U.S. patent application number 10/941295 was filed with the patent office on 2005-06-02 for viral preparations, vectors, immunogens, and vaccines.
This patent application is currently assigned to Xenova Research Limited. Invention is credited to Boursnell, Michael E.G., Inglis, Stephen C..
Application Number | 20050118192 10/941295 |
Document ID | / |
Family ID | 27267593 |
Filed Date | 2005-06-02 |
United States Patent
Application |
20050118192 |
Kind Code |
A1 |
Boursnell, Michael E.G. ; et
al. |
June 2, 2005 |
Viral preparations, vectors, immunogens, and vaccines
Abstract
A genetically disabled mutant virus has a genome which is
defective in respect of a selected gene that is essential for the
production of infectious new virus particles, and which carries
heterologous genetic material encoding an immunomodulatory protein
such as GM-CSF, IL-2, or others, such that the mutant virus can
infect normal host cells and cause expression of immunomodulatory
protein, but the mutant virus cannot cause production of infectious
new virus particles except when the virus infects recombinant
complementing host cells expressing a gene that provides the
function of the essential viral gene; the site of insertion of the
heterologous genetic material encoding the immunomodulatory protein
preferably being at the site of the defect in the selected
essential viral gene. Uses include prophylactic and therapeutic use
in generating an immune response in a subject treated therewith;
use in the preparation of an immunogen such as a vaccine for use in
tumour therapy; use in the in-vitro expansion of (e.g.
virus-specific) cytotoxic T cells; and therapeutic or prophylactic
use in corrective gene therapy.
Inventors: |
Boursnell, Michael E.G.;
(Cambridge, GB) ; Inglis, Stephen C.; (Cambridge,
GB) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
121 SW SALMON STREET
SUITE 1600
PORTLAND
OR
97204
US
|
Assignee: |
Xenova Research Limited
|
Family ID: |
27267593 |
Appl. No.: |
10/941295 |
Filed: |
September 14, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10941295 |
Sep 14, 2004 |
|
|
|
09917176 |
Jul 27, 2001 |
|
|
|
09917176 |
Jul 27, 2001 |
|
|
|
09033549 |
Mar 2, 1998 |
|
|
|
09033549 |
Mar 2, 1998 |
|
|
|
08604165 |
Feb 21, 1996 |
|
|
|
6287557 |
|
|
|
|
Current U.S.
Class: |
424/199.1 ;
424/93.2; 435/235.1; 435/456 |
Current CPC
Class: |
A61P 37/00 20180101;
C12N 15/86 20130101; C12N 2710/16643 20130101; A61P 43/00 20180101;
A61K 48/00 20130101; A61K 2039/55533 20130101; C12N 7/00 20130101;
C12N 2710/16662 20130101; A61K 2039/55522 20130101; A61K 2039/5256
20130101; A61K 39/39 20130101; A61P 31/12 20180101 |
Class at
Publication: |
424/199.1 ;
424/093.2; 435/456; 435/235.1 |
International
Class: |
A61K 048/00; A61K
039/12; C12N 007/00 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 16, 1996 |
GB |
9603322.0 |
Jul 28, 1995 |
GB |
9515557.8 |
Feb 21, 1995 |
GB |
9503395.7 |
Claims
1. A mutant virus having a genome which is defective in respect of
a selected gene that is essential for the production of infectious
new virus particles, and which carries heterologous genetic
material encoding an immunomodulatory protein, such that said
mutant virus can infect normal host cells and cause expression
therein of said heterologous genetic material encoding said
immunomodulatory protein, but said mutant virus cannot cause
production of infectious new virus particles except when said virus
infects recombinant complementing host cells which have been made
to carry and can express a gene that provides the function of said
essential viral gene.
2. A mutant virus according to claim 1, wherein said heterologous
genetic material encoding said immunomodulatory protein is inserted
at a site from which said essential viral gene has been
deleted.
3. A mutant virus according to claim 1, wherein the defect is in a
viral glycoprotein gene.
4. A mutant virus according to claim 1 which is a mutant of a
herpesvirus.
5. A mutant virus according to claim 1 which is a mutant of herpes
simplex virus (HSV).
6. A mutant virus according to claim 3 wherein the defect is in a
herpesviral glycoprotein gene.
7. A mutant virus according to claim 6 wherein the defect is in a
gene corresponding to glycoprotein gH, gD, gB or gL.
8. A mutant virus according to claim 1, wherein said heterologous
genetic material encodes a protein selected from cytokines,
chemokines, complement components, immune system accessory and
adhesion molecules, and receptors therefor of human or non-human
animal specificity.
9. A mutant virus according to claim 8, wherein the heterologous
genetic material encodes a protein selected from GM-CSF, IL-2,
IL-12, OX40, OX40L (gp34), and CD40L.
10. A process of using a mutant virus according to claim 1 as an
immunogen, for prophylactic or therapeutic use in generating an
immune response, which comprises treating a subject with said
mutant virus.
11. A process according to claim 10, where said mutant virus
encodes a heterologous antigen and said immune response is against
said antigen.
12. A process for preparing an immunogen such as a vaccine for
therapeutic or prophylactic use in tumour therapy which comprises
infecting cells carrying a tumour antigen with a mutant virus
according to claim 1.
13. A process for in-vitro expansion of (e.g. virus-specific)
cytotoxic T cells which comprises contacting T cells with a mutant
virus according to claim 1.
14. A process of therapeutic or prophylactic corrective gene
therapy which comprises infecting cells of a subject to be treated
with a mutant virus according to claim 1, encoding a gene to be
delivered to said subject.
15. A process of using a mutant virus according to claim 1 to
provide an immunostimulus to a treated human or non-human animal
subject, comprising: (i) contacting the mutant virus ex-vivo with a
preparation of cells capable after infection with the virus vector
of providing an immunostimulus to a subject to be treated; and (ii)
using the infected cells to deliver an immune stimulus to the
subject to be treated.
16. A process according to claim 15, wherein the infected cells are
used to deliver an immune stimulus to the subject to be treated by
direct administration of the infected cells as a vaccine e.g. after
inactivation before administration, e.g. after irradiation.
17. A process according to claim 15, wherein the infected cells are
used to deliver an immune stimulus to the subject to be treated by
use of the cells to prime or stimulate ex-vivo immune-competent
cells such as cells of the immune system of the subject to be
treated, followed by re-administration of the immune-competent
cells.
18. A process according to claim 17, wherein the cells infected
ex-vivo with the virus vector are autologous cells,
19. A process according to claim 17, wherein the cells infected
ex-vivo with the virus vector are heterologous cells, e.g.
comprising cells of a heterologous tumour cell line.
Description
[0001] This invention relates to viral preparations, immunogens,
vaccines and immunotherapeutic agents, and in particular to mutant
viruses, their culture, vaccines, and their preparation and uses,
e.g. as vectors for evoking immune responses or for corrective gene
therapy.
BACKGROUND AND PRIOR ART
[0002] Attenuated live viruses, including genetically engineered
recombinants, are known as useful vaccine vectors. The genome of
the live virus can be engineered to carry genes encoding
heterologous antigens against which immunological responses are
desired in such a way that the replicative ability of the live
virus is preserved, and that the heterologous gene is expressed in
cells infected by the recombinant virus. The expressed antigens are
thus available to provoke a useful immune response. The
heterologous antigens may originate from an infectious pathogen, in
order that a protective or therapeutic immune response can be
mounted against the infectious agent, but alternatively they may
represent tumour cell-specific or tumour-associated antigens; here
the aim is to induce an immune response against tumour cells, to
induce tumour rejection or regression.
[0003] More generally, recombinant viral vectors are among several
known agents available for the introduction of foreign genes into
cells so that they can be expressed as protein. A central element
is the target gene itself under the control of a suitable promoter
sequence that can function in the cell to be transduced. Known
techniques include non-viral methods, such as simple addition of
the target gene construct as free DNA; incubation with complexes of
target DNA and specific proteins designed for uptake of the DNA
into the target cell; and incubation with target DNA encapsulated
e.g. in liposomes or other lipid-based transfection agents.
[0004] A further option is the use of recombinant virus vectors
engineered to contain the required target gene, and able to infect
the target cells and hence carry into the cell the target gene in a
form that can be expressed. A number of different viruses have been
used for this purpose including retroviruses, adenoviruses, and
adeno-associated viruses.
[0005] Specification EP 0 176 170 (Institut Merieux: B Roizman)
describes foreign genes inserted into a herpes simplex viral genome
under the control of promoter-regulatory regions of the genome,
thus providing a vector for the expression of the foreign gene. DNA
constructs, plasmid vectors containing the constructs useful for
expression of the foreign gene, recombinant viruses produced with
the vector, and associated methods are disclosed.
[0006] Specification EP 0 448 650 (General Hospital Corporation: A
I Geller, X O Breakefield) describes herpes simplex virus type 1
expression vectors capable of infecting and being propagated in a
non-mitotic cell, and for use in treatment of neurological
diseases, and to produce animal and in vitro models of such
diseases.
[0007] Recombinant viruses are known in particular for use in gene
therapy applied to gene deficiency conditions.
[0008] Examples of genes used or proposed to be used in gene
therapy include: the gene for human adenosine deaminase (ADA), as
mentioned in for example WO 92/10564 (K W Culver et al: US
Secretary for Commerce & Cellco Inc), WO 89/12109 & EP 0
420 911 (IH Pastan et al); the cystic fibrosis gene and variants
described in WO 91/02796 (L-C Tsui et al: HSC Research &
University of Michigan), in WO 92/05273 (F S Collins & J M
Wilson: University of Michigan) and in WO 94/12649 (R J Gregory et
al: Genzyme Corp).
[0009] The prior art of malignant tumour treatment includes studies
that have highlighted the potential for therapeutic vaccination
against tumours using autologous material derived from a patient's
own tumour. The general theory behind this approach is that tumour
cells may express one or more proteins or other biological
macromolecules that are distinct from normal healthy cells, and
which might therefore be used to target an immune response to
recognise and destroy the tumour cells.
[0010] These tumour targets may be present ubiquitously in tumours
of a certain type. A good example of this in cervical cancer, where
the great majority of tumours express the human papillomavirus E6
and E7 proteins. In this case the tumour target is not a self
protein, and hence its potential as a unique tumour-specific marker
for cancer immunotherapy is clear.
