Use of untranslated region of osmotin gene to enhance transgene expression in plants

Abstract

The present invention provides methods, vectors and gene constructs for enhancing expression of a recombinant nucleic acid sequence in transgenic plants and plant tissues. According to the present invention, nucleic acid sequences are obtained and/or derived from the 5' and 3' untranslated regions of genes encoding osmotin proteins and engineered to flank respective portions of a selected coding region of a vector. The vector construct may be introduced into plants and/or plant tissues through conventional procedures, resulting in enhanced expression of the selected coding region. In a preferred embodiment, the selected coding region is a chimeric gene or gene fragment expressing one or more proteins known to impart a level of insecticidal activity to a transgenic plant and/or plant tissue.

Description

FIELD OF THE INVENTION

[0001] The present invention relates to plant molecular biology and the application of genetic engineering techniques to plants. More particularly, the present invention provides DNA sequences, constructs and methods that are useful for enhancing the expression of recombinant genes in plants.

BACKGROUND OF THE INVENTION

[0002] Recombinant DNA technology and genetic engineering have made it routinely possible to introduce desired DNA sequences into plant cells to allow for the expression of proteins of interest. For commercially viable transformation events, however, obtaining desired levels of stable and predictable expression in important crops remains challenging.

[0003] One method of expressing heterologous genes at desired levels in crops involves manipulation of the regulatory mechanisms governing expression in plants. The regulation may be transcriptional or post-transcriptional and can include, for example, mechanisms to enhance, limit, or prevent transcription of the DNA, as well as mechanisms that limit or increase the life span of an mRNA after it is produced. The DNA sequences involved in these regulatory processes can be located upstream, downstream or even internally to the structural DNA sequences encoding the protein product of a gene.

[0004] To regulate transcription in a transgenic plant, various types of promoters may be employed. Promoters can be used to control the expression of foreign genes in transgenic plants in a manner similar to the expression pattern of the gene from which the promoter was originally derived. Generally, promoters are classified in two categories. "Constitutive" promoters express in most tissues most of the time. Expression from a constitutive promoter is more or less at a steady state level throughout development. Genes encoding proteins with house-keeping functions are often driven by constitutive promoters. Examples of constitutively expressed genes in maize include actin and ubiquitin. (Wilmink et al., Plant Mol. Biol., 28:949-955, 1995). "Regulated" promoters are typically expressed in only certain tissue types (tissue specific promoters) or at certain times during development (temporal promoters).

[0005] Further improvements in transcription have been obtained in transgenic plants by placing "enhancer" sequences upstream (5') of the promoter. Enhancer elements are cis-acting and increase the level of transcription of an adjacent gene from its promoter in a fashion that is relatively independent of the upstream position and orientation of the enhancer. Such sequences have been isolated from a variety of sources, including viruses, bacteria and plant genes. One example of a well characterized enhancer sequence is the octopine synthase (ocs) enhancer from the Agrobacterium tumefaciens, as described in U.S. Pat. Nos. 5,837,849, 5,710,267 and 5,573,932, assigned to the assignee of the present invention. This short (40 bp) sequence has been shown to increase gene expression in both dicots and monocots, including maize, by significant levels. Tandem repeats of this enhancer have been shown to increase expression of the GUS gene eight-fold in maize. It remains unclear how these enhancer sequences function. Presumably enhancers bind activator proteins and thereby facilitate the binding of RNA polymerase II to the TATA box. WO95/14098 describes testing of various multiple combinations of the ocs enhancer and the mas (mannopine synthase) enhancer which resulted in several hundred fold increase in gene expression of the GUS gene in transgenic tobacco callus.

[0006] The use of a specific promoter, with or without one or more enhancers, however, does not necessarily guarantee desired levels of gene expression in plants. In addition to desired transcription levels, other factors such as improper splicing, polyadenylation and nuclear export can affect accumulation of both mRNA and the protein of interest. Therefore, methods of increasing RNA stability and translational efficiency through mechanisms of post-transcriptional regulation are needed in the art.

[0007] With regard to post-transcriptional regulation, it is has been demonstrated that certain 5' and 3' untranslated regions (UTRs) of eukaryotic mRNAs play a major role in translational efficiency and RNA stability, respectively. For example, the 5' and 3' UTRs of tobacco mosaic virus (TMV) and alfalfa mosiac virus (AMV) coat protein mRNAs can enhance gene expression 5.4-fold and 3.0 fold in tobacco plants, respectively. (Zeyenko, FEBS Lett., November 14;354(3):271-3 (1994)). The 5' and 3' UTRs of the maize alcohol dehydrogenase-1 (adh1) gene are required for efficient translation in hypoxic protoplasts. (Bailey-Serres et al., Plant Physiol., October;112(2):685-95 (1996)).

[0008] Experiments with various 5' UTR leader sequences demonstrate that various structural features of a 5'UTR can be correlated with levels translational efficiency. Certain 5' UTRs have been found to contain AUG codons which may interact with 40S ribosomal subunits when it scans for the AUG codon at the initiation site, thus decreasing the rate of translation. (Kozak, Mol. Cell. Biol. 7:3438 (1987); Kozak, J. Cell Biol. 108, 209 (1989)). Further, the 5'UTR nucleotide sequences flanking the AUG initiation site on the mRNA may have an impact on translational efficiency. If the context of the flanking 5'UTR are not favorable, part of the 40S ribosomal subunits might fail to recognize the translation start site such that the rate of polypeptide synthesis will be slowed. (Kozak, J. Biol. Chem. 266, 19867-19870 (1991); Pain, Eur. J. Biochem. 236, 747-771 (1996)). Secondary structures of 5'UTRs (e.g., hairpin formation) may also hinder the movement of 40S ribosomal subunits during their scanning process and therefore negatively impact the efficiency of translation. (Sonenberg et al., Nature 334:320 (1988); Kozak, Cell 44:283-292, (1986)). The relative GC content of a 5' UTR sequence has been shown to be an indicator of the stability of the potential secondary structure, with higher levels of GC indicating instability. (Kozak, J. Biol. Chem. 266, 19867-19870 (1991). Longer 5' UTRs may exhibit higher numbers of inhibitory secondary structures. (Sonenberg et al., 1996). Thus, the translational efficiency of any given 5' UTR is highly dependent upon its particular structure, and optimization of the leader sequence has been shown to increase gene expression as a direct result of improved translation initiation efficiency. Furthermore, significant increases in gene expression have been produced by addition of leader sequences from plant viruses or heat shock genes. (Raju et al., Plant Science 94: 139-149 (1993)).

[0009] In addition to 5' UTR sequences, 3' UTR (trailer) sequences of mRNAs are also involved in gene expression. 3' UTRs (also known as polyadenylation elements or adenylation control elements) are known to control the nuclear export, polyadenylation status, subcellular targeting and rates of translation and degradation of mRNA from RNases. In particular, 3' UTRs may contain one or more inverted repeats that can fold into stem-loop structures which act as a barrier to exoribonucleases, as well as interact with proteins known to promoter RNA stability (e.g., RNA binding proteins). (Barkan et al., A Look Beyond Transcription: Mechanisms Determining mRNA Stability and Translation in Plants, American Society of Plant Physiologists, Rockville, Md., pp. 162-213 (1998)). Certain elements found within 3' UTRs may be RNA destabilizing, however. One such example occurring in plants is the DST element, which can be found in small auxin up RNAs (SAURs). (Gil et al., EMBO J. 15,1678-1686 (1996)). A further destabilizing feature of some 3' UTRs is the presence of AUUUA pentamers. (Ohme-Takagi et al., Pro. Nat. Acad. Sci. USA 90 11811-11815 (1993)).

[0010] 3' UTRs have been demonstrated to play a significant role in gene expression of several maize genes. Specifically, a 200 base pair 3' sequence has been shown to be responsible for suppression of light induction of the maize small m3 subunit of the ribulose-1,5-biphosphate carboxylase gene (rbc/m3) in mesophyll cells. (Viret et al., Proc Natl Acad Sci USA. 91(18):8577-81 (1994)). In plants, especially maize, this sequence is not very well conserved. One 3' UTR frequently used in genetic engineering of plants is derived from a nopaline synthase gene (3' nos) (Wyatt et al., Plant Mol Biol 22(5):73149 (1993)).

[0011] In certain plant viruses, such as alfalfa mosaic virus (AMV) and tobacco mosaic virus (TMV), the highly structured 3' UTRs are essential for replication and can be folded into either a linear array of stem-loop structures which contain several high-affinity coat protein binding sites, or a tRNA-like site recognized by RNA-dependent RNA polymerases. (Olsthoorn et al., EMBO J 1;18(17):4856-64 (1999); Zeyenko et al., 1994)).

[0012] As of the date of the present invention, however, the use of 5' and 3' UTRs to regulate the expression of recombinant nucleic acids in transgenic plants has not been wide-spread, mainly because optimal/optimized UTR sequences have yet to be identified or characterized. Novel methods and compositions of matter for regulating gene expression using optimal/optimized 5' and 3' UTRs are therefore needed in the art.

SUMMARY OF THE INVENTION

[0013] The present invention provides methods, vectors and gene constructs for enhancing expression of a recombinant nucleic acid sequence in transgenic plants and plant tissues. According to the present invention, nucleic acid sequences are obtained and/or derived from the 5' and 3' untranslated regions of genes encoding osmotin proteins and engineered to flank respective portions of a selected coding region of a vector. The vector construct may be introduced into plants and/or plant tissues through conventional procedures, resulting in enhanced expression of the selected coding region. In a preferred embodiment, the selected coding region is a chimeric gene or gene fragment expressing one or more proteins known to impart a level of insecticidal activity to a transgenic plant and/or plant tissue.

BRIEF DESCRIPTION OF THE FIGURES

[0014] FIG. 1 is a diagram of the putative processing pathway of Toxin A protein and its proposed structure model. The molecular weight for unprocessed A0 protein and cleaved A1 and A2 polypeptides are indicated. 87 amino acids at N-terminal end; (): 88 amino acids at C-terminal end of A1 polypeptide.

[0015] FIG. 2 provides diagrams of the Toxin A gene constructs used for plant transformation. Six different Toxin A gene fragments were inserted between a Cassava Vein Mosaic Virus (CsVMV) promoter and Ti 15955 plasmid ORF25 3' sequences, respectively. RB: T-DNA right border; LB: T-DNA left border; Kan.sup.R: Kanamycin resistance gene. (): 87 amino acids at N-terminal end; (.box-solid.): 88 amino acids at C-terminal end of A1 polypeptide. The designations for each Toxin A gene fragment are indicated on the right of the diagrams.

[0016] FIG. 3 is a Northern blot analysis showing the RNA expression patterns of transgenic Arabidopsis plants carrying six different Toxin A constructs. Above each lane are the names of the Toxin A gene fragments carried by the transgenic plants. The number of the plants with expected RNA expression pattern (as shown in this blot) versus number of examined plants for each construct are indicated below as n/N. MW: molecular weight. The position where non-specific binding of the probe to ribosomal RNA occurs is indicated by an arrow.

[0017] FIG. 4 is a Western blot analysis of Toxin A expression in transgenic Arabidopsis plants. (A): Lane 1: Recombinant E. coli strain; Lane 2: Transgenic plant with CsVMV-GUS-ORF25 gene construct (pDAB7029); Lanes 3-10: Transgenic plants with construct pDAB7031. (B): Lane 1: Recombinant E. coli strain; Lane 2-6: Transgenic plants with construct pDAB7036. The bands below the A2 protein are the antibody cross-reacted background of Arabidopsis plants.

[0018] FIG. 5 is a Western blot analysis of Al protein expression in transgenic Arabidopsis plants. (A): Lane 1: Recombinant E. coli strain; Lanes 2-6: Transgenic plants with construct pDAB7035; Lane 7: Transgenic plant with GUS gene construct. (B): Lane 1: Recombinant E. coli strain; Lanes 2-6: Transgenic plants with construct pDAB7033; Lane 7: Transgenic plant with GUS gene construct. (C): Lane 1: Recombinant E. coli strain; Lanes 2-6: Transgenic plants with construct pDAB7034; Lane 7: Transgenic plant with GUS gene construct. The bands below the A2 protein are the antibody cross-reacted background of Arabidopsis plants.

[0019] FIG. 6 shows sequences and structural features of 5' and 3' UTRs of the tobacco osmotin gene. (A): DNA sequence of osmotin 5' UTR (SEQ. ID. NO. 1) and its A/T content; (B) Computer-predicted RNA secondary structure of osmotin 3' UTR sequences.

[0020] FIG. 7 provides diagrams of the modified Toxin A gene constructs used for plant transformation. The 5' and 3' UTR sequences of tobacco osmotin gene ()were added to the both ends of Toxin A genes in constructs pDAB7031, pDAB7033, and pDAB7032 (FIG. 2). The resultant constructs are designated pDAB7026, pDAB7027, and pDAB7028 as indicated on the right. CsVMV: Cassava Vein Mosaic Virus promoter; ORF 25: ORF25 3' sequences of Ti 15955 plasmid. RB: T-DNA right border; LB: T-DNA left border; Kan.sup.R: Kanamycin resistance gene. (.box-solid.): 87 amino acids at N-terminal end; (): 88 amino acids at C-terminal end of A1 polypeptide. The designations for each Toxin A gene fragment are shown in diagrams. The names for each construct are indicated on right.

[0021] FIG. 8 provides an analysis of Toxin A expression of transgenic Arabidopsis plants: (A) Western blot analysis of A2 protein expression in transgenic plants with construct pDAB7028. Lanes 1-4, and Lanes 6-8: transgenic plants; Lane 5: recombinant E. coli strain. (B) SDS-PAGE gel analysis of Toxin A expression in transgenic plants with construct pDAB7026. Lane 1: high expresser of Toxin A gene; Lanes 2-4: three low expressers of Toxin A gene; Lane 5: Transgenic plants with GUS gene construct. The positions of A0 and A1 proteins are indicated by arrows. Ten ug of total leaf protein were loaded into each lane.

