U.S. patent application number 10/784305 was filed with the patent office on 2005-06-02 for genetic engineering of streptavidin-binding peptide tagged single-chain variable fragment antibody to venezuelan equine encephalitis virus.
Invention is credited to Alvi, Azhar Z., Fulton, R. Elaine, Hu, Weigang, Nagata, Leslie P..
Application Number | 20050118569 10/784305 |
Document ID | / |
Family ID | 32908670 |
Filed Date | 2005-06-02 |
United States Patent
Application |
20050118569 |
Kind Code |
A1 |
Fulton, R. Elaine ; et
al. |
June 2, 2005 |
Genetic engineering of streptavidin-binding peptide tagged
single-chain variable fragment antibody to venezuelan equine
encephalitis virus
Abstract
A recombinant gene encoding a single-chain variable fragment
(scFv) antibody against Venezuelan equine encephalitis virus (VEE)
being cloned into a prokaryotic T7 RNA polymerase-regulated
expression vector was disclosed. A streptavidin-binding peptide
(SBP) sequence fused to a 6His tag is then attached downstream to
the scFv gene. The recombinant fusion protein is expressed in
bacteria and then purified by immobilized metal affinity
chromatography. ELISA and Western blotting results revealed that
the fusion protein not only retained VEE antigen binding and
specificity properties similar to those of its parent native
monoclonal antibody, but also possessed streptavidin-binding
activity. This discovery obviates the need for chemical
biotinylation of antibodies and the risk associated with antibody
denaturation and provides a stable and reproducible reagent for
rapid and efficient immunoassay of VEE.
Inventors: |
Fulton, R. Elaine; (Medicine
Hat, CA) ; Nagata, Leslie P.; (Medicine Hat, CA)
; Alvi, Azhar Z.; (Mississauga, CA) ; Hu,
Weigang; (Medicine Hat, CA) |
Correspondence
Address: |
RADER FISHMAN & GRAUER PLLC
LION BUILDING
1233 20TH STREET N.W., SUITE 501
WASHINGTON
DC
20036
US
|
Family ID: |
32908670 |
Appl. No.: |
10/784305 |
Filed: |
February 24, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60448902 |
Feb 24, 2003 |
|
|
|
Current U.S.
Class: |
435/5 ; 435/326;
435/455; 435/6.18; 435/69.1; 435/91.2; 530/388.1; 536/23.53 |
Current CPC
Class: |
C07K 2319/22 20130101;
C07K 16/1081 20130101; C07K 2317/622 20130101 |
Class at
Publication: |
435/005 ;
435/006; 435/091.2; 435/455; 435/069.1; 435/326; 530/388.1;
536/023.53 |
International
Class: |
C12Q 001/70; C12Q
001/68; C07H 021/04; C12P 019/34; C12N 005/06 |
Claims
What is claimed is:
1. A method for constructing a recombinant gene encoding a
single-chain variable fragment antibody cloned into an expression
vector and fused with a streptavidin-binding peptide (SBP) gene
sequence to produce a fusion protein, comprising: (a) encoding
anti-VEE single-chain variable fragment antibody (scFv Ab) gene to
a recombinant plasmid and inserting a SBP gene and a 6His tag
downstream to develop a SBP tagged scFv Ab construct; (b)
amplifying the resultant scFv/SBP/6His by polymerase chain reaction
(PCR); (c) inserting the amplified PCR products into cloning vector
to produce a SBP-plasmid; (d) constructing said SBP-plasmid with
promoter to produce a SBP tagged scFv Ab; and (e) expressing said
SBP tagged scFv Ab in E. coli cells as inclusion bodies and
purifying the expressed SBP tagged scFv Ab by immobilized metal
affinity chromatography.
2. A method as in claim 1, wherein: said recombinant plasmid in
step (a) is a pPICZ.alpha.BmA116 recombinant plasmid; said cloning
vector in step (c) is pCRT7 TA; and said promoter in step (d) is a
T7 promoter.
3. A method as in claim 1, wherein said anti-VEE scFv Ab is mA116
Ab.
4. A fusion protein, SBP tagged scFv Ab, comprising a single-chain
variable fragment antibody (scFv Ab) fused with a
streptavidin-binding peptide (SBP) sequence.
5. The SBP tagged recombinant scFv Ab fusion protein of claim 4,
comprising an amino acid sequence encoded by the nucleotide
sequence shown in SEQ ID NO.: 1.
6. The SBP tagged recombinant scFv Ab fusion protein of claim 4,
comprising the amino acid sequence shown in SEQ ID NO.: 2.
7. The SBP tagged recombinant scFv Ab fusion protein of claim 4,
wherein said fusion protein has a molecular weight of .about.32
kDa.
8. The SBP tagged recombinant scFv Ab fusion protein of claim 4,
wherein said fusion protein displays high antigen-binding affinity
to Venezuelan equine encephalitis virus (VEE).
9. The SBP tagged recombinant scFv Ab fusion protein of claim 4,
wherein said fusion protein displays high streptavidin-binding
activity.
10. The SBP tagged recombinant scFv Ab fusion protein of claim 4,
wherein said scFv Ab is mA116 scFv Ab.
11. A method for using the SBP tagged recombinant scFv Ab fusion
protein of claim 4 for detecting VEE, comprising: (a) reacting the
SBP tagged scFv Ab with a sample containing VEE for observing
antigen-binding activity; and (b) analyzing the reactant by
enzyme-linked immunosorbent assay (ELISA).
12. The method of claim 11, wherein said ELISA immunoassay employs
an indicator enzyme and substrate system to visually indicate
presence of antigen-binding activity.