[0011] There is increasing evidence that certain self proteins can
also be used as tumour target antigens. This is based on the
observation that they are expressed consistently in tumour cells,
but not in normal healthy cells. Examples of these include the MAGE
family of proteins. It is expected that more self proteins useful
as tumour targets remain to be identified.
[0012] Tumour associated antigens and their role in the
immunobiology of certain cancers are discussed for example by P van
der Bruggen et al, in Current Opinion in Immunology, 4(5) (1992)
608-612. Other such antigens, of the MAGE series, are identified in
T. Boon, Adv Cancer Res 58 (1992) pp 177-210, and MZ2-E and other
related tumour antigens are identified in P. van der Bruggen et al,
Science 254 (1991) 1643-1647; tumour-associated mucins are
mentioned in P O Livingston, in current Opinion in Immunology 4 (5)
(1992) pp 624-629; e.g. MUC1 as mentioned in J Burchell et al, Int
J Cancer 44 (1989) pp 691-696.
[0013] Although some potentially useful tumour-specific markers
have thus been identified and characterised, the search for new and
perhaps more specific markers is laborious and time-consuming, and
with no guarantee of success.
[0014] Administration to mammals of cytokines as such has been
tried, but is often poorly tolerated by the host and is frequently
associated with a number of side-effects including nausea, bone
pain and fever. (A Mire-Sluis, TIBTech vol. 11 (1993); M S Moore,
in Ann Rev Immunol 9 (1991) 159-91). These problems are exacerbated
by the dose levels often required to maintain effective plasma
concentrations.
[0015] Virus vectors have been proposed for use in cancer
immunotherapy to provide a means for enhancing tumour
immunoresponsiveness.
[0016] It is known to modify live virus vectors to contain genes
encoding a cytokine or tumour antigen: see specification WO
94/16716 (E Paoletti et al: Virogenetics Corp.) and references
cited therein: WO 94/16716 describes, for use in cancer therapy,
attenuated recombinant vaccinia viruses containing DNA coding for a
cytokine or a tumour antigen. Cytokines are examples of
immunomodulating proteins. Immuno-modulating proteins which enhance
the immune response such as the cytokine, interleukin 1,
interleukin 2 and granulocyte-macrophage colony stimulating factor
(GM-CSF) (see for example A W Heath et al., Vaccine 10 (7) (1992),
and Tao Mi-Hua et al., Nature 362 (1993)), can be effective vaccine
adjuvants.
[0017] It has been proposed to use GMCSF-transduced tumour cells as
a therapeutic vaccine against renal cancer. The protocols for
corresponding trials involve removal of tumour material from the
patients, and then transduction with the appropriate
immunomodulator gene. The engineered cells are then to be
re-introduced into the patient to stimulate a beneficial immune
response.
[0018] Although it is has been proposed to introduce
immunomodulatory genes into certain kinds of tumour cells, existing
methods are considered to have limitations, whether the
difficulties are due to low quantitative amounts of transduction,
to complexity, or to undesirable side-effects of the systems
employed.
[0019] Recently, an experimental intracranial murine melanoma has
been described as treated with a neuroattenuated HSV1 mutant 1716
(B P Randazzo et al, Virology 211 (1995) pp 94-101), of which the
replication appeared to be restricted to tumour cells and not to
occur on surrounding brain tissue.
[0020] Furthermore, vectors based on herpesvirus saimiri, a virus
of non-human primates, have been described as leading to gene
expression in human lymphoid cells (B Fleckenstein & R
Grassmann, Gene 102(2) (1991), pp 265-9). However, it has been
considered undesirable to use such vectors in a clinical
setting.
[0021] The prior art includes specification WO 92/05263 (Inglis et
al: Immunology Limited) (the content of which is incorporated
herein by reference), which describes for example the use as
vaccine of a mutant virus whose genome is defective in respect of a
gene essential for the production of infectious virus, such that
the virus can infect normal host cells and undergo replication and
expression of viral antigen genes in such cells but cannotm produce
infectious virus. WO 92/05263 particularly describes an HSV virus
which is disabled by the deletion of a gene encoding the essential
glycoprotein H (gH) which is required for virus infectivity (A
Forrester et al, J Virol 66 (1992) 341-348). In the absence of gH
protein expression non-infectious virus particles providing almost
the complete repertoire of viral proteins are produced. These
progeny virus, however, are not able to infect host cells and
spread of the virus within the host is prevented. Such a virus has
been shown to be an effective vaccine in animal model systems
(Farrell et al, J Virol 68 (1994) 927-932; McLean et al, J Infect
Dis, 170 (1994) 1100-9). These mutant viruses can be cultured in a
cell line which expresses the gene product in respect of which the
mutant virus is defective. Cell lines which are suitable for the
culture of certain viruses of this type have been described in the
literature: for example in references given in cited specification
WO 92/05263.
[0022] Complete or substantial sequence data has been published for
several viruses such as Epstein-Barr virus EBV (Baer et al, in
Nature 310 (1984) 207), human cytomegalovirus CMV (Weston and
Barrell in J Mol Biol 192 (1986) 177-208), varicella zoster virus
VZV (Davison and Scott, in J Gen Virol 67 (1986) 759-816) and
herpes simplex virus HSV (McGeoch et al, in J. Gen. Virol. 69
(1988) 1531-1574). The gH glycoprotein is known to have homologues
in EBV, CMV and VZV (Desai et al, in J Gen Virol 69 (1988)
1147).
[0023] Virus vectors provide an opportunity for intracellular
delivery of both DNA and protein, for immunisation and gene
therapy, e.g. corrective gene therapy, as well as for use in for
example cancer immunotherapy, but the prior art leaves it still
desirable to provide further viral vectors and processes useful for
transforming human and non-human animal cells and expressing
proteins therein.
SUMMARY AND DESCRIPTION OF THE INVENTION
[0024] According to the present invention, as described in further
detail below, a genetically inactivated (genetically disabled)
mutant virus vaccine provides an useful carrier for genes encoding
immunomodulatory proteins, and can be thus used as a virus vector.
The virus vaccine can infect cells e.g. of a vaccinated subject
leading to intracellular synthesis of viral antigens as well as of
the immunomodulatory proteins. Thus the immune response to the
virus can in certain examples of the invention be potentiated,
whether it is made against viral-encoded antigens or in response to
the immunomodulatory protein encoded by the virus. If the
genetically inactivated vaccine is also acting as a vector for
delivery of foreign antigens, then the immune response against the
foreign antigen can also be enhanced.
[0025] Since the vaccine virus can undergo only a single cycle of
replication in cells of the vaccinated host, however, production of
the immunomodulatory proteins will be confined to the site of
vaccination, in contrast to the situation with a replication
competent virus, where infection might spread throughout the body.
Furthermore, the overall amounts produced, though locally
sufficient to stimulate a vigorous immune response, will be
considerably less than that produced by a replication competent
virus, and thus much less likely to produce adverse systemic
responses.
[0026] It is considered an advantage to provide a vaccine or vector
system with the immunological benefit of a live virus or virus
vector together with the benefit of local production of
immunomodulatory protein, and which minimises the potential risk to
the vaccinated subject of unforeseen pathology, also avoiding the
potential environmental risk of allowing spread of a new and
potentially harmful replicating pathogen.
[0027] Cytokine administration as such is often poorly tolerated by
the host and is frequently associated with a number of side-effects
including nausea, bone pain and fever. (A Mire-Sluis, TIBTech vol.
11 (1993); M S Moore, in Ann Rev Immunol 9 (1991) 159-91). These
problems are exacerbated by the dose levels often required to
maintain effective plasma concentrations. To reduce systemic
toxicity a more targeted delivery of active cytokine is proposed,
as described herein.
[0028] A previous approach to overcome this problem was to fuse
antigen and cytokine genes to create a single bifunctional
polypeptide (M Hazama et al, Vaccine 11 (1993) p 6).
[0029] An alternative approach is to incorporate an nucleotide
sequence encoding an immunomodulating protein into a live virus
vaccine. Specification WO 94/16716 (E Paoletti et al: Virogenetics
Corp.) describes attenuated recombinant vaccinia viruses containing
DNA coding for cytokine or tumour antigen for use in cancer
therapy.
[0030] Virus vectors have found application in cancer immunotherapy
by providing a means for enhancing tumour immunoresponsiveness.
[0031] However, the present inventors consider that the use of live
viruses to carry immunomodulatory genes can pose a risk to the
community as well as the vaccinated individual. A vaccine virus
which is unable to spread from cell to cell, as provided by the
invention described herein, provides a considerable safety
advantage, since in normal circumstances there can be no
transmission to other individuals from the vaccines.
[0032] One unusual circumstance in which a transmission risk could
arise, however, is that if recombination were to occur between the
genetically inactivated virus and a naturally occurring wild virus
within the vaccinee, transfer might occur of the immunomodulatory
gene into the natural virus genome, or to the reconstitution of
replication competence by the vaccine virus through acquisition of
the missing gene. It is well known that homologous recombination
between closely related viruses can occur at relatively high
frequency when cells are simultaneously infected with both viruses.
This potential capacity can however be avoided by ensuring, as is
preferred according to the present disclosure, that the
immunomodulatory gene is inserted at the point within the vaccine
virus genome where the essential gene has been deleted. The
consequence of this mode of construction is that homologous
recombination with a wild virus, should it indeed occur within the
vaccinated host, cannot result in the production of a new virus
that is both replication competent and carries the immunomodulatory
gene (FIG. 7 of the accompanying drawings). This is because the
transfer of the deleted gene back into the vaccine virus would lead
to loss of heterologous sequences inserted at that site. By the
same token, transfer of the heterologous sequences to the wild
virus would result in loss of an essential gene.
[0033] According to the present invention, therefore, there is
provided a mutant virus which has a genome which is defective in
respect of a first gene essential for the production of infectious
virus, and which includes a heterologous nucleotide sequence which
encodes an immunomodulating protein. Additionally, in certain
embodiments the virus can also encode a heterologous antigen, e.g.
a viral or non-viral, e.g. tumour antigen.
