U.S. patent application number 10/940559 was filed with the patent office on 2005-05-26 for methods for diagnosis and therapy of autoimmune disease, such as insulin dependent diabetes mellitus, involving retroviral superantigens.
Invention is credited to Conrad, Bernard, Mach, Bernard.
Application Number | 20050112556 10/940559 |
Document ID | / |
Family ID | 26145636 |
Filed Date | 2005-05-26 |
United States Patent
Application |
20050112556 |
Kind Code |
A1 |
Conrad, Bernard ; et
al. |
May 26, 2005 |
Methods for diagnosis and therapy of autoimmune disease, such as
insulin dependent diabetes mellitus, involving retroviral
superantigens
Abstract
The invention relates to a process for the diagnosis of a human
autoimmune disease, including presymptomatic diagnosis, said human
autoimmune disease being associated with human retrovirus (HERV)
having Superantigen (SAg) activity, comprising specifically
detecting in a biological sample of human origin at least one of
the following: (I) the mRNA of an expressed human endogenous
retrovirus having Superantigen (SAg) activity, or fragments of such
expressed retroviral mRNA, said retrovirus being associated with a
given autoimmune disease, or (II) protein or peptide expressed by
said retrovirus, or (III) antibodies specific to the protein
expressed by said endogenous, or (IV) SAg activity specifically
associated with said endogenous retrovirus, detection of any of the
species (I) to (IV) indicating presence of autoimmune disease or
imminent onset of autoimmune disease.
Inventors: |
Conrad, Bernard; (Geneve,
CH) ; Mach, Bernard; (Chambesy-Geneve, CH) |
Correspondence
Address: |
MINTZ, LEVIN, COHN, FERRIS, GLOVSKY
AND POPEO, P.C.
ONE FINANCIAL CENTER
BOSTON
MA
02111
US
|
Family ID: |
26145636 |
Appl. No.: |
10/940559 |
Filed: |
September 14, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10940559 |
Sep 14, 2004 |
|
|
|
09490700 |
Jan 24, 2000 |
|
|
|
6800469 |
|
|
|
|
Current U.S.
Class: |
435/5 ;
435/6.16 |
Current CPC
Class: |
A61K 38/00 20130101;
G01N 33/5008 20130101; G01N 33/5091 20130101; G01N 33/564 20130101;
G01N 2800/24 20130101; G01N 2500/00 20130101; C12Q 1/686 20130101;
G01N 2333/15 20130101; G01N 33/5047 20130101; C12Q 2600/158
20130101; C12Q 1/48 20130101; G01N 33/56977 20130101; A01K 67/0275
20130101; G01N 33/505 20130101; A01K 2267/0325 20130101; G01N
33/56983 20130101; A01K 2217/20 20130101; G01N 33/5052 20130101;
C12N 2740/13022 20130101; A61P 3/10 20180101; A01K 2227/105
20130101; C12Q 1/702 20130101; C12N 2740/13021 20130101; G01N
33/502 20130101; A01K 2217/05 20130101; G01N 2800/042 20130101;
C12N 2740/10022 20130101; G01N 33/68 20130101; C07K 14/005
20130101; A61P 37/00 20180101 |
Class at
Publication: |
435/005 ;
435/006 |
International
Class: |
C12Q 001/70; C12Q
001/68 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 22, 1998 |
WO |
PCT/EP98/04926 |
Jul 22, 1997 |
EP |
97112482.1 |
Jul 23, 1997 |
EP |
97401773.3 |
Claims
1. Process for the diagnosis of a human autoimmune disease,
including pre-symptomatic diagnosis, said human autoimmune disease
being associated with human endogenous retrovirus (HERV) having
Superantigen (SAg) activity, comprising specifically detecting in a
biological sample of human origin at least one of the following:
I--the mRNA of an expressed human endogenous retrovirus having
Superantigen (SAg) activity, or fragments of such expressed
retroviral mRNA, said retrovirus being associated with a given
autoimmune disease, or II--protein or peptide expressed by said
retrovirus, or III--antibodies specific to the proteins expressed
by said endogenous retrovirus, or IV--SAg activity specifically
associated with said endogenous retrovirus, detection of any of the
species (I) to (IV) indicating presence of autoimmune disease or
imminent onset of autoimmune disease.
2.-61. (canceled)
Description
[0001] The present invention relates to methods for the diagnosis
of human autoimmune disease, for example Insulin Dependent Diabetes
Mellitus (IDDM), and to methods or identifying substances which can
be used in the therapy and prevention of such diseases. The
invention further relates to novel human retroviruses involved in
autoimmune disease and having superantigen activity, as well as to
their expression products.
[0002] For some autoimmune diseases such as IDDM, Mutiple
Sclerosis, arthritis and others, it is known that a combination of
genetic, environmental and possibly exogenous infectious factors
may be important in precipitating disease. However, the precise
roles of each of these factors remains incompletely elucidated. For
example, for IDDM, the Major Histocompatibility Complex (MHC) Class
II genotype is one of the strongest genetic factors determining
disease susceptibility (Vyse, T. J. and Todd J. A., 1996) although
the respective roles of the different MHC Class II.sup.+ cell types
in promoting disease has not yet been clarified. Furthermore, IDDM
shows temporal, epidemic-like variations and the clinical disease
exhibits preferential seasonal onset (Karvonen et al., 1993).
Recently, Conrad et al. (1994) provided evidence for superantigen
involvement in IDDM aetiolosy and postulated that viruses may be
the modifying agent responsible for the presence of superantigen on
diabetic islets.
[0003] Genetic background also has an important influence in
multiple sclerosis. In addition, Perron et al (Perron et al, 1997)
have recently identified a retrovirus which can be isolated from
cells of multiple sclerosis patients. Whether the retrovirus
contributes as a causative agent of multiple sclerosis or as a link
in the pathogenic process, or whether it is merely an
epiphenomenon, has not been identified. No superantigen activity of
the retrovirus has been identified.
[0004] It is an aim of the present invention to identify agents
implicated in the pathogenesis of human autoimmune diseases, such
as IDDM, and on the basis of these agents to provide reliable
diagnostic procedures and therapeutic or prophylactic substances
and compositions.
[0005] These objectives are met by the provision, according to the
invention, of diagnostic procedures involving the detection of
expressed retroviruses having superantigen (SAg) function, these
retroviruses being directly involved in the pathogenesis of human
autoimmune disease by activation of autoreactive T-cells. Compounds
and compositions capable of blocking SAg function or production are
also provided as therapeutic and prophylactic agents in the
treatment of autoimmune disease.
[0006] The present invention is based on the discovery, by the
present inventors that superantigens (SAgs) encoded by
retroviruses, particularly endogenous retroviruses, play a major
role in the pathogenesis of autoimmune disease, very likely by
activating autoreactive T-cells.
[0007] Superantigens (SAgs) (Choi et al, 1989 ; White et al, 1989)
are microbial proteins able to mediate Interactions between MHC
Class II.sup.+- and polyclonal T-cells resulting in reciprocal
activation (Acha-Orbea et al, 1991; Choi et al, 1991; Fleischer and
Schrezenmeier, 1988). Their function is restricted by only two
absolute requirements: the presence of MHC Class II on the surface
of the presenting cells and the expression of one or more defined
Variable (V)-.beta. T cell receptor (TCR) chain(s) on T cells.
[0008] The potential role of SAgs in human diseases is ill-defined.
Bacterial SAgs have been proposed to be associated with the
pathogenesis of autoimmune disease (White et al, 1989). However,
although pathogen disease associations have been described, none of
these have as vet implicated a pathogen-encoded SAg (Howell et al,
1991; Paliard et al, 1991). A SAg-like activity resembling the one
encoded by MMTV has been reported to be associated with herpesvirus
infections (Dobrescu et al, 1995; Sutkowski et al, 1996). However,
in none of these two systems has it been demonstrated that the SAg
activity is actually encoded by the infectious agent. SAg activity
has been reported in patients having Type I diabetes (Conrad et al
1994). However, the origin of the Sag activity is not
identified.
[0009] In the framework of the present invention, the inventors
have identified the source of SAg activity in IDDM patients as
being a novel endogenous retrovirus, (HERV) designated
IDDKK.sub.1.2-22. This retrovirus is related to, but distinct from
mouse mammary tumor virus (MMTV). It is ubiquitous in the human
genome but is only expressed in diabetic individuals, possibly in
response to a particular environmental stimulus. The HERV encodes
superantigen (SAg) activity within the env gene. Expression of the
SAg gives rise to preferential expansion of V.beta.-7 T-cell
receptor positive T-cells, some of which are very likely to be
autoreactive. Thus the expression of self-SAg leads to systemic
activation of a sub-set of T-lymphocytes, among which autoreactive
T-cells, will in turn give rise to organ-specific autoimmune
disease.
[0010] The involvement of retroviral SAg, particularly endogenous
retroviral SAg in autoimmune disease is unexpected. Indeed,
endogenous retroviruses (HERV) form an integral part of the human
genome. If expressed from birth, any autoreactive T-cells activated
by expression of a retroviral SAg should be deleted as part of the
normal development of the immune system (thymic deletion). However,
in the case of autoimmune diseases such as diabetes, the expression
of the retrovirus, and hence of the encoded SAg, occurs only later
in life, leading to the proliferation of autoreactive T-cells.
[0011] To identify the microbial agent responsible for SAg activity
in diabetes, the present inventors have developed a novel
primer-extension technique. This method can be used to isolate and
identify, in a sample of polyadenylated RNA, any expressed,
previously unidentified retroviral RNA, particularly retroviruses
having SAg activity and being involved in human autoimmune disease.
This strategy relies on the following three characteristic features
of functional retroviruses. First, retroviral genomes contain a
primer binding site (PBS) near their 5' end. Cellular tRNAs anneal
to the PBS and serve as primers for Reverse Transcriptase (reviewed
by Whitcomb and Hughes, 1992). Second, the R (repeat) sequence is
repeated at the 5' and 3' ends of the viral RNA (Temin, 1981).
Third, the RT-RNAse H region of the pol gene is she most conserved
sequence among different retroelements (McClure et al., 1988; Xiong
and Eickbusch, 1990). The method comprises the following steps:
[0012] i) isolation of the 5' R-U5 ends of expressed putative
retroviral genomes using nucleic acid amplification, the 3' primer
being complementary to known <<primer binding sites>>
(pbs).
[0013] ii) isolation of the 3' R-poly(A) ends corresponding to the
5' R-U5 ends, by use of primers specific for the R regions isolated
in step i).
[0014] iii) amplification of the conserved RT-RNase H region within
the pol gene by using degenerate primers corresponding to the
conserved region.
[0015] iv) amplification of the 5' moiety of the putative
retroviral genome by using primers specific for the different U5
regions isolated in step i) in conjunction with a primer specific
for the 3' end of the central pol region isolated in step iii).
[0016] v) amplification of the 3' moiety of the putative retroviral
genome using primers specific for the central pol region isolated
in step iii) in conjunction with primers specific for the poly(A)
signals present in the 3' R-poly(A) sequences isolated in step
ii).
[0017] vi) confirmation of the presence of an intact retroviral
genome by amplification using primers specific for its predicted U5
and U3 regions.
[0018] Once an expressed retrovirus has been identified, its SAg
activity can be tested by contacting a biological sample containing
MHC Class II.sup.+ cells expressing the putative Sag activity, with
cells bearing one or more variable (V)-.beta. T-cell receptor (TCR)
chains and detecting preferential proliferation of a V.beta.
subset.
[0019] The techniques developed by the inventors to elucidate Sag
involvement in IDDM, can be used to identify the possible
involvement of expressed retrovirus and encoded SAg activity in
other autoimmune diseases. The characterisation of the retrovirus
and its SAg can then be made, and the particular V.beta.-T cell
receptor chain activation associated with the SAg can be
identified. A given autoimmune disease can thus be defined by
reference to a characterised retroviral Sag specifically associated
with the disease, and to the V.beta.-specificity or specificities.
In certain autoimmune diseases, such as multiple sclerosis, it is
known that T-cells with different V.beta. specificities can be
involved in the recognition of the same immunodominant autoantigen,
M.B.P. (Wuchezpfennig K. W. et al, Science 1990, 25, 1016-1019).
Once this <<profile>> has been determined, specific
diagnostic, therapeutic and prophylactic tools can be elaborated
for each autoimmune disease involving retroviral SAg-stimulation of
autoreactive T-cells.
[0020] The present invention involves, in a first embodiment,
methods of diagnosis of autoimmune disease based on the specific
expression, in autoimmune patients, of retroviruses having Sag
activity.
[0021] The methods of diagnosis of the present invention are
advantageous in so far as they are highly specific, distinguishing
between expressed and non-expressed viral nucleic acid, and can
thus be reliably used even when the pathological agent is a
ubiquitous endogenous retrovirus. They can be carried out on easily
accessible biological samples, such as blood or plasma, without
extensive pre-treatment. The diagnostic methods of the invention
detect disease-specific expression of the retrovirus and can thus
be applied before appearance of clinical symptoms, for example on
genetically predisposed individuals. This allows suitable therapy
to be initiated before autoimmune destruction of a particular
target tissue occurs.
[0022] In the context of the present invention the following terms
encompass the following meanings:
[0023] a <<human autoimmune disease>> is defined as a
polygenic disease characterised by the selective destruction of
defined tissues mediated by the immune system. Epidemiological and
genetic evidence also suggests the involvement of environmental
factors.
[0024] a <<human endogenous retrovirus>> (HERV) is a
retrovirus which is present in the form of proviral DNA integrated
into the genome of all normal cells and s transmitted by Mendelian
inhertance patterns. Such proviruses are products of rare infection
and integration events of the retrovirus under consideration into
germ cells of the ancestors of the host. Most endogenous
retroviruses are transcriptionally silent or defective, but may be
activated under certain conditions. Expression of the HERV may
range from transcription of selected viral genes to production of
complete viral particles, which may be infectious or
non-infectious. Indeed, variants of HERV viruses may arise which
are capable of an exogenous viral replication cycle, although
direct experimental evidence for an exogenous life cycle is still
missing. Thus, in some cases, endogenous retroviruses may also be
present as exogenous retroviruses. These variants are included in
the term <<HERV>> for the purposes of the invention. In
the context of the invention, <<human endogenous
retrovirus>> includes proviral DNA corresponding to a full
retrovirus as represented schematically in FIG. 2A, comprising two
LTR's, gag, pol and env, and further includes remnants or
<<scars>> of such a-full retrovirus which have arisen
as a results of deletions in the retroviral DNA. Such remnants
include fragments of the structure depicted in FIG. 2A, and have a
minimal size of one LTR. Typically, the HERVs have at least one
LTR, preferably two, and all or part of gag, pol or env.
[0025] a Superantigen is a substance, normally a protein, of
microbial origin that binds to major histocompatibility complex
(MHC) Class II molecules and stimulates T-cell, via interaction
with the V.beta. domain of the T-cell receptor (TCR). SAgs have the
particular characteristic of being able to interact with a large
proportion of the T-cell repertoire, i.e. all the members of a
given V.beta. subset or <<family >>, or even with more
than one V.beta. subset, rather than with single, molecular clones
from distinct V.beta. families as is the case with a conventional
(MHC-restricted) antigen. The superantigen is said to have a
mitogenic effect that is MHC Class II dependent but
MHC-unrestricted. SAgs require cells that express MHC Class II for
stimulation of T-cells to occur.
[0026] <SAg activity>> signifies a capacity to stimulate
T-cells in an MHC-dependent but MHC-unrestricted manner. In the
context of the invention, SAg activity can be detected in a
functional assay by measuring either IL-2 release by activated
T-cells, or proliferation of activated T-cells.
[0027] a retrovirus having SAg activity is said to be
<<associated with>>a given autoimmune disease when
expressed retroviral RNA can be found specifically in biological
samples of autoimmune patients (ie the expressed retroviral RNA is
not found in individuals free of autoimmune disease). Preferably
<<associated with>> further signifies in this context
that retroviral SAg activation of a V.beta. subset gives rise
directly or indirectly to proliferation of autoreactive T-cells
targeting tissue characteristic of the autoimmune disease. Blockage
of SAg activity thus normally prevents generation of autoreactive
T-cells. Disease <<association>> with Sag can also be
defined immunologically or genetically immunological association
means that a particular disease-associated HLA haplotype is
permissive for Sag, whereas resistant haplotypes are permissive for
Sag inhibition. Genetic association implies a polymorphism in
either the expression pattern of Sag or in the amino acid sequence
of Sag, with Sag alleles exhibiting different degree of
susceptibility to the disease.
[0028] cells which <<functionally express>> Sag are
cells which express Sag in a manner suitable for giving rise to
MHC-dependent, MHC-unrestricted T-cell stimulation in vitro or in
vivo. This requires that the cell be MHC II or that it has been
made MHC II.sup.+ by induction by agents such as IFN-.gamma..
[0029] More particularly, in a first embodiment, the present
invention relates to a process for the diagnosis of a human
autoimmune disease, including pre-symptomatic diagnosis, said human
autoimmune disease being associated with human retrovirus having
Superantigen (SAg) activity, comprising specifically detecting in a
biological sample of human origin at least one of the
following:
[0030] I: the mRNA of an expressed human retrovirus known to have
Superantigen (SAg) activity, or fragments of such expressed
retroviral mRNA, said retrovirus being associated with a given
autoimmune disease, or
[0031] II: protein expressed by said retrovirus, or
[0032] III antibodies specific to the proteins expressed by said
retrovirus, or
[0033] IV: SAg activity specifically associated with the autoimmune
disease.
[0034] Thus, the diagnosis of a given autoimmune disease can be
made, according to the invention, by one or more of four methods (I
to IV), each involving the detection of a specific aspect of the
expression of a SAg-encoding retrovirus known to be associated with
the autoimmune disease, particularly an endogenous retrovirus.
Detection of any of the species (I) to (IV) as listed above is
indicative of the presence of the autoimmune disease specifically
associated with the endogenous retrovirus under consideration or of
imminent onset of the disease.
