U.S. patent application number 10/958377 was filed with the patent office on 2005-05-26 for detection system.
This patent application is currently assigned to The Secretary of State for Defence. Invention is credited to Fuerst, Roderick, Lee, Martin A..
Application Number | 20050112647 10/958377 |
Document ID | / |
Family ID | 10822794 |
Filed Date | 2005-05-26 |
United States Patent
Application |
20050112647 |
Kind Code |
A1 |
Lee, Martin A. ; et
al. |
May 26, 2005 |
Detection system
Abstract
A method for detecting the presence of a target nucleic acid
sequence in a sample, said method comprising: (a) adding to a
sample suspected of containing said target nucleic acid sequence, a
probe specific for said target sequence and DNA duplex binding
agent, said probe comprising a reactive molecule able to absorb
fluorescence from or donate fluorescent energy to said DNA duplex
binding agent, (b) subjecting the thus formed mixture to an
amplification reaction in which target nucleic acid is amplified,
(c) subjecting said sample to conditions under which the said probe
hybridizes to the target sequence, and (d) monitoring fluorescence
from said sample. This method can be used for example to monitor
amplification reactions such as PCR reactions, such that the amount
of target sequence present in the sample may be determined.
Additionally or alternatively, it may be used to generate duplex
destabilization data such as melt hysteresis information for
amplification monitoring or for detection and quantitation of
polymorphisms or allelic variation, and so is useful in genetic
diagnosis.
Inventors: |
Lee, Martin A.; (Salisbury,
GB) ; Fuerst, Roderick; (Kimbolton, GB) |
Correspondence
Address: |
NIXON & VANDERHYE, PC
1100 N GLEBE ROAD
8TH FLOOR
ARLINGTON
VA
22201-4714
US
|
Assignee: |
The Secretary of State for
Defence
Hampshire
GB
|
Family ID: |
10822794 |
Appl. No.: |
10/958377 |
Filed: |
October 6, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10958377 |
Oct 6, 2004 |
|
|
|
09555123 |
May 25, 2000 |
|
|
|
6833257 |
|
|
|
|
09555123 |
May 25, 2000 |
|
|
|
PCT/GB98/03560 |
Nov 27, 1998 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
C12Q 1/6818 20130101;
Y10S 436/80 20130101; Y10T 436/143333 20150115; C12Q 1/6823
20130101; C12Q 1/6818 20130101; C12Q 2563/107 20130101; C12Q
2561/113 20130101; C12Q 2527/107 20130101; C12Q 1/6818 20130101;
C12Q 2563/173 20130101; C12Q 2563/107 20130101; C12Q 2527/107
20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 29, 1997 |
GB |
9725197.9 |
Claims
We claim:
1. A method for determining a characteristic of a sequence, said
method comprising: (a) adding to a sample suspected of containing
said sequence, a probe specific for said target sequence DNA duplex
binding agent, said probe comprising a reactive molecule able to
absorb fluorescence from or donate fluorescent energy to said DNA
duplex binding agent; (b) subjecting said sample to conditions
under which the said probe hybridises to the said sequence; (c)
monitoring fluorescence from said sample and determining a
particular reaction condition, characteristic of said sequence, at
which fluorescence changes as a result of the hybridisation of the
probe to the sample of destabilisation of the duplex formed between
the probe and the target nucleic acid sequence.
2. A method according to claim 1 wherein the reaction condition
characteristic of said sequence is temperature, electrochemical
potential, or reaction with an enzyme or chemical.
3. A method according to claim 2 wherein the condition is
temperature.
4. A method according to any of claims 1 to 3 wherein the results
obtained from two sequences are compared in order to determine the
presence of polymorphisms or variations there between.
5. A method according to any one of claims 1 to 3 wherein the DNA
duplex binding agent is an intercalating dye.
6. A method according to claim 5 wherein the intercalating dye is
selected from the group consisting of SYBRGreen, SYBRGreen I,
SYBRGold, ethidium bromide and YOPRO-1.
7. A method according to any one of claims 1 to 3 wherein the
reactive molecule is an acceptor molecule.
8. A method according to claim 7 wherein the reactive molecule is
fluorescein.
9. A method according to any one of claims 1 to 3 wherein the probe
is immobilised on a solid support.
10. A method according to any one of claims 1 to 3 wherein the
product is immobilised on a solid support.
11. A kit comprises a probe specific for a target nucleotide
sequence which contains an reactive molecule, and a DNA duplex
binding agent which is compatible with said reactive molecule.
12. A kit according to claim 11 wherein the DNA duplex binding
agent is an intercalating dye.
13. A kit according to any one of claims 11 or 12 which further
comprises one or more reagents used in an amplification
reaction.
14. A probe which comprises a sequence which will hybridise with a
target nucleotide sequence and a reactive molecule.