[0022] FIG. 9 provides multi-generation analyses of insect resistance in transgenic line 7026-057. The number of active plants in each given progeny family are indicated as n/N (active plants/total examined plants) and as percentage of total examined plants (shown in parenthesis). All the active plants shown here were high expressers and had 100% insect mortality. The number of generation for each progeny family is indicated on left.

[0023] FIG. 10 is a comparative analysis of Toxin A RNA expression between high and low expressers of T1 progeny of line 7026-190. (A) Northern analysis of Toxin A RNA expression. Lanes 1-4: four T.sub.1 plants with low Toxin A expression level (<50 ppm). Lanes 5-8: four T.sub.1 plants with high Toxin A expression level (>1,400 ppm). (B) Ethidium bromide staining of RNA gel.

[0024] FIG. 11 illustrates the activity of Toxin A-expressing transgenic plants against THW with different ages. Sixteen larvae at each instar stage were used to test the activity of Toxin A-expressing plants. Plants transformed with GUS construct were used as negative control. The data shown above are the average of two replicate experiments.

[0025] FIG. 12 is a map of plasmid pDAB1542.

[0026] FIG. 13 is a map of plasmid pKA882.

[0027] FIG. 14 is a map of plasmid pDAB7013.

[0028] FIG. 15 is a map of plasmid pDAB7020.

[0029] FIG. 16 is a map of plasmid pDAB6001.

[0030] FIG. 17 is a map of plasmid pDAB7002.

[0031] FIG. 18 is a map of plasmid pDAB7021.

[0032] FIG. 19 is a map of plasmid pDAB7026.

[0033] FIG. 20 is a map of plasmid pDAB7031.

[0034] FIG. 21 is the nucleotide sequence of the full length A0 osmotin gene (SEQ. ID. No. 5).

[0035] FIG. 22 is the nucleotide sequence of the A0 osmotin gene with an N-terminal truncation (SEQ. ID. No. 6).

[0036] FIG. 23 is the nucleotide sequence of the A0 osmotin gene with a C-terminal truncation (SEQ. ID. No. 7).

[0037] FIG. 24 is the nucleotide sequence of the full length A1 osmotin gene (SEQ. ID. No. 8).

[0038] FIG. 25 is the nucleotide sequence of the A1 osmotin gene with N-terminal and C-terminal truncations (SEQ. ID. No. 9).

[0039] FIG. 26 is the nucleotide sequence of the A2 osmotin gene (SEQ. ID. No. 10)

[0040] FIG. 27 is the protein sequence of Photorabdus Toxin A (SEQ. ID. No. 4).

[0041] FIG. 28 (Table 1) summarizes a quantitative analysis of protein expression of transgenic plants carrying various Toxin A constructs.

[0042] FIG. 29 (Table 2) provides a comparison of protein expression and insecticidal activity between transgenic plants carrying Toxin A and osmotin-Toxin A constructs.

[0043] FIG. 30 (Table 3) summarizes bioassay results of 274 transgenic Arabidopsis lines transformed with construct pDAB7026.

[0044] FIG. 31 (Table 4) provides data regarding average insect mortality of high and low expressers of T.sub.1 transgenic plants transformed with construct pDAB7026.

[0045] FIG. 32 (Table 5) provides an analysis of protein exprssion and insect resistance of T.sub.1 progeny of transgenic lines transformed with construct pDAB7026 which showed high Toxin A expression, but low activity at the T.sub.0 generation.

[0046] FIG. 33 (Table 6) provides a multi-generation analysis of insect resistance demonstrated by transgenic line 7026-001.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0047] The present invention provides compositions and methods for genetically modifying cells, tissues, or organisms using 5' and/or 3' UTR regions isolated or derived from a tobacco osmotin gene. The 5' and/or 3' UTR regions of the present invention, when engineered to flank a structural nucleic acid of interest, improve mRNA stability and/or increase translational efficiency of the structural gene of interest in a transgenic plant. Thus, the present invention will facilitate the genetic engineering of plants to express phenotypes of economic or investigative value.

[0048] Osmotin is a small (24 kDa), basic, pathogenesis-related protein that is highly accumulated during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress, where it accounts for about 12% total soluble protein. In tobacco, two osmotins have been described, osmotin-l: a water-soluble form, and osmotin-II: a detergent-soluble, relatively protease resistant form. Both osmotins from tobacco have a molecular weight of about 24 kD, show a large amino-acid sequence identity, as well as similarity with a 24 kD osmotin-like protein from tomato (Lycopersicon esculentum), and to other proteins, including thaumatin from Thaumatococcus daniellii, pathogenesis-related protein S (PR-S) from tobacco, and a bifunctional maize trypsin/.alpha.-amylase inhibitor.

[0049] The expression of the osmotin gene is induced by various stress-related signals, such as those resulting from water deficit, salinity, viral infection and wounding. (See Singh et al., Plant Physiol., 85, 529-536 (1987); Singh et al., Plant Physiol., 90, 1096-1101 (1989); Singh et al., In NATO ASI Series, G19, pp. 67-87 "Environmental Stress in Plants", J. H. Cherry, ed (1989); LaRosa et al., Plant Physiol., 91, 855-861 (1989); Meeks-Wagner et al., Plant Cell, 1, 25-35 (1989); Grosset et al., Plant Physiol., 92, 520-527 (1990); Neale et al., Plant Cell, 2, 673-684 (1990); Roberts et al., J. Gen. Microbiol., 136, 1771-1778 (1990); Stintzi et al., Physiol. Mol. Plant Pathol., 38, 137-146 (1991); Woloshuk et al., Plant Cell, 3, 619-628 (1991); Singh et al., Plant Physiol. 79, 126-137 (1985); Richardson et al., Nature, 327, 432-434 (1987); Bol, In Temporal and Spatial Regulation of Plant Genes, D. P. S. Verma and R. B. Goldberg eds (New York: Springer-Verlag) pp. 201-221 (1988); Brederode et al., Mol. Biol., 17, 1117-1125 (1991); Linthorst, Crit. Rev. Plant Sci., 10, 123-150 (1991); LaRosa et al., Plant Physiol., 79,138-142 (1985); La Rosa et al., Plant Physiol., 85,174-185 (1987); Singh et al., Proc. Natl. Acad. Sci. USA, 84, 739-743) (1987)).

[0050] Both osmotin mRNA and osmotin protein are extremely stable. With regard to the present invention, the structural features of the 5' and 3' UTRs of the tobacco osmotin gene are consistent with the highly stable nature of the osmotin mRNA and protein: 1) its 5' UTR sequence is highly AT-rich, which allows 40S ribosomal subunits to easily scan to its start codon to initiate translation (See FIG. 6A); and 2) its 3' UTR sequences can form a strong stem-loop secondary structure that may effectively block the degradation from RNase (FIG. 6B).

[0051] According to preferred embodiments of the present invention, one or both of 5' and 3' UTR regions isolated or derived from an osmotin gene are genetically engineered to flank a structural gene of interest encoding a protein which is expressed recombinantly in a plant, plant cell or plant tissue. Preferably, the osmotin gene is isolated or derived from a tobacco osmotin gene.

[0052] The following definitions are provided in order to remove clarify the intent, scope and usage of certain terms in the Specification and Claims herein.

[0053] The term "chimeric gene construct", as used herein, means a recombinant nucleic acid comprising genes or portions thereof from more than one organism.

[0054] A "deletion", as used herein, refers to a change in either amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues, respectively, are absent.

[0055] A 5' and/or 3' osmotin UTR of the present invention is said to be "functionally linked" to a structural nucleic acid sequence of interest if these elements are situated in relation to another such that the 5' and 3' osmotin UTR influences mRNA stability, translational efficiency of transcription products of the structural nucleic acid sequence of interest.

[0056] The term "heterologous gene", as used herein, means a gene encoding a protein, polypeptide, RNA, or a portion of any thereof, whose exact amino acid sequence is not normally found in the host cell, but is introduced by standard gene transfer techniques.

[0057] The term "homology", as used herein, refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). A partially complementary sequence is one that at least partially inhibits an identical sequence from hybridizing to a target nucleic acid; it is referred to using the functional term "substantially homologous." The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence or probe to the target sequence under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding, the probe will not hybridize to the second non-complementary target sequence.

[0058] The terms "identity" and "similarity", as used herein, and as known in the art, are relationships between two polypeptide sequences or two polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between two polypeptide or two polynucleotide sequences as determined by the match between two strings of such sequences. Both identity and similarity can be readily calculated (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press. New York (1988); Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press (1987); and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York (1991)). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Preferred methods to determine identity are designed to give the largest match between the two sequences tested. Methods to determine identity and similarity are codified in computer programs. Typical computer program methods to determine identity and similarity between two sequences include: GCG program package (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BLASTP, BLASTN, FASTA and TFASTA (Atschul, S. F. et al., J. Mol. Biol. 215: 403 (1990)).

[0059] An "insertion" or "addition", as used herein, refers to a change in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid or nucleotide residues, respectively, as compared to the naturally occurring molecule.

[0060] The term "modified expression", as used herein, means expression in a transgenic plant which is genetically engineered to have one or both of the 5' and 3' osmotin UTRs of the present invention flanking the respective regions of a heterologous structural gene of interest wherein the mRNA levels, protein levels or enzyme specific activity of the structural gene of interest have been altered relative to 1) a native version of the plant, or 2) a transgenic plant harboring the structural gene of interest but not including the one or both of the 5' and 3' osmotin UTRs as flanking regions thereof.

[0061] By "non-native phenotype", as used herein, it is meant a trait occurring, or influenced by, expression of recombinant DNA in a plant.

[0062] As used herein, the term "recombinant nucleic acid" refers to nucleic acid that has been derived or isolated from any source, that may be subsequently chemically altered, and later introduced into a transgenic plant. An example of recombinant nucleic acid "derived" from a source, would be a DNA or RNA sequence that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form. An example of such DNA "isolated" from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.

[0063] The term "stringency" is used herein to describe the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. Those skilled in the art will recognize that "stringency" conditions may be altered by varying the parameters just described either individually or in concert. With "high stringency" conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences (for example, hybridization under "high stringency" conditions may occur between homologs with about 85-100% identity, preferably about 70-100% identity). With medium stringency conditions, nucleic acid base pairing will occur between nucleic acids with an intermediate frequency of complementary base sequences (for example, hybridization under "medium stringency" conditions may occur between homologs with about 50-70% identity). Thus, conditions of "weak" or "low" stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less.

[0064] The term "structural nucleic acid sequence of interest", as used herein, means a sequence of DNA, RNA or synthetic nucleotides that code for a protein. The term "structural nucleic acid of interest" is used interchangeably herein with the term "structural gene of interest".

[0065] As used in the present application, the term "substantial sequence homology" is used to indicate that a nucleotide sequence (in the case of DNA or RNA) or an amino acid sequence (in the case of a protein or polypeptide) exhibits substantial, functional or structural equivalence with another nucleotide or amino acid sequence. Any functional or structural differences between sequences having substantial sequence homology will be de minimis; that is they will not affect the ability of the sequence to function as indicated in the present application. Sequences that have substantial sequence homology with the sequences disclosed herein are usually variants of the disclosed sequence, such as mutations, but may also be synthetic sequences.

[0066] A "substitution", as used herein, refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively.

[0067] "Transformation", as defined herein, describes a process by which exogenous DNA enters and changes a recipient cell. It may occur under natural or artificial conditions using various methods well known in the art. Transformation may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method is selected based on the host cell being transformed and may include, but is not limited to, viral infection, electroporation, lipofection, and particle bombardment. Such "transformed" cells include stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome. They also include cells which transiently express the inserted DNA or RNA for limited periods of time.

[0068] "Nucleic acid sequence", as used herein, refers to a polymer of nucleotides in which the 3' position of one nucleotide sugar is linked to the 5' position of the next by a phosphodiester bridge. In a linear nucleic acid strand, one end typically has a free 5' phosphate group, the other a free 3' hydroxyl group. Nucleic acid sequences may be used herein to refer to oligonucleotides, or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single- or double-stranded, and represent the sense or antisense strand.

[0069] A promoter nucleic acid sequence is said to be "operably linked" to a structural nucleic acid sequence of interest if the two are situated such that the promoter nucleic acid sequence influences the transcription of the structural nucleic acid sequence of interest. For example, if the structural nucleic acid sequence codes for the production of a protein, the promoter nucleic acid sequence would be operably linked to the structural nucleic acid sequence if the promoter nucleic acid sequence affects the expression of the protein product from the structural nucleic acid sequence.

[0070] "Transgenic plant", as used herein, refers to a plant that contains a foreign nucleotide sequence inserted into either its nuclear genome or organellar genome.

[0071] The term "derivative", as used herein, refers to a modification of the native nucleic acid sequence of a 5' and/or 3' tobacco osmotin UTR. Illustrative of such modifications with regard to a 3' tobacco osmotin UTR, would be the substitution, insertion, and/or deletion of one or more bases relating to a nucleic acid sequence of a 3' tobacco osmotin UTR that preserve, slightly alter, or increase the protective function of one or more stem loop structures of the 3' UTR against RNase degradation. Such derivatives can be readily determined by one skilled in the art, for example, using sequence information to determine inverted repeats and using computer modeling techniques for predicting and optimizing optimal and suboptimal secondary structures, examples of which are discussed herein. A derivative of a 5' tobacco osmotin UTR may, for example, comprise a substitution, insertion, and/or deletion of one or more bases relating to a nucleic acid sequence of a 5' tobacco osmotin UTR that a) increase the AT (or AU) content; b) provide an optimized nucleotide context surround the AUG codon of the 5' end of the gene of interest; and/or c) do not add secondary structures which inhibit the scanning process of 40S ribosomal subunits. The term "derivative" thus also includes nucleic acid sequences having substantial sequence homology with the specifically disclosed regulatory sequences, such that they are able to have the disclosed effect on expression.

