U.S. patent application number 10/968732 was filed with the patent office on 2005-05-26 for methods for selective targeting.
Invention is credited to Chen, Yiyou, Estell, David A., Murray, Christopher J., Tijerina, Pilar.
Application Number | 20050112692 10/968732 |
Document ID | / |
Family ID | 22728668 |
Filed Date | 2005-05-26 |
United States Patent
Application |
20050112692 |
Kind Code |
A1 |
Murray, Christopher J. ; et
al. |
May 26, 2005 |
Methods for selective targeting
Abstract
A selective targeting method is disclosed comprising contacting
a library of ligands, particularly a peptide library, with an
anti-target to allow the ligands to bind to the anti-target;
separating the non-binding ligands from the anti-target bound
ligands, contacting the non-binding anti-target ligands with a
target allowing the unbound ligands to bind with the target to form
a target-bound ligand complex; separating the target-bound ligand
complex from ligands which do not bind to the target, and
identifying the target-bound ligands on the target-bound ligand
complex wherein the target-bound ligands have a K.sub.D in the
range of about 10.sup.-7 to 10.sup.-10 M. Additionally claimed are
the ligands identified according to the method.
Inventors: |
Murray, Christopher J.;
(Soquel, CA) ; Tijerina, Pilar; (San Diego,
CA) ; Estell, David A.; (San Mateo, CA) ;
Chen, Yiyou; (San Jose, CA) |
Correspondence
Address: |
Genencor International, Inc.
925 Page Mill Road
Palo Alto
CA
94034-1013
US
|
Family ID: |
22728668 |
Appl. No.: |
10/968732 |
Filed: |
October 19, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10968732 |
Oct 19, 2004 |
|
|
|
09832723 |
Apr 11, 2001 |
|
|
|
60197259 |
Apr 14, 2000 |
|
|
|
Current U.S.
Class: |
435/7.1 ;
424/70.4; 436/518; 506/18; 506/9; 510/320 |
Current CPC
Class: |
C12N 15/1034 20130101;
C40B 40/02 20130101; C07K 7/06 20130101; C12N 15/1037 20130101;
G01N 33/54393 20130101; G01N 2500/02 20130101; A61P 35/00 20180101;
C12N 15/1072 20130101; A61P 19/02 20180101; A61P 29/00 20180101;
G01N 33/6845 20130101; C07K 7/08 20130101 |
Class at
Publication: |
435/007.1 ;
436/518 |
International
Class: |
G01N 033/53; G01N
033/543 |
Claims
What is claimed:
1. A method for screening a peptide library comprising the steps
of, (a) contacting the peptide library with an anti-target to allow
the peptides to bind with said anti-target; (b) separating unbound
peptides; (c) contacting the unbound peptides with a selected
target to allow said unbound peptides to bind with the target to
form a target-bound peptide complex; (d) separating said
target-bound peptide complex from peptides which do not bind to
said target; and (e) identifying the target-bound peptides on the
target-bourid peptide complex.
2. The method according to claim 1, wherein step (a), (b), (c) or
(d) is repeated between 2 to 10 times.
3. A method for screening a peptide library comprising the steps
of, (a) contacting the peptide library with a selected target and
an anti-target essentially simultaneously to allow the peptides to
bind with said target to form a target-bound peptide complex; (b)
separating the target-bound peptide complex from the anti-target,
anti-target bound peptides and free peptides; and (c) identifying
the target-bound peptides on the target-bound peptide complex.
4. The method according to claim 3, wherein said contacting step is
in vivo.
5. The method according to claim 3, wherein said contacting step is
in vitro.
6. The method according to claims 1 or 3, wherein the target-bound
peptides bind with a selectivity corresponding to at least 10:1 and
have a K.sub.D in the range of at least about 10.sup.-7 M.
7. The method according to claims 1 or 3, wherein K.sub.off is
about 10.sup.-4 sec.sup.-1 or less.
8. The method according to claims 1 or 3, wherein the identifying
step comprises amplifying a nucleic acid coding for the
target-bound peptide in a polymerase chain reaction.
9. The method according to claim 3, wherein the target-bound
peptide is not released from the target during the identifying
step.
10. The method according to claims 1 or 3, wherein the peptides are
fused to a phage coat protein.
11. The method according to claims 1 or 3, wherein separating said
target-bound peptide further includes an acid elution step.
12. The method according to claims 1 or 3, wherein the identified
target-bound peptides are less than 25 amino acids in length.
13. The method according to claims 1 or 3, wherein the selectivity
of the peptide binding affinity to the target compared to the
peptide binding affinity to the anti-target is at least 20:1.
14. The method according to claims 1 or 3, wherein the anti-target
is skin or hair.
15. The method according to claims 1 or 3, wherein the target is a
cytokine selected from the group consisting of TNF and VEGF.
16. The method according to claims 1 or 3, wherein the target is a
stain.
17. The method according to claims 1 or 3, wherein the target is a
cell surface receptor.
18. The method according to claims 1 or 3, wherein the target is a
hematopoietic cell.
19. The method according to claims 1 or 3, wherein the target is a
protease enzyme and the anti-target is a different protease
enzyme.
20. A peptide identified according to the method of claims 1 or
3.
21. A peptide identified according to the method of claim 15,
wherein said peptide has the amino acid sequence of any one
sequence of SEQ ID NOS: 3-17 or 79-102, or an amino acid sequence
having at least 85% sequence identity thereto.
22. A method for identifying peptides useful in a cleaning
composition comprising the steps of, (a) contacting a peptide
library with an anti-target to allow said peptides to bind with the
anti-target, wherein the anti-target is selected from the group
consisting of fabric, ceramic, glass, stainless steel and plastic;
(b) separating unbound anti-target peptides; (c) contacting said
unbound anti-target peptides with a target, wherein the target is a
stain selected from the group consisting of porphyrin derived
stains, tannin derived stains, carotenoid pigment derived stains,
anthocyanin pigment derived stains, soil-based stains, oil-based
stains, and human body soil stains to allow said unbound peptides
to bind with the stain to form a stain-bound peptide complex; and
(d) identifying the stain-bound peptides on the stain-bound peptide
complex.
23. The method according to claim 22, wherein the cleaning
composition is a detergent composition.
24. A cleaning composition comprising a peptide identified
according to claim 22 and one or more surfactants.
25. The method according to claim 22, wherein the fabric is
selected from the group consisting of cotton, wool, silk,
polyester, rayon, linen, nylon and blends thereof.
26. The method according to claim 22, wherein the stain is selected
from the group consisting of blood, chlorophyll, bilirubin, tea,
wine, tomato, and berries.
27. A peptide identified according to the method of claim 22,
wherein said peptide can bind to the target stain with a K.sub.D in
the range of about 10.sup.-7 M to 10.sup.-10 M.
28. A peptide identified according to the method of claim 22,
wherein said peptide has the amino acid sequence of any one
sequence of SEQ ID NOs: 18-26, or an amino acid sequence having at
least 85% sequence identity to any one sequence of SEQ ID NOs:
18-26.
29. A peptide identified according to the method of claim 22,
wherein said peptide has the amino acid sequence of any one
sequence of SEQ ID NOs: 50-63, or an amino acid sequence having at
least 85% sequence identity to any one sequence of SEQ ID NOs:
50-63.
30. A peptide identified according to the method of claim 22,
wherein said peptide has the amino acid sequence of any one
sequence of SEQ ID NOs: 64-77, or an amino acid sequence having at
least 85% sequence identity to any one sequence of SEQ ID NOs:
64-77.
31. A peptide identified according to the method of claim 22,
wherein said peptide has the amino acid sequence of any one
sequence of SEQ ID NOs: 29-49, or an amino acid sequence having at
least 85% sequence identity to any one sequence of SEQ ID NOs:
29-49.
32. A peptide comprising the amino acid sequence of any one
sequence of SEQ ID NOs: 103-113, or an amino acid sequence having
at least 90% sequence identity to any one sequence of SEQ ID NOs:
103-113.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] Pursuant to 35 U.S.C. .sctn.119(e), the present application
claims benefit of and priority to U.S. Ser. No. 60/197,259,
entitled "Methods For Selective Targeting", filed Apr. 14, 2000, by
Murray et al.
BACKGROUND OF THE INVENTION
[0002] The present invention is directed to methods for the
selection and identification of compounds capable of binding
specifically to a target in the presence of undesired background
targets (anti-targets) using libraries of similar compounds. In one
particular aspect, the present invention is related to the
selection of ligands from peptide libraries. Ligand peptides
identified according to the method of the invention have a binding
affinity and a selectivity to a target similar to the binding
affinity and selectivity of antibodies.
[0003] The literature is replete with examples of recent advances
in methods for screening large library pools of compounds,
especially peptides. Methods for screening these compounds to
identify molecules that bind to a preselected target have also been
advanced. One well-known method is biopanning which was originally
developed by Smith, G. P., (1985), Science 228:1315. Biopanning in
its simplest form is an in vitro selection process in which a
library of phage-displayed peptides is incubated with a target. The
target and phage are allowed to bind and unbound phage are washed
away. The specifically bound phage are then acid eluted. The eluted
pool of phage is amplified in vivo and the process is repeated.
After a number of rounds individual clones are isolated and
sequenced.
[0004] A number of variations of the biopanning technique first
introduced by Smith have been described and reference is made to
Christian et al., (1992) J. Mol. Biol., 227:711; Cwirla et al.,
(1990) Proc. Natl. Acad. Sci. USA, 87:6378; Cull et al., (1992)
Proc. Natl. Acad. Sci. USA, 89:1865; Huls et al., (1996) Nature
Biotechnol., 7:276; and Bartoli et al., (1998) Nature Biotechnol.,
16:1068.
[0005] Huls et al., 1996 supra, describe a method comprising flow
cytometry-based subtractive selection of phage antibody on intact
tumor cells. The phage-displayed antibodies remain bound to the
target during the flow-cytometric selection. However, prior to
amplification the cell-bound phages are eluted from the target. WO
98/54312 discloses selection of antibodies under mild conditions
with high affinities for antigens using antibody libraries
displayed on ribosomes.
[0006] In many prior art methods it is generally assumed that
elution of target bound ligands is sufficient to identify the
tightest binding ligands in a library. However, a number of
research papers report on low affinity binders using elution
techniques (U.S. Pat. No. 5,582,981). Nevertheless, physical
separation of the ligands from the target prior to amplification or
identification is the standard method for selecting ligands that
bind to a preselected target.
[0007] Balass et al., (1996) Anal. Biochem., 243:264, describe the
selection of high-affinity phage-peptides from phage-peptide
libraries using a biotinylated target immobilized on a
nitrostreptavidin matrix. The interacting phage particles were
released under conventional acid elution. Further, after acid
elution, the target complex was analyzed for bound phage. These
particles were exposed to alkaline solutions or free biotin to
release the target bound phage particles from the solid support.
The affinity of the isolated phage was found to be higher than the
phage released by traditional acid elution methods. However, the
synthetically prepared peptides exhibited a lower affinity for the
target than the peptides prepared from sequences obtained by
acid-eluted phage.
[0008] Other targeting methods include, for example, SELEX. This is
a procedure in which an oligonucleotide from a library of
randomized sequences is embedded in a pool of nucleic acids. Many
cycles of affinity selection to a target of the oligonucleotide
from the heterologous RNA or DNA population occurs. The target and
annealed nucleic acids are partitioned and amplified. In order to
proceed to the amplification step, selected nucleic acids must be
released from the target after partitioning. (U.S. Pat. No.
5,475,096)
[0009] While various methods for screening and selecting libraries
of compounds exist, improved methods that do not require multiple
rounds of selection are particularly needed for compounds that a)
bind tightly and specifically to targets that are not well-defined
at the chemical, biochemical or genetic level but have macroscopic
properties that are desirable to target, b) bind tightly and
specifically to targets that cannot be easily physically separated
from a large background of undesirable targets (anti-targets), and
c) bind to targets under harsh conditions, such as acidic pH, high
detergent concentration or high temperature.
[0010] The selective targeting method according to the invention
overcomes some of the above deficiencies of the prior art methods
and in particular offers an advantage in rapidly identifying
compounds, particularly peptides, that bind with a high affinity
and selectively to a target.
SUMMARY OF THE INVENTION
[0011] In one aspect, the invention concerns a method for screening
a ligand library comprising contacting the ligand library with an
anti-target to allow the ligands to bind with the anti-target;
separating unbound ligands and contacting said unbound ligands with
the selected target to allow said unbound ligands to bind with the
target to form a target-bound ligand complex; separating said
target-bound ligand complex from ligands which do not bind to said
target; and identifying the target-bound ligands on-the
target-bound ligand complex.
[0012] In another aspect, the invention concerns a method for
screening a ligand library comprising contacting the ligand library
essentially simultaneously with a selected target and an
anti-target to allow the ligands to bind with the target forming a
target-bound ligand complex; separating the target-bound ligand
complex from the anti-target, anti-target bound ligands and free
ligands; and identifying the ligands of the target-bound ligand
complex. The contacting step may be accomplished either in vivo or
in vitro.
[0013] In one preferred embodiment, the selectivity of ligand
binding to a target compared to ligand binding to an anti-target is
about at least 10:1. In a second preferred embodiment, the ligand
is a peptide but not an antibody and is bound to the target with a
K.sub.D at least about 10.sup.-7 M and preferably in the range of
about 10.sup.-7 M to 10.sup.-10 M. In a third preferred embodiment,
the ligand library is a peptide library. Preferably the peptides
identified according to the method are less than 25 amino acids in
length and more preferably between 4 to 15 amino acids in length.
In a fourth embodiment, the k.sub.off is about 10.sup.-4 sec.sup.-1
or less. In a fifth embodiment, the target is a stain, and
particularly a stain on fabric, wherein the stain is a porphyrin
derived stain, a tannin derived stain, a carotenoid pigment derived
stain, an anthocyanin pigment derived stain, a soil-based stain,
oil-based stain, or human body soil stains.
[0014] In yet a further aspect, the invention is directed to the
ligands, particularly peptide ligands, which are identified by the
selective targeting method of the invention.
[0015] Another embodiment of the invention concerns a method for
identifying peptides useful in a cleaning composition comprising,
contacting a peptide library with an anti-target to allow the
peptides to bind with the anti-target, wherein the anti-target is
selected from the group consisting of fabric, ceramic, glass,
stainless steel, and plastic; separating unbound anti-target
peptides, contacting the unbound anti-target peptides with a target
wherein the target is a stain selected from the group consisting of
porphyrin derived stains, tannin derived stains, carotenoid pigment
derived stains, anthocyanin pigment derived stains, soil-based
derived stains, oil-based derived stains and human body soil stains
to allow the unbound peptides to bind with the stain to form a
stain-bound peptide complex; and identifying the stain-bound
peptide on the stain-bound peptide complex. In at least one
embodiment the peptide binds to the stain with a K.sub.D in the
range of about 10.sup.-7M to 10.sup.-10M.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 is a general schematic diagram of the selective
targeting method disclosed herein. The method comprises the steps
of, a) selection against anti-targets which provides a library of
ligands depleted of anti-target bound ligands, b) selection for the
target by formation of a target-bound ligand complex, c) separation
of the target-bound ligand complex, d) identification of the
target-bound ligands, and e) optionally sequencing the target-bound
ligands, exposing the target-bound ligands to additional rounds of
selective targeting, and/or diversification.