15. The method of claim 1 wherein said characteristic is genetic
diagnosis.
16. The method of claim 1 wherein said characteristic is DNA
melting curve analysis.
17. A method according to claim 4 wherein the DNA duplex binding
agent is an intercalating dye.
18. A method according to claim 17 wherein the intercalating dye is
selected from the group consisting of SYBRGreen, SYBRGreen I,
SYBRGold, ethidium bromide and YOPRO-1.
19. A method according to claim 4 wherein the reactive molecule is
an acceptor molecule.
20. A method according to claim 4 wherein the probe is immobilised
on a solid support.
21. A method according to claim 4 wherein the product is
immobilised on a solid support.
Description
[0001] The present invention provides a method for detecting a
target polynucleotide in a sample, for example by quantitatively
monitoring an amplification reaction, as well as to probes and kits
for use in these methods. The method is particularly suitable for
the detection of polymorphisms or allelic variation and so may be
used in diagnostic methods.
[0002] Known fluorescence polymerase chain reaction (PCR)
monitoring techniques include both strand specific and generic DNA
intercalator techniques that can be used on a few second-generation
PCR thermal cycling devices.
[0003] Generic methods utilise DNA intercalating dyes that exhibit
increased fluorescence when bound to double stranded DNA species.
Fluorescence increase due to a rise in the bulk concentration of
DNA during amplifications can be used to measure reaction progress
and to determine the target molecule copy number. Furthermore, by
monitoring fluorescence with a controlled change of temperature,
DNA melting curves can be generated, for example, at the end of PCR
thermal cycling.
[0004] When generic DNA methods are used to monitor the rise in
bulk concentration of nucleic acids, these processes can be
monitored with a minimal time penalty (compared to some other known
assays discussed below). A single fluorescent reading can be taken
at the same point in every reaction. End point melting curve
analysis can be used to discriminate artifacts from amplicon, and
to discriminate amplicons. Melting peaks of products can be
determined for concentrations that cannot be visualized by agarose
gel electrophoresis.
[0005] In order to obtain high resolution melting data, for example
for multiple samples, the melt experiment must be performed slowly
on existing hardware taking up to five minutes. However, by
continually monitoring fluorescence amplification, a 3D image of
the hysteresis of melting and hybridization can be produced. This
3D image is amplicon dependent and may provide enough information
for product discrimination.
[0006] It has been found that DNA melting curve analysis in general
is a powerful tool in optimizing PCR thermal cycling. By
determining the melting temperatures of the amplicons, it is
possible to lower the denaturing temperatures in later PCR cycles
to this temperature. Optimization for amplification from first
generation reaction products rather than the target DNA, reduces
artifact formation occurring in later cycles. Melting temperatures
of primer oligonucleotides and their complements can be used to
determine their annealing temperatures, reducing the need for
empirical optimization.
[0007] The generic intercalator methods however are only
quasi-strand-specific and therefore is not very useful where strand
specific detection is required.
[0008] Strand specific methods utilise additional nucleic acid
reaction components to monitor the progress of amplification
reactions. These methods often use fluorescence energy transfer
(FET) as the basis of detection. One or more nucleic acid probes
are labeled with fluorescent molecules, one of which is able to
act-as an energy donor and the other of which is an energy acceptor
molecule. These are sometimes known as a reporter molecule and a
quencher molecule respectively. The donor molecule is excited with
a specific wavelength of light which falls within its excitation
spectrum and subsequently it will emit light within its
fluorescence emission wavelength. The acceptor molecule is also
excited at this wavelength by accepting energy from the donor
molecule by a variety of distance-dependent energy transfer
mechanisms. A specific example of fluorescence energy transfer
which can occur is Fluorescence Resonance Energy Transfer or
"FRET". Generally, the acceptor molecule accepts the emission
energy of the donor molecule when they are in close proximity (e.g.
on the same, or a neighboring molecule). The basis of fluorescence
energy transfer detection is to monitor the changes at donor and
acceptor emission wavelengths.
[0009] There are two commonly used types of FET or FRET probes,
those using hydrolysis of nucleic acid probes to separate donor
from acceptor, and those using hybridization to alter the spatial
relationship of donor and acceptor molecules.
[0010] Hydrolysis probes are commercially available as Taqman.TM.
probes. These consist of DNA oligonucleotides that are labeled with
donor and acceptor molecules. The probe are designed to bind to a
specific region on one strand of a PCR product. Following annealing
of the PCR primer to this strand, Tag enzyme extends the DNA with
5' to 3' polymerase activity. Tag enzyme also exhibits 5' to 3'
exonuclease activity. TaqMan.TM. probes are protected at the 3' end
phosphorylation to prevent them from priming Taq extension. If the
TaqMan.TM. probe is hybridized to the product strand, an extending
Taq molecule may also hydrolyze the probe, liberating the donor
from acceptor as the basis of detection. The signal in this
instance is cumulative, the concentration of free donor and
acceptor molecules increasing with each cycle of the amplification
reaction.