[0034] The mutant virus can be a mutant DNA or RNA virus e.g. a
mutant non-retroviral virus, e.g. a RNA virus other than a
retroviral virus) for example a mutant herpesvirus, adenovirus,
papovavirus, or a mutant poxvirus. Mutant herpesviruses can for
example be based on HSV1, HSV2, VZV, CMV, EBV, HHV6, HHV7, or on
non-human animal herpesviruses such as PRV, IBRV/BHV, MDV, EHV, and
others.
[0035] The genome of the mutant virus is defective in respect of a
selected gene essential for the production of infectious virus by
infected host cells, such that the virus can infect normal host
cells (i.e. cells other than those which have been mutated so that
they express the product of the essential gene in respect of which
the virus is defective) and cause viral replication and expression
of viral antigen genes in those cells, but cannot cause production
of normal infectious virus. In such a mutant virus the genetic
defect can be such (e.g. deletion of herpesvirus gH or gD) as to
allow the production and release of non-infectious viral particles
when the mutant virus infects host cells other than such
recombinant complementing host cells.
[0036] Thus the present invention provides a mutant virus whose
genome is defective in respect of a gene essential for the
production of infectious virus, such that the virus can infect
normal cells and replicate therein to give rise to the production
and release from the cells of non-infectious viral particles, and
contains at least one heterologous nucleotide sequence which
encodes at least one immunomodulating protein. A plurality of
heterologous sequences can be carried in a single viral vector,
encoding if desired a plurality of immunomodulating proteins.
Alternatively, mixtures of vectors each containing a respective
heterologous nucleic acid sequence encoding an immunomodulatory
protein can be used.
[0037] The present invention also provides a mutant virus whose
genome is defective in respect of a gene essential for the
production of infectious virus and which carries genetic material
encoding an immunogen or a plurality of immunogens from a pathogen
exogenous to the virus, such that the virus can infect normal cells
and undergo some replication and expression of the genetic material
encoding the immunogen but cannot produce infectious virus
particles, and contains a heterologous nucleotide sequence which
encodes an immunomodulating protein.
[0038] As used herein, the expression "immunomodulatory protein"
and related terms includes a protein or proteins which either
enhance or suppress a host immune response to a mutant virus or
protein encoded thereby, or to an antigen such as an immunogen from
a pathogen or source exogenous to the virus, or a tumour-associated
antigen. The immunomodulating proteins are not normally those
proteins presently used as immunogens (antigens) in themselves. An
immunomodulatory protein can be a natural member of a human or
non-human animal immune system, e.g. of a mammalian immune system,
with a functional binding capacity for another natural constituent
of such an immune system. Alternatively an immunomodulatory protein
can be a protein encoded by a pathogen, which has a functional
binding capacity for a natural constituent of such an immune
system. Alternatively an immunomodulatory protein can be an
artificial protein, for example a fragment of a natural
immunomodulatory protein, or a mutein of such a protein or
fragment, or a fusion protein incorporating any of these. Many
immunomodulatory proteins, and genetic materials encoding them, and
their nucleotide and aminoacid sequences, are known to the
literature of this subject, and available in genetic sequence
databases such as the EMBL database, and several are commercially
available in the form of engineered genetic material for cloning
and other manipulation.
[0039] Immunomodulating proteins for which encoding nucleotide
sequences are expressibly carried by mutant virus vectors as
described herein can usefully for example be of sequences native to
the species which is to receive vaccination by the recombinant
viruses e.g. an immunomodulating protein of human type for
treatment of a human subject.
[0040] The protein(s) can be selected in certain examples of the
invention to enhance the effect of the mutant virus as an
immunogen, e.g. as a vaccine. Potential hazards associated with
expression of such proteins in a fully replicating virus can be
avoided by the defective character of the vector used as described
herein.
[0041] Examples of useful immunomodulating proteins include
cytokines, chemokines, complement components, immune system
accessory and adhesion molecules and their receptors of human or
non-human animal specificity. Useful examples include GM-CSF, IL-2,
IL-12, OX40, OX40L (gp34), lymphotactin, CD40, and CD40L. Further
useful examples include interleukins for example interleukins 1 to
15, interferons alpha, beta or gamma, tumour necrosis factor,
granulocyte-macrophage colony stimulating factor (GM-CSF),
macrophage colony stimulating factor (M-CSF), granulocyte colony
stimulating factor (G-CSF), chemokines such as neutrophil
activating protein (NAP), macrophage chemoattractant and activating
factor (MCAF). RANTES, macrophage inflammatory peptides MIP-1a and
MIP-1b, complement components and their receptors, or an accessory
molecule such as B7.1. B7.2. ICAM-1, 2 or 3 and cytokine receptors.
OX40 and OX40-ligand (gp34) are further useful examples of
immunomodulatory proteins. Immunomodulatory proteins can for
various purposes be of human or non-human animal specificity and
can be represented for present purposes, as the case may be and as
may be convenient, by extracellular domains and other fragments
with the binding activity of the naturally occuring proteins, and
muteins thereof, and their fusion proteins with other polypeptide
sequences, e.g. with immunoglobulin heavy chain constant domains.
Where nucleotide sequences encoding more than one immunomodulating
protein are inserted, they can for example comprise more than one
cytokine or a combination of cytokine(s) and accessory/adhesion
molecule(s).
[0042] Immune response evoked by the use of such vectors encoding
such products can include immune responses of a variety of types
that can be stimulated by the virus. e.g. a response against a
virally-encoded protein, and/or a response against a host antigen,
being a response stimulated by the viral vector or by the
expression of the heterologous gene encoded thereby. Among the uses
of the mutant virus vectors as described herein is e.g. to protect
a subject of a susceptible species against infection by a
corresponding wild-type virus when the subject is treated
therewith, e.g. infected therewith, e.g. by direct
immunisation.
[0043] The genetic material encoding an immunomodulatory protein
can be carried in the mutant viral genome as an expressible open
reading frame encoding a hybrid or fusion protein which comprises a
polypeptide region having homology to and functionality of an
immunomodulatory protein, linked to a polypeptide region having
another homology and optionally another functionality. For example,
the immunomodulatory protein can be, comprise, or correspond in
functionality to the gp34 protein identified as a binding partner
to human Ox-40 (see W Godfrey et al, J Exp Med 180(2) 1994 pp
757-762, and references cited therein, including S Miura et al, Mol
Cell Biol 11(3) 1991, pp 1313-1325). The version of this protein
functionality that can be encoded in the mutant viral genome can
correspond to the natural gp34 sequence itself, or to a fragment
thereof, or to a hybrid expression product e.g. based on the
(C-terminal) extracellular (binding) domain of gp34 fused to
another protein, e.g. to the constant region of an immunoglobulin
heavy chain such as human IgG1, e.g. with the extracellular domain
of gp34 (a type 2 membrane protein) fused at its N-terminal to the
C-terminal of the immunoglobulin constant domain.
[0044] Others of the immunomodulatory proteins can also be carried
and expressed in such derivative and hybrid forms. It is also
understood that mutations of the aminoacid sequences of such
immunomodulatory proteins can be incorporated. Included here are
proteins having mutated sequences such that they remain homologous,
e.g. in sequence, function, and antigenic character, with a protein
having the corresponding parent sequence. Such mutations can
preferably for example be mutations involving conservative
aminoacid changes, e.g. changes between aminoacids of broadly
similar molecular properties. For example, interchanges within the
aliphatic group alanine, valine, leucine and isoleucine can be
considered as conservative. Sometimes substitution of glycine for
one of these can also be considered conservative. Interchanges
within the aliphatic group aspartate and glutamate can also be
considered as conservative. Interchanges within the amide group
asparagine and glutamine can also be considered as conservative.
Interchanges within the hydroxy group serine and threonine can also
be considered as conservative. Interchanges within the aromatic
group phenylaalanine, tyrosine and tryptophan can also be
considered as conservative. Interchanges within the basic group
lysine, arginine and histidine can also be considered conservative.
Interchanges within the sulphur-containing group methionine and
cysteine can also be considered conservative. Sometimes
substitution within the group methionine and leucine can also be
considered conservative. Preferred conservative substitution groups
are aspartate-glutamate; asparagine-glutamine;
valine-leucine-isoleucine; alanine-valine; phenylalanine-tyrosine;
and lysine-arginine. In other respects, mutated sequences can
comprise insertion and/or deletions.
[0045] In certain examples the immunomodulating protein can
comprise a cytokine, preferably granulocyte macrophage colony
stimulating factor (GM-CSF), e.g. murine or preferably human
GM-CSF.
[0046] Murine and human GM-CSFs are both known: the murine GM-CSF
gene encodes a polypeptide of 141 amino acids, the mature secreted
glycoprotein having a molecular weight of between 14 k-30 k daltons
depending on the degree of glycosylation. GM-CSF generically is a
member of the haematopoietic growth factor family and was first
defined and identified by its ability to stimulate in vitro colony
formation in haematopoietic progenitors. GM-CSF is a potent
activator of neutrophils, eosinophils and macrophage-monocyte
function, enhancing migration, phagocytosis, major
histocompatibility complex (MHC) expression, and initiating a
cascade of bioactive molecules which further stimulate the immune
system. GM-CSF is currently being clinically evaluated for
treatment of neutropenia following chemotherapy and as an adjuvant
in cancer therapy.
[0047] The heterologous nucleotide sequence employed can comprise a
heterologous gene, gene fragment or combination of genes provided
it encodes an immunomodulating protein as defined above.
[0048] According to examples of the invention, combinations of two
or more immunomodulatory proteins can be encoded for the purposes
described herein within one virus vector, or a mixture of two or
more vectors each containing at least one gene encoding a different
immunomodulatory product can be used. In particular examples, given
for illustration only and not limitation, combinations involving
IL2, GMCSF, lymphotactin and/or CD40L can be used with each other
or with others of the immunomodulatory proteins cited above. Each
of the other binary combinations of the immunomodulatory proteins
mentioned above are also given by, and within the scope of, this
disclosure.
[0049] Examples of mutant virus as provided hereby can be capable
of protecting a susceptible species, immunised therewith, against
infection by the corresponding wild-type virus. The mutant virus
can also carry a mutation which enables it to cause expression in
host cells of antigen for example corresponding to another
pathogen, eg. a bacterial or viral pathogen, and thereby be able to
confer immunity against such another pathogen on a host of a
susceptible species immunised with such a mutant virus.