[0072] Computer modeling techniques for use in predicting/evaluating 5' and 3' UTR derivatives of the present invention include, but are not limited to: MFold version 3.1 available from Genetics Corporation Group, Madison, Wis. (see Zucker et al., Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide. In RNA Biochemistry and Biotechnology, 11-43, J. Barciszewski & B. F. C. Clark, eds., NATO ASI Series, Kluwer Academic Publishers, Dordrecht, N L, (1999); Zucker et al., Expanded Sequence Dependence of Thermodynamic Parameters Improves Prediction of RNA Secondary Structure. J. Mol. Biol. 288, 911-940 (1999); Zucker et al., RNA Secondary Structure Prediction.In Current Protocols in Nucleic Acid Chemistry S. Beaucage, D. E. Bergstrom, G. D. Glick, and R. A. Jones eds., John Wiley & Sons, New York, 11.2.1-11.2.10, (2000)), COVE (RNA structure analysis using covariance models (stochastic context free grammar methods)) v.2.4.2 (Eddy & Durbin, Nucl. Acids Res. 1994, 22: 2079-2088) which is freely distributed as source code and which can be downloaded by accessing http://www.genetics.wustl.edu/eddy/software/, and FOLDALIGN , also freely distributed and available for downloading at http://www.bioinf.au.dk/FOLDALIGN/(see Finding the most significant common sequence and structure motifs in a set of RNA sequences. J. Gorodkin, L. J. Heyer and G. D. Stormo. Nucleic Acids Research, Vol. 25, no. 18 pp 3724-3732, 1997; Finding Common Sequence and Structure Motifs in a set of RNA Sequences. J. Gorodkin, L. J. Heyer, and G. D. Stormo. ISMB 5;120-123, 1997).

[0073] Native, optimized, fragmented or otherwise modified versions of the 5' tobacco osmotin UTR may be used to flank the 5' region one or more structural genes of interest in a construct. The native sequence of the 5' tobacco osmotin UTR is as follows: tatccaacaacccaacttgttaaaaaaaatgtcca- acaac (SEQ. ID No. 1). (Nelson et al., Analysis of structure and transcriptional activity of an osmotin gene. Plant Mol. Bio. 19:577-588 (1992)).

[0074] One skilled in the art will readily be able ascertain usable derivations of the native sequence. In one preferred embodiment, exemplified herein, the single "atg" codon has been modified to watt"such that 40S ribosomal subunits will not be hindered by the semblance of an initiation codon in the 5' UTR. According to this embodiment, the nucleic acid sequence of the native 5' tobacco osmotin UTR has been modified to:

[0075] tatccaacaacccaacttgttaaaaaaaatttccaacaac (SEQ. ID No. 2) where the single base change is shown with underlining.

[0076] Native, optimized, fragmented or otherwise modified versions of the 3' tobacco osmotin UTR may also be used to flank the 3' region of one or more structural genes of interest in a construct. The published native sequence of the 3' tobacco osmotin UTR is:

[0077] agtggctatttctgtaataagatccaccttttggtcaaattattctatcgacacgttagtaagacaa- tctattt gactcgtttttatagttacgtactttgtttgaagtgatcaagtcatgatctttgctgtaataaacc- taagacctg aataagagtcacatatgtatttttgtcttgatgftatatagatcaataatgcatttggattatc- gtttttatattgtt tttcttttgaagttttagtaaagtcttaagctt (SEQ. ID No. 3). (Nelson et al. (1992).

[0078] In most cases, sequences having 95% homology to the 5' and 3' tobacco osmotin UTR sequences specifically disclosed herein will function as equivalents, and in many cases considerably less homology, for example 75% or 80%, will be acceptable. Locating the parts of these sequences that are not critical may be time consuming, but is routine and well within the skill in the art.

[0079] To modify the subject 5' and 3' UTR sequences in accordance with the teachings of this invention, exemplary techniques include those for polynucleotide-mediated, site-directed mutagenesis as well as well known techniques for the use of restriction enzymes, PCR amplification and ligase to modify and/or join existing nucleic acid molecules. (See, e.g., Zoller et al., DNA, 3:479-488 (1984); Higuchi et al., Nucl. Acids Res., 16:7351-7367 (1988); Ho et al., Gene, 77:51-59 (1989); Horton et al., Gene, 77:61 (1989); PCR Technology: Principles and Applications for DNA Amplification, (ed.) Erlich (1989); and U.S. Pat. No. 6,271,360 to Metz et al., Single-stranded oligodeoxynucleotide mutational vectors (issued Aug. 7, 2001)). In a preferred embodiment of the invention, one or more stem loop structures are added to SEQ. ID. No. 2 to provide further protection against mRNA degradation. In one aspect of this embodiment, the additional stem loop structures are derived through PCR amplification of all or part of SEQ. ID. No. 3. Stem loop structures may also be synthesized independently of SEQ. ID. No. 3. In a further embodiment of the invention, one or more existing stem loop structures within SEQ. ID. No. 3 are deleted, for example, by the use of site-specific restriction enzymes known to those skilled in the art.

[0080] Preferably, the 5' and 3' tobacco osmotin UTRs of the present invention are used in conjunction with one another with regard to flanking the appropriate regions of one or more structural genes of interest. The present invention, however, is not so limited. One or both of the 5' or 3' tobacco osmotin UTRs of the present invention may thus be used, for example, in conjunction with a UTR native to the structural gene(s) of interest, heterologous to the structural gene(s) of interest and the tobacco osmotin gene, or in addition to such a native or heterologous UTR.

[0081] The 5' and 3' osmotin UTRs for use in the present invention can be isolated from tobacco tissues or cells by means of nucleic acid hybridization techniques known in the art using, for example, the nucleotide sequences disclosed herein or portions thereof as hybridization probes. Such probes may consist of the entire osmotin gene or portions thereof, including the 5' and 3' UTRs identified herein. The subject osmotin 5' and 3' UTRs may also be synthetic and obtained using the above described sequences and nucleic acid synthesis techniques known in the art. Further, osmotin-encoding nucleotide sequences can be obtained from pOC cDNA clones as described by Singh et al., Plant Physiol. 90:1096-1101 (1989).

[0082] Other plants from which osmotin genes can be isolated are inter alia, millet, soybean, cotton, tomato and potato, described by Singh et al. (1987), and King et al., Plant. Mol. Biol. 10, 401-412 (1988). It is further contemplated that UTRs from genes encoding osmotin-like proteins from other plants than those mentioned above, such as maize, can be used in accordance with the present invention as can reasonably be expected to have similar homology to osmotin UTRs from tobacco.

[0083] The structural nucleic acid sequence of interest is operably linked to 5' and/or 3' UTR regions isolated or derived from an osmotin gene by known cloning techniques. The structural nucleic acid sequence of interest may be heterologous or homologous to the genes natively presently in the recipient plant, plant cell(s), or plant tissue. In either case, the 5' and 3' osmotin UTRs of the present invention are useful for regulating the translational efficiency of a nucleic acid sequence of interest so as to: increase the half-life of transcribed mRNA; and/or express the protein encoded by the structural nucleic acid sequence of interest in greater abundance in plant tissue than would be expressed without use of the 5' and/or 3' osmotin UTR(s) of the present invention. It is further specifically contemplated herein that the present invention is used in a gene construct engineered such that the protein encoded by the structural nucleic acid sequence of interest is expressed only in certain preferred tissue of a plant, such as the roots, leaves or stems, and not in the seed.

[0084] The present invention is generally applicable to the expression of structural genes of interest in both monocotyledonous and dicotyledonous plants. This invention is thus suitable for any member of the monocotyledonous (monocot) plant family including, but not limited to, maize, rice, barley, oats, wheat, sorghum, rye, sugarcane, pineapple, yams, onion, banana, coconut, and dates. A preferred application of the present invention is in the production of transgenic maize plants. Dicotyledonous (dicot) species for use with the present invention include, but are not limited to, tobacco, tomato, sunflower, cotton, sugarbeet, potato, lettuce, melon, soybean and canola (rapeseed).

[0085] The structural nucleic acid sequence of interest used in constructs of the present invention may be any nucleic acid sequence that provides for, or enhances, a beneficial feature of a resultant transgenic plant. Particularly useful nucleic acid sequences are those that encode proteins or antisense RNA transcripts in order to promote increased nutritional values, higher yields, tolerance to herbicides, insects, or diseases, and the like. More preferably, the nucleic acid sequences will be useful genes which are inherently unstable due to their relatively large size (at least 4-5 kb in length), which is known to render the genes more susceptible to physical, chemical, or enzymatic degradation. Genes inherently unstable due to their size include insecticidal genes from Xenorhabdus (see U.S. Pat. No. 6,048,838, hereby incorporated by reference herein) and Photorabdus (e.g., Toxin A as discussed herein).

[0086] In one preferred embodiment of the present invention, one or more structural nucleic acids of interest are flanked by one or more osmotin UTRs of the present invention which have been "stacked" in relation to one another in a particular crop variety. By use of the terms "stacked" or "stacking", it is meant herein that multiple structural genes of interest, each structural gene of interest preferably conferring a commercially desirable trait, have been transgenically introduced into a single crop variety (inbred or hybrid). For example, a corn hybrid with stacked genes may comprise one or more recombinant genes for insect resistance (e.g., Cry1F B.t. genes) as well as one or more recombinant herbicide resistance genes (e.g., glyphosate resistance genes).

[0087] In another preferred embodiment, one or more of the osmotin UTRs of the present invention are functionally linked to a Toxin A gene from Photorabdus, which is then stacked with one or more insecticide and/or herbicide resistance genes in a single crop variety. Preferably, but not necessarily, the insecticide gene(s) will be from a Bacillus thuringiensis or Xenorhabdus spp., and the herbicide gene(s) will be one or more of a glufosinate, glyphosate, imidazolinone, or 2.4-D or sulfonyl urea resistance genes. Of course, any of the "stacked" insecticide or herbicide genes may be functionally linked to the osmotin UTRs of the present invention.

[0088] The structural nucleic acid sequence of interest may be derived in whole or in part from a bacterial genome or episome, eukaryotic genomic, mitochondrial or plastid DNA, cDNA, viral nucleic acid, or chemically synthesized nucleic acid. It is contemplated that the structural nucleic acid sequence of interest may contain one or more modifications in either the coding region which could affect the biological activity or the chemical structure of the expression product, the rate of expression, or the manner of expression control. Such modifications include, but are not limited to, mutations, insertions, deletions, rearrangements and substitutions of one or more nucleotides. The structural nucleic acid sequence of interest may constitute an uninterrupted coding sequence or it may include one or more introns, bounded by the appropriate plant-functional splice junctions. The structural nucleic acid sequence of interest may be a composite of segments derived from a plurality of sources, naturally occurring or synthetic. The structural nucleic acid sequence of interest may also encode a fusion protein, so long as the experimental manipulations maintain functionality in the joining of the coding sequences.

[0089] In carrying out the present invention, cloning techniques are employed so as to obtain a vector containing the 5' and/or 3' osmotin UTRs flanking the structural gene of interest for subsequent introduction into desired host cells. The 5' and 3' osmotin UTRs, structural nucleic acid sequence of interest, and any desired promoters, enhancers, selectable markers, etc. may thus be isolated and cloned into vectors using standard cloning procedures in the art, such as those described by J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (2d ed., 1989), and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y. both of which are hereby incorporated by reference.

[0090] A wide variety of cloning vectors are available, or can be prepared, where the cloning vector includes a gene construct functional in a desired plant species. Illustrative vectors include, for example, pBR322, pUC series, pACYC184, Bluescript series (Stratagene), and the like. Such vectors are thus commercially available or can be readily prepared for transformation of plant cells. In general, plasmid or viral vectors will contain nucleic acid sequences necessary for both maintenance and expression of a heterologous DNA sequence in a given host. Selection of appropriate elements to optimize expression in any particular species is a matter of ordinary skill in the art utilizing the teachings of this disclosure. Suitable DNA components, selectable marker genes, reporter genes, enhancers, introns, and the like are described by K. Weising et al., Ann. Rev. Genetics, 22, 421 (1988).

[0091] Typically, the structural nucleic acid sequence of interest and 5' and/or 3' tobacco osmotin UTRs are inserted into an appropriate cloning vector at appropriate restriction site(s) such that the structural gene of interest is operably linked to a desired promoter and the 5' and/or 3' tobacco osmotin UTRs are functionally linked to the structural nucleic acid sequence of interest. In preparing the gene constructs of this invention, the various nucleic acid fragments may be manipulated, so as to provide for the nucleic acid sequences in the proper orientation and, as appropriate, in the proper reading frame. Of course, adapters or linkers may be employed for joining nucleic acid fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like.

[0092] The expression of structural genes employed in the present invention may be driven by any number of promoters. Although the endogenous promoter of a structural gene of interest may be utilized herein for transcriptional regulation of the gene, preferably, the promoter is a foreign regulatory sequence. For plant expression vectors, suitable viral promoters include the Cassava Vein Mosaic Virus promoter (Verdaguer et al., Plant Mol. Biol. 31(6):1129-39 (1996); 35S RNA and 19S RNA promoters of Cauliflower Mosaic Virus (CaMV) (Brisson et al., Nature 310:511 (1984); Odell et al., Nature, 313:810 (1985); the enhanced and double enhanced CaMV35S promoter (Kay et al., Science 236:1299-1302(1987); the full-length transcript promoter from Figwort Mosaic Virus (FMV) (Gowda et al., J. Cell Biochem., 13D: 301, 1989) and the coat protein promoter from TMV (Takamatsu et al., EMBO J. 6:307, 1987). Other useful promoters include the light-inducible promoter from the small subunit ribulose 1,5-bisphosphate carboxylase oxygenase (ssRUBISCO) (Coruzzi et al., EMBO J., 3:1671 (1984); Broglie, et al., Science 224:838 (1984); rice actin promoter (McElroy et al., Plant Cell. 2(2):163-71 (1990); and Adh1 promoter (Dennis et al., Nucleic Acids Res. 12(9):3983-4000 (1984)); mannopine synthase promoter (Velten et al., EMBO J., 3:2723, 1984); nopaline synthase (NOS) and octopine synthase (OCS) promoters (carried on tumor-inducing plasmids of Agrobacterium tumefaciens) or heat shock promoters, e.g., soybean hsp17.5-E or hsp17.3-B (Gurley et al., Mol. Cell. Biol. 6:559 (1986); Severin et al., Plant Mol. Biol. 15:827, (1990)).