[0011] The fact that signal generation is dependent upon the
occurrence of probe hydrolysis reactions means that there is a time
penalty associated with this method. Furthermore, the presence of
the probe may interrupt the smooth operation of the PCR
process.
[0012] In addition, it has been found that hydrolysis can become
non-specific, particularly where large numbers of amplification
cycles, for instance more than 50 cycles, are required. In these
cases, non-specific hydrolysis of the probe will result in an
unduly elevated signal.
[0013] This means that such techniques are not very compatible with
rapid PCR methods which are becoming more prominent with the
development of rapid hot air thermal cyclers such as the
Rapidcycler.TM. and LightCycler.TM. from Idaho Technologies Inc.
Other rapid PCR devices are described for example in co-pending
British Patent Application Nos. 9625442.0 and 9716052.7. The merits
of rapid cycling over conventional thermal cycling have been
reported elsewhere. Such techniques are particularly useful for
example in detection systems for biological warfare where speed of
result is important if loss of life or serious injury is to be
avoided.
[0014] Furthermore, hydrolysis probes do not provide significant
information with regard to hysteresis of melting since signal
generation is, by and large, dependent upon hydrolysis of the probe
rather than the melt temperature of the amplicon.
[0015] U.S. Pat. No. 5,491,063 describes a method for in-solution
quenching of fluorescently labeled probes which relies on
modification of the signal from a labeled single stranded
oligonucleotide by a DNA binding agent. The difference in this
signal which occurs as a result of a reduced chain length of the
probe following probe cleavage (hydrolysis) during a polymerase
chain reaction is suggested for providing a means for detecting the
presence of a target nucleic acid.
[0016] Hybridization probes are available in a number of forms.
Molecular beacons are oligonucleotides that have complementary 5'
and 3' sequences such that they form hairpin loops. Terminal
fluorescent labels are in close proximity for FRET to occur when
the hairpin structure is formed. Following hybridization of
molecular beacons to a complementary sequence the fluorescent
labels are separated, so FRET does not occur, and this forms the
basis of detection.
[0017] Pairs of labeled oligonucleotides may also be used. These
hybridize in close proximity on a PCR product strand bringing donor
and acceptor molecules together so that FRET can occur. Enhanced
FRET is the basis of detection. Variants of this type include using
a labeled amplification primer with a single adjacent probe.
[0018] The use of two probes, or a molecular beacon type of probe
which includes two labeling molecules increases the cost involved
in the process. In addition, this method requires the presence of a
reasonably long known sequence so that two probes which are long
enough to bind specifically in close proximity to each other are
known. This can be a problem in some diagnostic applications, where
the length of conserved sequences in an organism which can be used
to design an effective-probe, such as the HIV virus, may be
relatively short.
[0019] Furthermore, the use of pairs of probes involves more
complex experimental design. For example, a signal provided-when by
the melt of a probe is a function of the melting off of both
probes. The study of small mismatches or where one of the probes is
required to bind across a splice region (for example to detect RNA
as compared to DNA in a sample where the sequence on either side of
an intron can be utilised as the probe site) can yield incorrect
results if the other probe melts first.
[0020] U.S. Pat. No. 4,868,103 describes in general terms, a FRET
system for detecting the presence of an analyte, which utilises an
intercalating dye as the donor molecule. The process does not
involve an amplification stage.
[0021] The applicants have developed a strand specific system for
detecting the presence of particular nucleic acid sequences.
[0022] The invention provides a method for detecting the presence
of a target nucleic acid sequence in a sample, said method
comprising
[0023] (a) adding to a sample suspected of containing said target
nucleic acid sequence, a DNA duplex binding agent, and a probe
specific for said target sequence, said probe comprising a reactive
molecule able to absorb fluorescence from or donate fluorescent
energy to said DNA duplex binding agent,
[0024] (b) subjecting the thus formed mixture to an amplification
reaction in which target nucleic acid is amplified,
[0025] (c) subjecting said sample to conditions under which the
said probe hybridizes to the target sequence, and
[0026] (d) monitoring fluorescence from said sample.
[0027] As used herein, the expression "DNA duplex binding agent"
refers to any entity which adheres or associates itself with DNA in
duplex form. These include intercalating dyes as are well known in
the art.
[0028] As the probe hybridizes to the target sequence in step (c),
DNA duplex binding agent such as an intercalating dye is trapped
between the strands. In general, this would increase the
fluorescence at the wavelength associated with the dye. However,
where the reactive molecule is able to absorb fluorescence from the
dye (i.e. it is an acceptor molecule), it accepts emission energy
from the dye by means of FET, especially FRET, and so it emits
fluorescence at its characteristic wavelength. Increase in
fluorescence from the acceptor molecule, which is of a different
wavelength to that of the dye, will indicate binding of the probe
in duplex form. Thus changes in fluorescence which are indicative
of the formation or destabilization of duplexes involving the probe
are preferably monitored in step (d).