[0017] FIGS. 2A and 2B are photographs of a gel of PCR amplified
DNA fragments after lysis of target bound phage. FIG. 2A
illustrates TNF-.alpha. bound phage and FIG. 2B illustrates IL-6
and IL-8 bound phage.
[0018] FIG. 3 is a photograph of a gel of PCR amplified DNA
fragments for soil-targeted peptides.
[0019] FIG. 4 illustrates binding, dissociation and attempted
elution of phage peptide clone A1 corresponding to RYWQDIP (SEQ ID
NO: 3) from immobilized TNF-.alpha. on an IAsys biosensor
cuvette.
[0020] FIGS. 5A and 5B are images of collar soils and the
corresponding polyester fabric as viewed by digital imaging and
autoradiography, respectively.
[0021] FIGS. 6A and 6B illustrate the fractional percent .sup.14C
labeled peptide binding to collar soils on polyester cotton fabric.
FIG. 6A illustrates a soil-targeted peptide, SISSTPRSYHWT, (SEQ ID
NO: 20) which is terminally labeled with .sup.14C-glycine wherein
.smallcircle. depicts stain #1, .box-solid. depicts stain #2, and
.sunburst. depicts blue polycotton and FIG. 6B illustrates a random
peptide, NFFPTWILPEHT (SEQ ID NO: 78) which is terminally labeled
with .sup.14C-glycine.
[0022] FIG. 7 illustrates the kinetics of dissociation of the
Ni-chelated peptide GGHTFQHQWTHQTR (SEQ ID NO: 28) from collar soil
(.circle-solid.) and the corresponding cotton fabric
(.smallcircle.). The slope of the lines correspond to rate
constants k.sub.off=1.times.10.sup.-3 sect.sup.-1.
[0023] FIG. 8 is a photograph of a gel of PCR amplified fragment
for egg soil targets and stainless steel or glass bead
anti-targets.
[0024] FIG. 9 illustrates ELISA assay results for binding of 3
peptides. LESTPKMK (SEQ ID NO: 115) binds to hair and FTQSLPR (SEQ
ID NO: 116) selectively targets skin and not hair (.box-solid.
depicts hair and .sunburst. depicts skin).
DETAILED DESCRIPTION OF THE INVENTION
[0025] A. Unless defined otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which this invention pertains.
For the purposes of the present invention, the following terms are
used to describe the invention herein.
[0026] The term "ligand" refers to a molecule or compound that is
recognized by a particular target or anti-target. The term is
independent of molecular size or compositional feature. The ligand
may serve as a substrate for an enzyme-catalyzed reaction, as an
agonist, as an antagonist, act as a signal messenger, or stimulate
or inhibit metabolic pathways. Ligands may be nucleic acids,
peptides, peptide derivatives, peptidomimetics, polypeptides, small
organic molecules, carbohydrates and other molecules that are
isolated from a candidate mixture that acts on a target in a
desirable manner. Preferably the desirable manner is binding the
target, but could include for example, catalytically changing the
target or reacting with the target that modifies or alters the
target. In one preferred embodiment, the ligand has a binding
affinity for the target in the range of an antibody binding
affinity for a selected receptor.
[0027] The term "library" refers to a collection of chemical or
biological entities that can be created in a single reservoir and
simultaneously screened for a desired property. As used herein a
library can have a minimum size of at least two members and may
contain as many as 10.sup.15 members. In one aspect, the library
has at least 10.sup.2 members. In another aspect, the library has
at least 10.sup.3 members. In yet another aspect, the library has
at least 10.sup.6 members. In a further aspect, the library has at
least 10.sup.9 members. The size of a library refers to the total
number of entities comprising the library whether the members are
the same or different.
[0028] A "peptide library" refers to a set of peptides and to the
peptides and any fusion proteins containing those peptides.
Stochastic or random processes may be used to construct random
peptides. The term "random" does not mean that the library
composition is not known.
[0029] The term "peptide" refers to an oligomer in which the
monomeric units are amino acids (typically, but not limited to
L-amino acids) linked by an amide bond. Peptides may be two or more
amino acids in length. Peptides identified according to the
invention are preferably less than 50 amino acids in length, more
preferably less than 30 amino acids in length, also preferably less
than 25 amino acids in length, and preferably less than 20 amino
acids in length. In one preferred embodiment the peptides
identified according to the method of the invention are between 4
and 15 amino acids in length. However, in general peptides may be
up to 100 amino acids in length. Peptides that are longer than 100
amino acids in length are generally referred to as polypeptides.
Standard abbreviations for amino acids are used herein. (See
Singleton et al., (1987) Dictionary of Microbiology and Molecular
Biology, Second Ed., page 35, incorporated herein by
reference).
[0030] The peptides or polypeptides may be provided as a fusion
peptide or protein. Peptides include synthetic peptide analogs
wherein the amino acid sequence is known. The term peptide does not
include molecules structurally related to peptides, such as peptide
derivatives or peptidomimetics whose structure cannot be determined
by standard sequencing methodologies, but rather must be determined
by more complex methodologies such as mass spectrometric methods.
Peptidomimetics (also known as peptide mimetics) are peptide
analogs but are non-peptide compounds. Usually one or more peptide
linkages are optionally replaced. (Evans et al., (1987) J. Med.
Chem. 30:1229). The term "protein" is well known and refers to a
large polypeptide.
[0031] The term "nucleic acid" means DNA, RNA, single-stranded or
double-stranded and chemical modifications thereof. Modifications
may include but are not limited to modified bases, backbone
modifications, methylations, unusual base pairing modifications,
and capping modifications. When a nucleic acid library is used in
the selective targeting method of the invention, the nucleic acid
ligand is generally between 4 and 250 nucleotides in length, and
preferably between 4 and 60 nucleotides in length.
[0032] The invention further includes ligands, preferably nucleic
acid, peptide or polypeptide ligands and more preferably peptide
ligands that have substantially the same ability to bind to a
target as the nucleic acid, peptide or polypeptide identified by
the selective targeting method described herein. Substantially the
same ability to bind a target means the affinity and selectivity is
approximately the same as the affinity and selectivity of the
ligands selected by the method herein claimed.
[0033] Additionally a ligand having substantially the same ability
to bind to a target will be substantially homologous to the ligand
identified by the disclosed selective targeting method. With
respect to a nucleic acid sequence, substantially homologous to an
identified ligand means the degree of primary sequence homology is
in excess of 80%, preferably in excess of 85%, more preferably in
excess of 90%, further preferably in excess of 95%, even more
preferably in excess of 97%, and most preferably in excess of 99%.
It will be appreciated by those skilled in the art that as a result
of the degeneracy of the genetic code, a multitude of peptide
encoding nucleotide sequences may be produced. A peptide or
polypeptide is substantially homologous to a reference peptide or
polypeptide if it has at least 85% sequence identity, preferably at
least 90% to 95% sequence identity, more preferably at least 97%,
and most preferably at least 99% identical or equivalent to the
reference sequence when optimally aligned. Optimal alignment of the
sequences may be conducted by various known methods and
computerized implementation of known algorithims (e.g. TFASTA,
BESTFIT, in the Wisconsin Genetics Software Package, Release 7.0,
Genetics Computer Group, Madison, Wis.). General categories of
equivalent amino acids include 1) glutamic acid and aspartic acid;
2) lysine, arginine, and histidine; 3) alanine, valine, leucine,
and isoleucine; 4) asgaragine and glutamine; 5) threonine and
serine; 6) phenylalaine, tyrosine and tryptophan; and 7) glycine
and alanine. It is well within the ordinary skill of those in the
art to determine whether a given sequence substantially homologous
to those identified herein have substantially the same ability to
bind a target.
[0034] A small organic molecule as defined herein is a molecule,
preferably a nonpolymeric molecule, having a molecular weight of
approximately 1000 daltons or less and more preferably 500 daltons
or less. A "peptoid" is defined herein as an enzymatically
resistant peptide analog.
[0035] The term "target" or "anti-target" refers to molecules or
heterogeneous molecules that have a binding affinity as defined
herein, for a given ligand. Both target and anti-targets may be
naturally occurring or synthetic molecules or heterogeneous
molecules.
[0036] The binding affinity of a ligand for its target or
anti-target may be described by the dissociation constant
(K.sub.D), concentration needed for 50% effective binding
(EC.sub.50), or concentration needed for 50% inhibition of binding
of another compound that binds to the target (IC.sub.50). K.sub.D
is defined by k.sub.off/k.sub.on. The k.sub.off value defines the
rate at which the target-ligand complex breaks apart or separates.
This term is sometimes referred to in the art as the kinetic
stability of the target-ligand complex or the ratio of any other
measurable quantity that reflects the ratio of binding affinities,
such as an enzyme-linked immunosorbent assay (ELISA) signal or
radio-active label signal. Selectivity is defined by the ratio of
binding affinities or k.sub.off for dissociation of the
ligand-complex (target K.sub.D/anti-target K.sub.D). The k.sub.on
value describes the rate at which the target and ligand combine to
form the target-ligand complex.
[0037] The term "contacting" is broadly defined to mean placing a
library of ligands and a target or anti-target in immediate
proximity or-association and includes in vitro and in vivo contact.
The term includes touching, associating, joining, combining,
intravenous injection, oral administration, intraperitoneally,
topical application, intramuscular, inhalation, subcutaneous
application and the like. The term "separating" as used herein
means to select, segregate, partition, isolate, collect, keep apart
and disunite.
[0038] "Amplifying" means a process or combination of process steps
that increases the amount or number of copies of a molecule or
class of molecules. In one aspect, amplification refers to the
production of additional copies of nucleic acid sequences that is
carried out using polymerase chain reaction (PCR) technology well
known in the art. In another aspect, amplification refers to
production of phage virions by infection of a host.
[0039] As used in the specification and claims, the singular "a",
"an" and "the" include the plural references unless the context
clearly dictates otherwise. For example, the term "a protease" may
include a plurality of proteases.
[0040] The following references describe the general techniques
employed herein: Sambrook et al., (1989) Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.; Innis et al., PCR Protocols--A Guide to Methods and
Applications (1990), Academic Press, Inc.; Kay et al., (1996) Phage
Display of Peptides and Proteins, Academic Press; Ausubel et al.,
(1987) Current Protocols in Molecular Biology, Greene-Publishing
& Wiley Interscience NY (Supplemented through 1999); Berger and
Kimmel, (1987) Methods in Enzymology, Vol. 152. Academic Press
Inc., San Diego, Calif.
[0041] The contents of all references, patents and published patent
applications cited throughout this application are hereby
incorporated by reference in their entirety.
[0042] B. General Method
[0043] Described herein is a selective targeting method for
screening a library of ligands having a binding affinity and
selectivity for a selected target. In its most basic form the
selective targeting method may be defined as follows: Preparing or
obtaining a library of ligands, preferably peptides of different
sequences and more preferably a random peptide library. Deselecting
ligands that bind with an anti-target by contacting the ligand
library with an anti-target under conditions favorable for binding
between the ligands of the library and the anti-target; allowing
the anti-target to bind with the ligands; and separating the
anti-target non-binders (unbound ligands) from the anti-target
ligand bound molecules and any free ligands. Contacting the
anti-target non-binders with a selected target under suitable
conditions and allowing them to bind. Ligands with an affinity for
the target will bind to form a target-bound ligand complex. The
removal of ligands bound to the anti-target and removal of weak
target-bound ligands may generally be referred to as library
depletion. The target-bound ligand complex is then separated from
the remaining mixture including the unbound ligands, and the
target-bound ligands are identified. The target-bound ligand
complex or the target-bound ligands may then optionally be
subjected to amplification, sequencing or further rounds of
selection (FIG. 1). The invention further comprises the ligands
identified according to the selective targeting method of the
invention.
[0044] In the practice of the invention, a library of compounds to
be tested will generally be provided. A library of ligands may
include, but is not limited to, random peptide libraries, synthetic
peptide or peptidomimetic combinatorial libraries, peptide loop
libraries, combinatorial chemical libraries, and oligonucleotide
libraries. These libraries are well known to those in the art as
well as methods for making said libraries. Reference is made to
Barbas, C. F. (1993) Current Opinion in Biotech., 4:526; Cwirla et
al., (1990) supra; Scott and Smith, (1990) Science, 249:386; Cull
et al., (1992) supra; Pinilla et al., (1994) Biochem. J. 301:847;
Sambrook et al., (1989) supra; Ausubel et al., (1987) supra; and
Gubler and Hoffman, (1983) Gene 25:263; each of which is
incorporated herein by reference.
[0045] One preferred type of library includes random peptide
libraries (also sometimes referred to in the art as epitope
libraries). These libraries may include cell-surface display
libraries, for example yeast display (Boder and Wittrup (1997) Nat.
Biotechnol., 15:553); peptide libraries inserted into proteins
(Lenstra et al., (1992) J. Immunol. Methods, 152:149 and U.S. Pat.
No. 5,837,500); direct screening of peptides on polysomes (Tuerk et
al., (1990) Science 249:505) and phage display libraries (Delvin et
al., (1990) Science 249:404; WO91/18980; Dower et al. WO91/19818;
and Parmley et al., (1988) Gene 73:305). Phage display libraries
are particularly preferred. A phage display library is a library in
which numerous peptides are displayed on the surface of a
bacteriophage, such as a filamentous phage. The peptide or protein
is expressed as a fusion with a coat protein of the bacteriophage
resulting in display of the fusion protein on the surface of the
virion while the DNA encoding the fusion resides within the virion.
Suitable non-limiting examples of vectors for construction of phage
libraries include fAFF1; the fUSE series, such as fUSE5; lamba
phage vectors; and T7select (non-filamentous) phage vectors. (Smith
and Scott (1993) Methods Enzymol. 217:228; and Cwirla et al.,
(1990) Proc. Natl. Acad. Sci. USA 87:6378). Phage-peptide library
kits are available and reference is made to Chiron Corp.
(Emeryville, Calif.), New England BioLabs Inc., Catalog No.8100
(Beverly, Mass.), and Novagen Catalog No. 70550-3 (Madison Wis.).
While various antibody libraries are known, including antibody
display libraries on phage (de Bruin et al., (1999) Nat.
Biotechnol., 17:397), in one preferred aspect of the present
invention, the library of ligands used in the selective targeting
method according to the invention will not include antibodies.
[0046] Another type of peptide library encoded by nucleic acids
includes a library wherein the peptide is expressed as a fusion
with another protein, for example, either a cell-surface protein or
an internal protein of a host. The nucleotides encoding the peptide
are inserted into a gene encoding the internal protein. Various
examples of this type of library include the fusion of peptides to
a lac repressor, GAL4, thioredoxin, and various antibodies (U.S.