[0035] Each of the four possible methods I to IV of diagnosis of
human autoimmune disease will be described in detail below.
[0036] According to method I, the autoimmune disease is diagnosed
by specifically detecting in a biological sample the mRNA of an
expressed human retrovirus known to have SAg activity.
[0037] Specific detection of retroviral expressed mRNA is
preferably carried out using nucleic acid amplification with viral
specific primers which discriminate between proviral DNA and
expressed RNA template. This is of particular importance when the
retrovirus associated with the autoimmune disease is an endogenous
retrovirus. Indeed in such cases, the proviral DNA is present in
all human cells, whether or not the autoimmune disease is present.
False positives would be obtained if a detection method were used
which does not distinguish between proviral DNA and transcribe
mRNA.
[0038] The biological sample to be used for specific mRNA detection
according to the invention may be any body fluid or tissue but is
preferably plasma or blood. Normally, total RNA is extracted from
the sample using conventional techniques. DNAse treatment may be
carried out to reduce contaminating cellular DNA.
[0039] By performing the amplification on total RNA samples, the
effects of contaminating DNA are reduced but not eliminated, even
after treatment by DNAse. The method of the present invention
allows selective amplification of expressed viral RNA transcripts
using at least one m-RNA specific primer, for example a poly-A
specific primer, even in the presence of contaminating viral DNA in
the sample. The poly-A specific primer is specific for the poly-A
signals present in the R-poly(A) sequences and the 3' extremity of
the retrovirus (see for example FIG. 2A step 5 and FIG. 2C).
[0040] It has surprisingly been found that a poly-A-specific primer
having from four to 25 T's for example 5 or 20 T's is optimal for
the purposes of the present invention.
[0041] The mRNA specific amplification requires a reverse
transcriptase (RT) step, for which the poly A-specific primer is
also be used.
[0042] The second primer in the PCR step is generally complementary
to the U3 region. When the amplification product has a size of
about 300 to 500 nucleotides, the conditions applied for the
amplification (PCR) step are normally the following:
1 i) reverse transcriptase 50.degree. C. 30 minutes ii)
amplification 94.degree. C. 2 minutes (for a total 94.degree. C. 30
secondes of 10 cycles) 68.degree. C. 30 secondes -1.3.degree. C.
each cycle 68.degree. C. 45 secondes iii) amplification 94.degree.
C. 30 secondes (for a total 55.degree. C. 30 secondes 25 cycles)
68.degree. C. 45 secondes
[0043] The amplified material is subjected to gel electrophoresis
and hybridised with suitable probes, for example generated from the
U3 region.
[0044] By performing the mRNA specific detection of the invention,
the presence of a given expressed retrovirus can be reliably
determined in a biological sample. For endogenous retroviruses
expression generally indicates onset of the disease process. This
can be detected well before the apparition of any clinical
symptoms. The diagnosis of the invention can thus be used to detect
onset of the disease process, enabling treatment to be administered
before irreversible autoimmune attack occurs.
[0045] The invention also encompasses pro-viral specific detection
of retroviral DNA, and simultaneous detection of both expressed
retroviral mRNA and proviral DNA. Details of these methods are
given in FIG. 2D and 2E, and associated legends. Specific proviral
DNA detection can be used on healthy biological samples to confirm
the endogenous nature of the retrovirus the assay detecting both
retroviral mRNA and proviral DNA can be used as an internal
standard.
[0046] According to a preferred embodiment of the invention, the
autoimmune disease detected is IDDM. The present inventors have
identified, a human endogenous retrovirus associated with IDDM.
This novel retrovirus (called IDDMK.sub.1.2-22) has SAg activity
encoded in the NH.sub.2 terminal portion of the env gene, causing
preferential proliferation of V.beta.7-TCR chain bearing
T-cells.
[0047] IDDMK.sub.1.2-22 comprises the 5' LTR, 3' LTR and
env-encoding sequences shown in FIGS. 7A, 7B and 7C respectively,
and further comprises gag-encoding sequences. The SAg portion of
the env protein occurs within the sequences shown in FIGS. 7D or
7G, particularly 7G.
[0048] Diagnosis of IDDM by specific detection of expressed
retroviral RNA is carried out using a polyA specific probe of the
type:
2 5' TTTTTGAGTCCCCTTAGTATTTATT 3'
[0049] or similar sequence specifically hybridising to the polyA
region of IDDMK.sub.1.2-22 type retroviruses, having at lest 90%
sequence identity with the IDDMK.sub.1.2-22 and having SAg
activity.
[0050] According to a second embodiment (II) of the invention, the
human autoimmune disease associated with a retroviral SAg is
diagnosed by specifically detecting protein expressed by the
retrovirus, particularly gag, pol or env. In the case of endogenous
retroviruses, the expressed proteins may be slightly different from
the expected products as a result of read-through phenomena and
possibly reading-frame shifts. Preferably, the expressed protein is
detected in the biological sample, such as blood or plasma, using
antibodies, particularly monoclonal antibodies, specific for the
said protein. A Western-like procedure is particularly preferred,
but other antibody-based recognition assays may be used.
[0051] In the case of IDDM a preferred diagnostic method comprises
the detection of a protein encoded by the env gene, as shown in
FIGS. 7C, 7D or 7G, or the pol protein shown in FIG. 7H, or the
IDDMK.sub.1.2-22 GAG protein. Alternatively, proteins having at
least approximately 90% homology with these proteins, or proteins
arising from read-through of, internal stop codons, possibly with
frame-shift, particularly a -1 frame shift, occurring immediately
after the internal stop codon. Fragments of any of these proteins
having at least 6, and preferably at least 10 amino acids, for
example 6-20, or 10-15 amino acids, may also be detected. Preferred
proteins for this type of diagnostic assay are those having SAg
activity. It is also possible to detect retroviral particles when
produced.
[0052] According to a third embodiment (III) of the invention, the
autoimmune disease is diagnosed by detecting in a biological
sample, antibodies specific for the protein expressed by the
associated retrovirus.
[0053] Detection of antibodies specific for these proteins is
normally carried out by use of the corresponding retroviral protein
or fragments thereof having at least 6 amino-acids, preferably at
least 10, or example 6-25 amino acids. The proteins are typically
Gag, Pol or Env or fragments thereof and may or may not have
superantigen activity. The retroviral proteins used in the
detection of the specific antibodies may be recombinant proteins
obtained by introducing viral DNA encoding the appropriate part of
the retrovirus into eukaryotic cell and the conditions allowing the
DNA to be expressed and recovering the said protein.
[0054] In the context of the present invention, the terms
"antibodies specific for retroviral proteins" signifies that the
antibodies show no significant cross reaction with any other
proteins likely to occur in the biological sample. Generally, such
antibodies specifically bind to an epitope which occurs exclusively
on the retroviral protein in question. The antibodies may recognize
the retroviral protein having SAg activity as presented by the
M.H.C class II molecule.
[0055] Detection of specific antibodies may be carried out using
conventional techniques such as sandwich assays, etc. Western
blotting or other antibody-based recognition system may be
used.
[0056] According to the fourth embodiment of the invention, the
autoimmune disease is diagnosed by detecting, in a biological
sample, SAg activity specifically associated with the autoimmune
disease. This is done by carrying out a functional assay in which a
biological fluid sample containing MHC class II.sup.+ cells, for
example Antigen Presenting Cells (APC) such as dendritic cells is
contacted with cells bearing one or more variable .beta.-T-receptor
chains and detecting preferential proliferation of the V.beta.
subset characteristic of said autoimmune disease. Typically, this
method of diagnosis is combined with one or more of the methods
(I), (II), (III) as described earlier to maximise specificity.
[0057] The biological sample according to this variant of the
invention is typically blood and necessarily contains MHC class
II.sup.+ cells such as B-lymphocytes, monocytes, macrophages or
dendritic cells which have the capacity to bind the superantigen
and enable it to elicit its superantigen activity. MHC class II
content of the biological sample may be boosted by addition of
agents such as IFN-gamma.
[0058] The biological fluid sample is contacted with cells bearing
the V.beta.-T receptors belonging to a variety of different
families or subsets in order to detect which of the V.beta. subsets
is stimulated by the putative SAg, for example V-.beta.2, 3, 7, 8,
9 13 and 17. Within any one V-.beta. family it is advantageous to
use V-.beta. chains having junctional diversity in order to confirm
superantigen activity rather than nominal antigen activity.
[0059] The cells bearing the V-.beta. receptor chains may be either
an unselected population of T-cells or T-cell hybridoma. If
unselected T-cells are used, the diagnostic process is normally
carried out in the following manner: the biological sample
containing MHC Class II+ cells is contacted with the T-cells for
approximately 3 days. A growth factor such as Interleukin 2 (IL-2)
which selectively amplifies activated T-cells is then added.
Enrichment of a particular V-.beta. family or families is measured
using monoclonal antibodies against the TCR-.beta.-chain. Only
amplified cells are thus detected. The monoclonal antibodies are
generally conjugated with a detectable marker such as a
fluorochrome. The assay can be made T-cell specific by use of a
second antibody, anti CD3, specifically recognizing the
CD3-receptor.
[0060] T-cell hybridoma bearing defined T-cell receptor may also be
used in the functional or cell-based assay for SAg activity. An
example of commercially available cells of this type are given in
B. Fleischer et al. Infect. Immun. 64, 987-994, 1996. Such
cell-lines are available from Immunotech, Marseille, France.
According to -his variant, activation of a particular family of
V-.beta. hybridoma leads to release of IL-2. IL2 release is
therefore measured as read-out using conventional techniques. A
specific example of this procedure for diabetes is illustrated in
FIG. 9. The basic methodology is adapted for other autoimmune
diseases by employing T-cell receptor cells of the appropriate type
for that disease.
[0061] For diabetes, detection of SAg activity will normally lead
to preferential proliferation of the V-.beta.7 subset. For other
autoimmune diseases, other V-.beta. subsets may be
proliferated.
[0062] According to another aspect of the present invention, there
is provided human endogenous retroviruses having superantigen
activity and being associated with human auto immune disease. Such
retroviruses which may be of the HERV-K family, or otherwise, are
obtainable from RNA prepared from a biological sample of human
origin, by carrying out the following steps:
[0063] i) isolation of the 5' R-U5 ends of expressed putative
retroviral genomes using nucleic acid amplification, the 3' primer
being complementary to known <<primer binding sites>>
(pbs);
[0064] ii) isolation of the 3' R-poly(A) ends corresponding to the
5' R-U5 ends, by use of primers specific for the R regions isolated
in step i);
[0065] iii) amplification of the conserved RT-RNase H region within
the pol gene by using degenerate primers corresponding to the
conserved region;
[0066] iv) amplification of the 5' moiety of the putative
retroviral genome by using primers specific for the different U5
regions isolated in step i) in conjunction with a primer specific
for the 3' end of the central pol region isolated in step iii);
[0067] v) amplification of the 3' moiety of the putative retroviral
genome using primers specific for the central pol region isolated
In step iii) in conjunction with primers specific for the poly(A)
signals present In the 3' R-poly(A) sequences isolated in step
ii);
[0068] vi) confirmation of the presence of an intact retroviral
genome by amplification using primers specific for its predicted U5
and U3 regions.
[0069] A preferred human endogenous retrovirus of the invention is
IDDMK 1,2 22 comprising each of the sequences illustrated in FIGS.
7A, 7B, 7C or sequences having at least 90% identity with these
sequences, and further comprising GAG-encoding sequences, and
sequences encoding POL as shown in FIG. 7H. This retrovirus has a
size of approximately of 8.5 kb, has SAg activity encoded within
the Env region as shown in FIGS. 7C and 7E and gives rise to
V-.beta.7 specific proliferation.
[0070] The invention also relates to proviral DNA of a retrovirus
having superantigen activity and being associated with an
autoimmune disease. Such proviral DNA is naturally found integrated
into the human genome. The proviral DNA may be obtained from a
biological sample of human origin by
[0071] i) obtaining retroviral RNA according to the method of claim
13, and further,
[0072] ii) generating a series of DNA probes from the retroviral
RNA obtained in i);
[0073] iii) hybridising under stringent conditions, the probes on a
genomic human DNA library
[0074] iv) isolation of the genomic sequences hybridising with the
probes.
[0075] The invention also relates to nucleic acid molecules (RNA,
DNA or cDNA) comprising fragments of the retroviral RNA or DNA
described above, having at least 20 nucleotides and preferably at
least 40. The fragments may be specific for a given retrovirus,
specific signifying a homology of less than 20% wish other human or
non-human retroviruses.
[0076] Preferred nucleic acid molecules of the invention encode SAg
activity particularly SAg activity, responsible for the
proliferation of autoreactive T-cells. If the region of the viral
genome encoding the SAg activity is unknown, the particular region
may be identified by:
[0077] i) transfecting expressed retroviral DNA or portions thereof
into MHC Class II.sup.+ antigen presenting cells under conditions
in which the viral DNA is expressed,
[0078] ii) contacting the MHC class II.sup.+ transfectants with
cells bearing one or more defined (V)-.beta. T-cell receptor
chains, and
[0079] iii) determining whether the transfectant is capable of
inducing preferential proliferation of a V.beta. subset, the
capacity to induce preferential proliferation being indicative of
SAg activity within the transfected DNA or portion thereof.
Proliferation may be measured by determination of 3H-thymidine
incorporation (see Examples methods and materials).
[0080] The nucleic acid molecule encoding SAg activity may be
derived from an endogenous human retrovirus. It typically
corresponds to an open reading frame of the retrovirus and may
contain at least one internal stop codon or may be a synthetic
mutant in which 1 or 2 nucleotides have been added or deleted to
remove the stop codon and modify the reading frame.
[0081] Preferably, the nucleic acid of the invention comprises or
consists of all or part of the env gene (encoding the envelope
glycoprotein) of an endogenous human retrovirus associated with
autoimmune disease. The env--encoded protein is particularly likely
to have SAg activity, as exemplified by the IDDM HERV. Synthetic or
recombinant nucleic acids corresponding to the env genes or
fragments thereof are also within the scope of the invention.
[0082] The nucleic acid molecules of the invention may comprise
ribosomes or antisense molecules to the retrovirus involved in
autoimmune disease.
[0083] The invention also relates to nucleic acid molecules capable
of hybridizing in stringent conditions with retroviral DNA or RNA.
Typical stringent conditions are those where the combination of
temperature and salt concentration chosen to be approximately
12-20.degree. C. below the Tm (melting temperature) of the hybrid
under study.
[0084] Such nucleic acid molecules may be labelled with
conventional labelling means to act as probes or, alternatively,
may be used as primers in nucleic acid amplification reactions.
[0085] Preferred nucleic acid molecules of the invention are
illustrated in FIGS. 7A, 7B, 7C, 7D, 7E, 7G and also encompass
nucleic acid sequences encoding the POL protein shown in FIG. 7H,
and the GAG protein. Sequences exhibiting at least 90% homology
with any of the afore-mentioned sequences are also comprised within
the invention or fragments of any of these sequences having at
least 20 and preferably at least 30 nucleotides.
[0086] The Env encoding sequence shown in FIG. 7C is particularly
preferred, as well as the nucleic acid encoding the Env/F-S SAg
protein shown in FIGS. 7G and 7E. A preferred nucleic acid molecule
is a molecule encoding the Env/F-S Sag protein wherein the first
internal stop codon (shown underlined in FIG. 7C), is mutated by
insertion of an extra T (at position 517 in FIG. 7G underlined) to
eliminate premature translational stop, the resulting sequence
being then in the correct reading frame to encode the COOH terminal
extension (shown underlined in FIG. 7G). This protein arises
naturally from read-through together with a -1 frame shift, but
this process is inefficient. The synthetic T'-inserted cDNA
provides an efficient way of producing the SAg molecule shown in
FIG. 7G. The single reading frame in this <<synthetic>>
molecule thus corresponds to two different reading frames separated
by a stop codon in the natural molecule. Nucleic acid molecules
encoding an HERV env and including minus 1, plus 1 frameshifts and
termination suppression (0 frame) are thus particularly preferred
embodiments of the invention.
[0087] The invention further relates to proteins expressed by human
endogenous retroviruses having SAg activity and being associated
with human autoimmune disease. Peptides or fragments of these
proteins having at least 6 and preferably at least 10 aminoacids,
for example 6-50 or 10-30 amino acids, are also included within the
scope of the invention. Such proteins may be Gag, Pol or Env
proteins or may be encoded by any Open Reading Frame situated
elsewhere in the viral genome. These proteins may or may not
present SAg activity. Particularly preferred proteins of the
invention have SAg activity. Examples of SAg proteins of the
invention are proteins encoded by the env gene of HERV, for example
that shown in FIG. 7G.
[0088] The proteins having. SAg activity may naturally result from
a premature translational stop and possibly also from a
translational frameshift. Endogenous retroviral ORFs typically
contain a number of internal stop codons, which often render the
HERV defective. It has been discovered by the present inventors
that, in some cases, retroviral expression products having SAg
activity result from read-through transcription of the ORF,
possibly also accompanied by a reading frame shift. Consequently,
the proteins exhibiting SAg activity are not, in these cases, the
expected expression products of the retrovirus.
[0089] It may therefore be deduced that open reading frames of
retroviruses associated with human autoimmune disease which contain
at least one internal translational stop codon are among potential
candidates for SAg activity. The proteins produced by premature
translational stop may have an additional carboxy-terminal
extension resulting from translational frame shift, for example -1
or -2 or +1 or +2 translational frame shift. Such a protein is
Illustrated in FIG. 7G. Further preferred proteins of the invention
are the proteins encoded by synthetic cDNA, corresponding to the
in-frame fusion of two normally different reading frames, together
with mutation of the internal stop codon. These artificial
open-reading frames are made by inserting or deleting one or two
nucleotides in the coding sequence at the site where frame-shift
occurs naturally, thus <<correcting>> the reading frame
and enabling efficient production of a protein which is naturally
only produced very inefficiently.