[0029] Similarly, where the reactive molecule is able to donate
fluorescence to the dye (i.e. it is a donor molecule), the emission
from the donor molecule is reduced as a result of FRET and this
reduction may be detected Fluorescence of the dye is increased more
than would be expected under these circumstances.
[0030] Preferably the reactive molecule is an acceptor molecule as
the signals are more readily determinable.
[0031] The use of a DNA duplex binding agent such as an
intercalating dye and a probe which is singly labeled is
advantageous in that these components are much more economical than
other assays in which doubly labeled probes are required. By using
only one probe, the length of known sequence necessary to form the
basis of the probe can be relatively short and therefore the method
can be used, even in difficult diagnostic situations.
[0032] Furthermore the method of the invention is extremely
versatile in its applications. The method can be used to generate
both quantitative and qualitative data regarding the target nucleic
acid sequence in the sample, as discussed in more detail
hereinafter. In particular, not only does the invention provide for
quantitative amplification, but also it can be used, additionally
or alternatively, to obtain characterizing data such as duplex
destabilization temperatures or melting points.
[0033] In the method of the invention, the sample may be subjected
to conditions under which the probe hybridizes to the samples
during or after the amplification reaction has been completed. The
process therefore allows the detection to be effected in a
homogenous manner, in that the amplification and monitoring can be
carried out in a single container with all reagents added
initially. No subsequent reagent addition steps are required.
Neither is there any need to effect the method in the presence of
solid supports (although this is an option).
[0034] The probe may comprise a nucleic acid molecule such as DNA
or RNA, which will hybridize to the target nucleic acid sequence
when the latter is in single stranded form. In this instance, step
(c) will involve the use of conditions which render the target
nucleic acid single stranded.
[0035] Probe may either be free in solution or immobilized on a
solid support, for example to the surface of a bead such as a
magnetic bead, useful in separating products, or the surface of a
detector device, such as the waveguide of a surface plasmon
resonance detector. The selection will depend upon the nature of
the particular assay being looked at and the particular detection
means being employed.
[0036] In particular, the amplification reaction used will involve
a step of subjecting the sample to conditions under which any of
the target nucleic acid sequence present in the sample becomes
single stranded. Such amplification reactions include the
polymerase chain reaction (PCR) or the ligase chain reaction (LCR)
but is preferably a PCR reaction.
[0037] It is possible then for the probe to hybridize during the
course of the amplification reaction provided appropriate
hybridization conditions are encountered.
[0038] In a preferred embodiment, the probe may be designed such
that these conditions are met during each cycle of the
amplification reaction. Thus at some point during each cycle of the
amplification reaction, the probe will hybridize to the target
sequence, and generate a signal as a result of the FET or FRET
between it and the DNA duplex binding agent such as the
intercalating dye trapped between the probe and the target
sequence. As the amplification proceeds, the probe will be
separated or melted from the target sequence and so the signal
generated by it will reduce. Hence in each cycle of the
amplification, a fluorescence peak from the reactive molecule is
generated. The intensity of the peak will increase as the
amplification proceeds because more target sequence becomes
available for binding to the probe.
[0039] By monitoring the fluorescence of the reactive molecule from
the sample during each cycle, the progress of the amplification
reaction can be monitored in various ways. For examples the data
provided by melting peaks can be analyzed, for example by
calculating the area under the melting peaks and this data plotted
against the number of cycles.
[0040] For example, the fluorescence is suitably monitored using a
known fluorimeter. The signals from these, for instance in the form
of photo-multiplier voltages, are sent to a data processor board
and converted into a spectrum associated with each sample tube.
Multiple tubes, for example 96 tubes, can be assessed at the same
time. Data may be collected in this way at frequent intervals, for
example once every 10 ms, throughout the reaction.
[0041] The spectra generated in this way can be resolved, for
example, using "fits" of pre-selected dyes, to form peaks
representative of each signaling moiety (i.e. dye and/or reactive
molecule). The areas under the peaks can be determined which
represents the intensity value for each signal, and if required,
expressed as quotients of each other. The differential of signal
intensities and/or ratios will allow changes in FRET to be recorded
through the reaction or at different reaction conditions, such as
temperatures. The changes, as outlined above, are related to the
binding phenomenon between the probe and the target sequence. The
integral of the area under the differential peaks will allow
intensity values for the FRET effects to be calculated.
[0042] This data provides the opportunity to quantitate the amount
of target nucleic acid present in the sample.
