgcc accgcggtgg
2220 agctccagct tttgttccct ttagtgaggg ttaattgcgc gcttggcgta
atcatggtca 2280 tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc
cacacaacat acgagccgga 2340 agcataaagt gtaaagcctg gggtgcctaa
tgagtgagct aactcacatt aattgcgttg 2400 cgctcactgc ccgctttcca
gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 2460 caacgcgcgg
ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 2520
tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata
2580 cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa
aggccagcaa 2640 aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
tccataggct ccgcccccct 2700 gacgagcatc acaaaaatcg acgctcaagt
cagaggtggc gaaacccgac aggactataa 2760 agataccagg cgtttccccc
tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 2820 cttaccggat
acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 2880
cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa
2940 ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga
gtccaacccg 3000 gtaagacacg acttatcgcc actggcagca gccactggta
acaggattag cagagcgagg 3060 tatgtaggcg gtgctacaga gttcttgaag
tggtggccta actacggcta cactagaagg 3120 acagtatttg gtatctgcgc
tctgctgaag ccagttacct tcggaaaaag agttggtagc 3180 tcttgatccg
gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 3240
attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac
3300 gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc
aaaaaggatc 3360 ttcacctaga tccttttaaa ttaaaaatga agttttaaat
caatctaaag tatatatgag 3420 taaacttggt ctgacagtta ccaatgctta
atcagtgagg cacctatctc agcgatctgt 3480 ctatttcgtt catccatagt
tgcctgactc cccgtcgtgt agataactac gatacgggag 3540 ggcttaccat
ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 3600
gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
3660 ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag
tagttcgcca 3720 gttaatagtt tgcgcaacgt tgttgccatt gctacaggca
tcgtggtgtc acgctcgtcg 3780 tttggtatgg cttcattcag ctccggttcc
caacgatcaa ggcgagttac atgatccccc 3840 atgttgtgca aaaaagcggt
tagctccttc ggtcctccga tcgttgtcag aagtaagttg 3900 gccgcagtgt
tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca 3960
tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt
4020 atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc
gccacatagc 4080 agaactttaa aagtgctcat cattggaaaa cgttcttcgg
ggcgaaaact ctcaaggatc 4140 ttaccgctgt tgagatccag ttcgatgtaa
cccactcgtg cacccaactg atcttcagca 4200 tcttttactt tcaccagcgt
ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 4260 aagggaataa
gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 4320
tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa
4380 aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccac 4426 45 29
DNA Artificial Sequence EAT 3' PCR primer 45 ctgtgctcac gatcttgttg