[0090] Other proteins of the invention are those comprising the
aminoacid sequences shown in FIGS. 7D, 7F, 7H or an aminoacid
sequence having at least 80% and preferably at least 90% homology
with the illustrated sequences or fragments of these sequences
having at least 6 and preferably at least 10 aminoacids. The
proteins of the invention may be made by synthetic or recombinant
techniques.
[0091] The invention also relates to antibodies capable of
specifically recognizing a protein according to the invention.
These antibodies are preferably monoclonal. Preferred antibodies
are those which specifically recognize a retroviral protein having
SAg activity and which have the capacity to block SAg activity. The
capacity of the antibody to block SAg activity may be tested by
introducing the antibody under test into an assay system
comprising:
[0092] i) MHC Class II cells expressing retroviral protein having
SAg activity and
[0093] ii) cells bearing V.beta.-T cell receptor chains of the
family or families specifically stimulated by the HERV SAg
expressed by the MHC Class II.sup.+ cells, and determining the
capacity of the substance under test to diminish or block
V.beta.-specific stimulation by the HERV Sag.
[0094] The steps described below involve the use of Sag-expressing
transfectant cells such as those described in the examples, to
inhibit the effect of Sag in vitro and in vivo. The example applies
to the Sag expressed by the IDDM-associated HERV, as well as to
other Sags, encoded by HERV associated with other autoimmune
diseases, such as multiple sclerosis, and previously identified as
Sag by a functional T cell activation assay as described
earlier.
[0095] Mabs directed against the Sag protein (or portion of it) are
generated by standard procedures used to generate antibodies
against cell surface antigens. Mice are immunised with mouse cells
expressing both Sag and MHC class II (such as a Sag-transfected
mouse B cell line described in the examples below). After fusion
with hybridoma cell lines, supernatants are screened for the
presence of anti-Sag antibodies on microtiter plates for reactivity
to Sag transfectants cells, with non-transfected cells as negative
controls. Only Mabs with reactivity specific for Sag expressing
cells are selected.
[0096] All such Mabs, either as culture supernatants or as ascites
fluid, are then tested for their ability to block the Sag activity,
as assayed by the T cell assay in the presence of Sag-expressing
human MHC class II positive transfectants, as described in Example
4 below. A preferred version of this assay makes use of
V.beta.-specific hybridomas as T cell targets for read out.
Controls are blocking of the same assay by anti-HLA-DR Mabs, which
is known to inhibit the Sag effect on T cell activation. Mabs
capable of efficiently blocking the V.beta.-specific Sag effect,
when tested at several dilutions, are selected as anti-Sag blocking
Mabs.
[0097] As well as monoclonal antibodies capable of inhibiting IDDM
Sag, this generation and selection of anti-Sag blocking Mabs can be
achieved in the case of any HERV-encoded Sag associated with other
autoimmune diseases, once such a HERV-encoded Sag has been
demonstrated.
[0098] Sufficient numbers of anti-Sag Mabs are screened in the
functional assay to identify anti-Sag Mabs with optimal Sag
blocking activity, in terms of T cell activation (see for example
FIG. 9). Selected Sag blocking Mabs are then converted into their
<<humanised>> counterpart by standard CDR grafting
methodology (a procedure performed for a fee under contract by
numerous companies). A humanised anti-Sag blocking Mab, directed
against the IDDM associated Sag or against any Sag encoded by
another HERV associated with autoimmunity, can then be tested
clinically in patients. In the case of IDDM, early diagnosed
patients are selected and protection against progessive requirement
for insulin therapy is followed as an index of efficacy. In the
case of other autoimmune diseases, efficacy of the anti-Sag Mab is
followed with reference to the relevant clinical parameters.
[0099] The invention also relates to cells transfected with and
expressing human endogenous retrovirus having SAg activity and
being associated with a human autoimmune disease. The cells may be
preferably human cells other than the naturally occuring cells from
auto-immune patients and may also include other type of eukaryotic
cells such as monkey, mouse or other higher eukaryotes. The cells
may be established cell-lines and are preferably MHC class
II.sup.+, or MHC II.sup.+-inducible, such as .beta.-lymphocytes and
monocytes. Non-human higher eukaryotic cell-lines (e.g. mouse)
stably transfected with the HERV Sags of the invention (as
exemplified in Example 6 below) have been found to specifically
stimulate in vitro human v.beta.-T cells of the specificity
normally associated with the HERV Sag in vivo. The stimulation is
coreceptor independent (CD4 and CD8) This specific T-cell
stimulation can also be observed in vivo upon injection of the
transfectants into non-human animals. A transgenic animal model for
the human autoimmune disease is therefore technically feasible. The
transgenic animal is made according to conventional techniques and
includes in its genome, nucleic acid encoding the HERV Sags of the
invention.
[0100] A further important aspect of the invention relates to the
identification of substances capable of blocking or inhibiting SAg
activity. These substances are used in prophylactic and therapeutic
treatment of autoimmune diseases involving retroviral SAg activity.
The invention thus concerns methods for treating or preventing
autoimmune disease, for example IDDM, by administering effective
amounts of substances capable of blocking Sag activity associated
with expression of a human endogenous retrovirus. The substances
may be antibodies, proteins, peptides, derivatives of the HERV,
derivatives of the Sag or small chemical molecules. The invention
also relates to pharmaceutical compositions comprising these
substances in association with physiological acceptable carriers,
and to methods or the preparation of medicaments for use in therapy
or prevention of autoimmune disease using these substances.
[0101] Further, this aspect of the invention includes a process for
identifying substances capable of blocking or inhibiting SAg
activity of an endogenous retrovirus associated with autoimmune
disease, comprising: introducing the the substance under test into
an assay system comprising:
[0102] i) MHC Class II.sup.+ cells functionally expressing
retroviral protein having SAg activity and;
[0103] ii) cells bearing V.beta.-T cell receptor chains of the
family or families specifically stimulated by the HERV SAg
expressed by the MHC Class II.sup.+ cells, and determining the
capacity of the substance under test to diminish or block
V.beta.-specific stimulation by the HERV SAg,
[0104] The cells bearing the .beta.-T cell receptors and the MHC
Class II+ cells may be those described earlier. Read-out is IL-2
release.
[0105] The substances tested for inhibition or blockage of Sag
activity in such screening procedures may be proteins, peptides,
antibodies, small molecules, synthetic or naturally occurring,
derivatives of the retroviruses themselves, etc. . . Small
molecules may be tested in large amounts using combinatorial
chemistry libraries.
[0106] The screening procedure may include an additional
preliminary step for selecting substances capable of binding to
retroviral protein having SAg activity. This additional screening
step comprises contacting the substances under test, optionally
labelled with detectable marker with the retroviral protein having
SAg activity and detecting binding.
[0107] The Sags of the invention or a portion thereof may be used
for the identification of low molecular weight inhibitor molecules
as drug candidates.
[0108] The rational is that because HERV encoded Sags are the
product of ancient infectious agents, they are not indispensable to
humans and can thus be inhibited without adverse side effects.
[0109] Inhibitors of Sag, as potential drug candidates, are
preferably identified by a two step process:
[0110] In the first step, compatible with large scale, high
throughput, screening of collections <<<libraries>>)
of small molecular weight molecules, the recombinant Sag protein
(or portion of it) is used in a screening assay for molecules
capable of simply binding to the Sag protein
(=<<ligands>> ). Such high throughput screening assays
are routinely performed by companies such as Novalon Inc or
Scriptgen Inc, and are based either on competition for binding of
peptides to the target protein or on changes in protein
conformation induced by binding of a ligand to the target protein.
Such primary high throughput screening for high affinity ligands
capable of binding to a target recombinant protein are available
commercially, under contract, from such companies as Novalon or
Scriptgen. This screening method requires that a HERV protein with
Sag activity, and knowledge of such an activity, be available.
[0111] In the second step, any low molecular weight molecule
identified as described above as capable of binding to the Sag
protein, is tested in the functional Sag assay consisting of human
MHC class II positive Sag transfectants and responding
V.beta.-specific T cells (preferably hybridomas), as described
herein. Positive control for Sag inhibition is an anti-HLA-DR Mab,
known to inhibit the Sag effect. All candidate molecules are thus
tested, at different concentrations, for a Quantitative assessment
their anti-Sag inhibitory efficacy.
[0112] This example can apply to the Sag encoded by the
IDDM-associated HERV described herein, as well as to any other Sag
discovered to be encoded by another HERV associated with another
autoimmune disease.
[0113] This screening procedure relies upon the availability of a
Sag and of a Sag functional assay according to the invention, but
it otherwise relies on commercially available steps. Compounds
exhibiting anti-Sag inhibitory effects are then tested for obvious
toxicity and pharmacokinetics assays, in order to determine if they
represent valuable drug candidates.
[0114] Once a substance or a composition of substances has been
identified which is capable of blocking or inhibiting SAg activity,
its mode of action may be identified particularly its capacity to
block transcription or translation of SAg encoding sequences.
[0115] This capacity can be tested by carrying out a process
comprising the following steps
[0116] i) contacting the substance under test with cells expressing
retroviral protein having SAg activity, as previously defined,
and
[0117] ii) detecting loss of SAg protein expression using SAg
protein markers such as specific, labelled anti-SAg antibodies.
[0118] The antibodies used in such a detection process are of the
type described earlier.
[0119] The invention also relates to a kit for screening substances
capable of blocking SAg activity of an endogenous retrovirus
associated with an autoimmune disease, or of blocking transcription
or translation of the retroviral SAg protein. The kit
comprises:
[0120] MHC Class II.sup.+ cells transformed with and expressing
retroviral SAg according to the invention
[0121] cells bearing V.beta. T-cell receptor chains of the family
or families specifically stimulated by the HERV SAg;
[0122] means to detect specific V.beta. stimulation by HERV
SAg;
[0123] optionally, labelled antibodies specifically binding to the
retroviral SAg.
[0124] According to a further important aspect of the invention,
there is provided a protein or peptide derived from an autoimmune
related retroviral SAg as previously defined wherein the protein is
modified so as to be essentially devoid of SAg activity, thereby no
longer being capable of significantly activating auto-reactive
T-cells. Such modified proteins are however capable of generating
an immune response against SAg, the immune response involving
either antibodies and/or T-cells responses. The immunogenic
properties of the modified proteins are thus conserved with respect
with the authentic SAg.
[0125] Such modified immunogenic proteins may be obtained by a
number of conventional treatments of the SAg protein, for example
by denaturation, by truncation or by mutation involving deletion,
insertion or replacement of aminoacids. Modified SAg proteins being
essentially devoid of SAg activity but capable of generating an
immune response against SAg include the Truncations of the SAg
protein, either at the amino or carboxyterminal, and may involve
truncations of about 5-30 aminoacids at either terminal. A
preferred example with respect to the IDDMK 1.2-22 SAg encoded by
the Env gene illustrated in FIG. 7, particularly in FIG. 7E and
FIG. 7G, are amino and carboxy terminal truncations of the protein
shown in FIG. 7G, for example truncations of 5, 10, 15, 20, 25 or
30 amino acids. An example of a C-terminal truncation of the IDDMK
1.2-22 SAg protein is the protein shown in FIG. 7D, involving a
truncation of 28 amino acids. The modified protein may be obtained
by recombinant or synthetic techniques, or by modifying naturally
occuring SAg proteins, for example by physical or chemical
treatment.
[0126] These proteins are used in the framework of the invention as
vaccines, both prophylactic and therapeutic, against autoimmune
disease associated with retroviral SAg. The vaccines of the
invention comprise an immunogenically effective amount of the
immunogenic protein in association with a pharmaceutically
acceptable carried and optionally an adjuvant. The use of these
vaccine compositions is particularly advantageous in association
with the early diagnosis of the autoimmune disease using the method
of the invention. The invention also includes the use of the
immunogenic proteins in the preparation of a medicament for
prophylactic or therapeutic vaccination against autoimmune
diseases.
[0127] The rational behind this prospective immunisation technique
is that because HERV encoded Sags are the product of ancient
infectious agents, they are not indispensable to humans and can
thus be inhibited without adverse side effects.
[0128] Identification of suitable anti-sag vaccine proteins or
peptides can be made in the following way. Modified forms of the
original active Sag protein, including truncated or mutated forms,
or even specific peptides derived from the Sag protein, are first
tested in the functional Sag assays described above to confirm that
they have lost all Sag activity (in terms of T cell activation).
These modified forms of Sag are then used to immunise mice (or
humans) by standard procedures and with appropriate adjuvants.
Extent and efficacy of immunisation is measured, including
circulating anti-Sag antibodies. In a preferred example, eliciting
a B cell immune response, by selecting B cell epitopes from the Sag
protein as immunogen, is deliberately aimed at.
[0129] Successfully immunised animals are then tested for the
effect of Sag in vivo by a standard assay, namely the injection of
MHC class II positive Sag transfectants (such as the transfectants
described in the examples below), known to induce in vivo a
V.beta.-specific T cell activation. Successful immunisation against
a Sag protein is expected to result in a reduction or in a block of
the in vivo Sag-induced T cell activation and proliferation in
effectively immunised individuals. This procedure is referred to as
anti-Sag vaccination. Immunisation against Sag can be performed in
humans, for diabetes, preferably initially in the case of early
diagnosed IDDM patients. Efficacy of this novel
<<vaccination>> procedure is monitored by clinical
outcome and by reduction of the expected requirements for insulin
therapy. In the case of other Sags, encoded by HERV associated with
autoimmune diseases other than diabetes, the clinical outcome is
monitored accordingly.
[0130] The vaccines of the invention can be prepared as
injectables, e.g. liquid solutions or suspensions. Solid forms for
solution in, or suspension in, a liquid prior to injection also can
be prepared. Optionally, the preparation also can be emulsified.
The active antigenic ingredient or ingredients can be mixed with
excipients which are pharmaceutically acceptable and compatible
with the active ingredient. Examples of suitable excipients are
water, saline, dextrose, glycerol, ethanol, or the like, and
combinations thereof. In addition, if desired, the vaccine can
contain minor amounts of auxiliary substances such as wetting or
emulsifying agents, pH buffering agents, or adjuvants such as
aluminium hydroxide or muramyl dipeptide or variations thereof. In
the case of peptides, coupling to larger molecules (e.g. KLH or
tetanus toxoid) sometimes enhances immunogenicity. The vaccines are
conventionally administered parenterally, by injection, for
example, either subcutaneously or intramuscularly. Additional
formulations which are suitable for other modes of administration
includes suppositories and, in some cases, oral formulations.
[0131] The vaccines of the invention also include nucleic acid
vaccines comprising nucleic acid molecules encoding the human
retroviral Sag or modified forms of the SAg known to be immunogenic
but no longer active as SAgs. The nucleic acid vaccines,
particularly DNA vaccines, are usually administered in association
with a pharmaceutically acceptable carrier as an intra-muscular
injection.
[0132] The invention also relates to use of substances inhibiting
either the retroviral function or the SAg function of the
associated retroviruses, or Sag synthesis, in therapy for
autoimmune diseases. These substances may be identified by the
screening procedures described herein.
[0133] The invention further relates to methods for treatment or
prevention of autoimmune diseases comprising administering an
effective amount of a substance capable of inhibiting retroviral
function or a substance capable of inhibiting SAg activity or
synthesis.
[0134] An examples of compounds inhibiting retroviral function is
AZT. Examples of compounds or substances capable of inhibiting SAg
activity are antibodies to Sag, or ribozymes or antisense molecules
to the SAg-encoding nucleic acid, or small molecules identified by
virtue of their ability to inhibit SAg.
[0135] The invention also relates to a an exploratory process for
detecting human autoimmune disease associated with expression of
unidentified human retrovirus Superantigen (SAg), said process
comprising at least one of the following steps:
[0136] i) detecting the presence of any expressed retrovirus in a
biological sample of human origin;
[0137] ii) detecting the presence of SAg activity in a biological
sample of human origin containing MHC Class II.sup.+ cells.
[0138] This process can be used as a preliminary indication of the
involvement of retroviral superantigens in autoimmune disease.
[0139] Different aspects of the invention are illustrated in the
figures.
[0140] FIG. 1. Leukocytes from IDDM-patients release Reverse
Transcriptase (RT) activity.
[0141] (A) Supernatants derived from cultured islets isolated from
two patients (Conrad et al., 1994) were assayed for RT-activity,
using a half-logarithmic dilution series of purified murine
leukemia virus (MLV) RT as a standard (Pyra et al., 1994). Results
are expressed as mean.+-.1 SD. Islets and spleen cells from
non-diabetic organ donors were cultured either alone, in the
presence or absence of mitogen (-/+), or together in mixed
allogeneic cultures (time as days in culture prior to collection of
the supernatant is indicated below the bars).
[0142] (B) Islets and spleen cells from three non diabetic organ
donors, from the two patients with acute-onset IDDM, and two
patients with chronic IDDM (Conrad et al., 1994) were cultured for
1 week and supernatants were analyzed for the presence of
RT-activity. Results are expressed as mean.+-.1 SD for at least
three individual measurements.
[0143] FIG. 2A. Isolation of a single full length retroviral
genome, IDDMK.sub.1,222, with a six step procedure.
[0144] 1) cPBS primers (Lys.sub.1,2, Lys.sub.3, Pro, Trp) were used
to perform a 5' RACE 2) the eight 5' R-U5 sequences obtained in 1)
were used to perform a 3' RACE with primers annealing in the R 3)
the conserved RT-RNAse H region was amplified with degenerate
primers 4) the 5' moiety (the predicted size for full length
HERV-K-retroviruses is 3.6 kb was amplified by PCR using primers
specific for the eight 5' R-U5 sequences in conjunction with a
primer specific for the 3' of the central pol region obtained in
step 3. The primer specific for the K.sub.1,222 5' consistently
yielded a fragment of this size, 5) the 3' (the predicted size for
HERV-K-retroviruses is 5 kb ) was amplified by PCR using a primer
specific for the 5' of the central pol region isolated in step 3
and primers specific for the poly(A) signals present in the 3'
R-poly(A) sequences obtained in step 2. The PCR reaction using a
primer specific for the 3' clone K.sub.1,222 (amplified in step 4)
consistently yielded a fragment potentially representing an intact
3' HERV-K moiety of 5 kb, 6) the presence of an intact 8.6 kb
retroviral genome containing the overlapping 5' and 3' moieties
isolated in steps 4 and 5 was confirmed by PCR using primers
specific for its predicted U5 and U3 regions.