[0043] In addition, the kinetics of probe hybridization will allow
the determination, in absolute terms, of the target sequence
concentration. Changes in fluorescence from the sample can allow
the rate of hybridization of the probe to the sample to be
calculated. An increase in the rate of hybridization will relate to
the amount of target sequence present in the sample. As the
concentration of the target sequence increases as the amplification
reaction proceeds, hybridization of the probe will occur more
rapidly. Thus this parameter also can be used as a basis for
quantification. This mode of data processing useful in that it is
not reliant on signal intensity to provide the information.
[0044] Preferably, the fluorescence of both the dye and the
reactive molecule are monitored and the relationship between the
emissions calculated. This provides a strand specific measure to
complement the generic DNA information provided by measuring
fluorescence from the dye. In this way, the contribution to the
signal of non-specific amplification can be distinguished and thus
the method provides an internal check.
[0045] Suitable reactive molecules are rhodamine dyes or other dyes
such as Cy5 or fluorescein. These may be attached to the probe in a
conventional manner. The position of the reactive molecule along
the probe is immaterial although it general, they will be
positioned at an end region of the probe.
[0046] Intercalating dyes are well known in the art. They include
for example SYBRGreen such as SYBRGreen I, SYBRGold, ethidium
bromide and YOPRO-1.
[0047] In order for FET, such as FRET, to occur between the
reactive molecule and the dye, the fluorescent emission of the
donor (which may either be the intercalating dye or the reactive
molecule on the probe) must be of a shorter wavelength than the
acceptor (i.e. the other of the dye or the reactive molecule).
[0048] Suitable combinations are therefore set out in the following
Table;
1 Reactive Dye Acceptor/Donor molecule Acceptor/Donor SYBRGold
donor rhodamine acceptor SYBRGreen I donor rhodamine acceptor
SYBRGold donor Cy5 acceptor SYBRGreen I donor Cy5 acceptor Ethidium
acceptor Fluorescein donor bromide
[0049] Preferably, the molecules used as donor and/or acceptor
produce sharp peaks, and there is little or no overlap in the
wavelengths of the emission. Under these circumstances, it may not
be necessary to resolve the strand specific peak from the DNA
duplex binding agent signal. A simple measurement of the strand
specific signal alone (i.e. that provided by the reactive molecule)
will provide information regarding the extent of the FRET caused by
the target reaction. The ethidium bromide/fluorescein combination
may fulfil this requirement. In that case, the strand specific
reaction will be quantifiable by the reduction in fluorescence at
520 nm, suitably expressed as 1/Fluorescence.
[0050] However, where there is a spectral overlap in the
fluorescent signals from the donor and acceptor molecules, this can
be accounted for in the results, for example by determining
empirically the relationship between the spectra and using this
relationship to normalize the signals from the two signals.
[0051] It is possible to design the probe such that it is
hydrolyzed by the DNA polymerase used in the amplification reaction
thereby releasing the reactive molecule. This provides a cumulative
signal, with the amount of free reactive molecule present in the
system increasing with each cycle. A cumulative signal of this type
may be particularly preferred where the amount of target sequence
is to be quantified. However, it is not necessary in this assay for
the probe to be consumed in this way as the signal does not depend
solely upon the dissociation of the probe.
[0052] In order to achieve a fully reversible signal which is
directly related to the amount of amplification product present at
each stage of the reaction, and/or where speed of reaction is of
the greatest importance, for example in rapid PCR, it is preferable
that the probe is designed such that it is released intact from the
target sequence. This may be, for example, during the extension
phase of the amplification reaction. However, since the signal is
not dependent upon probe hydrolysis, the probe may be designed to
hybridize and melt from the target sequence at any stage during the
amplification cycle, including the annealing or melt phase of the
reaction. Such probes will ensure that interference with the
amplification reaction is minimized.
[0053] Where probes which bind during the extension phase are used,
their release intact from the target sequence can be achieved by
using a 5'-3' exonuclease lacking enzyme such as Stoffle fragment
of Taq or Pwo.
[0054] In order to ensure that the probe is not extended during the
extension phase of this, or indeed, any of the amplification
reactions, the 3' end of the probe can be blocked, suitably by
phosphorylation.
[0055] The probe may then take part again in the reaction, and so
represents an economical application of probe.
[0056] The data generated in this way can be interpreted in various
ways. In its simplest form, an increase in fluorescence of the
acceptor molecule in the course of or at the end of the
amplification reaction is indicative of an increase in the amount
of the target sequence present, suggestive of the fact that the
amplification reaction has proceeded and therefore the target
sequence was in fact present in the sample. However, as out-lined
above, quantitation is also possible by monitoring the
amplification reaction throughout. In addition, the emissions from
the DNA duplex binding agent, in particular the intercalating dye,
can be used in order to monitor the bulk-rise in nucleic acid in
the sample and this can be compared to the strand specific
amplification, as measured by the relationship between the reactive
molecule and dye signals. Finally, it is possible to obtain
characterization data and in particular melting point analysis,
either as an end point measure or throughout, in order to obtain
information about the sequence as will be discussed further
below.