Pat. Nos. 5,283,173; 5,270,181; and 5,292,646). Cull et al. (1992)
Proc. Natl. Acad. Sci. USA 89:1865 teach the construction of a
fusion gene encoding a fusion protein of peptide library members
and Lacl. Nucleic acids encoding a library of peptides are inserted
into a gene encoding Lacl. The fusion protein and the fusion
plasmid encoding the fusion protein are physically linked by
binding of the peptides to the lac operator sequence in a plasmid.
Host cells may be transformed with the library plasmids. The cells
expressing the fusion protein are lysed releasing the fusion
protein and associated DNA (see for example U.S. Pat. No.
5,733,731). The library can then be screened or selected. DNA
shuffled libraries are also known which are constructed by
homologous exchange of DNA fragments during DNA recombination
methods or by synthetic methods (see for example U.S. Pat. No.
5,605,793 and Stemmer (1994), Proc. Natl. Aca. Sci. USA
91:10747).
[0047] So called anchor libraries have been described in PCT
US96/09383 and WO 97/22617. This is a peptide library wherein
peptides have non-continuous regions of random amino acids
separated by specifically designated amino acids. These libraries
are made by genetic or chemical means.
[0048] A combinatorial chemical library and particularly a peptide
library may also be synthesized directly by methods known in the
art including, but not limited to synthesis by arrays (Foder et
al., (1991) Science 251:767); synthesis on solid supports
(WO97/35198); and other chemical methods such as those disclosed in
Lam et al., (1993) Bioorg. Med. Chem. Lett., 3:419, Tjoeng et al.,
(1990) Int. J. Pept. Protein Res. 35:141, and WO96/33010.
[0049] Methods for creating combinatorial chemical libraries are
also known in the art. Combinatorial libraries include large
numbers of chemical variants for peptides, oligonucleotides,
peptoids, carbohydrates, small organic molecules and even
solid-state materials (Schultz et al., (1995) Science, 268:1738). A
core structure will be varied by adding substituents or by linking
different molecular building blocks. Libraries may include
molecules free in solution, linked to solid particles or beads, or
arrayed on surfaces of modified organisms. Virtually any class of
compounds may be modified by varying substituents around the core
molecule. Various non-limiting examples of classes of compounds for
combinatorial libraries include benzodiazepines; mercaptoacyl
prolines; carbamates; chalcone libraries; ketoamide conjugates;
polyketones; paclitaxel libraries; anilides;
aryloxyphenoxypropionates; oxazolidinones; carbohydrates; and
numerous other classes. While methods for making combinatorial
libraries are well documented in the literature, these methods may
be very time consuming. Various companies now make instrumentation
to generate combinatorial libraries from both solution and solid
phase synthesis (CombiChem Inc. (San Diego, Calif.); Advanced
ChemTech (Louisville); Zymark Corp. (MA); and Hewlett Packard
(CA)). Once a library has been generated it can optionally be
purified for example by high performance liquid chromatography
(HPLC). Once a small organic molecule is screened and identified
according to the selective targeting method of the invention, it
may be produced on a larger scale by means of organic synthesis
known in the art.
[0050] As taught herein not only are standard methods for
generating libraries of ligands well known, but also ligand
libraries may be obtained commercially, for example from Sigma (St.
Louis Mo.) or from various public sources such as American Type
Culture Collection (ATCC) and the National Institute of Health
(NIH).
[0051] Suitable targets and anti-targets used in the selective
targeting method according to the invention include, but are not
limited to, proteins, peptides, nucleic acids, carbohydrates,
lipids, polysaccharides, glycoproteins, hormones, receptors,
antigens, antibodies, viruses, pathogens, toxic substances,
metabolites, inhibitors, drugs, dyes, nutrients, growth factors,
cells or tissues.
[0052] Sources of cells or tissues include human, animal,
bacterial, fungal, viral and plant. Tissues are complex targets and
refer to a single cell type, a collection of cell types or an
aggregate of cells generally of a particular kind. Tissue may be
intact or modified. General classes of tissue in humans include but
are not limited to epithelial, connective tissue, nerve tissue, and
muscle tissue.
[0053] Preferred human cellular targets or anti-targets include
hematopoietic cells, cancer cells and retroviral-mediated
transduced cells. Hematopoietic cells encompass hematopoietic stem
cells, erythrocytes, neutrophils, monocytes, platelets, mast cells,
eosinophils, basophils, B and T cells, macrophages, and natural
killer cells.
[0054] Non-limiting examples of protein and chemical targets
encompassed by the invention include chemokines and cytokines and
their receptors. Cytokines as used herein refer to any one of the
numerous factors that exert a variety of effects on cells, for
example inducing growth or proliferation. Non-limiting examples
include interleukins (IL), IL-2, IL-3, IL4 IL-6, IL-10, IL-12,
IL-13, IL-14 and IL-16; soluble IL-2 receptor; soluble IL-6
receptor; erythropoietin (EPO); thrombopoietin (TPO); granulocyte
macrophage colony stimulating factor (GM-CSF); stem cell factor
(SCF); leukemia inhibitory factor (LIF); interferons; oncostatin
M(OM); the immunoglobulin superfamily; tumor necrosis factor (TNF)
family, particularly TNF-.alpha.; TGF.beta.; and IL-1.alpha.; and
vascular endothelial growth factor (VEGF) family, particularly VEGF
(also referred to in the art as VEGF-A), VEGF-B, VEGF-C, VEGF-D and
placental growth factor (PLGF).
[0055] Chemokines are a family of small proteins that play an
important role in cell trafficking and inflammation. Members of the
chemokine family include, but are not limited to, IL-8,
stomal-derived factor-1 (SDF-1), platelet factor 4, neutrophil
activating protein-2 (NAP-2) and monocyte chemo attractant
protein-1 (MCP-1).
[0056] Other protein and chemical targets include: immunoregulation
modulating proteins, such as soluble human leukocyte antigen (HLA,
class I and/or class II, and non-classical class I HLA (E, F and
G)); surface proteins, such as soluble T or B cell surface
proteins; human serum albumin; arachadonic acid metabolites, such
as prostaglandins, leukotrienes, thromboxane and prostacyclin; IgE,
auto or alloantibodies for autoimmunity or allo- or xenoimmunity,
Ig Fc receptors or Fc receptor binding factors; G-protein coupled
receptors; cell-surface carbohydrates; angiogenesis factors;
adhesion molecules; ions, such as calcium, potassium, magnesium,
aluminum, and iron; fibril proteins, such as prions and tubulin;
enzymes, such as proteases, aminopeptidases, kinases, phosphatases,
DNAses, RNAases, lipases, esterases, dehydrogenases, oxidases,
hydrolases, sulphatases, cyclases, transferases, transaminases,
carboxylases, decarboxylases, superoxide dismutase, and their
natural substrates or analogs; hormones and their corresponding
receptors, such as follicle stimulating hormone (FSH), leutinizing
hormone (LH), thyroxine (T4 and T3), apolipoproteins, low density
lipoprotein (LDL), very low density lipoprotein (VLDL), cortisol,
aldosterone, estriol, estradiol, progesterone, testosterone,
dehydroepiandrosterone (DHBA) and its sulfate (DHEA-S); peptide
hormones, such as renin, insulin calcitonin, parathyroid hormone
(PTH), human growth hormone (hGH), vasopressin and antidiuretic
hormone (AD), prolactin, adrenocorticotropic hormone (ACTH), LHRH,
thyrotropin-releasing hormone (THRH), vasoactive intestinal peptide
(VIP), bradykinin and corresponding prohormones; catechcolamines
such as adrenaline and metabolites; cofactors including
atrionatriutic factor (AdF), vitamins A, B, C, D, E and K, and
serotonin; coagulation factors, such as prothrombin, thrombin,
fibrin, fibrinogen, Factor VIII, Factor IX, Factor XI, and
vonWillebrand factor; plasminogen factors, such as plasmin,
complement activation factors, LDL and ligands thereof, and uric
acid; compounds regulating coagulation, such as hirudin, hirulog,
hementin, hepurin, and tissue plasminigen activator (TPA); nucleic
acids for gene therapy; compounds which are enzyme antagonists; and
compounds binding ligands, such as inflammation factors.
[0057] Non-human derived targets and anti-targets include without
limitation; drugs, especially drugs subject to abuse, such as
cannabis, heroin and other opiates, phencyclidine (PCP),
barbiturates, cocaine and its derivatives, and benzadiazepine;
toxins, such as heavy metals like mercury and lead, arsenic, and
radioactive compounds; chemotherapeutic agents, such as
paracetamol, digoxin, and free radicals; bacterial toxins, such as
lipopolysaccharides (LPS) and other gram negative toxins,
Staphylococcus toxins, Toxin A, Tetanus toxins, Diphtheria toxin
and Pertussis toxins; plant and marine toxins; snake and other
venoms, virulence factors, such as aerobactins, or pathogenic
microbes; infectious viruses, such as hepatitis, cytomegalovirus
(CMV), herpes simplex virus (HSV types 1, 2 and 6), Epstein-Barr
virus (EBV), varicella zoster virus (VZV), human immunodeficiency
virus (HIV-1, -2) and other retroviruses, adenovirus, rotavirus,
influenzae, rhinovirus, parvovirus, rubella, measles, polio,
pararyxovirus, papovavirus, poxvirus and picornavirus, prions,
plasmodia tissue factor, protozoans, such as Entamoeba histolitica,
Filaria, Giardia, Kalaazar, and toxoplasma; bacteria, gram-negative
bacteria responsible for sepsis and nosocomial infections such as
E. coli, Acynetobacter, Pseudomonas, Proteus and Klebsiella, also
gram-positive bacteria such as Staphylococcus, Streptococcus,
Meningococcus and Llycobacteria, Chlamydiae Legionnella and
Anaerobes; fungi such as Candida, Pneumocystis, Aspergillus, and
Mycoplasma.
[0058] In one aspect the target includes an enzyme such as
proteases, aminopeptidases, kinases, phosphatases, DNAses, RNAases,
lipases, esterases, dehydrogenases, oxidases, hydrolases,
sulphatases, cellulases, cyclases, transferases, transaminases,
carboxylases, decarboxylases, superoxide dismutase, and their
natural substrates or analogs. Particularly preferred enzymes
include hydrolases, particularly alpha/beta hydrolases; serine
proteases, such as subtilisins, and chymotrypsin serine proteases;
cellulases; and lipases.
[0059] In another aspect the target is a stain on a fabric or other
surface material such as ceramic, glass, silica, wood, paper, metal
and alloys, and living tissue, such as skin. The stain may be
selected from the following non-limiting group of stains; porphyrin
derived stains, tannin derived stains, carotenoid pigment derived
stains, anthocyanin pigment derived stains, soil-based stains,
oil-based stains, and human body derived stains. Particularly the
stain may be a blood-derived stain or a chlorophyll-derived stain.
More specifically the stain may be grass; paprika; a tea-derived
stain; or a fruit or vegetable derived stain, such as from wine,
tomato and berries. A particularly preferred stain is human body
soil, and more specifically stains referred to as collar soil.
[0060] In yet another aspect the target includes hematopoietic stem
cells (HSCs). A particularly preferred surface antigen expression
profile of HSCs is CD34.sup.+Thy-1.sup.+, and preferably
CD34.sup.+Thy-1.sup.+Lin.su- p.-. Lin.sup.- refers to a cell
population selected on the basis of the lack of expression of at
least one lineage specific marker. Methods for isolating and
selecting HSCs are well known in the art and reference is made to
U.S. Pat. Nos. 5,061,620; 5,677,136; and 5,750,397.
[0061] In a further aspect, preferred targets include cytokines,
particularly IL-2, IL-3, IL-6, IL-10, IL-12, IL-13, IL-14 and
IL-16; EPO; GM-CSF; the TNF family; the VEGF family, GF.beta.; and
IL-1.alpha.. Cytokines are commercially available from several
vendors including Amgen (Thousand Oaks, Calif.), Immunex (Seattle,
Wash.) and Genentech (South San Francisco, Calif.). Particularly
preferred are VEGF and TNF-.alpha.. Antibodies against TNF-.alpha.
show that blocking interaction of the TNF-.alpha. with its receptor
is useful in modulating over-expression of TNF-.alpha. in several
disease states such as septic shock, rheumatoid arthritis, or other
inflammatory processes. VEGF is an angiogenic inducer, a mediator
of vascular permeability, and an endothelial cell specific mitogen.
VEGF has also been implicated in tumors. Targeting members of the
VEGF family and their receptors may have significant therapeutic
applications, for example blocking VEGF may have therapeutic value
in ovarian hyper stimulation syndrome (OHSS). Reference is made to
N. Ferrara et al., (1999) Nat. Med. 5:1359 and Gerber et al.,
(1999) Nat. Med. 5:623. Other preferred targets include
cell-surface receptors, such as T-cell receptors.
[0062] It is preferred that the target and anti-target are
characterized in some detail at the structural, chemical or genetic
level to allow some control over the purity, stability and
concentration of the target. However, targets and anti-targets may
be used that are not well characterized. Non-limiting examples of
potentially not well-characterized targets include collar soil,
tumor cells, human skin and hair.
[0063] A preferred anti-target includes fabric selected from the
group consisting of cotton, wool, silk, polyester, rayon, linen,
nylon and blends thereof.
[0064] In another aspect, when the target is damaged cells, tissue,
or organs, the anti-target is healthy normal (non-damaged) cells,
tissue, organs or combinations thereof. Specific non-limiting
anti-target examples include healthy normal whole blood, skin,
hair, teeth, and nails.
[0065] In some applications, the target and anti-target can be
reversed depending upon the specific application of interest. For
example there may be multiple applications where it is desirable to
target human skin and not hair. Therefore the anti-target would be
hair. In a similar application it may be desirable to target human
hair and not the corresponding anti-target, skin.
[0066] The following general examples of target/anti-target used in
the same application are provided for illustrative purpose only and
are not meant to limit the selective targeting method disclosed
herein: tumor cell/normal cell; receptor cell/cell not expressing
the receptor; neoplastic cell/normal cell; soil stain/cotton
fabric; food stain/ceramic; specific protease/other protease;
serine protease/whole blood; hematopoietic stem cell/whole blood;
specific enzyme variant/other forms of the enzyme; virus in a
cell/cell; TNF-alpha/blood components; specific insect
enzyme/homologous enzymes in animals; hematopoietic stem cell/other
hematopoietic cells; hair/skin; nucleus/mitochondria;
cytoplasm/nucleus; alpha/beta hydrolases/other hydrolases; and a
specific enzyme involved in photosynthesis/leaf tissue.
[0067] Both the target and anti-target concentrations to be used in
the selective targeting method will vary depending on the type of
ligand library, anti-target and target used. As discussed herein,
the disclosed method has wide applicability to many different
targets and anti-targets, therefore the concentration useful in the
method may vary from about 1.0 M to 10.sup.-15 M, preferably the
concentration is in the 10.sup.-9 M range. In general an excess
amount of anti-target relative to the amount of target is required.