[0145] FIG. 2B. Consensus features of retroviral 5' end sequences
(termed STRs). These consensus features are valid for retroviruses
with a polyadenylation signal in the R (repeat) region. The R
region is characterized by the AATAAA or ATTAAA polyadenylation
signal (bold) followed by 13 to 20 nucleotides and the dinucleotide
CA or GA (bold) at the 3' end of the R region. The beginning of U5
region is defined by a GT- or T-rich sequence (underlined). The 3'
end of the U5 region is in all known retroviruses defined by the
dinucleotide CA, followed by one, two or three nucleotides and the
primer-binding site (PB)--(N) stands for nucleotide, the suffixes
x, y, and z for an undefined number.
[0146] FIG. 2C. Schematic representation of mRNA-specific PCR of
IDDMK.sub.1.2-22 using a poly (A)-specific probe (Rc-T.sub.(4)).
Details of this technique are given in the <<Experimental
Procedure>> Section of the Examples. This procedure results
in a Reverse-Transcriptase-dependent amplification of retroviral
genomes. The products generated can be diminished below background
by RNAse treatment.
[0147] FIG. 2D. Schematic representation of IDDMK.sub.1,2-22.
Provirus-specific PCR. The procedure specifically amplifies
proviral 5' and 3' LTRs (long terminal repeats).
[0148] The primers used in an RT-control are substituted with
either U5-primers 1) 5'ATC CAA CAA CCA Tga Tgg Ag 3' or 2) 5' TCT
Cgt Aag gTg CAA Atg Aag 3' at 0.3 .mu.M final concentration in
conjunction with the U3-primers using either 3) gTA Aag gAT CAA gTg
Ctg TgC 3' or 4) 5'CTT TAC AAA gCA gTA Ttg Ctg C 3' at 0.3 .mu.M
final concentration. 0.75 .mu.l of Taq- Pwo-polymerase mix
(Boehriner Mannheim, Expand.TM. High Fidelity PCR System) are used
with a thermocycler profile corresponding to the one described for
mRNA-specific RT-PCR and omitting the RT step.
[0149] Hybridization is performed with the probe and the methods
corresponding those used for mRNA-specific RT-PCR.
[0150] Sequence identity is confirmed by sequencing according to
standard procedures.
[0151] FIG. 2E. IDDMK.sub.1.2-22 RNA- and Provirus-specific PCR.
This procedure will result in amplification products independentely
of the presence or absence of RT-reactions and reflects the total
retroviral RNA- and DNA-templates present in a given sample.
[0152] The same conditions as in the proviral specific PCR are used
with U3 primers 1) 5'AAC ACT gCg AAA ggC CgC Agg 3' or 2) 5' Agg
TAT TgT CCA Agg TTT CTC C 3' in conjunction with R (repeat) primers
3) 5' CTT TAC AAA gCA gTA TTg Ctg C 3' or 4) 5' gTA Aag gAT CAA gTg
Ctg TgC 3'. Cycling conditions and primer concentrations are
identical to those described for proviral specific PCR.
[0153] FIG. 2F. IDDMK.sub.1,222 is an endogenous retrovirus found
in the plasma of IDDM patients at disease onset but not in the
plasma of healthy controls.
[0154] PCR primers pairs were designed that are either specific for
the U3-R- or for the U3-R-poly(A)-region of IDDMK.sub.1,222 (see
experimental Procedures). The U3-R primer pair amplified both viral
RNA and DNA, whereas the U3-R-poly(A) primer pair amplified
selectively viral RNA. The amplified material was hybridized with
probes generated with the molecularly cloned U3-R region of
IDDMK.sub.1,222. Signals in the first and third rows correspond to
amplification of contaminating DNA present in the plasma of IDDM
patients (left hand columns, 1-10) and controls (right hand
columns, 1-10) and were as expected RT-independent. In contrast,
signals in the second row resulted from the amplification of viral
RNA present only in IDDM patients (left hand columns, 1-10) but not
in the non diabetic controls (right hand columns, 1-10). This was
supported by the absence of amplification products in reactions
lacking RT (fourth row, right and left hand columns, 1-10). In
addition the signal could be diminished below background by RNAse
treatment (data not shown). In the fifth row the genomic DNA from
IDDM patients and controls was amplified with the U3-R-specific
primers. The primer pair specific for the U3-R-poly(A), in turn,
did not result in amplification of genomic DNA (data not
shown).
[0155] FIG. 3. Phylogenetic trees of coding and non-coding regions
place IDDMK.sub.1,222 in the HERV-K10 family of HERVs.
[0156] (A) IDDMK.sub.1,222 SU-ENV is most closely related to
HERV-K10, and is also related to the B-type retroviruses MMTV and
JSRV.
[0157] (B) The phylogenetic analysis of the RT region shows that
IDDMK.sub.1.222 belongs to the HERV-K10 family and is more closely
related to B-type retroviruses such as MMTV than to D-type
retroviruses such as Simian Mason Pfizer (SMP) or Spumaviridae
(SFV). Abbreviations used: SRV-2, Simian retrovirus; JSRV,
Jaagsiekte Sheep retrovirus; SFV; Simian foamy virus).
[0158] (C) The non-coding LTR region was used to construct a
phylogenetic tree of the HERV-K family. K.sub.1,21 and K.sub.1,24
(see above) were isolated only as subgenomic or truncated
transcripts. K.sub.1,21 is related to KC4, while K.sub.1,24 and
IDDMK.sub.1,222 are related to the K10/K18 subfamily. Within this
family, K.sub.1,24 is closely related K10, whereas IDDMK.sub.1,222
appears to be more distant.
[0159] FIG. 4. The pol-env-U3-R region of IDDMK.sub.1,222 exerts an
MHC class II dependent but not MHC restricted mitogenic effect upon
transfection in monocytes.
[0160] (A). IDDMK.sub.1,222 is expected to generate two singly
spliced subgenomic RNAs, one encoding ENV, and one comprising the
U3-R region. The episomal expression vector was engineered to carry
a proximal SD downstream of the promoter (pPOL-ENV-U3). Thus, the
two naturally expected subgenomic RNAs can also be generated.
[0161] (3) Monocytic cell lines do not express MHC class II surface
proteins in the absence of induction by Interferon-g (IMF-g),
(reviewed by Mach et al., 1996). The monocyte cell line THP1 was
transiently transfected with pPOL-ENV-U3 or with the expression
vector alone (pVECTOR). Mitomycin C treated transfectants, either
induced with INF-g or 48 h or non-induced (.+-.INF-g, indicated
below the x-axis) were cultured with MHC-compatible T cells at
different responder:stimulator ratios as indicated below the graphs
(T:APC). .sup.3H-Thymidine incorporation was measured during the
last 18 h of a 72 h culture and is given on the y-axis as
n.times.10.sup.3 cpm. Results are presented as mean.+-.1 SD.
[0162] (C) The MHC class II transactivator CIITA mediates INF-g
inducible MHC class II expression (reviewed by Mach et al., 1996).
An integrative and stable THP1-CIITA transfectant (THP1-CIITA) was
transfected with pVECTOR or pPOL-ENV-UR and was used in functional
assays identical to those described in FIG. 4B.
[0163] (D) Peripheral blood lymphocytes (PBL) from healthy,
MHC-unrelated donors (donors I, II and III indicated below the
x-axis) were cultured with retroviral (pPOL-ENV-U3) and control
transfectants (pVECTOR) at T:non-T ratios as indicated below the
graphs (T:APC).
[0164] FIG. 5. IDDMK.sub.1,222 mediates a Vb 7-specific
SAG-effect.
[0165] 10.sup.6 T cells/ml were cultured for 3 days with
Mitomycin-treated pPOL-ENV-U3 and pVECTOR transfectants at T:non-T
ratios as indicated. Twenty U/ml of recombinant IL-2 were then
added to the cultures and FACS analysis performed after 3 to 4 days
of expansion (Conrad et al., 1994).
[0166] (A) THP1 cells were transfected with pPOL-ENV-U3, the
stimulated and expanded T cells were stained with anti-CD3
monoclonal antibodies and an isotype control after 7 days of
coculture.
[0167] (B) T cells stimulated by THP1 transfected with the vector
(pVECTOR) alone were stained with anti-CD3 monoclonal antibodies
and the anti Vb 7-specific antibody 3G5.
[0168] (C) THP1 cells were transfected with pPOL-ENV-U3, the
stimulated T cells were stained with anti-CD3 monoclonal antibodies
and the anti Vb 7-antibody 3G5.
[0169] Table1. IDDMK.sub.1,222 mediates a Vb 7-specific SAG-effect.
The B lymphoblastoid cell line Raji was stably transfected with
either pPOL-ENV-U3 or pVECTOR, and used in functional assays
(equivalent to FIG. 5) 2 weeds after selection. The monocytic cell
line THP1 was cultured for 48 hours after transfection with the
same constructs. The percentages of double positive (CD3 and Vb-7,
Vb-8, -12) T cells are indicated that were obtained after 1 week of
coculture with the respective transfectants (pPOL-ENV-U3 or
pVECTOR).
[0170] FIG. 6. The N-terminal env moiety of IDDMK.sub.1,222
mediates the SAG-effect.
[0171] (A). Based on the construct pPOL-ENV-U3 different deletional
mutants were generated that comprised 1) pPOL: the pol gene; 2)
pPOL-ENV/TR: the pol -. and the N-terminal moiety of the env-gene;
3) pCI-ENV/TR: the N-terminal moiety of env-gene alone.
[0172] B). PBL from MHC unrelated donors were cocultured with
Mitomycin C treated THP1 cells as described in FIG. 4. The
individual transfectants are indicated with the names of the
constructs above the bars. (1) pVECTOR, 2) pPOL, 3) pPOL-ENV-U3, 4)
pPOL-ENV/TR, 5) pCI-neo, 6) pCI-ENV/TR). One of at least three
independent 3H-Thymidine incorporation experiments with allogeneic
T cells stimulated by the individual transfectants is shown. The
ratio between T cells and transfectants is indicated below the bars
(T:APC).
[0173] FIG. 7A. IDDMK.sub.1.222-5' LTR.
[0174] This figure shows the sequence of the 5' LTR (U3 RU5) of the
IDDMK.sub.1.222-provirus.
[0175] FIG. 7B. IDDMK.sub.1.222-3' LTR.
[0176] This figure shows the sequence of the 3' LTR (U3 RU5) of the
IDDMK.sub.1.222 provirus.
[0177] FIG. 7C. IDDMK.sub.1.222-env.
[0178] This figure shows the full nucleotide sequence of the env
coding region, starting with the ATG initiation codon at position
59 (as shown in FIG. 7D).
[0179] The first internal stop codon TAG at position 518 is
underlined co-responding to the codon where, following a -1 frame
shift, translation stops to give rise to the protein illustrated in
FIG. 7D.
[0180] The second internal stop codon TAG at position 601 (in frame
with the earlier TAG) is also underlined. Translational stop at
this codon gives rise to the IDDMK.sub.1.233-ENV/FS (SAG) protein
illustrated in FIG. 7G. The nucleic acid coding for the
IDDMK.sub.1.222-env/fs (SAG) protein s also shown in FIG. 7E.
[0181] FIG. 7D. The nucleotide and deduced amino acid sequence of
IDDMK.sub.1,222-SAG.
[0182] The minimal stimulatory sequence corresponding to the insert
of pCI-ENV/TR comprises a C-terminally truncated protein of 153
amino acids. There is only one ORF with a stop codon at position
518. The first potential start codon in a favorable context is at
position 59. Two potential N-linked glycosilation sites are present
at positions 106, and 182 respectively. The degree of homology with
other retroviral ENV proteins is shown in FIG. 3A. No significant
homology was detected with the SAG of MMTV or with autoantigens
known to be important in IDDM.
[0183] FIG. 7E. IDDMK.sub.1.222-env/fs-sag.
[0184] Wild-type Nucleotide sequence coding for the 181 amino acid
IDDMK.sub.1.222-ENV/FS-SAG protein shown in FIG. 7G. To give rise
to the SAg protein shown in FIG. 7G, translation of this nucleotide
sequence involves a read-through of the first stop codon at
position 518 followed Immediately by a -1 frame shift.
[0185] FIG. 7F. IDDMK.sub.1.222-ENV.
[0186] Deduced amino acid sequence encoded by the full env coding
region (as shown in FIG. 7B), without frame shift.
[0187] The underlined <<Z>> is the stop site for the
153 amino acid protein shown in FIG. 7D.
[0188] FIG. 7G. Recombinant IDDMK.sub.1.222 ENV/FS (SAG).
[0189] With respect to wild-type IDDMK.sub.1.222 env an insertion
of a T at position 517 (underlined) results in a predicted protein
corresponding to the one expected to be generated by
IDDMK.sub.1.222 ENV/FS. The additional predicted C terminal amino
acids that characterize ENV-FS are underlined. This protein has
marked SAg activity.
[0190] FIG. 7H. IDDMK.sub.1.222 POL.
[0191] Deduced amino acid sequence of the POL protein of
IDDMK.sub.1.222.
[0192] FIGS. 8A to 8G illustrate candidate 5' STRs isolated in the
first step of the six-step procedure (illustrated in FIG. 2A) to
isolate putative retroviral genomes from IDDM patients.
[0193] FIG. 9. Functional assay for the presence of
V.beta.7-IDDM-SAG in PBL.
[0194] PBL (peripheral blood lymphocytes) are isolated from 10 ml
of Heparine-blood (Vacutainer) from IDDM patients or controls with
Ficoll-Hypaque (Pharmacia).
[0195] 5.times.10.sup.6 PBL are incubated with or without 10.sup.3
U/ml recombinant human INF-.gamma. (Gibco-BRL) for 48 hours.
[0196] 100 .mu.g/ml Mitomycin C (Calbiochem) are added to
inactivate for 10.sup.7 cells for 1 hour at 37.degree.0 C., and
extensive washing is performed.
[0197] Culture with T cell hybridomas bearing human V.beta.-2, -3,
-7, -8, -9, -13 and -17 at stimulator:responder ratios of 1:1 and
1:3 in 96 round bottom wells.
[0198] TCR-crosslinking with anti-CD3 antibodies (OKT3) is used as
a positive control for each individual T hybridoma.
[0199] IL-2 release into the supernatant is measured with the
indicator cell line CTLL2 according to standard procedures.
[0200] Results are expressed as percentage of maximal stimulation
obtained with TCR crosslinking in the same experiments.
[0201] A selectively induced TCR-crosslinking and IL-release of
V.beta.7 is interpreted as being compatible with the presence of
IDDM-SAG in PBL from the individual analysed.
EXAMPLES
[0202] In two patients with type I diabetes, a dominant pancreatic
enrichment of one Vb-family, Vb 7, has been observed (Conrad et
al., 1994). The same dominant enrichment of Vb 7 could be mimicked
by stimulating T cells of diverse haplotypes with surface membrane
preparations derived from the pancreatic inflammatory lesions but
not with membranes from MHC-matched healthy control islets. This
was taken as evidence for the presence of a surface
membrane-associated SAG (Conrad et al., 1994).
[0203] In the framework of the present invention, the hypothesis
that this SAG is of endogenous retroviral origin has been tested.
Below it is shown that the SAG identified in these two patients is
encoded by a human endogenous retrovirus related to MMTV.
Expression of this endogenous SAG in IDDM suggests a general model
according to which self SAG-driven and systemic activation of
autoreactive T cells leads to organ-specific autoimmune
disease.
Example 1
Cultured Leukocytes from Inflammatory b-cell Lesions of
IDDM-Patients Release Reverse Transcriptase Activity
[0204] Expression of cellular retroelements may be associated with
measurable Reverse Transcriptase-activity (RT) (Heidmann et al.,
1991). An RT-assay detected up to a hundredfold increase in
RT-activity in supernatants from short-term cultures of freshly
isolated pancreatic islets derived from two patients (FIG. 1A),
(Conrad et al., 1994; Pyra et al., 1994). No RT-activity above
background levels was detected in medium controls, indicating that
the RT-activity could not be accounted for by a contamination of
the synthetic media and sera with animal retroviruses. We can also
exclude the possibility that the RT-activity represents cellular
polymerases released into the supernatant by dying cells. Indeed,
no RT-activity can be detected in cultures non-diabetic controls
under conditions in which cell death is strongly enhanced, namely
mitogen treated peripheral blood lymphocytes (PBL), splenocytes and
cocultures of islets with allogeneic T cells. Moreover, the
IDDM-derived islets were cultured for 5 days, whereas control
cultures were sequentially analysed for up to 4 weeks. Finally the
absence of RT-activity in the supernatants of the mitogen-treated
control PBL also excluded the possibility that the RT-activity
detected with the IDDM islets was simply due to non-specific cell
activation. Both, the islets and the inflammatory infiltration
represented potential sources for the enzymatic activity. As shown
in FIG. 13, supernatants from cultured spleen cells from the
patients contained more RT-activity than the inflammatory b-cell
lesions. Moreover, the RT-activity disappeared together with the
local inflammatory lesion in two patients with chronic and
long-standing disease, but it persisted in cultured spleen cells
from the same patient (FIG. 1B). This was interpreted as being
compatible with the leukocytes as the most likely source of this
RT-activity.
Example 2
Isolation of a Full Length Retroviral Genome, IDDMK.sub.1,222, from
Supernatants of IDDM Islets
[0205] A strategy to isolate putative retroviral genomes from
polyadenylated RNA extracted from the supernatants of IDDM islets
was developed (FIG. 2A). This strategy relies on the following
three characteristic features of functional retroviruses. First,
retroviral genomes contain a primer binding site (PBS) near their
5' end. Cellular tRNAs anneal to the PBS and serve as primers or
Reverse Transcriptase (reviewed by Whitcomb and Hughes, 1992).
