U.S. patent application number 10/861928 was filed with the patent office on 2005-06-02 for compositions and methods for polynucleotide sequence determination.
This patent application is currently assigned to Stratagene California. Invention is credited to Arezi, Bahram, Hogrefe, Holly H., Sorge, Joseph A..
Application Number | 20050118609 10/861928 |
Document ID | / |
Family ID | 27609302 |
Filed Date | 2005-06-02 |
United States Patent
Application |
20050118609 |
Kind Code |
A1 |
Sorge, Joseph A. ; et
al. |
June 2, 2005 |
Compositions and methods for polynucleotide sequence
determination
Abstract
The present invention relates to a method for identifying a
nucleotide at a predetermined location on a target polynucleotide.
The method involves single nucleotide extension reaction comprising
an oligonucleotide primer comprising a first sequence and a second
sequence or a tag. The method may further comprises a probe which
hybridizes to the second sequence or an anti-tag molecule which
interacts with the tag, where the hybridization or interaction
causes a detectable signal transfer which is indicative of the
identity of the nucleotide base at the predetermined location. The
invention further provides compositions and kits for performing the
subject method of the invention.
Inventors: |
Sorge, Joseph A.; (Del Mar,
CA) ; Arezi, Bahram; (Carlsbad, CA) ; Hogrefe,
Holly H.; (San Diego, CA) |
Correspondence
Address: |
PALMER & DODGE, LLP
KATHLEEN M. WILLIAMS / STR
111 HUNTINGTON AVENUE
BOSTON
MA
02199
US
|
Assignee: |
Stratagene California
|
Family ID: |
27609302 |
Appl. No.: |
10/861928 |
Filed: |
June 4, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10861928 |
Jun 4, 2004 |
|
|
|
10056598 |
Jan 24, 2002 |
|
|
|
6803201 |
|
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12 |
Current CPC
Class: |
C12Q 1/6818 20130101;
C12Q 1/6827 20130101; C12Q 1/6858 20130101; C12Q 2535/125 20130101;
C12Q 2535/125 20130101; C12Q 2525/161 20130101; C12Q 2525/161
20130101; C12Q 2565/101 20130101; C12Q 2535/125 20130101; C12Q
2525/161 20130101; C12Q 2565/101 20130101; C12Q 1/6827 20130101;
C12Q 1/6818 20130101; C12Q 1/6858 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
1. A method of identifying the presence of a nucleotide at a
predetermined position of a target polynucleotide, said method
comprising: (a) incubating said target polynucleotide in a reaction
mixture comprising an oligonucleotide primer which hybridizes to
said target polynucleotide immediately 3' of said nucleotide, an
oligonucleotide probe which hybridizes to said oligonucleotide
primer and labeled with a first member of a pair of interactive
labels, a polynucleotide chain terminator labeled with a second
member of said pair of interactive labels, wherein said incubating
permits said polynucleotide chain terminator to be incorporated
into said oligonucleotide primer, and permits said oligonucleotide
probe to hybridize to said oligonucleotide primer to permit said
pair of interactive labels to generate a signal; and (b) detecting
said signal, wherein said detection is indicative of the presence
of said nucleotide in said target polynucleotide.
2. A method of identifying the presence of a nucleotide at a
predetermined position of a target polynucleotide, said method
comprising the steps: (a) incubating said target polynucleotide in
a reaction mixture comprising an oligonucleotide primer which
hybridizes to said target polynucleotide immediately 3' of said
nucleotide and a polynucleotide chain terminator labeled with a
second member of a pair of interactive labels, wherein said
incubating permits said polynucleotide chain terminator to be
incorporated into said oligonucleotide primer; (b) incubating the
oligonucleotide primer comprising said second member of said pair
of interactive labels with an oligonucleotide probe labeled with a
first member of said pair of interactive labels, such that
formation of a hybrid between said oligonucleotide probe and said
primer permits said pair of interactive labels to a generate a
signal; and (c) detecting said signal, wherein said detection is
indicative of the presence of said nucleotide in said target
polynucleotide.
3. The method of claim 1 or 2, wherein said signal is generated by
fluorescent resonance energy transfer.
4. The method of claim 1 or 2, wherein said oligonucleotide primer
comprises a first sequence which hybridizes to said target
polynucleotide and a second sequence which does not hybridize to
said target polynucleotide in the presence of a third sequence.
5. The method of claim 4, wherein said oligonucleotide probe
comprises said third sequence which hybridizes to said second
sequence of said oligonucleotide primer.
6. The method of claim 1 or 2, wherein said polynucleotide chain
terminator is incorporated by a polynucleotide synthesis
enzyme.
7. The method of claim 1 or 2, wherein said reaction mixture
further comprises one or more of a second, a third and/or a fourth
polynucleotide chain terminator, wherein said first, second, third
and fourth polynucleotide terminators are not identical.
8. The method of claim 6, wherein said polynucleotide synthesis
enzyme is a JDF-3 DNA polymerase.
9. The method of claim 4, wherein said second sequence is at the 5'
terminal of said first sequence.
10. The method of claim 1 or 2, wherein said oligonucleotide primer
comprises a separation moiety that permits separation of said
oligonucleotide primer from said reaction mixture.
11. The method of claim 10, wherein a target moiety is provided for
said separation moiety to form a specific binding pair for
separation.
12. The method of claim 11, wherein said target moiety is attached
to a solid support.
13. A method of identifying the presence of a nucleotide at a
predetermined position of a target polynucleotide, said method
comprising: (a) incubating said target polynucleotide in a reaction
mixture comprising an anti-tag molecule labeled with a first member
of a pair of interactive labels, a polynucleotide chain terminator
labeled with a second member of said pair of interactive labels,
and an oligonucleotide primer which hybridizes to said target
polynucleotide immediately 3' of the nucleotide, said
oligonucleotide primer covalently coupled to a tag molecule,
wherein said incubating permits said polynucleotide chain
terminator to be incorporated into said oligonucleotide primer, and
said incubating also permits said anti-tag molecule to interact
with said tag molecule on said oligonucleotide primer, so that said
pair of interactive labels generate a signal; and (b) detecting
said signal, wherein said detection is indicative of the presence
of said nucleotide in said target polynucleotide.
14. The method of claim 13, wherein said signal is generated by
fluorescent resonance energy transfer.
15. The method of claim 13, wherein said tag molecule is at 5'
terminal of said oligonucleotide primer.
16. The method of claim 15, wherein said tag molecule comprises a
first member of a specific binding pair which comprises said first
member and a second member.
17. The method of claim 16, wherein said anti-tag molecule
comprises said second member of said specific binding pair.
18. The method of claim 17, wherein said specific binding pair is a
biotin-streptavidin binding pair.
19. The method of claim 1 or 2, wherein one member of the pair of
interactive labels is a quencher molecule.
20. The method of claim 1, 2, or 13, wherein said chain terminator
is one selected from the group consisting of: a dideoxynucleotide
triphosphate, a ribofuranose analog, a reversible nucleotide
terminator, and an acyclic terminator.
21. The method of claim 1, 2, or 13, wherein the target
polynucleotide presents in a sample.
22. A method of identifying the presence of a nucleotide at a
predetermined position of a target polynucleotide, said method
comprising: (a) incubating said target polynucleotide in a reaction
mixture comprising an oligonucleotide primer which hybridizes to
said target polynucleotide immediately 3' of said nucleotide, an
oligonucleotide probe which hybridizes to said oligonucleotide
primer and labeled with a first member of a pair of interactive
labels, a conventional deoxynucleotide labeled with a second member
of said pair of interactive labels, wherein said incubating permits
said labeled conventional deoxynucleotide to be incorporated into
said oligonucleotide primer at a position corresponding to the
predetermined position of the target polynucleotide, and permits
said oligonucleotide probe to hybridize to said oligonucleotide
primer to permit said pair of interactive labels to generate a
signal; and (b) detecting said signal, wherein said detection is
indicative of the presence of said nucleotide in said target
polynucleotide.
23. A method of identifying the presence of a nucleotide at a
predetermined position of a target polynucleotide, said method
comprising the steps: (a) incubating said target polynucleotide in
a reaction mixture comprising an oligonucleotide primer which
hybridizes to said target polynucleotide immediately 3' of said
nucleotide and a conventional deoxynucleotide labeled with a second
member of a pair of interactive labels, wherein said incubating
permits said conventional deoxynucleotide to be incorporated into
said oligonucleotide primer at a position corresponding to the
predetermined position of the target polynucleotide; (b) incubating
the oligonucleotide primer comprising said second member of said
pair of interactive labels with an oligonucleotide probe labeled
with a first member of said pair of interactive labels, such that
formation of a hybrid between said oligonucleotide probe and said
primer permits said pair of interactive labels to a generate a
signal; and (c) detecting said signal, wherein said detection is
indicative of the presence of said nucleotide in said target
polynucleotide.
24. A method of identifying the presence of a nucleotide at a
predetermined position of a target polynucleotide, said method
comprising: (a) incubating said target polynucleotide in a reaction
mixture comprising an anti-tag molecule labeled with a first member
of a pair of interactive labels, a conventional deoxynucleotide
labeled with a second member of said pair of interactive labels,
and an oligonucleotide primer which hybridizes to said target
polynucleotide immediately 3' of the nucleotide, said
oligonucleotide primer covalently coupled to a tag molecule,
wherein said incubating permits said conventional deoxynucleotide
to be incorporated into said oligonucleotide primer at a position
corresponding to the predetermined position of the target
polynucleotide, and said incubating also permits said anti-tag
molecule to interact with said tag molecule on said oligonucleotide
primer, so that said pair of interactive labels generate a signal;
and (b) detecting said signal, wherein said detection is indicative
of the presence of said nucleotide in said target
polynucleotide.
25. The method of claim 22, 23, or 24, wherein the reaction mixture
further comprising at least one unlabeled chain terminator.
Description
FIELD OF THE INVENTION
[0001] This invention relates to the field of polynucleotide
sequence determination, in particular, relates to determine the
identity of a single nucleotide in a target polynucleotide
sequence, e.g., single nucleotide polymorphism ("SNP")
analysis.
BACKGROUND
[0002] Techniques for the analysis of polynucleotide sequences have
found widespread use in basic research, diagnostics, and forensics.
Single nucleotide detection is applied in processes including the
detection of single nucleotide polymorphisms, identification of
single base changes, speciation, determination of viral load,
genotyping, medical marker diagnostics, and the like.
[0003] Single nucleotide detection can be accomplished by a number
of methods. Most methods rely on the use of the polymerase chain
reaction (PCR) to amplify the amount of target DNA. One of the
first developed PCR-dependent methods is restriction site
polymorphism detection, where the PCR product is cleaved by a
restriction enzyme and then analyzed by electrophoresis. Another
early method is allele-specific PCR in which one of the PCR primers
is designed such that it will discriminate at its 3' end between
DNA targets having a sequence that perfectly matches the primer
from those targets not perfectly matching the primer.
[0004] TaqMan was the first homogenous assay capable of detecting
single nucleotide polymorphisms (U.S. Pat. Nos. 5,723,591). In this
assay, two PCR primers flank a central probe oligonucleotide. The
probe oligonucleotide comprises two fluorescent moieties. During
the polymerization step of the PCR process, the polymerase cleaves
the probe oligonucleotide. The cleavage causes the two fluorescent
moieties to become physically separated, which causes a change in
the wavelength of the fluorescent emission. As more PCR product is
created, the intensity of the novel wavelength increases. While
TaqMan accomplishes the goal of single nucleotide detection in a
homogenous assay, it has two disadvantages. The first is that each
nucleotide to be detected requires a different oligonucleotide
probe comprising two different fluorescent moieties. Such probes
must be custom-synthesized and are thus expensive. The second
disadvantage is that TaqMan probes are not very discriminating for
single nucleotide differences. Thus there can be significant
false-positive signals.
[0005] Molecular Beacons are an alternative to TaqMan (U.S. Pat.
Nos. 6,277,607; 6,150,097; 6,037,130). Molecular Beacons undergo a
conformational change upon binding to a perfectly matched template.
The conformational change of the Beacon increases the physical
distance between a fluorophore moiety and a quencher moiety on the
Beacon. This increase in physical distance causes the effect of the
quencher to be diminished, thus increasing the signal derived from
the fluorophore. Molecular Beacons are more discriminating of
single nucleotide differences, as compared with TaqMan probes.
However they still require the synthesis of a custom
oligonucleotide (the Beacon) having two different fluorescent
moieties for each target sequence being examined. Thus the
technology is expensive.
[0006] There are several other fluorescent and enzymatic PCR
technologies, such as Scorpions.TM., Sunrise.TM. primers, and
DNAzymes. Not all of these are suitable for single nucleotide
detection, and most of them require the synthesis of a custom,
fluorescently labeled oligonucleotide for each target
nucleotide.
[0007] Hybridization to a "DNA chip" is another way of detecting
single nucleotide differences (U.S. Pat. No. 5,856,104). Typically
oligonucleotides that are complementary to the suspected target
DNAs are synthesized on a solid surface ("chip" or "oligonucleotide
array"). The target DNA is PCR amplified, labeled, and then
hybridized to the oligonucleotide array. Ideally, perfectly matched
PCR fragments will hybridize to the array, but mismatched fragments
will not. While the technology, in theory, offers the opportunity
to look at many different loci simultaneously, in practice the need
to amplify the target DNA using PCR limits the degree to which the
assay can be multiplexed. In addition the start-up costs for
designing an oligonucleotide microarray can be very expensive.
Lastly, the frequency of false-positive and false-negative spots is
very high, and necessitates the use of many surface-bound
oligonucleotides for each target DNA sequence.
[0008] There currently are two non-PCR based technologies capable
of detecting single nucleotide changes in complex genomes. The
Invader-Squared method (U.S. Pat. No. 6,001,567) utilizes a cascade
of DNA cleavage reactions. While sensitive, it requires the
synthesis of several long, target-specific oligonucleotides in
addition to several detection oligonucleotides. The rolling circle
detection method (Lizardi et al., Nature Genetics 19: 225-232)
utilizes a target nucleotide-specific ligation reaction to create a
circular template that is then replicated with a polymerase in
rolling-circle fashion. One of the advantages is that the reaction
does not require thermal cycling. One drawback is that ligation
reactions are not highly specific for single nucleotide
detection.
[0009] Single base extension ("SBE"; also called minisequencing) is
a technology that uses dideoxy chain terminators in combination
with a DNA polymerase to determine the identity of a single
nucleotide in a target DNA sample that has been PCR amplified
(Syvanen et al., 1990, Genetics 8:684-642; U.S. Pat. No. 5,888,819;
Euoropean patent application EP 0648280 A1, each of which is
incorporated herein by reference). The technology uses a DNA primer
that is hybridized to a target polynucleotide in the presence of
dideoxy chain terminators, but typically in the absence of
deoxynucleotide triphosphates. A DNA polymerase will add a single
dideoxy chain terminator to the 3' end of a primer that is
reasonably hybridized to the DNA target. The polymerase
incorporates the appropriate dideoxy terminator determined by the
complementary sequence in the target polynucleotide. Thus, the
identity of the dideoxy terminator that is incorporated reflects
the identity of the nucleotide within the target polynucleotide
that is immediately adjacent to the target nucleotide that is
hybridized with the 3' nucleotide of the primer.
[0010] There are a number of patents and patent applications for
SBE. In U.S. Pat. No. 6,013,431, the dideoxy chain terminators
would be labeled with reporter moieties, such as fluorescent
molecules, and the incorporation of a label into a primer is
measured by gel electrophoresis. The method described in U.S. Pat.