13. The method of claim 12, wherein horseradish peroxidase is used
in said ELISA as the indicator enzyme.
14. The method of claim 12, wherein
2,2'-azino-di-(3-ethyl-benzthiazoline-- sulfonic acid) diammonium
salt (ABTS) is used in said ELISA as the substrate system.
15. The method of claim 11, wherein said scFv Ab is mA116 scFv Ab.
Description
[0001] This Application claims the benefit of U.S. Provisional
Application No. 60/448,902, filed on Feb. 24, 2003, the entire
content of which is incorporated by reference in this
application.
FIELD OF THE INVENTION
[0002] This invention relates to the construction of a recombinant
gene encoding a single-chain variable fragment antibody cloned into
an expression vector and fused with a streptavidin-binding peptide
sequence to produce a fusion protein. The resultant fusion protein
can be used as reagent for immunoassay of Venezuelan equine
encephalitis virus when detected by horseradish
peroxidase-conjugated streptavidin. This invention is related to
U.S. Provisional Patent Application No. 60/361,698 filed by Fulton
et al., the same inventors and assignee, which is herein
incorporated by reference.
BACKGROUND OF THE INVENTION
[0003] List of Prior Art Literatures
[0004] Johnston R E and Peters C J: Alphavirus. In: Fields
virology, 3.sup.rd ed. Fields B N, Knipe D M and Howley P M (Eds.),
Raven Publishers, Philadelphia, Pa., 1996, pp.843-898.
[0005] Franck P T and Johnson K M: An outbreak of Venezuelan
encephalitis in man in the Panama Canal Zone. Am J Trop Med Hyg
1970;19:860-865.
[0006] Johnson K M, Shelokov A, Peralta P H, Dammin G J, and Young
N A: Recovery of Venezuelan equine encephalomyelitis virus in
Panama: a fatal case in man. Am J Trop Med Hyg 1968;17:432-440.
[0007] Alvi A Z, Stadnyk L L, Nagata L P, Fulton R E, Bader D E,
Roehrig J T, and Suresh M R: Development of a functional monoclonal
single-chain variable fragment antibody against Venezuelan equine
encephalitis virus. Hybridoma 1999;18:413-421.
[0008] Alvi A Z, Fulton R E, Chau D, Suresh M R, and Nagata L P:
Development of a second generation monoclonal single chain variable
fragment antibody against Venezuelan equine encephalitis virus:
expression and functional analysis. Hybridoma and Hybridomics
2002;21:169-178.
[0009] Alvi A Z, Hu W G, Fulton R E, Nagata L P, Coles J E, and
Long M C: Functional enhancement of a partially active single chain
variable fragment antibody to Venezuelan equine encephalitis virus.
Viral Immunology 2003;16:213-222.
[0010] Luo D, Geng M, Schultes B, Ma J, Xu D Z, Hamza N, Qi W,
Noujaim A A, and Madiyalakan R: Expression of a fusion protein of
scFv-biotin mimetic peptide for immunoassay. J. Biotechnol
1998;65:225-228.
[0011] Long M C, Jager S, Mah D C, Jebailey L, Mah M A, Masri S A,
and Nagata L P: Construction and characterization of a novel
recombinant single-chain variable fragment antibody against Western
equine encephalitis virus. Hybridoma 2000;19:1-13.
[0012] Nakamura R M: Monoclonal antibodies: methods and clinical
laboratory applications. Clin Physiol Biochem 1983;1:160-172.
[0013] Huston J S, Levinson D, Mudgett-Hunter M, Tai M S, Novotny
J, Margolies M N, Ridge R J, Bruccoleri R E, Haber E, and Crea R:
Protein engineering of antibody binding sites: recovery of specific
activity in an anti-digoxin single-chain Fv analogue produced in
Escherichia coli. Proc Natl Acad Sci USA 1988;85:5879-5883.
[0014] Marin M, Brockly F, Noel D, Etienne-Julan M,
Biard-Piechaczyk M, Hua T D, Gu Z J, and Piechaczyk M: Cloning and
expression of a single-chain antibody fragment specific for a
monomorphic determinant of class I molecules of the human major
histocompatibility complex. Hybridoma 1995; 14:443-451.
[0015] Bruyns A M, De Jaeger G, De Neve M, De Wilde C, Van Montagu
M, and Depicker A: Bacterial and plant-produced scFv proteins have
similar antigen-binding properties. FEBS Lett 1996;386:5-10.
[0016] George A J, Jamar F, Tai M S, Heelan B T, Adams G P,
McCartney J E, Houston L L, Weiner L M, Oppermann H, and Peters A
M: Radiometal labeling of recombinant proteins by a genetically
engineered minimal chelation site: technetium-99m coordination by
single-chain Fv antibody fusion proteins through a C-terminal
cysteinyl peptide. Proc Natl Acad Sci USA 1995;92:8358-8362.
[0017] Boleti E, Deonarain M P, Spooner R A, Smith A J, Epenetos A
A and George A J: Construction, expression and characterisation of
a single chain anti-tumour antibody (scFv)-IL-2 fusion protein. Ann
Oncol 1995;6:945-947.
[0018] Wels W, Harwerth I M, Mueller M, Groner B, and Hynes N E:
Selective inhibition of tumor cell growth by a recombinant
single-chain antibody-toxin specific for the erbB-2 receptor.
Cancer Res 1992;52: 6310-6317.
[0019] Green N M: Avidin: 1. The use of 14C-biotin for kinetic
studies and for assay. Biochem J 1963; 89:585-590.