While not meant to limit the invention, this excess amount may be
in the range of at least 10 fold greater to more than 1000 fold
greater. An initial target concentration may be preferably provided
in the range of 10.sup.-3 M to 10.sup.-15 M. In one preferred
embodiment, when the target is an enzyme, the target concentration
may be provided in the range of about 10.sup.-3 M to 10.sup.-12 M.
In another preferred embodiment, when the target is a cytokine, the
target may be provided in the concentration range of about
10.sup.-3 M to 10.sup.-12 M. In yet another embodiment, when the
target is a hematopoietic cell, the target concentration may be
provided in the range of about 10 to 10.sup.9 cells.
[0068] In one preferred embodiment, when the anti-target is a blood
protein or an enzyme, the anti-target concentration may be provided
in a concentration range of about 1.0 M to 10.sup.-12 M.
[0069] In certain preferred embodiments, the anti-target or target
may be a material or surface, such as a fabric, ceramic or
micro-fluidic chip. In this instance the area of the target or
anti-target will be important. While not intended to limit the
invention in any manner, in general the size of the anti-target or
target material will be about 1.0 mm to 1.5 cm; more preferably
about 25.0 mm to 0.5 cm; however, the diameter or area may be more
or less than these values.
[0070] In one aspect, the invention is directed to the screening
and identification of ligands that bind to a selected target to
form a non-covalent target-ligand complex with a binding affinity
in the range of antibody affinities for antigens. The ligand
binding affinity according to the present invention for K.sub.D,
EC.sub.50 or IC.sub.50 is in the range of between about 10.sup.-7 M
to 10.sup.-15 M, although higher or low binding affinities may be
achieved. In one aspect, the affinity is in the range of at least
about 10.sup.-7 M, also at least about 10.sup.-8 M, preferably at
least about 10.sup.-9 M and also preferably at least about
10.sup.-12 M. In another embodiment, the affinity is less than
about 10.sup.-7 M. In another aspect, k.sub.off values for the
ligand-target complex will be less than about 10.sup.-3 sec.sup.-1,
less than about 10.sup.-4 sec.sup.-1, and also less than about
10.sup.-5 sec.sup.-1. The ligands identified according to the
selective targeting method of the invention will not bind with any
significance to the anti-target. While not meant to limit the
invention, a preferred ligand identified according to the selective
targeting method described herein may have a K.sub.D for the
anti-target greater than about 10.sup.-4 M, and preferably greater
than about 10.sup.-1 M.
[0071] The selective targeting method according to the invention
may be characterized not only by the binding affinity of a ligand
to the target, but also may be characterized by the selectivity of
the ligand-target complex. The selectivity of ligand binding for a
target compared to ligand binding to an anti-target can be defined
by a ratio of K.sub.D, EC.sub.50 or IC.sub.50 in the range of about
3:1 to 500:1. In one aspect, selectivity is at least about 5:1,
preferably at least about 10:1, more preferably at least about
20:1, even more preferably at least about 30:1, even more
preferably at least about 50:1, and yet more preferably at least
about 100:1.
[0072] In another aspect, the selective targeting method may be
used to select ligands with a low affinity for the target but with
a high selectivity for the target. In this aspect, the selectivity
of ligand binding affinity for the target compared to said ligand
binding to an anti-target would be at least about 5:1, preferably
at least about 10:1, also preferably at least about 20:1, more
preferably at least about 50:1, and even preferably at least about
100:1. However, the target binding affinity would be in the range
of about 10.sup.-3 M to10.sup.-7 M.
[0073] Methods for measuring binding affinities and selectivity are
well known in the art, and these methods include but are not
limited to measurement by radio-labeled release and competition
assay; by isothermal titration calorimetry; biosensor binding
assays (Morton & Myszka, (1998) Methods Enzymol. 295:268-294);
by fluorescence and chemi-luminescence spectroscopy; and by mass
spectrophotometry (Gao et al., (1996), J. Med, Chem., 39:1949).
[0074] In one aspect, the anti-target is combined with the library
of ligands and allowed to incubate prior to exposing the library of
ligands to the target. In another aspect, the anti-target and
target are combined with the library of ligands essentially
simultaneously. Essentially simultaneously means at the same time
or very close in time wherein the ligand library is exposed to both
the anti-target and the target prior to any separation step.
[0075] The selective targeting method as described herein may be
performed in vitro or in vivo. When performed in vitro, the library
of ligands and the anti-target (and optionally the target), are
combined in or on a vessel. The vessel may be any suitable material
or receptacle such as a plate, culture tube, microtiter plate,
micro-fluidic chip, petri dish and the like.
[0076] Preferably, the anti-target and the target are available in
an environment where non-specific binding events are minimized.
This may be accomplished by various means including, but not
limited to, 1) by coating a vessel containing the ligand library
and the targetlanti-target with BSA, skim-milk or other adsorbing
protein to block non-specific binding, 2) by labeling the target
molecule with a capture agent such as a biotinylated compound, for
example biotin, avidin, or mutated form thereof which can be
subsequently trapped by streptavidin or a streptavidin derivative,
such as nitrostreptavidin, 3) displaying the targetlanti-target on
magnetic beads that can be physically separated from the library,
or 4) by using library display vectors with low background
adsorption properties. These methods are known in the art and
reference is made to Parmley et al. (1988) supra; and Bayer et al.,
(1990) Methods Enzymol. 184:138.
[0077] A composition including a library of ligands and an
anti-target may be combined together with additional compounds such
as buffers and optionally detergents and organic solvents under
suitable conditions to allow binding of the ligands with the
anti-target. One skilled in the art is well aware of useful
buffers. Non-limiting examples include;
tris(hydroxymethyl)aminomethane (Tris) buffers;
N-2-hydroxyethylpiperazin- e-N'-2-ethanesulfonic acid (HEPES)
buffers; morphololino-ethanesulfonic acid (MES) buffers; buffered
saline solutions, such as
N,N-bis[2-hydroxyethyl]2-aminoethanesulfonic acid (BES), Tris, and
phosphate-buffered saline (PBS), preferably buffered saline
solutions (Sambrook et al., (1989) supra). Commercial buffers are
available for example SuperBlock.TM. (Pierce, Rockford, Ill.).
Other ingredients such as detergents, for example Tween and Triton
can be used in the solutions.
[0078] Depending on the target, the composition including the
ligand library and anti-target is incubated for a period of about 1
minute to about 96 hours to allow the ligands to bind with the
anti-target. However, longer time periods may be used depending on
the stability of the target or anti-target. The component
containing the unbound anti-target ligands is separated from the
anti-target bound ligands after incubation. While not essential,
the separated component including the unbound anti-target ligands
may optionally be transferred to a new vessel including the
anti-target, incubated and then the component containing the
unbound anti-target ligands can again be separated from the bound
anti-target ligands. This transfer process may be repeated numerous
times, for example it may be repeated between 2 to 10 times or
more. The repeated transfer step further reduces the number of
ligands that bind to the anti-target. However, the contacting of
the library of ligands with the anti-target and the separating of
the anti-target bound ligands from the unbound ligands may be
accomplished in one round. The contacting including incubation, and
the separation steps, whether completed in one round or in multiple
rounds may generally be referred to as deselection.
[0079] In general, the temperature conditions during deselection
may be between 2 and 30.degree. C. The temperature is limited by
the stability of the components and is well within the skill of one
of ordinary skill in the art to determine.
[0080] The unbound anti-target ligands may be separated from the
anti-target bound ligands by methods well known in the art. Some of
these methods include liquid transfer, washing, centrifugation,
filtration, chromatography, micro-dissection and fluorescence
activator cell sorting (FACS).
[0081] The ligand library, depleted of anti-target binding ligands
and containing unbound ligands is transferred to a vessel including
the target under suitable conditions which will allow one or more
members of the ligand library to bind with the target thereby
forming a target-bound ligand complex. In one aspect the ligands
may be contacted with the same target. In another aspect the
ligands may be contacted with an array of targets at the same time.
One non-limiting example of an array of targets includes the
contacting of a ligand with multiple stains on a surface. The
ligands are incubated under conditions that allow binding to the
target and generally for a period of time ranging from about 1
minute to about 96 hours. The incubation time depends on the
stability of the target. When the target is a stain, the incubation
period will generally range from about 5 minutes to about 90
minutes. The vessel may further include buffers as described herein
above. The temperature range is generally between about 2 and
30.degree. C., and preferably about 18 to 25.degree. C.
[0082] One skilled in the art is well aware of references
describing cell, organ, and tissue culture, and reference is made
to Atlas and Parks (eds) (1993), The Handbook of Microbiological
Media, CRC Press, Boca Raton Fla.; Gamborg and Phillips (eds)
(1995) Plant Cell Tissue and Organ Culture, Fundamental Methods,
Springer Lab Manual Springer-Verlag.
[0083] The target-bound ligand complex may be subject to one or
more wash steps. The washing compounds may include buffers (such as
TBS and PBS), detergents, acids (glycine), organic solvents, bases,
enzymes, sonication, or combinations thereof, wherein unbound
ligands are washed. When the target-bound ligand complex is subject
to an acid elution, the pH of the acid elution may be in the range
of about 1.5 to 4.5, preferably in the range of about 2.0 to 3.5.
The acid elution may take place for between 2 to 20 minutes and
generally no longer than about 10 minutes. The wash step may be
repeated numerous times and in general can be repeated between 2-6
depending on the specific target and ligand library. Particularly
when the washing step is with an acid, washing will generally be
followed by neutralization with various well-known compounds and
buffers, such as TRIS-HCL. The washing step results in a
target-bound ligand complex comprising tight binding ligands having
a K.sub.D, k.sub.off and selectivity values as herein defined.
[0084] When the ligand library is contacted with the anti-target
and target essentially simultaneously as opposed to sequentially
the ligand library, anti-target and target composition may further
include all materials described above for the sequential exposure
of the anti-target and target.
[0085] Further when the ligand library is contacted with the
anti-target and target essentially simultaneously, the method may
also be performed in vivo. In this aspect, the library of ligands
may be administered by means well known in the art, but preferably
by injection into a host. If the library is a phage-peptide
library, the number of transducing units may be in the range of
10.sup.4-10.sup.10. The host may be any animal, such as a human,
mouse, chicken, or pig, preferably mouse. The target for example
may be whole organs or damaged or tumor tissue, more specifically
tumor blood vessels. If the target is a tissue or cells found in
the blood, the library of ligands may be circulated in the blood
for a period of about 1 minute to 10 minutes and allowed to bind
with the target. The target-bound ligand complex may be recovered
after perfusion and the tissue dissected (Koivunen et al., (1999)
Nature Biotech. 17:768 and Arap et al., (1998) Science
279:377).
[0086] Separation of the target-bound ligands from the anti-target
unbound ligands or free ligands in the mixture may also be
accomplished by well-known means in the art and these methods
include affinity chromatography; centrifugation; high-performance
liquid chromatography (HPLC); filtration, such as gel filtration;
enzyme-linked immunosorbent assays (ELISA); and
fluorescence-activator cell sorting (FACS). The choice of the
separating method will depend on various factors such as the
target, anti-target and ligand molecules. The choice of the
separation method is well within the skill of one in the art and a
variety of instruments used for these separation methods are
commercially available. (See Kenny and Fowell (eds) (1992)
Practical Protein Chromatography Methods in Molecular Biology, vol.
11, Humana Press, Totowa N.J.).
[0087] The target-bound ligand on the target-bound ligand complex
may be identified by various techniques including polymerase chain
reaction (PCR), mass spectrophotometry (MS), surface plasmon
resonance, immunoprecipitation and nuclear magnetic resonance (NMR)
spectroscopy (U.S. Pat. No. 4,683,202; Szabo et al., (1995) Curr.
Opin. Struct. Bio.) 5:699; Harlow et al., (1999) Using Antibodies,
A Laboratory Manual, Cold Spring Harbor Press; and Hajduk et al.,
(1999) J. Med Chem., 42:2315). Asymmetric PCR may also be used for
identification of the target-bound ligand wherein a single primer
species or primers in differential concentration may be used. As
well known to those in the art, when the library members are
genetically linked to the peptide or protein, DNA or mRNA can be
amplified by PCR and the corresponding sequence subcloned into a
vector for sequencing and identification.
[0088] During the process of the identifying step, the target-bound
ligand may separate from the target-bound ligand complex, but the
identifying step does not require separation, and preferably the
target-bound ligand is not separated from the target-bound ligand
complex prior to identification of the ligand. For example, in mass
spectrophotometry (MS), once the target-bound ligand complex is
injected into the mass spectrophotometer the target-bound ligand
may be separated from the target complex. Additionally, PCR may be
directly carried out on the target-bound ligand complex.
[0089] The selective targeting method according to the invention
preferably includes PCR to identify target-bound peptides.
According to the invention use of PCR results in the recovery of
peptides not recovered by conventional biopanning methods which
utilize acid-elution. In general, a ligand encoding a DNA is
amplified by PCR with appropriate primers.
[0090] The presence of specific PCR products indicates that the
target-bound ligand encoding DNA is present. The amount of the
target-bound ligand is determined by quantitative PCR. The degree
of wash stringency can be monitored to a desired level and to very
low detection levels for example to attomole levels. Nonspecific
ligand binders may be competed out for example by adding wild type
phage and designing primers that only amplify the ligand library.
To prevent deterioration of signal-to-noise ratio, the sequences
flanking the ligand encoding DNA may be changed frequently during
rounds of selection. Sensitivity for the analysis of target-bound
ligands may be controlled by changing target concentration, the
number of PCR amplification cycles, the specificity of the PCR
primers, and the detection method for PCR products.
[0091] In one embodiment, when the target is a tumor antigen, tumor
tissue including the target-bound phage ligands may be excised from
a tumor and addition of appropriate PCR primers, nucleotides, and
polymerase may yield the amplified PCR product. Various inhibitory
reactions of PCR may be alleviated by the addition of excipents
including bovine serum albumin, cationic amines, and organic
solvents and reference is made to Roux, (1995) "Optimization and
Troubleshooting in PCR" in PCR Primer: A Laboratory Manual, Cold
Spring Harbor Press. DMSO and glycerol may be used to improve
amplification efficiency and specificity of PCR. The DNA of the
target-bound ligand may also be extracted and purified using
standard techniques.
[0092] To facilitate sequencing of desired clones or separation
from undesired non-specific phage, the polynucleotide products
generated by PCR may be labeled for example with biotinyl or
fluorescent label moieties by incorporation during polymerase
mediated catalysis. When the desired PCR product is to be cloned
into a vector for additional rounds of selective targeting
according to the method of the invention, it may be desirable to
introduce diversity by mutagenic PCR methods, (See Stemmer, in Kay
et al., supra). These include cassette mutagenesis, error prone
PCR, DNA shuffling, ITCHY-SCRATCY and the like as is well known by
those in the art. Also reference is made to Tillett and Neilan,
(1999) "Enzyme-free Cloning: A Rapid Method to Clone PCR Products
Independent of Vector Restriction Enzyme Sites": Nucl. Acids. Res.,
27:26e.