[0093] Analysis of the cloning steps are typically conducted and may involve sequence analysis, restriction analysis, electrophoresis, or the like. After each manipulation the DNA sequence to be used in the final construct may be restricted and joined to the next sequence, where each of the partial constructs may be cloned in the same or different plasmids.

[0094] Once the cloning steps have been completed, various techniques exist which allow for the introduction, plant regeneration, stable integration, and expression of foreign recombinant vectors containing heterologous genes of interest in plant cells. One such technique involves acceleration of microparticles coated with genetic material directly into plant cells (U.S. Pat. No. 4,945,050 to Cornell; U.S. Pat. No. 5,141,131 to DowElanco; and U.S. Pat. Nos. 5,538,877 and 5,538,880, both to Dekalb). This technique is commonly referred to as "microparticle bombardment" or "biolistics". Plants may also be transformed using Agrobacterium technology (U.S. Pat. No. 5,177,010 to University of Toledo, U.S. Pat. No. 5,104,310 to Texas A&M, European Patent Application 0131624B1, European Patent Applications 120516, 159418B1 and 176, 112 to Schilperoot, U.S. Pat. Nos. 5,149,645, 5,469,976, 5,464,763 and 4,940,838 and 4,693,976 to Schilperoot, European Patent Applications 116718, 290799, 320500 all to Max Planck, European Patent Applications 604662, 627752 and U.S. Pat. No. 5,591,616 to Japan Tobacco, European Patent Applications 0267159, and 0292435 and U.S. Pat. No. 5,231,019 all to Ciba-Geigy, U.S. Pat. Nos. 5,463,174 and 4,762,785 both to Calgene, and U.S. Pat. Nos. 5,004,863 and 5,159,135 both to Agracetus). Another transformation method involves the use of elongated needle-like microfibers or "whiskers" to transform maize cell suspension cultures (U.S. Pat. Nos. 5,302,523 and 5,464,765 both to Zeneca). In addition, electroporation technology has been used to transform plant cells from which fertile plants have been obtained (WO 87/06614 to Boyce Thompson Institute; U.S. Pat. Nos. 5,472,869 and 5,384,253 both to Dekalb; U.S. Pat. Nos. 5,679,558, 5,641,664, WO9209696 and WO9321335 to Plant Genetic Systems).

[0095] Still further techniques for the transformation of plant cells include: direct DNA uptake mechanisms (see Mandel and Higa, J. Mol. Biol., 53:159-162 (1972); Dityatkin et al., Biochimica et Biophysica Acta, 281:319-323 (1972): Wigler et al., Cell, 16:77 (1979); and Uchimiya et al., In: Proc. 5th Intl. Cong. Plant Tissue and Cell Culture, A. Fujiwara (ed.), Jap. Assoc. for Plant Tissue Culture, Tokyo, pp. 507-508 (1982)); fusion mechanisms (see Uchidaz et al., In: Introduction of Macromolecules Into Viable Mammalian Cells, Baserga et al. (eds.) Wistar Symposium Series, 1:169-185 (1980)); site specific recombination (see WO/9109957), and various infectious agents (see Fraley et al., CRC Crit. Rev. Plant Sci., 4:1-46(1986); and Anderson, Science, 226:401-409(1984)).

[0096] The appropriate procedure to transform a selected plant cell may be chosen in accordance with the plant cell used. Based on the experience to date, there appears to be little difference in the expression of genes, once inserted into cells, attributable to the method of transformation itself. Rather, the activity of the foreign gene inserted into plant cells is dependent upon the influence of endogenous plant DNA adjacent the insert. Generally, the insertion of heterologous genes appears to be random using any transformation technique; however, technology currently exists for producing plants with site specific recombination of DNA into plant cells (see WO/9109957).

[0097] The particular methods used to transform such plant cells are not critical to this invention, nor are subsequent steps, such as regeneration of such plant cells, as necessary. Any method or combination of methods resulting in the expression of the desired sequence or sequences under the regulatory control of one or more of the subject 5' and/or 3' UTRs is acceptable.

[0098] Once introduced into the plant tissue, the expression of the structural gene may be assayed in a transient expression system, or it may be determined after selection for stable integration within the plant genome.

[0099] Any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)) and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes that can be employed in tk- or aprt-cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection; for example, dhfr, which confers resistance to methotrexate (Wigler et al., Proc. Natl. Acad. Sci., 77:3567 (1980)); npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin et al., J. Mol. Biol., 150:1 )(1981)); and ALS (U.S. Pat. No. 5,378.824 to Bedbrook) or PAT (Wehrmann et al., Nat Biotechnol 14(10):1274-8 (1996)), which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively. Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman and Mulligan, Proc. Natl. Acad. Sci., 85:8047 (1988)). More recently, the use of visible markers has gained popularity with such markers as GFP, anthocyanins, .alpha.-glucuronidase and its substrate GUS, luciferase and its substrate luciferin, being widely used not only to identify transformants, but also to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al., Methods Mol. Biol., 55:121 (1995)).

[0100] Although the presence/absence of marker gene expression suggests that the gene of interest is also present, its presence and expression may need to be confirmed. For example, if the sequence encoding a polypeptide is inserted within a marker gene sequence, recombinant cells containing sequences encoding the polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding the polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the tandem gene as well.

[0101] Alternatively, host cells that contain the nucleic acid sequence encoding the polypeptide of interest (for example, a polypeptide encoded by a nucleic acid of the present invention) and express the polypeptide may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques that include membrane, solution, or chip based technologies for the detection and/or quantification of nucleic acid or protein.

[0102] The presence of polynucleotide sequences encoding a polypeptide of interest (for example, a polypeptide encoded by a nucleic acid of the present invention) can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or portions or fragments of polynucleotides encoding the polypeptide. Nucleic acid amplification based assays involve the use of oligonucleotides or oligomers based on the sequences encoding the polypeptide to detect transformants containing DNA or RNA encoding the polypeptide. As used herein "oligonucleotides" or "oligomers" refer to a nucleic acid sequence of at least about 10 nucleotides and as many as about 60 nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20-25 nucleotides, that can be used as a probe or amplimer.

[0103] A variety of protocols for detecting and measuring the expression of a polypeptide (for example, a polypeptide encoded by a nucleic acid of the present invention), using either polyclonal or monoclonal antibodies specific for the protein are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering epitopes on the polypeptide is preferred, but a competitive binding assay may be employed. These and other assays are described, among other places, in Hampton et al., Serological Methods, a Laboratory Manual, APS Press, St Paul, Minn. (1990), and Maddox et al., J. Exp. Med., 158:1211 (1983).

[0104] A wide variety of labels and conjugation techniques are known by those skilled in the art and may be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding a polypeptide of interest include oligonucleotide labeling, nick translation, end-labeling or PCR amplification using a labeled nucleotide. Alternatively, the sequences encoding the polypeptide, or any portions thereof may be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro by addition of an appropriate RNA polymerase such as T7, T3, or SP6 and labeled nucleotides. These procedures may be conducted using a variety of commercially available kits from Pharmacia & Upjohn (Kalamazoo, Mich.), Promega Corporation (Madison, Wis.) and U.S. Biochemical Corp. (Cleveland, Ohio). Suitable reporter molecules or labels, that may be used, include radionucleotides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.

[0105] Techniques are known for the in vitro culture of plant tissue, and, in a number of cases, for regeneration into whole plants. The appropriate procedure to produce mature transgenic plants may be chosen in accordance with the plant species used. Regeneration varies from species to species of plants. Efficient regeneration will depend upon the medium, on the genotype, and on the history of the culture. Once whole plants have been obtained, they can be sexually or clonally reproduced in such a manner that at least one copy of the sequence is present in the cells of the progeny. Seed from the regenerated plants can be collected for future use, and plants grown from this seed. Procedures for transferring the introduced gene from the originally transformed plant into commercially useful cultivars are known to those skilled in the art.

[0106] Particular embodiments of this invention are further exemplified in the Examples. However, those skilled in the art will readily appreciate that the specific experiments detailed are only illustrative of the invention as described more fully in the claims which follow thereafter.

[0107] The preferred gene of interest for use in the present invention is the Toxin A gene from Photorhabdus luminescens (hereinafter "Photorabadus" or "P. luminescens).

EXAMPLES

[0108] Experimental Design

[0109] Photorhabdus luminescens is a gram-negative bacterium that forms entomopathogenic symbioses with Heterorhabditis spp. soil nematodes. (ffrench-Constant et al., Cell Mol Life Sci 57(5):828-33 (2000); ffrench-Constant et al. Curr Opin Microbiol. 2(3):284-8 (1999)). Nematodes harboring this bacterium have long been used as biological control agents for insect infestation. After the nematode invades the insect host, the bacteria are released into the insect haemocoel where they produce toxins and proteases that kill the insect host and render the host cadaver into a ready source of nutrients for both bacteria and nematode growth.

[0110] Several groups of toxin complexes have been purified from P. luminescens and their corresponding genes have been cloned. (Bowen et al., Science 280:2129-32 (1998); Merlo et al., GenBank Accession No. AF188483 (1999)). In previously conducted work, it was found that the fermentation broth of P. luminescens strain W-14 contains at least two potent proteins, Toxin A and Toxin B, which independently contribute to the insecticidal activity against Southern corn rootworm (SCR; Diabrotica undecimpunctata howardi) and tobacco hornworm (THW; Manduca sexta). (Gou et al., J. Biol. Chem. 274(14):9836-42 (1999)). The activities of these two proteins differ dramatically in toploaded artificial diet assays. LD.sub.50 values (lethal dose for 50% of insects) against SCR are 5 ng/cm.sup.2 diet and 87 ng/cm.sup.2 diet for Toxin A and Toxin B, respectively.

[0111] The 283 kD Toxin A protein (SEQ. ID. No. 4) (designated A0 protein herein) of P. luminescens strain W-14 is encoded by a single open reading frame (designated tcdA) of 7548 bp. (GenBank Accession No. AF188483; Gou, 1999). In the bacterial fermentation broth, native Toxin A exists in a large complex (>860 kD) consistent in size with a homotetramer (Verdaguer et al., Plant Mol. Biol. 31(6):1129-39 (1996)). Isolation and characterization (N-terminal sequencing and MALDI-TOF/QTOF analyses) of the proteins comprising the Toxin A complex revealed that the N-terminal 88 amino acids of the A0 primary gene product are removed, and the remaining peptide is cleaved into two large polypeptides, designated Al (5.8 kb) and A2 (1.7 kb) herein. During this processing step, another 88 internal amino acids are lost (see FIG. 1). The order of these cleavage steps, and the significance of the N-terminal and internal deletions relative to toxin activity are believed to be unknown in the art at the time of this disclosure. It has also previously been unclear as to whether the A1 polypeptide alone is responsible for the insecticidal activity of Toxin A.

[0112] To assess the potential use of various forms of the Toxin A gene for pest control, its insecticidal activity was tested in transgenic Arabidopsis plants as follows.

[0113] Six plant transformation vectors (pDAB7031 -pDAB7036) were constructed which contained various forms of the Toxin A gene under the control of a constitutive Cassava Vein Mosaic Virus promoter (CsVMV). (See FIG. 2). These Toxin A gene fragments included: 1) full-length A0 gene (A0, 7.5 kb) (SEQ. ID. No. D) in construct pDAB7031, 2) A0 gene with N-terminal truncation (A0/.DELTA.N, 7.3 kb) (SEQ. ID. No. 6) in construct pDAB7032, 3) full-length A1 gene (A1, 5.8 kb) (SEQ. ID. No. 7) in construct pDAB7033, 4) A1 gene with C-terminal truncation (A1/.DELTA.C, 5.6 kb) (SEQ. ID. No. 8) in construct pDAB7034, 5) A1 gene with both N- and C-terminal truncations (A1/.DELTA.N+.DELTA.C, 5.4) (SEQ. ID. No. 9) in construct pDAB7035, and 6) full-length A2 gene (A2, 1.7 kb) (SEQ. ID. No. 10) in construct pDAB7036. These six constructs were transformed into Arabidopsis plants via Agrobacterium-mediated transformation. Transgenic plants were selected based on the phenotype of kanamycin resistance.

[0114] As a strategy to enhance the expression of Toxin A in plant cells, additional gene constructs were also engineered such that three of Toxin A gene fragments, A0 (SEQ. ID. No. 5), A1/.DELTA.C (SEQ. ID. No. 8), and A2 (SEQ. ID. No. 10) were flanked on respective ends by 5' and 3' UTR sequences (SEQ. ID. Nos. 2 and 3, respectively) isolated from a tobacco osmotin gene. The resulting constructs were designated pDAB7026, pDAB7027, and pDAB7028, respectively (see FIG. 7). The protein expression levels of pDAB7026, pDAB7027 and pDAB7028 (hereinafter, the "osmotin UTR-Toxin A constructs") were then compared with Toxin A constructs not containing the osmotin UTRS-pDAB7031 through pDAB7036 (see FIG. 2) (hereinafter, the "non-osmotin UTR-Toxin A constructs").

[0115] Plasmid Construction

[0116] Unless otherwise noted herein, standard methods of DNA purification, restriction enzyme digestion, agarose gel analysis, DNA fragment isolation, ligation and transformation may be used as described in Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (2d ed., 1989), and Ausubel et al., Current Protocols in Molecular Biology (New York: John Wiley and Sons) (1987).