ttcttgatc 29 46 29 DNA Artificial Sequence EAT 5' PCR primer 46
gtcggcggat ccatggaaga aagctcatc 29 47 21 RNA Arabidopsis thaliana
AP2 RNA 47 cugcagcauc aucaggauuc u 21 48 21 RNA Arabidopsis
thaliana misc_feature (0)...(0) EAT miRNA 48 agaaucuuga ugaugcugca
u 21 49 59 DNA Arabidopsis thaliana 49 accaagtgtt gacaaatgct
gcagcatcat caggattctc tcctcatcat cacaatcag 59 50 59 DNA Arabidopsis
thaliana 50 caccgccact gttttcaaat gcagcatcat caggattctc actctcagct
acacgccct 59 51 59 DNA Arabidopsis thaliana 51 caccattgtt
ctcagttgca gcagcatcat caggattctc acatttccgg ccacaacct 59 52 59 DNA
Arabidopsis thaliana 52 gaaatcgagt ggtgggaatg gcagcatcat caggattctc
tcctcaacct tccccttac 59 53 59 DNA Zea mays 53 acgtgccgtt gcaccactct
gcagcatcat caggattctc taccgccgcc ggggccaac 59 54 59 DNA Zea mays 54
acgccagcag cgccgccgct gcagcatcat caggattccc actgtggcag ctgggtgcg 59
55 35 DNA Artificial Sequence EAT PCR primer 55 gactactcga
gcacctctca ctccctttct ctaac 35 56 36 DNA Artificial Sequence EAT
PCR primer 56 gactactcga ggttctcaag ttgagcactt gaaaac 36 57 77 DNA
Artificial Sequence EAT deletion oligonucleotide 57 gatccatgga
agaaagctca tctgtcgttg tttgtaggcg cagcaccatt aagattcaca 60
tggaaattga taaatac 77 58 55 DNA Artificial Sequence EAT deletion
oligonucleotide 58 cctaaattag ggttttgata tgtatattca acaatcgacg
gctacaaata cctaa 55 59 77 DNA Artificial Sequence EAT deletion
oligonucleotide 59 tagggtattt atcaatttcc atgtgaatct taatggtgct
gcgcctacaa acaacgacag 60 atgagctttc ttccatg 77 60 55 DNA Artificial
Sequence EAT deletion oligonucleotide 60 agctttaggt atttgtagcc
gtcgattgtt gaatatacat atcaaaaccc taatt 55 61 30 DNA Artificial
Sequence S1 probe 61
atgcagcatc atcaagattc tcatatacat 30 62 29 DNA Artificial Sequence
mir172a-2 PCR primer 62 gtcggcggat ccatggaaga aagctcatc 29 63 30
DNA Artificial Sequence mir172a-2 PCR primer 63 caaagatcga
tccagacttc aatcaatatc 30 64 27 DNA Artificial Sequence mir172a-1
PCR primer 64 taatttccgg agccacggtc gttgttg 27 65 28 DNA Artificial
Sequence mir172a-1 PCR primer 65 aatagtcgtt gattgccgat gcagcatc 28
66 24 DNA Artificial Sequence Actin PCR primer 66 atggcagatg
gtgaagacat tcag 24 67 26 DNA Artificial Sequence Actin PCR primer
67 gaagcacttc ctgtggacta ttgatg 26 68 26 DNA Artificial Sequence
AP2 PCR primer 68 tttccgggca gcagcaacat tggtag 26 69 29 DNA
Artificial Sequence AP2 PCR primer 69 gttcgcctaa gttaacaaga
ggatttagg 29 70 30 DNA Artificial Sequence ANT PCR primer 70
gatcaacttc aatgactaac tctggttttc 30 71 30 DNA Artificial Sequence
ANT PCR primer 71 gttatagaga gattcattct gtttcacatg 30 72 21 DNA
Artificial Sequence miRNA template to EAT 72 agaatcttga tgatgctgca
t 21 73 175 DNA Artificial Sequence Synthetic oligonucleotide 1 for
EAT with attB sites 73 ttaaacaagt ttgtacaaaa aagcaggctg tcgttgtttg