[0050] Examples of such antigens are papilloma virus proteins L1
and L2, HIV proteins, gag, pol, env and nef, chlamydia antigens
(such as the chlamydia Major Outer Membrane Protein MOMP) and
Chlamydia heat shock proteins.
[0051] Alternatively the antigen can be a tumour associated antigen
whereby the anti-tumour activity of the CTLs associated with tumour
cell depletion is enhanced. It has been found that specific
cytokines such as tumour necrosis factor-.alpha., interferon gamma,
interleukin-2, interleukin-4 and interleukin-7 are particularly
useful in this regard. Tumour associated antigens and their role in
the immunobiology of certain cancers is discussed for example by P
van der Bruggen et al, Current Opinion in Immunology, 4(5) (1992)
608-612. Particular examples of such antigens which are envisaged
for use in the context of the present application are E6 and E7
antigens of human papillomavirus (especially for example of types
6, 11, 16, 18, etc); Epstein-Barr virus-derived proteins, e.g.
those identified in references 24 and 25 in P van der Bruggen et
al., cited above; antigens of the MAGE series as identified in T.
Boon, Adv Cancer Res 58 (1992) pp 177-210 and/or MZ2-E and other
antigens as identified in P. van der Bruggen et al, Science 254
(1991) 1643-1647; melanoma proteins, e.g. human tyrosinase; and
mucins such as those identified in P. O. Livingston, in current
Opinion in Immunology 4 (5) (1992) pp 624-629; e.g. MUC1 as
identified in J Burchell et al, Int J Cancer 44 (1989) pp
691-696.
[0052] In general, mutant virus can be based on a double-stranded
DNA virus, eg. a herpes virus, such as herpes simplex virus. The
first gene, as referred to above, can be the glycoprotein gH
gene.
[0053] The defects in the first gene can comprise deletion or
complete or partial inactivation. The gene can be for example
inactivated by any mutations that block expression, e.g. point or
promoter mutations or inactivating insertional mutations.
Preferably the first gene is deleted in its entirety.
[0054] Heterologous nucleotide sequences inserted in the genome of
certain examples of the mutant virus can be expressed in infected
cells, e.g. at the site of inoculation, and may be expressed during
latency in infected neurones. Expression of the heterologous
nucleotide sequence can be regulated on two levels, by selection of
a suitable promoter, and by the inherent limitations of the mutant
virus itself. The heterologous sequence can be placed under the
control of any of a wide variety of known viral promoters e.g. a
CMV IE promoter, or under the control of a known mammalian e.g.
tissue-specific promoter. Spread of the mutant virus within the
host is self-limiting and therefore expression of the heterologous
nucleotide sequence in such cases is restricted to the duration of
intracellular expression at the site of inoculation. A suitable
promoter can be selected, inducible or constitutive, of viral or
cellular origin, to enable more precise regulation of gene
expression and protein concentration. The gene sequence can be
native or modified to allow localisation of the protein within a
specified cellular compartment.
[0055] In a preferred embodiment, the heterologous nucleotide
sequence encoding an immunomodulatory protein is inserted into the
genome of the mutant virus at the locus of the first gene: most
preferably, it completely replaces the said first gene which is
deleted in its entirety. In this way, even if any unwanted
recombination event should take place, which results in the
reinsertion of the first gene from a wild source into the mutant
virus, it would be most likely to eliminate the inserted
heterologous nucleotide sequence. This would avoid the possibility
that a replication competent viral carrier for the heterologous
nucleotide sequence might be produced. Such a recombination event
would be extremely rare, but in this embodiment, the harmful
effects of such an occurrence would be minimised.
[0056] An advantage of immunogenic examples of the invention is to
provide intracellular antigen delivery which can stimulate both
antibody and cell mediated immunity and the production of effective
localised cytokine concentrations in the presence of antigen
without inducing systemic toxicity. For example, expression of
GM-CSF in an animal vaccinated with such a viral vector, in cells
of the treated animal that have been infected by the vector,
occurring as a result of the presence of a GM-CSF-encoding gene in
the infecting virus vector, can usefully enhance the level of
specific and/or neutralising antibody response by the vaccinated
animal to viral or tumour antigens.
[0057] The combination of cytokine and antigen can enhance the host
response to the associated antigen. In turn this can increase the
immunogenicity of poorly immunogenic proteins, and can allow a dose
reduction with more effective antigens.
[0058] Examples of mutant viruses hereby provided can be used as
immunogens, e.g. for prophylactic or therapeutic use in generating
an immune response in a subject treated therewith. Embodiments of
the invention also provides for use of a mutant virus as hereby
provided in the preparation of an immunogen such as a vaccine for
therapeutic or prophylactic use. A particular application is in the
field of tumour therapy as discussed above, where as mentioned for
example the role of the immunogen can be to stimulate immune
response directed against endogenous tumour antigens.
[0059] The present invention also provides an immunogen such as a
vaccine comprising a mutant virus as hereby provided, eg. an
immunogenic preparation such as a vaccine comprising such mutant
virus together with a pharmaceutically acceptable vehicle such as
is used in the preparation of live vaccines, and can optionally
include adjuvant.
[0060] The mutant virus can for example be formulated into an
immunogenic or vaccine preparation in a dose containing for example
up to about 5.times.10{circumflex over ( )}7 pfu of the mutant
virus, e.g. up to about 5.times.10{circumflex over ( )}6 pfu or up
to about 5.times.10{circumflex over ( )}5 pfu.
[0061] The mutant viruses as hereby provided can be manufactured by
a method of involving the culture of cells which have been infected
with the mutant virus, the cells also expressing a gene which
complements the first defective viral gene so as to allow
production of infectious virus particles containing the defective
genome, and recovering the mutant virus from the culture.
[0062] In immunogenic examples of the viruses disclosed herein, a
second viral gene which normally functions to downregulate a host
immune response against virus carrying such a second gene can be
inactivated, e.g. deleted, and the resulting mutant virus used as a
safe vector for delivering to the immune system of an infected host
a protein such as an immunostimulatory protein or antigen normally
foreign to the virus: this can be achieved by inserting, into the
genome of the virus, nucleic acid sequences coding for such a
protein, in such a way as to cause their expression during
infection of host cells by the virus. For example, a gene encoding
a desired foreign antigen can be inserted in an effective manner by
cloning the desired gene next to a viral promoter, to obtain a DNA
cassette containing the gene and the promoter; cloning the cassette
into a suitable plasmid; and co-transfecting the plasmid into a
complementing cell line along with DNA purified from the mutant
virus with its defect in a gene of which the product is provided by
the cell line; and screening for recombinant virus. An example of
the application of somewhat analogous technique is described, for
example, in respect of a gene encoding SIV gp120 antigen, in
WO92/05263 (Immunology Ltd: Inglis et al).
[0063] Such examples of genetically disabled virus vectors can be
used in processes of providing an immunostimulus to a treated human
or non-human animal subject, e.g. for purposes of cancer
immunotherapy. The use of the vectors can be either direct, e.g. by
administration to the subject, e.g. into the site of a solid
tumour, or it can be indirect. For example the use of the vector
can comprise:
[0064] (i) contacting a defective virus vector ex-vivo with a
preparation of cells capable after infection with the vector of
providing an immunostimulus to a subject to be treated; and
[0065] (ii) using the infected cells to deliver an immune stimulus
to the subject to be treated, e.g.
[0066] (a) by direct administration of the infected cells as a
vaccine e.g. after inactivation before administration, e.g. after
irradiation, or
[0067] (b) by indirect use of the cells to prime or stimulate
ex-vivo immune-competent cells such as cells of the immune system
of the subject to be treated, followed by re-administration of the
immune-competent cells e.g. without concurrent administration of
virus or virus-infected cells. Any cells unwanted in this
connection can for example be removed by a purification process
comprising negative depletion, e.g. by selective removal of cells
of unwanted type e.g. with corresponding antibodies or other
binding agents.
[0068] Cells infected ex-vivo with the virus vector can be either
autologous cells or heterologous cells, e.g. heterologous cells
obtained from one or a plurality of subjects with a condition
similar to that which is to be treated. The cells can be of a
single cell type or of a mixture of cell types, e.g. they can
comprise cells of one or plural cell lines established from
clinical tumour samples. Thus, for example, in the case where an
immune stimulus is to be given, directed against melanoma cells,
the heterologous cells can be melanoma cells from one or more
subjects with melanoma, other than the subject to be treated, or
including the subject to be treated. Corresponding arrangements can
be made for other specificities of immune stimulus.
[0069] The infected cells for administration to provide an immune
stimulus can preferably be inactivated, e.g. by irradiation, before
administration. They can preferably be incubated for a sufficient
time before inactivation to allow them to express the heterologous
gene carried by the viral vector.
[0070] According to examples of the invention there is also
provided a dosed or calibrated preparation of vector-infected,
optionally inactivated cells, for administration to a subject to be
treated to an immune stimulus, which has been dosage-calibrated,
e.g. by reference to the number or concentration of infected cells
it contains, or by reference to the quantity of heterologous gene
product it expresses.
[0071] Alternatively the genetically disabled virus vectors can be
used in in-vivo administration of a quantity or concentration of
the virus vector to contact and thereby infect tumour cells in
vivo, e.g. cells of a solid tumour such as for example a
melanoma.
[0072] Among the cells that can usefully be treated in this way are
for example malignant cells of human and non-human animals,
especially for example malignant cells related to blood cells, e.g.
leukaemic cells, e.g. CD34+ cells (haematopoietic cells) (see, for
example, cell types as mentioned in R Jurecic et al, ch 2, pp 7-30
in `Somatic Gene Therapy` CRC Press 1995, ed. P. L. Chang).
[0073] Immunological treatment of tumours using cytokines is
reviewed by H Tahara et al, ch. 15, pp 263-285 in `Somatic Gene
Therapy` CRC Press 1995, ed. P. L. Chang). The vectors described
herein can be applied to the immunological applications of the
cytokines and methods of treatment reviewed in the cited review by
H Tahara et al, using appropriate adaptations and modifications as
will be readily apparent to those skilled in the field.
[0074] The invention also finds further application in vitro for
example in in vitro treatments such as expansion of T cells such as
virus-specific cytotoxic T cells. Two complications of many
immunosuppressive or cytotoxic treatments are generalised viraemia
following virus infections and expansion of virus-transformed cells
as a result of latent virus reactivation. This is due to the fact
that the normal mechanism for controlling such infections is
impaired as a result of the treatment. One possible solution to
this problem is to produce in vitro the appropriate cytotoxic T
cells which are capable of controlling the virus infected cells.