Nos. 6,015,675; 5,582,989; 5,578,458 relates to placing the primer
on a solid surface, such as a chip. The chip is exposed to a
solution containing the target polynucleotide plus fluorescently
labeled dideoxy chain terminators and polymerase. When a single
labeled base is added to the bound primer, the probe begins to
fluoresce.
[0011] Fluorescence polarization has been used to perform SBE. With
this approach the chain terminators are fluorescently labeled as
with other methods. However rather than separating the labeled
primers by gel electrophoresis or physical separation, the
incorporated chain terminators are generated by shining polarized
light on the sample, and then detecting the polarization of the
emitted fluorescent light. Fluorescent light emitted by
unincorporated terminators will not be polarized because these
small molecules are rapidly moving in solution. However labeled
terminators that have been incorporated onto the end of a primer
will be moving more slowly and tend to emit polarized light. Thus
the degree to which the emitted light is polarized reflects the
degree to which there has been incorporation of a dideoxy chain
terminator onto the end of a primer. The color of the polarized
emitted light reflects the particular dideoxy terminator (A, C, G,
or T) that was incorporated onto the 3' end of the primer. The
advantage to the fluorescent polarization method is that it is
homogeneous (all done in a single test tube). However the input
target DNA is typically a PCR fragment, and the PCR reaction needs
to be performed prior to SBE. Moreover the PCR product needs to be
separated from the PCR primers and deoxynucleotides of the PCR
reaction prior to performing the SBE reaction.
[0012] Another homogenous method has been described in U.S. Pat.
No. 6,177,249. This patent uses fluorescence resonance energy
transfer ("FRET") (Wittwer, et al., 1997, Biotechniques 22:130-138;
Bernard, et al., 1998, Am. J. Pathol. 153:1055-1061). FRET occurs
when two fluorescent molecules are in close physical proximity
(e.g., 10-100 .ANG.), and one of the fluorescent molecules can
absorb light of a wavelength that is emitted by the other
fluorescent molecule. For example, suppose the first fluorescent
molecular is stimulated by blue light and emits green light, and
the second fluorescent molecule is stimulated by green light and
emits red light. If, for example, an oligonucleotide contains both
fluorescent molecules and the primer is illuminated with blue
light, it will emit red light without emitting much green light. In
U.S. Pat. No. 6,177,249 (supra), the SBE primer contains one
fluorescent molecule. The dideoxy chain terminators contain another
(up to 4 different) fluorescent molecules. Upon addition of a
terminator to the 3' end of a primer, FRET can occur. As per the
FRET example above, stimulating blue light would be converted to
green light by the fluorophore on the primer, and then would be
further converted to red light after a terminator has been added to
the primer. The emission of red light would be used to monitor the
degree to which terminators have been added to the primer. One
would use 4 terminators with 4 different emission spectra, but all
capable of being stimulated by the wavelength released by the
primer-bound fluorophore. The advantage to this method is that it
is a homogenous assay, although still requiring a PCR amplification
pre-SBE step for complex genomes. The disadvantage is that the user
must synthesize an expensive, custom oligonucleotide primer for
each target DNA locus being examined.
SUMMARY OF THE INVENTION
[0013] The present invention relates to compositions and methods
for the detection of nucleotides at predetermined locations on a
polynucleotide of interest. The embodiments of the invention
include compositions and methods in which a primer extension
reaction is designed to extend a single nucleotide (single base
extension, SBE) and the incorporation of a labeled chain terminator
is determined by signal transfer.
[0014] The invention provides a composition for identifying a
nucleotide at a predetermined position of a target polynucleotide
in a sample, the composition comprising:
[0015] (a) an oligonucleotide primer comprising a first sequence
which hybridizes to the target polynucleotide immediately 3' of the
nucleotide, and a second sequence which does not hybridize to the
target polynucleotide in the presence of a third sequence; and
[0016] (b) an oligonucleotide probe comprising the third sequence
which hybridizes to the second sequence of the oligonucleotide
primer, the oligonucleotide probe labeled with a first member of a
pair of interactive labels.
[0017] The second sequence of the oligonucleotide primer is
preferably located at the 5' terminal of the first sequence.
[0018] The composition of the invention may also comprise a first
polynucleotide chain terminator, which is incorporated in a
template-dependent manner into the oligonucleotide primer by a
polynucleotide synthesis enzyme.
[0019] The composition of the invention may further comprise one or
more of a second, a third and/or a fourth polynucleotide chain
terminator, where the first, second, third and fourth
polynucleotide terminators are not identical.
[0020] The composition of the invention may still further comprises
a template-dependent polynucleotide synthesis enzyme for
incorporating in a template-dependent manner a complementary
polynucleotide chain terminator into the oligonucleotide
primer.
[0021] Preferably, the first polynucleotide chain terminator of the
subject composition is labeled with a second member of the pair of
interactive labels.
[0022] In a preferred embodiment, one member of the pair of
interactive labels is a quencher molecule.
[0023] In one embodiment of the invention, the first and second
members of the pair of interactive labels interact with each other
to generate a signal by fluorescent resonance energy transfer.
[0024] Preferably, the first and second members of the pair of
interactive labels are fluorescent molecules which interact with
each other to generate a signal by fluorescent resonance energy
transfer.
[0025] Also preferably, the polynucleotide synthesis enzyme of the
subject composition is a JDF-3 DNA polymerase.
[0026] In one embodiment of the invention, the oligonucleotide
primer comprises a separation moiety that permits separation of the
oligonucleotide primer and/or the oligonucleotide probe hybridized
to the primer from unincorporated polynucleotide chain terminator,
and oligonucleotide probe which is not hybridized to the
oligonucleotide primer.
[0027] Preferably, the composition of the subject invention also
provides a target moiety specific for the separation moiety, where
the separation moiety binds to the target moiety to permit the
separation.
[0028] The target moiety of the composition is preferably attached
to a solid support.
[0029] The invention provides another composition for identifying a
nucleotide at a predetermined position of a target polynucleotide
in a sample, the composition comprising:
[0030] (a) an oligonucleotide primer comprising a first sequence
which hybridizes to the target polynucleotide immediately 3' of the
nucleotide, and is covalently attached to a tag molecule; and
[0031] (b) an anti-tag molecule which binds to the tag molecule,
the anti-tag molecule labeled with a first member of a pair of
interactive labels.
[0032] The tag molecule of the subject composition is preferably
located on the 5' terminal of the oligonucleotide primer.
[0033] Preferably, the tag molecule is a first member of a specific
binding pair which comprises the first member and a second
member.
[0034] Also preferably, the anti-tag molecule is the second member
of the specific binding pair.
[0035] In one embodiment, the specific binding pair is a
biotin-streptavidin pair.
[0036] The invention provides a kit for identifying a nucleotide at
a predetermined position of a target polynucleotide in a sample,
the kit comprising:
[0037] (a) an oligonucleotide primer comprising a first sequence
which hybridizes to the target polynucleotide immediately 3' of the
nucleotide, and a second sequence which does not hybridize to the
target polynucleotide in the presence of a third sequence;
[0038] (b) an oligonucleotide probe comprising the third sequence
which hybridizes to the second sequence of the oligonucleotide
primer, the oligonucleotide probe labeled with a first member of a
pair of interactive labels; and
[0039] (c) packaging materials therefore.
[0040] The kit of the subject invention may also comprise a
polynucleotide chain terminator, which can be incorporated in a
template-dependent manner into the oligonucleotide primer by a
polynucleotide synthesis enzyme.
[0041] The kit of the subject invention may further comprise one or
more of a second, a third and/or a fourth polynucleotide chain
terminator, where the first, second, third and fourth
polynucleotide terminators are not identical.
[0042] The polynucleotide chain terminator of the kit is preferably
labeled with a second member of the pair of interactive labels.
[0043] The kit of the subject kit may still further comprise a
template-dependent polynucleotide synthesis enzyme for
incorporating in a template-dependent manner a complementary
polynucleotide chain terminator into the oligonucleotide
primer.
[0044] Preferably, the polynucleotide synthesis enzyme is a JDF-3
DNA polymerase.
[0045] The invention provides a kit for identifying a nucleotide at
a predetermined position of a target polynucleotide in a sample,
the kit comprising:
[0046] (a) an oligonucleotide primer comprising a first sequence
which hybridizes to the target polynucleotide immediately 3' of the
nucleotide, and is covalently attached to a tag molecule;
[0047] (b) an anti-tag molecule which binds to the tag molecule,
the anti-tag molecule being labeled with a first member of a pair
of interactive labels; and
[0048] (c) packaging materials therefore.
[0049] The tag molecule of the subject kit is preferably a first
member of a specific binding pair which comprises the first member
and a second member.
[0050] Preferably, the anti-tag molecule is the second member of
the specific binding pair.
[0051] In one embodiment of the invention, the specific binding
pair comprises a biotin-streptavidin pair.
[0052] The invention provides a method of identifying the presence
of a nucleotide at a predetermined position of a target
polynucleotide, the method comprising:
[0053] (a) incubating the target polynucleotide in a reaction
mixture comprising an oligonucleotide primer which hybridizes to
the target polynucleotide immediately 3' of the nucleotide, an
oligonucleotide probe which hybridizes to the oligonucleotide
primer and labeled with a first member of a pair of interactive
labels, a polynucleotide chain terminator labeled with a second
member of the pair of interactive labels, where the incubating
permits the polynucleotide chain terminator to be incorporated into
the oligonucleotide primer, and permits the oligonucleotide probe
to hybridize to the oligonucleotide primer to permit the pair of
interactive labels to generate a signal; and
[0054] (b) detecting the signal, where the detection is indicative
of the presence of the nucleotide in the target polynucleotide.
[0055] The invention also provides a method of identifying the
presence of a nucleotide at a predetermined position of a target
polynucleotide, the method comprising the steps:
[0056] (a) incubating the target polynucleotide in a reaction
mixture comprising an oligonucleotide primer which hybridizes to
the target polynucleotide immediately 3' of the nucleotide and a
polynucleotide chain terminator labeled with a second member of a
pair of interactive labels, where the incubating permits the
polynucleotide chain terminator to be incorporated into the
oligonucleotide primer;
[0057] (b) incubating the oligonucleotide primer comprising the
second member of the pair of interactive labels with an
oligonucleotide probe labeled with a first member of the pair of
interactive labels, such that formation of a hybrid between the
oligonucleotide probe and the primer permits the pair of
interactive labels to a generate a signal; and
[0058] (c) detecting the signal, where the detection is indicative
of the presence of the nucleotide in the target polynucleotide.
[0059] In one embodiment of the invention, the signal is generated
by fluorescent resonance energy transfer.
[0060] In a preferred embodiment, the oligonucleotide primer
comprises a first sequence which hybridizes to the target
polynucleotide and a second sequence which does not hybridize to
the target polynucleotide in the presence of a third sequence.
[0061] Preferably, the second sequence on the oligonucleotide
primer is located at the 5' terminal of the first sequence.
[0062] Also preferably, the oligonucleotide probe comprises the
third sequence which hybridizes to the second sequence of the
oligonucleotide primer.
[0063] In one embodiment, the polynucleotide chain terminator is
incorporated by a polynucleotide synthesis enzyme.
[0064] The reaction mixture of the subject method may also comprise
one or more of a second, a third and/or a fourth polynucleotide
chain terminator, where the first, second, third and fourth
polynucleotide terminators are not identical.
[0065] Preferably, the polynucleotide synthesis enzyme is a JDF-3
DNA polymerase.
[0066] The oligonucleotide primer of the subject method may
comprise a separation moiety that permits separation of the
oligonucleotide primer from the reaction mixture.
[0067] Preferably, a target moiety is provided in the subject
method for the separation moiety to form a specific binding pair
for separation.
[0068] In one embodiment, the target moiety is attached to a solid
support.
[0069] The invention provides a method for identifying the presence
of a nucleotide at a predetermined position of a target
polynucleotide, the method comprising:
[0070] (a) incubating the target polynucleotide in a reaction
mixture comprising an anti-tag molecule labeled with a first member
of a pair of interactive labels, a polynucleotide chain terminator
labeled with a second member of the pair of interactive labels, and
an oligonucleotide primer which hybridizes to the target
polynucleotide immediately 3' of the nucleotide, the
oligonucleotide primer covalently coupled to a tag molecule, where
the incubating permits the polynucleotide chain terminator to be
incorporated into the oligonucleotide primer, and the incubating
also permits the anti-tag molecule to interact with the tag
molecule on the oligonucleotide primer, so that the pair of
interactive labels generate a signal; and (b) detecting the signal,
where the detection is indicative of the presence of the nucleotide
in the target polynucleotide.
[0071] In a preferred embodiment, the signal is generated by
fluorescent resonance energy transfer.
[0072] In another preferred embodiment, one member of the pair of
interactive labels is a quencher molecule.
[0073] Preferably, the tag molecule is located at 5' terminal of
the oligonucleotide primer.
[0074] The tag molecule of the subject method may comprise a first
member of a specific binding pair which comprises the first member
and a second member.
[0075] The anti-tag molecule may comprise the second member of the
specific binding pair.
[0076] In one embodiment, the specific binding pair is a
biotin-streptavidin binding pair.
[0077] The chain terminator of the invention may be one selected
from the group consisting of: a dideoxynucleotide triphosphate, a
ribofuranose analog, a reversible nucleotide terminator, and an
acyclic terminator.
[0078] The target polynucleotide of the invention may present in a
sample.
BRIEF DESCRIPTION OF DRAWINGS
[0079] FIG. 1 illustrates the hybridization of an oligonucleotide
probe comprising a third sequence which hybridizes to an
oligonucleotide primer comprising a first and a second sequences
and an incorporated chain terminator in one embodiment of the
invention. The probe is labeled with a first member of a pair of
interactive labels. Chain terminators (L1 to L4) are used, each
labeled with a different second member of the pair of interactive
labels. Each terminator will emit a different signal (e.g., color)
when stimulated by the stimulus (F) coming from the oligonucleotide
probe. The signal form each terminator is generated by FRET.
[0080] FIG. 2 illustrates the use of a tag and anti-tag pair to
replace the primer-probe interaction of FIG. 1 in one embodiment of
the invention.
[0081] FIG. 3 illustrates the use of an oligonucleotide probe which
is fully complementary to the oligonucleotide primer in one
embodiment. FRET signal is generated between two members (dye 1 and
dye 2) of a pair of interactive labels present on ddNTP and the
probe.
[0082] FIG. 4 illustrates that the positive control (A4 well) shows
a ROX signal increase due to FRET from Fluorescein compared to the
negative control (A3 well) according to one embodiment of the
invention.
[0083] FIG. 5 illustrates that the positive control (B2 well) shows
a ROX signal increase due to FRET from Fluorescein compared to the
negative control (B1 well) according to one embodiment of the
invention.
[0084] FIG. 6 illustrates the use of a quencher molecule according
to one embodiment of the invention.
[0085] FIG. 7 demonstrates a ROX signal decrease for the positive
control due to quenching of ROX fluorescence by BHQ2 upon
incorporation of ROX-ddC according to one embodiment of the
invention.