[0117] The 7548 bp DNA sequence of the native Toxin A gene ORF used in this work was determined from a gene cloned in this laboratory from P. luminescens strain W-14. (GenBank Accession No. AF188483). An alanine codon was added at the second position of the ORF to accommodate an Nco I recognition site spanning the start codon. The resulting nucleic acid sequence, which coded for essentially the same protein, was subsequently designed according to parameters outlined in Adang et al., Plant Mol. Biol. 21 (1993). Synthesis of gene fragments and assembly into an intact coding region were performed by Operon Technologies (Alameda, Calif.). Rebuilding of the Toxin A gene removed putative RNA instability sequences (ATTTAA), potential intron splice signals, potential polyadenylation signal sequences, and adjusted codon usage to accommodate expression in both monocot and dicot plant species ("plant optimized") (see PCT Application WO 01/11029, hereby incorporated by reference herein in its entirety). Unique Nco I and Sac I sites were added to the 5' and 3' ends of the coding region, respectfully. Various gene derivatives with corresponding Nco I and Sac I sites were generated from the basic tcdA coding region using PCR methods: A0/.DELTA.N gene (SEQ. ID. No. 6), A1 gene (SEQ. ID. No.7), A1/.DELTA.C gene (SEQ. ID. No. 8), A1/.DELTA.N+.DELTA.C gene (SEQ. ID. No.9) and A2 gene (SEQ. ID. No.10). All Toxin A gene fragments were placed under expression control of the CsVMV promoter and a 3'UTR/polyadenylation signal sequence derived from the intergenic region between ORFs25/26 of Ti plasmid pTi-1 5955 (Barker et al., Plant Mol. Biol. 2, 335 (1983)). Each Toxin A gene expression cassette was excised (Asc I and Pme I) and cloned between the T-DNA borders on binary vector pDAB1542 (FIG. 12), which contains a kanamycin resistance gene as selectable marker for plant transformation. The resultant constructs (pDAB7031 through pDAB7036) are further described herein and diagrammed in FIG. 2.

[0118] A control plant transformation vector (pDAB7029) containing a CsVMV-GUS-ORF25 expression cassette (Jefferson, Plant Molec. Biol. Rep. 5, 387 (1987)) was constructed using the same strategy. The GUS gene was first excised from plasmid pKA882 (FIG. 13) by Nco I and Sac I enzymes and inserted in the place of the PAT gene in plasmid pDAB7013 (FIG. 14). The CsVMV-GUS-ORF25 cassette was then moved into binary vector pDAB1542 (FIG. 12) using enzymes Asc I and Pme I.

[0119] To generate osmotin-Toxin A gene constructs, a pair of complementary oligonucleotides encoding the 40 bp 5' UTR sequence of a tobacco osmotin gene (SEQ. ID. No. 1) was chemically synthesized according to the published sequence (Nelson et al., 1992) except for a modification which changed a single "atg" codon to "att" so as to remove a putative initiation codon from the 5' UTR sequence (resulting in SEQ. ID. No. 2). During the synthesis, Bgl II and Nco I sites were added to 5' and 3' ends. The resulting 5' UTR sequence was then inserted into the same site between CsVMV promoter and PAT gene in vector pDAB7013 (FIG. 14), resulting in plasmid pDAB7020 (FIG. 15). The 3' UTR sequences of the same tobacco osmotin gene (SEQ. ID. No. 3) were PCR amplified from an osmotin cDNA clone (Liu et al., Proc. Natl. Acad. Sci. U.S.A. 91:1888-1892 (1994); a kind gift from Dr. Ray Bressan, Purdue University). During the PCR amplification, Sac I and Xho I sites were added to the 5' and 3' ends, respectively. The amplified osmotin 3'UTR sequence (SEQ. ID. No. 3) was then used to replace the ORF25/26 3' sequence on pDAB6001 (FIG. 16), giving rise to plasmid pDAB7002 (FIG. 17). The PAT gene and osmotin 3'UTR were then excised from pDAB7002 with Nco I and Xho I and used to replace the GUS gene on pDAB7020, resulting in plasmid pDAB7021 (FIG. 18), which contains CsVMV-OSM (osmotin) 5'UTR/PAT/OSM 3' UTR-ORF25/26 expression cassette. The coding regions of three Toxin A gene fragments, A0 (SEQ. ID. No. 5), A1/.DELTA.C (SEQ. ID. No. 8), and A2 (SEQ. ID. No. 10), were then used to replace the PAT gene on pDAB7021 (FIG. 18). Finally, the expression cassettes containing the modified coding region fragments under control of the CsVMV promoter and ORF25/26 3'UTR were cloned separately into binary vector pDAB1542 (FIG. 12).

[0120] A map of a plant transformation vector containing the full-length A0 gene with osmotin 5' and 3' UTR (pDAB7026) is shown in FIG. 19. Using a similar strategy, a control plant transformation vector containing CsVMV-OSM 5'UTR/GUS/OSM 3'UTR-ORF 25/26 was also constructed.

[0121] In addition to the vector embodiments described above, one of skill in the art will recognize that a generic vector can readily be created which will allow any gene of interest to be cloned adjacent the 5' and 3' tobacco osmotin UTRs of the present invention. As a non-limiting example, the plant expression vector pBI121 (Clontech Laboratories, Palo Alto, Calif.) contains an expression cassette of the GUS reporter gene driven by a CaMV 35S promoter and terminated by NOS terminator. (Jefferson, Nature 342:837-838, 1989). There are three restriction sites, Xba I, BamH I, and Sma I, between the CaMV 35S promoter and GUS reporter gene. Vector pBI121 also has a Sst I site between the GUS gene and its NOS terminator sequence. A 5' osmotin UTR sequence of the present invention may be chemically synthesized with Xba I and BamH I sites on its 5' and 3' ends using standard techniques, and then readily inserted into the Xba I and BamH I sites on pBI121. To insert the osmotin 3' UTR sequence into vector pBI121, PCR amplification procedures can be used to isolate the osmotin 3' UTR from osmotin cDNA clone with the addition of Sma I and Sst I sites to its 5' and 3' ends. This osmotin 3'UTR sequence then can be inserted into the Sma I and Sst I sites on pBI121, which will replace the GUS coding region. This cloning step creates an expression cassette of CaMV 35S-OSM 5'UTR/OSM 3'UTR-NOS on the resultant plasmid. In this expression cassette, there will be two restriction sites, BamHI and SmaI, between osmotin 5' UTR and 3' UTR sequence. Thus using BamH I and Sma I restriction enzymes and the appropriate restriction sites on the gene of interest, any gene of interest may be cloned into pBI121 for expression in transgenic plants.

[0122] Plant Growth and Transformation

[0123] Arabidopsis plants (Columbia ecotype) were grown at 22.degree. C. with a lighting cycle of 16 hours light and 8 hours dark. All plant transformation constructs were transformed into Agrobacterium strain C58 (Z707)(ATCC 33970) using either electroporation (Mattanovich et al., Efficient transformation of Agrobacterium spp. by electroporation. Nucleic Acids Research 17(16) pp 6747 (1989); Mersereau et al., Efficient transformation of Agrobacterium tumefaciens by electroporation. Gene (90) pps 149-151 (1990)) or freeze-thaw methods (Hofgen and Willmitzer, Storage of competent cells for Agrobacterium transformation. Nucleic Acids Research, 16:9877 (1998). Plant transformations were performed using the vacuum infiltration method (Bechtold et al., Mol. Biol. Genet. 316: 1194-1199 (1993)). Transgenic plants were selected based on the phenotype of kanamycin resistance.

[0124] Northern Hybridization

[0125] Total RNA was extracted from 150 mg mature leaf tissues using RNeasy Mini Plant Kit (QIAGEN, Inc, Valencia, Calif.). For RNA blot analysis, 5 ug of total RNA was loaded onto 1.5% agarose gels containing formaldehyde and processed for Northern analysis. Hybridizations were performed at 42.degree. for 4 hours in a UL TRAhyb solution (Ambion, Inc., Austin, Tex.). After hybridization, membranes were washed twice with 2.times.SSPE, 0.5% SDS for 15 min, then twice with 0.1.times.SSPE, 0.1% SDS. The first three washes were at room temperature, and the final wash was at 42.degree. C.

[0126] Bioassay of Transgenic Plants Against THW

[0127] Tobacco hornworm (THW, Manduca sexta) eggs were received from the North Carolina State University insectary. Eggs were incubated in lighted chambers (Percival, Boone, Iowa) at 220 or 28.degree. C. for 2 to 3 days in 90 mm Petri dishes with agar solution. The morning of the bioassay, any larvae that hatched overnight were removed from the plates, and only fresh larvae were used in the bioassay (less than 6 hours old, preferably). 128-well CD International (Pitman, N.J.) bioassay trays were prepared by placing 0.5 ml of a 2% agar solution into each well. Arabidopsis leaves were taken from 5-week-old plants. For each plant, leaf tissues were distributed evenly among 8 wells. A single neonate hornworm larva was placed into each well. Wells were covered with perforated sticky lids and the insects were allowed to feed for three days (72 hr) in a chamber at 28.degree. C. and 16:8 light:dark cycle. After 72 hours, insect mortality and weight scores were recorded. Mortality index was determined from the number of dead larvae out of the total number for any given plant. Two control (GUS) plants were used for every 16 transgenic plants containing the Toxin A gene construct. Data analysis was performed on insect mortality scores by comparing the percent insect mortality on experimental versus control plants. Mortality scores were transformed and a z-test was used. Plants that showed "moderate to high" Toxin A protein levels and significantly higher mortality than the controls (at p=0.05) were considered "active." If the Toxin A protein level was low, but mortality was high (usually >50%), plants were re-tested (usually in the next generation, but the original plant was sometimes re-sampled). To reveal any potential growth inhibition effects, individual insect weights were analyzed by ANOVA, comparing transformed plants with controls.

[0128] Experimental Results

[0129] Non-Osmotin UTR-Toxin A Constructs

[0130] Northern hybridization experiments indicated that 67% of the To plants examined (43 of 64) showed a single Toxin A RNA species of the expected size (FIG. 2). So far as we are aware, the full-length tcdA transcript is the largest transgenic RNA produced in plants to date. RNA expression levels varied from line to line (data not shown). Immunoblot (western) analysis was performed to examine the protein expression patterns in plants for each construct. Purified Toxin A protein produced from a recombinant E. coli strain, which exhibited three bands (A0, A1/.DELTA.C, and A2 proteins) on SDS-PAGE gel, was used as a positive standard. Plants transformed with the CsVMV-GUS-ORF25 construct (pDAB7029) served as the negative control. The results (FIGS. 3A and 3B) showed that plants carrying construct pDAB7031 (full-length tcdA) (FIG. 20) produced three protein bands which aligned with the positive control (FIG. 3A). In pDAB7036 plants, only a single protein band was observed, whose molecular weight was slightly smaller than the full-length A0 protein due to the N-terminal truncation of 88 amino acids (FIG. 3B). The absence of detectable A1/.DELTA.C and A2 proteins suggests that the 88 amino acids at the N-terminus of the A0 protein act as a control signal for internal processing between the two large subunits. From plants carrying the three A1 gene constructs, single A1 protein bands with the expected molecular sizes were found (FIG. 3C). The A1 protein in pDAB7035 plants was the same size as that of the standard (FIG. 3A), while A1 proteins from pDAB7033 and pDAB7034 plants hand slightly smaller sizes due to the truncations at the C-terminus or both ends (FIG. 5B and 5C). In contrast, no A2 protein was detected in 32 examined plants transformed with construct pDAB7032 (data not shown), even though A2 RNA was properly produced (FIG. 2). These results suggest that either the translation efficiency of A2 RNA is extremely low, the A2 protein is very unstable in plants, or the A2 protein is not extracted by the methodology used.

[0131] Protein accumulation levels were further quantified for each primary transformant using an ELISA procedure (FIG. 28--Table 1). For construct pDAB7031 (FIG. 20), all the positive lines except lines 7031-43 and 7031-25 contained Toxin A protein at levels lower than 200 ppm (parts per million; in this work, 1,000 ppm is equal to 0.1 % of total extractable protein).

[0132] The T.sub.1 selfed progeny from three pDAB7031 lines (7031-043, 025, and 041) were tested for Toxin A protein accumulation and for resistance to THW feeding. All progeny analyzed in this work were pre-selected on kanamycin-containing medium to ensure the presence of transgenes. Parents of these three lines had shown Toxin A protein levels of 1056, 349, and 134 ppm, respectively, at the T.sub.0 generation. However, none of the progeny from lines 7031-025 and 7031-041 produced Toxin A protein. For line 7031-043, 9 out of 32 progeny showed very low levels of Toxin A protein (<80 ppm); none of the others showed detectable Toxin A. Apparently, Toxin A gene expression was silenced in these progeny plants. As a consequence, none of these plants showed resistance to THW (data not shown).

[0133] These data prompted a larger scale examination of primary transformants (T.sub.0 plants) for insecticidal activity and Toxin A accretion levels. For this purpose, another 280 transgenic lines were generated with construct pDAB7031 (FIG. 20). Among these 280 transformants, only one line (7031-240) showed significantly high insecticidal activity (100% insect mortality) (FIG. 29--Table 2). This plant had a Toxin A protein level of 788 ppm. and was the highest expresser among these 280 lines. Toxin A protein production and insect activity of 32 of its T.sub.1 progeny were determined. The results showed that 11 progeny had undetectable levels of Toxin A protein and insecticidal activity, while the other 21 plants retained the high to very high levels of Toxin A protein production (739-7023 ppm) and showed 100% insect mortality. Insect mortality for the control plants transformed with construct CsVMV-GUS-ORF25 was 18.7%.

[0134] The above results indicated that when Toxin A accumulation reached a threshold level in plants (about 700 ppm), it could confer complete resistance to THW. However, it was noticed that the frequency of recovering insect-resistant lines was very low (1 out of 340 or 0.3%). This was probably due to the overall low expression of the large Toxin A gene from transformation vector pDAB7031 (FIG. 20), even though a strong constitutive promoter was used.

[0135] Osmotin UTR-Toxin A Constructs

[0136] To enhance expression of the Toxin A gene in plants, new constructs were produced by adding 5' and 3' UTR sequences (SEQ. ID. Nos. 2 and 3) from a tobacco osmotin gene to the corresponding ends of the Toxin A coding regions as described herein. To determine if these osmotin UTR structural elements would improve Toxin A gene expression levels, their effects were tested in three Toxin A gene constructs: pDAB7026 (full-length A0 gene) (SEQ. ID. No. 5), pDAB7027 (A1/C gene) (SEQ. ID. No. 8), and pDAB7028 (A2 gene) (SEQ. ID. No. 10). (See FIG. 7).