This can be done by isolating peripheral blood mononuclear cells or
lymphocytes or T cells prior to treatment of the patient and
stimulating such cells in vitro with a preparation of live virus.
It is necessary to use live virus as cytotoxic T cells are
generally directed against peptides derived from foreign proteins
which are synthesised within the antigen-presenting cell:
inactivated virus or individual proteins are very poor at raising
cytotoxic T cell responses. The activated cells are then expanded
in culture over a period of weeks with further re-stimulation with
antigen and a growth factor such as interleukin-2. However, there
is the concern that there might be residual live virus in the cell
culture when the CTLs are re-infused into the patient. Use of a
disabled virus capable of inducing CTL activity but incapable of
spread within the patient, if inadvertently given along with the in
vitro expanded cells, can therefore provide an advantage over a
system that uses replication competent virus.
[0075] Hence the invention further provides a method for producing
virus-specific cytotoxic T cells which method comprises;
[0076] (a) isolating a sample of blood mononuclear cells,
lymphocytes or T cells from a patient;
[0077] (b) culturing said sample in vitro in the presence of a
mutant virus which is defective in respect of a first gene
essential for the production of infectious virus, and which can
optionally include a heterologous nucleotide sequence which encodes
an immunomodulating protein; and
[0078] (c) reinfusing cultured cells into the patient.
[0079] Certain vectors provided by the present invention can also
be applied to gene therapy, e.g. corrective gene therapy. In such
an application the vector can further encode a gene to be delivered
by way of corrective gene therapy, e.g. a gene encoding ADA or
another gene to be administered for such a purpose e.g. as
mentioned above. A vector as described herein encoding the
immunomodulatory protein TGF beta can be particularly suitable as a
vector for corrective gene therapy, to downregulate the response of
the treated subject, who will usually be treated either directly
with a vector provided hereby or with live cells, autologous or
heterologous, after their infection with the vector. Negative
immunomodulatory effects can be provided by this or other suitable
choice of immunomodulatory proteins. Further choice of
immunomodulatory proteins for this application can for example be
as follows: Inhibition of Th1 effects can be achieved with vectors
encoding Th2 cytokines or vice versa: for example a vector encoding
IL10 against Th1 effects and a vector encoding IFN-gamma against
Th2 effects. Immune response can be further downregulated by using
a vector that encodes for example an immune downregulatory gene of
viral or other pathogenic origin, e.g. a vector encoding a herpes
ICP47 gene (from HSV1 or HSV2) or additionally encoding another
known immune-downregulatory gene, e.g. E3-gp19k of adenovirus (see
G Fejer et al, J Virol 68 (1994) 5871-81)). Literature procedures
of gene therapy, e.g. U.S. Pat. No. 5,399,346 (W F Anderson et al),
can be adapted with the use of the vectors provided hereby.
[0080] Alternatively the systems disclosed herein can be used to
express immunomodulating proteins, particularly authentic mammalian
proteins. Many expression systems are available for the manufacture
of clinically relevant proteins. The expression system selected and
in particularly the organism used will have a profound influence on
the final character of the protein, with probable influences on
molecular weight and degree of glycosylation, immunogenicity,
toxicity and potency. GM-CSF has been successfully manufactured in
E. coli (Libby, R. T. et al DNA 1987 Jun. 6), yeast (Price, V et al
Gene 1987 55 (2-3)) and mammalian cell culture systems, however
considerable differences are seen in yield, product potency and
therefore cost, toxicity and in vivo clearance rates (Dorr. R. T.
Clin Ther. 1993 Jan.-Feb. 15, D Hovgaard Eur J. Hematology 1993
January 50) These parameters in turn can affect the economic and
technical viability of treating a particular disease with a protein
product.
[0081] In a further aspect the invention provides a method of
producing an immunomodulating protein, which method comprises
culturing in-vitro a cell line infected with a mutant virus which
is defective in respect of a first gene essential for the
production of infectious virus, and which includes a heterologous
nucleotide sequence which encodes an immunomodulating protein, said
cell line being a complementary cell line capable of supporting
replication of said mutant virus, and optionally thereafter
isolating immunomodulating protein from said culture.
[0082] In particular, recombinant HSV vectors have the potential to
be used as alternative expression system where an authentic
mammalian cell derived product is required and where conventional
stable cell expression systems are unsuccessful or inappropriate.
The system can operate as a conventional batch culture system where
complementing cells i.e. CR1 cells (designation of a recombinant
complementing Vero-derived cell line expressing gH of HSV1) are
grown to confluence using standard tissue culture systems, the
cells are infected at high titre with the recombinant virus
containing the coding sequence for heterologous gene expression. At
an appropriate time following infection the culture supernatants
can be harvested and processed to recover the relevant protein.
[0083] In order to illustrate the present invention more fully,
embodiments will be described by way of example only and not by way
of limitation. The construction and properties of a gH-defective
virus is described in Forrester et al, 1992 J. Virol. 66, p 341, in
WO92/05263 and in WO94/21807. Further, all genetic manipulation
procedures can be carried out according to standard methods as
described in "Molecular Cloning" A Laboratory Manual, eds.
Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory Press
1989.
[0084] The examples are illustrated non-limitatively by reference
to the accompanying drawings, in which
[0085] FIGS. 1 to 6 are diagrams illustrating the construction of
plasmids pIMMB45, pIMMB56, pIMMB46, pIMC14, pIMR1 and pIMR3,
respectively.
[0086] FIG. 7 is a recombination diagram illustrating the
introductory description of the invention.
[0087] The description below particularly includes:
[0088] Construction of gH-deleted HSV1 and HSV2 encoding (murine)
GM-CSF at the site of deletion of the gH gene and able to cause
expression of the GM-CSF in an infected cell:
[0089] Testing the effect of such a vector as an immunogen
(vaccine):
[0090] Construction of gH-deleted HSV2 encoding human GM-CSF at the
site of deletion of the gH gene and able to cause expression of the
GM-CSF in an infected cell: and
[0091] Construction of gH-deleted HSV2 encoding human IL-2 at the
site of deletion of the gH gene and able to cause expression of the
IL-2 in an infected cell.
[0092] Construction of gH-Deleted HSV1 and gH-Deleted HSV2
Expressing GM-CSF
[0093] The gH-deleted HSV1 virus and gH-deleted HSV2 virus was
propagated in the complementing cell lines. These cell lines have
been engineered to express the HSV-1 gH gene or the HSV-2 gH gene
respectively. Such cell lines can be constructed as described in
WO94/05207 and WO94/21807 and references cited therein. The
following section provides a further description of the
construction of suitable cell lines, and starts with the
construction of certain plasmids.
[0094] Source of Virus DNA:
[0095] Where HSV viral DNA is required, it can be made for example
(in the case of HSV2) from the strain HG52 by the method of
Walboomers and Ter Schegget (1976) Virology 74, 256-258, or by
suitable adaptations of that method. An elite stock of the HG52
strain is kept at the Institute of Virology, MRC Virology Unit,
Church Street, Glasgow, Scotland, UK. The DNA of other HSV-2
strains is likely to be very similar in this region, and strains G
and MS for example can be obtained from the ATCC, Rockville, Md.,
USA.
[0096] Construction of Plasmid pIMC05
[0097] A 4.3 kb Sst-1 fragment encoding the HSV-1 (HFEM) gH gene
and upstream HSV-1 gD promoter (-392 to +11) was excised from the
plasmid pgDBrgH (Forrester et al., op. cit.), and cloned into
pUC119 (Vieira & Messing, 1987) to produce plasmid pUC119gH. A
Not 1 site was introduced into plasmid pUC119gH by site-directed
mutagenesis, 87 bp downstream of the gH stop codon. The resulting
plasmid, pIMC03, was used to generate a Not 1-Sst 1 fragment which
was repaired and ligated into the eucaryotic expression vector
pRc/CMV (Invitrogen Corporation), pre-digested with Not 1 and Nru 1
to remove the CMV IE promoter. The resulting plasmid, pIMC05,
contains the HSV-1 gH gene under the transcriptional control of the
virus inducible gD promoter and BGH (Bovine Growth Hormone) poly A.
It also contains the neomycin resistance gene for selection of G418
resistant stable cell lines.
[0098] Construction of gH-Deleted HSV-1 Complementing Cell Line
[0099] The plasmid pIMC05 was transfected into Vero (ATCC no.
88020401) cells using the CaPO.sub.4, technique (Sambrook, Fritsch
& Maniatis, A Laboratory Manual, Cold Spring Harbor Laboratory
Press). Cells were selected by dilution cloning in the presence of
G418 and a clonal cell line was isolated. Following expansion and
freezing, cells were seeded into 24 well plates and tested for
their ability to support the growth of gH-negative virus, by
infection with SC16.DELTA.gH (Forrester et al, op. cit) at 0.1
pfu/cell. Virus plaques were observed 3 days post infection
confirming expression of the gH gene.
[0100] Construction of BHK TK--Cell Line
[0101] These cells were produced by transfection of plasmid pIMC05
into thymidine kinase negative (TK-) BHK cells (ECACC No. 85011423)
in the same manner as that described for gH-deleted HSV-1 and
gH-deleted HSV-2 complementary cells.
[0102] Construction of Plasmid PIMC08
[0103] Plasmid pIMMB24 containing the HSV-2 gH gene is constructed
from two adjacent BamHI fragments of HSV-2 strain 25766. The
plasmids are designated pTW49, containing the approximately 3484
base pair BamHI R fragment, and pTW54, containing the approximately
3311 base pair BamHI S fragment, both cloned into the BamHI site of
pBR322. Equivalent plasmids can be cloned easily from many
available strains or clinical isolates of HSV-2. The 5' end of the
HSV-2 gene is excised from pTW54 using BamHI and KpnI, to produce a
2620 base pair fragment which is gel-purified. The 3' end of the
HSV-2 gH gene is excised from pTW49 using BamHI and SalI, to
produce a 870 base pair fragment which is also gel-purified. The
two fragments are cloned into pUC119 which had been digested with
SalHI and KpnI. This plasmid now contains the entire HSV-2 gH
gene.