taggcgcagc accattaaga 60 ttcacatgga aattgataaa taccctaaat
tagggttttg atatgtatat gagaatcttg 120 atgatgctgc atcaacaatc
gacggcaccc agctttcttg tacaaagtgg tttaa 175 74 175 DNA Artificial
Sequence Synthetic oligonucleotide 2 for EAT with attB sites 74
ttaaaccact ttgtacaaga aagctgggtg ccgtcgattg ttgatgcagc atcatcaaga
60 ttctcatata catatcaaaa ccctaattta gggtatttat caatttccat
gtgaatctta 120 atggtgctgc gcctacaaac aacgacagcc tgcttttttg
tacaaacttg tttaa 175 75 21 DNA Artificial Sequence miRNA template
for FAD2 75 agataagacc aactgtgtca t 21 76 175 DNA Artificial
Sequence Synthetic oligonucleotide 1 for FAD2 76 ttaaacaagt
ttgtacaaaa aagcaggctg tcgttgtttg taggcgacac agctggtctt 60
atcacatgga aattgataaa taccctaaat tagggttttg atatgtatat gagataagac
120 caactgtgtc atcaacaatc gacggcaccc agctttcttg tacaaagtgg tttaa
175 77 175 DNA Artificial Sequence Synthetic oligonucleotide 2 for
FAD2 77 ttaaaccact ttgtacaaga aagctgggtg ccgtcgattg ttgatgacac
agttggtctt 60 atctcatata catatcaaaa ccctaattta gggtatttat
caatttccat gtgataagac 120 cagctgtgtc gcctacaaac aacgacagcc
tgcttttttg tacaaacttg tttaa 175 78 21 DNA Artificial Sequence miRNA
template for PDS 78 agaaactctt aaccgtgcca t 21 79 175 DNA
Artificial Sequence Synthetic oligonucleotide 1 to target PDS 79
ttaaacaagt ttgtacaaaa aagcaggctg tcgttgtttg taggcggcac ggtcaagagt
60 ttcacatgga aattgataaa taccctaaat tagggttttg atatgtatat
gagaaactct 120 taaccgtgcc atcaacaatc gacggcaccc agctttcttg
tacaaagtgg tttaa 175 80 175 DNA Artificial Sequence Synthetic
oligonucleotide 2 to target PDS 80 ttaaaccact ttgtacaaga aagctgggtg
ccgtcgattg ttgatggcac ggttaagagt 60 ttctcatata catatcaaaa
ccctaattta gggtatttat caatttccat gtgaaactct 120 tgaccgtgcc
gcctacaaac aacgacagcc tgcttttttg tacaaacttg tttaa 175 81 907 DNA
Zea mays 81 ttaaaaaaat agcgatttgt ttgaagaaag gatcatggcc gagcatcatt
caacgtacct 60 ctgtagggcg tatgaatcgt tggattagga tcaaagtcgg
caacggttaa attcaaggaa 120 gaaaacaacg ggcgtggggt cctgtccacg
tcatcaggtg accaggcagg caggcatgcg 180 cgccatgcgg cattgcttct
gtccccgtgc ccgggcagct tttggcagcg gatccggacg 240 gaacaccacg
cgcgcgcgcg cgcggcaggc acgcaccggc caacttaatc ttgcctccac 300
tctgcactag tggggttatt aacaatttga ttaatccgac actgacgtac tgtgtcaacc
360 aatggcaccg cctatatatt aatcgaacca ttcagctcgt cttaattgcc
acccacccac 420 ccaccgccat tgccatggtt cacctcattc attctaagct
tagacgatgc agtgatagaa 480 attaatactg caaatcagtc agtgtttgcg
ggcgtggcat catcaagatt cacaacccat 540 caatccgaac cactgatttg
gaatgcatgt atgagaatct tgatgatgct gcatccgcca 600 acaagcgcct
acgaacgttt gtgtgctcat cttcgccatc aatcgagatt ttgtatcttc 660
acgtttagct aaggtgaaag atcgtcatcc catccgccta aagctagctt tgcaaatttt
720 tattcgaaac aacgaccatt tctatatatt tcctttctct gttatagtct
ctaattaacg 780 cctgtaaact gttgcaccct gcttctgcat cttcttatta
attagttttg tctcttatgg 840 atgctaaaca gccatgacgt ttcggacaat