[0020] Guesdon J L, Ternynck T, and Avrameas S: The use of
avidin-biotin interaction in immunoenzymatic techniques. J
Histochem Cytochem 1979;27:1131-1139.
[0021] Hsu S M, Raine L, and Fanger H: Use of
avidin-biotin-peroxidase complex (ABC) in immunoperoxidase
techniques: a comparison between ABC and unlabeled antibody (PAP)
procedures. J Histochem Cytochem 1981;29:577-580.
[0022] Miralles F, Takeda Y, and Escribano M J: Comparison of
carbohydrate and peptide biotinylation on the immunological
activity of IgG1 murine monoclonal antibodies. J Immunol Methods
1991;140:191-196.
[0023] Devlin J J, Panganiban L C, and Devlin P E: Random peptide
libraries: a source of specific protein binding molecules. Science
1990;249:404-406.
[0024] Ostergaard S, Hansen P H, Olsen M, and Holm A: Novel avidin
and streptavidin binding sequences found in synthetic peptide
libraries. FEBS Lett 1995;362:306-308.
[0025] Gissel B, Jensen M R, Gregorius K, Elsner H I, Svendsen I,
and Mouritsen S: Identification of avidin and streptavidin binding
motifs among peptides selected from a synthetic peptide library
consisting solely of D-amino acids. J Pept Sci 1995; 1:217-226.
[0026] Schmidt T G, Koepke J, Frank R, and Skerra A: Molecular
interaction between the strep-tag affinity peptide and its cognate
target, streptavidin. J Mol Biol 1996; 255:753-766.
[0027] Skerra A, and Schmidt T G: Applications of a peptide ligand
for streptavidin: the strep-tag. Biomol Eng 1999;16:79-86.
[0028] Koo K, Foegeding P M, and Swaisgood H E: Construction and
expression of a bifunctional single-chain antibody against Bacillus
cereus spores. Appl Environ Microbiol 1998;64:2490-2496.
[0029] Aubrey N, Devaux C, di Luccio E, Goyffon M, Rochat H, and
Billiald P: A recombinant scFv/streptavidin-binding peptide fusion
protein for the quantitative determination of the scorpion venom
neurotoxin Biol Chem 2001;382:1621-1628.
[0030] Schmidt T G and Skerra A: One-step affinity purification of
bacterially produced proteins by means of the "strep tag" and
immobilized recombinant core streptavidin. J Chromatogr A
1994;676:337-345.
[0031] Zwicker N, Adelhelm K, Thiericke R, Grabley S, and Hanel F:
Strep-tag II for one-step affinity purification of active bHLHzip
domain of humanc-myc. Biotechniques 1999;27:368-375.
[0032] Sutton M R, Fall R R, Nervi A M, and Alberts A W, Vagelos P
R, and Bradshaw R A: Amino acid sequence of Escherichia coli biotin
carboxyl carrier protein (9100). J Biol Chem
1977;252:3934-3940.
[0033] Venezuelan equine encephalitis virus (VEE), belonging to
alphavirus genus of the family Togaviridae, is an important
pathogen of epidemics in humans and of epizootics in some animals
(Johnston et al., 1996). VEE causes a spectrum of human diseases
ranging from inapparent infection to acute encephalitis (Franck et
al; 1970; Johnson et al., 1968). Since the VEE genome is composed
of positive sense RNA, its nucleic acid is infectious independent
of the complete viral particle (Johnston et al., 1996).
Furthermore, VEE is highly infectious by aerosol inhalation in
humans (Johnston et al., 1996). Thus, VEE is a potential biological
warfare and bioterrorist agent of concern. Therefore, simple,
stable, and efficient immunoassays are required for rapid
identification of VEE in environmental or clinical samples in order
that immediate therapeutic and preventive counter measures can be
taken to limit the epidemic spread of VEE infection.
[0034] The present inventors have previously cloned and
characterized several single-chain variable fragment antibodies
(scFv Abs) against VEE (Alvi et al., 1999; Alvi et al., 2002; Alvi
et al., 2003). Among them, mA116 scFv Ab was well characterized,
showing sensitivity and specificity in recognition of VEE by
immunoassay (Alvi et al., 2003). In order to further explore the
potentiality of mA116 scFv Ab as an immunodiagnostic reagent for
detecting VEE, the present inventors successfully fused a
streptavidin-binding peptide (SBP) to mA116 scFv Ab by DNA
recombinant technique. This confers a streptavidin-binding function
on the mA116 scFv Ab and therefore obviates the need for
conventional chemical biotinylation. Chemical biotinylation is
commonly associated with impairment of the antigen-binding site of
the Ab and it is hence desirable to use the recombinant SBP tagged
mA116 scFv of the present invention as reagent to develop a simple,
stable and efficient immunoassay for VEE.
SUMMARY OF THE INVENTION
[0035] It is an object of the present invention to teach a method
for constructing a streptavidin-binding peptide (SBP) to the
sequence for mA I16 scFv Ab to VEE. According to one aspect of the
present invention, it provides a method for constructing a
recombinant gene encoding a single-chain variable fragment antibody
cloned into an expression vector and fused with a SBP gene sequence
to produce a fusion protein, comprising: (a) encoding anti-VEE scFv
Ab gene to a recombinant plasmid and inserting a SBP gene and a
6His tag downstream to develop a SBP tagged scFv Ab construct; (b)
amplifying the resultant scFv/SBP/6His by polymerase chain
reaction; (c) inserting the amplified PCR products into cloning
vector to produce a SBP-plasmid; (d) constructing said SBP-plasmid
with promoter to produce a SBP tagged scFv Ab; and (e) expressing
said SBP tagged scFv Ab in E. coli cells as inclusion bodies and
purifying the expressed SBP tagged scFv Ab by immobilized metal
affinity chromatography.