Second, the R (repeat) sequence is repeated at the 5' and 3' ends
of the viral RNA (Temin, 1981). Third, the RT-RNAse H region of the
pol gene is the most conserved sequence among different
retroelements (McClure et al., 1988; Xiong and Eickbusch, 1990).
These three features were exploited in a six step procedure as
follows.
[0206] 1) To isolate the 5' ends (5'R-U5) of putative retroviral
RNA genomes, a 5' RACE procedure was performed with primers
complementary to known PBS sequences (cPBS primers) (Weissmahr et
al., 1997). Most retroviruses known have a primer binding site
(PBS) complementary to one of only four individual 3' ends of
tRNAs: tRNA.sup.Pro, tRNA.sup.Lys3, tRNA.sup.Lys1.2 and
tRNA.sup.Trp. Accordingly, sequence-specific primers complementary
to the four PBSs were used to derive cDNA (Weissmahr, 1995). The
amplification products resulting from anchored PCR and of 100-700
bp in size were sequenced and analyzed for the presence of
consensus sequences typically found in retroviral 5' R-U5s
(Weissmahr, 1995).
[0207] Eight different candidate 5'R-U5 sequences (5'K.sub.1,2-1,
-4, -10, -16, -17, -22, -26 and -27) were obtained with the
cPBS-Lysine.sub.1,2 primer. All eight sequences contained features
typical of the 5' ends of retroviral genomes (Temin, 1981). These
include the presence at the expected positions of i) a PBS region,
ii) conserved and correctly spaced upstream regulatory sequences,
such as a poly(A) addition signal and site, and the downstream GT-
or T-rich elements (Wahle and Keller, 1996), iii) a putative 5' end
specific U5 region and iv) a putative R region. Of the eight 5'
R-U5 sequences isolated, three (5'K.sub.1,2-1, -4, and -22) were
identified on the basis of sequence homology as belonging to
previously identified families of human endogenous retroviruses
(HERVs) that are closely related to mouse mammary tumour viruses
(MMTV), namely HERV-K(C4) (Tassabehji et al., 1994), HERV-K10 and
HERV-K18 (Ono, 1986a; Ono et al., 1986b). The remaining give
sequences exhibited only a distant relationship with HERV-K
retroviruses.
[0208] 2) A repeat (R) region conserved in the 5' R-U5 and the 3'
U3-R-poly(A) is essential for retroviral first strand DNA synthesis
to proceed to completion (Whitcomb and Hughes, 1992). Primers
specific for the R region-sequence obtained for individual 5' R-U5s
were used to prime the cDNA synthesized with oligo(dT), (Weissmahr,
1995). Products resulting from anchored PCR were sequenced and
analyzed for the presence of a conserved R region followed by a
poly(A)-tail. The eight 3'R-poly(A) ends (3'K.sub.1,2-1, -4, -10,
-16, -17, -22, -26 and -27) corresponding to the eight different
5'R-U5 regions identified in step 1 were isolated by means of a 3'
RACE procedure using primers specific for the R regions. In each
case, the isolated sequences contained the expected R region
followed by a poly(A) tail.
[0209] 3) The conserved RT-RNase H region within the pol gene was
next amplified by PCR using degenerate primers (Medstrand and
Blomberg, 1993). 15 individual subclones were sequenced and all
exhibited approximately 95% similarity at the protein level to the
RT-RNase H region of the HERV-K family.
[0210] 4) The 5' moiety (from the U5 region at the 5' end to the
pol gene) of the putative retroviral genome was amplified by PCR
using primers specific for the eight different U5 regions present
in the 5'R-U5 sequences (isolate in step 1) in conjunction with a
primer specific for the 3' end of the central pol region (isolated
in step 3). The expected size of the PCR product corresponding to
the 5' moiety of full length HERV-K retroviruses is 3.6 kb (Ono et
al., 1986b). Only the PCR reaction using the primer specific for
the K.sub.1,222 5' end clone consistently yielded a fragment of
this size. Sequence analysis of several independent clones
confirmed that this 3.6 kb fragment contains the R-U5-PBS region
followed by coding regions corresponding to the gag and pol genes,
and thus indeed represents the 5' moiety of an intact retroviral
genome
[0211] 5) The 3' moiety (from the pol gene to the 3' end) of the
putative retroviral genome was amplified by PCR using a primer
specific for the 5' end of the central pol region (isolated in step
3) and primers specific for the poly(A) signals present in the
3'R-poly(A) sequences (isolated in step 2). The expected size of
the PCR product corresponding to the 3' moiety of full length
HERV-K-retroviruses is 5 kb (Ono et al., 1986b). The PCR reaction
using a primer specific for the 3' end clone K.sub.1,222, which is
the one that should correspond to the 3' end of the retrovirus from
which the 3.6 kb 5' moiety was amplified in step 4, consistently
yielded a fragment potentially representing an intact 3' moiety of
5 kb. Sequence analysis of several independent clones confirmed
that this 5 kb fragment indeed contains coding regions
corresponding to the pol and env genes followed by the expected
U3-R-poly(A) region.
[0212] 6) Finally, the presence of an intact 8.6 kb retroviral
genome containing the overlapping 5' and 3' moieties isolated in
steps 4 and 5 was confirmed by PCR using primers specific for its
predicted U5 and U3 regions.
[0213] The full length retroviral genome that was isolated was
called IDDMK.sub.1,222, where IDDM refers to the tissue source,
K.sub.1,2 refers to Lysine.sub.1,2 cPBS primer and 22 represents
the serial number of the clone. IDDMK.sub.1,222 was determined to
be novel retrovirus on the basis of two criteria. First, it has a
unique pattern of restriction enzyme cleavage sites that is
distinct from that of other known viruses. Second, its nucleotide
and amino acid sequences in non-coding and coding regions diverge
from other known retroviruses by at least 5-10%.
[0214] IDDMK.sub.1,222 was the only full length virus identified in
these experiments, suggesting that it is the only functional
retrovirus specifically associated with the supernatants of the
cultured IDDM islets. PCR. reactions using primers specific for the
other 5'R-U5-PBS and 3'U3-R-poly(A) clones isolated in steps 1 and
2 did not yield fragments of the size expected for intact
retroviral genomes in steps 4 and 5. In particular, primers
specific for the 5' and 3' ends corresponding to the ubiquitous
HERV-K10 virus did not amplify fragments corresponding to complete
genomes, although this virus is known to be released as full length
genome associated with viral particles from several cell lines and
tissues (Tonjes et al., 1996). Our inability to detect full length
HERV-K10 genomes in the IDDM islet supernatant is unlikely to be
due to a technical problem because it could be amplified very
efficiently from both genomic DNA and a size selected cDNA library
prepared from a B-lymphoblastoid cell line (data not shown). It is
more likely that HERV-K10 is not released in significant amounts by
the cultured IDDM islets.
[0215] Finally, i) we confirmed by RNA-specific PCR that sequences
identical, or highly similar, to the 3' U3-R-poly(A) of
IDDMK.sub.1,2 were present in RT-positive but not in RT-negative
samples analysed; ii) in a preliminary epidemiological study we
detected by PCR sequences identical, or highly similar, to the 3'
U3-R-poly(A) of IDDMK.sub.1,2 only in the plasma of 10 recent onset
IDDM patients but not in the plasma of 10 age-matched non diabetic
controls (FIG. 2F); and iii) we confirmed by PCR the presence of
sequences identical, or highly similar to the U3-R region of
IDDMK.sub.1,2 in genomic DNA of IDDM patients (n=10) and non
diabetic controls (n=10) (FIG. 2F). In summary, these data indicate
that IDDMK.sub.1,2 is an endogenous retrovirus that is released
from leukocytes in IDDM patients but not in non diabetic
controls.
Example 3
IDDMK.sub.1,222 is a Novel Member of the MMTV-Related Family of
hERV-K, and is Related to HERV-K10
[0216] To evaluate the relationship between IDDMK.sub.1,222 and
other known retroviruses we derived phylogenetic trees for
subregions exhibiting different degrees of conservation (Galtier et
al., 1996; Saitou and Nei, 1987; Thompson et al., 1994). The three
regions chosen for this analysis were the RT region of the pol gene
(FIG. 3B), the outer region (SU, surface) of the env gene (FIG. 3A)
and the U3 region of the LTR (FIG. 3C). The RT and SU regions were
selected to construct interspecies phylogenetic trees because they
represent, respectively, the most highly conserved and the most
variable of the protein coding regions (McClure et al., 1988). The
U3 region of the LTR was chosen to construct an intraspecies tree
of the family to which IDDMK.sub.1,222 belongs because LTR
sequences are conserved in size and sequence only within a given
species, and the U3 region accounts for most of the intraspecies
differences (Temin, 1981). As shown in FIG. 3A, the ENV polyprotein
of IDDMK.sub.1,222 is most closely related to that of HERV-K10.
Both proteins are related to those of MMTV and Jaagsiekte sheep
retrovirus (JSRV). The same is essentially true for the
RT-subregion of the POL polyprotein, where IDDMK.sub.1,222 and
HERVK10 are most closely related to the B-type retrovirus MMTV
(FIG. 3B). FIG. 3C illustrates, that K.sub.1,21 is related to
HERV-K(C4), while K.sub.1,24 and IDDMK.sub.1,222 are related to the
K10/K18 subfamily. Within this family, K.sub.1,24 is closely
related to K10, whereas IDDMK.sup.1,222 appears to be more
distant.
Example 4
IDDMK.sub.1,222 Encodes a V.beta.7-Specific SAG
[0217] The strategy used to identify a putative SAG-function
encoded by IDDMK.sub.1,222 was dictated by 1) predictions based on
the biology of the MMTV-SAG, 2) general requirements for a
protein-protein interaction between a SAG and MHC class II
molecules and 3) intracellular trafficking mechanisms used by
proteins encoded by retroviruses. The prototypical retroviral SAG
of MMTV is a type II transmembrane protein that is encoded within
the U3 of the 3' LTR (reviewed by Acha-Orbea and McDonald, 1995).
It is targeted into the MHC class II peptide loading compartment
and exported to the cell surface. On the basis of potential splice
donor (SD) and acceptor sites (SA) present in its sequence,
IDDMK.sub.1,222 is expected to generate two subgenomic mRNAs, one
encoding ENV and a second transcript comprising the U3-R region
(FIG. 4A). Based on these criteria we produced an episomal
expression construct (pPOL-ENV-U3) with a 5' SD positioned upstream
of the truncated pol, env and U3-regions (FIG. 4A). It is expected
that both of the putative subgenomic mRNAs can be generated from
this construct (FIG. 4A).
[0218] Retroviral- and control-transfectants of monocyte- and B
lymphocyte-cell lines were generated and tested for their ability
to stimulate MHC compatible and allogeneic T cell lines in a
V.beta.7-specific manner. Monocytes do not express measurable MHC
class II surface proteins in the absence- of induction by
Interferon-.gamma. (INF-.gamma.); the MHC class II transactivator
CIITA mediates INF-.gamma.-inducible MHC class II expression
(reviewed by Mach et al., 1996). As shown in FIG. 4A, transient
monocyte (THP1, U937) transfectants induced with INF-g and
expressing the truncated IDDMK.sub.1,222 genome (pPOL-ENV-U3)
stimulated in a dose-dependent fashion T cell lines from
MHC-compatible donors essentially to the same extent. The mitogenic
effect was dependent on the presence of MHC class II, since
INF-g-mediated MHC class II expression specifically induced the
stimulatory capacity of retroviral- as compared to
control-transfectants (FIG. 4B). The use of THP1 cells rendered
constitutively MHC class II positive by transfection with CIITA
resulted in a stimulation comparable to INF-g-induction, suggesting
that the INF-g-induced and CIITA-dependent MHC class II expression
was indeed responsible for this functional difference (FIG. 4C).
The mitogenic effect is not MHC-restricted, since a response
exceeding allostimulation was observed when PBL from several
different MHC-disparate donors were tested for proliferative
responses to monocytes transfected with pPOL-ENV-U3 (FIG. 4D). In
essence, these functional data suggest that the truncated
IDDMK.sub.1,222 (pPOL-ENV-U3) genome is responsible for a mitogenic
effect that is MHC class II-dependent but not MHC-restricted.
[0219] Experiments were performed in bulk-cultures using
TCR-V.beta.-specific stimulation and expansion as a readout.
Retroviral THP1 transfectants induce a more than 15 fold increase
in the number of the V.beta.-7 family but not of the two control
families tested (V.beta.8, Vb12) after specific stimulation and
subsequent amplification (FIG. 5, Table 1). This was verified by
using two different V.beta.-7-specific monoclonal antibodies, 3G5
and 20E. A comparable effect was also observed when PBL from
MHC-disparate donors were tested. This was interpreted as evidence
for the presence a V.beta.-7-specific SAG.
[0220] The monocytic cell lines were at least 3 times more
efficient in terms of specific TCR Vb-7 amplification as compared
to the most efficient B lymphoblastoid cell line (Table 1). This
difference could not be explained by variations in the level of MHC
class II expression or by the individual MHC haplotypes present. On
the other hand, it may be due to differential expression of
costimulatory molecules or secretion of cytokines. In conclusion,
by all criteria known to date, IDDMK.sub.1,222 encodes a mitogenic
activity having all features of a Vb-7-specific SAG.
3TABLE 1 IDDMK.sub.1.222 mediates a V.beta.7-specific SAG-effect
V.beta.-FAMILY TRANSFECTANT V.beta.-7 V.beta.-8 V.beta.-12
Raji-pPOL-ENV-U3 7% 5% 2.5% Raji-pVECTOR 1.5% 5.5% 2%
THP1-pPOL-ENV-U3 16% 5.3% 2.8% THP1-pVECTOR 1% 5.8% 3%
Example 5
The SAG Function is Mediated by the N-Terminal Moiety of the env
Protein
[0221] A series of deletional mutants were generated that contained
either the truncated pol-env-U3 region (pPOL-ENV-U3), the truncated
pol gene alone (pPOL), or the truncated pol gene followed by the
env gene truncated downstream of the premature stop codon found in
all clones (pPOL-ENV/TR), (FIG. 6A). In addition, a C-terminally
truncated env gene was generated as an individual expression unit
(pCI-ENV/TR). As shown in FIG. 6B, by excluding the env-coding
region the SAG-function is selectively lost (pPOL). If, however,
the truncated env gene is included (pPOL-ENV/TR), the stimulatory
capacity is restored to levels comparable so pPOL-ENV-U3. In
addition, expression of the truncated env gene alone (pCI-7-NV/TR)
is sufficient for function. These findings demonstrate that the SAG
function is mediated by the N-terminal moiety of the env gene
comprising 153 amino acids. The nucleotide and predicted amino acid
sequences of the minimal stimulatory region are shown in FIG. 7. As
shown in FIG. 3A, this predicted protein resembles the N-terminal
ENV proteins of related HERVs (HERV-K10), and those of the B-type
retroviruses (MMTV, JSRV). However, there is no significant
sequence homology with either MMTV-SAG, other SAGs, or autoantigens
known to be important in IDDM.
[0222] Here, evidence is provided showing that a human endogenous
retrovirus, IDDMK.sub.1,222, is released from leukocytes in
patients with acute onset type I diabetes. In preliminary
experiments IDDMK.sub.1,222 RNA sequences were detectable in the
plasma of IDDM patients at disease onset but not in the plasma of
age-matched healthy controls. This novel human retrovirus is
related to MMTV and encodes a SAG with functional characteristics
similar to the one encoded by MMTV. In contrast to MMTV, however
the IDDM-associated SAG is encoded within the retroviral env gene
rather than within the 3' LTR. It has the same TCR
V.beta.7-specificity with the SAG originally identified in the IDDM
patients. This SAG is thus likely to be the cause of the
Vb7-enriched repertoire of islet-infiltrating T lymphocytes.
[0223] IDDMK.sub.1,222 as a Member of the HERV-K Class of
Endogenous Retroviruses
[0224] HERV-K genomes exist in two different forms, type I genomes
which are largely splice deficient and type II genomes which
generate three subgenomic mRNAs (Tonjes et al., 1996; Ono, 1986). A
292 bp insert at the pol-env boundary with clustered nucleotide
changes downstream of the splice acceptor site are present in type
II but not in type I genomes (Tonjes et al., 1996). The insert
affects both, the env and pol gene: i) type II genomes have a stop
codon between env and pol which is missing in type I genomes and
ii) have a considerably longer N terminal env region. The 292 bp
insert and the clustered nucleotide changes have been proposed to
be responsible for the efficient splicing of type II genomes
(Tonjes et al., 1996). IDDMK.sub.1,222 is missing the 292 bp insert
but has two in frame stop codons between env and pol and the
clustered nucleotide changes downstream of the SA typical of those
found in type II genomes. In terms of splice efficiency,
IDDMK.sub.1,222 may be in an intermediate position between type I
and II genomes. This and the altered N terminal sequences in
IDDMK.sub.1,222 with respect to type II genomes may affect SAG
expression in vivo. However, as shown in FIG. 4, the 3' terminal
moiety (POL-ENV-U3) of the IDDMK.sub.1,222 genome mediates the SAG
function in vitro. Moreover, it is known from MMTV that the SAG
function in vivo may be present at levels where the respective
protein remains undetectable (Winslow et al., 1992; reviewed by
Acha-Orbea and MacDonald, 1995).
[0225] The Model: Human Self SAGs as Activators of Autoreactive T
Cells in Type I Diabetes
[0226] A model is proposed according to which induction of self
SAGs in systemic and professional APCs, outside the pancreas, leads
to autoimmunity in genetically susceptible individuals. The model
implies two steps, the first is systemic, the second
organ-specific. The initial event is a-systemic, polyclonal
activation of a Vb-restricted T cell subset, triggered by the
expression of an endogenous retroviral SAG in professional MHC
class II.sup.+APCs. In a second step, autoreactive T cells within
the subset of SAG-activated T lymphocytes initiate organ-specific
tissue destruction. The evidence presented here, however, does not
rule out that the release of the IDDMK.sub.1,222 RNA sequences in
vivo and the SAG function associated with IDDM in these patients
are the consequence rather than the cause of the inflammation.