[0057] Thus, a preferred embodiment of the invention comprises a
method for detecting nucleic acid amplification comprising:
performing nucleic acid amplification on a target polynucleotide in
the presence of (a) a nucleic acid polymerase (b) at least one
primer capable of hybridizing to said target polynucleotide, (c) a
fluorescent DNA duplex binding agent and (d) an oligonucleotide
probe which is capable of binding to said target polynucleotide
sequence and which contains an acceptor molecule which is capable
of absorbing fluorescence from the said dye; and monitoring changes
in fluorescence during the amplification reaction.
[0058] As before, the DNA duplex binding agent is suitably an
intercalating dye. The amplification is suitably-carried out using
a pair of primers which are designed such that only the target
nucleotide sequence within a DNA strand is amplified as is well
understood in the art. The nucleic acid polymerase is suitably a
thermostable polymerase such as Taq polymerase.
[0059] Suitable conditions under which the amplification reaction
can be carried out are well known in the art. The optimum
conditions may be variable in each case depending upon the
particular amplicon involved, the nature of the primers used and
the enzymes employed. The optimum conditions may be determined in
each case by the skilled person. Typical denaturation temperatures
are of the order of 95.degree. C., typical annealing temperatures
are of the order of 55.degree. C. and extension temperatures are of
the order of 72.degree. C.
[0060] The method can be used in hybridization assays for
determining characteristics of particular sequences.
[0061] Thus in a further aspect, the invention provides a method
for determining a characteristic of a sequence, said method
comprising;
[0062] (a) adding to a sample suspected of containing said
sequence, DNA duplex binding agent and a probe specific for said
target sequence and, said probe comprising a reactive molecule able
to absorb fluorescence from or donate fluorescent energy to said
DNA duplex binding agent,
[0063] (b) subjecting said sample to conditions under which the aid
probe hybridizes/to the target sequence,
[0064] (c) monitoring fluorescence from said sample and determining
a particular reaction condition, characteristic of said sequence,
at which fluorescence changes as a result of the hybridization of
the probe to the sample or destabilization of the duplex formed
between the probe and the target nucleic acid sequence.
[0065] Suitable reaction conditions include temperature,
electrochemical, or the response to the presence of particular
enzymes or chemicals. By monitoring changes in fluorescence as
these properties are varied, information characteristic of the
precise nature of the sequence can be achieved. For example, in the
case of temperature, the temperature at which the probe separates
or "melts" from the target sequence can be determined. This can be
extremely useful in for example, to detect and if desired also to
quantitate, polymorphisms in sequences including allelic variation
in genetic diagnosis. By "polymorphism" is included transitions,
transversions, insertions, deletions of inversions which may occur
in sequences, particularly in nature.
[0066] The hysteresis of melting of the probe will be different if
the target sequence varies by only one base pair. Thus where a
sample contains only a single allelic variant, the temperature of,
melting of the probe will-be a particular value which will be
different from that found in a sample which contains only another
allelic variant. A sample containing both allelic variants which
show two melting points corresponding to each of the allelic
variants.
[0067] Similar considerations apply with respect to electrochemical
properties, or in the presence of certain enzymes or chemicals. The
probe may be immobilized on a solid surface across which an
electrochemical potential may be applied. Target sequence will bind
to or be repulsed from the probe at particular electrochemical
values depending upon the precise nature of the sequence.
[0068] This embodiment can be effected in conjunction with
amplification reactions such as the PCR reaction mentioned above,
or it may be employed individually. Again, the reactive molecule is
preferably an acceptor molecule.
[0069] Further aspects of the invention include kits for use in the
method of the invention. These kits will contain a probe specific
for a target nucleotide sequence which contains a reactive
molecule. Additionally, they may contain a DNA duplex binding agent
such as an intercalating dye which is compatible in terms of being
able to undergo FET or FRET with said reactive molecule. Other
potential components of the kit include reagents used in
amplification reactions such as DNA polymerase.
[0070] The invention will now be particularly described by way of
example with reference to the accompanying diagrammatic drawings in
which:
[0071] FIG. 1 shows diagrammatically the interactions which are
utilised in the process of the invention;
[0072] FIG. 2 illustrates stages during an amplification reaction
in accordance with the invention;
[0073] FIG. 3 shows the results of an amplification reaction in
accordance with the invention, and
[0074] FIG. 4 shows the results of a experiment to detect
mismatches in sequences.