DETAILED DESCRIPTION OF THE INVENTION
[0086] Definitions
[0087] "Target polynucleotide" refers to a polynucleotide having a
sequence, to which the presence or absence or identity of at least
one nucleotide is to be determined, i.e., by primer extension,
conventional sequencing or mini-sequencing. In the context of a
preferred application of the method according to the present
invention, a target polynucleotide comprises a nucleotide at a
predetermined position of the target polynucleotide whose presence
or absence or identity in the target polynucleotide is to be
determined. The terms "nucleotide" and "nucleotide base" are used
interchangeably. A target polynucleotide may be a length between 10
kb and 10 base pairs, e.g., 1 kb-50 base pairs, or 500 base
pairs-100 base pairs. A target polynucleotide of the invention may
be a naturally occurring polynucleotide (i.e., one existing in
nature without human intervention), or a recombinant polynucleotide
(i.e., one existing only with human intervention).
[0088] According to the invention, a nucleotide can be modified,
biotinylated, radiolabeled, and the like and also include
phosphorothioate, phosphite, ring atom modified derivatives, and
the like. The term "nucleotide" includes the derivatives and
analogs thereof and includes dNTPs and ddNTPs.
[0089] A nucleotide "position" as used herein refers to the
location of a given single base within a polynucleotide, including
an oligonucleotide.
[0090] A "polynucleotide" is a covalently linked sequence of
nucleotides (i.e., ribonucleotides for RNA and deoxyribonucleotides
for DNA) in which the 3' position of the pentose of one nucleotide
is joined by a phosphodiester group to the 5' position of the
pentose of the next. "Polynucleotide" includes, without limitation,
single- and double-stranded polynucleotide. The term
"polynucleotide" as it is employed herein embraces chemically,
enzymatically or metabolically modified forms of polynucleotide.
"Polynucleotide" also embraces a short polynucleotide, often
referred to as an oligonucleotide.
[0091] A polynucleotide or an oligonucleotide (e.g., the
oligonucleotide primer or the oligonucleotide probe) has a
"5'-terminus" (5' end) and a "3'-terminus" (3' end) because
polynucleotide phosphodiester linkages occur to the 5' carbon and
3' carbon of the pentose ring of the substituent mononucleotides.
The end of a polynucleotide at which a new linkage would be to a 5'
carbon is its 5' terminal nucleotide. The end of a polynucleotide
at which a new linkage would be to a 3' carbon is its 3' terminal
nucleotide. A terminal nucleotide, as used herein, is the
nucleotide at the end position of the 3'- or 5'-terminus. As used
herein, a polynucleotide sequence, even if internal to a larger
polynucleotide (e.g., a sequence region within a polynucleotide),
also can be said to have 5'- and 3'-ends.
[0092] Oligonucleotides are typically less than 150 nucleotides
long (e.g., between 5 and 150, preferably between 10 to 100, more
preferably between 15 to 50 nucleotides in length), however, as
used herein, the term is also intended to encompass longer or
shorter polynucleotide chains. Oligonucleotides can form secondary
and tertiary structures by self-hybridizing or by hybridizing to
other polynucleotides, therefore serving as primers for
polynucleotide chain extension. Such structures can include, but
are not limited to, duplexes, hairpins, cruciforms, bends, and
triplexes.
[0093] As used herein, an "oligonucleotide primer" is an
oligonucleotide comprising a sequence complementary to a target
polynucleotide. An oligonucleotide, according to the invention,
hybridizes to a target polynucleotide through base pairing so to
initiate an elongation (extension) reaction to incorporate a
nucleotide into the oligonucleotide primer. An "oligonucleotide
primer" according to the present invention, may comprise a first
sequence that hybridizes to a target polynucleotide immediately 3'
of a nucleotide at a predetermined location. An "oligonucleotide
primer" may comprise a first sequence which hybridizes to a target
polynucleotide and a second sequence which does not hybridize to
the target polynucleotide in the presence of a third sequence. The
first sequence or the second sequence of an oligonucleotide may be
between 10 to 100 nucleotides in length, preferably between 15-50
nucleotides in length. A common second sequence may be used for a
number of oligonucleotide primers comprising the same first
sequence. An oligonucleotide primer useful in the present invention
may be covalently coupled to a tag molecule.
[0094] An "oligonucleotide probe" is an oligonucleotide comprising
a third sequence which is complementary to the oligonucleotide
primer. One or more oligonucleotide probes can be made, each
comprising a different sequence complementary to the
oligonucleotide primer. An "oligonucleotide probe" according to the
invention, may be between 10 to 100 nucleotides in length,
preferably between 15-50 nucleotides in length. When an
oligonucleotide probe is designed to complement to a common second
sequence on a number of oligonucleotide primers, the
oligonucleotide probe is also referred to as a universal probe for
the number of oligonucleotide primers.
[0095] As used herein, an "oligonucleotide hybridizing to a target
polynucleotide immediately 3"of a nucleotide" is an oligonucleotide
comprising a first sequence that is complementary to the target
polynucleotide. The oligonucleotide has a 3' terminal nucleotide
complementary to the nucleotide next to the 3' end of the
nucleotide, with no nucleotides in between the position of the 3'
terminal nucleotide of the oligonucleotide and the position of the
3' end of the nucleotide. The hybridization of the oligonucleotide
to the immediately 3' of the nucleotide of the target
polynucleotide allows the incorporation of a nucleotide or a
nucleotide analog (e.g., a ddNTP), in a template dependent manner,
into the oligonucleotide at the position corresponding to the
predetermined nucleotide of the target polynucleotide.
[0096] A "tag molecule" refers to a molecule covalently coupled to
an oligonucleotide primer. An "anti-tag molecule" refers to a
molecule which interacts with the tag molecule through specific
binding. An anti-tag molecule useful in the invention may be
further labeled with a member of a pair of interactive labels. The
tag and anti-tag molecule pair allows the interaction of a labeled
anti-tag molecule with an oligonucleotide primer which may comprise
an incorporated labeled polynucleotide chain terminator. A tag
molecule and its corresponding anti-tag molecule, according to the
invention, can be members of a specific binding pair. It is not
critical for either a tag molecule or an anti-tag molecule to be a
specific member of a specific binding pair, so long as it permits
the binding between the members of the specific binding pair.
[0097] As used herein, a "specific binding pair" refers to two
different molecules, where one molecule has an area on the surface
or in a cavity which specifically binds to and is thereby defined
as complementary with a particular spatial and polar organization
of the other molecule. The two molecules of a specific binding pair
may also comprise complementary sequences and form the specific
binding through base-pairing. A "specific binding pair", according
to the invention, include, but are not limited to members of an
immunological pair such as antigen-antibody, or an
operator-repressor, nuclease-nucleotide, biotin-streptavidin,
ligand-receptor pair, polynucleotide duplexes, IgG-protein A,
DNA-DNA, DNA-RNA.
[0098] A specific binding pair can be used to separate an
oligonucleotide primer or an oligonucleotide probe from a target
polynucleotide when desired. The two different molecules in such a
specific binding pair can also be referred to as a separation
moiety and a target moiety. As used herein, a "separation moiety"
is the molecule of a specific binding pair which is coupled to the
oligonucleotide primer or the oligonucleotide probe. A "target
moiety" refers to the other molecule of the specific binding pair
which is optionally coupled to a solid support. "Separation", as
used herein refers to physically separating one molecule from
another molecule, for example, separating an oligonucleotide primer
or an oligonucleotide primer/probe duplex from an unincorporated
chain terminator or from an unhybridized oligonucleotide probe.
[0099] As used herein, a "solid support" refers to a porous or
non-porous water insoluble material. The support can be hydrophilic
or capable of being rendered hydrophilic and includes inorganic
powders such as silica, magnesium sulfate and alumina; natural
polymeric materials, particularly cellulosic materials and
materials derived from cellulose, such as fiber containing papers,
e.g., filter paper, chromatographic paper, etc.; synthetic or
modified naturally occurring polymers, such as nitrocellulose,
cellulose acetate, polyvinyl chloride, polyacrylamide, cross-linked
dextran, agarose, polyacrylate, polyethylene, polypropylene,
poly(4-methylbutene), polystyrene, polymethacrylate, polyethylene
terephthalate, nylon, polyvinyl butyrate, etc.; either used by
themselves or in conjunction with other materials; glass available
as Bioglass, ceramics, metals, and the like. A "solid support" also
include magnetic particle such as magnetic beads and such as
disclosed in U.S. Pat. Nos. 5,898,071 and 5,705,628. Natural or
synthetic assemblies such as liposomes, phospholipid vesicles and
cells can also be employed.
[0100] Binding of a specific binding pair molecule to a support or
surface may be accomplished by well-known techniques, commonly
available in the literature. See, for example, "Immobilized
Enzymes," Ichiro Chibata, Halsted Press, New York (1978) and
Cuatrecasas, J. Biol. Chem., 245:3059 (1970). The surface can have
any one of a number of shapes, such as strip, rod, particle or
bead.
[0101] As used herein, "non-conventional nucleotide" refers to a) a
nucleotide structure that is not one of the four conventional
deoxynucleotides dATP, dCTP, dGTP, and dTTP recognized by and
incorporated by a DNA polymerase, b) a synthetic nucleotide, c) a
modified conventional nucleotide, or d) a ribonucleotide (since
they are not normally recognized or incorporated by DNA
polymerases) and modified forms of a ribonucleotide.
Non-conventional nucleotides include but are not limited to those
listed in Table 1, which are commercially available, for example,
from New England Nuclear.
[0102] "Complementary" refers to the broad concept of sequence
complementarity between regions of two polynucleotide strands or
between two regions of the same polynucleotide strand. It is known
that an adenine base of a first polynucleotide region is capable of
forming specific hydrogen bonds ("base pairing") with a base of a
second polynucleotide region which is antiparallel to the first
region if the base is thymine or uracil. Similarly, it is known
that a cytosine base of a first polynucleotide strand is capable of
base pairing with a base of a second polynucleotide strand which is
antiparallel to the first strand if the base is guanine. A first
region of a polynucleotide is complementary to a second region of
the same or a different polynucleotide if, when the two regions are
arranged in an antiparallel fashion, at least one nucleotide of the
first region is capable of base pairing with a base of the second
region. A first polynucleotide that is 100% complementary to a
second polynucleotide forms base pair at every nucleotide position.
A first polynucleotide that is not 100% complementary (e.g., 90%,
or 80% or 70% complementary) contains mismatched nucleotides at one
or more nucleotide positions.
[0103] As used herein, a "detectable marker" or a "detectable
label" refers to a molecule capable of generating a detectable
signal. A "detectable marker" may be detected directly or
detectable through a specific binding reaction that generates a
detectable signal. The label can be isotopic or non-isotopic,
usually non-isotopic, and can be a catalyst, such as an enzyme
(also referred to as an enzyme label), a polynucleotide coding for
a catalyst, promoter, dye, fluorescent molecule (also referred to
as a fluorescent label), chemiluminescer (also referred to as a
chemiluminescent label), coenzyme, enzyme substrate, radioactive
group (also referred to as a radiolabel), a small organic molecule,
amplifiable polynucleotide sequence, a particle such as latex or
carbon particle, metal sol, crystallite, liposome, cell, etc.,
which may or may not be further labeled with a dye (also referred
to as a colorimetric label), catalyst or other detectable group,
and the like. The label may be a directly detectable label or may
be a member of a signal generating system, and thus can generate a
detectable signal in context with other members of the signal
generating system, e.g., a biotin-avidin signal generation system.
The label can be bound directly to a nucleotide or a polynucleotide
sequence or indirectly via a linker.
[0104] The preferred labels, according to the invention, are
members of a pair of interactive labels. The members of a pair of
"interactive labels" generates a detectable signal when brought in
close proximity. The signals generated is preferably detectable by
visual examination methods well known in the art, preferably by a
fluorescence resonance energy transfer assay (FRET) (Stryer et al.,
1978, Ann. Rev. Biochem., 47:819; Selvin, 1995, Methods Enzymol.,
246:300).
[0105] First and second members of a pair of interactive labels may
be a donor and an acceptor, a receptor and a quencher, or vice
versa. As used herein, the term "donor" refers to a fluorophore
which absorbs at a first wavelength and emits at a second, longer
wavelength. The term "acceptor" refers to a fluorophore,
chromophore or quencher with an absorption spectrum which overlaps
the donor's emission spectrum and is able to absorb some or most of
the emitted energy from the donor when it is near the donor group
(typically between 1-100 nm). If the acceptor is a fluorophore
capable of exhibiting FRET, it then re-emits at a third, still
longer wavelength; if it is a chromophore or quencher, then it
releases the energy absorbed from the donor without emitting a
photon. Although the acceptor's absorption spectrum overlaps the
donor's emission spectrum when the two groups are in proximity,
this need not be the case for the spectra of the molecules when
free in solution. Acceptors thus include fluorophores, chromophores
or quenchers that, following attachment to either a chain
terminator or to an anti-tag molecule, show alterations in
absorption spectrum which permit the group to exhibit either FRET
or quenching when placed in proximity to the donor through the
binding interactions of the anti-tag molecule and a tag molecule
comprising the chain terminator.
[0106] As used herein, a "reporter molecule" is a molecule capable
of generating a fluorescence signal. A "quencher molecule" is a
molecule capable of absorbing the fluorescence energy of an excited
reporter molecule, thereby quenching the fluorescence signal that
would otherwise be released from the excited reporter molecule. In
order for a quencher molecule to quench an excited fluorophore, the
quencher molecule must be within a minimum quenching distance of
the excited reporter molecule at some time prior to the reporter
molecule releasing the stored fluorescence energy.
[0107] According the invention, a pair of interactive labels may
comprise more than one second member, each second member can
interact with the same first member of the pair of interactive
labels and generate a distinguishable signal transfer which is
indicative of the identity of each of the second member.
[0108] As used herein, references to "fluorescence" or "fluorescent
groups" or "fluorophores" include luminescence and luminescent
groups, respectively.
[0109] As used herein, the term "hybridization" is used in
reference to the pairing of complementary polynucleotide strands.
Hybridization and the strength of hybridization (i.e., the strength
of the association between polynucleotide strands) is impacted by
many factors well known in the art including the degree of
complementarity between the polynucleotides, stringency of the
conditions involved affected by such conditions as the
concentration of salts, the Tm (melting temperature) of the formed
hybrid, the presence of other components (e.g., the presence or
absence of polyethylene glycol), the molarity of the hybridizing
strands and the G:C content of the polynucleotide strands.
[0110] As used herein, the term "stringency" is used in reference
to the conditions of temperature, ionic strength, and the presence
of other compounds, under which polynucleotide hybridizations are
conducted. With "high stringency" conditions, polynucleotide
pairing will occur only between polynucleotide fragments that have
a high frequency of complementary base sequences. Thus, conditions
of "weak" or "low" stringency are often required when it is desired
that polynucleotides which are not completely complementary to one
another be hybridized or annealed together. The art knows well that
numerous equivalent conditions can be employed to comprise high or
low stringency conditions.
[0111] As used herein, "high stringency conditions" refer to
temperature and ionic condition used during polynucleotide
hybridization and/or washing. The extent of "high stringency" is
nucleotide sequence dependent and also depends upon the various
components present during hybridization. Generally, highly
stringent conditions are selected to be about 5 to 20 degrees C.
lower than the thermal melting point (Tm) for the specific sequence
at a defined ionic strength and pH. The Tm is the temperature
defined by the following equation: T.sub.m=69.3+0.41.times.(G-
+C)%-650/L, wherein L is the length of the probe in nucleotides.
"High stringency conditions", as used herein, refer to a washing
procedure including the incubation of two or more hybridized
polynucleotides in an aqueous solution containing 0.1.times.SSC and
0.2% SDS, at room temperature for 2-60 minutes, followed by
incubation in a solution containing 0.1.times.SSC at room
temperature for 2-60 minutes. "High stringency conditions" are
known to those of skill in the art, and may be found in, for
example, Maniatis et al., 1982, Molecular Cloning, Cold Spring
Harbor Laboratory and Schena, ibid.