[0227] The expression of self SAGs can in principle be modulated by
two variables: physiological endogenous stimuli or environmental
stimuli. A possible physiological stimulus might be steroid
hormones. HERV-K10 expression is steroid-inducible in vitro and
this is possibly the result of hormone response elements (HRE)
present in its LTR (Ono et al., 1987). IDDMK.sub.1,222 and HERV-K10
share the same putative HRE in their respective LTRs (Ono et al.,
1987), (FIG. 3). Steroid inducibility of IDDMK.sub.1,222 could
therefore also occur n vivo, in analogy to the well documented
example of the transcriptional control by steroid hormones of the
MMTV promoter (reviewed by Acha-Orbea and Mac Donald, 1995).
Infectious agents are of major importance when considering
environmental factors. Examples include the cellular SAGs that are
expressed by herpesvirus-infected monocytes and B-lymphocytes
(Dobrescu et al., 1995; Sutkowski et al., 1996). In both cases,
HERVs have not been excluded as a potential source of the
SAG-activity. It is thus conceivable that SAGs are being
selectively expressed in response to ubiquitous pathogens such as
herpesviridae (reviewed by Roizman, 1996). In fact, HERVs are
induced by a variety of environmental stresses, and some of them
behave as hepatic acute-phase genes (reviewed by Wilkinson et al.,
1994).
[0228] The experimental evidence presented suggests that the
RT-activity, the IDDMK.sub.1,222 RNA sequences and in consequence
the SAG may derive from leukocytes rather than from the pancreatic
b-cells. This may indicate that expression of the retroviral SAG is
induced preferentially in systemically circulating professional MHC
class II.sup.+ APCs. The highest rate of IDDM coincides with
puberty (10-14 years) in both sexes (Bruno et al., 1993).
Infections with ubiquitous viruses (reviewed by Roizman, 1996) may
act synergistically with an increase in the circulating levels of
steroids to enhance expression of the SAG in professional APCs.
Autoreactive T cells can be readily demonstrated in the mature
repertoire of healthy individuals (Pette et al., 1990). However, in
order to able to migrate to the target tissue these T cells have to
be activated (reviewed by Steinman, 1995). These considerations
lead us to the hypothesis that among the Vb7.sup.+-T cells
activated by IDDMK.sub.1,222-SAG, some are autoreactive and migrate
to the target tissue were b-cell specific death ensues. Once
b-cells die, cellular antigens are liberated and the immune
response perpetuated through determinant spreading (reviewed by
McDevitt, 1996).
[0229] The Concept of IDDMK.sub.1,222-sag as Autoimune Gene
[0230] Known genes conferring susceptibility to autoimmune diseases
are host-derived, stably inherited Mendelian traits and contribute
in a cumulative fashion to the familial clustering of the disease
without causing disease per se (reviewed by Todd, 1996).
IDDMK.sub.1,222 should be viewed as mobile genetic element with the
potential to move within the host genome due to multiple
mechanisms, including retrotransposition, homologous recombination,
gene conversion and capture, resulting in multiple copies of
individual HERVs (reviewed by Preston and Dougherty, 1996;
Wain-Hobson, 1996). This renders family studies dealing with
searches for HERV-disease association difficult. It should be
noted, however, that there is little or no plus/minus genetic
polymorphism in different humans at the HERV-K loci and as yet no
evidence for mobility. Interestingly, an IDDMK.sub.1,222-related
HLA-DQ-LTR is associated with susceptibility to IDDM, possibly due
to cosegregation with the HLA (FIG. 3C), (Badenhoop et al., 1996).
In addition, infectious transmission cannot be excluded, as is the
case for two closely related virus groups containing endogenous and
exogenous variants: MMTV and JSRV (FIGS. 4A and 4B), (reviewed by
Acha-Orbea and McDonald, 1995; York et al., 1992).
[0231] In summary, this candidate autoimmune-gene has distinctly
different features from classical, disease-associated
susceptibility genes. It has the potential of being transmitted as
either an inherited trait or as an infectious agent. Moreover, this
gene has no apparent essential function for the host but it may
have instead an inducible and intriguing potential to directly
cause disease whenever expressed in genetically susceptible
individuals.
Example 6
Development of an Animal Model to Document and Study the Sag Effect
in vivo
[0232] Several mouse cell lines, in particular a B lymphocytes line
(A20) and a monocyte line (WEHI-3) were stably transfected with the
IDDM Sag cDNA (corresponding to the minimal region encoding a.a. 1
to 153 of the env protein of IDDM1,2,22, as described above). The B
cell lines express mouse MHC class II molecules constitutively. In
the case of monocyte lines, the transfectants are induced to
express mouse MHC class II molecules by treatment with mouse
interferon gamma (100-1000 units of mouse interferon (Genzyme) per
ml for 48 hrs).
[0233] These MHC class II positive Sag transfectants were capable
of stimulating (in vitro) human T lymphocytes of the V.beta.7
specificity, and not V.beta.8 or V.beta.12 as negative controls.
This demonstrates that the IDDM Sag can function when expressed on
MHC class II positive mouse cells. These Sag-expressing, MHC class
II positive, mouse transfectants are used to immunise mice against
the Sag protein and to generate anti Sag monoclonal antibodies,
using as control the homologous untransfected cell lines.
[0234] This Sag effect lead to the stimulation of V.beta.7-specific
T lymphocytes of both the CD4 and the CD8 type. This observation
indicates that the IDDM Sag functions in T cell activation in a
manner that is independent of the co-receotors CD4 and CD8. This
situation is different from what is observed in the case of the
mouse MMTV Sag, where only CD4 T lymphocytes are stimulated.
[0235] The same MHC class II positive mouse stable Sag
transfectants (A 20, B lymphocytes and WEHI-3, monocytes),
expressing the minimal functional region of IDDM Sag defined above
(and corresponding to a.a. 1 to 153 of the env protein of
IDDM1,2,22) specifically stimulated mouse T lymphocytes of the
V.beta.4 and the V.beta.10 specificity. (These are the most highly
related mouse Vb sequences, from a structural point of view, to
human V.beta.7).
[0236] Again, both CD4 and CD8 mouse T lymphocytes were activated,
indicating a Sag mediated activation that is independent of the CD4
and CD8 co-receptors.
[0237] More importantly, injection of the same stable Sag
transfectants into mice (either in the bind foot path or in the
tail vein) lead to in vivo activation of T lymphocytes, again with
the same V.beta. specificity observed upon in vitro mouse T cell
activation by the IDDM Sag. T cell activation and V.beta.
specificity in response to the injection of Sag transfectants was
monitored by analysis of T lymphocytes in draining lymph nodes and
in the spleen.
[0238] The ability to induce V.beta.-specific T lymphocyte
activation in vivo n mice following injection of MHC class II
positive transfectants expressing IDDM Sag indicates that the
biological effect of IDDM Sag can now be monitored in an in vivo
animal model. This allows the testing in vivo, not only of a Sag
biological effect, but also of potential inhibitors of the effect
of Sag, such as anti-Sag antibodies, including monoclonal anti-Sag
antibodies, and small molecular weight inhibitors of Sag (first
identified as inhibitors of Sag in in vitro cell based assays)
Finally, this in vivo model of the biological effect of Sag allows
to test the effect of prior immunisation of animals with the Sag
protein (or derivatives thereof) on the biological effect of Sag in
vivo. This model provides a test of the possibility of a protective
vaccination against IDDM Sag in vivo.
[0239] Transgenic mice carrying the IDDM Sag gene have been
obtained. The Sag gene is under the control of a tetracycline
operator element (consisting of a heptameric repeat of the Tn
motive linked to a minimal promoter). These transgenic mice have
been crossed with two other transgenic mice carrying the
tetracycline transactivator gene (TTA) under the control of the CMV
promoter. One transgenic (CMV-TTA) induces the tet transactivator
upon withdrawal of tetracycline, while the other (CMV-RTTA) induces
the tet transactivator in the presence of tetracycline. These
double transgenic mice permit the deliberate, selective and
controlled expression of Sag in vivo, allowing the subsequent study
of immunopathological consequences of Sag expression.
[0240] Exactly the same steps can be followed (=Sag-expressing
mouse cells and Sag expression in vivo.) to establish animal models
of the effect of other Sags encoded by other HERVs in the context
of other autoimmune diseases, such as multiple sclerosis or
rheumatoid arthritis.
[0241] Experimental Procedures
[0242] Patients
[0243] The the islets and spleens from patients with acute onset-
and chronic IDDM and non diabetic organ donors were provided by the
Pittsburgh Transplant Institute (Conrad et al., 1994).
[0244] The plasma and genomic DNA from patients and controls for
the epidemiological study were isolated by the Diabetes Register in
Turin, Italy (Bruno et al., 1993). The samples were collected
within 1 month after the clinical diagnosis from patients, aged
from 0-29 years (Bruno et al., 1993).
[0245] RT Assays
[0246] RT assays were performed as described (Pyra et al.,
1994).
[0247] Isolation of Full Length associated Retroviral Genomes
[0248] A description of the criteria used to identify unknown
retroviral 5' R-U5s and 3' R-poly(As) has been published (Weissmahr
et al., 1997).
[0249] I. Primers sequences for the 3'moiety of the putative
retroviral genomes; abbreviations are according to Eur. J. Biochem.
(1985). 150, 1-5.
4 A. RT region RT 1a 5'YAAATggMgWAYgYTAACAqACT3' RT 1b
5'YAAATggMgWAYgYTAACTgAcT3' RT 2a-nested
5'CgTCTAgAgCCYTCTCCggCYATgATCCCg3' RT 2b-nested
5'CgTCTAgAgCCYTCTCCggCYATgATCCCA3'
[0250] B. 3' U3-R-Poly(As): all primers have an identical
5'-anchor:
5 5'TgCgCCAgCAATgTATCCATg3' + sequence-specific part #1K1, 2-1
5'gggTggCAgTgcATcATAggT3' #4K1, 2-4 5'gggAgAgggTcAgcAgcAgAcA3' #K1,
2-10 5'gACAgCAAgccAgTgATAAgcA3' #K1, 2-16 5'ggAACAgggAcTcTcTgcA3'
#K1, 2-17 5'gggAAgggTAAggAAgTgTg3' #K1, 2-22
5'ggTgTTTCTccTgAgggAg3' #K1, 2-26 5'gAAgAATggccAAcAgAAgCT3' #K1,
2-27 5'gggAAACAAggAgTgTgAgT3'
[0251] common, secondary anchor primer:
[0252] 3'U3-R-poly(As)common
6 5'CATgTATATgCggCCgCTgCgCCAgCAATgTATCCATgg3'
[0253] II. Primer sequences for the 5' moiety of the genome:
7 A. RT-region RT 1 5'TATCTTTCgTTTCTgCAgCAC3' RT 2
5'TAACTggTTgAAgAgCTCgACC3' B. 5'-R-U5 R-U5-1
5'ATACTAAggggACTCAgAggC3' R-U5-2
5'CAgAggCTggTgggATCCTCCATATgC3'
[0254] The PCR conditions were as follows: 1.times.94+C. 2 min; 45+
C. 5 min; 68+ C. 30 min; 10.times.94.degree. C. 15 sec; 45.degree.
C. 30 sec+1.degree. C./cycle; 68.degree. C. 3 min 30 sec;
25.times.: 94.degree. C. 15 sec; 55.degree. C. 30 sec; 68.degree.
C. 3 min 30 sec+20 sec/cycle. Primers were used at 300 nM final
concentration, dNTPs at 200 mM, with 52 U/ml of Taq-Pwo
polymerase-mix (Boehringer Mannheim). One vol % of first-round PCR
was subjected to a nested PCR. Size selected and purified
amplification products were blunted, EcoRI adapted and subcloned
into EcoRI-digested lZAPII-arms. After two rounds of hybridisation
20 individual clones were rescued as plasmids. Eleven clones were
selected for further analysis based on a conserved restriction
pattern. An equivalent procedure was followed for the 5' moiety of
the genome. Sequencing was performed on an automatic sequencer
(ABI, Perkin Elmer) using subgenomic clones.
[0255] Epidemiological study. RNA-PCR. Three ml of blood was
collected in EDTA tubes (Vacutainer) and further processed within 6
hours. Samples were subjected twice -o centrifugation, for
4.times.10.sup.3 G, 10 min at 4.degree.0 C. Total RNA was extracted
from 560 ml of plasma (QIAamp; Qiagen). Four vol % of total RNA was
used for a single tube RT-PCR using thermostable AMV, Taq and Pwo
(Boehringer Mannheim). Reactions contained at a final
concentration: di-Na salts of dNTPs at 0.2 mM; DTT at 5 mM; 10 U
recombinant RNAsin (Promega); 1.5 mM MgCl.sub.2; R-poly(A) primer
5' TTT TTg AgT CCC CTT AgT ATT TAT T 3'; U3 primer 5' Agg TAT TgT
CCA Agg TTT CTC C 3', both at 0.3 mM. RT was performed at
50.degree.0 C. for 30 min directly followed by 94.degree. C. 2 min;
94.degree. C. 30 sec, 68.degree. C. 30 sec, -1.3.degree. C. each
cycle, 68.degree. C. 45 sec for a total of 10 cycles; 94.degree. C.
30 sec, 55.degree. C. 30 sec. 68.degree. C. 45 sec for a total of
25 cycles. The amplified material (487 bp) was subjected to agarose
gel electrophoresis followed by alkaline transfer and hybridisation
with probes generated from the IDDMK.sub.1,222 U3-R-region. Genomic
PCR. 100 ng of genomic DNA was subjected to PCR. Reactions
contained at a final concentration: dNTPs at 200 mM; 1.5 mM
MgCl.sub.2; 2.6 U of Taq-Pwo (Boehringer Mannheim); U3-primer 5'
Agg TAT TgT CCA Agg TTT CTC C 3'; R-primers either 5' CTT TAC AAA
gCA gTA TTg CTg C 3, or 5' gTA AAg gAT CAA gTg CTg TgC 3' at 300
nM. The amplified products were 300 and 395 bp in size,
respectively. The cycling profile was as follows: 94.degree. C. 2
min; 94.degree. C. 15 sec, 68.degree. C. 30 sec. -1.3.degree. C.
each cycle, 72.degree. C. 45 sec for a total of 10 cycles;
94.degree. C. 15 sec, 55.degree. C. 30 sec, 72.degree. C. 45 sec
for a total of 25 cycles.
[0256] Sequence Alignment and Phylogenetic Trees
[0257] Sequences were aligned with CLUSTAL W (Thompson et al.,
1994). Alignments were checked and manually corrected with the SEA
VIEW multiple sequence alignment editor (Galtier et al., 1996).
Phylogenetic trees were computed from multiple alignments using the
"neighbour joining" method (Saitou and Nei, 1987).
[0258] Expression
[0259] Constructs. pPOL-ENV-U3: a SacI-NotI fragment derived from
11 IDDMK.sub.1,222 clones was ligated with 1) a BamHI-SacI adapter
containing a consensus SD and 2) with a NotI-XbaI adapter and 3)
was subcloned into BamHI-XbaI digested plDR2-arms, selected for by
two rounds of screening and plasmids rescued. At least five
independent clones were used for transfections. pPOL: pPOL-ENV-U3
was digested with KpnI-NotI, blunted and religated. pPOL-ENV/TR: a
stimulatory clone was digested with XbaI and religated. pCI-ENV/TR:
1 ng of pPOL-ENV-U3 was amplified with the primers 5' gAC TAA gCT
TAA gAA CCC ATC AgA gAT gC 3' and 5' AgA CTg gAT CCg TTA AgT CgC
TAT CgA CAg C 3'. The amplified products were subcloned into
pCI-neo (Promega).
[0260] Cells and cell lines. Monocytic cell lines: THP1, U937.
B-lymphoblastoid cell lines: Raji, BOLETH, SCHU and WT 51. T cells
of molecularly MHC-typed blood donors were generated by positive
selection with anti-CD3 coated immunomagnetic beads
(Milan-Analytika).
[0261] Transfections. Transient transfectants were used for
functional assays 48 hours after transfection; stable transfectants
were selected for 2 weeks in progressive concentration of
Hygromycin B to a final concentration of 250 mg/ml for
lymphoblastoid lines, and 50 mg/ml for monocytic cell lines.
[0262] Functional assays. Transfectants were treated with Mitomycin
C (Calbiochem) at 100 mg/ml per 10.sup.7 cells for 1 hour at
37.degree. C. and washed extensively. Proliferation assays.
10.sup.5 CD3-beads-selected, MHC compatible T cells or
Ficoll-Paque-isolated allogeneic PBL were cultured with
transfectants at stimulator: responder ratios of 1:1; 1:3 and 1:10
for 48 and 72 hours in 96 round-bottom wells at 37.degree. C.
.sup.3H-Thymidine was then added at 1 mCi/well and incorporation
measured after 18 hours incubation at 37.degree. C. FACS analysis
and antibodies used were as described; after 3 days of specific
stimulation, at T: non-T ratios of 1:1 for syngeneic, and 10:3 for
allogeneic stimulations, the T cells were further expanded in 20
U/ml recombinant IL-2 for 6 days before flow cytometric analysis
(Conrad et al., 1994).
[0263] References
[0264] Acha-Orbea, H., Shakow, A. N., Scarpellino, L., Kolb, E.,
Muller, V., Vessaz-Shaw, A., Fuchs, R., Blochlinger, K., Rollini,
P., Billotte, J., Sarafidou, M., MacDonald, H. R., and Diggelmann,
H. (1991). Clonal deletion of Vb14-bearing T cells in mice
transgenic for mouse mammary rumor virus. Nature 350, 207-211.
[0265] Acha-Orbea, H., and MacDonald, H. R. (1995). Superantigens
of mouse mammary tumor virus. Annu. Rev. Immunol. 13, 459-486.