[0093] As mentioned above and as well known in the art, the PCR
fragments may be cloned into various vectors for sequencing, they
may be used in the formation of peptide protein fusions, or cloned
into additional display vectors.
[0094] The target bound library members may also be identified
preferably by mass spectrometric methods. This is a rapid and
accurate identification of the structure of a compound based on the
mass of the compound and on fragments of the compound generated in
the mass spectrometry. The use of mass spectrometry to identify the
structure of compounds has been reported in Cao et al., (1997)
Techniques in Protein Chemistry VIII, Academic Press pages 177-184;
and Youngquist et al., (1995) J. Am. Chem. Soc. 117:3900. Also
reference is made to Cheng et al., (1995) J. Am. Chem. Soc.,
117:8859 and Walk et al., (1999) Angew. Che. Int Ed., 38:1763. One
mass spectrometric technique is tandem mass spectrometry (MS/MS)
wherein mass spectrometry is performed in tandem with liquid
chromatography. To purify and separate the ligand of interest, this
type of MS is preferably used to screen target-bound ligands other
than phage-type peptides because of the need to separate and purify
target-bound ligands from a biological system prior to injection of
the ligands into a mass spectrometer. Various recently developed MS
techniques are available for identification of the target-bound
ligands. (See Wu et al., (1997) in Chemistry and Biology, vol.
14(9):653, Marshall et al., (1998), Mass Spectrometry Reviews 17:1,
and Nelson et al., (1999) J. Mol. Recognition, 12:77).
[0095] Following the screening of one or more ligand members,
particularly peptide ligands, the amino acid sequence of the
peptides may be determined according to standard techniques known
by those in the art such as direct amino acid sequencing of the
selected peptide by using peptide sequencers, MS/MS, or manually or
by determining the nucleotide sequence that encodes the peptide.
The invention further includes the target-bound ligands,
particularly the target-bound peptides identified according to the
selective targeting method. Preferred target-bound peptides
identified according to the method include peptides having the
amino acid sequence of SEQ ID NOs: 3-17; SEQ ID NOs: 18-26; SEQ ID
NOs: 29-49; SEQ ID NOs: 50-63; SEQ ID NOs: 64-77 and SEQ ID NOs:
79-102.
[0096] When multiple ligands are selected from the initial ligand
library, and the library is a peptide library, the amino acid
sequences of the ligands when aligned do not necessarily exhibit a
conserved region or a peptide motif, which is herein defined as an
amino acid consensus sequence that represents preferred amino acid
sequences in all of the selected peptides.
[0097] In a particular embodiment, the method concerns selecting
peptides from a peptide library having a binding affinity for a
target of between about 10.sup.-7M to about10.sup.-10 M which
comprises, contacting a peptide library with an anti-target to
allow the peptides in the library to bind with the anti-target;
separating unbound peptides from the anti-target bound peptides;
contacting the separated unbound peptides with a target under
conditions allowing binding of the unbound peptides with the target
to form a target-bound peptide complex; separating the target-bound
peptide complex from the peptides that do not bind to the target;
and identifying the bound peptides on the target-bound peptide
complex wherein the peptides are less than about 50 amino acids in
length, are not antibodies, and have a selectivity in the range of
about 10:1 to about 50:1. Preferably the peptides identified on the
target-bound peptide complex are less than 25 amino acids in length
with selectivity in the -range of about 20:1.
[0098] Once the target-bound ligands are identified, the ligands
may be exposed to repeated rounds of the selective targeting method
and reference is made to FIG. 1. The target-bound ligands may be
subject to diversification. Diversification including chemical
diversity may include a number of mutagenesis techniques. See Saiki
et al., (1988) Science 239:487; Zoller et al., (1982) Nucl. Acids.
Res. 10:6487; and Smith (1985) Ann Rev. Genetics. 19:423. The
target-bound ligands may be sequenced to determine the identity of
the bound ligands and then oligonucleotides may be made based on
the sequences but which include small variations. PCR may be used
to make small changes in the nucleotide coding sequences for the
ligands. This PCR mutagenesis can result in a mutation at any
position in the coding sequence. Diversification may also take
place by mutagenesis of a small subset of identified ligands. In
general diversified ligands will have at least 80%, 85%, 90%, 95%,
97% or 99% sequence identity at the nucleotide level to the
target-bound ligand. When the ligand is a peptide the diversified
peptide will have at least 80%, 85%, 90%, 95%, 97% or 99% amino
acid sequence identity to the identified target-bound peptide. The
diversified ligands may be exposed to one or more rounds of the
selective targeting method of the present invention. The
diversified ligands may be screened with other identified
target-bound ligands from which they were derived and assayed in
appropriate applications for which the ligands were originally
screened.
[0099] The selective targeting method of the current invention for
screening a library of ligands that bind to a target has wide
utility for many applications. In one particular application, the
selective targeting method described herein may be used to identify
ligands that bind to a target under harsh conditions. A harsh
condition may include but is not limited to acidic pH, high
temperature, and exposure to detergents, such as those found in
household laundry detergents. In this respect, one exemplary
application according to the invention is screening and
identification of a ligand, particularly a peptide, which is useful
in cleaning applications. Cleaning applications include but are not
limited to detergent compositions, stain removal compositions, and
textile treatment compositions. Particular stain targets include
human body soil stain, a porphyrin derived stain, a tannin derived
stain, a carotenoid pigment derived stain, an anthocyanin pigment
derived stain, a soil-based stain, or an oil-based stain.
Components of various cleaning compositions and particularly
detergent compositions, are well known in the art and are not
repeated herein in any detail. The compositions may include, but
are not limited to one or more of the following components;
surfactants, such as; anionic, nonioinc, cationic, amphoteric,
soaps and mixtures thereof; builders, such as; phosphate builders,
for example triphosphates, sodium aluminosilicate builders, for
example zeolites; organic builders, for example polycarboxylate
polymers; enzymes, such as proteases, cellulases, lipases and
others; enzyme-stabilizers; bleaching agents; dyes; masking agents;
softening agents; and others. Reference is made to the following
references U.S. Pat. Nos. 3,929,678; 4,760,025; 4,800,197;
5,011,681; and McCutheon's Detergents and Emulsifiers, North
American. Edition (1986) Allured Publishing Co.
[0100] In another particular application, selective targeting
according to the invention may be used to screen and identify a
ligand useful for therapeutic intervention. In this respect a
library of ligands may be screened to identify a tumor-bound
ligand. The tumor may be a carcinoma, sarcoma or melanoma. While
one skilled in the art could envisage any number of anti-targets
one preferred anti-target is a normal cell. Once a tumor-bound
ligand is identified the ligand may be used to prevent tumor cell
migration, tumor cell establishment and/or tumor cell growth in
vivo.
[0101] In yet another particular therapeutic intervention
application a library of ligands may be screened according to the
invention to identify a cytokine and in particular a TNF or a VEGF.
A cytokine-bound ligand may prevent the cytokine from binding with
its corresponding receptor. This inhibition could render the
cytokine inactive and inhibit downstream signal transduction that
controls various disease states. While one skilled in the art could
envisage any number of anti-targets, one preferred anti-target is
blood. Another preferred anti-target is the corresponding receptor
or an isoform.
[0102] In a further application, the selective targeting method
according to the invention may be used to identify ligands,
particularly peptides, useful in personal care applications for
example skin care or hair care.
[0103] In another application, the selective targeting method
according to the invention may be used to identify cell type
specific surface molecules. Preferred anti-targets include one or
more different cell types, cells in different states, or cells that
do not display the surface molecule.
[0104] The selective targeting method and the ligands identified
according to the method may be used in broad applications. In
addition to the applications discussed herein above, other
non-limiting applications, particularly for peptide ligands
include: 1) for mapping antibody epitopes; 2) in providing new
ligands for important binding molecules, such as enzymes and
hormone receptors; 3) in providing potential agricultural compounds
with pesticidial properties; 4) for developing new drug leads and
exploiting current leads; 5) identifying industrial catalysts; 6)
in identifying highly sensitive in vivo and in vitro diagnostic
agents; 7) for increasing the efficiency of enzyme catalysts by
binding metals and other cofactors; 8) for controlling protease
action in vivo; 9) to change inhibitory properties of targeted
proteins; 10) use in developing a targeted enzyme; 11) use in
selective delivery of gene therapy vectors to specific tissues or
cell types; and 12) use in drug delivery or targeted actives.
[0105] Accordingly, the following examples are offered by way of
illustration, and are not meant to limit the invention in any
manner. Those skilled in the art will recognize or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein.
EXAMPLES
[0106] The procedures for restriction digest, ligation, preparation
of competent cells using calcium chloride, preparation of 20 mg/ml
isopropyl (IPTG), preparation of 20 mg/ml
5-bromo-4-chloro-3-indolyl-.beta.-D-galac- toside (X-gal), and
preparation of phosphate-buffered saline (PBS) were according to
well-known methods in the art and can be found in Sambrook et al.
(1989) supra. Phage-displayed libraries (cyclic 7-mer, linear 7-mer
and linear 12-mer) were supplied by New England Biolabs ((NEB;
Beverly, Mass.). Restriction endonucleases Eagl and Acc65I,
10.times. NEBuffer 3, T4 DNA ligase, alkaline calf intestinal
phosphatase, E. coli ER2537 host strain, and M13KE gIII cloning
vector were supplied by NEB and used according to the
manufacturer's instructions unless stated otherwise. Taq
polymerase, 10.times.PCR Buffer, and dNTP mix were supplied by
Roche Molecular Biochemicals (Indianapolis, Ind.). PCR was carried
out using a HYBAID Omn-E Thermocycler from E&K Scientific
Products (Campbell, Calif.).
[0107] Both the QIAquick Gel Extraction Kit and QIAquick PCR
Purification Kit were obtained from QIAGEN (Valencia, Calif.).
AmpliWax.TM. PCR Gems were obtained from Perkin Elmer.
Phenol/chloroform extractions were carried out using Phase Lock
Gels.TM. I (light) from 5 Prime 3 Prime, Inc. (Boulder, Colo.).
Nondenaturing Polyacrylamide Gels (8%) and D-15 DNA Markers were
obtained from Novex (San Diego, Calif.).
Example 1
[0108] Selection of Phage-Peptides that Bind to Tumor Necrosis
Factor .alpha. (TNF-.alpha.) Using PCR for Identification of High
Affinity Phage-Peptide Clones:
[0109] A thin-walled PCR tube was coated with the target human
(h)TNF-.alpha. (BioSource International; Camarillo, Calif.) by
incubating 100 .mu.l of 0.5 mg/ml purified TNF-.alpha. in PBS
overnight at 4.degree. C. in the PCR tube. Excess unbound
TNF-.alpha. was removed, and the tube was coated overnight at
4.degree. C. with 100 .mu.l of SuperBlock.TM. blocking buffer
(Pierce: Rockford, Ill.) in Tris buffered saline (TBS). The
anti-target (SuperBlock.TM. blocking buffer) was prepared in
separate PCR tubes coated overnight at 4.degree. C. with 100 .mu.l
of SuperBlock.TM.. A phage-displayed 7-mer random peptide library
(10 .mu.l of 2.times.10.sup.13 plaque forming units (pfu)/ml) was
diluted in 50 .mu.l of PBS and incubated at 4.degree. C. with
shaking for 30 minutes in the anti-target PCR tube. The supernatant
was transferred to another anti-target PCR tube and this procedure
was repeated 3 times to greatly reduce the number of
phage-displayed peptides that bind to the anti-target.
[0110] The supernatant containing the phage-peptide library
(depleted of anti-target binders) was transferred to the target PCR
tube coated with TNF-.alpha. and incubated for 4 hours at 4.degree.
C. with shaking to allow the phage-displayed peptides to bind to
the target. Unbound phage were removed by washing the tube 5 times
with 150 .mu.l PBS containing 0.1% Tween-20 at room temperature.
Low affinity binders were washed away by incubating with 60 .mu.l
of 0.2 M Glycine (pH 2.2) for 6 minutes followed by neutralization
with 9 .mu.l 1M Tris-Cl (pH 9.1). The acid washed population was
retained for further analysis. The tube was then washed again 3
times with 150 .mu.l of PBS.
[0111] To the remaining phage-peptides bound to the TNF-.alpha., 54
.mu.l of Lysis Buffer A (10 mM Tris-Cl, pH 8.4, 0.1% Triton-X100)
and an AmpliWax.TM. PCR gem (Perkin Elmer, Norwalk, USA.) was
added. The tube was heated at 95.degree. C. for 15 min and then
allowed to cool. The following PCR reagents were then added:
1 10 mM dNTPs 2.5 .mu.l 50 .mu.M CMM13-01 primer 10 .mu.l 50 .mu.M
CMM13-02 primer 10 .mu.l 10X PCR Buffer 7.5 .mu.l Taq Polymerase (5
U/ml) 1 .mu.l
[0112] PCR amplification was performed using 20 cycles of
denaturation at 94.degree. C. for 15 sec, annealing at 55.degree.
C. for 20 sec, and extension at 72.degree. C. for 30 sec. The
sequences of the primers (synthesized by GIBCO BRL) were:
2 CMM13-01 5' CCTCGAAAGCAAGCTGATAAC 3' SEQ ID NO:1 CMM13-02 5'
CATTCCACAGACAACCCTCATAG 3' SEQ ID NO:2
[0113] The PCR product (267 base pairs (bp)) was analyzed on an 8%
polyacrylamide gel along with the PCR product from a single phage
peptide clone (positive control) and molecular weight markers (FIG.
2). A slower running product that appeared as a diffuse band was
observed at around 500-700 bp. This was due to too much template
(i.e. phage) in the PCR reaction, and can be alleviated by
decreasing the phage concentration or by decreasing the number of
PCR cycles (FIG. 3). To decrease the amount of the 500-700 bp
diffuse band, the PCR product was diluted appropriately for
subsequent PCR reactions from this starting material to generate
more products for sub-cloning purposes. Once the desired product
(267 bp) was amplified, it was digested with EagI and Acc65I
restriction endonucleases to produce a 45 bp fragment containing
the DNA coding for the random peptide. The 45 bp fragment was then
sub-cloned into the M13KE vector (New England Biolabs; Beverly,
Mass.) at the EagI and Acc65I restriction sites using standard
techniques (Sambrook, et al., (1989) supra). After ligating the 45
bp fragment into the M13KE vector, the ligation reaction was
transformed into chemically competent ER2537 E. coli cells. The
cells were made competent with calcium chloride using a standard
protocol (Sambrook, et al., (1989) supra). The M13 DNA was isolated
from various transformants using a modified protocol from New
England Biolab's protocol for M13 DNA preparation and then
sequenced. The modification includes the use of 96-well plates as
opposed to tubes. The corresponding peptide sequences are shown in
Table 1.