[0112] As used herein, "low stringency conditions" refer to a
washing procedure including the incubation of two or more
hybridized polynucleotides in an aqueous solution comprising
1.times.SSC and 0.2% SDS at room temperature for 2-60 minutes.
[0113] As used herein, the term "Tm" is used in reference to the
"melting temperature". The melting temperature is the temperature
at which 50% of a population of double-stranded polynucleotide
molecules becomes dissociated into single strands. The equation for
calculating the Tm of polynucleotides is well-known in the art. The
Tm of a hybrid polynucleotide is often estimated using a formula
adopted from hybridization assays in 1 M salt, and commonly used
for calculating Tm for PCR primers: [(number of
A+T).times.2.degree. C.+(number of G+C).times.4.degree. C.], see,
for example, C. R. Newton et al. PCR, 2nd Ed., Springer-Verlag (New
York: 1997), p. 24. This formula was found to be inaccurate for
primers longer that 20 nucleotides. Other more sophisticated
computations exist in the art which take structural as well as
sequence characteristics into account for the calculation of Tm. A
calculated Tm is merely an estimate; the optimum temperature is
commonly determined empirically.
[0114] "Polynucleotide chain terminator", or "chain terminator", or
"terminator" means any nucleotide that when incorporated into a
primer extension product prevents the further extension of such
primer extension product. One requirement of a nucleotide
terminator is that when the nucleotide terminator includes a
ribofuranose sugar portion, the 3'-position must not have a hydroxy
group capable of being subsequently used by a polymerase to
incorporate additional nucleotides, e.g., dideoxyadenosine
triphosphate (ddATP), dideoxycytosine triphosphate (ddCTP),
dideoxyguanosine triphosphate (ddGTP), dideoxythymidine
triphosphate (ddTTP), or dideoxyuridine triphosphate (ddUTP).
Alternatively, a ribofuranose analog could be used, such as
arabinose. Exemplary nucleotide terminators include
2',3'-dideoxy-.beta.-D-ribofuran- osyl, .beta.-D-arabinofuranosyl,
3'-deoxy-.beta.-D-arabinofuranosyl,
3'-amino-2',3'-dideoxy-.beta.-D-riboftranosyl, and
2',3'-dideoxy-3'-fluoro-.beta.-D-ribofuranosyl (Chidgeavadze).
Nucleotide terminators also include reversible nucleotide
terminators (Metzker) and acyclic terminators.
[0115] "Primer extension reaction" or "chain elongation reaction"
means a reaction between a target-primer hybrid and a nucleotide
which results in the addition of the nucleotide to a 3'-end of the
primer such that the incorporated nucleotide is complementary to
the corresponding nucleotide of the target polynucleotide. Primer
extension reagents typically include (i) a polymerase enzyme; (ii)
a buffer; and (iii) one or more extendible nucleotides. Both
conventional sequencing and mini-sequencing act as primer extension
reactions until a nucleotide terminator is incorporated.
Mini-sequencing reagents, according to the present invention may
comprise an extendible nucleotide.
[0116] As used herein, "polymerase chain reaction" or "PCR" refers
to an in vitro method for amplifying a specific polynucleotide
template sequence. The PCR reaction involves a repetitive series of
temperature cycles and is typically performed in a volume of 50-100
.mu.l. The reaction mix comprises dNTPs (each of the four
deoxynucleotides dATP, dCTP, dGTP, and dTTP), primers, buffers, DNA
polymerase, and polynucleotide template. One PCR reaction may
consist of 5 to 100 "cycles" of denaturation and synthesis of a
polynucleotide molecule.
[0117] As used herein, "polynucleotide polymerase" refers to an
enzyme that catalyzes the polymerization of nucleotide. Generally,
the enzyme will initiate synthesis at the 3'-end of the primer
annealed to a polynucleotide template sequence, and will proceed
toward the 5' terminal of the template strand. "DNA polymerase"
catalyzes the polymerization of deoxynucleotides. Useful DNA
polymerases include, but are not limited to, Pyrococcus furiosus
(Pfu) DNA polymerase (Lundberg et al., 1991, Gene, 108:1; U.S. Pat.
No. 5,556,772, incorporated herein by reference), Thermus
thermophilus (Tth) DNA polymerase (Myers and Gelfand 1991,
Biochemistry 30:7661), Bacillus stearothermophilus DNA polymerase
(Stenesh and McGowan, 1977, Biochim Biophys Acta 475:32),
Thermococcus litoralis (Tli) DNA polymerase (also referred to as
Vent DNA polymerase, Cariello et al., 1991, Polynucleotides Res,
19: 4193), Thermotoga maritima (Tma) DNA polymerase (Diaz and
Sabino, 1998 Braz J. Med. Res, 31:1239), Pyrococcus kodakaraensis
KOD DNA polymerase (Takagi et al., 1997, Appl. Environ. Microbiol.
63:4504), JDF-3 DNA polymerase (Patent application WO 0132887), and
Pyrococcus GB-D (PGB-D) DNA polymerase (Juncosa-Ginesta et al.,
1994, Biotechniques, 16:820). The polymerase activity of any of the
above enzyme can be defined by means well known in the art. One
unit of DNA polymerase activity, according to the subject
invention, is defined as the amount of enzyme which catalyzes the
incorporation of 10 nmoles of total dNTPs into polymeric form in 30
minutes at optimal temperature.
[0118] DNA polymerases used in the present invention are preferred
to have reduced discrimination against non-conventional
nucleotides.
[0119] As used herein, "discrimination" refers to the tendency of
DNA polymerase to not carry out the incorporation of
non-conventional nucleotides into the nascent DNA polymer. DNA
polymerase has the ability to sense nucleotide structure, including
but not limited to nucleotide complementarity, and structural
features of the sugar and heterocyclic base, thereby allowing DNA
polymerase to preferentially utilize conventional deoxynucleotides
rather than non-conventional nucleotides for incorporation into a
nascent polymer. DNA polymerase strongly prefers to incorporate the
conventional deoxynucleotides dATP, dCTP, dGTP and dTTP into DNA
polymers; the polymerase is unlikely to progress with an
unconventional nucleotide in its binding pocket.
[0120] As used herein, "reduced discrimination" refers to a
reduction in the tendency of a DNA polymerase to exclude
non-conventional nucleotides from, or to not incorporate
non-conventional nucleotides into, a nascent DNA polymer as
compared to the natural tendency of the DNA polymerase. The
preference of DNA polymerase to incorporate the conventional
deoxynucleotides dATP, dCTP, dGTP and TTP rather than
non-conventional nucleotides into DNA polymers is thereby reduced
compared to the natural level of preference, such that
non-conventional nucleotides are more readily incorporated into DNA
polymers by DNA polymerase. Discrimination may be quantitated by
measuring the concentration of a non-conventional nucleotide
necessary to inhibit the incorporation of the corresponding
conventional nucleotide by 50%. This concentration is referred to
herein as the "150%" for a non-conventional nucleotide.
Discrimination against a given non-conventional nucleotide is
"reduced" if the 150% for that non-conventional nucleotide is
reduced by at least two fold relative to an identical assay
containing, in place of the mutant DNA polymerase, a parental DNA
polymerase. Alternatively, reduced discrimination may be
quantitated by determining the amount of a non-conventional
nucleotide (for example, a dideoxynucleotide, ribonucleotide, or
cordycepin) necessary in a reaction with a mutant enzyme to
generate a sequencing ladder comparable to a sequencing ladder
produced using the wild-type or parental enzyme. For this type of
assay, a constant amount of dNTPs and varying amounts of
non-conventional nucleotides are used to generate a sequencing
ladder with both the wild-type or parental enzyme and the mutant
enzyme (for ribonucleotides, a sequencing ladder is generated by
alkalai cleavage of the polymerization products). The sequencing
ladders are then examined in the range of 1 to 400 bases from the
primer. For details of this type of assay, see Gardner & Jack,
1999, supra. A mutant exhibits reduced discrimination of it
requires at least two-fold less, five-fold less, ten-fold less, or
an even greater fold smaller in the amount of the non-conventional
nucleotide to produce a sequencing ladder comparable (with respect
to the length of extension products generated) to that generated by
the wild-type or parental enzyme using a given amount of nucleotide
analog.
[0121] As used herein, "3' to 5' exonuclease deficient" or "3' to
5' exo.sup.-" refers to an enzyme that substantially lacks the
ability to remove incorporated nucleotides from the 3' terminal of
a DNA polymer. DNA polymerase exonuclease activities, such as the
3' to 5' exonuclease activity exemplified by members of the Family
B polymerases, can be lost through mutation, yielding an
exonuclease-deficient polymerase. As used herein, a DNA polymerase
that is deficient in 3' to 5' exonuclease activity substantially
lacks 3' to 5' exonuclease activity. "Substantially lacks"
encompasses a complete lack of activity, 0.03%, 0.05%, 0.1%, 1%,
5%, 10%, 20% or even up to 50% of the exonuclease activity relative
to the parental enzyme.
[0122] The term "sample" as used herein is used in its broadest
sense. A sample may comprise a cell, chromosomes isolated from a
cell (e.g., a spread of metaphase chromosomes), genomic DNA, RNA,
cDNA and the like.
[0123] A "single nucleotide polymorphism" or SNP, as used herein,
is a variation from the most frequently occurring base at a
particular polynucleotide position.
[0124] The invention relates to improved methods and assays for
identifying a nucleotide at a predetermined location on a target
polynucleotide. A nucleotide is identified by incorporating into an
oligonucleotide primer a labeled terminator that base pairs with
the nucleotide having identity to be determined. The
oligonucleotide primer comprises a first sequence which is
complementary to and hybridize to the target polynucleotide.
[0125] In a preferred embodiment, the oligonucleotide primer also
comprises a second sequence which does not hybridize to the target
polynucleotide. In this embodiment, a labeled oligonucleotide probe
comprising a third sequence hybridizes to the oligonucleotide
primer after the incorporation of the labeled terminator and cause
the generation of a signal by energy transfer (e.g., FRET). The
signal indicates the identity of the nucleotide to be determined.
The improvement relates to the use of an oligonucleotide primer
with a second sequence, preferably at the 5' terminal of the
oligonucleotide primer, and a labeled oligonucleotide probe which
is capable of hybridizing to the second sequence of the
oligonucleotide primer. By employing the second sequence on the
oligonucleotide primer and the oligonucleotide probe, one can
design a common second sequence for a number of different
oligonucleotide primers and therefore use a common oligonucleotide
probe to hybridize to the common second sequence. The label on the
probe can interact with the label on an incorporated polynucleotide
chain terminator to generate an energy transfer. The
oligonucleotide primer itself needs not to be labeled. Therefore
the requirement for synthesizing an expensive, fluorescently
labeled primer for each target polynucleotide locus being examined
is eliminated.
[0126] The subject methods and assays include incubating a target
polynucleotide in a reaction mixture comprising an oligonucleotide
primer which hybridizes to the target polynucleotide immediately 3'
of the nucleotide, an oligonucleotide probe which hybridizes to the
oligonucleotide primer and labeled with a first member of a pair of
interactive labels, a polynucleotide chain terminator labeled with
a second member of the pair of interactive labels, where the
incubating permits the polynucleotide chain terminator to be
incorporated into said oligonucleotide primer, and allows the
oligonucleotide probe to hybridize to the oligonucleotide primer to
permit the pair of interactive labels to generate a signal by
fluorescent resonance energy transfer.
[0127] The subject methods and assays also include: (a) incubating
a target polynucleotide in a reaction mixture comprising an
oligonucleotide primer which hybridizes to the target
polynucleotide immediately 3' of the nucleotide and a
polynucleotide chain terminator labeled with a second member of a
pair of interactive labels, where the incubating permits the
polynucleotide chain terminator to be incorporated into the
oligonucleotide primer; and (b) incubating the oligonucleotide
primer comprising the second member of the pair of interactive
labels with the oligonucleotide probe labeled with a first member
of the pair of interactive labels, such that formation of a hybrid
between the oligonucleotide probe and the primer permits said pair
of interactive labels to a generate a signal by fluorescent
resonance energy transfer.
[0128] In the reaction mixture, the target polynucleotide and the
oligonucleotide primer forms a duplex (double stranded
polynucleotide). The oligonucleotide primer hybridizes to the
target polynucleotide immediately 3' of the nucleotide at a
predetermined position, thereby forcing the next nucleotide to be
incorporated into the oligonucleotide primer to base pair with the
nucleotide to be identified. Preferably, the target polynucleotide
for analysis is from a genomic or cDNA preparation. The step of
duplex formation may take place by polynucleotide hybridization or
may take place concomitantly with a reaction that generates a
duplex polynucleotide. For example, a duplex between an
oligonucleotide primer and a target polynucleotide for analysis may
be formed during the process of a restriction endonuclease
digestion, e.g., the recessed 3' terminal of the digestion product
can serve as the oligonucleotide primer for extension. The
oligonucleotide primer may or may not be perfectly complementary to
the target polynucleotide for analysis. Thus, the duplex may
contain one or more mismatches, provided that the mismatches do not
significantly interfere with the ability of a DNA polymerase to
extend the oligonucleotide primer or interfere with the ability of
the 3' terminus nucleotide of the oligonucleotide primer to
hybridize immediately 3' of the nucleotide at the predetermined
location on the target polynucleotide for analysis.
[0129] The target polynucleotide for analysis serves as a template
for the labeled terminators that are incorporated into the
elongating chain comprising the oligonucleotide primer. The target
polynucleotide for analysis may be produced by any of a variety of
polynucleotide preparation techniques generally known to those of
ordinary skill in the art of molecular biology. Examples of such
preparation techniques include, direct extraction of
polynucleotides, cDNA formation, polynucleotide amplification
(e.g., the polymerase chain reaction), and the like.
[0130] Subsequent to the formation of the duplex polynucleotide
molecule, the oligonucleotide primer is extended by one nucleotide
in a DNA polymerase catalyzed polynucleotide chain extension
reaction. The single incorporated nucleotide is complementary to
the nucleotide to be determined at the predetermined location. The
extension reaction takes place in a reaction extension reaction
mixture comprising at least one labeled terminator. The extension
reaction mixture also comprises other reagents necessary for primer
extension such as a DNA polymerase, a buffer suitable for the DNA
polymerase, and the like. In preferred embodiments of the
invention, four polynucleotide chain terminators are used in the
reaction, each of the terminators labeled with a different second
member of a pair of interactive labels. Therefore, a first member
of a pair of interactive labels may have more than one second
member. The second members used in the same reaction mixture to
interact with the same first member of the pair of interactive
labels are selected so as to not significantly interfere with the
detection of the each other. In preferred embodiments of the
invention, the detectable labels are fluorescent dyes that are
spectrally resolvable from one another. As naturally occurring
polynucleotides have one of four possible nucleotide (e.g., A, T, G
and C) at a predetermined position, a set of four labeled
terminators is sufficient to determine the identity of a nucleotide
at a given location on a target polynucleotide. Less than four
unlabeled terminators may be employed when the nucleotide at the
predetermined location is known not to be of a certain base,
thereby obviating the need to test for the presence of that
nucleotide.