gttcagctcg tacttccttc aatcgggagc 900 gccaaaa 907 82 1128 DNA Zea
mays 82 tcgtcgatct gatttgcctg ctttatttct tcttcttctt cacaccgagc
tagctagcta 60 tcttgcttta atttgcctag aacgaataga tccaccgtac
tagcttcttg ctcgatctgc 120 agcttctcgc ttgtgagcca agagcccggc
cagcagtgtc ggccgtgcag tggcactctc 180 tccatcaaca atcaaccctc
tctccgtcga catgtggaaa ggtaggtaga gatagatggt 240 gtgtgtaatc
cggttccttg gttcttgtgt ttccgatctc ctctaattaa tcgatctctc 300
tacctggcca gctcacttca cccatgcttg catctagctg ttccaatctg atgcatgata
360 tagatgatgc ttgcggcctc ttcttcttga ttcataggct catcatctat
gcctctgtca 420 tgcacacact cgtgtctttc ttcttgatgg atacacgtac
ggggggttgg gttgttcaca 480 tatatagtag tatagctagt ttattagatg
caggtataca gatcatgagg aagcaagaaa 540 ttatgcaaaa cagtcggtgc
ttgcaggtgc agcaccatca agattcacat ccccagctcg 600 atctgtgcat
gatgagatga gaatcttgat gatgctgcat cagcaaacac tcacttacat 660
cgatctcacc cctggacaag ctggacagtg aaaccggact gagcaatcga gtactactaa
720 aaacttgtcc tcagctcttt atgttttact ttcaattacc ttgcttatat
taattttctt 780 tcacttaatt tagttaatta ctgctctctc tctctctctc
tgtctctctc tctctctctc 840 tggttttttc atcttgcaaa aaaaatgcag
aaattaatat gtatatgtgt acctcatgat 900 tattaaggcc gctgcaccat
gattttatgg tatattatta tcagcttaaa acaggctttc 960 ccttttgatt
atatttcaat aattcgttta gcatcattag tttctgcatt tgccgatgat 1020
ctcgaggttc tgtttgcaag aagtggctgc actgcagccc tgcagctata tatacacagg
1080 ttcaagttac taattttgtg cttctacaat aatcctatca gtccgcag 1128 83
912 DNA Zea mays 83 cactaatagc tttctatctg atcgattcat catcatccgg
gcatgcatga gcatcatcgt 60 ctccagatcg ttgggctctc gcagctacct
acattcaaca ttcaagctcg ctctacatat 120 gcatgcaaat ctgcaacact
cgctcttggc agggatacat tcacgccgag agagagagag 180 agagagagag
agagagagag agagagagag atgtgtgtgc tgtagtcatc agccagccgg 240
tgatttctgg agtggcatca tcaagattca cacactgcat gccaacataa tgcgcgtgtt
300 catgcatcca tcgccgccgc tgcatcatgc atcatatata atatatatat
atgtgtatgt 360 gtgggaatct tgatgatgct gcattggata tcaagggcta
tatatatata tggatcaagc 420 atatatatat atatatcaga tcaccagtca
tatcgagttc ttccttccag gcttgctagg 480 taatttataa cttaaacctt
gttgctgaac taactaattt tacttagcta gctagctact 540 actatacttc
attgttagta gtagctagca agaaggaaag taggcatccc ggccggttcg 600
taccttcttt ttttttgcac agcaggatct gaccttctgt ataaaatgca tttttgcctt
660 gagttttttt gtttttccac agtaggaggt agctgattct gatctgctgt
ataaaaatgc 720 atttttttcc ttttcatttc atggcagaag gcaatatata
ataagaaaag actgaaagga 780 aaaggcacca ctgccatgat ggatcgcatc
agtgcatctg ttttgttctt ctaaacgatt 840 caggtcatca ggtgagctag
gtgggctaat aagtatatag attaatttct attttgcaca 900 tgatttatat gg 912
84 1063 DNA Zea mays 84 catgcatgct gccttacacc taagctagct agctgttgaa
tttgatgcat gacgcatgct 60 ttcctcctcc tccgttcgta gtcgttgtcg
ttgtctcagt aatccatcct ctctcttttt 120 ttcttgctaa tacataaaag
gggttcagat ggtagctgct agtggttatt cttcttctta 180 gacgatgcaa