3TABLE 1 Amino Acid sequences that bind to TNF-alpha and not to
SuperBlock .TM. Clone Amino Acid ID Sequence Frequency.sup.a T1
RYWQDIP 8 SEQ ID NO:3 T2 APEPILA 7 SEQ ID NO:4 T3 DMIMVSI 3 SEQ ID
NO:5 T4 WTPKPTQ 2 SEQ ID NO:6 T5 ATFPNQS 2 SEQ ID NO:7 T6 ASTVGGL 2
SEQ ID NO:8 T7 TMLPYRP 2 SEQ ID NO:9 T8 AWHSPSV SEQ ID NO:10 T9
LTQSFSS SEQ ID NO:11 T10 THKNTLR SEQ ID NO:12 T11 GQTHFHV SEQ ID
NO:13 T12 LPILTQT SEQ ID NO:14 T13 SILPVSH SEQ ID NO:15 T14 LSQPIPI
SEQ ID NO:16 T15 QPLRKLP SEQ ID NO:17 .sup.aNumber of multiple
times this amino acid sequence occurred out of 24 clones
sequenced
Example 2
[0114] Characterization of Binding Affinity & Selectivity of
Phage-Peptides that Bind to TNF-.alpha.:
[0115] The binding and dissociation of phage clone A1, amino acid
sequence: RYWQDIP; Table 1, (SEQ ID NO: 3) to TNF-.alpha. was
monitored using an IAsys AutoPlus Biosensor following the
Labsystems Affinity Sensors IAsys Protocol 2.4 `Immobilization to
Protein Layer: Thiol coupling to avidin` (Thermo BioAnalysis Corp.
Franklin, Mass.). Two cuvettes were first coated with avidin and
one (the control) was then blocked with biotin. This was followed
by activation of the lysine groups. A 15 .mu.l aliquot of a 1 mg/ml
(h)TNF-.alpha. solution was added to each cuvette. No binding of
the protein to the surface was observed in the control cuvette, but
(h)TNF-.alpha. was clearly immobilized on the unblocked
avidin-coated cuvette (not shown). This complex was stable and did
not dissociate over a 10 minute time period. After blocking and
washing, phage clone A1, RYWQDIP (SEQ ID NO: 3) was added to give a
final titer of 5.times.10.sup.11 pfu/ml. As shown in FIG. 4, there
is significant binding of the phage to the TNF-.alpha. in the
sample cuvette, while very little phage bound to the control
cuvette.
[0116] The dissociation of the phage from the TNF-.alpha. is very
slow with the dissociation constant estimated as
k.sub.off<10.sup.-4 sec.sup.-1 (10 mM HEPES/0.05% Tween).
Washing with a 10.times. buffer concentrate (at the 70 min time
point) only removed a small portion of the phage. Additional washes
with 10 mM HCl failed to completely remove the phage peptide from
the target. Binding of phage-displayed peptide sequence RYWQDIP
(SEQ ID NO: 3) is specific since wild-type phage lacking the insert
did not bind to immobilized TNF.
Example 3
[0117] Selection of Phage-Peptides that Bind to IL-6 and IL-8:
[0118] Using the same method as described in Example 1, human IL-6
and IL-8 were used as targets and SuperBlock.TM. blocking buffer
was used as an anti-target. The PCR tubes were coated with
recombinant human IL-6 (0.1 mg/ml) and IL-8 (0.25 mg/ml) (Biosource
International). Selections yielded PCR bands of the expected size
(267 bp) even after acid elution of phage from the target (FIG.
2B).
Example 4
[0119] Selection of Phage-Peptides that bind to VEGF:
[0120] A sterile microtitre plate (5 wells/sample) was coated with
200 .mu.l 1% PBS/BSA (PBS+1% Bovine Serum Albumin) followed by
washing 3.times. with 200 .mu.l 0.25% PBST. The wells were left
filled. A library of phage peptides were deselected against whole
human blood as the anti-target by mixing 100 .mu.l fresh, whole
human blood with 10 .mu.l phage library, adding to the first coated
well, and incubating for 30 minutes at room temperature (RT).
Following 30 minutes, the solution was aspirated and delivered to
the next coated well. This procedure was repeated 4 times to
generate the library of anti-target non-binding phage. For the
target, 5 mg of 200 .mu.m polystyrene beads were coated with human
VEGF, by incubating with 100 .mu.l of 100 .mu.g/ml recombinant
human VEGF (Biosource International; Camarillo, Calif.) overnight
at 4.degree. C. with gentle agitation. Excess unbound VEGF was
removed by washing 3 times with PBST (0.25% Tween-20 in
1.times.PBS). The beads were then blocked with 2% Tween-20
a.times.PBST for two hours at room temperature (RT). A
phage-displayed cyclic 7-mer random peptide library was used. The
selection procedure is essentially the same as described in Example
1. After the first round of selection, the PCR fragment from the
target-bound ligand was purified, digested with EagI and Acc65I,
and the restriction enzymes were heat denatured. The fragments were
ligated directly into M13KE cut vector using the Takara ligation
Kit (Promega Corp). Ligation mixes were transformed, and amplified
according to standard procedures (Sambrook et al. (1989) supra). A
second round of selection was carried out to further enrich
phage-peptides that bind to VEGF. The corresponding peptide
sequences are shown in the following table:
4TABLE 2 Amino Acid seguences that bind to VEGF using selective
targeting Clone Amino Acid ID Sequence SEQ ID NO: V-1 CSKHSQITC SEQ
ID NO:79 V-2 CKTNPSGSC SEQ ID NO:80 V-3 CRPTGHSLC SEQ ID NO:81 V-4
CKHSAKAEC SEQ ID NO:82 V-5 CKPSSASSC SEQ ID NO:83 V-6 CPVTKRVHC SEQ
ID NO:84 V-7 CTLHWWVTC SEQ ID NO:85 V-8 CPYKASFYC SEQ ID NO:86 V-9
CPLRTSHTC SEQ ID NO:87 V-10 CEATPRDTC SEQ ID NO:88 V-11 CNPLHTLSC
SEQ ID NO:89 V-12 CKHERIWSC SEQ ID NO:90 V-13 CATNPPPMC SEQ ID
NO:91 V-14 CSTTSPNMC SEQ ID NO:92 V-15 CADRSFRYC SEQ ID NO:93 V-16
CPKADSKQC SEQ ID NO:94 V-17 CPNQSHLHC SEQ ID NO:95 V-18 CSGSETWMC
SEQ ID NO:96 V-19 CALSAPYSC SEQ ID NO:97 V-20 CKMPTSKVC SEQ ID
NO:98 V-21 CITPKRPYC SEQ ID NO:99 V-22 CKWIVSETC SEQ ID NO:100 V-23
CPNANAPSC SEQ ID NO:101 V-24 CNVQSLPLC SEQ ID NO:102
[0121] To compare the selective targeting method of the current
invention with the conventional biopanning method, a parallel
experiment using conventional acid-elution method was performed.
Three rounds of biopanning according to methods described by Smith
and Scott (1990) Science 249:386 yielded the sequence profiles
summarized in Table 3. These sequences do not overlap with the
sequences identified the selective targeting method according to
the current invention (Table 2).
5TABLE 3 Amino Acid sequences that bind VEGF using conventional
biopanning method Clone Amino Acid ID Sequence SEQ ID NO. BP 81
CYNLYGWTC SEQ ID NO:103 BP 82 CTLWPTFWC SEQ ID NO:104 BP 83
CNLWPHFWC SEQ ID NO:105 BP 84 CSLWPAFWC SEQ ID NO:106 BP 85
CSLWPHFWC SEQ ID NO:107 BP 86 CAPWNSHIC SEQ ID NO:108 BP 87
CAPWNLHIC SEQ ID NO:109 BP 96 CLPSWHLRC SEQ ID NO:110 BP 97
CPTILEWYC SEQ ID NO:111 BP 02 CTLYPQFWC SEQ ID NO:112 BP 04
CHLAPSAVC SEQ ID NO:113
Example 5
[0122] Selection of Phage-Peptides that Bind to Collar Soil:
[0123] Soiled shirt collars on cotton or 65% polyester:35% cotton
containing the target (collar soil) and anti-target EMPA 213
polyester cotton fabric (Test Fabrics, Freehold, N.J.)) were cut to
a diameter of {fraction (7/32)}" using a die with an expulsion to
fit an NAEF punch press (MS Instrument Company, Stony Creek, N.Y.).
A 96-well flat bottom microtiter plate (Costar, cat #3598) was
coated overnight with SuperBlock.TM. blocking buffer and then
washed with 200-250 .mu.l TBST (0.1% Tween-20) using an EL403 auto
plate washer (Bio-Tek Instruments, Winooski, Vt.). The fabric
pieces were placed in the wells and a 10 .mu.l stock solution of a
phage-peptide 12-mer library displayed on M13 filamentous phage was
added to 100 .mu.l of detergent (3.4 g/L European Detergent) in a
well containing polyester-cotton as the anti-target. After a
20-minute incubation, the supernatant containing unbound phage
(anti-target non-binders) was transferred to a second well
containing the polyester-cotton fabric. This was repeated once
more. The supernatant was then transferred to the well containing
the soiled shirt collar fabric, and the remaining phage peptide
population was selected for "stain binders" by incubation with the
stain for 10-60 min. The stain was subjected to a series of wash
steps with either TBST containing 0.1-2% Tween-20 or 3.4 g/L
detergent. The wash step can be manipulated toward the desired
stringency. After an initial wash in the original well containing
the stain, the stained fabric piece containing any remaining bound
phage was transferred to the next well for a second wash step.
[0124] A portion of the stained fabric containing the bound phage
was transferred to a PCR tube with 60 .mu.l of Lysis Buffer B (10
mM Tris-Cl, pH 8.4, 1% Triton-X100; 10 mM EDTA) and an AmpliWaX.TM.
PCR gem (Perkin Elmer, Norwalk, USA.). The tube was heated at
95.degree. C. for 20 min and then allowed to cool. PCR
amplification of target-bound phage was carried out as described in
Example 1 with minor modification. FIG. 3 shows amplification of a
single band of homoduplex DNA requires less than 20 PCR cycles
(lane 4). Longer cycle times (lane 3) yield substantial fractions
of heteroduplex DNA formation whereas shorter cycle times (lane 5)
do not yield measurable PCR products. The correct size PCR product
was gel purified on a 8% polyacrylamide gel, subcloned back into
M13KE and sequenced as described in Example 1. The amino acid
sequences corresponding to phage peptide clones that bind to collar
soils and not to polyester cotton fabric in detergent are
summarized in Table 4.
6TABLE 4 Amino Acid sequences that bind to collar soils and not to
polyester-cotton Clone Amino Acid ID Sequence Frequency.sup.a C1
HPASQTFTFTRT 2 SEQ ID NO:18 C2 NSDVLFKPYPMF 7 SEQ ID NO:19 C4
SISSTPRSYHWT 8 SEQ ID NO:20 C8 TPSTMPPSLPLR SEQ ID NO:21 C14
TPDKDTMSPPVP SEQ ID NO:22 C16 HLPVRITDWFHH SEQ ID NO:23 C19
EPILMRASPFRE SEQ ID NO:24 C20 ESSAFTALSGQP SEQ ID NO:25 C21
SSPNMITLLSSL SEQ ID NO:26 .sup.aNumber of multiple times this amino
acid sequence occurred out of 24 clones sequenced.
Example 6
[0125] Selective Binding of a Radiolabeled Peptide to Target Collar
Soils on Fabric:
[0126] Soiled shirt collars (cotton or 65% polyester:35% cotton)
containing the target (collar soil) and anti-target EMPA 213
polyester cotton (Test Fabrics, Freehold, N.J.)) were cut to a
diameter of 1/2" and placed into a Costar 24-well plate. The soil
targeting peptide SISSTPRSYHWT (SEQ ID NO: 20) identified according
to Example was N-terminally labeled with .sup.14C-glycine. 10 .mu.L
of a 400 .mu.M solution of [1-.sup.14C-G]SISSTPRSYHWT (SynPep,
Dublin, Calif.) (SEQ ID NO: 114) was added to 4 mL of 50 mM CAPS
buffer, pH 10.4, containing 0.002% Tween-20. 950 uL aliquots of the
radiolabled peptide were added to each well and samples were shaken
on a rotary shaker at 30.degree. C. for 30 minutes. Samples were
removed and washed with 4 mL of buffer, followed by 4 mL of milliQ
H.sub.2O for 20 min. Samples were air dried on Whatman filter
paper, and digitally scanned with an Hewlett Packard scanner (Palo
Alto, Calif.). The radioactively labeled swatches were then exposed
to a phosphor screen (Molecular Dynamics; Sunnyvale, Calif.) for 30
hours at -70.degree. C. The resulting phosphorimage was scanned
using a Molecular Dynamics Storm.RTM. system. FIG. 5 illustrates
the visual image of the target (stain) and anti-target along with
the corresponding phosphorimage of stained and control fabric. The
relative intensity of the phosphorimage was quantitated using the
ImageQuant.RTM. image analysis software (Molecular Dynamics;
Sunnyvale, Calif.) and shows that the selectivity ratio of stain
binding to fabric binding is >15:1.
Example 7
[0127] Demonstration of Slow k.sub.off Rate Constant for Release of
Stain Targeted Peptide:
[0128] Soiled shirt collars (65% polyester: 35% cotton) containing
the target (collar soil) and anti-target along with the control
anti-target (unstained polyester:cotton from the same shirt) were
cut to a diameter of {fraction (7/32)}" and placed into a 96-well
microtiter plate (Millipore Corp., 0.22 .mu.M Durapore membrane;
Cat. No. MAGV N22 50). Serial dilutions of a 400 .mu.M stock
solution of a soil targeting peptide SISSTPRSYHWT (SEQ ID NO: 20)
and a peptide control NFFPTWILPEHT (SEQ ID NO: 78) both terminally
labelled with .sup.14C-glycine were added to 1 g/L Tide detergent
solutions (Procter and Gamble, Cincinnati, Ohio) and 60 .mu.L
aliquots were placed into the wells of the microtiter plate. The
plate was incubated with shaking for 30 minutes at 32.degree. C.
followed by suction filtering of excess unbound radiolabeled
peptide (Vacuum manifold; Millipore Corp. Cat. No. MAVM 096 OR).
The samples were rinsed three times with 200 .mu.L of distilled
water, with shaking in between rinses, over a period of about 40
minutes. The remaining radioactivity bound to the samples was
quantitated by liquid scintillation counting in a Wallac microbeta
counter. FIG. 6A shows that greater than 50% of the total
radiolabel remains bound to the stained fabric for the stain
targeted peptide, even after rinsing for 40 minutes. This
corresponds to a rate constant for release of the soil targeting
peptide k.sub.off.ltoreq.2.times.10.sup.-4 sec.sup.-1. In contrast,
the control peptide shows no affinity or selectivity in the same
assay, FIG. 6B.