[0131] The different labeled polynucleotide chain terminators
present in a reaction mixture are labeled with different second
labels that may readily be distinguished from one another, upon
their interaction with the first member of the pair of interactive
labels. The second member on a given labeled terminator is
correlated with the chemical structure (e.g., identity) of the
nucleotide of the terminator. Thus by detecting and identifying the
signal transfer generated from the label, the identity of the base
may be ascertained.
[0132] In another embodiment of the invention, the oligonucleotide
primer is covalently coupled to a tag molecule. Preferably, the tag
molecule is a first member of a specific binding pair (e.g., biotin
or a ligand). A labeled chain terminator (e.g., labeled with a
second member of a pair of interactive labels) is incorporated into
the oligonucleotide primer by chain elongation. In this embodiment,
an anti-tag molecule comprising the second corresponding member of
the specific binding pair (e.g., streptavidin or a receptor for the
ligand) is labeled with a first member of the pair of interactive
labels. The labeled anti-tag molecule interacts with the tag
molecule through the specific binding between the members of the
specific binding pair to generate a signal by energy transfer
(e.g., FRET).
[0133] Polynucleotides or Oligonucleotide Probes and Primers
[0134] A polynucleotide or an oligonucleotide can be obtained by
biological synthesis or by chemical synthesis. For short sequences
(up to about 100 nucleotides) chemical synthesis is frequently more
economical as compared to biological synthesis. For longer
sequences standard replication methods employed in molecular
biology can be used such as the use of M13 for single stranded DNA
as described by Messing, 1983, Methods Enzymol. 101: 20-78.
Chemical methods of polynucleotide or oligonucleotide synthesis
include phosphotriester and phosphodiester methods (Narang, et al.,
Meth. Enzymol. (1979) 68:90) and synthesis on a support (Beaucage,
et al., Tetrahedron Letters. (1981) 22:1859-1862) as well as
phosphoramidate technique, Caruthers, M. H., et al., Methods in
Enzymology (1988)154:287-314 (1988), and others described in
"Synthesis and Applications of DNA and RNA," S. A. Narang, editor,
Academic Press, New York, 1987, and the references contained
therein.
[0135] Oligonucleotide probes and primers can be synthesized by any
method described above and other methods known in the art. The
primer and probe used for identifying a nucleotide at a
predetermined position of a target polynucleotide can be designed
to have different lengths, so that by controlling the annealing
temperature, the reaction can be driven towards more primer
annealing to the target polynucleotide or annealing of primer to
the probe which creates a detectable signal. Preferably, the 3'
terminal of the probe is blocked by adding a phosphate or an amine
group, or the like to prevent chain elongation from the 3' terminal
of the probe.
[0136] In one embodiment of the invention, the oligonucleotide
primer comprises a first sequence which hybridizes to the target
polynucleotide template. In a preferred embodiment, the
oligonucleotide primer comprises a first sequence, which hybridizes
to the target polynucleotide template, and a second sequence which
does not hybridize to the target polynucleotide template. The first
sequence, which hybridizes to the target template, may be at least
70% (e.g., at least 80% or at least 90% or more) complementary to
the target template and comprises 10 to 100 nucleotides in length,
preferably 15 to 50 nucleotides in length, more preferably 17-30
nucleotides in length. The second sequence, which does not
hybridize to the target template, may be less than 50% (e.g., less
than 40%, or 30%, or 20% or 10%) complementary to the target
template and comprises 10 to 50 nucleotides in length, preferably
20-35 nucleotides in length. The second sequence may be any
sequence so long as it does not hybridize to the target template
and does not interfere with the hybridization of the first sequence
to the target template.
[0137] The second sequence, which does not hybridize to the target
template, may be located at any position of the primer so long as
it does not interfere with the annealing of the primer to the
target template for primer extension. In one embodiment, the second
sequence is located in the "middle" of the primer, preferably, at
least 10 nucleotides (e.g., at least 15 nucleotides, or at least 20
nucleotides, or 30 nucleotides or more) from the 3' terminus of the
primer, or up to 1 nucleotide away from the 5' terminus of the
primer. In another embodiment, the second sequence is located at
the 5' terminal of the primer.
[0138] The second sequence, according to the invention, may be a
universal sequence (i.e., a common sequence) which is identical for
a number of primers. Each of the number of primers also comprises
its unique first sequence which hybridizes to its target
polynucleotide template. The universal sequence does not hybridize
to the target polynucleotide templates, but serves to provide a
common sequence from which a universal oligonucleotide probe may be
designed (i.e., a common oligonucleotide probe complementary to the
universal sequence). Therefore, the use of the universal sequence
as the second sequence on a number of primers avoids the laborious
and costly design of a specific oligonucleotide probe for each
primer used in the invention.
[0139] Nucleotides and Polynucleotide Chain Terminators
[0140] Polynucleotide chain terminators can be labeled (e.g.,
physically joined) to a detectable label. The linkage to the
detectable label is at a site or sites on that terminator that do
not prevent the incorporation of the terminator into a tag molecule
(e.g., an oligonucleotide primer) in a reaction catalyzed by a DNA
polymerase. The detectable label serves to (1) signal the
incorporation of the terminator into a polynucleotide and (2) to
indicate the structure of the nucleotide moiety of the terminator
that has been incorporated by way of a predetermined correlation
between the signal produced through the interaction between the tag
molecule and its corresponding anti-tag molecule.
[0141] "Nucleotide Analog" refers to a nucleotide in which the
pentose sugar and/or one or more of the phosphate esters is
replaced with its respective analog. Exemplary pentose sugar
analogs are those previously described in conjunction with
nucleoside analogs. Exemplary phosphate ester analogs include, but
are not limited to, alkylphosphonates, methylphosphonates,
phosphoramidates, phosphotriesters, phosphorothioates,
phosphorodithioates, phosphoroselenoates, phosphorodiselenoates,
phosphoroanilothioates, phosphoroanilidates, phosphoroamidates,
boronophosphates, etc., including any associated counterions, if
present.
[0142] Also included within the definition of "nucleotide analog"
are nucleobase monomers which can be polymerized into
polynucleotide analogs in which the DNA/RNA phosphate ester and/or
sugar phosphate ester backbone is replaced with a different type of
linkage.
[0143] Useful chain terminators include, but are not limited to,
conventional dideoxynucleotide chain terminator (e.g., ddATP,
ddTTP, ddCTP, and ddGTP) and non-conventional dideoxynucleotide
analogs (Table 1).
1TABLE 1 Non-Conventional Dideoxynucleotide Analogs Fluorescein
Labeled Fluorophore Labeled Fluorescein - 12 - ddCTP Eosin - 6 -
ddCTP Fluorescein - 12 - ddUTP Coumarin - 5 - ddUTP Fluorescein -
12 - ddATP Tetramethylrhodamine - 6 - ddUTP Fluorescein -12 - ddGTP
Texas Red - 5 - ddATP Fluorescein - N6 - ddATP LISSAMINETM -
rhodamine - 5 - ddGTP FAM Labeled TAMRA Labeled FAM - ddUTP TAMRA -
ddUTP FAM - ddCTP TAMRA - ddCTP FAM - ddATP TAMRA - ddATP FAM -
ddGTP TAMRA - ddGTP ROX Labeled JOE Labeled ROX - ddUTP JOE - ddUTP
ROX - ddCTP JOE - ddCTP ROX - ddATP JOE - ddATP ROX - ddGTP JOE -
ddGTP R6G Labeled R110 Labeled R6G - ddUTP R110 - ddUTP R6G - ddCTP
R110 - ddCTP R6G - ddATP R110 - ddATP R6G - ddGTP R110 - ddGTP
BIOTIN Labeled DNP Labeled Biotin - N6 - ATP DNP - N6 - ddATP
[0144] Up to four different chain terminators, i.e., one, two,
three, or four may be used for the subject composition and method
of the invention. Each chain terminator is labeled with a different
label and emits a different signal when excited or quenched by the
corresponding interactive label on the probe.
[0145] In some embodiments of the invention, a conventional
deoxynucleotide is labeled with a member of a pair of interactive
labels in similar manner described above. The labeled
deoxynucleotide may be used in combination with an unlabeled chain
terminator, so that the deoxynucleotide is incorporated into the
oligonucleotide primer at the position corresponding to the
predetermined position and the chain terminator terminates the
primer extension at 3' nucleotide position of the incorporated
deoxynucleotide.
[0146] In a preferred embodiment, the reaction mixture comprises a
labeled conventional deoxynucleotide and four unlabeled chain
terminators. Up to four such reactions may be performed (i.e., each
comprising a labeled deoxynucleotide) for the identification of a
predetermined nucleotide of a target polynucleotide.
[0147] Fluorescent Dyes
[0148] Fluorescent dye-labeled chain terminators and polynucleotide
probes can be purchased from commercial sources. Labeled
polynucleotides probes can also be prepared by any of a number of
approaches. For example, unlabeled polynucleotides can be prepared
by excision, transcription or chemical synthesis. Labeling of the
polynucleotide probe with a fluorescent dye can be done internally
or by end labeling using methods well known in the art (see, for
example, Ju et al., Proc Nat Acad Sci 92:4347-4351, 1995; Nelson et
al. Polynucleotides Res 20:6253-6259, 1992 which are incorporated
by reference).
[0149] Preferably, a chain terminator, an oligonucleotide probe and
an anti-tag molecule is labeled with a fluorescent dye. Fluorescent
dyes useful as detectable labels are well known to those skilled in
the art and numerous examples can be found in the Handbook of
Fluoresdent Probes and Research Chemicals 6th Edition, Richard
Haugland, Molecular Probes, Inc., 1996 (ISBN 0-9652240-O-7). The
detectable label may be joined directly to the terminator or
anti-tag molecule, or it may be joined through a linker. Examples
of suitable linkers are described in U.S. Pat. No. 5,770,716.
Preferably, the detectable label is joined to the nucleotide moiety
of the terminator so as not to prevent the incorporation of the
labeled terminator in a DNA polymerase catalyzed reaction. Also
preferably, the detectable label is joined to the nucleotide moiety
of the anti-tag molecule so as not to prevent the interaction
between the anti-tag molecule and its corresponding tag molecule
(e.g., during a hybridization reaction). The labels may be any
fluorescent label or fluorophore that does not interfere with the
ability of the oligonucleotide probe to interact with the
oligonucleotide primer comprising a labeled polynucleotide chain
terminator, and is able to show or fluorescence resonance energy
transfer with the corresponding label on the polynucleotide chain
terminator. Detectable labels may be compounds or elements
detectable by techniques other than, or in addition to,
fluorescence. Such additional labels include radioisotopes,
chemiluminescent compounds, spin labels, immunologically detectable
haptens, and the like.
[0150] Preferably, fluorescent dyes are selected for compatibility
with detection on an automated DNA sequencer and thus should be
spectrally resolvable and not significantly interfere with
electrophoretic analysis. In general, fluorescent dye labeled
terminators suitable for DNA sequencing by the subject methods are
suitable for use in the subject methods. Examples of suitable
fluorescent dyes for use as detectable labels on labeled
terminators can be found in among other places, U.S. Pat. Nos.
5,750,409; 5,366,860; 5,231,191; 5,840,999; 5,847,162; 4,439,356;
4,481,136; 5,188,934; 5,654,442; 5,840,999; 5,750,409; 5,066,580;
5,750,409; 5,366,860; 5,231,191; 5,840,999; 5,847,162; 5,486,616;
5,569,587; 5,569,766; 5,627;027; 5,321,130; 5,410,030; 5,436,134;
5,534,416; 5,582,977; 5,658,751; 5,656,449; 5,863,753; PCT
Publications WO 97/36960; 99/27020; 99/16832; European Patent EP 0
050 684; Sauer et al, 1995, J. Fluorescence 5:247-261; Lee et al.,
1992, Nucl. Acids Res. 20:2471-2483; and Tu et al., 1998, Nucl.
Acids Res. 26:2797-2802.
[0151] The oligonucleotide probe may be fluorescently labeled at
any suitable position. For instance, the fluorescent group may be
placed on or adjacent to the 5' terminal of the oligonucleotide
probe. In other instances, the fluorescent group may be placed on
or adjacent to the 3' terminal of the oligonucleotide probe.
[0152] Alternatively, the fluorescent group may be placed on or
adjacent to the 3' or 5' end of a nucleotide within the
oligonucleotide probe, for instance by incorporation of a
fluorescent nucleotide derivative, modification of a nucleotide or
substitution of a nucleotide by a fluorescent molecule. For
example, tetramethylrhodamine (TAMRA) can be introduced into the
oligonucleotide probe by incorporating the modified deoxy-thymidine
phosphoramidite (5'-Dimethoxytrityloxy-5-[N-((tetramethyl-
-odaminyl)-aminohexyl)-3-acryimido]-2'-deoxy-thymidine-3'-[(2-cyanoethyl)--
(N,N-diisopropyl)]-phosphoramidite). Fluorescein may be
incorporated in an analogous way with:
5'-Dimethoxytrityloxy-5-[N-((3',6'-dipivaloylfluoresc-
einyl)-aminohexyl)-3-acryimido]-2'-deoxy-thymidine-3'-[(2-cyanoethyl)-(N,N-
-diisopropyl)]-phosphoramidite. The DABCYL group may also be
incorporated using
5'-Dimethoxytrityloxy-5-[N-((4-(dimethylamino)azobenzene)-aminohexy-
l)-3-acryimido]-2'-deoxy-thymidine-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-p-
hosph-oramidite. More generally, a free amino group may be reacted
with the active ester of any dye; such an amino group may be
introduced by the inclusion of the modified thymidine
5'-Dimethoxytrityl-5-[N-(trifluoroace-
tylaminohexyl)-3-acrylimido]-2'-deoxy-thymidine,
3'-[(2-cyanoethyl)-(N,N-d- iisopropyl)]-phosphoramidite.
Preferably, the incorporation of a modified base allows for normal
base pairing. One skilled in the art should understand that
thymidine in the above analogs may be substituted with other
nucleotide (e.g., Guanosine, Adenosine, or Cytidine).
[0153] The oligonucleotide probes and polynucleotide chain
terminators contain primary and secondary amines, hydroxyl, nitro
and carbonyl groups. Methods that can be used to make fluorescent
oligonucleotide probes and chain terminators are described
below.
[0154] A number of chemical reactions can be applied to the
fluorescent labeling of amines including but not limited to the
following, where the fluorescent dye is conjugated to the indicated
reactive group:
2 TABLE 2 Functional Group Reaction Product Amine dye -
isothiocyanates Thiourea Amine dye - succinimidyl ester Carboxamide
Amine dye - sulfonyl chloride Sulphonamide Amine dye - aldehyde
Alkylamine
[0155] Oligonucleotide probes or chain terminators containing amine
groups that are appropriate for the introduction of fluorescent
dyes include but are not limited to those listed in Table 2.
[0156] A number of chemical reactions can be applied to the
fluorescent labeling of ketone groups including but not limited to
the following, where the fluorescent dye is conjugated to the
indicated reactive group:
3 TABLE 3 Functional Group Reaction Product Ketone dye - hydrazides
Hydrazones Ketone dye - semicarbazides Hydrazones Ketone dye -
carbohydrazides Hydrazones Ketone dye - amines Alkylamine
[0157] Oligonucleotide probes or chain terminators containing
ketone groups that are appropriate for the introduction of
fluorescent dyes include but are not limited to those listed in
Table 3.