gtatatgtat atggaccacc aaattagctt ctcgtcttgc cgccggaccg 240
ccatcatgca ccttggagaa gcaacagaac gaagctcgct gctatgctat ctatggatta
300 ttgtattgta tatgaatgaa gcagcaagca aacgtagttc agtacagtcg
gtgcttgcag 360 gtgcagcacc atcaagattc acatcgtcca actcatgcat
catgcatata tgcatcttca 420 atgatgcgtg cctcgcatgt gtgtgtatat
atatatgatg agatgagaat cttgatgatg 480 ctgcatcagc agacactcac
tagctcatgc atcacctcca agtaataaga gatgaattga 540 attaacgacc
atgcagctac tagctctrgt acgtaccact tcgttctcct ctaatttctt 600
tttccattca gtctaccttg tttgctaatc aacttgttct catataatat atggttccca
660 atgcgataag ggttggcctg caggcttagc tctgcagcag gtagcaccca
tgcatggccc 720 atgatacata acatattgat ggatatatac tagcataaaa
acatgatgat gcagagcagc 780 agcatccatc tcatagctag cataaaaaca
tgcatgagct agcagcggca gttgacgatg 840 actcttcgag aggaaggaag
gaagcagcag atcgatggac gcgagacatg agcagtgaca 900 gatgcataat
gtagcagtac atacagcatt attgctatta tttgtgccca agcaaattaa 960
ggaaggggac caaattgaaa tatactaatg acattgcaga cggcaccagc agagtccaca
1020 gctcgtgaac ctgtgtaggc tgcctgccga tggtacaatg caa 1063 85 1738
DNA Zea mays 85 ccatcagcaa ctgctcgtag ctccgtcctc atcacttaaa
ccttatcatc atcactctct 60 cttcctctct cttctggccg gccggtcctt
tcacctcact catcttctca gttcattcca 120 tggagagcgt cgttcctata
tatcatgcat catccaccaa ggccctagct aagctgctac 180 tacctgctag
gggttttatt agttgctcaa ccttcgctgg ccggccttat atatacctag 240
ctatagctgt cttgcttgca tagatcatcg atccatgttg ctagctagct agctccctca
300 gttcagttca gttcagttca gctcagctag ctagctcact cctctcttga
gtcgtggtgt 360 ccatcacaat cttctctata tcgatacagg tgaggaggta
gctagacaga tcaacaccaa 420 tcctctcaac gacatcccct tgttcttgta
gagagagttg gtgtaggtcg aaaggcagat 480 agatcatata tagagggaga
gatgcatata tggtgtaggg ttcttcaatt tgtttctatg 540 atcgattcat
tcgccctgca gccccccctg cgcatctagt tatgtctcca tccctcctcc 600
cttgttcctg atacatatat atatatgtag gtagtggctc tgtatatacc catgccatct
660 ctctcaatct catctatatc atatataccc atgctttgca tctagctgtt
tcatttcttt 720 tcactcgtgc tttgaaagat ctggtacagt ccggcctgta
ttagtaagaa cgagttagaa 780 aaatacacac gtacgcgcga gaaccatgca
tcatcagcta gctcctctct ttcctctttt 840 tttttgttaa tgcatacatt
catatatata ttcccatgaa tgaatgcttt aagcatgagg 900 caagcaaaca
tcgacagtgg gtgcttgcag gtgcagcacc accaagattc acatccaact 960
ctcacgcatc ttcagtgatg catgcatgct ctgtgatgtc tcgcagcagc tatatgcata
1020 tgtgatgaga tgagaatctt gatgatgctg catcagcaga cactcactca
tcacaccaac 1080 gtaccccaac aagggtgaga gacgacgaat cggctgctgg
tatatacata caactgagaa 1140 gtcggattac ctttgctgat tattaacttg
tttccattgc tgtgaaatga aactttcaat 1200 gcaagggggc tggcctacca
gctggtacta gcaggaatga agagcatata tatatgaaca 1260 tgatgatgca
tatatgcaga gcagcaacag cagcatcgtc gtaccatctc atatatatca 1320
ttgcaaacat gagcagtagt ggtagttcat gaatcatgat gaaagcaagg aagaggaagc
1380 tagcagtgct ggacgcggat cagatgcaga tcgatggagg ccggggccgg