Example 8
[0129] Selectivity and affinity of Peptides for Acid Elution
Compared to the Selective Targeting Method of the Invention:
[0130] A phage peptide sequence HTFQHQWTHQTR, (SEQ ID NO: 27 ) that
binds to collar soil on cotton was identified after five rounds of
biopanning as described in example 5 except that phage peptides
were eluted by acid after each round using the methods described in
Scott and Smith (1990) Science 249:386: The selectivity (stain vs.
cotton binding) and affinity (k.sub.off) were measured for the
corresponding peptide binding to collar soil as follows: A 1 mM
solution of Ni chelated GGHTFQHQWTHQTR (SEQ ID NO: 28) was
incubated with collar soil on cotton or cotton alone for 90 minutes
at room temperature with shaking in a microtiter plate. A control
peptide chelate Ni GGH was also tested under the same conditions.
After pipeting off the incubation solution from the well, fabric
swatches were rinsed in 200 .mu.L water with shaking for 3 minutes.
The residual bound peptide was assayed by adding 200 .mu.L
o-phenylenediamine (OPD) and 50 uL of 100 mM H.sub.2O.sub.2 and
measuring the absorbance of the oxidized OPD at 420 nm. As
summarized in Table 5 and FIG. 7, the selectivity ratio of stain
binding to fabric is less than or equal to .ltoreq.3:1 and the
affinity as measured by k.sub.off=1.times.10.sup.-3 sec.sup.-1.
These data demonstrate specific and selective tight binding
peptides are preferably identified using the selective targeting
methods according to the present invention.
7TABLE 5 Summary of Collar Soil Binding Peptide Selectivity and
Affinity Selec- Affinity Method of Rounds of tivity 10.sup.-4
Sequence identification Selection Ratio k.sub.off(sec.sup.-1)
GSISSTPRSYHWT Selective 1 >15:1 .ltoreq.2 SEQ ID NO: 114
Targeting (PCR) GGHTFQHQWTHQTR Biopanning 5 .ltoreq.3:1 10 SEQ ID
NO: 28
Example 9
[0131] Stability of Phage Displayed Libraries in a Detergent
Matrix:
[0132] To examine the effect of household laundry detergents on the
stability of phage peptide libraries, a stock solution of a peptide
12-mer library displayed on M13 filamentous phage (New England
Biolabs, Beverly Mass., USA) containing 10.sup.13 pfu/mL was
diluted to 10.sup.12 pfu/mL in a) 100 mM Tris HCl, pH 7.5, 0.1%
Tween-20 (TBST control) b) 0.7 g/L of Ariel Futur (Procter &
Gamble, Cincinnati, Ohio) containing 3 grams per gallon (gpg)
hardness, and c) 3.4 g/L of Ariel Futur containing 15 gpg hardness.
Aliquots (100 .mu.L) were added to the wells of a 96-well flat
bottom microtiter plate (Costar, cat #3598) that was blocked with
Superblock blocking buffer in TBS (Pierce, cat #37535). The samples
were incubated at 25.degree. C. with gentle rocking for 90 minutes.
10 .mu.L aliquots were removed and serially diluted into Luria
Broth for phage titering according to standard procedures (Kay et
al., (1996) supra). No loss in phage titer was observed in
detergent solution, relative to the control phage library in
TBST.
Example 10
[0133] Selection of Phage-Peptides that Bind to Polyurethane and
Not to Cotton, Polyester, or Polyester-Cotton Fabrics.
[0134] 1.5 mL microfuge tubes were blocked overnight with Blocking
buffer-PBS, washed with 1 mL 3.4 g/L detergent and drained. 500
.mu.L 3.4 g/L detergent was added to 4 tubes, along with one piece
each cotton, polycotton, and polyester fabric. Phage peptide
libraries were added as follows:
8 Tube 1 10 .mu.L Ph.D.-C7C library Tube 2 10 .mu.L Ph.D.-12
library Tube 3 10 .mu.L wild-type phage control Tube 4 no phage
control
[0135] The tubes were incubated at room temperature for 20 minutes
at 1000 rpm in an Eppendorf thermomixer and fabric pieces were
removed. This deselection step was repeated at total of 3 times,
followed by incubation of the phage libraries with a polyurethane
plug wetted by squeezing with a clean pipet tip for 30 minutes.
[0136] The supernatant was aspirated from the plugs using a clean
pipet tip attached to a vacuum line and 1 mL of 3.4 g.L detergent
solution was added to the tube. The plug was rewetted by squeezing
with clean inoculation loop, and tubes were placed in the Eppendorf
thermomixer for a total of 10 washes. Plugs were transferred to
clean 100 mL disposable filter systems(Corning) and 3.times.40 mL
PBST (0.25% v/v Tween-20) washes were performed by delivering the
wash solution to the filter system. Plugs were rewetted by
squeezing with a clean pipet tip, incubated momentarily with the
PBST, then dried by aspiration. Ten 1 mL PBS washes were performed
by pipeting wash solution directly onto the plug while the filter
system was under vacuum.
[0137] The plugs were transferred to clean 0.5 mL microfuge tubes.
100 .mu.L lysis buffer (0.1% Triton X-100, 10 mM Tris pH 8.4) was
added, and the tubes were incubated at 95.degree. C. for 20 minutes
to lyse the phage. Lysed phage were PCRed in the same tube as
follows:
[0138] 50 .mu.L HotStarTaq.RTM. master mix (QIAGEN)
[0139] 25 .mu.L lysis buffer
[0140] 5 .mu.L BSA (10 .mu.g/.mu.L)
[0141] 1.25 .mu.L CMM13-01 primer (50 .mu.M)
[0142] 1.25 .mu.L CMM13-02 primer (50 .mu.M)
[0143] 17.5 .mu.L H.sub.2O
[0144] PCR amplification was performed using 30 cycles of
denaturation at 95.degree. C. for 15 sec, annealing at 58.degree.
C. for 30 sec, and extension at 72.degree. C. for 30 sec followed
by a single cycle at 72.degree. C. for 5 min. PCR products were
cloned into the TOPO.RTM.-10 vector (Invitrogen, San Diego, Calif.)
by zero blunt cloning according to the manufacturer's instructions.
Clones were sequenced using standard sequencing methods and
summarized in Table 6.
9TABLE 6 Amino Acid sequences that bind to polyurethane and not to
fabrics Clone Amino Acid ID Sequence P39 HPSWAPVSSTLR SEQ ID NO:29
P40 STPHQPCATAPH SEQ ID NO:30 P41 LDQILTSSRIWP SEQ ID NO:31 P42
HYLKNVEATGPR SEQ ID NO:32 P43 SSRMYPSPDSFM SEQ ID NO:33 P44
SMATQLQGNITM SEQ ID NO:34 P45 YMHASLMWAFG SEQ ID NO:35 P46
KALPPNSTLSRA SEQ ID NO:36 P47 LELPNNIQSITS SEQ ID NO:37 P48
QVFHIAGVRDQV SEQ ID NO:38 P49 REPAPSCTTTCL SEQ ID NO:39 P50
YPHHPRLHYTFS SEQ ID NO:40 P52 KVTEFQKAHCSS SEQ ID NO:41 P53
GITLHNTMVPWT SEQ ID NO:42 P54 EAGLSPTRPYMF SEQ ID NO:43 P56
SHHTHYGQPGPV SEQ ID NO:44 P57 FYPSPSTAKMWR SEQ ID NO:45 P58
SGFQSAYAFPYS SEQ ID NO:46 P59 MVSQPDPRATLR SEQ ID NO:47 P61
IKSKILIPXSAP SEQ ID NO:48 P62 TNVSTQNIVQPL SEQ ID NO:49
[0145] Peptide sequences were synthesized and the ability of the
peptides to protect against polyurethane oxidation was
determined.
Example 11
[0146] Selective Binding of a Peptide Selected to Target Baked-On
Egg Soil on Stainless Steel or Glass:
[0147] Egg soil was prepared by using the yolks from fresh eggs.
The yolks were rinsed in cold water, then forced through a strainer
into a beaker. The beaker was placed into a 140.degree. F. water
bath, and the egg yolk cooked for 30 minutes with constant
stirring. After 30 minutes, the beaker was placed into an ice bath
to cool the yolks to room temperature with constant stirring. #316
Stainless steel foil disks were cut to a diameter of {fraction
(7/32)}" using a die with an expulsion to fit an NAEF punch press
(MS Instrument Company, Stony Creek, N.Y.). These were used as both
the substrate for the target, baked-on egg soil, and the
anti-target, unsoiled disks. Before use, the disks were washed in
mild detergent, and rinsed thoroughly in deionized water.
[0148] Egg soiled 316 stainless steel disks and egg soiled glass
beads were placed into a Costar 96-well flat bottom plate. For each
peptide library, three clean stainless steel (SS) disks or glass
beads (anti-targets) were placed into adjacent wells in a 96 well
plate. An egg soiled (target) disk or bead was placed in the
adjacent well. Into the first well (A) containing a clean disk or
bead was added 150 .mu.L detergent and 10 .mu.L phage library--C7C,
linear 7-mer, or wild type phage. The samples were incubated at
room temp for 20 min with gentle agitation and the supernatant
containing unbound phage peptides was transferred to the next well
and the process repeated a total of three times. The supernatant
was then transferred to the egg soiled coupon or bead and incubated
for 30 minutes with gentle mixing. The samples were then
transferred to a fresh well and washed a total of 38 times as
follows: 3.times. in 200 .mu.L detergent solution, 3.5 g/l powder
automatic dishwashing detergent, 30.times. in 250 .mu.L PBST, and
5.times. in 200 .mu.L PBS.
[0149] The washed disks or glass beads were transferred to a 0.5 mL
PCR tube. The PCR reaction was run directly on the egg soiled disks
or beads using 200 .mu.L of reaction mixture using the Qiagen
HotStart.RTM. kit and 50 .mu.L of mineral oil. PCR amplification
was performed using 1 cycle at 95.degree. C. for 15 min to initiate
the reaction, followed by 30 cycles of denaturation at 94.degree.
C. for 30 sec, annealing at 58.degree. C. for 30 sec, and extension
at 72.degree. C. for 30 sec, and concluding with 1 cycle for 10 min
at 72.degree. C. for elongation. The 278 bp product as analyzed on
an 2% agarose gel along with molecular weight markers. As shown in
FIG. 8 for stainless steel as the anti-target, a PCR product is
visible for the linear 7-mer library, and there was no visible
signal for wild-type (WT) phage control. A second PCR amplification
was conducted and the PCR product was cloned into a TOPO.RTM. TA
vector (Invitrogen) for sequencing as summarized in Table 7.
10TABLE 7 Amino Acid sequences that bind to egg-soil on stainless
steel and not to stainless steel Clone Amino Acid ID Sequence
Frequency.sup.a E1 LSPHLAR 4 SEQ ID NO:50 E2 THRPDWD 3 SEQ ID NO:51
E3 APKSFKT 2 SEQ ID NO:52 E4 AYSQWKY 2 SEQ ID NO:53 E5 DFSPQLD 2
SEQ ID NO:54 E6 GLFEWRV 2 SEQ ID NO:55 E7 ILNHPPN 2 SEQ ID NO:56 E8
LNQKNVT 2 SEQ ID NO:57 E9 LPSEFLR 2 SEQ ID NO:58 E10 MPGATSL 2 SEQ
ID NO:59 E11 QMSAQWR 2 SEQ ID NO:60 E12 SNTAIWR 2 SEQ ID NO:61 E13
TASPMPL 2 SEQ ID NO:62 E14 VALPTLT 2 SEQ ID NO:63 .sup.aNumber of
multiple times this amino acid sequence occurred out of 118
clones
[0150] The sequences were cloned into a subtilisin protease gene
and the affinity for egg soil was determined in a proteolytic
assay.
Example 12
[0151] Specific and selective Binding of a Selected Peptide to
Target Tea Stains on Ceramic:
[0152] Using the methods described in Example 1, peptides that bind
to tea on ceramic in the presence of automatic dishwashing
detergent were identified after two rounds of selective targeting.
The target bound peptide sequences are summarized in Table 8.
11TABLE 8 Amino Acid sequences that bind to tea on ceramic Clone
Amino Acid ID Sequence T1 LDYKHDL SEQ ID NO:64 T2 SAAADYL SEQ ID
NO:65 T3 TPGPLFL SEQ ID NO:66 T4 DXQDNIW SEQ ID NO:67 T5 MPQPSSM
SEQ ID NO:68 T6 LTITIQE SEQ ID NO:69 T7 XPGPLFL SEQ ID NO:70 T8
TNFATXL SEQ ID NO:71 T9 DARNALF SEQ ID NO:72 T10 WTSLISN SEQ ID
NO:73 T11 ACWLRPXLHC SEQ ID NO:74 T12 NLSSSNKHAVGN SEQ ID NO:75 T13
YVHRPNA SEQ ID NO:76 T14 GSYDPKEFHHPQ SEQ ID NO:77
Example 13
[0153] Screening for Peptides Selected to Target Human Skin and Not
Hair:
[0154] Two 3 inch strands of dark human hair (International Hair
Importers & Products, White Plains, N.Y.) were placed in BSA
blocked 50 ml conical tubes containing 10 ml of a 2%
Neutrogena.RTM. body wash (Neutrogena Corp.) solution in DI water.
10 .mu.L of cyclic 7-mer or linear 12-mer peptide libraries
(10.sup.10 pfu/.mu.l), or wild type phage (10.sup.9 pfu/.mu.l) were
added and the samples mixed at room temperature for 15 min with
rotatory shaking (30 rpm). The unbound supernatent was transferred
to a new tube containing an additional two 3 inch strands of dark
hair, and incubated at room temperature for 15 min with rotary
shaking. After this second hair incubation, 500 .mu.l of the
solution was transferred to the surface of human skin tissues
(EpiDerm.TM., MatTek Corp. Ashland, Mass.) in a 6 well culture
plate containing 0.9 mL tissue culture media (MatTek Corp) for 30
minutes at room temperature with gentle agitation. The skin tissues
were removed and washed 2.times. in 50 mls of 2% body wash for 5
min each and 3.times. in 50 mls of PBS for 5 min each in blocked 50
mL conical tubes. After the final PBS wash, the skin tissues were
frozen at -20.degree. C. followed by PCR of the target bound ligand
phage.
Example 14
[0155] Screening for Peptides Selected to Target Human Hair and Not
Skin:
[0156] Pre-equilbrated skin tissues were placed into a 6 well
culture plate containing fresh 0.9 mL tissue culture media and 300
.mu.l of a 2% Neutrogena.RTM. body wash containing, 10 .mu.L of
cyclic 7-mer or linear 12-mer peptide libraries (10.sup.10
pfu/.mu.l), or wild type phage (10.sup.9 pfu/.mu.l) were added to
the skin surface. The samples were incubated at room temperature
for 15 min with gentle agitation. The unbound supernatent was
transferred to a new well containing skin tissue and the procedure
was repeated. The incubation solution was transferred to nine 3
inch dark hair (International Hair Importers & Products, White
Plains, N.Y.) strands in 50 ml tubes containing 10 ml of 2% body
wash for 30 minutes at room temperature with rotatory shaking (30
rpm). The hair samples were then washed with 1.times.50 mls,
2.times.50 mls, or 4.times.50 mls of 2% body wash; Wash cycles in
PBS followed (1.times.25 mis for 5 min, 1.times.25 mls for 2 min,
2.times.50 mls for 5 min each, 150 mls total). After the final PBS
wash the hair samples containing bound phage peptides were frozen
at -20.degree. C. PCR amplification of target-bound phage was
carried out as described in Example 1 with minor modifications. PCR
reactions contained 50 .mu.g of BSA to prevent inhibition of the
PCR reactions by hair or skin.