[0137] RNA expression patterns were examined in transgenic plants transformed with these three osmotin-Toxin A gene constructs. Northern blot analyses indicated 20 out of 30 examined plants, which covered all three constructs, showed a single species of Toxin A RNA with the expected molecular size (data not shown). These results were therefore the same as those observed from analogous non-osmotin UTR-Toxin A constructs. Toxin A protein levels of these osmotin-Toxin A constructs were compared with their nonosmotin-Toxin A counterparts (FIG. 29--Table 2). Of 340 total pDAB7031 plants, only 23% had detectable levels of Toxin A protein, and the average Toxin A accumulation level of expressing plants was 67 ppm. For the 273 pDAB7026 transgenic plants, 39% contained Toxin A protein, and the average level of the expressing plants was 390 ppm. Therefore, there was about a 6-fold difference between these two constructs. If all plants examined were included in the statistical analysis (i.e. expressers and non-expressers), the average Toxin A production levels were 15 ppm for the pDAB7031 plants, and 150 ppm for the pDAB7026 plants (10-fold difference). In addition to an increase in overall Toxin A producers and Toxin A accumulation, there was a also difference in the number of high expressers (Toxin A protein >700 ppm) for each construct. Among the pDAB7031 plants, there were 2 high expressers (0.6%), whereas in the ppAB7026 plant group, there were 13 high expressers (4.7%). For some high expressers with construct pDAB7026 (>2,000 ppm), the accumulation of Toxin A protein in plant cells could be easily observed in an SDS-PAGE gel (FIG. 8B).

[0138] For plants carrying construct pDAB7033, 58% produced the truncated A1 proteins, and the average A1 protein level of expressing plants was 251 ppm. For pDAB7028 transgenic plants, 90% of examined plants showed A1 protein, and the average level of accumulation was 1131 ppm (4.5-fold increase). The effect of the osmotin flanking sequences was also observed in transgenic plants carrying constructs designed to produce the A2 protein. There was no detectable A2 protein in any of the 32 pDAB7032 plants examined (Table 1). However, in the 25 plants carrying construct pDAB7028, 40% (10 plants) produced a single band of A2 protein (FIG. 29--Table 2 and FIG. 8A), although the overall expression level was not high. These data clearly demonstrate that tobacco osmotin UTR sequences can greatly enhance Toxin A gene expression in transgenic Arabidopsis plants.

[0139] The increase in the overall accumulation of Toxin A protein also increased the chances of recovering insect-resistant lines. Bioassays were performed directly on 259 primary pDAB7026 transformants. Among these T.sub.0 plants, 9 lines (not including line 7026-011, see below) showed 100% insect mortality (FIG. 30--Table 3). Except for line 7026-127, all these lines had Toxin A levels higher than 1,000 ppm. The bioactivity and high level accumulation of the Toxin A protein were coordinately transmitted into the next generation. At least 32 progeny were examined for each of these 9 lines as well as line 7026-011 (FIG. 30--Table 3). Although bioassays were not done on the T.sub.0 plant of line 7026-011, its T.sub.1 progeny were included in this study because the T0 plant had a high level of Toxin A protein. For line 7026-011, all except one of the 71 T.sub.1 progeny showed 100% insect mortality. The remaining plant showed 87.5% mortality (1 of 8 insects survived), which was nevertheless significantly higher than the control mortality (19%) (Table 6). In contrast, for line 7026-195, none of its 32 T.sub.1 progeny showed Toxin A accumulation or insecticidal activity. For the other lines, the percentage of progeny that showed high levels of Toxin A protein and insecticidal activity ranged from 90% to 18% (FIG. 30--Table 3). In total, 333 T.sub.1 progeny for these 10 lines were analyzed, and 214 were found to retain a high level of Toxin A protein. Among these T.sub.1 high expressers, 211 (98%) had significantly high insecticidal activity when compared to the control group (FIG. 30--Table 3). FIG. 31--Table 4 shows the average insect mortality of the high expressers and the low or non-expressers among the T.sub.1 progeny for each line. These results further confirmed that the high level of accumulation of Toxin A protein was responsible for the plants' insecticidal activity against THW.

[0140] During the screening for insect-resistant lines amongst T.sub.0 pDAB7026 plants, four lines were found that had very low or no Toxin A accumulation, yet showed a significantly high insecticidal activity. Sixteen T.sub.1 progeny from each of these four lines were examined. None of these plants showed any Toxin A protein or insect activity (data not shown), suggesting that these four lines were false positives in the insect bioassays. The earlier bioassay results on the T.sub.0 plants were probably due to variations in test insect viability or to some undetermined artifacts resulting from the transformation processes.

[0141] In contrast, four lines were identified that showed high level accumulation of Toxin A protein, but no significant insect mortality. To determine if these could be false negative results, 32 progeny from each of these lines were analyzed. Except for line 7026-101, in which none of the progeny showed any Toxin A protein or insect activity, the other three lines, with a total 11 progeny, showed high level expression of the Toxin A gene (FIG. 32--Table 5). The average insect mortality shown by these T.sub.1 high expressers was 98.2% while the control group was 14.0%. These results confirmed that the non-significant activity observed on these lines at the T.sub.0 generation could have been escapes of the current bioassay procedure. These aberrant results underscore the need to examine transgenic progeny, rather than solely TO plants, in assessing gene function.

[0142] In summary, from 274 pDAB7026 transgenic lines analyzed at the T.sub.1 generation, 12 lines (4.4%) were identified with heritable high levels of Toxin A production and insect activity (FIG. 29--Table 2), even though the degree of heritability varied from 3% (line 7026-101) to 100% (line 7026-011). These results demonstrate that the enhanced accumulation of the Toxin A protein by the osmotin UTR sequences increased the recovery frequency of insect-resistant lines from 0.3% to 4.4% (FIG. 29--Table 2).

[0143] Lines 7026-011 and 7026-057 were further followed to their fifth generations (T.sub.4 plants) to determine the stability of Toxin A gene expression and associated insecticidal activity. For line 7026-011, the overexpression of Toxin A and insecticidal activity were stably maintained in all progeny for five generations (FIG. 33--Table 6). However, the heritability pattern for line 7026-057 was more complicated (FIG. 9). Thirty-eight T.sub.1 progeny were examined, and all 15 T.sub.1 plants homozygous for the transgenes had lost Toxin protein production as well as insect activity. Only 7 of the remaining 23 hemizygous progeny retained both high level accumulation of Toxin A and 100% insect mortality (FIG. 29--Table 2). A T.sub.2 generation was derived from 6 of the 7 insect active hemizygous T.sub.1 plants (FIG. 9). The percentage of active plants for each T.sub.2 family ranged from 0% to 35%.

[0144] Examination of T.sub.4 progeny identified one T.sub.3 family in which 60% of family members were high expressers and were insect active. One interesting question was to determine, for this family, if the average percentage of active plants in the T.sub.4 generation would increase over the T.sub.3 generation. Apparently, this was not the case. Similar results were also seen for the progeny of five T.sub.3 families, which were derived from a single T.sub.2 family, in which 35.8% family members were active plants.

[0145] According to the structural model of the Toxin A complex (FIG. 1), a question addressable by these transgenic materials was whether the A2 polypeptide is an indispensable part of the complex's activity. Transgenic plants carrying constructs pDAB7033, 7034, and 7035, which produce only A1 proteins at relatively high levels, were further studied. From the screening of 146 T.sub.1 progeny, 12 high expressers were identified which covered all three A1 constructs. Bioassay results showed that none of these plants showed significantly higher insect mortality compared to the control plants (data not shown). This indicated that the A1 protein alone in Arabidopsis is not sufficient for insecticidai activity against THW.

[0146] Discussion

[0147] In this work, the initial analysis concerned expression of a plant-optimized P. luminescens strain W-14 tcdA gene in transgenic Arabidopsis plants. The results provided some important insights about the behaviors of Toxin A protein in plants: 1) the full length tcdA gene can produce Toxin A protein whose final products mimic those observed from the native P. luminescens strain W-14 and from a recombinant E. coli strain, indicating that Toxin A protein is appropriately processed in plant cells; 2) the N-terminal 88 amino acids of the A0 protein seem to serve as a signal peptide for protein cleavage, since the deletion of these amino acids prevents the cleavage of the TcdA protein into the A1 and A2 polypeptides; 3) the N-terminus and C-terminus of the A1 protein were not further processed in plants cells, otherwise, the Al proteins encoded by three different A1 gene constructs would have the same molecular weights.

[0148] In the early stages of this work with construct pDAB7031 (FIG. 20), it was observed that the overall accumulation of Toxin A protein in transgenic plants was very low. The overall low expression also resulted in a low frequency of recovering insect-resistant lines (0.3% of transgenics). In the particular case of construct pDAB7032, A2 protein was not observed in the transgenic plants, even though the A2 mRNA was easily detected. Poor transgene expression in plants can be attributed to many factors, especially when using a gene from heterologous sources. Use of a strong promoter does not necessarily guarantee a high level of gene expression. In addition to low transcriptional activity due to integration position effects, features such as improper splicing, incomplete polyadenylation, inefficient nuclear export, mRNA instability, and poor translation efficiency all can result in low level accumulation of both mRNA and protein. Elimination of these potential pitfalls was attempted through complete redesign and synthesis of the plant-optimized Toxin A coding region. Further, Toxin A gene expression was enhanced by adding 5' and 3' UTR flanking sequences from a tobacco osmotin gene to the Toxin A gene. Structural features of the osmotin mRNA 5' and 3' UTRs are consistent with the criteria of a stable, highly expressed plant mRNA: i) the 5' UTR sequence is highly AT-rich, allowing ribosomes to easily scan to the start codon to initiate translation, and ii) the 3' UTR sequences can form a strong stem-loop secondary structure that may effectively block degradation from RNase. (Kozie, 1996). Indeed, after the osmotin 5' and 3' UTR sequences were added to the corresponding ends of the Toxin A gene(s), the overall production of the A1 and A0 proteins increased 5-10 fold. As a consequence, the recovery frequency for insect-resistant lines transformed with tcdA genes increased from 0.3% to 4.4%. Also, for the first time, accumulation of the A2 protein could be detected in 40% of plants examined that were transformed with the A2 gene alone.

[0149] Importantly, it was demonstrated that overexpression of tcdA in transgenic Arabidopsis plants can render the plants completely toxic to feeding THW. For the first time, it has been clearly shown that the presence of the A2 subunit is associated with Toxin A's insecticidal activity, as plants containing only the large A1 subunit were inactive. In the analysis of about 2,500 individual plants, insecticidal activity was always associated with high level accumulation of the Toxin A protein. These results indicate that the Toxin A gene is an excellent candidate for crop protection in agriculture, since Toxin A also has strong activity against SCR. The Toxin A gene and other P. luminescens toxin genes may open new routes for pest control in agriculture. Until now, transgenic crop insect control has heavily relied on the use of Bt toxin genes, and the P. luminescens toxin genes can help reduce the problem of development of resistance of pests to Bt plants. Stacking the Toxin A gene into plants which already contain a Bt gene may also increase the efficacy of insect toxicity in terms of potency and pest spectrum.

[0150] Summary

[0151] The analysis of protein expression of three Toxin A coding regions in transgenic Arabidopsis plants is provided in Table 1. In plants carrying the A0 gene construct with no osmotin UTR flanks, only 23% of the 340 examined plants showed detectable protein expression. The average Toxin A protein level of expression plants was 67 PPM (parts per million, ng per mg soluble protein). However, for the 273 transgenic plants examined that carried the osmotin UTR-A0 gene construct, 39% showed protein expression, and the average Toxin A protein level of the expressing plants was 390 PPM. Therefore, osmotin UTR-A0 constructs are expressed about 6-fold higher as compared to non-osmotin A0 constructs. When all plants examined are included in the statistical analysis, the average Toxin A expression level for the A0 construct was 15 ppm, while the average Toxin A expression level for the osmotin UTR-A0 plants was 150 PPM. Thus, the difference in average Toxin A production between these two constructs is about 10 fold. The number of high expressers for each construct (Toxin A protein>700 PPM) was also calculated. Among the A0 plants, there were 2 high expressers (0.6%), whereas in the osmotin UTR-A0 plant group, 13 high expressers (4.7%) were found.

[0152] For transgenic plants carrying the A1/.DELTA.C gene construct, 58% expressed the truncated A1 proteins, and the average A1 protein expression level of expressing plants was 251 ppm. For transgenic plants carrying the osmotin UTR-A1/.DELTA.C construct, 90% of examined plants showed A1 protein expression, and the average level of expression was 1131 PPM (a 4.5-fold increase). For transgenic plants carrying the A2 gene, A2 protein expression could not be detected in any of the 32 examined plants. However, in 25 osmotin-A2 plants, 10 plants (40%) were found that expressed the A2 protein, and the average level for expression was 31 pp. These data clearly show that tobacco osmotin UTR sequences can greatly enhance foreign gene expression in transgenic Arabidopsis plants with three different gene constructs.

[0153] The insecticidal activity of the transgenic plants carrying full-length Toxin A gene constructs was also evaluated. For non-osmotin/A0 plants, only one line (0.3%) showed complete resistance (100% mortality) against tobacco hornworm (THW) at the T0 generation, and its activity was confirmed at the next generation. For the plant group with the osmotin UTR-A0 gene, 10 lines (3.6%) were found with heritable resistance to THW.

[0154] Having thus described in detail preferred embodiments of the present invention, it is to be understood that the various described embodiments are merely exemplary of the present invention and that many apparent variations thereof are possible without departing from the spirit or scope thereof. Accordingly, one skilled in the art will readily recognize that the present invention is not limited to the specific embodiments described herein.