gggtgtacct 1440 acgtagtaca ttgctattat tgtgtccatg gaagggggac
caaagtatgt aatgcgttgc 1500 acaccacaca ccagagctgg ctcagcagct
agcagcagcc tgtggtggtg gtggtacaat 1560 gcagcgtgta ctgctgtcgt
cccagcagca agttgaaagg taaaagagag aaatatttca 1620 gctgacttta
ctcatcacgc actctgcctg catgctggct gcaggcctgc tgtgagtctg 1680
tgtgtgtgtg cttgttctct tgctttagtg gtggtgtaga tcttctattt gctagttt
1738 86 21 DNA Arabidopsis thaliana 86 agaatcttga tgatgctgca t 21
87 26 DNA Artificial Sequence Forward PCR primer for maize miR172a
87 ggatcctctg cactagtggg gttatt 26 88 26 DNA Artificial Sequence
Reverse PCR primer for maize miR172a 88 gatatctgca acagtttaca
ggcgtt 26 89 26 DNA Artificial Sequence Forward PCR primer for
maize miR172b 89 ggatcccatg atatagatga tgcttg 26 90 26 DNA
Artificial Sequence Reverse PCR primer for maize miR172b 90
gatatcaaga gctgaggaca agtttt 26 91 170 DNA Zea mays 91 tatacagatc
atgaggaagc aagaaattat gcaaaacagt cggtgcttgc aggtgcagca 60
ccatcaagat tcacatcccc agctcgatct gtgcatgatg agatgagaat cttgatgatg
120 ctgcatcagc aaacactcac ttacatcgat ctcacccctg gacaagctgg 170 92
21 DNA Zea mays 92 agaatcttga tgatgctgca t 21 93 21 DNA Zea mays 93
gtgcagcacc atcaagattc a 21 94 170 DNA Artificial Sequence miRNA
precursor template to target PDS 94 tatacagatc atgaggaagc
aagaaattat gcaaaacagt cggtgcttgc agatcctgcc 60 tcgcaggttg
tcacatcccc agctcgatct gtgcatgatg agatgagaca acctgcaagg 120
caggatcagc aaacactcac ttacatcgat ctcacccctg gacaagctgg 170 95 21
DNA Artificial Sequence miRNA template to PDS target 95 agacaacctg
caaggcagga t 21 96 21 DNA Artificial Sequence miRNA template
backside to PDS target 96 atcctgcctc gcaggttgtc a 21 97 178 DNA
Artificial Sequence Oligonucleotide 1 for maize miR172b 97
gatctataca gatcatgagg aagcaagaaa ttatgcaaaa cagtcggtgc ttgcaggtgc
60 agcaccatca agattcacat ccccagctcg atctgtgcat gatgagatga
gaatcttgat 120 gatgctgcat cagcaaacac tcacttacat cgatctcacc
cctggacaag ctgggtac 178 98 170 DNA Artificial Sequence
Oligonucleotide 2 for maize miR172b 98 ccagcttgtc caggggtgag
atcgatgtaa gtgagtgttt gctgatgcag catcatcaag 60 attctcatct
catcatgcac agatcgagct ggggatgtga atcttgatgg tgctgcacct 120
gcaagcaccg actgttttgc ataatttctt gcttcctcat gatctgtata 170 99 178
DNA Artificial Sequence Oligonucleotide 1 for maize PDS target 99
gatctataca gatcatgagg aagcaagaaa ttatgcaaaa cagtcggtgc ttgcagatcc
60 tgcctcgcag gttgtcacat ccccagctcg atctgtgcat gatgagatga
gacaacctgc 120 aaggcaggat cagcaaacac tcacttacat cgatctcacc
cctggacaag ctgggtac 178 100 170 DNA Artificial Sequence
Oligonucleotide 2 for maize PDS target 100 ccagcttgtc caggggtgag
atcgatgtaa gtgagtgttt gctgatcctg ccttgcaggt 60 tgtctcatct
catcatgcac agatcgagct ggggatgtga caacctgcga ggcaggatct 120
gcaagcaccg actgttttgc ataatttctt gcttcctcat gatctgtata 170
* * * * *