[0158] A number of chemical reactions can be applied to the
fluorescent labeling of aldehyde groups including but not limited
to the following, where the fluorescent dye is conjugated to the
indicated reactive group:
4 TABLE 4 Functional Group Reaction Product Aldehyde dye -
hydrazides Hydrazones Aldehyde dye - semicarbazides Hydrazones
Aldehyde dye - carbohydrazides Hydrazones Aldehyde dye - amines
Alkylamine
[0159] Oligonucleotide probes or chain terminators containing
aldehyde groups that are appropriate for the introduction of
fluorescent dyes include but are not limited to those listed in
Table 4.
[0160] Dehydrobutyrene and dehydroalanine moieties have
characteristic reactions that can be utilized to introduce
fluorophores, as illustrated but not limited to the following,
where the fluorescent dye is conjugated to the indicated reactive
group:
5 TABLE 5 Functional Group Reaction Product Dehydrobutyrine dye -
sulphydryl Methyl lanthionine Dehydroalanine dye - sulphydryl
Lanthionine
[0161] Oligonucleotide probes or chain terminators containing
aldehyde groups that are appropriate for the introduction of
fluorescent dyes include but are not limited to those listed in
Table 5.
[0162] Other useful fluorophores (in addition to those listed in
Tables 1-4) include, but are not limited to: Texas Red.TM. (TR),
Lissamine.TM. rhodamine B, Oregon Green.TM. 488
(2',7'-difluorofluorescein), carboxyrhodol and carboxyrhodamine,
Oregon Green.TM. 500, 6-JOE
(6-carboxy-4',5'-dichloro-2',7'-dimethyoxyfluorescein, eosin F3S
(6-carobxymethylthio-2',4', 5',7'-tetrabromo-trifluorofluorescein),
cascade blue.TM. (CB), aminomethylcoumarin (AMC), pyrenes, dansyl
chloride (5-dimethylaminonaphthalene-1-sulfonyl chloride) and other
napththalenes, PyMPO, ITC
(1-(3-isothiocyanatophenyl)-4-(5-(4-methoxyphen-
yl)oxazol-2-yl)pyridinium bromide).
[0163] Members of Pair of Interactive Labels
[0164] A pair of interactive labels comprises a first and a second
member. A first member may have more than one, e.g., two, three, or
four different second members. The members may be a donor and an
acceptor pair for generating detectable signal transfer. It is not
critical which member of the interactive labels is the donor or the
acceptor. In preferred embodiment, the first member which is used
to label the oligonucleotide probe of the invention is a donor and
the second member which is used to label the polynucleotide chain
terminator is the acceptor. The stimulation of the acceptor by the
donor, when brought to close proximity, generates a detectable
signal transfer. When more than one terminator is used in the
reaction mixture and each terminator is labeled with a different
second member (e.g., a different acceptor), the same first member
(e.g., the donor) will interact with each second member (e.g.,
acceptor) and cause a different signal transfer to be detected.
[0165] Contact between the two members (e.g., donor and acceptor)
in a pair of interactive labels may occur in solution (e.g., a test
tube, dish or well of a microtitre plate) or, alternatively, either
the oligonucleotide probe molecule or the oligonucleotide primer
comprising an incorporated chain terminator may be adhered to a
solid support (e.g., an affinity gel, matrix, or column) by
covalent or non-covalent linkages using methods known in the art.
The support bound primer comprising the chain terminator or
oligonucleotide probe molecule is then mixed with a solution
containing the other compounds of the reaction mixture.
[0166] When the oligonucleotide probe and the oligonucleotide
comprising the chain terminator are mixed, they can form a complex
which brings the first and second members of a pair of interactive
labels into proximity. The "fluorescence" of, or light emitted
from, the complex formed between the oligonucleotide probe molecule
and the polynucleotide chain terminator on the elongating chain is
altered by fluorescence resonance energy transfer (FRET). "FRET" is
a distance-dependent interaction between the electronic exited
states of two dye molecules in which excitation is transferred from
a donor molecule to an acceptor molecule. FRET is dependent on the
inverse sixth power of the intermolecular separation, making it
useful over distances comparable to the dimensions of biological
macromolecules and obtainable in the complexes formed between the
oligonucleotide probe molecules and polynucleotide chain terminator
molecules in the method of this invention. In most embodiments, the
donor and acceptor dyes for FRET are different, in which case FRET
can be detected by the appearance of sensitized fluorescence of the
acceptor. When the donor and acceptor are the same, FRET is
detected by the resulting fluorescence depolarization.
[0167] Since a common labeled oligonucleotide probe may be used to
detect four different labeled chain terminators, if the
oligonucleotide is labeled with a donor, the donor may interact
with four complementary acceptors on the four chain terminators.
Likewise, if the oligonucleotide is labeled with an acceptor, the
acceptor may interact with four complementary donors on the four
chain terminators.
[0168] The donor and acceptor groups may independently be selected
from suitable fluorescent groups, chromophores and quenching
groups. Donors and acceptors useful according to the invention
include but are not limited to: 5-FAM (also called
5-carboxyfluorescein; also called Spiro(isobenzofuran-1(3H),
9'-(9H)xanthene)-5-carboxylic acid,
3',6'-dihydroxy-3-oxo-6-carboxyfluorescein);
5-Hexachloro-Fluorescein
([4,7,2',4',5',7'-hexachloro-(3',6'-dipivaloyl-fluoresceinyl)-6-carboxyli-
c acid]); 6-Hexachloro-Fluorescein
([4,7,2',4',5',7'-hexachloro-(3',6'-dip-
ivaloylfluoresceinyl)-5-carboxylic acid]);
5-Tetrachloro-Fluorescein
([4,7,2',7'-tetra-chloro-(3',6'-dipivaloylfluoresceinyl)-5-carboxylic
acid]); 6-Tetrachloro-Fluorescein
([4,7,2',7'-tetrachloro-(3',6'-dipivalo-
ylfluoresceinyl)-6-carboxylic acid]); 5-TAMRA
(5-carboxytetramethylrhodami- ne; Xanthylium,
9-(2,4-dicarboxyphenyl)-3,6-bis(dimethyl-amino); 6-TAMRA
(6-carboxytetramethylrhodamine; Xanthylium,
9-(2,5-dicarboxyphenyl)-3,6-b- is(dimethylamino); EDANS
(5-((2-aminoethyl) amino)naphthalene-1-sulfonic acid); 1,5-IAEDANS
(5-((((2-iodoacetyl)amino)ethyl) amino)naphthalene-1-sulfonic
acid); DABCYL (4-((4-(dimethylamino)phenyl) azo)benzoic acid) Cy5
(Indodicarbocyanine-5) Cy3 (Indo-dicarbocyanine-3); and BODIPY FL
(2,6-dibromo-4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-
-indacene-3-proprionic acid), Rox, as well as suitable derivatives
thereof.
[0169] According to some methods of the invention, a chain
terminator has been specifically labeled by a donor/acceptor that
is different from the acceptor/donor that is present on the
oligonucleotide probe. Preferred combinations of donors and
acceptors are listed as, but not limited to, the donor/acceptor
pairs shown in Tables 6 and 7 (which includes values for
R.sub.o--the distance at which 50% of excited donors are
deactivated by FRET).
6TABLE 6 Typical values of R.sub.o Donor Acceptor Ro (.ANG.)*
Fluorescein Tetramethylrhodamine 55 IAEDANS Fluorescein 46 EDANS
DABCYL 33 Fluorescein Fluorescein 44 BODIPY FL BODIPY FL 57
*R.sub.o is the distance at which 50% of excited donors are
deactivated by FRET. Data from Haugland, RP. 1996. Handbook of
Fluorescent Probes and Research Chemicals, 6th edition. Molecular
Probes, Inc. Eugene OR, USA.
[0170]
7TABLE 7 FRET-pairs suitable for use in the method of this
invention. Donor Acceptor (a) Fluorescent donors Fluorescein
Tetramethylrhodamine Fluorescein Cy-3 Fluorescein Rox EDANS DABCYL
Dansyl Fluorescein Cy3 Cy-5 Tryptophan AEDANS Fluorescein
Tetramethyl rhodamine Tetramethyl rhodamine DABCYL Fluorescein
DABCYL DABCYL Cy-3 Fluorescein Hexachlorofluorescein
Tetrachlorofluorescein Cy-5 (b) Luminescent donors Europium Cy-5
Terbium Tetramethyl rhodamine Terbium Cy-3
[0171] Reference herein to "fluorescence", "fluorescent dye" or
"fluorescent groups" or "fluorophores" include luminescence,
luminescent groups and suitable chromophores, respectively. In the
present invention, the polynucleotide chain terminator and
oligonucleotide probe may be labeled with luminescent labels and
luminescence resonance energy transfer is indicative of complex
formation. Suitable luminescent probes include, but are not limited
to, the luminescent ions of europium and terbium introduced as
lanthium chelates (Heyduk & Heyduk, 1997). The lanthanide ions
are also good donors for energy transfer to fluorescent groups
(Selvin, 1995). Luminescent groups containing lanthanide ions can
be incorporated into polynucleotides utilizing an `open cage`
chelator phosphoramidite. Table 6 gives some preferred luminescent
groups.
[0172] In certain embodiments of the invention, the polynucleotide
chain terminator and oligonucleotide probe may also be labeled with
two chromophores, and a change in the absorption spectra of the
label pair is used as a detection signal, as an alternative to
measuring a change in fluorescence.
[0173] There is a great deal of practical guidance available in the
literature for selecting appropriate reporter-quencher pairs for
particular probes, as exemplified by the following references:
Clegg (1993, Proc. Natl. Acad. Sci., 90:2994-2998); Wu et al.
(1994, Anal. Biochem., 218:1-13); Pesce et al., editors,
Fluorescence Spectroscopy (1971, Marcel Dekker, New York); White et
al., Fluorescence Analysis: A Practical Approach (1970, Marcel
Dekker, New York); and the like. The literature also includes
references providing exhaustive lists of fluorescent and
chromogenic molecules and their relevant optical properties for
choosing reporter-quencher pairs, e.g., Berlman, Handbook of
Fluorescence Spectra of Aromatic Molecules, 2nd Edition (1971,
Academic Press, New York); Griffiths, Colour and Constitution of
Organic Molecules (1976, Academic Press, New York); Bishop, editor,
Indicators (1972, Pergamon Press, Oxford); Haugland, Handbook of
Fluorescent Probes and Research Chemicals (1992 Molecular Probes,
Eugene) Pringsheim, Fluorescence and Phosphorescence (1949,
Interscience Publishers, New York), all of which incorporated
hereby by reference. Further, there is extensive guidance in the
literature for derivatizing reporter and quencher molecules for
covalent attachment via common reactive groups that can be added to
an oligonucleotide, as exemplified by the following references,
see, for example, Haugland (cited above); Ullman et al., U.S. Pat.
No. 3,996,345; Khanna et al., U.S. Pat. No. 4,351,760, all of which
hereby incorporated by reference.
[0174] Exemplary reporter-quencher pairs may be selected from
xanthene dyes, including fluoresceins, and rhodamine dyes. Many
suitable forms of these compounds are widely available commercially
with substituents on their phenyl moieties which can be used as the
site for bonding or as the bonding functionality for attachment to
an oligonucleotide. Another group of fluorescent compounds are the
naphthylamines, having an amino group in the alpha or beta
position. Included among such naphthylamino compounds are
1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene
sulfonate and 2-p-touidinyl-6-naphthalene sulfonate. Other dyes
include 3-phenyl-7-isocyanatocoumarin, acridines, such as
9-isothiocyanatoacridin- e and acridine orange;
N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles, stilbenes,
pyrenes, and the like.
[0175] The reporter and quencher molecules may be selected from
fluorescein and rhodamine dyes. These dyes and appropriate linking
methodologies for attachment to oligonucleotides are described in
many references, e.g., Marshall, Histochemical J., 7: 299-303
(1975); Menchen et al., U.S. Pat. No. 5,188,934; Menchen et al.,
European Patent Application 87310256.0; and Bergot et al.,
International Application PCT/US90/05565. All are hereby
incorporated by reference.
[0176] There are many linking moieties and methodologies for
attaching labeling molecules (e.g., a member of an interactive
labels) to the 5' or 3' termini of oligonucleotides, as exemplified
by the following references: Eckstein, editor, Oligonucleotides and
Analogues: A Practical Approach (IRL Press, Oxford, 1991);
Zuckerman et al., Polynucleotides Research, 15: 5305-5321 (1987)
(3' thiol group on oligonucleotide); Sharma et al., Polynucleotides
Research, 19: 3019 (1991) (3' sulfhydryl); Giusti et al., PCR
Methods and Applications, 2: 223-227 (1993) and Fung et al., U.S.
Pat. No. 4,757,141 (5' phosphoamino group via Aminolink.TM. II
available from Applied Biosystems, Foster City, Cafil.) Stabinsky,
U.S. Pat. No. 4,739,044 (3' aminoalkylphosphoryl group); Agrawal et
al., Tetrahedron Letters, 31: 1543-1546 (1990) (attachment via
phosphoramidate linkages); Sproat et al., Polynucleotides Research,
15: 4837 (1987) (5' mercapto group); Nelson et al., Polynucleotides
Research, 17: 7187-7194 (1989) (3' amino group); and the like.
[0177] Preferably, an oligonucleotide probe is linked to a member
of a pair of interactive labels at its 5' end. Also preferably, the
3' terminal of the oligonucleotide probe is blocked by a phosphate
to prevent template independent elongation.
[0178] Measurable Changes
[0179] In the method of the present invention, the labeled
oligonucleotide probe is capable of binding to a elongation chain
comprising a labeled polynucleotide chain terminator or a labeled
deoxynucleotide, thereby forming a complex in which the donor
present on one molecule comes into proximity with the acceptor on
the other molecule. This results in altered (e.g., reduced)
fluorescence of the complex compared to the uncomplexed
fluorescence exhibited by the oligonucleotide probe and/or
polynucleotide chain terminator when free in solution.
[0180] In the method of the invention, fluorescence intensity of
the oligonucleotide probe, the fluorescence intensity of the chain
terminator and the fluorescence intensity of the complex is
measured at one or more wavelengths with a fluorescence
spectrophotometer, microtitre plate reader or real time PCR
instruments. It is generally preferred that the oligonucleotide
probe and the elongating chain comprising a chain terminator form a
one-to-one complex and equal molar concentrations of
oligonucleotide probe and chain terminator are present in the
binding reaction. However, an excess of one reagent may be used
without departing from the scope of the invention.
[0181] Typically, it is preferable to look for a signal (a
positive), rather than for the absence of a signal (a negative) in
an assay of the invention, but it will be appreciated that either
or both may be followed. The preferred method for generating a
detectable signal, according to the invention, is FRET. The
advantage to FRET is that a new light wavelength is created. It is
easier to detect a small signal above background than to detect a
small decrease in a large signal. If future energy transfer
reactions were to be developed, such as magnetic resonance energy
transfer, or biological resonance energy transfer (as between green
fluorescent protein and luciferase), such processes could also be
used.
[0182] In some embodiments of the invention, fluorescence resonance
energy transfer between the donor and acceptor may give rise to a
distinct fluorescence emission spectrum of the complex which can be
compared to the fluorescence emission spectra of the separate
oligonucleotide probe and polynucleotide chain terminator
molecules.
[0183] In some embodiments of the invention, signal generated by
FRET is detected by steady state measurements of the integrated
emission intensity of the donor (i.e., the fluorescent dye that is
excited by the light source used in the spectral measurement)
and/or the acceptor (i.e., the fluorescent dye which has a
absorption spectrum that overlaps the emission spectrum of the
donor). In addition, FRET may be detected by time-resolved
measurements in which the decay of donor fluorescence is measured
after a short pulse of excitation. In certain embodiments of the
invention the donor is excited at a wavelength that does not itself
result in efficient excitation of the acceptor, and FRET is
detected by measuring the excitation of the acceptor due to
transfer of a photon from the donor.