[0104] Plasmid pIMC08 containing the HSV-2 (strain 25766) gH gene
was constructed as follows. Plasmid pIMMB24 was digested with NcoI
and BstXI and the fragment containing the central portion of the gH
gene was purified from an agarose gel. The 5' end of the gene was
reconstructed from two oligonucleotides CE39 and CE40 which form a
linking sequence bounded by HindIII and NcoI sites.
[0105] The 3' end of the gene was reconstructed from two
oligonucleotides CE37 and CE38 which form a linking sequence
bounded by BstXI and NotI sites.
1 CE39 5' AGCTTAGTACTGACGAC 3' CE40 5' CATGGTCGTCAGTACTA 3' CE37 5'
GTGGAGACGCGAATAATCGCGAGC 3' CE38 5'
GGCCGCTCGCGATTATTCGCGTCTCCACAAAA 3'
[0106] The two oligonucleotide linkers and the purified NcoI-BstXI
gH fragment were cloned in a triple ligation into HindIII-NotI
digested pIMC05, thus replacing the HSV-1 gH gene by the HSV-2 gH
gene. The resultant plasmid was designated pIMC08.
[0107] Construction of gH-Deleted HSV-2 Complementary Cell Line
[0108] The plasmid pIMC08, contains the HSV-2 gH gene under the
transcriptional control of the virus inducible gD promoter and BGH
(Bovine Growth Hormone) poly A. It also contains the neomycin
resistance gene for selection of G418 resistant stable cell lines.
The plasmid pIMC08 was transfected into Vero (ATCC no. 88020401)
cells using the CaP04 technique (Sambrook, Fritsch & Maniatis,
A Laboratory Manual, Cold Spring Harbor Laboratory Press). Cells
were selected by dilution cloning in the presence of G418 and a
clonal cell line was isolated. Following expansion and freezing,
these cells, designated CR2 cells, were seeded into 24 well plates,
and infected with the gH deleted HSV-1 (SC16 gH) at 0.1 pfu/cell.
Virus plaques were observed 3 days post infection confirming
expression of the gH gene.
[0109] Construction of Recombination Plasmids
[0110] a) pIMMB56+
[0111] pIMMB56+ is a vector with a lacZ cassette flanked by HSV-2
sequences from either side of the gH gene. It is made as follows:
the two PCR fragments made by oligos MB97-MB96 and by oligos
MB57-MB58 are digested with the restriction enzymes appropriate to
the sites that have been included in the PCR oligonucleotides. The
MB97-MB96 fragment is digested with HindIII and HpaI. The MB57-MB58
fragment is digested with HpaI and EcoRI. These fragments are then
ligated into the vector pUC119 which has been digested with HindIII
and EcoRI. The resultant plasmid is called pIMMB45 (FIG. 1).
[0112] The oligonucleotides used for PCR are shown below:
2 HindIII MB97: 5' TCGAAGCTTCAGGGAGTGGCGCAGC 3' HpaI MB96: 5'
TCAGTTAACGGACAGCATGGCCAGGTCAAG 3' HpaI MB57: 5'
TCAGTTAACGCCTCTGTTCCTTTCCC- TTC 3' EcoRI MB58: 5'
TCAGAATTCGAGCAGCTCCTCATGTTCGAC 3'
[0113] To allow for easy detection of the first stage recombinants,
the E. coli beta-galactosidase gene, under the control of an SV40
promoter is inserted into pIMMB45. The SV40 promoter plus
beta-galactosidase gene is excised from the plasmid pCH110
(Pharmacia) using BamHI and Tth III 1. The ends are filled in using
the Klenow fragment of DNA polymerase. The fragment is
gel-purified. The plasmid pIMMB45 is digested with HpaI,
phosphatased with Calf Intestinal Alkaline Phosphatase (CIAP) to
abolish self ligation, and gel-purified. The gel-purified fragments
are then ligated together to produce the plasmid pIMMB56+ (see FIG.
2).
[0114] b) pIMMB46
[0115] pIMMB46 contains sequences flanking the HSV-2 gH gene, with
a central unique HpaI site. Any gene cloned into this site can be
inserted by recombination into the HSV-2 genome at the gH locus. If
the virus is a TK-negative gH-negative virus, (for example made
using the pIMMB56+ plasmid described above) then the plasmid will
replace the 3' end of the TK gene, thus restoring TK activity and
allowing selection for TK-positive virus.
[0116] The two PCR fragments made by oligos MB94-MB109 and by
oligos MB57-MB108 are digested with the restriction enzymes
appropriate to the sites that have been included in the PCR
oligonucleotides. The MB94-MB109 fragment is digested with HindIII
and HpaI. The MB57-MB108 fragment is digested with HpaI and EcoRI.
These fragments are then ligated into the vector pUC119 which has
been digested with HindIII and EcoRI. The resultant plasmid is
called pIMMB46 (see FIG. 3). The oligonucleotides used are as
follows:
3 HpaI MB57: 5' TCAGTTAACGCCTCTGTTCCTTTCCCTTC 3' EcoRI MB108: 5'
TCAGAATTCGTTCCGGGAGCAGGCGTGGA 3' HindIII M894: 5'
TCAAAGCTTATGGCTTCTCACGCCGGCCAA 3' HpaI MB109: 5'
TCAGTTAACTGCACTAGTTTTAATTAAT- ACGTATG 3'
[0117] c) pIMC14
[0118] The plasmid pRc/CMV (Invitrogen Corporation) was digested
with the restriction enzymes NruI, PvuII and BsmI and a 1066 base
pair NruI-PvuII fragment was isolated from an agarose gel. The
fragment was cloned into HpaI digested pIMMB46 (see FIG. 4). The
resultant is named pIMC14.
[0119] The pRc/CMV fragment contains the cytomegalovirus major
immediate early promoter (CMV-IE promoter) and the bovine growth
hormone (BGH) poly A addition site. This plasmid, pIMC14, is a
general recombinant plasmid with unique sites for the insertion of
foreign genes which can then be recombined into an HSV-2 gH-deleted
DISC vector.
[0120] d) pIMR1
[0121] The plasmid pIMR1 is a recombination vector for the
insertion of the murine GM-CSF gene, under the control of the
CMV-IE promoter, into a DISC HSV-2 vector. pIMC14 is digested with
XbaI, phosphatased with CIAP, gel purified and the overhanging ends
made flush with Klenow polymerase. The murine GM-CSF gene is
excised from the plasmid pGM 3.2 FF (referred to as pGM3.2 in Gough
et al. EMBO Journal 4, 645-653, 1985) (or from the equivalent
plasmid constructed as described below), by a two stage procedure.
Firstly pGM 3.2FF is digested with EcoRI and a 1048 base pair
fragment is gel-purified. This fragment is then digested with HinfI
and StuI. The 495 base pair fragment is gel-purified and the ends
repaired with Klenow polymerase. This fragment is then cloned into
multi cloning site of pIMC14, prepared as described above. The
resulting plasmid is designated pIMR1 (see FIG. 5).
[0122] An alternative plasmid equivalent to pGM3.2, can be
constructed as follows.
[0123] A library of cDNA clones is constructed from a cloned
T-lymphocyte line (from a BALB/c strain of mouse), such as LB3
(Kelso et al, J. Immunol. 132, 2932, 1984) in which the synthesis
of GM-CSF is inducible by concanavalin A. The library is searched
by colony hybridisation with a sequence specific to the murine
GM-CSF gene (see Gough et al, EMBO J, 4, 645, 1985 for sequence). A
example of an oligonucleotide usable in this case is 5' TGGATGACAT
GCCTGTCACA TTGMTGAAG AGGTAGAMGT 3'. Clones of over 1 kb are picked
and sequenced to check that they are GM-CSF. These operations can
be carried out as described in "Molecular Cloning: A Laboratory
Manual", ed. Sambrook, Fritsch and Maniatis, Cold Spring Harbor
Laboratory Press. Such an operation results in a clone containing
the complete GM-CSF sequence which can be excised with HinfI and
StuI as described for pGM3.2.
[0124] e) pIMR3
[0125] In the plasmid pIMR1 the open reading frame for the GM-CSF
gene is preceded by a short open reading frame (ORF) of 15 base
pairs. Because it was thought possible that this might interfere
with the expression of GM-CSF, the plasmid pIMR1 is altered so that
this small reading frame was removed. pIMR1 was digested with NotI
and PpuMI. The digested vector was phosphatased with calf
intestinal alkaline phosphatase (CIAP) and gel-purified. The
sequences between the two restriction enzyme sites were replaced by
a short piece of double-stranded DNA generated by the annealing of
two oligonucleotides CE55 and CE56:
4 CE55 GGCCGCTCGAACATGGCCCACGAGAGAAAGGCTAAG CE56
GACCTTAGCCTTTCTCTCGTGGGCCATGTTCGAGC
[0126] The oligonucleotides are constructed so as to have
overhanging ends compatible with the NotI and PpuMI ends generated
by the digestion of pIMR1. The two oligonucleotides are annealed,
phosphorylated, and ligated to the NotI-PpuMI-digested pIMR1. The
resultant vector was designated pIMR3. The sequences in the
relevant region are shown below:
5 pIMR1 TTAATACGAC TCACTATAGG GAGACCGGAA GCTTGGTACC GAGCTCGGAT
CCACTAGTAA CGGCCGCCAG TGTGCTGGAA TTCTGCAGAT ATCCATCACA CTGGCGGCCG
CTCGAGCATG CATCTAGCCT TTTGACTACA ATGGCCCACGAGA NotI Short ORF Start
of GM-CSF GAAAGGCTAA GGTCCTG PpuMI pIMR3 TTAATACGAC TCACTATAGG
GAGACCGGAA GCTTGGTACC GAGCTCGGAT CCACTAGTAA CGGCCGCCAG TGTGCTGGAA
TTCTGCAGAT ATCCATCACA CTGGCGGCCG CTCGAACATG GCCCACGAGA GAAAGGCTAA
GGTCCTG Not I Start PpuMI
[0127] To make an HSV-1 DISC virus expressing the GM-CSF protein, a
different set of plasmids is made:
[0128] f) pIMMB34
[0129] This is a recombination vector containing sequences flanking
the HSV-1 gH gene. The left side flanking sequences inactivate TK
gene which lies adjacent to the gH gene. The two PCR fragments made
by oligos MB97-MB100 and by oligos MB61-MB58 are digested with the
restriction enzymes appropriate to the sites that have been
included in the PCR oligonucleotides. The MB97-MB100 fragment is
digested with HindIII and HpaI. The MB61-MB58 fragment is digested
with HpaI and EcoRI. These fragments are then ligated into the
vector pUC119 which has been digested with HindIII and EcoRI. The
resultant plasmid is called pIMMB34. The oligonucleotides used are
as follows:
6 HindIII MB97: 5' TCGAAGCTTCAGGGAGTGGCGCAGC 3' HpaI MB100 5'
TCAGTTAACGGCCAGCATAGCCAGGTCA- AG 3' HpaI MB61: 5'
TCAGTTAACAGCCCCTCTTTGCTT- TCCCTC 3' EcoRI MB58: 5'
TCAGAATTCGAGCAGCTCCTCATGTTCGAC 3'
[0130] To allow for easy detection of the first stage recombinants,
the E. coli beta-galactosidase gene, under the control of an SV40
promoter is inserted into pIMMB34. The SV40 promoter plus
beta-galactosidase gene is excised from the plasmid pCH110
(Pharmacia) using BamHI and Tth III 1. The ends are filled in using
the Klenow fragment of DNA polymerase. The fragment is
gel-purified. The plasmid pIMMB34 is digested with HpaI,
phosphatased with Calf Intestinal Alkaline Phosphatase (CIAP) to
abolish self ligation, and gel-purified. The gel-purified fragments
are then ligated together to produce the plasmid pIMMB55+.