[0036] It is another object of the invention to demonstrate that
the recombinant fusion protein retains antigen-binding affinity to
VEE and possesses streptavidin-binding function. Hence, the
genetically recombinant SBP tagged mA116 scFv Ab can be used as an
excellent reagent for detecting VEE by means of immunoassay.
According to another aspect of the present invention, it provides a
method for using the SBP tagged recombinant scFv Ab fusion protein
of claim 4 for detecting VEE, comprising: (a) reacting the SBP
tagged scFv Ab with a sample containing VEE for observing
antigen-binding activity; and (b) analyzing the reactant by
enzyme-linked immunosorbent assay (ELISA).
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1 is a schematic diagram showing the construction of
pCRT7mA116SBP. Step 1--A single double-stranded oligonucleotide
encoding SBP and 6His flanked by Not I and Sal I sticky ends was
ligated into pPICZ.alpha.BmA116 digested with NotI/Sal I. Step
2--scFv/SBP/6His tag sequence was amplified from
pPICZ.alpha.BmA116SBP vector by PCR. Step 3--PCR product was
ligated into pCRT7 TA cloning vector as described under "Materials
and Methods".
[0038] FIG. 2 shows the nucleotide and deduced amino acid sequences
(SEQ ID NOs. 1 and 2 respectively) of SBP tagged mA116 Ab. MA116
scFv followed by SBP and 6His tags.
[0039] FIG. 3 shows SDS-PAGE analysis of samples from the
purification of the SBP tagged mA116 scFv Ab. Samples were resolved
on 10% polyacrylamide gel and stained with Coomassie blue. Lane
1--molecular weight markers; Lane 2--bacterial lysate; Lane
3--solubilized protein fraction; Lane 4--column flow through
fraction; Lane 5--purified fraction.
[0040] FIGS. 4A & 4B show Western blotting analysis of samples
from the purification of the SBP tagged mA116 scFv Ab. Samples were
resolved by SDS-PAGE, transferred to Immunobilon-P membranes, and
probed with: FIG. 4A: HRP-conjugated Ni--NTA. FIG. 4B:
HRP-conjugated streptavidin. Lane 1--bacterial lysate; Lane
2--solubilized protein fraction; Lane 3--column flow through
fraction; Lane 4--purified fraction.
[0041] FIGS. 5A & 5B are graphs showing VEE antigen binding
assay by ELISA. FIG. 5A: Various concentrations of Abs were added
to 96-well plate coated with 10 .mu.g/ml of VEE; FIG. 5B: 10
.mu.g/ml of Abs were added to a 96-well plate coated with various
concentrations of VEE. Binding was detected with HRP-conjugated
streptavidin or HRP-conjugated anti-mouse Ig followed by ABTS
solution. Each point represents the mean .+-. the standard error of
the mean (SEM) of the four determinations.
DETAILED DESCRIPTION OF THE INVENTION
[0042] Materials and Methods
[0043] Construction of pCRT7mA116SBP
[0044] The pPICZ.alpha.BmA116 recombinant plasmid, containing
anti-VEE mA116 scFv Ab gene, arranged in variable heavy
(VH)-variable light (VL) chain orientation via (Gly.sub.4Ser).sub.3
linker, was constructed previously. In order to introduce a SBP
sequence, PCHPQFPRCYA (SEQ ID NO. 3) (Lue et at., 1998) followed by
a 6His tag at the C-terminus of mA116 scFv Ab, two complementary
oligonucleotides corresponding to the SBP sequence and 6His tag
with flanking sequences for restriction enzymes Not I and Sal I,
were synthesized and purified by Life Technologies (Burlington,
ON). The sequences were as follows: sense,
5'-ggccgcCCATTCTGGTGGTGGTGGCCCATGCCATCCGC
AGTTCCCACGATGTTATGCGGGTGGTGGCGG- TTCTCATCATCATCATCATCAT TGAg-3'
(SEQ ID NO. 4); anti-sense, tcgacTCAATGATGATGATGATGATGAGAAC
CGCCACCACCCGCATAACATCGTGGGAACTGCGGATGGCAT- GGGCCACCACC
ACCAGAATGGgc-3' (SEQ ID NO. 5). The two oligonucleotides were
heated to denature, and then annealed to a single double-stranded
oligonucleotide by slow cooling to room temperature. The annealed
dimer possessed a Not I sticky end on one side and Sal I on the
other side, and was ligated to pPICZA.alpha.BmA116 that had been
cut with Not I and Sal I. The resulting plasmid was named
pPICZ.alpha.BmA116SBP.
[0045] To obtain high expression of the recombinant fusion protein,
the PCR method was introduced to amplify the mA116 scFv/SBP/6His
sequence in pPICZ.alpha.BmA116SBP vector and the PCR product was
subcloned into a T7 RNA polymerase-regulated expression vector. Two
primers were synthesized on an Oligo 1000 DNA synthesizer (Beckman
Instruments, Fullerton, Calif.). The sequence of the forward primer
was 5'-ATGGCTAAAGAAGAAGGGGTAT- C-3' (SEQ ID NO. 6) and the reverse
was 5'-TCATGTCTAAGGCTACAAACTCAA-3' (SEQ ID NO. 7). PCR reaction in
a 50 .mu.l volume consisted typically of 200 .mu.mol each dNTP, 0.6
.mu.M primers, 0.1 .mu.g template, and 1.25 unit of HotStarTaq.TM.