[0184] In some embodiments, the signal is generated by quenching
and then detected by fluorescent readers. Any FRET (e.g., black
hole) or non-FRET (e.g., Dabcyl) quenchers may be used as
quencher-reporter pair for the present invention.
[0185] Fluorescent reporter molecule--quencher molecule pairs have
been incorporated onto oligonucleotide probes in order to monitor
biological events based on the fluorescent reporter molecule and
quencher molecule being separated or brought within a minimum
quenching distance of each other (see, for example, U.S. Pat. Nos.
6,030,78, and 5,795,729, each of which incorporated hereby in its
entirety).
[0186] In some embodiments of the invention, the donor-acceptor
pair is replaced by a receptor-quencher pair. It is not critical to
the invention whether the oligonucleotide probe or a chain
terminator is labeled with a quenching molecule so long as the
other is labeled with a corresponding receptor molecule of a
receptor-quencher pair. For example, probes can be developed where
the intensity of the reporter molecule fluorescence increases due
to the separation of the reporter molecule from the quencher
molecule. Probes can also be developed which lose their
fluorescence because the quencher molecule is brought into
proximity with the reporter molecule. These reporter--quencher
molecule pair probes can be used to detect the presence and
identity of an incorporated chain terminator by monitoring either
the appearance or disappearance of the fluorescence signal
generated by the reporter molecule.
[0187] In one embodiment, the oligonucleotide probe comprises a
quencher molecule, such that the quenching would quench signal from
the primer-bound terminator. For example, the oligonucleotide probe
is labeled with a dark quencher (e.g., a black hole quencher, BHQ)
that absorbs or quenches fluorescence emitted by a receptor
molecule (e.g., FAM). The BHQ dyes are a new class of dark
quenchers that prevent fluorescence until a hybridization event
occurs. In addition, these new dyes have no native fluorescence,
virtually eliminating background problems seen with other
quenchers. BHQ Dyes can be used to quench almost all reporter dyes
and are commercially available, for example, from Biosearch
Technologies, Inc (Novato, Calif.). The receptor fluorophore is
used to label a chain terminator. Thus, incorporation of a chain
terminator into the oligonucleotide primer and the hybridization of
the oligonucleotide probe to the oligonucleotide primer bring the
quencher molecule and the receptor molecule into close proximity.
The quencher molecule quenches the fluorescent signal emitted from
the receptor molecule and results in a decrease in fluorescent
signal generated by FRET.
[0188] Preferably, reporter molecules are fluorescent organic dyes
derivatized for attachment to the terminal 3' carbon or terminal 5'
carbon of the probe or a chain terminator via a linking moiety.
Preferably, quencher molecules are also organic dyes, which may or
may not be fluorescent, depending on the embodiment of the
invention. For example, in a preferred embodiment of the invention,
the quencher molecule is a black hole quencher. Generally whether
the quencher molecule is fluorescent or simply releases the
transferred energy from the reporter by non-radiative decay, the
absorption band of the quencher should substantially overlap the
fluorescent emission band of the reporter molecule. Non-fluorescent
quencher molecules that absorb energy from excited reporter
molecules, but which do not release the energy radiatively, are
referred to in the application as chromogenic molecules.
[0189] In one embodiment of the invention, the change of signal is
measured using a spectrofluorophotometer.
[0190] Useful DNA Polymerases for the Invention
[0191] A wide variety of DNA polymerases maybe used in the subject
methods. Suitable DNA polymerases for use in the subject methods
may or may not be thermostable. DNA polymerases having mutations
that reduce discrimination against the incorporation of chain
terminators that are 2',3'-dideoxynucleotides (ddNTP) as compared
with nucleotide triphosphates are preferred. Particularly preferred
is the use of JDF-3 DNA polymerase mutants with reduced
discrimination against ddNTP incorporation. Preferably, the JDF-3
DNA polymerase is also deficient in 3' to 5' exonuclease activity.
A detailed description for suitable JDF-3 mutants can be found in
U.S. patent application with Ser. No. 09/896,923, incorporated
herein by reference.
[0192] In a preferred embodiment of the present invention, the
JDF-3 DNA polymerase comprises one or more mutation at
corresponding amino acids D141, E143, A485, L408 and P410.
[0193] In a more preferred embodiment, the JDF-3 DNA polymerase has
one or more amino acid mutations selected from the group consisting
of: D141A or D141T, E143A, L408H or L408F, A485T, and P410L.
[0194] In still another preferred embodiment, the JDF-3 DNA
polymerase comprises four amino acid mutations of D141A, E 143A,
P410L and A485T.
[0195] Taq DNA polymerase mutants having a Tyr residue at position
667 (numbered with reference to Taq DNA polymerase) may be used. A
detailed description of such mutants can be found in U.S. Pat. No.
5,614,365, hereby incorporated by reference.
[0196] Methods for Generating DNA Polymerase Mutants with Reduced
Discrimination
[0197] U.S. patent application Ser. No. 09/698,341, filed Oct. 27,
2000 and 09/896,923, filed Jun. 29, 2001 describe methods for
making DNA polymerases with reduced discrimination toward
non-conventional nucleotides (incorporated herein by reference).
Random or site-directed mutants generated as known in the art or as
described herein and expressed in bacteria may be screened for
reduced discrimination against non-conventional nucleotides by
several different assays. In one method, DNA polymerase proteins
expressed in lytic lambda phage plaques generated by infection of
host bacteria with expression vectors based on, for example, Lambda
ZapII.RTM., are transferred to a membrane support. The immobilized
proteins are then assayed for polymerase activity on the membrane
by immersing the membranes in a buffer containing a DNA template
and the unconventional nucleotides to be monitored for
incorporation.
[0198] Mutant polymerase libraries may be screened using a
variation of the technique used by Sagner et al (Sagner, G., Ruger,
R., and Kessler, C. (1991) Gene 97:119-123). For this approach,
lambda phage clones are plated at a density of 10-20 plaques per
square centimeter. Proteins present in the plaques are transferred
to filters and moistened with polymerase screening buffer (50 mM
Tris (pH 8.0), 7 mM MgCl.sub.2, 3 mM .mu.-ME). The filters are kept
between layers of plastic wrap and glass while the host cell
proteins are heat-inactivated by incubation at 65.degree. C. for 30
minutes. The heat-treated filters are then transferred to fresh
plastic wrap and approximately 35 .mu.l of polymerase assay
cocktail are added for every square centimeter of filter. The assay
cocktail consists of 1.times. cloned Pfu (cPfu) magnesium free
buffer (1.times. buffer is 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10
mM (NH4).sub.2SO.sub.4, 100 ug/ml bovine serum albumin (BSA), and
0.1% Triton X-100; Pfu Magnesium-free buffer may be obtained from
Stratagene (Catalog No. 200534)), 125 ng/ml activated calf thymus
or salmon sperm DNA, 1.29 .mu.Ci/ml .alpha.-.sup.33P ddNTP or
dideoxynucleotides (at a dNTP:dye-ddNTP ratio of 1:15). Initial
screening was done in the presence of MnCl.sub.2, but the preferred
method was to screen in 1.times.Taq Polymerase buffer (1.5 mM
MgCl.sub.2) The filters are placed between plastic wrap and a glass
plate and then incubated at 65.degree. C. for one hour, and then at
70.degree. C. for one hour and fifteen minutes. Filters are then
washed three times in 2.times.SSC for five minutes per wash before
rinsing twice in 100% ethanol and vacuum drying. Filters are then
exposed to X-ray film (approximately 16 hours), and plaques that
incorporate label are identified by aligning the filters with the
original plate bearing the phage clones. Plaques identified in this
way are re-plated at more dilute concentrations and assayed under
similar conditions to allow the isolation of purified plaques.
[0199] In assays such as the one described above, the signal
generated by the label is a direct measure of the activity of the
polymerase with regard to that particular unconventional nucleotide
or combination of unconventional nucleotides used in the assay.
Unconventional nucleotides corresponding to all four conventional
nucleotides may be included in the reactions, or, alternatively,
only one unconventional nucleotide may be included to assess the
effect of the mutation(s) on utilization of a given unconventional
nucleotide. One approach is to use unconventional nucleotides
corresponding to all four nucleotides in a first screen to identify
clones that incorporate more than a reference wild-type clone, and
then to monitor the incorporation of individual unconventional
nucleotides in a subsequent screen. In the preferred screening
mode, only the dideoxynucleotides and dideoxynucleotide analogs of
ddATP, ddCTP, and ddTTP would be used since ddGTP is not
discriminated against by some DNA polymerases and increases the
background signal of any screen In order to screen for clones with
enhanced ability to incorporate dideoxynucleotides, clones
identified in first screens utilizing only dideoxynucleotides may
then be characterized by their sensitivity to low levels of each of
the four dideoxynucleotides in a DNA polymerase nucleotide
incorporation assay employing all four dNTPs, H-TTP tracer, and a
low level of each ddNTP. Since incorporation of dideoxynucleotides
stops DNA chain elongation, superior ability to incorporate
dideoxynucleotides diminishes the incorporation of tritium labeled
deoxynucleotides relative to wild-type DNA polymerase. Comparisons
of ddNTP concentrations that bring about 50% inhibition of
nucleotide incorporation (150%) can be used to compare ddNTP
incorporation efficiency of different polymerases or polymerase
mutants. Comparisons of 150% values for ddATP, ddCTP, ddGTP, and
ddTTP can be used to identify mutants with reduced selectivity for
particular bases. Such mutants would be expected to produce more
uniform DNA sequencing ladders.
[0200] In order to measure incorporation of individual ddNTPs,
cocktails are prepared which consist of varying concentrations of
the ddNTP of interest, and a total of 200 .mu.M of each nucleotide
triphosphate. For example, the incorporation of ddATP by wild type
JDF-3 polymerase may be measured at 0, 40, 80, 120 and 160 .mu.M
ddATP. In these reactions, dATP concentrations would be adjusted to
200, 160, 120, 80, and 40 .mu.M, respectively, so that the total
amount of adenine nucleotide triphosphate is 200 .mu.M. In
comparison, mutants may be assayed using ddATP concentrations of 0,
5, 10, and 20 .mu.M ddATP, and adjusted dATP concentrations of 200,
195, 190, and 180 .mu.M, respectively (dATP+ddATP=200 .mu.M).
Additional cocktails are prepared to similarly measure ddCTP,
ddGTP, and ddTTP incorporation.
[0201] Incorporation of nucleotides under the concentration
parameters described above may be measured in extension reactions
by adding, for example, 1 .mu.l of appropriately diluted bacterial
extract (i.e., heat-treated and clarified extract of bacterial
cells expressing a cloned polymerase or mutated cloned polymerase)
to 10 .mu.l of each nucleotide cocktail, followed by incubation at
72.degree. C. for 30 minutes. Extension reactions are quenched on
ice, and then 5 .mu.l aliquots are spotted immediately onto DE81
ion-exchange filters (2.3 cm; Whatman #3658323). Unincorporated
label is removed by 6 washes with 2.times.SCC (0.3M NaCl, 30 mM
sodium citrate, pH 7.0), followed by a brief wash with 100%
ethanol. Incorporated radioactivity is then measured by
scintillation counting. Reactions that lack enzyme are also set up
along with sample incubations to determine "total cpms" (omit
filter wash steps) and "minimum cpms" (wash filters as above).
[0202] Cpms bound is proportional to the amount of polymerase
activity present per volume of bacterial extract. The volume of
bacterial extract (generally about 0.25-1 .mu.l) which brings about
incorporation of approximately 10,000 cpms is determined for use in
subsequent nucleotide analog incorporation testing.
[0203] Genes for mutant DNA polymerases generated by random
mutagenesis may be sequenced to identify the sites and number of
mutations. For those mutants comprising more than one mutation, the
effect of a given mutation may be evaluated by introduction of the
identified mutation to the DNA polymerase gene by site-directed
mutagenesis in isolation from the other mutations borne by the
particular mutant. Screening assays of the single mutant thus
produced will then allow the determination of the effect of that
mutation alone.
[0204] Expression of Mutated DNA Polymerase According to the
Invention
[0205] Methods known in the art may be applied to express and
isolate the mutated forms of DNA polymerase according to the
invention. Many bacterial expression vectors contain sequence
elements or combinations of sequence elements allowing high level
inducible expression of the protein encoded by a foreign sequence.
For example, as mentioned above, bacteria expressing an integrated
inducible form of the T7 RNA polymerase gene may be transformed
with an expression vector bearing a mutated DNA polymerase gene
linked to the T7 promoter. Induction of the T7 RNA polymerase by
addition of an appropriate inducer, for example,
isopropyl-.beta.-D-thiog- alactopyranoside (IPTG) for a
lac-inducible promoter, induces the high level expression of the
mutated gene from the T7 promoter (see Gardner & Jack, 1999,
supra).
[0206] Appropriate host strains of bacteria may be selected from
those available in the art by one of skill in the art. As a
non-limiting example, E. coli strain BL-21 is commonly used for
expression of exogenous proteins since it is protease deficient
relative to other strains of E. coli. BL-21 strains bearing an
inducible T7 RNA polymerase gene include WJ56 and ER2566 (Gardner
& Jack, 1999, supra). For situations in which codon usage for
the particular polymerase gene differs from that normally seen in
E. coli genes, there are strains of BL-21 that are modified to
carry tRNA genes encoding tRNAs with rarer anticodons (for example,
argU, ileY, leuW, and proL tRNA genes), allowing high efficiency
expression of cloned protein genes, for example, cloned archaeal
enzyme genes (several BL21-CODON PLUS.TM. cell strains carrying
rare-codon tRNAs are available from Stratagene, for example).
[0207] There are many methods known to those of skill in the art
that are suitable for the purification of a modified DNA polymerase
of the invention. For example, the method of Lawyer et al. (1993,
PCR Meth. & App. 2: 275) is well suited for the isolation of
thermostable DNA polymerases expressed in E. coli, as it was
designed originally for the isolation of Taq polymerase.
Alternatively, the method of Kong et al. (1993, J. Biol. Chem. 268:
1965, incorporated herein by reference) may be used, which employs
a heat denaturation step to destroy host proteins, and two column
purification steps (over DEAE-Sepharose and heparin-Sepharose
columns) to isolate highly active and approximately 80% pure
thermostable DNA polymerase.
[0208] Chain Elongation-Primer Extension
[0209] The polynucleotide extension reactions employed in the
subject methods are catalyzed by a DNA polymerase, preferably one
with reduced discrimination against the incorporation of ddNTP. The
reaction may be carried out by methods well known in the art, for
example, as described in Current Protocols in Molecular Biology
(1997, Ausubel et al., John Weley & Sons, Inc.).
[0210] In some embodiments, the reaction mixture for the primer
extension reaction may comprise a labeled chain terminator in
addition to a polynucleotide template and an oligonucleotide
primer. The labeled chain terminator serves as a chain terminator
for the extension reaction and also provides a member of the pair
of interactive labels to interact with the other member of the same
pair of interactive labels on a correspondingly labeled
oligonucleotide probe.
[0211] In other embodiments of the invention, the reaction mixture
comprises a labeled deoxynucleotide, an unlabeled chain terminator,
in addition to a polynucleotide template and an oligonucleotide
primer. The labeled deoxynucleotide provides a member of the pair
of interactive labels to interact with the other member of the same
pair of interactive labels on a correspondingly labeled
oligonucleotide probe. The unlabeled chain terminator simply serves
to terminate the primer extension reaction.