Example 15
[0157] ELISA Assay for Selective Binding of Peptides that Target
Human Hair and Not Skin or Target Skin and Not Hair.
[0158] Peptide sequences identified in Examples 13 and 14 along
with a random control peptide were C-terminally labeled with the
sequence GGGK (biotin). The sequence LESTPKMK (SEQ ID NO: 115)
contains the consensus sequence LEST and was isolated on hair.
FTQSLPR (SEQ ID NO: 116) contains the consensus sequence TQSL and
was isolated on skin. YGGFMTSE (SEQ ID NO: 117) is a control
peptide.
[0159] Dark brown hair (3" long, 4 each), moistened with 2% body
wash and pre-equilibrated human skin tissues, were placed in the
wells of a 24 well plate. 1 ml of a 200 .mu.M solution of the
biotinylated peptide in 2% Neutrogena body wash was added to the
hair and skin samples and incubated 30 min at room temperature with
gentle agitation. The solution was then pipetted off and the hair
and skin samples transferred with clean tweezers to a 50 ml conical
tube, washed once with 50 ml of 2% body wash, twice with 50 ml of
water, and once with 50 ml of PBS; each wash step took 5 min and
was performed on a rotary shaker at 20 rpm. The hair and skin
samples were then transferred with clean tweezers to a fresh 24
well plate where 1 ml of streptavidin conjugated horseradish
peroxidase (diluted 1/1000 in PBS) was added for 1 hr at room
temperature under gentle rocking. Excess streptavidin HRP was
removed by washing twice with 50 ml of PBS (5 min, 20 rpm each) in
a 50 mL conical tube. The hair and skin samples were transferred to
fresh wells and 1 ml of H.sub.2O.sub.2/OPD solution was added and
the color left to develop at room temperature. FIG. 9 shows that
peptide binding is selective for the respective targets, relative
to the control peptide.
Sequence CWU 1
1
117 1 21 DNA Artificial Sequence primer 1 cctcgaaagc aagctgataa c
21 2 23 DNA Artificial Sequence primer 2 cattccacag acaaccctca tag
23 3 7 PRT Artificial Sequence peptides screened from a phage
display random peptide library 3 Arg Tyr Trp Gln Asp Ile Pro 1 5 4
7 PRT Artificial Sequence peptides screened from a phage display
random peptide library 4 Ala Pro Glu Pro Ile Leu Ala 1 5 5 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 5 Asp Met Ile Met Val Ser Ile 1 5 6 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 6 Trp Thr Pro Lys Pro Thr Gln 1 5 7 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 7 Ala Thr Phe Pro Asn Gln Ser 1 5 8 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 8 Ala Ser Thr Val Gly Gly Leu 1 5 9 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 9 Thr Met Leu Pro Tyr Arg Pro 1 5 10 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 10 Ala Trp His Ser Pro Ser Val 1 5 11 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 11 Leu Thr Gln Ser Phe Ser Ser 1 5 12 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 12 Thr His Lys Asn Thr Leu Arg 1 5 13 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 13 Gly Gln Thr His Phe His Val 1 5 14 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 14 Leu Pro Ile Leu Thr Gln Thr 1 5 15 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 15 Ser Ile Leu Pro Val Ser His 1 5 16 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 16 Leu Ser Gln Pro Ile Pro Ile 1 5 17 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 17 Gln Pro Leu Arg Lys Leu Pro 1 5 18 12 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 18 His Pro Ala Ser Gln Thr Phe Thr Phe Thr Arg Thr
1 5 10 19 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 19 Asn Ser Asp Val Leu Phe Lys Pro
Tyr Pro Met Phe 1 5 10 20 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 20 Ser Ile Ser
Ser Thr Pro Arg Ser Tyr His Trp Thr 1 5 10 21 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 21 Thr Pro Ser Thr Met Pro Pro Ser Leu Pro Leu Arg 1 5 10
22 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 22 Thr Pro Asp Lys Asp Thr Met Ser
Pro Pro Val Pro 1 5 10 23 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 23 His Leu Pro
Val Arg Ile Thr Asp Trp Phe His His 1 5 10 24 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 24 Glu Pro Ile Leu Met Arg Ala Ser Pro Phe Arg Glu 1 5 10
25 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 25 Glu Ser Ser Ala Phe Thr Ala Leu
Ser Gly Gln Pro 1 5 10 26 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 26 Ser Ser Pro
Asn Met Ile Thr Leu Leu Ser Ser Leu 1 5 10 27 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 27 His Thr Phe Gln His Gln Trp Thr His Gln Thr Arg 1 5 10
28 14 PRT Artificial Sequence peptides screened from a phage
display random peptide library 28 Gly Gly His Thr Phe Gln His Gln
Trp Thr His Gln Thr Arg 1 5 10 29 12 PRT Artificial Sequence
peptides screened from a phage display random peptide library 29
His Pro Ser Trp Ala Pro Val Ser Ser Thr Leu Arg 1 5 10 30 12 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 30 Ser Thr Pro His Gln Pro Cys Ala Thr Ala Pro His
1 5 10 31 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 31 Leu Asp Gln Ile Leu Thr Ser Ser
Arg Ile Trp Pro 1 5 10 32 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 32 His Tyr Leu
Lys Asn Val Glu Ala Thr Gly Pro Arg 1 5 10 33 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 33 Ser Ser Arg Met Tyr Pro Ser Pro Asp Ser Phe Met 1 5 10
34 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 34 Ser Met Ala Thr Gln Leu Gln Gly
Asn Ile Thr Met 1 5 10 35 11 PRT Artificial Sequence peptides
screened from a phage display random peptide library 35 Tyr Met His
Ala Ser Leu Met Trp Ala Phe Gly 1 5 10 36 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 36 Lys Ala Leu Pro Pro Asn Ser Thr Leu Ser Arg Ala 1 5 10
37 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 37 Leu Glu Leu Pro Asn Asn Ile Gln
Ser Ile Thr Ser 1 5 10 38 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 38 Gln Val Phe
His Ile Ala Gly Val Arg Asp Gln Val 1 5 10 39 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 39 Arg Glu Pro Ala Pro Ser Cys Thr Thr Thr Cys Leu 1 5 10
40 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 40 Tyr Pro His His Pro Arg Leu His
Tyr Thr Phe Ser 1 5 10 41 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 41 Lys Val Thr
Glu Phe Gln Lys Ala His Cys Ser Ser 1 5 10 42 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 42 Gly Ile Thr Leu His Asn Thr Met Val Pro Trp Thr 1 5 10
43 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 43 Glu Ala Gly Leu Ser Pro Thr Arg
Pro Tyr Met Phe 1 5 10 44 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 44 Ser His His
Thr His Tyr Gly Gln Pro Gly Pro Val 1 5 10 45 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 45 Phe Tyr Pro Ser Pro Ser Thr Ala Lys Met Trp Arg 1 5 10
46 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 46 Ser Gly Phe Gln Ser Ala Tyr Ala
Phe Pro Tyr Ser 1 5 10 47 12 PRT Artificial Sequence peptides
screened from a phage display random peptide library 47 Met Val Ser
Gln Pro Asp Pro Arg Ala Thr Leu Arg 1 5 10 48 12 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 48 Ile Lys Ser Lys Ile Leu Ile Pro Xaa Ser Ala Pro 1 5 10
49 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 49 Thr Asn Val Ser Thr Gln Asn Ile
Val Gln Pro Leu 1 5 10 50 7 PRT Artificial Sequence peptides
screened from a phage display random peptide library 50 Leu Ser Pro
His Leu Ala Arg 1 5 51 7 PRT Artificial Sequence peptides screened
from a phage display random peptide library 51 Thr His Arg Pro Asp
Trp Asp 1 5 52 7 PRT Artificial Sequence peptides screened from a
phage display random peptide library 52 Ala Pro Lys Ser Phe Lys Thr
1 5 53 7 PRT Artificial Sequence peptides screened from a phage
display random peptide library 53 Ala Tyr Ser Gln Trp Lys Tyr 1 5
54 7 PRT Artificial Sequence peptides screened from a phage display
random peptide library 54 Asp Phe Ser Pro Gln Leu Asp 1 5 55 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 55 Gly Leu Phe Glu Trp Arg Val 1 5 56 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 56 Ile Leu Asn His Pro Pro Asn 1 5 57 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 57 Leu Asn Gln Lys Asn Val Thr 1 5 58 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 58 Leu Pro Ser Glu Phe Leu Arg 1 5 59 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 59 Met Pro Gly Ala Thr Ser Leu 1 5 60 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 60 Gln Met Ser Ala Gln Trp Arg 1 5 61 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 61 Ser Asn Thr Ala Ile Trp Arg 1 5 62 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 62 Thr Ala Ser Pro Met Pro Leu 1 5 63 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 63 Val Ala Leu Pro Thr Leu Thr 1 5 64 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 64 Leu Asp Tyr Lys His Asp Leu 1 5 65 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 65 Ser Ala Ala Ala Asp Tyr Leu 1 5 66 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 66 Thr Pro Gly Pro Leu Phe Leu 1 5 67 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 67 Asp Xaa Gln Asp Asn Ile Trp 1 5 68 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 68 Met Pro Gln Pro Ser Ser Met 1 5 69 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 69 Leu Thr Ile Thr Ile Gln Glu 1 5 70 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 70 Xaa Pro Gly Pro Leu Phe Leu 1 5 71 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 71 Thr Asn Phe Ala Thr Xaa Leu 1 5 72 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 72 Asp Ala Arg Asn Ala Leu Phe 1 5 73 7 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 73 Trp Thr Ser Leu Ile Ser Asn 1 5 74 10 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 74 Ala Cys Trp Leu Arg Pro Xaa Leu His Cys 1 5 10
75 12 PRT Artificial Sequence peptides screened from a phage
display random peptide library 75 Asn Leu Ser Ser Ser Asn Lys His
Ala Val Gly Asn 1 5 10 76 7 PRT Artificial Sequence peptides
screened from a phage display random peptide library 76 Tyr Val His
Arg Pro Asn Ala 1 5 77 12 PRT Artificial Sequence peptides screened
from a phage display random peptide library 77 Gly Ser Tyr Asp Pro
Lys Glu Phe His His Pro Gln 1 5 10 78 12 PRT Artificial Sequence
peptides screened from a phage display random peptide library 78
Asn Phe Phe Pro Thr Trp Ile Leu Pro Glu His Thr 1 5 10 79 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 79 Cys Ser Lys His Ser Gln Ile Thr Cys 1 5 80 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 80 Cys Lys Thr Asn Pro Ser Gly Ser Cys 1 5 81 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 81 Cys Arg Pro Thr Gly His Ser Leu Cys 1 5 82 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 82 Cys Lys His Ser Ala Lys Ala Glu Cys 1 5 83 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 83 Cys Lys Pro Ser Ser Ala Ser Ser Cys 1 5 84 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 84 Cys Pro Val Thr Lys Arg Val His Cys 1 5 85 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 85 Cys Thr Leu His Trp Trp Val Thr Cys 1 5 86 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 86 Cys Pro Tyr Lys Ala Ser Phe Tyr Cys 1 5 87 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 87 Cys Pro Leu Arg Thr Ser His Thr Cys 1 5 88 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 88 Cys Glu Ala Thr Pro Arg Asp Thr Cys 1 5 89 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 89 Cys Asn Pro Leu His Thr Leu Ser Cys 1 5 90 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 90 Cys Lys His Glu Arg Ile Trp Ser Cys 1 5 91 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 91 Cys Ala Thr Asn Pro Pro Pro Met Cys 1 5 92 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 92 Cys Ser Thr Thr Ser Pro Asn Met Cys 1 5 93 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 93 Cys Ala Asp Arg Ser Phe Arg Tyr Cys 1 5 94 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 94 Cys Pro Lys Ala Asp Ser Lys Gln Cys 1 5 95 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 95 Cys Pro Asn Gln Ser His Leu His Cys 1 5 96 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 96 Cys Ser Gly Ser Glu Thr Trp Met Cys 1 5 97 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 97 Cys Ala Leu Ser Ala Pro Tyr Ser Cys 1 5 98 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 98 Cys Lys Met Pro Thr Ser Lys Val Cys 1 5 99 9 PRT
Artificial Sequence peptides screened from a phage display random
peptide library 99 Cys Ile Thr Pro Lys Arg Pro Tyr Cys 1 5 100 9
PRT Artificial Sequence peptides screened from a phage display
random peptide library 100 Cys Lys Trp Ile Val Ser Glu Thr Cys 1 5
101 9 PRT Artificial Sequence peptides screened from a phage
display random peptide library 101 Cys Pro Asn Ala Asn Ala Pro Ser
Cys 1 5 102 9 PRT Artificial Sequence peptides screened from a
phage display random peptide library 102 Cys Asn Val Gln Ser Leu
Pro Leu Cys 1 5 103 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 103 Cys Tyr Asn Leu Tyr
Gly Trp Thr Cys 1 5 104 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 104 Cys Thr Leu Trp Pro
Thr Phe Trp Cys 1 5 105 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 105 Cys Asn Leu Trp Pro
His Phe Trp Cys 1 5 106 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 106 Cys Ser Leu Trp Pro
Ala Phe Trp Cys 1 5 107 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 107 Cys Ser Leu Trp Pro
His Phe Trp Cys 1 5 108 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 108 Cys Ala Pro Trp Asn
Ser His Ile Cys 1 5 109 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 109 Cys Ala Pro Trp Asn
Leu His Ile Cys 1 5 110 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 110 Cys Leu Pro Ser Trp
His Leu Arg Cys 1 5 111 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 111 Cys Pro Thr Ile Leu
Glu Trp Tyr Cys 1 5 112 9 PRT Artificial Sequence peptides screened
from a phage display random peptide library 112 Cys Thr
Leu Tyr Pro Gln Phe Trp Cys 1 5 113 9 PRT Artificial Sequence
peptides screened from a phage display random peptide library 113
Cys His Leu Ala Pro Ser Ala Val Cys 1 5 114 13 PRT Artificial
Sequence peptides screened from a phage display random peptide
library 114 Gly Ser Ile Ser Ser Thr Pro Arg Ser Tyr His Trp Thr 1 5
10 115 8 PRT Artificial Sequence peptides screened from a phage
display random peptide library 115 Leu Glu Ser Thr Pro Lys Met Lys
1 5 116 7 PRT Artificial Sequence peptides screened from a phage
display random peptide library 116 Phe Thr Gln Ser Leu Pro Arg 1 5
117 8 PRT Artificial Sequence peptides screened from a phage
display random peptide library 117 Tyr Gly Gly Phe Met Thr Ser Glu
1 5
* * * * *