Sequence CWU 1

1

10 1 40 DNA Nicotiana tabacum 1 tatccaacaa cccaacttgt taaaaaaaat gtccaacaac 40 2 40 DNA Nicotiana tabacum 2 tatccaacaa cccaacttgt taaaaaaaat ttccaacaac 40 3 260 DNA Nicotiana tabacum 3 agtggctatt tctgtaataa gatccacctt ttggtcaaat tattctatcg acacgttagt 60 aagacaatct atttgactcg tttttatagt tacgtacttt gtttgaagtg atcaagtcat 120 gatctttgct gtaataaacc taagacctga ataagagtca catatgtatt tttgtcttga 180 tgttatatag atcaataatg catttggatt atcgttttta tattgttttt cttttgaagt 240 tttagtaaag tcttaagctt 260 4 2516 PRT Photorabus luminescens 4 Met Asn Glu Ser Val Lys Glu Ile Pro Asp Val Leu Lys Ser Gln Cys 1 5 10 15 Gly Phe Asn Cys Leu Thr Asp Ile Ser His Ser Ser Phe Asn Glu Phe 20 25 30 Arg Gln Gln Val Ser Glu His Leu Ser Trp Ser Glu Thr His Asp Leu 35 40 45 Tyr His Asp Ala Gln Gln Ala Gln Lys Asp Asn Arg Leu Tyr Glu Ala 50 55 60 Arg Ile Leu Lys Arg Ala Asn Pro Gln Leu Gln Asn Ala Val His Leu 65 70 75 80 Ala Ile Leu Ala Pro Asn Ala Glu Leu Ile Gly Tyr Asn Asn Gln Phe 85 90 95 Ser Gly Arg Ala Ser Gln Tyr Val Ala Pro Gly Thr Val Ser Ser Met 100 105 110 Phe Ser Pro Ala Ala Tyr Leu Thr Glu Leu Tyr Arg Glu Ala Arg Asn 115 120 125 Leu His Ala Ser Asp Ser Val Tyr Tyr Leu Asp Thr Arg Arg Pro Asp 130 135 140 Leu Lys Ser Met Ala Leu Ser Gln Gln Asn Met Asp Ile Glu Leu Ser 145 150 155 160 Thr Leu Ser Leu Ser Asn Glu Leu Leu Leu Glu Ser Ile Lys Thr Glu 165 170 175 Ser Lys Leu Glu Asn Tyr Thr Lys Val Met Glu Met Leu Ser Thr Phe 180 185 190 Arg Pro Ser Gly Ala Thr Pro Tyr His Asp Ala Tyr Glu Asn Val Arg 195 200 205 Glu Val Ile Gln Leu Gln Asp Pro Gly Leu Glu Gln Leu Asn Ala Ser 210 215 220 Pro Ala Ile Ala Gly Leu Met His Gln Ala Ser Leu Leu Gly Ile Asn 225 230 235 240 Ala Ser Ile Ser Pro Glu Leu Phe Asn Ile Leu Thr Glu Glu Ile Thr 245 250 255 Glu Gly Asn Ala Glu Glu Leu Tyr Lys Lys Asn Phe Gly Asn Ile Glu 260 265 270 Pro Ala Ser Leu Ala Met Pro Glu Tyr Leu Lys Arg Tyr Tyr Asn Leu 275 280 285 Ser Asp Glu Glu Leu Ser Gln Phe Ile Gly Lys Ala Ser Asn Phe Gly 290 295 300 Gln Gln Glu Tyr Ser Asn Asn Gln Leu Ile Thr Pro Val Val Asn Ser 305 310 315 320 Ser Asp Gly Thr Val Lys Val Tyr Arg Ile Thr Arg Glu Tyr Thr Thr 325 330 335 Asn Ala Tyr Gln Met Asp Val Glu Leu Phe Pro Phe Gly Gly Glu Asn 340 345 350 Tyr Arg Leu Asp Tyr Lys Phe Lys Asn Phe Tyr Asn Ala Ser Tyr Leu 355 360 365 Ser Ile Lys Leu Asn Asp Lys Arg Glu Leu Val Arg Thr Glu Gly Ala 370 375 380 Pro Gln Val Asn Ile Glu Tyr Ser Ala Asn Ile Thr Leu Asn Thr Ala 385 390 395 400 Asp Ile Ser Gln Pro Phe Glu Ile Gly Leu Thr Arg Val Leu Pro Ser 405 410 415 Gly Ser Trp Ala Tyr Ala Ala Ala Lys Phe Thr Val Glu Glu Tyr Asn 420 425 430 Gln Tyr Ser Phe Leu Leu Lys Leu Asn Lys Ala Ile Arg Leu Ser Arg 435 440 445 Ala Thr Glu Leu Ser Pro Thr Ile Leu Glu Gly Ile Val Arg Ser Val 450 455 460 Asn Leu Gln Leu Asp Ile Asn Thr Asp Val Leu Gly Lys Val Phe Leu 465 470 475 480 Thr Lys Tyr Tyr Met Gln Arg Tyr Ala Ile His Ala Glu Thr Ala Leu 485 490 495 Ile Leu Cys Asn Ala Pro Ile Ser Gln Arg Ser Tyr Asp Asn Gln Pro 500 505 510 Ser Gln Phe Asp Arg Leu Phe Asn Thr Pro Leu Leu Asn Gly Gln Tyr 515 520 525 Phe Ser Thr Gly Asp Glu Glu Ile Asp Leu Asn Ser Gly Ser Thr Gly 530 535 540 Asp Trp Arg Lys Thr Ile Leu Lys Arg Ala Phe Asn Ile Asp Asp Val 545 550 555 560 Ser Leu Phe Arg Leu Leu Lys Ile Thr Asp His Asp Asn Lys Asp Gly 565 570 575 Lys Ile Lys Asn Asn Leu Lys Asn Leu Ser Asn Leu Tyr Ile Gly Lys 580 585 590 Leu Leu Ala Asp Ile His Gln Leu Thr Ile Asp Glu Leu Asp Leu Leu 595 600 605 Leu Ile Ala Val Gly Glu Gly Lys Thr Asn Leu Ser Ala Ile Ser Asp 610 615 620 Lys Gln Leu Ala Thr Leu Ile Arg Lys Leu Asn Thr Ile Thr Ser Trp 625 630 635 640 Leu His Thr Gln Lys Trp Ser Val Phe Gln Leu Phe Ile Met Thr Ser 645 650 655 Thr Ser Tyr Asn Lys Thr Leu Thr Pro Glu Ile Lys Asn Leu Leu Asp 660 665 670 Thr Val Tyr His Gly Leu Gln Gly Phe Asp Lys Asp Lys Ala Asp Leu 675 680 685 Leu His Val Met Ala Pro Tyr Ile Ala Ala Thr Leu Gln Leu Ser Ser 690 695 700 Glu Asn Val Ala His Ser Val Leu Leu Trp Ala Asp Lys Leu Gln Pro 705 710 715 720 Gly Asp Gly Ala Met Thr Ala Glu Lys Phe Trp Asp Trp Leu Asn Thr 725 730 735 Lys Tyr Thr Pro Gly Ser Ser Glu Ala Val Glu Thr Gln Glu His Ile 740 745 750 Val Gln Tyr Cys Gln Ala Leu Ala Gln Leu Glu Met Val Tyr His Ser 755 760 765 Thr Gly Ile Asn Glu Asn Ala Phe Arg Leu Phe Val Thr Lys Pro Glu 770 775 780 Met Phe Gly Ala Ala Thr Gly Ala Ala Pro Ala His Asp Ala Leu Ser 785 790 795 800 Leu Ile Met Leu Thr Arg Phe Ala Asp Trp Val Asn Ala Leu Gly Glu 805 810 815 Lys Ala Ser Ser Val Leu Ala Ala Phe Glu Ala Asn Ser Leu Thr Ala 820 825 830 Glu Gln Leu Ala Asp Ala Met Asn Leu Asp Ala Asn Leu Leu Leu Gln 835 840 845 Ala Ser Ile Gln Ala Gln Asn His Gln His Leu Pro Pro Val Thr Pro 850 855 860 Glu Asn Ala Phe Ser Cys Trp Thr Ser Ile Asn Thr Ile Leu Gln Trp 865 870 875 880 Val Asn Val Ala Gln Gln Leu Asn Val Ala Pro Gln Gly Val Ser Ala 885 890 895 Leu Val Gly Leu Asp Tyr Ile Gln Ser Met Lys Glu Thr Pro Thr Tyr 900 905 910 Ala Gln Trp Glu Asn Ala Ala Gly Val Leu Thr Ala Gly Leu Asn Ser 915 920 925 Gln Gln Ala Asn Thr Leu His Ala Phe Leu Asp Glu Ser Arg Ser Ala 930 935 940 Ala Leu Ser Thr Tyr Tyr Ile Arg Gln Val Ala Lys Ala Ala Ala Ala 945 950 955 960 Ile Lys Ser Arg Asp Asp Leu Tyr Gln Tyr Leu Leu Ile Asp Asn Gln 965 970 975 Val Ser Ala Ala Ile Lys Thr Thr Arg Ile Ala Glu Ala Ile Ala Ser 980 985 990 Ile Gln Leu Tyr Val Asn Arg Ala Leu Glu Asn Val Glu Glu Asn Ala 995 1000 1005 Asn Ser Gly Val Ile Ser Arg Gln Phe Phe Ile Asp Trp Asp Lys 1010 1015 1020 Tyr Asn Lys Arg Tyr Ser Thr Trp Ala Gly Val Ser Gln Leu Val 1025 1030 1035 Tyr Tyr Pro Glu Asn Tyr Ile Asp Pro Thr Met Arg Ile Gly Gln 1040 1045 1050 Thr Lys Met Met Asp Ala Leu Leu Gln Ser Val Ser Gln Ser Gln 1055 1060 1065 Leu Asn Ala Asp Thr Val Glu Asp Ala Phe Met Ser Tyr Leu Thr 1070 1075 1080 Ser Phe Glu Gln Val Ala Asn Leu Lys Val Ile Ser Ala Tyr His 1085 1090 1095 Asp Asn Ile Asn Asn Asp Gln Gly Leu Thr Tyr Phe Ile Gly Leu 1100 1105 1110 Ser Glu Thr Asp Ala Gly Glu Tyr Tyr Trp Arg Ser Val Asp His 1115 1120 1125 Ser Lys Phe Asn Asp Gly Lys Phe Ala Ala Asn Ala Trp Ser Glu 1130 1135 1140 Trp His Lys Ile Asp Cys Pro Ile Asn Pro Tyr Lys Ser Thr Ile 1145 1150 1155 Arg Pro Val Ile Tyr Lys Ser Arg Leu Tyr Leu Leu Trp Leu Glu 1160 1165 1170 Gln Lys Glu Ile Thr Lys Gln Thr Gly Asn Ser Lys Asp Gly Tyr 1175 1180 1185 Gln Thr Glu Thr Asp Tyr Arg Tyr Glu Leu Lys Leu Ala His Ile 1190 1195 1200 Arg Tyr Asp Gly Thr Trp Asn Thr Pro Ile Thr Phe Asp Val Asn 1205 1210 1215 Lys Lys Ile Ser Glu Leu Lys Leu Glu Lys Asn Arg Ala Pro Gly 1220 1225 1230 Leu Tyr Cys Ala Gly Tyr Gln Gly Glu Asp Thr Leu Leu Val Met 1235 1240 1245 Phe Tyr Asn Gln Gln Asp Thr Leu Asp Ser Tyr Lys Asn Ala Ser 1250 1255 1260 Met Gln Gly Leu Tyr Ile Phe Ala Asp Met Ala Ser Lys Asp Met 1265 1270 1275 Thr Pro Glu Gln Ser Asn Val Tyr Arg Asp Asn Ser Tyr Gln Gln 1280 1285 1290 Phe Asp Thr Asn Asn Val Arg Arg Val Asn Asn Arg Tyr Ala Glu 1295 1300 1305 Asp Tyr Glu Ile Pro Ser Ser Val Ser Ser Arg Lys Asp Tyr Gly 1310 1315 1320 Trp Gly Asp Tyr Tyr Leu Ser Met Val Tyr Asn Gly Asp Ile Pro 1325 1330 1335 Thr Ile Asn Tyr Lys Ala Ala Ser Ser Asp Leu Lys Ile Tyr Ile 1340 1345 1350 Ser Pro Lys Leu Arg Ile Ile His Asn Gly Tyr Glu Gly Gln Lys 1355 1360 1365 Arg Asn Gln Cys Asn Leu Met Asn Lys Tyr Gly Lys Leu Gly Asp 1370 1375 1380 Lys Phe Ile Val Tyr Thr Ser Leu Gly Val Asn Pro Asn Asn Ser 1385 1390 1395 Ser Asn Lys Leu Met Phe Tyr Pro Val Tyr Gln Tyr Ser Gly Asn 1400 1405 1410 Thr Ser Gly Leu Asn Gln Gly Arg Leu Leu Phe His Arg Asp Thr 1415 1420 1425 Thr Tyr Pro Ser Lys Val Glu Ala Trp Ile Pro Gly Ala Lys Arg 1430 1435 1440 Ser Leu Thr Asn Gln Asn Ala Ala Ile Gly Asp Asp Tyr Ala Thr 1445 1450 1455 Asp Ser Leu Asn Lys Pro Asp Asp Leu Lys Gln Tyr Ile Phe Met 1460 1465 1470 Thr Asp Ser Lys Gly Thr Ala Thr Asp Val Ser Gly Pro Val Glu 1475 1480 1485 Ile Asn Thr Ala Ile Ser Pro Ala Lys Val Gln Ile Ile Val Lys 1490 1495 1500 Ala Gly Gly Lys Glu Gln Thr Phe Thr Ala Asp Lys Asp Val Ser 1505 1510 1515 Ile Gln Pro Ser Pro Ser Phe Asp Glu Met Asn Tyr Gln Phe Asn 1520 1525 1530 Ala Leu Glu Ile Asp Gly Ser Gly Leu Asn Phe Ile Asn Asn Ser 1535 1540 1545 Ala Ser Ile Asp Val Thr Phe Thr Ala Phe Ala Glu Asp Gly Arg 1550 1555 1560 Lys Leu Gly Tyr Glu Ser Phe Ser Ile Pro Val Thr Leu Lys Val 1565 1570 1575 Ser Thr Asp Asn Ala Leu Thr Leu His His Asn Glu Asn Gly Ala 1580 1585 1590 Gln Tyr Met Gln Trp Gln Ser Tyr Arg Thr Arg Leu Asn Thr Leu 1595 1600 1605 Phe Ala Arg Gln Leu Val Ala Arg Ala Thr Thr Gly Ile Asp Thr 1610 1615 1620 Ile Leu Ser Met Glu Thr Gln Asn Ile Gln Glu Pro Gln Leu Gly 1625 1630 1635 Lys Gly Phe Tyr Ala Thr Phe Val Ile Pro Pro Tyr Asn Leu Ser 1640 1645 1650 Thr His Gly Asp Glu Arg Trp Phe Lys Leu Tyr Ile Lys His Val 1655 1660 1665 Val Asp Asn Asn Ser His Ile Ile Tyr Ser Gly Gln Leu Thr Asp 1670 1675 1680 Thr Asn Ile Asn Ile Thr Leu Phe Ile Pro Leu Asp Asp Val Pro 1685 1690 1695 Leu Asn Gln Asp Tyr His Ala Lys Val Tyr Met Thr Phe Lys Lys 1700 1705 1710 Ser Pro Ser Asp Gly Thr Trp Trp Gly Pro His Phe Val Arg Asp 1715 1720 1725 Asp Lys Gly Ile Val Thr Ile Asn Pro Lys Ser Ile Leu Thr His 1730 1735 1740 Phe Glu Ser Val Asn Val Leu Asn Asn Ile Ser Ser Glu Pro Met 1745 1750 1755 Asp Phe Ser Gly Ala Asn Ser Leu Tyr Phe Trp Glu Leu Phe Tyr 1760 1765 1770 Tyr Thr Pro Met Leu Val Ala Gln Arg Leu Leu His Glu Gln Asn 1775 1780 1785 Phe Asp Glu Ala Asn Arg Trp Leu Lys Tyr Val Trp Ser Pro Ser 1790 1795 1800 Gly Tyr Ile Val His Gly Gln Ile Gln Asn Tyr Gln Trp Asn Val 1805 1810 1815 Arg Pro Leu Leu Glu Asp Thr Ser Trp Asn Ser Asp Pro Leu Asp 1820 1825 1830 Ser Val Asp Pro Asp Ala Val Ala Gln His Asp Pro Met His Tyr 1835 1840 1845 Lys Val Ser Thr Phe Met Arg Thr Leu Asp Leu Leu Ile Ala Arg 1850 1855 1860 Gly Asp His Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Asn Glu 1865 1870 1875 Ala Lys Met Trp Tyr Met Gln Ala Leu His Leu Leu Gly Asp Lys 1880 1885 1890 Pro Tyr Leu Pro Leu Ser Thr Thr Trp Ser Asp Pro Arg Leu Asp 1895 1900 1905 Arg Ala Ala Asp Ile Thr Thr Gln Asn Ala His Asp Ser Ala Ile 1910 1915 1920 Val Ala Leu Arg Gln Asn Ile Pro Thr Pro Ala Pro Leu Ser Leu 1925 1930 1935 Arg Ser Ala Asn Thr Leu Thr Asp Leu Phe Leu Pro Gln Ile Asn 1940 1945 1950 Glu Val Met Met Asn Tyr Trp Gln Thr Leu Ala Gln Arg Val Tyr 1955 1960 1965 Asn Leu Arg His Asn Leu Ser Ile Asp Gly Gln Pro Leu Tyr Leu 1970 1975 1980 Pro Ile Tyr Ala Thr Pro Ala Asp Pro Lys Ala Leu Leu Ser Ala 1985 1990 1995 Ala Val Ala Thr Ser Gln Gly Gly Gly Lys Leu Pro Glu Ser Phe 2000 2005 2010 Met Ser Leu Trp Arg Phe Pro His Met Leu Glu Asn Ala Arg Gly 2015 2020 2025 Met Val Ser Gln Leu Thr Gln Phe Gly Ser Thr Leu Gln Asn Ile 2030 2035 2040 Ile Glu Arg Gln Asp Ala Glu Ala Leu Asn Ala Leu Leu Gln Asn 2045 2050 2055 Gln Ala Ala Glu Leu Ile Leu Thr Asn Leu Ser Ile Gln Asp Lys 2060 2065 2070 Thr Ile Glu Glu Leu Asp Ala Glu Lys Thr Val Leu Glu Lys Ser 2075 2080 2085 Lys Ala Gly Ala Gln Ser Arg Phe Asp Ser Tyr Gly Lys Leu Tyr 2090 2095 2100 Asp Glu Asn Ile Asn Ala Gly Glu Asn Gln Ala Met Thr Leu Arg 2105 2110 2115 Ala Ser Ala Ala Gly Leu Thr Thr Ala Val Gln Ala Ser Arg Leu 2120 2125 2130 Ala Gly Ala Ala Ala Asp Leu Val Pro Asn Ile Phe Gly Phe Ala 2135 2140 2145 Gly Gly Gly Ser Arg Trp Gly Ala Ile Ala Glu Ala Thr Gly Tyr 2150 2155 2160 Val Met Glu Phe Ser Ala Asn Val Met Asn Thr Glu Ala Asp Lys 2165 2170 2175 Ile Ser Gln Ser Glu Thr Tyr Arg Arg Arg Arg Gln Glu Trp Glu 2180 2185 2190 Ile Gln Arg Asn Asn Ala Glu Ala Glu Leu Lys Gln Ile Asp Ala 2195 2200 2205 Gln Leu Lys Ser Leu Ala Val Arg Arg Glu Ala Ala Val Leu Gln 2210 2215 2220 Lys Thr Ser Leu Lys Thr Gln Gln Glu Gln Thr Gln Ser Gln Leu 2225 2230 2235 Ala Phe Leu Gln Arg Lys Phe Ser Asn Gln Ala Leu Tyr Asn Trp 2240 2245 2250 Leu Arg Gly Arg Leu Ala Ala Ile Tyr Phe Gln Phe Tyr Asp Leu 2255 2260 2265 Ala Val Ala Arg Cys Leu Met Ala Glu Gln Ala Tyr Arg Trp Glu 2270 2275 2280 Leu Asn Asp Asp Ser Ala Arg Phe Ile Lys Pro Gly Ala Trp Gln 2285 2290 2295 Gly Thr Tyr Ala Gly Leu Leu Ala Gly Glu Thr Leu Met Leu Ser 2300 2305 2310 Leu Ala Gln Met Glu Asp Ala His Leu Lys Arg Asp Lys Arg Ala 2315 2320 2325 Leu Glu Val Glu Arg Thr Val Ser Leu