[0266] Badenhoop, K., Tonjes, R. R., Rau., H., Donner, H., Rieker,
W., Braun, J., Herwig, J., Mytilineos, J., Kurth, R., and Usadel,
K. H. (1996). Endogenous retroviral Long Terminal Repeats of the
HLA-DQ region are associated with susceptibility to
Insulin-dependent diabetes mellitus. Human. Immunol. 50,
103-110.
[0267] Brocke, S., Gaur, A., Piercy, C., Gautam, A., Gijbels, K.,
Fathman, C. G., and Steinman, L. (1993). Induction of relapsing
paralysis in experimental autoimmune encephalomyelitis by bacterial
superantigen. Nature 365, 642-644.
[0268] Bruno, G., Merletti, F., Vuolo, A., Pisu, E., Giorio, M.,
and Pagano, G. F. (1993). Sex differences in incidence of IDDM in
age-group 15-29 yr. Diabetes Care 16, 133-136.
[0269] Choi, Y., Kotzin, B., Herron, L., Callahan, J., Marrack, P.,
and Kappler, J. (1989). Interaction of. staphylococcus aureus toxin
"superantigens" with human T cells. Science 86, 8941-8945.
[0270] Choi, Y., Kappler, J. W., and Marrack, P. (1991). A
superantigen encoded in the open reading frame of the 3' long
terminal repeat of mouse mammary tumor virus. Nature 350,
203-207.
[0271] Cole, B. C., and Griffiths, M. M. (1993). Triggering and
exacerbation of autoimmune arthritis by the mycoplasma arthritidis
superantigen MAM. Arthritis Rheum. 36, 994-1002.
[0272] Conrad, B., Weidmann, E., Trucco, G., Rudert, W. A., Behboo,
R., Ricordi, C., Rodriquez-Rilo, H., Finegold, D., and Trucco, M. (
1994). Evidence for superantigen involvement in insulin-dependent
diabetes mellitus aetiology. Nature 371, 351-355.
[0273] Dobrescu, D., Ursea, B., Pope, M., Asch, A. S., and Posnett,
D. N. (1995). Enhanced HIV-1 replication in V.beta.12 T cells due
to human cytomegolovirus in monocytes:evidence for a putative
herpesvirus superantigen. Cell 82, 753-763.
[0274] Fleischer, B., and Schrezenmeier, H. (1988). T cell
stimulation by Staphylococcal Enterotoxins. J. Exp. Med. 167,
1697-1707.
[0275] Galtier, N., Gouy, M., and Gautier, C. (1996). SeaView and
Phylo-win, two graphic tools for sequence alignment and molecular
phylogeny. Comput. Applic. Biosci., In Press.
[0276] Heidmann, O., and Heidmann, T. (1991). Retrotransposition of
a mouse IAP sequence tagged with an indicator gene. Cell 64,
159-170.
[0277] Held, W., Waanders, G. A., Shakov, A. N., Scarpellino, L.,
Acha-Orbea, H., and MacDonald, H. R. (1993). Superantigen-induced
immune stimulation amplifies mouse mammary tumor virus infection
and allows virus transmission. Cell 74, 529-540.
[0278] Howell, M. D., Diveley, J. P., Lundeen, K. A., Esty, A.,
Winters, S. T., Carlo, D. J., and Brostoff, S. W. (1991). Limited
T-cell b-chain heterogeneity among interleukin 2 receptor-positive
synovial T cells suggests a role for superantigen in rheumatoid
arthritis. Proc. Natl. Acad. Sci. USA 88, 10921-10925.
[0279] Karvonen, M., Tuomilehto, J., Libman, I., LaPorte, R.
(1993). A review of the recent epidemiological data on the
worldwide incidence of type 1 (insulin-dependent) diabetes
mellitus. Diabetologia 36, 883-892.
[0280] Lo, D., Reilly, C. R., Scott, B., Liblau, R., McDevitt, H.
C., and Burkly, L. C. (1993). Antigen-presenting cells in
adoptively transferred and spontaneous autoimmune diabetes. Eur. J.
Immunol. 23, 1693-1698.
[0281] Mackay, C. R. (1993). Homing of naive, memory and effector
lymphocytes. Curr. Op. Immunol. 5, 423-427.
[0282] Mach, B., Steimle, V., Martinez-Soria, E., and Reith, W.
(1996). Regulation of MHC class II genes: lessons from disease.
Annu. Rev. Immunol. 14, 301-331.
[0283] McClure, M. A., Johnson, M. S., and Doolittle, R. F. (1988).
Sequence comparisons of retroviral proteins: relative rates of
change and general phylogeny. Proc. Natl. Acad. Sci. USA 85,
2469-2473.
[0284] Medstrand, P., and Blomberg, J. (1993). Characterization of
novel reverse transcriptase encoding human endogenous retroviral
sequences similar to type A and type B retroviruses:differential
transcription in normal human tissues. J. Virol. 67, 6778-6787.
[0285] Oldstone, M. B. A. (1990). Molecular mimicry and autoimmune
disease. Cell 50, 819-820.
[0286] Ono, M. (1986a). Molecular cloning and Long Terminal Repeat
sequences of human endogenous retrovirus genes related to types A
and B retrovirus genes. J. Virol. 58, 937-944.
[0287] Ono, M., Yasunaga, T., Miyata, T., and Ushikubo, H. (1986b).
Nucleotide sequence of human endogenous retrovirus genome related
to mouse mammary tumor virus genome. J. Virol. 60, 589-598.
[0288] Ono, M., Kawakami, M., and Ushikubo, H. (1987). Stimulation
of expression of the human endogenous retrovirus genome by female
steroid hormones in human breast cancer cell line T47D. J. Virol.
61, 2059-2062.
[0289] Paliard, X., West, S. G., Lafferty, J. A., Clements, J. R.,
Kappler, J. W., Marrack, P., and Korzin, B. L. (1991). Evidence for
the effects of a superantigen in rheumatoid arthritis. Science 253,
325-329.
[0290] Perron, H. et al (1997). P.N.A.S. 94, 7583-7588.
[0291] Pette, M., Fujiita, K., Wilkinson, D., Altmann, D. M.,
Trowsdale, J., Giegrich, G., Hinkkanen, A., Epplen, J. T., Kappos,
L., and Weckerle, H. (1990). Myelin autoreactivity in multiple
sclerosis: recognition of myelin basic protein in the context of
HLA-DR2 products by T lymphocytes of multiple sclerosis patients
and healthy donors. Proc. Natl. Acad. Sci. USA 87, 7968-7972.
[0292] Preston, B. D., and Dougherty, J. P. (1996). Mechanisms of
retroviral mutation. Trends Microbiol. 4, 16-21.
[0293] Pyra, H., Boni, J., and Schupbach, J. (1994). Ultrasensitive
retrovirus detection by a reverse transcriptase assay based on
product enhancement. Proc. Natl. Acad. Sci. USA 91,1 544-1548.
[0294] Roizman, B. (1996). Herpesviridae. In Fields Virology, B. N.
Fields et al., eds. (Philadelphia: Lippincott-Raven Publishers),
pp. 2221-2230.
[0295] Saitou, N., and Nei, M. (1987). The neighbor-joining method:
a new method for reconstructing phylogenetic trees. Mol. Biol.
Evol. 4, 406-425.
[0296] Stegall, M. D., Lafferty, K. J., Kam, I., and Gill, R. G.
(1996). Evidence of recurrent autoimmunity in human allogeneic
islet transplantation. Transplantation 61, 1272-1274.
[0297] Steinman, L. (1995). Escape from "horror autotoxicus":
pathogenesis and treatment of autoimmune disease. Cell 80,
7-10.
[0298] Sutkowski, N., Palkama, T., Ciurli, C., Sekaly, R. P.,
Thorley-Lawson, D. A., and Huber, B. T. (1996). An Epstein-Barr
virus-associated superantigen. J. Exp. Med. 184, 971-980.
[0299] Tassabehji, M., Strachan, T., Anderson, M., Campbell, R. D.,
Collier, S., and Lako, M. (1994). Identification of a novel family
of human endogenous retroviruses and characterization of one family
member, HERV-K(C4), located in the complement C4 gene cluster.
Nucl. Acids. Res. 22, 5211-5217.
[0300] Temin, H. M. (1981). Structure,variation and synthesis of
retrovirus Long Terminal Repeat. Cell 27,1-3.
[0301] Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994).
CLUSTAL W: improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, position specific
gap penalties and weight matric choice. Nucl. Acids. Res. 22,
4673-4680.
[0302] Tisch R., and McDevitt, H. (1996). Insulin-dependent
diabetes mellitus. Cell. 85, 291-297.
[0303] Tydn, G., Finn, P. R., Sundkvist, G., and Bolinder, J.
(1996). Recurrence of autoimmune diabetes mellitus in recipients of
cadaveric pancreatic grafts. N. Engl. J. Med. 335, 860-863.
[0304] Tonjes, R. R., Lower, R., Boller, K., Denner, K.,
Hasenmaier, B., Kirsch, H., Konig, H., Korbmacher, C., Limbach, C.,
Lugert, R., Phelps, R. C., Scherer, J., Thelen, K., Lower, J., and
Kurth, R. (1996). HERV-K: the biologically most active human
endogenous retrovirus family. J. AIDS. Hum. Retrovirol. 13,
261-267.
[0305] Vyse, T. J., and Todd, J. A. (1996). Genetic analysis of
autoimmune diseases. Cell 85, 311-318.
[0306] Wahle, E., and Keller, W. (1996). The biochemistry of
polyadenylation. TIBS 21, 247-250.
[0307] Wahle, Hobson, S. (1996). Running the gamut of retroviral
variation. Trends Microbiol. 4, 135-141.
[0308] Weissmahr, R. N., Boni, J., and Schupbach, J. (1997).
Reverse Transcriptase activity in chicken embryo fibroblast culture
supernatants is associated with particles containing endogenous
avian retrovirus EAV-O RNA. J. Virol. 71, 3005-3012.
[0309] Whitcomb, J. M., and Hughes, S. H. (1992). Retroviral
reverse transcription and integration: progress and problems. Annu.
Rev. Cell. Biol. 8, 275-306.
[0310] White, J., Herman, A., Pullen, A. M., Kubo, R., Kappler, J.
W., and Marrack, P. (1989). The Vb-specific superantigen
staphylococcal enterotoxin B: stimulation of mature T cells and
clonal deletion in neonatal mice. Cell 56, 27-35.
[0311] Wilkinson, D. A., et al. (1994). Endogenous human
retroviruses. In The Retroviridae, J. A. Levy, ed. (New York:
Plenum Press), pp. 465-535.
[0312] Winslow, G. M., Scherer, M. T., Kappler, J. W., and Marrack,
P. (1992). Detection and biochemical characterization of the mouse
mammary tumor virus 7 superantigen (Mls-1.sup.a). Cell 71,
719-730.
[0313] Wucherpfennig, K. W., and Strominger, J. L. (1995a).
Selective binding of self peptides to disease-associated Major
Histocompatibility Complex (MHC) molecules: a mechanism for
MHC-linked susceptibility to human autoimmune diseases. J. Exp.
Med. 181, 1597-1601.
[0314] Wucherpfennig, K. W., and Strominger, J. L. (1995b).
Molecular mimicry in T cell-mediated autoimmunity: viral peptides
activate human T cell clones specific for myelin basic protein.
Cell 80, 695-705.
[0315] Xiong, Y., and Eickbusch, T. (1990). Origin and evolution of
retroelements based upon their reverse transcriptase sequences.
EMBO J. 9, 3353-3362.
[0316] York, D. F., Vigne, R., Verwoerd, D. W., and Guerat, G.
(1992). Nucleotide sequence of the Jaagsiekte retrovirus, an
exogenous and endogenous type D and B retrovirus of sheep and
goats. J. Virol. 66, 4930-4939.
Sequence CWU 1
1
48 1 25 DNA Artificial probe 1 tttttgagtc cccttagtat ttatt 25 2 20
DNA Artificial primer 2 atccaacaac catgatggag 20 3 21 DNA
Artificial primer 3 tctcgtaagg tgcaaatgaa g 21 4 21 DNA Artificial
primer 4 gtaaaggatc aagtgctgtg c 21 5 22 DNA Artificial primer 5
ctttacaaag cagtattgct gc 22 6 21 DNA Artificial primer 6 aacactgcga
aaggccgcag g 21 7 22 DNA Artificial primer 7 aggtattgtc caaggtttct
cc 22 8 23 DNA Artificial primer 8 yaaatggmgw aygytaacag act 23 9
23 DNA Artificial primer 9 yaaatggmgw aygytaactg act 23 10 30 DNA
Artificial primer 10 cgtctagagc cytctccggc yatgatcccg 30 11 30 DNA
Artificial primer 11 cgtctagagc cytctccggc yatgatccca 30 12 21 DNA
Artificial primer 12 tgcgccagca atgtatccat g 21 13 21 DNA
Artificial primer 13 gggtggcagt gcatcatagg t 21 14 22 DNA
Artificial primer 14 gggagagggt cagcagcaga ca 22 15 22 DNA
Artificial primer 15 gacagcaagc cagtgataag ca 22 16 19 DNA
Artificial primer 16 ggaacaggga ctctctgca 19 17 20 DNA Artificial
primer 17 gggaagggta aggaagtgtg 20 18 19 DNA Artificial primer 18
ggtgtttctc ctgagggag 19 19 21 DNA Artificial primer 19 gaagaatggc
caacagaagc t 21 20 20 DNA Artificial primer 20 gggaaacaag
gagtgtgagt 20 21 39 DNA Artificial primer' 21 catgtatatg cggccgctgc
gccagcaatg tatccatgg 39 22 21 DNA Artificial primer' 22 tatctttcgt
ttctgcagca c 21 23 22 DNA Artificial primer' 23 taactggttg
aagagctcga cc 22 24 21 DNA Artificial primer' 24 atactaaggg
gactcagagg c 21 25 27 DNA Artificial primer' 25 cagaggctgg
tgggatcctc catatgc 27 26 25 DNA Artificial primer 26 tttttgagtc
cccttagtat ttatt 25 27 22 DNA Artificial primer 27 aggtattgtc
caaggtttct cc 22 28 22 DNA Artificial primer 28 ctttacaaag
cagtattgct gc 22 29 21 DNA Artificial primer 29 gtaaaggatc
aagtgctgtg c 21 30 29 DNA Artificial primer 30 gactaagctt
aagaacccat cagagatgc 29 31 31 DNA Artificial primer 31 agactggatc
cgttaagtcg ctatcgacag c 31 32 208 DNA retroviral provirus 32
catctccctc aggagaaaca cccacgaatg atcaataaat actaagggga ctcagaggct
60 ggtgggatcc tccatatgct gaacgttggt tcccggggcc cccttatttc
tttctctata 120 ctttgtctct gtgtcttttt cttttccaag tcttcttcat
ttgcacctta cgagaaacat 180 ctccatcatg gttgttggat gggggcaa 208 33
1060 DNA retroviral provirus 33 ctgcaggtgt acccaacagc tccgaagaga
cagtgacatc gagaacgggc catgatgacg 60 atggcggttt tgtcgaaaag
aaaaggggga aatgtgggga aaagcaagag agatgagatt 120 gttactgtgt
ctgtatagaa agaagtagac ataggagact ccattttgtt ctgtactaag 180
aaaaattctt ctgccttgag atgctgttaa tctatgacct tacccccaac cccgtgctct
240 ctgaaacatg tgccgtgtca aactcagggt taaatggatt aagggtggtg
caagatgtgc 300 tttgttaaac agatgcttga aggcagcatg ctcattaaga
gtcatcacca ctccctaatc 360 tcaagtaccc agggacacaa acactgcgaa
aggccgcagg gacctctgcc taggaaagcc 420 aggtattgtc caaggtttct
ccccatgtga tagtctgaaa tatggcctcg tgggaaggga 480 aagacctgac
catcccccag accaacaccc gtaaagggtc tgtgctgagg aggattagta 540