[0075] FIG. 1A illustrates the action of an intercalating dye (1)
which is in the presence of single stranded DNA (2), as would be
found during the melt phase of a PCR reaction. The dye attaches to
the DNA strands and fluoresce at ascertain level. However, when the
DNA becomes double stranded (3), the dye is concentrated and the
fluorescence increases significantly. This increase in fluorescence
can be used to detect the formation of double stranded DNA. The
fluorescence of the dye will be at a particular wavelength, for
example in the green region of the spectrum.
[0076] The effect of intercalating dye (1) on a probe (4) in
accordance with the invention is illustrated in FIG. 1C. Some dye
will bind to the nucleotides of the probe and will fluoresce at the
background level. However, as a result of FRET, some energy will
pass to the acceptor molecule (5) as indicated by the arrow and so
this molecule will also fluoresce but at a different wavelength to
that of the dye, for example, in the red region of the
spectrum.
[0077] When the probe hybridizes with a single stranded target
sequence as illustrated in FIG. 1D, any increase in the fluorescent
energy from the dye passes to the acceptor Molecule (5) which thus
fluoresces at a higher level. Increase in the fluorescence of the
acceptor molecule will thus be indicative of hybridization of the
probe to the target sequence. Thus by measuring the increase in
fluorescence of the acceptor molecule, for example as the
temperature decreases, the point at which hybridization occurs can
be detected. Similarly, a decrease in acceptor fluorescence will
occur as the temperature increases at the temperature at which the
probe melts from the target sequence. This will vary depending-upon
the hybridization characteristics of the probe and the target
sequence. For example, a probe which is completely complementary to
a target sequence will melt at a different temperature to a probe
which hybridizes with the target sequence but contains one or more
mismatches.
[0078] FIG. 2 illustrates how the method of the invention can be
employed in amplification reactions such as the PCR reaction. Probe
(4) will hybridize to single stranded DNA in conjunction with the
intercalating dye (1) and thus generate an increased acceptor
signal (FIG. 2A). This will occur during the annealing phase of the
cycle. As the amount of target sequence increases as a result of
the amplification, the signal generated during the annealing phase
by the acceptor molecule will also increase.
[0079] During the extension phase, the probe is removed from the
target sequence either by hydrolysis or, as illustrated, because it
is displaced by the DNA polymerase. At this point, the acceptor
signal decreases although the signal from the dye (1) will be
enhanced, again indicative of the increase in the amount of target
sequence.
[0080] By monitoring the progress of the amplification reaction in
this manner, the quantity of target sequence present in the
original sample can be quantitated.
EXAMPLE 1
[0081] PCR Amplification Reaction
[0082] PCR reaction mixtures contained the following reagents,
working concentrations were prepared:
[0083] 1.times. native PCR Buffer (3 mM Mg++, Bio/Gene, Bio/Gene
House, 6 The Business Centre, Harvard Way, Kimbolton, Cambridge,
PE18 0NJ, UK). Taq DNA polymerase 0.025 units/.mu.l, and dNTP's PCR
nucleotides 200 .mu.M (Boehringer Mannheim UK (Diagnostics &
Biochemical) Limited, Bell Lane, Lewes, East Sussex, BN7 1LG, UK).
Custom oligonucleotide primers 1 .mu.M each (Cruachem Ltd, Todd
Campus, West of Scotland Science Park, Acre Road, Glasgow G200 UA,
UK). Plasmid DNA was added to a final concentration of 10 fg/.mu.l
(.about.3000 copies). In a negative control experiment, a similar
PCR was carried out in the absence of plasmid DNA.
[0084] The forward YPPA155 (SEQ ID NO:1)
(dATGACGCAGAAACAGGAAGAAAGATCAGCC) and reverse YPP229R (SEQ ID NO:2)
(dGGTCAGAAATGAGTATGGATCCCAGGATAT) primers select a 104 bp amplicon
of the anti-coagulase gene of Yersinia pestis. This has previously
been cloned into to pBluescript SK vector (Stratagene Europe,
Hogehilweg 15, 1101 CB Amersterdam, Zuidoost, The Netherlands) to
form the phagemid construct pYP100ML.
[0085] The fluorescent probe (5' (CY5) CGCTATCCTGAAAGGTGATATATCCTGG
(SEQ ID NO:3), Bio/Gene, Bio/Gene House, 6 The Business Centre,
Harvard Way, Kimbolton, Cambridge, PE18 0NJ, UK) was added to a
final concentration of 0.2 .mu.M. SyberGold DYE (Molecular Probes)
was added to a final concentration of 1:400,000 of the reference
concentration.
[0086] The reaction was thermal cycled in composite glass
capillaries and an Idaho Technology Lightcycler (Bio/Gene, Bio Gene
House, 6 The Business Centre, Harvard Way, Kimbolton, Cambridge,
PE18 0NJ, UK). The cycle was 95.degree. C. for 1 Sec, 55.degree. C.
for 1 Sec, and 74.degree. C. for 1 Sec.