[0131] h) pIMMB63:
[0132] pIMMB63 is made from HSV-1 strain KOS (m) DNA. pIMMB63
contains sequences flanking the HSV-1 gH gene, with a central
unique HpaI site. Any gene cloned into this site can be inserted by
recombination into the HSV-1 genome at the gH locus. If the virus
is a TK-negative virus (for example made using the pIMMB55+plasmid
described above) then the plasmid will replace the 3' end of the TK
gene, thus restoring TK activity and allowing selection for
TK-positive virus.
[0133] The two PCR fragments made by oligos MB98-MB63 and by oligos
MB61-MB58 are digested with the restriction enzymes appropriate to
the sites that have been included in the PCR oligonucleotides. The
MB98-MB63 fragment is digested with HindIII and HpaI. The MB61-MB58
fragment is digested with HpaI and EcoRI. These fragments are then
ligated into the vector pUC119 which has been digested with HindIII
and EcoRI. The resultant plasmid is called pIMMB63. The
oligonucleotides used are as follows:
7 HindIII MB98: 5' TCAAAGCTTATGGCTTCGTACCCCTGCCAT 3' HpaI MB63: 5'
TCAGTTAACGGACCCCGTCCCTAACC- CACG 3' HpaI MB61: 5'
TCAGTTAACAGCCCCTCTTTGCTTTCCCTC 3' EcoRI MB58: 5'
TCAGAATTCGAGCAGCTCCTCATGTTCGAC 3'
[0134] This plasmid is a general recombination plasmid with unique
sites for the insertion of foreign genes which can then be
recombined into an HSV-1 gH-deleted DISC vector. The plasmid
pRc/CMV was digested with NruI and PvuII and a 1066 bp fragment,
which contains CMV IE promoter and a polyA signal, was blunt ended
with Klenow polymerase and inserted into the unique HpaI site of
plasmid pIMMB63. This plasmid is named pIMX1.0. The multiple
cloning site contained between the CMV IE promoter and the polyA
signal is ideal for cloning other genes into the plasmid and their
subsequent introduction into DISC HSV-1.
[0135] j) pIMX3.0
[0136] The plasmid pIMX3.0 is a recombination vector for the
insertion of murine GM-CSF, under the control of CMV IE promoter,
into the deleted gH region of type I DISC HSV. This plasmid was
constructed by inserting the murine GM-CSF which was excised out
from plasmid pGM3.2FF (op. cit.) with SmaI and DraI, into the
unique BsaBI site of pIMX1.0. This plasmid, pIMX3.0, is the HSV-1
equivalent of pIMR3.
[0137] Construction of Recombinant Virus
[0138] Recombinant virus expressing GM-CSF was made in two stages.
In the first stage the gH gene, and part of the TK gene are
replaced by a "lacZ cassette", consisting of the SV40 promoter
driving the E. coli lacZ gene. This virus has a TK minus phenotype
and also gives blue plaques when grown under an overlay containing
the colourigenic substrate X-gal. This recombinant virus can now be
conveniently used for the insertion of foreign genes at the gH
locus. Genes are inserted in conjunction with the missing part of
the TK gene. At the same time the lacZ cassette is removed. These
viruses can be selected on the basis of a TK-positive phenotype,
and a white colour under X-gal.
[0139] a) Construction of First Stage Recombinant with SV40-lacZ
Cassette Replacing gH.
[0140] Recombinant virus was constructed by transfection of viral
DNA with the plasmid pIMMB56+ (for HSV-2) or pIMMB55+ (for HSV-1).
Viral DNA is purified on a sodium iodide gradient as described in
Walboomers & Ter Schegget (1976) Virology 74, 256-258.
[0141] Recombination is carried out as follows:
[0142] a) First Stage
[0143] A transfection mix is prepared by mixing 5 .mu.g of viral
DNA, 0.5 .mu.g of linearised plasmid DNA (linearised by digestion
with the restriction enzyme ScaI) in 1 ml of HEBS buffer (137 mM
NaCl, 5 mM KCl, 0.7 mM Na2HPO.sub.4, 5.5 mM glucose, 20 mM Hepes,
pH 7.05). 70 .mu.l of 2M CaCl, is added dropwise, and mixed gently.
The medium is removed from a sub-confluent 5 cm dish of CR1 or CR2
cells and 500 .mu.l of the transfection mix is added to each of two
dishes. The cells are incubated at 37.degree. C. for 40 minutes,
when 4 ml of growth medium containing 5% foetal calf serum (FCS)
are added. 4 hours after adding the transfection mix, the medium is
removed and the cells washed with serum-free medium. The cells are
then `shocked` with 500 .mu.l per dish of 15% glycerol for 2
minutes. The glycerol is removed, the cells washed twice with
serum-free medium and growth medium containing 5% FCS is added.
[0144] After 4-7 days, when a full viral cytopathic effect (CPE) is
observed, the cells are scraped into the medium, spun down at 2500
rpm for 5 minutes at 4.degree. C., and resuspended in 120 .mu.l of
Eagles minimal essential medium (EMEM). This is now a crude virus
stock containing wild-type and recombinant virus. The stock is
frozen, thawed and sonicated and screened for recombinants on CR1
cells at a range of dilutions. The medium contains 10 .mu.g/ml of
acyclovir, to select for TK-minus virus. After addition of the
virus dilutions, the cells are overlaid with medium containing 1%
low-gelling temperature agarose. After the appearance of viral
plaques at about 3 days, a second overlay of agarose containing 330
.mu.g/ml of Xgal as well as 10 .mu.g/ml acyclovir, is added. Blue
plaques are picked, within 48 hours, and transferred to 24-well
dishes (1 cm2 per well) containing CR1 cells. The plaques are
allowed to grow to full CPE and harvested by scraping into the
medium. Multiple rounds of plaque-purification are carried out
until a pure stock of virus is obtained.
[0145] The structure of the first stage recombinant is confirmed as
follows. Sodium iodide purified viral DNA is prepared as before,
and digested with BamHI. This digest is separated on an agarose gel
and transferred to a nylon membrane. This is probed with a
radiolabelled DNA fragment homologous to the sequences either side
of the gH gene.
[0146] b) Second Stage.
[0147] Recombination is carried out as before using viral DNA from
the first stage recombinant, and the plasmid pIMR3 (for HSV-2) or
pIMX3.0 (for HSV-1). After the initial harvest of virus,
TK-positive recombinant viruses are selected by growth on BHK
gh-positive TK-negative cells, in the presence of 0.6 .mu.M
methotrexate, 15 .mu.M Thymidine, 9.5 .mu.M Glycine, 4.75 .mu.M
Adenosine and 4.75 .mu.M Guanosine. Three rounds of this selection
are carried out in 6-well dishes (10 cm.sup.2 per well). At each
stage the infected cells are harvested by scraping into the medium,
spinning down and resuspending in 200 .mu.l of EMEM. After
sonication, 50 .mu.l of this is added to fresh BHK gH-positive
TK-negative cells, and the selection continued.
[0148] After the final selection the virus infected cells are
harvested as before and screened on gH-deleted HSV1 complementary
cells. Overlays are added as before and white plaques are selected
in the presence of Xgal. Plaques are picked as before and
plaque-purified three times on said gH-deleted HSV1 complementary
cells.
[0149] The structure of the viral DNA is analysed as before.
[0150] Testing of Vaccine Potential of gH-Deleted GM-CSF Expressing
Mutant Virus
[0151] The gH-deleted GM-CSF expressing mutant virus can be tested
for its efficacy as a vaccine by using a mouse model system as
described in Farrell et al, J. Virol. 68, 927-32, 1994. Groups of
mice are vaccinated by scarification of the ear pinna with varying
doses ranging from 10.sup.2 to 10.sup.6 plaque forming units (pfu)
of gH-deleted mutant virus, GM-CSF expressing virus, the gH-deleted
GM-CSF-expressing mutant virus, and the gH revertant. A control
group is vaccinated with PBS. After 3 weeks, mice are challenged in
the opposite ear pinna with 10.sup.6 pfu of wild-type HSV-1 (strain
SC16). Five days post challenge the mice are killed the challenged
ears removed and frozen at -70.degree. C. The ears are homogenised
and the amount of infectious challenge virus in each ear is
determined by plaque titration. The reduction in virus titres in
the vaccinated groups of mice compared to the PBS-treated controls
is a measure of the protection afforded by the virus vaccine. It is
known that the gH-deleted virus can completely abolish the presence
of infectious virus at a vaccinating dose of 5.times.10{circumflex
over ( )}5 pfu, whilst even at 5.times.10{circumflex over ( )}4 pfu
a reduction of 1000-fold is observed. That the gH-deleted GM-CSF
expressing mutant can give increased level of protection can be
tested by observing complete protection from any infectious virus
at lower challenge doses than in the gH-deleted mutant-virus
vaccinated mice, and a greater reduction of infectious virus titres
as compared to the PBS-vaccinated controls. The gH-deleted
GM-CSF-carrying virus can give an increased level of antibody
response as compared with a gH-deleted virus not carrying the
GM-CSF gene.