DNA polymerase in buffer supplied by the manufacturer (Qiagen,
Mississauga, ON). Initial activation (95.degree. C. for 15 min) was
carried out followed by cycling (94.degree. C. for 1 min,
61.degree. C. for 1 min, and 72.degree. C. for 2 min), repeated 30
times, on a Peltier Thermal Cycler (DNA Engine PTC-200; MJ
Research, Watertown, Mass.). After gel-purification, the PCR
fragment was cloned into the pCRT7 vector by use of a pCRT7 TA
cloning expression kit in accordance with the manufacturer's
instructions (Invitrogen, Carlsbad, Calif.). The recombinant
plasmid, named pCRT7mA116SBP, contained the correct orientation of
the insert, mA116 scFv/SBP/6His tag, as confirmed by restriction
digestion fragment mapping and DNA sequencing.
[0046] Expression, Purification and Refolding of the SBP Tagged
mA116 scFv Ab
[0047] Expression, purification and refolding of the SBP tagged
mA116 scFv Ab were performed using minor modifications of
previously described methodologies (Long et al., 2000). In brief,
an overnight culture of E. coli BL-21 (DE3) pLys cells that had
been transformed with pCRT7mA116SBP vector, was diluted 1:50 with
LB-medium containing 100 .mu.g/ml ampicillin and incubated with
shaking at 37.degree. C. to OD.sub.600 of 0.5. The promoter was
then induced for 3 hr by isopropyl .beta.-D-thiogalactoside (IPTG).
The cell pellet was resuspended in 5 mM borate sodium, pH 9.3 and 4
M urea, and cell lysate was prepared by sonication (three cycles of
10 sec; amplitude 10 .mu.m; 15 sec cooling on ice), using a MSE
Soniprep 150-probe sonicator (Wolf Laboratories, Pocklington, UK).
The sonicates were centrifuged (13,000 g for 10 min) and pellets
were resuspended in 5 mM borate sodium, pH 9.3, 8 mM urea, and 100
mM sodium chloride (solubilizing agent). Purification of the
recombinant protein was performed on Talon.TM. metal affinity resin
(Clontech, Palo Alto, Calif.). A solution of 5 mM borate sodium, pH
9.3, 8 M urea, and 100 mM sodium chloride was used as wash buffer.
Bound fractions were eluted with 100 mM imidazole and then 1 M
arginine (final concentration) was added as cosolvent, to encourage
the correct folding of the protein molecules. The recombinant
protein was refolded by removal of 8 M urea, by dialyzing against 5
mM borate sodium, pH 9.3, and 1 M arginine; the cosolvent was then
removed by dialyzing against 5 mM borate sodium, pH 9.3. The purity
was checked by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and Coomassie brilliant blue R-250
(Bio-Rad Laboratories, Mississauga, ON) staining after samples had
been concentrated in dialysis bags on a bed of polyethylene glycol
compound, molecular weight (MW) 15,000-20,000 (Sigma, Oakville,
ON).
[0048] SDS-PAGE and Western Blot Analysis
[0049] Proteins were separated by 10% SDS-PAGE gels by use of a
Mini-PROTEAN II apparatus (Bio-Rad Laboratories). The bands were
visualized by Coomassie blue staining. The molecular weights of the
samples were estimated by comparison to the relative mobility
values of standards of known molecular weights.
[0050] Gels were immunoblotted to Immunobilon-P membranes
(Millipore Corp, Bedford, Mass.) using a western blot semi-dry
transfer apparatus (Bio-Rad Laboratories) with Towbin buffer (25 mM
Tris-HCl, pH 8.3, 192 mM glycine, and 20% methanol). Blots were
blocked with blocking buffer (2% bovine serum albumin in
phosphate-buffered saline (PBS)). Blots were washed three times for
5 min with PBS containing 0.1% tween-20 (PBST) and then incubated
directly with a 1:1000 dilution of HRP-conjugated streptavidin
(Sigma) or a 1:2000 dilution of HRP-conjugated Ni-nitrilotriacetic
acid (NTA) (Qiagen) at room temperature for 1 hr. After three
washes for 5 min with PBST, and two washes for 2 min with deionized
water, the specific binding was detected by an enhanced
chemiluminescence kit (Amersham Pharmacia Biotech, Baie d'Urfe,
QC).
[0051] Enzyme-Linked Immunosorbent Assay (ELISA)
[0052] The antigen-binding activity of the purified SBP tagged
mA116 scFv Ab to VEE antigen was determined by an ELISA. Nunc
maxisorp.TM. flat-bottomed 96-well plates (Life Technologies) were
coated overnight at 4.degree. C. with whole VEE (strain TC-83) at a
fixed concentration of 10 .mu.g/ml, or various concentrations of
0.2-60 .mu.g/ml, in carbonate bicarbonate buffer, pH 9.6,
containing 0.02% sodium azide. The plates were washed five times
with PBST and then blocked twice in 2% bovine serum albumin for 1
hr at 37.degree. C. After five washes with PBST, plates were
incubated for 1 hr at 37.degree. C. with various concentrations of
0.6-50 .mu.g/ml, or a fixed concentration of 10 .mu.g/ml of the SBP
tagged mA116 scFv Ab or its parental monoclonal antibody (MAb)
1A4A1, diluted in PBST. Following five washes with PBST, plates
were incubated for 1 hr at 37.degree. C. with 1:1000 dilution of
HRP-conjugated streptavidin in PBST for the SBP tagged mA116 scFv
Ab and 1:2000 dilution of HRP-conjugated goat anti-mouse Ig for
1A4A1 MAb. Finally, the plates were washed five times with PBST and
developed for 30 min at room temperature with a substrate
consisting of 2,2'-azino-di-(3-ethyl-benzthiazoline-sulfonic acid)
diammonium salt (ABTS) and hydrogen peroxidate (Kirkegaard and
Perry Laboratories, Gathersburg, Md.). The reactions were read at
an absorbance of 405 nm by a microplate autoreader (Molecular
Devices, Sunnyvale, Calif.).