[0212] The reaction mixture may further comprise an oligonucleotide
probe which hybridizes to the oligonucleotide primer.
[0213] After or during the polynucleotide extension reaction, the
oligonucleotide probe hybridizes to the elongating chain comprising
the oligonucleotide primer and a chain terminator, the products are
analyzed so as to identify the detectable signal generated by the
interaction between the two members of the pair of interactive
labels used to label the chain terminator and the probe (e.g., by
FRET).
[0214] Hybridization
[0215] Polynucleotide hybridization involves providing a denatured
probe (e.g., the oligonucleotide probe) and polynucleotide(s)
(e.g., the oligonucleotide primer) under conditions where the probe
and its complementary polynucleotide can form stable hybrid
duplexes through complementary base pairing. The polynucleotides
that do not form hybrid duplexes are then washed away leaving the
hybridized polynucleotides to be detected, typically through
detection of an attached detectable label. In a preferred
embodiment, the oligonucleotide probe hybridizes to an elongating
chain comprising the oligonucleotide primer and an incorporated
chain terminator so that the donor and the acceptor on each of the
molecules come to close proximity to generate a detectable signal
which is indicative of the identity of the chain terminator. It is
generally recognized that polynucleotides are denatured by
increasing the temperature or decreasing the salt concentration of
the buffer containing the polynucleotides.
[0216] The stringency required is nucleotide sequence dependent and
also depends upon the various components present during
hybridization and/or washing. In preferred embodiments, high
stringent hybridization/washing conditions are used. In one
embodiment, the oligonucleotide probe and the oligonucleotide
primer are hybridized in an aqueous solution containing
0.1.times.SSC and 0.2% SDS, at room temperature for 2-60 minutes,
followed by incubation in a solution containing 0.1.times.SSC at
room temperature for 2-60 minutes.
[0217] Under high stringency conditions, majority of the
hybridization occurs only between molecules which comprise
complementary sequences (such as between an oligonucleotide primer
comprising a first sequence and a second sequence and an
oligonucleotide probe comprising a third sequence which hybridizes
to the second sequence). However, it is not required two molecules
to be completely complementary in order to hybridize under high
stringency conditions. Under low stringency conditions (e.g., low
temperature and/or high salt) hybrid duplexes (e.g., DNA:DNA,
RNA:RNA, or RNA:DNA) will form even where the annealed sequences
are not perfectly complementary. Thus specificity of hybridization
is reduced at lower stringency. Conversely, at higher stringency
(e.g., higher temperature or lower salt) successful hybridization
requires fewer mismatches.
[0218] In some preferred embodiments of the invention, the probe is
simply added into the amplification reaction mixture and the
hybridization between the oligonucleotide probe and the primer
comprising an incorporated labeled chain terminator is performed
during the amplification reaction (e.g., a PCR reaction). This
provides a homogenous assay method which does not require the
purification the primer-probe complex from unincorporated chain
terminators before detection.
[0219] In other embodiments of the invention, the hybridization
between the oligonucleotide probe and the primer comprising an
incorporated labeled chain terminator is performed after the chain
elongation reaction.
[0220] The oligonucleotide probe may be a universal probe which
hybridizes to the second sequence of the oligonucleotide primer, or
it may be made hybridizable to each primer which comprises a first
sequence.
[0221] Specific Binding Pair
[0222] A specific binding pair may be used to construct the tag and
the anti-tag molecules of the invention. In one embodiment, instead
of having a 5' tag nucleotide sequence, the oligonucleotide primer
of the present invention comprises a 5' tag comprising a member of
a specific binding pair (e.g., biotin). A corresponding anti-tag
molecule can be a molecule (e.g., a polynucleotide, a protein or
other molecules) comprising the other member of the specific
binding pair (streptavidin). In this case, the interaction between
the tag and the anti-tag molecules is not through nucleotide
pairing, but through the interaction between the members of the
specific binding pair. A donor or acceptor labeled chain terminator
may be incorporated into the oligonucleotide primer according to
the subject method of the invention. The anti-tag molecule is
labeled with the complementary acceptor or donor of the pair of
interactive labels, and the interaction between biotin on the
elongated primer and the streptavidin on the anti-tag molecule will
allow the donor and acceptor of the same pair of interactive labels
to come to close proximity, therefore generating a FRET signal.
[0223] Biotinylation of a target molecule (e.g., a polynucleotide)
is a well known procedure which may be accomplished through a
number of known procedures. For example, a chain terminator or a
polynucleotide may be biotinylated using 5' kinase reactions.
[0224] Pre-Treatment Before Measuring
[0225] Undesired labels that might cause high background or other
problems during the measuring or analysis (e.g., unincoporated
labeled chain terminators or unhybridized oligonucleotide probes)
may be removed by several ways. The operability of the subject
methods is not dependent upon the precise method of removal. In
some embodiments of the invention, the elongating chains comprising
the oligonucleotide and the incorporated chain terminator are
separated from the target polynucleotide prior to or concurrent
with the incubation with the oligonucleotide probe. Such separation
may be achieved in a variety of ways, including, but not limited
to, electrophoresis, separation of extended primers by binding to a
solid phase via a binding moiety on the extendable primer,
separation of the extended primers by binding a solid phase in a
binding moiety on the labeled terminator, chromatography, and the
like. Suitable electrophoretic detection and separation systems
include systems designed for the simultaneous electrophoretic
separation and detection of fluorescently labeled polynucleotides,
e.g., automated DNA sequencers such as the PE Applied Biosystems
(Foster City, Calif., USA) 310, 377, or 3700.
[0226] Any of a broad range of solid supports known in the art
could effectively be used in methods of the invention. For example,
streptavidin-coated solid supports are available commercially such
as for example, streptavidin-coated magnetic beads available from
Promega (Madison, Wis.) and streptavidin coated microtitre plates
(Covalink) available from NUNC (Raskilde, Denmark) or Labsystems
(Marlboro, Mass.).
[0227] Separation methodologies dependent on nonspecific
physical-chemical properties may be employed. Preferred
methodologies include those methodologies in which specific
affinity interactions are utilized such as solid support based
affinity chromatography.
[0228] The unincorporated labeled terminators may be removed by a
variety of different methods. One embodiment of such removal
methods is the adsorption of the unincorporated terminators, such
as by QIAquick.TM. PCR purification kit spin column (Qiagen, Venlo,
Netherlands). In a preferred embodiment of the invention, the
unincorporated labeled terminators are separated on the basis of
differential electrophoretic migration by altering the
electrophoretic mobility properties of the unincorporated
terminators. The electrophoretic mobility of the unincorporated
labeled terminators may be altered by treating the terminators with
an alkaline phosphatase, shrimp alkaline phosphatase being
particular preferred.
[0229] It will be readily appreciated to those skilled in the art
that the subject methods and compositions may readily be
"multiplexed" so as to simultaneously perform multiple analyses in
a single reaction mixture. For example, one can detect SBE products
from different primers/target polynucleotide pairs simultaneously.
This may be accomplished by using a different 5' sequence tag of
the primer and oligonucleotide probe for each primer/target
polynucleotide pair.
[0230] The invention also includes compositions for performing the
subject methods of identifying a nucleotide at a predetermined
location on a polynucleotide molecule for analysis. The
compositions of the invention include mixtures that are formed in
the course of performing the methods of the invention or
compositions that may be formed in the process of preparing to
perform methods of the invention. Examples of the subject
composition include mixtures comprising the combinations of an
oligonucleotide primer comprising a first and a second sequences
and an oligonucleotide probe which hybridizes to the
oligonucleotide primer. The oligonucleotide probe may be labeled
with a first member of a pair of interactive labels. The
composition may further comprise one or more polynucleotide chain
terminators, each of which is labeled with a second member of the
pair of interactive labels. The composition may also comprise a
polynucleotide synthesis enzyme (e.g., a DNA polymerase) and
reagents required for primer extension and hybridization between
the probe and the primer. The primer or the probe in the subject
composition may be coupled to a member of a specific binding pair
to allow its separation from other reagents in the composition or
the reaction mixture comprising the subject composition.
[0231] A subject composition may comprise an oligonucleotide
comprising a first sequence and a covalently linked tag molecule,
and a labeled anti-tag molecule which specifically interacts with
the tag molecule on the oligonucleotide primer. The tag molecule is
preferred to locate at the 5' terminal of the oligonucleotide
primer.
[0232] The invention also includes kits for identifying a
nucleotide at a predetermined location on a target polynucleotide.
Embodiments of the subject kits include a plurality of reagents
that may be used to identify nucleotides in accordance with the
methods of the invention. Kits of the invention, in addition to the
reagents, preferably include written instructions for performing
the subject methods. The subject kit may comprise a labeled
oligonucleotide probe or a labeled anti-tag molecule, and one or
more labeled terminators. Kits are preferably packaged in a unit
container and may contain the reagents in pre-measured amounts
designed to operate with each other so as to produce the desired
result. The kits may further comprise one or more of the following
items, DNA polymerase, alkaline phosphatase, chromatography
columns, reaction buffers, amplification primers, exonuclease for
degrading excess amplification primers, and hybridization/washing
buffers.
EXAMPLES
Example 1
Detection of Nucleotide at Predetermined Position Using Probe
Complementary to the Primer
[0233] Detection of SNPs was also performed by FRET minisequencing
using a probe which is fully complementary to the primer. The
primer pBA was designed to anneal to pBluescript (A562C) so that
the dideoxynucleotide to be incorporated is a ddCTP.
8 pBA 5'-GGATGTGCTGCAAGGCGATT-3' pAntiBA
3'-(P)CCTACACGACGTTCCGCTAA(F)-5'
[0234] pBA and pAntiBA were synthesized and HPLC purified by Genset
Corporations (La Jolla, Calif.). pAntiBA20 was labeled with
Fluorecein at 5'-end, and blocked with a phosphate group at its
3'-end. The relative orientation of the primers (above) are
arranged to facilitate viewing of how they will hybridize to each
other. 25 .mu.l reactions contained 200 nM ROX-ddC, 4 U polymerase,
250 nM pBA 250 nM pAntiBA, and 200 nM pBluescript in 1.times.
polymerase reaction buffer. Negative control lacked DNA template
(pBluescript). Thermal cycling was performed in the Applied
Biosystems Prism 7700 Sequence Detector. Thermal cycling conditions
were performed by initial denaturing step at 95.degree. C. for 2
minutes, followed by 30 cycles at 95.degree. C. for 30 s,
50.degree. C. for 1 min, and 57.degree. C. for 30 s. The
fluorescent intensities were acquired during the
annealing/extension phase of the primer extension cycles. The
analysis was done using the multicomponent data from the Applied
Biosystems 7700 Sequence Detector. FIG. 4 illustrates that the
positive control (A4 well) shows a ROX signal increase due to FRET
from Fluorescein compared to the negative control (A3 well).
Example 2
Detection of Nucleotide at Predetermined Position Using a Probe
Partially Complementary to the Primer
[0235] Detection of SNPs was also performed by FRET minisequencing
using a probe which is partially complementary to the primer. The
primer pJ was designed to anneal to pBluescript (A562C) so that the
dideoxynucleotide to be incorporated is a ddCTP. 1
[0236] Oligos were synthesized and HPLC purified by Genset
Corporations (La Jolla, Calif.). pAntiJ was labeled with Fluorecein
at 5'-end, and blocked with a phosphate group at its 3'-end. The
relative orientation of the primers (above) are arranged to
facilitate viewing of how they will hybridize to each other.
[0237] 25 .mu.l reactions contained 200 nM ROX-ddC, 4 U polymerase,
250 nM pJ 250 nM pAntiJ, and 200 nM pBluescript in 1.times.
polymerase reaction buffer. Negative control lacked DNA template
(pBluescript). Thermal cycling was performed in the Applied
Biosystems Prism 7700 Sequence Detector. Thermal cycling conditions
were performed by initial denaturing step at 95.degree. C. for 2
minutes, followed by 30 cycles at 95.degree. C. for 30 s,
50.degree. C. for 1 min, and 57.degree. C. for 30 s. The
fluorescent intensities were acquired during the
annealing/extension phase of the primer extension cycles. The
analysis was done using the multicomponent data from the Applied
Biosystems 7700 Sequence Detector. FIG. 5 illustrates that the
positive control (B2 well) shows a ROX signal increase due to FRET
from Fluorescein compared to the negative control (B1 well).
Example 4
Detection of Nucleotide at Predetermined Position Using a Quencher
Molecule and a Probe Partially Complementary to the Primer
[0238] Detection of SNPs was also performed by FRET minisequencing
using a probe containing a quencher (FIG. 6). The primer pJ was
designed to anneal to pBluescript (A562C) so that the
dideoxynucleotide to be incorporated is a ddCTP. 2
[0239] pJ was synthesized and HPLC purified by Genset Corporations
(La Jolla, Calif.). pAntiJ-BHQ was synthesized, labeled with Black
Hole Quencher 2 (BHQ2) at its 5'-end, and blocked with a phosphate
group at its 3'-end by Biosearch Technologies (Novato, Calif.). The
relative orientation of the primers (above) are arranged to
facilitate viewing of how they will hybridize to each other.
[0240] 50 .mu.l reactions contained 200 nM ROX-ddC, 4 U polymerase,
250 nM pJ, 250 nM pAntiJ-BHQ, and 200 nM pBluescript in 1.times.
polymerase reaction buffer. Negative control lacked DNA template
(pBluescript). Thermal cycling was performed in the Mx4000 QPCR
system (Stratagene). Thermal cycling conditions were performed by
initial denaturing step at 95.degree. C. for 10 minutes, followed
by 30 cycles at 95.degree. C. for 30 s, 45.degree. C. for 1 min,
and 57.degree. C. for 30 s. The fluorescent intensities were
acquired during the annealing/extension phase of the primer
extension cycles. The analysis was done using the multicomponent
data from the Mx4000 QPCR system (Stratagene). FIG. 7 demonstrates
a ROX signal decrease for the positive control due to quenching of
ROX fluorescence by BHQ2 upon incorporation of ROX-ddC. Negative
control lacks DNA template and therefore, no incorporation (no
signal) is detected.
Other Embodiments
[0241] The foregoing examples demonstrate experiments performed and
contemplated by the present inventors in making and carrying out
the invention. It is believed that these examples include a
disclosure of techniques which serve to both apprise the art of the
practice of the invention and to demonstrate its usefulness. It
will be appreciated by those of skill in the art that the
techniques and embodiments disclosed herein are preferred
embodiments only that in general numerous equivalent methods and
techniques may be employed to achieve the same result.
[0242] All of the references identified hereinabove, are hereby
expressly incorporated herein by reference to the extent that they
describe, set forth, provide a basis for or enable compositions
and/or methods which may be important to the practice of one or
more embodiments of the present inventions.
Sequence CWU 1
1
4 1 20 DNA Artificial misc_feature (1)..(20) Synthetic primer 1
ggatgtgctg caaggcgatt 20 2 20 DNA Artificial misc_feature (1)..(20)
Synthetic primer 2 cctacacgac gttccgctaa 20 3 40 DNA Artificial
misc_feature (1)..(40) Synthetic primer 3 gaggctcgga gcggttaaac
ggatgtgctg caaggcgatt 40 4 20 DNA Artificial misc_feature (1)..(20)
Synthetic primer 4 ctccgagcct cgccaatttg 20
* * * * *