[0152] GM-CSF Assay
[0153] Cos 1 cells (ECACC No. 88031701) are transfected with
plasmid DNA using DEAE dextran as described in Gene Transfer and
Expression, A laboratory Manual, Michael Kriegler. Supernatants
from transfected Cos 1 cells or infected CR2 cells are screened for
GM-CSF activity by bioassay. An IL-3/GM-CSF responsive murine
hemopoietic cell line designated C2GM was obtained from Dr. E.
Spooncer, Paterson Institute for Cancer Research, Christie
Hospital, UK. The cell line C2GM is maintained in Fischers media
with 20% horse serum, 1% glutamine and 10% conditioned cell media.
The conditioned cell media is obtained from exponentially growing
cultures of Wehi 3b cells (ECACC No. 86013003) which secrete murine
IL-3 into the media. Wehi 3b cells are maintained in RPMI 1640
media, 10% FCS and 1% glutamine.
[0154] The above examples concern the creation of HSV-1 and HSV-2
mutants which are gH-negative and which express GM-CSF.
[0155] The above description can readily be adapted to the
construction of vectors expressing various immunomodulatory
proteins, for example as follows:
[0156] Construction of gH-Deleted HSV2 Vectors Expressing Human
GM-CSF:
[0157] Human GMCSF and its gene are described in M Cantrell et al,
PNAS 82 (1985) 6250-6254; F Lee et al, PNAS 82 (1985) 4360-4364; G
Wong et al, Science (1985) 228: 810-815.
[0158] DNA for cloning is obtainable by the use of PCR and
oligonucleotides in standard manner, and an engineered version of
the gene is also commercially available from R&D Systems Europe
Ltd, Abingdon, OX14 3YS UK.
[0159] The gene can be prepared for cloning by engineering the DNA
ends to ensure that a natural leader sequence and start signal for
expression in a mammalian system is present at the 5' end, and, for
present purposes, by adding complementary ends to match (at the 5'
end) a HindIII site and (at the 3' end) a EcoRI site.
[0160] The prepared gene can then be ligated into a cloning vector
pcDNA3 (Invitrogen Corporation) between the HindIII and EcoRI
sites, and cloned. The resulting vector is designated
pcDNA3-hGMSCF. This can be digested with EcoRI, and then with
HindIII, blunt-ended, and cloned into vector pIMC14 as described
above, (in place of the murine gene as used in the example
described above).
[0161] The resulting cloning vector with hGMCSF can then be used in
adaptations of the remaining procedures already described herein,
for example to make a gH-deleted defective HSV2 virus vector
encoding human GMCSF at the site of deletion of the gH gene.
[0162] Construction of gH-Deleted HSV2 Vectors Expressing Human
IL-2:
[0163] Human IL-2 and its gene are described in T Taniguchi et al,
Nature 302 (1983) (5906) 305-310, and in EMBL sequence HSIL02 (mRNA
encoding IL2); see also R Devos et al, Nucl Acids Res 11(13) (1983)
4307-4323 (referring to bacterial expression).
[0164] DNA for cloning is obtainable e.g. from T cells, by the use
of PCR and oligonucleotides in standard manner, and an engineered
version of the gene is also commercially available from R&D
Systems Europe Ltd, Abingdon, OX14 3YS UK.
[0165] The gene can be prepared for cloning by engineering the DNA
ends to ensure that a natural leader sequence and start signal for
expression in a mammalian system is present at the 5' end, and, for
present purposes, by adding complementary ends to match (at the 5'
end) a HindIII site and (at the 3' end) a EcoRI site.
[0166] The prepared gene can then be ligated into a cloning vector
pcDNA3 (Invitrogen Corporation) between the HindIII and EcoRI
sites, and cloned. The resulting vector is designated pcDNA3-hIL02.
This can be digested with EcoRI, and then with HindIII,
blunt-ended, and cloned into vector pIMC14 as described above, (in
place of the murine GMCSF gene as used in the example already
described).
[0167] The resulting cloning vector with human IL-2 can then be
used in adaptations of the remaining procedures already described
herein, for example to make a gH-deleted defective HSV2 virus
vector encoding human IL-2 at the site of deletion of the gH
gene.
[0168] The techniques can be readily adapted to other interleukins,
cytokines, chemokines, for example IL-12, lymphotactin, and CD40L,
among many others.
[0169] Thus, using for example the viral vectors particularly
described herein, a patient can be immunised for prophylactic or
therapeutic purposes such as those mentioned herein by the
administration of an immunogen or vaccine comprising a mutant virus
which has a genome defective in respect of a selected gene
essential for the production of infectious virus such that the
virus can infect normal cells and undergo replication and
expression of viral antigen genes in those cells but cannot produce
normal infectious virus, the genome also having a heterologous
nucleotide sequence which functions to express an immunomodulating
protein, preferably encoded at the locus of the defective essential
gene.
[0170] The skilled person can readily adapt this teaching to the
preparation of other mutant viruses which are defective in respect
of a first gene essential for the production of infectious virus,
such that the virus can infect normal cells and undergo replication
and expression of viral antigen in these cells but cannot produce
named infectious virus and which also express a heterologous
nucleotide sequence which encodes an immunomodulating protein.
[0171] Many other mutant viruses can be made on the basis of
deletion or other inactivation (for example) of the following
essential genes in the following viruses and virus types:--
[0172] In herpes simplex viruses, essential genes such as gB, gD,
gL, ICP4, ICP8 and/or ICP27 can be deleted or otherwise inactivated
as well as or instead of the gH gene used in the above examples. In
other herpesvirus, known essential genes, such as any known
essential homologues to the gB, gD, gL, gH, ICP4, ICP8 and/or ICP27
genes of HSV, can be selected for deletion or other inactivation.
Cytomegalovirus can e.g. be genetically disabled by deleting or
otherwise activating genes responsible for temperature-sensitive
mutations, for example as identifiable from Dion et al, Virology
158 (1987) 228-230.
[0173] In poxvirus such as vaccinia virus, genetically disabled
virus can be made by deleting or otherwise inactivating a gene such
as one of those identified as essential or as giving rise to
conditional-lethal temperature-sensitive mutants, e.g. in Goebel et
al, Virology 179 (1990) pp 249 et seq.
[0174] Genetically-disabled SV40 virus can be made by deleting or
otherwise inactivating e.g. the T-antigen encoding region.
[0175] Adenovirus type 5 can for example be genetically disabled by
deleting or otherwise inactivating essential genes such as those
identified in the references cited above in the introduction.
[0176] These examples can also be applied to uses as mentioned
herein.
[0177] The examples and embodiments mentioned in the foregoing
description and appended claims and more particularly described
above are for illustration and not limitation: various
modifications in the light thereof will be apparent to persons
skilled in the art and are included within the scope of the
invention. This disclosure and invention extend to combinations and
subcombinations of the features so mentioned, and the present
disclosure includes the published documents cited herein, which are
hereby incorporated in their entirety by reference.
Sequence CWU 1
1
20 1 17 DNA Artificial Sequence Oligonucleotide primer 1 agcttagtac
tgacgac 17 2 17 DNA Artificial Sequence Oligonucleotide primer 2
catggtcgtc agtacta 17 3 24 DNA Artificial Sequence Oligonucleotide
primer 3 gtggagacgc gaataatcgc gagc 24 4 32 DNA Artificial Sequence
Oligonucleotide primer 4 ggccgctcgc gattattcgc gtctccacaa aa 32 5
25 DNA Artificial Sequence Oligonucleotide primer 5 tcgaagcttc
agggagtggc gcagc 25 6 30 DNA Artificial Sequence Oligonucleotide
primer 6 tcagttaacg gacagcatgg ccaggtcaag 30 7 29 DNA Artificial
Sequence Oligonucleotide primer 7 tcagttaacg cctctgttcc tttcccttc
29 8 30 DNA Artificial Sequence Oligonucleotide primer 8 tcagaattcg
agcagctcct catgttcgac 30 9 29 DNA Artificial Sequence
Oligonucleotide primer 9 tcagaattcg ttccgggagc aggcgtgga 29 10 30
DNA Artificial Sequence Oligonucleotide primer 10 tcaaagctta
tggcttctca cgccggccaa 30 11 35 DNA Artificial Sequence
Oligonucleotide primer 11 tcagttaact gcactagttt taattaatac gtatg 35
12 40 DNA Artificial Sequence Oligonucleotide primer 12 tggatgacat
gcctgtcaca ttgaatgaag aggtagaagt 40 13 36 DNA Artificial Sequence
Oligonucleotide primer 13 ggccgctcga acatggccca cgagagaaag gctaag
36 14 35 DNA Artificial Sequence Oligonucleotide primer 14
gaccttagcc tttctctcgt gggccatgtt cgagc 35 15 170 DNA Artificial
Sequence Cloning vector 15 ttaatacgac tcactatagg gagaccggaa
gcttggtacc gagctcggat ccactagtaa 60 cggccgccag tgtgctggaa
ttctgcagat atccatcaca ctggcggccg ctcgagcatg 120 catctagcct
tttgactaca atggcccacg agagaaaggc taaggtcctg 170 16 147 DNA
Artificial Sequence Cloning vector 16 ttaatacgac tcactatagg
gagaccggaa gcttggtacc gagctcggat ccactagtaa 60 cggccgccag
tgtgctggaa ttctgcagat atccatcaca ctggcggccg ctcgaacatg 120
gcccacgaga gaaaggctaa ggtcctg 147 17 30 DNA Artificial Sequence
Oligonucleotide primer 17 tcagttaacg gccagcatag ccaggtcaag 30 18 30
DNA Artificial Sequence Oligonucleotide primer 18 tcagttaaca
gcccctcttt gctttccctc 30 19 30 DNA Artificial Sequence
Oligonucleotide primer 19 tcaaagctta tggcttcgta cccctgccat 30 20 30
DNA Artificial Sequence Oligonucleotide primer 20 tcagttaacg
gaccccgtcc ctaacccacg 30
* * * * *