[0053] Results
[0054] Construction, Expression and Purification
[0055] The pPICZ.alpha.BmA116 recombinant plasmid, encoding
anti-VEE mA116 scFv Ab gene was used as a source material to create
the SBP tagged mA116 scFv Ab construct. After a synthetic
double-stranded oligonucleotide encoding a SBP and 6His tag was
inserted downstream to the pPICZ.alpha.BmA116, mA116 scFv/SBP/6His
was amplified using PCR method with appropriate primers. The PCR
product was inserted into pCRT7 TA cloning vector. The resulting
plasmid, designated pCRT7mA116SBP, contained the mA116 scFv Ab
gene, followed by the SBP sequence under the control of T7 promoter
(FIG. 1). In addition, there was a 6His tag located downstream of
the SBP for immobilized metal affinity chromatography (IMAC)
purification. The nucleotide and deduced amino acid sequences are
showed in FIG. 2. The encoded whole recombinant fusion protein was
296 residues with a predicted molecular weight of 31.3 kDa.
[0056] The SBP tagged mA116 scFv Ab was expressed in E.coli BL-21
cells as inclusion bodies and purified by IMAC. SDS-PAGE
demonstrated that there was a relatively small amount of protein in
the bacterial lysate of molecular weight .about.32 kDa
corresponding to the predicted size (31.3 kDa) of the SBP tagged
mA116 scFv Ab, due to the presence of large amounts of
contaminating proteins (FIG. 3, Lane 2). However, after
centrifugation of the lysate, and dissolution of the pellet in
solubilizing agent, many of the bacterial host proteins were
removed from the lysate, making the .about.32 kDa band more visible
(FIG. 3, Lane 3). The solubilized protein fraction was incubated
with metal affinity resin and loaded to an empty column. After
thoroughly washing with wash buffer, the bound fractions were
eluted by 100 mM imidazole. Only one band of .about.32 kDa was
observed in the purified fraction (FIG. 3, lane 5). In this
purification protocol, the expressed protein could be purified to
over 90%.
[0057] Biochemical Characterization
[0058] To confirm the integrity of the expressed SBP tagged mA116
scFv Ab, a series of Western blotting experiments was performed, in
which the 32-kDa protein was detected by both HRP-conjugated
streptavidin and HRP-conjugated Ni--NTA (FIG. 4). With
HRP-conjugated Ni--NTA, a 32 kDa band was observed in all
purification fractions (FIG. 4A, Lanes 2-4). With HRP-conjugated
streptavidin, bands were visible at 32 kDa in all fractions (FIG.
4B, Lanes 2-4). In addition, bands were observed at 20 kDa in the
bacterial lysate, solubilized protein fraction, and column flow
through fraction (FIG. 4B, Lanes 1-3). However, after purification,
only the 32 kDa band was present in the purified fraction (FIG. 4B,
Lane 4).
[0059] Binding Properties to VEE Antigen
[0060] The immunoreactivity of the SBP tagged mA116 scFv Ab to VEE
antigen was examined by ELISA. When the plates were coated with a
fixed concentration of VEE (10 .mu.g/ml), the SBP tagged mA116 scFv
Ab bound to VEE in a dose-dependent manner, similar to the binding
to VEE of its parental 1A4A1 MAb (FIG. 5A). An additional ELISA was
performed in which a concentration gradient of VEE was titrated
against a fixed concentration of Abs (10 .mu.g/ml). A similar
dose-response relationship was observed (FIG. 5B).
[0061] Discussion
[0062] Since the introduction of MAb technology, a number of types
of immunodiagnostic assays have been developed based on specific
binding between antigens and their corresponding MAbs (Nakamura,
1983). However, the disadvantages of MAbs as immunodiagnostic
reagents are numerous. The cost and time required for growth and
maintenance of hybridoma cell lines, and production and
purification of MAbs, coupled with the potential for occurrence of
genetic mutation during repeated cycles of cell growth, makes
routine production of MAbs from hybridoma cell lines difficult,
expensive, and time consuming. ScFv Abs are comprised of
immunoglobulin VH and VL chains, covalently connected by a peptide
linker (Huston et al., 1988). These small proteins generally retain
the specificity and affinity for antigen similar to their parental
MAb and possibly bind to poorly accessible epitopes more
efficiently due to their small size (Marin et al., 1995; Bruyns et
al., 1996). The attractiveness of scFv Abs is that they can be
produced economically in bacteria and manipulated via genetic
engineering, for example to form fusion proteins with additional
functions (George et al., 1995; Boleti et al., 1995; Wels et al.,
1992).
[0063] The streptavidin-biotin system has one of the highest
affinities (10.sup.-15 M) among receptor-ligand interactions
(Green, 1963). The strong interaction between streptavidin and
biotin has been applied in many immunoassays (Guesdon et al., 1979;
Hsu et al., 1981). However, chemical biotinylation of Ab is
time-consuming and, as most of the biotin binds to amino groups of
the protein, the degree of labeling can differ from batch to batch.
Furthermore, the possibility exists that the biological activity of
the Ab may be affected by the labeling procedure (Mirables et al.,
1991). With advent of recombinant DNA technology, it is possible to
fuse a short peptide to the target protein through gene fusion
technique. SBPs, constituting around 10 amino acids have been
selected from random peptide libraries (Devlin et al., 1990;
Osterguard et al., 1995; Gissel et al., 1995). Some of them have
been well characterized (Schmidt et al., 1996; Skewa et al., 1999).