[0087] Following the thermal cycle a melting experiment was carried
out from 55.degree. C. to 95.degree. C. at 0.1.degree. C./Sec. The
reaction was optically interrogated using the LightCycler.TM., the
fluorescent emission at 520 & 670 nm were recorded.
[0088] The results, expressed as a function of the differential of
fluorescence (F) against temperature (T) dF/dT plotted against
temperature on the Y axis, is shown in FIG. 3. At 520 nm, only the
fluorescence from the SybrGold is recorded. A clear peak associated
with the melt temperature of the specific product, which has been
amplified in the PCR reaction. The negative control shows only
artifacts.
[0089] At 670 nm, both signal from the CY5 acceptor molecule and
also signal from the SybrGold is recorded. The peak indicative of
the specific amplification product is observed in the positive
experiment but is lacking in the negative control where again only
artifacts are shown. However, additionally in this case, a clear
peak resulting from melting of the probe is observed in the
positive experiment.
EXAMPLE 2
[0090] The following materials were used.
[0091] Oligonucleotides:
2 Probe: 5' (CY5)CGCTATCCTGAAAGGTGATATATCCTGGGA 3' (SEQ ID NO:4)
Homologue: 5' TCCCAGGATATATCACCTTTCAGGATAGCG 3' (SEQ ID NO:5)
Mismatch 1: 5' TCCCAGGATATATCAGCTTTCAGGATAGCG 3' (SEQ ID NO:6)
Mismatch 2: 5' TCCCAGGATATATCAGGTTTCAGGATAG- CG 3' (SEQ ID NO:7)
Mismatch 3: 5' TCCCAGGATATATCTTTCAGGAT- AGCG 3' (SEQ ID NO:8)
[0092] (Bio/Gene Limited, Bio/Gene House, 6 The Business Centre,
Harvard Way, Kimbolton, Cambridgeshire, PE18 0NJ)
[0093] Intercalator:
[0094] SYBR Green I (Molecular Probes)
[0095] Hybridization buffer:
[0096] PCRM0012 (Bio/Gene Limited, Bio/Gene House, 6 The Business
Centre, Harvard Way, Kimbolton, Cambridgeshire, PE18 0NJ)
[0097] Fluorimeter:
[0098] Idaho Technology LC32 (Bio/Gene Limited, Bio/Gene House, 6
The Business Centre, Harvard Way, Kimbolton, Cambridgeshire, PE18
0NJ)
[0099] Methods:
[0100] 4 .mu.l hybridization mixtures were assembled to consist of
the following:
[0101] PCRM012: Working concentration as defined by
manufacturer
[0102] SYBR Green I: 1/20,000 concentration of reference
solution
[0103] Probe oligonucleotide: 100 .mu.M
[0104] Target oligonucleotide: 100 .mu.M
[0105] Hybridization mixtures were subjected to the following
temperature regime in the LightCycler. Heating to 95.degree. C. at
20.degree. C./s, cooling to 50.degree. C. at 20.degree. C./s,
holding at 50.degree. C. for 10 s, heating to 80.degree. C. at
0.1.degree. C./s. Fluorescence was monitored in two channels during
the final heating step, F1 (520 nm-580 nm) with gain set to 16 and
F2 (650 nm-690 nm) with gain set to 128.
[0106] Spectral overlap from SYBR Green I into F2 was removed from
F2 fluorescence using the following empirically determined
relationship: F2 overlap=0.3232.times.F1+4.2853. The SYBR Green I
independent component of F2 was normalized and plotted on the Y
axis against temperature on the X axis, as shown in FIG. 4. The
results show the dependence of probe dissociation temperature on
the nature of the sequence targeted. Single base differences in the
targeted sequence are clearly discriminable.
Sequence CWU 1
1
8 1 30 DNA Artificial Sequence Description of Artificial Sequence
Primer 1 atgacgcaga aacaggaaga aagatcagcc 30 2 30 DNA Artificial
Sequence Description of Artificial Sequence Primer 2 ggtcagaaat
gagtatggat cccaggatat 30 3 28 DNA Artificial Sequence Description
of Artificial Sequence Probe 3 cgctatcctg aaaggtgata tatcctgg 28 4
30 DNA Artificial Sequence Description of Artificial Sequence
Oligonucleotide 4 cgctatcctg aaaggtgata tatcctggga 30 5 30 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide 5 tcccaggata tatcaccttt caggatagcg 30 6 30 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide 6 tcccaggata tatcagcttt caggatagcg 30 7 30 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide 7 tcccaggata tatcaggttt caggatagcg 30 8 27 DNA
Artificial Sequence Description of Artificial Sequence
Oligonucleotide 8 tcccaggata tatctttcag gatagcg 27
* * * * *