taagaggaaa gcatgcctct tgcagttgag agaagaggaa gacatctgtc tcctgcccat
600 cccctgggca atggaatgtc tcagtataaa acccgattga acattccatc
tactgagata 660 gggaaaaact gccttagggc tggaggtggg acatgtgggc
agcaatactg ctttgtaaag 720 cattgagatg tttatgtgta tgtatatcta
aaagcacagc acttgatcct ttaccttgtc 780 tatgatgcaa acacctttgt
tcacgtgttt gtctgctgac cctctcccca ctattgtctt 840 gtgaccctga
cacatctccc tcaggagaaa cacccacgaa tgatcaataa atactaaggg 900
gactcagagg ctggtgggat cctccatatg ctgaacgttg gttcccgggg cccccttatt
960 tctttctcta tactttgtct ctgtgtcttt ttcttttcca agtcttcttc
atttgcacct 1020 tacgagaaac atctccatca tggttgttgg atgggggcaa 1060 34
1754 DNA Human endogenous retrovirus 34 atggtaacac cagtcacatg
gatggataat cctatagaag tatatgttaa tgatagtgta 60 tgggtacctg
gccccacaga tgatcgctgc cctgccaaac ctgaggaaga agggatgatg 120
ataaatattt ccattgggta tcattatcct cctatttgcc tagggagagc accaggatgt
180 ttaatgcctg cagtccaaaa ttggttggta gaagtaccta ctgtcagtcc
taacagtaga 240 ttcacttatc acatggtaag cgggatgtca ctcaggccac
gggtaaatta tttacaagac 300 ttttcttatc aaagatcatt aaaatttaga
cctaaaggga aaacttgccc caaggaaatt 360 cctaaaggat caaagaatac
agaagtttta gtttgggaag aatgtgtggc caatagtgtg 420 gtgatattac
aaaacaatga attcggaact attatagatt aggcacctcg aggtcaattc 480
taccacaatt gctcaggaca aactcagtcg tgtccaagtg cacaagtgag tccagctgtc
540 gatagcgact taacagaaag tctagacaaa cataagcata aaaaattaca
gtctttctac 600 ctttgggaat gggaagaaaa aggaatctct accccaagac
caaaaataat aagtcctgtt 660 tctggtcctg aacatccaga attgtggagg
cttactgtgg cctcacacca cattagaatt 720 tggtctggaa atcaaacttt
agaaacaaga tatcgtaagc cattttatac tatcgaccta 780 aattccattc
taacggttcc tttacaaagt tgcctaaagc ccccttatat gctagttgta 840
ggaaatatag ttattaaacc agcctcccaa actataacct gtgaaaattg tagattgttt
900 acttgcattg attcaacttt taattggcag caccgtattc tgctggtgag
agcaagagaa 960 ggcatgtgga tccctgtgtc cacggaccga ccgtgggagg
cctcgccatc catccatatt 1020 ttgactgaaa tattaaaagg cgttttaaat
agatccaaaa gattcatttt tactttaatt 1080 gcagtgatta tgggattaat
tgcagtcaca gctacggctg ctgtggcagg ggttgcattg 1140 cactcttctg
ttcagtcagt aaactttgtt aattattggc aaaagaattc tacaagattg 1200
tggaattcac aatctagtat tgatcaaaaa ttggcaagtc aaattaatga tcttagacaa
1260 actgtcattt ggatgggaga caggcttgac ttagaacatc atttccagtt
acagtgtgac 1320 tggaatacgt cagatttttg tattacaccc caaatttata
atgagtctga gcatcactgg 1380 gacatggtta gacgccatct acagggaaga
gaagataatc tcactttaga catttccaaa 1440 ttaaaagaac aaattttcga
agcatcaaaa gcccatttaa atttggtgcc aggaactgag 1500 gcaattgcag
gagttgctga tggcctcgca aatcttaacc ctgtcacttg gattaagacc 1560
atcagaagta ctatgattat aaatctcata ttaatcgttg tgtgcctgtt ttgtctgttg
1620 ttagtctgca ggtgtacccc aacagctccg aaaaaaacag tgacatcgag
aacgggccat 1680 gaatgacaaa ggcggttttt gttccaaaaa aaaaaggggg
aaattttggg gaaaaccaaa 1740 aaaatgaaaa tgtt 1754 35 520 DNA Human
endogenous retrovirus 35 acatttgaag ttctacaatg aacccatcag
agatgcaaag aaaagcgcct ccacggagat 60 ggtaacacca gtcacatgga
tggataatcc tatagaagta tatgttaatg atagtgtatg 120 ggtacctggc
cccacagatg atcgctgccc tgccaaacct gaggaagaag ggatgatgat 180
aaatatttcc attgggtatc attatcctcc tatttgccta gggagagcac caggatgttt
240 aatgcctgca gtccaaaatt ggttggtaga agtacctact gtcagtccta
acagtagatt 300 cacttatcac atggtaagcg ggatgtcact caggccacgg
gtaaattatt tacaagactt 360 ttcttatcaa agatcattaa aatttagacc
taaagggaaa acttgcccca aggaaattcc 420 taaaggatca aagaatacag
aagttttagt ttgggaagaa tgtgtggcca atagtgtggt 480 gatattacaa
aacaatgaat tcggaactat tatagattag 520 36 153 PRT Human endogenous
retrovirus 36 Met Val Thr Pro Val Thr Trp Met Asp Asn Pro Ile Glu
Val Tyr Val 1 5 10 15 Asn Asp Ser Val Trp Val Pro Gly Pro Thr Asp
Asp Arg Cys Pro Ala 20 25 30 Lys Pro Glu Glu Glu Gly Met Met Ile
Asn Ile Ser Ile Gly Tyr His 35 40 45 Tyr Pro Pro Ile Cys Leu Gly
Arg Ala Pro Gly Cys Leu Met Pro Ala 50 55 60 Val Gln Asn Trp Leu
Val Glu Val Pro Thr Val Ser Pro Asn Ser Arg 65 70 75 80 Phe Thr Tyr
His Met Val Ser Gly Met Ser Leu Arg Pro Arg Val Asn 85 90 95 Tyr
Leu Gln Asp Phe Ser Tyr Gln Arg Ser Leu Lys Phe Arg Pro Lys 100 105
110 Gly Lys Thr Cys Pro Lys Glu Ile Pro Lys Gly Ser Lys Asn Thr Glu
115 120 125 Val Leu Val Trp Glu Glu Cys Val Ala Asn Ser Val Val Ile
Leu Gln 130 135 140 Asn Asn Glu Phe Gly Thr Ile Ile Asp 145 150 37
603 DNA Human endogenous retrovirus 37 acatttgaag ttctacaatg
aacccatcag agatgcaaag aaaagcgcct ccacggagat 60 ggtaacacca
gtcacatgga tggataatcc tatagaagta tatgttaatg atagtgtatg 120
ggtacctggc cccacagatg atcgctgccc tgccaaacct gaggaagaag ggatgatgat
180 aaatatttcc attgggtatc attatcctcc tatttgccta gggagagcac
caggatgttt 240 aatgcctgca gtccaaaatt ggttggtaga agtacctact
gtcagtccta acagtagatt 300 cacttatcac atggtaagcg ggatgtcact
caggccacgg gtaaattatt tacaagactt 360 ttcttatcaa agatcattaa
aatttagacc taaagggaaa acttgcccca aggaaattcc 420 taaaggatca
aagaatacag aagttttagt ttgggaagaa tgtgtggcca atagtgtggt 480
gatattacaa aacaatgaat tcggaactat tatagattag gcacctcgag gtcaattcta
540 ccacaattgc tcaggacaaa ctcagtcgtg tccaagtgca caagtgagtc
cagctgtcga 600 tag 603 38 561 PRT Human endogenous retrovirus
VARIANT (154)..(154) wherein Xaa at position 154 is "Z" as
described in the figure legend for FIG. 7F. 38 Met Val Thr Pro Val
Thr Trp Met Asp Asn Pro Ile Glu Val Tyr Val 1 5 10 15 Asn Asp Ser
Val Trp Val Pro Gly Pro Thr Asp Asp Arg Cys Pro Ala 20 25 30 Lys
Pro Glu Glu Glu Gly Met Met Ile Asn Ile Ser Ile Gly Tyr His 35 40
45 Tyr Pro Pro Ile Cys Leu Gly Arg Ala Pro Gly Cys Leu Met Pro Ala
50 55 60 Val Gln Asn Trp Leu Val Glu Val Pro Thr Val Ser Pro Asn
Ser Arg 65 70 75 80 Phe Thr Tyr His Met Val Ser Gly Met Ser Leu Arg
Pro Arg Val Asn 85 90 95 Tyr Leu Gln Asp Phe Ser Tyr Gln Arg Ser
Leu Lys Phe Arg Pro Lys 100 105 110 Gly Lys Thr Cys Pro Lys Glu Ile
Pro Lys Gly Ser Lys Asn Thr Glu 115 120 125 Val Leu Val Trp Glu Glu
Cys Val Ala Asn Ser Val Val Ile Leu Gln 130 135 140 Asn Asn Glu Phe
Gly Thr Ile Ile Asp Xaa Ala Pro Arg Gly Gln Phe 145 150 155 160 Tyr
His Asn Cys Ser Gly Gln Thr Gln Ser Cys Pro Ser Ala Gln Val 165 170
175 Ser Pro Ala Val Asp Ser Asp Leu Thr Glu Ser Leu Asp Lys His Lys
180 185 190 His Lys Lys Leu Gln Ser Phe Tyr Leu Trp Glu Trp Glu Glu
Lys Gly 195 200 205 Ile Ser Thr Pro Arg Pro Lys Ile Ile Ser Pro Val
Ser Gly Pro Glu 210 215 220 His Pro Glu Leu Trp Arg Leu Thr Val Ala
Ser His His Ile Arg Ile 225 230 235 240 Trp Ser Gly Asn Gln Thr Leu
Glu Thr Arg Tyr Arg Lys Pro Phe Tyr 245 250 255 Thr Ile Asp Leu Asn
Ser Ile Leu Thr Val Pro Leu Gln Ser Cys Leu 260 265 270 Lys Pro Pro
Tyr Met Leu Val Val Gly Asn Ile Val Ile Lys Pro Ala 275 280 285 Ser
Gln Thr Ile Thr Cys Glu Asn Cys Arg Leu Phe Thr Cys Ile Asp 290 295
300 Ser Thr Phe Asn Trp Gln His Arg Ile Leu Leu Val Arg Ala Arg Glu
305 310 315 320 Gly Met Trp Ile Pro Val Ser Thr Asp Arg Pro Trp Glu
Ala Ser Pro 325 330 335 Ser Ile His Ile Leu Thr Glu Ile Leu Lys Gly
Val Leu Asn Arg Ser 340 345 350 Lys Arg Phe Ile Phe Thr Leu Ile Ala
Val Ile Met Gly Leu Ile Ala 355 360 365 Val Thr Ala Thr Ala Ala Val
Ala Gly Val Ala Leu His Ser Ser Val 370 375 380 Gln Ser Val Asn Phe
Val Asn Tyr Trp Gln Lys Asn Ser Thr Arg Leu 385 390 395 400 Trp Asn
Ser Gln Ser Ser Ile Asp Gln Lys Leu Ala Ser Gln Ile Asn 405 410 415
Asp Leu Arg Gln Thr Val Ile Trp Met Gly Asp Arg Leu Asp Leu Glu 420
425 430 His His Phe Gln Leu Gln Cys Asp Trp Asn Thr Ser Asp Phe Cys
Ile 435 440 445 Thr Pro Gln Ile Tyr Asn Glu Ser Glu His His Trp Asp
Met Val Arg 450 455 460 Arg His Leu Gln Gly Arg Glu Asp Asn Leu Thr
Leu Asp Ile Ser Lys 465 470 475 480 Leu Lys Glu Gln Ile Phe Glu Ala
Ser Lys Ala His Leu Asn Leu Val 485 490 495 Pro Gly Thr Glu Ala Ile
Ala Gly Val Ala Asp Gly Leu Ala Asn Leu 500 505 510 Asn Pro Val Thr
Trp Ile Lys Thr Ile Arg Ser Thr Met Ile Ile Asn 515 520 525 Leu Ile
Leu Ile Val Val Cys Leu Phe Cys Leu Leu Leu Val Cys Arg 530 535 540
Cys Thr Pro Thr Ala Pro Lys Lys Thr Val Thr Ser Arg Thr Gly His 545
550 555 560 Glu 39 604 DNA Human endogenous retrovirus 39
acatttgaag ttctacaatg aacccatcag agatgcaaag aaaagcgcct ccacggagat
60 ggtaacacca gtcacatgga tggataatcc tatagaagta tatgttaatg
atagtgtatg 120 ggtacctggc cccacagatg atcgctgccc tgccaaacct
gaggaagaag ggatgatgat 180 aaatatttcc attgggtatc attatcctcc
tatttgccta gggagagcac caggatgttt 240 aatgcctgca gtccaaaatt
ggttggtaga agtacctact gtcagtccta acagtagatt 300 cacttatcac
atggtaagcg ggatgtcact caggccacgg gtaaattatt tacaagactt 360
ttcttatcaa agatcattaa aatttagacc taaagggaaa acttgcccca aggaaattcc
420 taaaggatca aagaatacag aagttttagt ttgggaagaa tgtgtggcca
atagtgtggt 480 gatattacaa aacaatgaat tcggaactat tatagattta
ggcacctcga ggtcaattct 540 accacaattg ctcaggacaa actcagtcgt
gtccaagtgc acaagtgagt ccagctgtcg 600 atag 604 40 181 PRT Human
endogenous retrovirus 40 Met Val Thr Pro Val Thr Trp Met Asp Asn
Pro Ile Glu Val Tyr Val 1 5 10 15 Asn Asp Ser Val Trp Val Pro Gly
Pro Thr Asp Asp Arg Cys Pro Ala 20 25 30 Lys Pro Glu Glu Glu Gly
Met Met Ile Asn Ile Ser Ile Gly Tyr His 35 40 45 Tyr Pro Pro Ile
Cys Leu Gly Arg Ala Pro Gly Cys Leu Met Pro Ala 50 55 60 Val Gln
Asn Trp Leu Val Glu Val Pro Thr Val Ser Pro Asn Ser Arg 65 70 75 80
Phe Thr Tyr His Met Val Ser Gly Met Ser Leu Arg Pro Arg Val Asn 85
90 95 Tyr Leu Gln Asp Phe Ser Tyr Gln Arg Ser Leu Lys Phe Arg Pro
Lys 100 105 110 Gly Lys Thr Cys Pro Lys Glu Ile Pro Lys Gly Ser Lys
Asn Thr Glu 115 120 125 Val Leu Val Trp Glu Glu Cys Val Ala Asn Ser
Val Val Ile Leu Gln 130 135 140 Asn Asn Glu Phe Gly Thr Ile Ile Asp
Leu Gly Thr Ser Arg Ser Ile 145 150 155 160 Leu Pro Gln Leu Leu Arg
Thr Asn Ser Val Val Ser Lys Cys Thr Ser 165 170 175 Glu Ser Ser Cys
Arg 180 41 182 PRT Human endogenous retrovirus 41 Phe Thr Ile Pro
Leu Ala Glu Gln Asp Cys Glu Lys Phe Ala Phe Thr 1 5 10 15 Ile Pro
Ala Ile Asn Asn Lys Glu Pro Ala Thr Arg Phe Gln Trp Lys 20 25 30
Val Leu Pro Gln Gly Met Leu Asn Ser Pro Thr Ile Cys Gln Thr Phe 35
40 45 Val Gly Arg Ala Leu Gln Pro Val Arg Asp Lys Phe Ser Asp Cys
Tyr 50 55 60 Ile Ile His Tyr Phe Asp Asp Ile Leu Cys Ala Ala Glu
Thr Lys Asp 65 70 75 80 Lys Leu Ile Asp Cys Tyr Thr Phe Leu Pro Ala
Glu Val Ala Asn Ala 85 90 95 Gly Leu Ala Ile Ala Ser Asp Lys Ile
Gln Thr Ser Thr Pro Phe His 100 105 110 Tyr Leu Gly Met Gln Ile Glu
Asn Arg Lys Ile Lys Pro Gln Lys Ile 115 120 125 Glu Ile Arg Lys Asp
Thr Leu Lys Thr Leu Asn Asp Phe Gln Lys Leu 130 135 140 Leu Gly Asp
Ile Asn Trp Ile Arg Pro Thr Leu Gly Ile Pro Thr Tyr 145 150 155 160
Ala Met Ser Asn Leu Phe Ser Ile Leu Arg Gly Asp Ser Asp Leu Asn 165
170 175 Ser Lys Arg Met Leu Thr 180 42 250 DNA Human endogenous
retrovirus 42 gtaaatgaca cctatgatgc actgccaccc tttcactgtt
tcaccctgaa catctgcttt 60 ttacatctaa gtgattgtac ccaataaata
gtgtggagac cagagctctg agccttttgc 120 agcctccatt ttgcaactgg
tcccctggct cccaccttta tgaactctta acctgtcttt 180 tctcattcct
ttgtcaccat tggactttgg gtaccctacg ggtggtgttg aggctgtcac
240 cgcacattaa 250 43 203 DNA Human endogenous retrovirus 43
gtttagttaa tctataatct atagagacaa tgcttatcac tggcttgctg tcaataaata
60 tgtgggtaaa tctctgttca agactctcag ctttgaagct gtgagacccc
tgatttccca 120 ctccacacct ctatatttct gtgtgtgtgt ctttaattcc
tccagtgttg ctgggttagg 180 gtctcctcga cgagctgtcg tgc 203 44 283 DNA
Human endogenous retrovirus 44 aactcagctg ctgcacagtg gtcgagcctc
cagagctcat gccattgcag tggtcagagc 60 ctggccctcc tcttcctgca
tagaacctgg attcaatctg taaggtggga agtgcagcag 120 cagagaactc
tggccttgca gagagtccct gttcccactt cactttcctt ttcaccaaat 180
aaaaccctgc tttcactcat gcatcaaatt gtctgtgagc ctacattttt gtggccatgg
240 gacaagaaca ccatctttag ctgagctagg gaaaagtcct gca 283 45 245 DNA
Human endogenous retrovirus 45 gatgtgacca ctgtgaccta cctacactgg
agatggctca cacttcctta cccttcccct 60 gctgtaccaa taaataacag
cacagcctga cattcggagc cattaccggt ctttgtgact 120 tggtggtagt
ggtatcccct agggcccagc tgtcttttct tttatctctt tgtcttgtgt 180
ctttatttct atgagtctct cgtctccgca catggggaga aaaacccata gaccctgtag
240 ggctg 245 46 181 DNA Human endogenous retrovirus 46 ctcacaaaaa
taataaaagc ttctgttggc cattcttcag atcttcatct cttgtgagga 60
tccccctgta catgtaaaaa tgtaataaaa cttgtatcct ttctcctctt aatctgtctt
120 gcatcaatat cattcctaga cccagtcaga gatgggtgga ggtgagccgt
acatttccct 180 a 181 47 287 DNA Human endogenous retrovirus 47
cagagaactc cagccagctg tgatggagcc tcaggaagtt cacagttgca gcaggaagga
60 gcctggctgc tcctcttcct gtgtggaacc tgggattaga acaggctggc
aggaagtgct 120 ttagcaggga ctctggccta ctcacactcc ttgtttcccc
cctttcttcc ttttcactca 180 ataaagccct gtcttactca ccattcaaat
tgtctgtgag cctgaatttt catggctgtg 240 ggacaaagaa ccctattttt
agctgaacta aggaaaattc ctgcaaa 287 48 264 DNA Human endogenous
retrovirus 48 gtgattgtct gctgaccctc tccccacaat tgtcttgtga
ccctgacaca tccccctctt 60 cgagaaacac ccgcggatga tcaataaata
ttaagggaac tcagaggctg gcaggatcct 120 ccatatgctg aacgctggtt
gccccgggtc cccttctttc tttctctata ctttgtctct 180 gtgtcttttt
cttttccaaa tctctcgtcc caccttacga gaaacaccca caggtgtgtc 240
cgggcaaccc aacgccacat aaca 264
* * * * *