SBPs have successfully been fused to scFv Abs to antigen CA125,
Bacillus cereus spores, and scorpion toxin for use in immunoassay
(Luo et al., 1998 Kao et al., 1998 Aubrey et al., 2001).
[0064] The present inventors genetically incorporated a SBP
sequence in mA116 scFv Ab gene in order to biotinylate mA116 scFv
Ab. DNA sequencing confirmed that DNA cloning was successful. The
SBP tagged mA I16 scFv Ab was expressed in E. coli to high levels
in the form of insoluble inclusion bodies. The insoluble
recombinant fusion protein was solubilized by denaturing agent, 8M
urea. Inclusion of 6His tag allowed the solubilized recombinant
fusion protein to be purified via IMAC. In this way, greater than
90% purity of the SBP tagged recombinant mA116 scFv Ab could be
obtained. After purification, arginine was introduced to the
recombinant protein solution to direct correct refolding.
[0065] The streptavidin-binding peptide confers reversible binding
activity toward the streptavidin. Therefore, it can be employed for
the one step purification of a corresponding fusion protein via
streptavidin affinity chromatography (Schmidt et al., 1994; Zwicker
et al., 1999). However, in the present invention, purification of
the recombinant SBP tagged mA116 scFv Ab using streptavidin
affinity column chromatography yielded only small amounts of
product containing relatively large amounts of host proteins (data
not shown). In fact, a large amount of streptavidin-binding protein
of around 20 kDa showed up in the bacterial lysate on Western blot
analysis of bacterial lysate (FIG. 4B). This may be attributed to
whole cell extracts of E.coli containing biotinylated proteins,
such as biotin carboxyl carrier protein (22.5 kDa) that binds
strongly to streptavidin (Sutton et al., 1977). Accordingly, a 6His
tag was introduced into the gene construct in order that IMAC could
be used to purify the Ab of the present invention.
[0066] The results of Western blot analysis confirmed that the
refolded recombinant fusion protein was intact, with a molecular
weight of .about.32kDa. The in vitro binding characteristics of the
SBP tagged mA116 scFv Ab to VEE antigen were assayed by ELISA. The
recombinant fusion protein exhibited strong binding activity to
VEE, indicating that the SBP did not interfere with the
conformation of antigen-binding site or the bioactivity of mA116
scFv Ab. The parental 1A4A1 MAb showed similar binding activity to
VEE. However, a direct comparison of the binding affinities between
both Abs was not possible by ELISA due to the use of different
HRP-conjugates.
[0067] In summary, a SBP sequence was introduced downstream to the
sequence for mA116 scFv Ab to VEE. The fusion protein was expressed
and purified. Fusion to the SBP did not affect the ability of mA116
scFv Ab to recognize VEE antigen with an affinity similar to that
observed for the parental MAb. Similarly, the streptavidin-binding
property of the fusion protein was not impaired. Western blot and
ELISA results suggest that SBP tagged mA116 scFv Ab could be used
for simple, stable, and efficient detection of VEE when used in
conjunction with HRP-conjugated streptavidin. This approach
eliminates the need for chemical biotinylation of Abs with
resultant possible impairment of the antigen-binding site of the
Ab.
[0068] It is to be understood that the embodiments and variations
shown and described herein are merely illustrative of the
principles of this invention and that various modifications may be
implemented by those skilled in the art without departing from the
scope and spirit of the invention.
[0069] In addition, the List of Prior Art Literatures referred to
in the Background of the Invention section is incorporated by
reference herein.
Sequence CWU 1
1
7 1 891 DNA Mouse CDS (1)..(891) scFv 1-807 SBP, 6His and spacers
808-891 1 atg gct aaa gaa gaa ggg gta tct ctc gag aaa aga gag gct
gaa gct 48 Met Ala Lys Glu Glu Gly Val Ser Leu Glu Lys Arg Glu Ala
Glu Ala 1 5 10 15 gca gga att cac gtg gcc cag ccg gcc atg gcc cag
gtc caa ctg cag 96 Ala Gly Ile His Val Ala Gln Pro Ala Met Ala Gln
Val Gln Leu Gln 20 25 30 gag tca gga cct gag ctg gtg aag cct ggg
gct tca gtg aag ata tcc 144 Glu Ser Gly Pro Glu Leu Val Lys Pro Gly
Ala Ser Val Lys Ile Ser 35 40 45 tgc aag gcc tct ggc tac acc ttc
act gac tac cat gtt cac tgg gtg 192 Cys Lys Ala Ser Gly Tyr Thr Phe
Thr Asp Tyr His Val His Trp Val 50 55 60 aag ggg aag cct gga cag
gga ctt gaa tgg att gga atg act tat cct 240 Lys Gly Lys Pro Gly Gln
Gly Leu Glu Trp Ile Gly Met Thr Tyr Pro 65 70 75 80 gga ttc gat aat
act aat tac agt gag act ttc aag ggc aag gcc aca 288 Gly Phe Asp Asn
Thr Asn Tyr Ser Glu Thr Phe Lys Gly Lys Ala Thr 85 90 95 ttg act
gta gac aca tcc tcc aac aca gtc tac atg cag ctc agc agc 336 Leu Thr
Val Asp Thr Ser Ser Asn Thr Val Tyr Met Gln Leu Ser Ser 100 105 110
ctg aca tct gag gac acc gct gtc tat ttt tgt gca aga ggt gtg ggc 384
Leu Thr Ser Glu Asp Thr Ala Val Tyr Phe Cys Ala Arg Gly Val Gly 115
120 125 ctt gac tac tgg ggc caa ggg acc acg gtc acc gtc tcc tca ggt
gga 432 Leu Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly
Gly 130 135 140 ggc ggt tca ggc gga ggt ggc tct ggc ggt ggc gga tcg
gac atc gag 480 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Asp Ile Glu 145 150 155 160 ctc act cag tct cca aat tcg ttg tcc aca
tca ata gga gac agg atc 528 Leu Thr Gln Ser Pro Asn Ser Leu Ser Thr
Ser Ile Gly Asp Arg Ile 165 170 175 aga atc acc tgc aag gcc agt cag
gat gtg gat act gct gta ggc tgg 576 Arg Ile Thr Cys Lys Ala Ser Gln
Asp Val Asp Thr Ala Val Gly Trp 180 185 190 tat caa cag aga cca ggg
caa tct cct aaa cta ctg att ttc tgg tca 624 Tyr Gln Gln Arg Pro Gly
Gln Ser Pro Lys Leu Leu Ile Phe Trp Ser 195 200 205 tcc acc cgg cac
act gga gtc cct gat cgc ttc aca ggc agt gga tct 672 Ser Thr Arg His
Thr Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser 210 215 220 ggg aca
gat ttc act ctc acc att agc aat gtg cag tct gaa gac ttg 720 Gly Thr
Asp Phe Thr Leu Thr Ile Ser Asn Val Gln Ser Glu Asp Leu 225 230 235
240 gca gat tat ttc tgt cac caa tat agc agc tat cca ttc acg ttc ggc
768 Ala Asp Tyr Phe Cys His Gln Tyr Ser Ser Tyr Pro Phe Thr Phe Gly
245 250 255 tcg ggg aca aag ttg gaa ata aaa cgg gcg gcc gcc cat tct
ggt ggt 816 Ser Gly Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala His Ser
Gly Gly 260 265 270 ggt ggc cca tgc cat ccg cag ttc cca cga tgt tat
gcg ggt ggt ggc 864 Gly Gly Pro Cys His Pro Gln Phe Pro Arg Cys Tyr
Ala Gly Gly Gly 275 280 285 ggt tct cat cat cat cat cat cat tga 891
Gly Ser His His His His His His 290 295 2 296 PRT Mouse
MISC_FEATURE scFv 1-269 SBP,6His and spacers 270-296 2 Met Ala Lys
Glu Glu Gly Val Ser Leu Glu Lys Arg Glu Ala Glu Ala 1 5 10 15 Ala
Gly Ile His Val Ala Gln Pro Ala Met Ala Gln Val Gln Leu Gln 20 25
30 Glu Ser Gly Pro Glu Leu Val Lys Pro Gly Ala Ser Val Lys Ile Ser
35 40 45 Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr His Val His
Trp Val 50 55 60 Lys Gly Lys Pro Gly Gln Gly Leu Glu Trp Ile Gly
Met Thr Tyr Pro 65 70 75 80 Gly Phe Asp Asn Thr Asn Tyr Ser Glu Thr
Phe Lys Gly Lys Ala Thr 85 90 95 Leu Thr Val Asp Thr Ser Ser Asn
Thr Val Tyr Met Gln Leu Ser Ser 100 105 110 Leu Thr Ser Glu Asp Thr
Ala Val Tyr Phe Cys Ala Arg Gly Val Gly 115 120 125 Leu Asp Tyr Trp
Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly 130 135 140 Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Glu 145 150 155
160 Leu Thr Gln Ser Pro Asn Ser Leu Ser Thr Ser Ile Gly Asp Arg Ile
165 170 175 Arg Ile Thr Cys Lys Ala Ser Gln Asp Val Asp Thr Ala Val
Gly Trp 180 185 190 Tyr Gln Gln Arg Pro Gly Gln Ser Pro Lys Leu Leu
Ile Phe Trp Ser 195 200 205 Ser Thr Arg His Thr Gly Val Pro Asp Arg
Phe Thr Gly Ser Gly Ser 210 215 220 Gly Thr Asp Phe Thr Leu Thr Ile
Ser Asn Val Gln Ser Glu Asp Leu 225 230 235 240 Ala Asp Tyr Phe Cys
His Gln Tyr Ser Ser Tyr Pro Phe Thr Phe Gly 245 250 255 Ser Gly Thr
Lys Leu Glu Ile Lys Arg Ala Ala Ala His Ser Gly Gly 260 265 270 Gly
Gly Pro Cys His Pro Gln Phe Pro Arg Cys Tyr Ala Gly Gly Gly 275 280
285 Gly Ser His His His His His His 290 295 3 11 PRT Artificial
Sequence Streptavidian-Binding Peptide 3 Pro Cys His Pro Gln Phe
Pro Arg Cys Tyr Ala 1 5 10 4 95 DNA Artificial Sequence
Oligonucleotides 4 ggccgcccat tctggtggtg gtggcccatg ccatccgcag
ttcccacgat gttatgcggg 60 tggtggcggt tctcatcatc atcatcatca ttgag 95
5 95 DNA Artificial Sequence Oligonucleotides 5 tcgactcaat
gatgatgatg atgatgagaa ccgccaccac ccgcataaca tcgtgggaac 60
tgcggatggc atgggccacc accaccagaa tgggc 95 6 23 DNA Artificial
Sequence DNA Primer 6 atggctaaag aagaaggggt atc 23 7 24 DNA
Artificial Sequence DNA Primer 7 tcatgtctaa ggctacaaac tcaa 24
* * * * *