Ala Glu Val Tyr Ala Gly 2330 2335 2340 Leu Pro Lys Asp Asn Gly Pro Phe Ser Leu Ala Gln Glu Ile Asp 2345 2350 2355 Lys Leu Val Ser Gln Gly Ser Gly Ser Ala Gly Ser Gly Asn Asn 2360 2365 2370 Asn Leu Ala Phe Gly Ala Gly Thr Asp Thr Lys Thr Ser Leu Gln 2375 2380 2385 Ala Ser Val Ser Phe Ala Asp Leu Lys Ile Arg Glu Asp Tyr Pro 2390 2395 2400 Ala Ser Leu Gly Lys Ile Arg Arg Ile Lys Gln Ile Ser Val Thr 2405 2410 2415 Leu Pro Ala Leu Leu Gly Pro Tyr Gln Asp Val Gln Ala Ile Leu 2420 2425 2430 Ser Tyr Gly Asp Lys Ala Gly Leu Ala Asn Gly Cys Glu Ala Leu 2435 2440 2445 Ala Val Ser His Gly Met Asn Asp Ser Gly Gln Phe Gln Leu Asp 2450 2455 2460 Phe Asn Asp Gly Lys Phe Leu Pro Phe Glu Gly Ile Ala Ile Asp 2465 2470 2475 Gln Gly Thr Leu Thr Leu Ser Phe Pro Asn Ala Ser Met Pro Glu 2480 2485 2490 Lys Gly Lys Gln Ala Thr Met Leu Lys Thr Leu Asn Asp Ile Ile 2495 2500 2505 Leu His Ile Arg Tyr Thr Ile Lys 2510 2515 5 7560 DNA Photorabdus luminescens 5 ccatggctaa cgagtccgtc aaggagatcc cagacgtcct caagtcccaa tgcggtttca 60 actgcctcac tgacatctcc cacagctcct tcaacgagtt cagacaacaa gtctctgagc 120 acctctcctg gtccgagacc catgacctct accatgacgc tcagcaagct cagaaggaca 180 acaggctcta cgaggctagg atcctcaaga gggctaaccc acaactccag aacgctgtcc 240 acctcgccat cttggctcca aacgctgagt tgattggtta caacaaccag ttctctggca 300 gagctagcca gtacgtggct cctggtacag tctcctccat gttcagccca gccgcttacc 360 tcactgagtt gtaccgcgag gctaggaacc ttcatgcttc tgactccgtc tactacttgg 420 acacacgcag accagacctc aagagcatgg ccctcagcca acagaacatg gacattgagt 480 tgtccaccct ctccttgagc aacgagcttc tcttggagtc catcaagact gagagcaagt 540 tggagaacta caccaaggtc atggagatgc tctccacctt cagaccaagc ggtgcaactc 600 cataccatga tgcctacgag aacgtcaggg aggtcatcca acttcaagac cctggtcttg 660 agcaactcaa cgcttctcca gccattgctg gtttgatgca ccaggcatcc ttgctcggta 720 tcaacgcctc catctctcct gagttgttca acatcttgac tgaggagatc actgagggca 780 acgctgagga gttgtacaag aagaacttcg gcaacattga gccagcctct cttgcaatgc 840 ctgagtacct caagaggtac tacaacttgt ctgatgagga gctttctcaa ttcattggca 900 aggcttccaa cttcggtcaa caggagtaca gcaacaacca gctcatcact ccagttgtga 960 actcctctga tggcactgtg aaggtctacc gcatcacacg tgagtacacc acaaacgcct 1020 accaaatgga tgttgagttg ttcccattcg gtggtgagaa ctacagactt gactacaagt 1080 tcaagaactt ctacaacgcc tcctacctct ccatcaagtt gaacgacaag agggagcttg 1140 tcaggactga gggtgctcct caagtgaaca ttgagtactc tgccaacatc accctcaaca 1200 cagctgacat ctctcaacca ttcgagattg gtttgaccag agtccttccc tctggctcct 1260 gggcctacgc tgcagccaag ttcactgttg aggagtacaa ccagtactct ttcctcttga 1320 agctcaacaa ggcaattcgt ctcagcagag ccactgagtt gtctcccacc atcttggagg 1380 gcattgtgag gtctgtcaac cttcaacttg acatcaacac tgatgtgctt ggcaaggtct 1440 tcctcaccaa gtactacatg caacgctacg ccatccatgc tgagactgca ctcatcctct 1500 gcaacgcacc catctctcaa cgctcctacg acaaccagcc ttcccagttc gacaggctct 1560 tcaacactcc tctcttgaac ggccagtact tctccactgg tgatgaggag attgacctca 1620 actctggctc cacaggtgac tggagaaaga ccatcttgaa gagggccttc aacattgatg 1680 atgtctctct cttccgtctc ttgaagatca cagatcacga caacaaggat ggcaagatca 1740 agaacaactt gaagaacctt tccaacctct acattggcaa gttgcttgca gacatccacc 1800 aactcaccat tgatgagttg gacctcttgc tcattgcagt cggtgagggc aagaccaacc 1860 tctctgcaat ctctgacaag cagttggcaa ccctcatcag gaagttgaac accatcacct 1920 cctggcttca cacccagaag tggtctgtct tccaactctt catcatgacc agcacctcct 1980 acaacaagac cctcactcct gagatcaaga acctcttgga cacagtctac cacggtctcc 2040 aaggcttcga caaggacaag gctgacttgc ttcatgtcat ggctccctac attgcagcca 2100 ccctccaact ctcctctgag aacgtggctc actctgtctt gctctgggct gacaagctcc 2160 aacctggtga tggtgccatg actgctgaga agttctggga ctggctcaac accaagtaca 2220 caccaggctc ctctgaggct gttgagactc aagagcacat tgtgcaatac tgccaggctc 2280 ttgcacagtt ggagatggtc taccactcca ctggcatcaa cgagaacgct ttcagactct 2340 tcgtcaccaa gcctgagatg ttcggtgctg ccacaggtgc tgcacctgct catgatgctc 2400 tctccctcat catgttgacc aggttcgctg actgggtcaa cgctcttggt gagaaggctt 2460 cctctgtctt ggctgccttc gaggccaact ccctcactgc tgagcaactt gctgatgcca 2520 tgaaccttga tgccaacctc ttgctccaag cttccattca agctcagaac caccaacacc 2580 tcccacctgt cactccagag aacgctttct cctgctggac ctccatcaac accatcctcc 2640 aatgggtcaa cgtggctcag caactcaacg tggctccaca aggtgtctct gctttggtcg 2700 gtcttgacta catccagtcc atgaaggaga caccaaccta cgctcaatgg gagaacgcag 2760 ctggtgtctt gactgctggt ctcaactccc aacaggccaa caccctccat gctttcttgg 2820 atgagtctcg ctctgctgcc ctctccacct actacatcag gcaagtcgcc aaggcagctg 2880 ctgccatcaa gtctcgcgat gacctctacc aatacctcct cattgacaac caggtctctg 2940 ctgccatcaa gaccaccagg atcgctgagg ccatcgcttc catccaactc tacgtcaacc 3000 gcgctcttga gaacgttgag gagaacgcca actctggtgt catctctcgc caattcttca 3060 tcgactggga caagtacaac aagaggtact ccacctgggc tggtgtctct caacttgtct 3120 actacccaga gaactacatt gacccaacca tgaggattgg tcagaccaag atgatggatg 3180 ctctcttgca atctgtctcc caaagccaac tcaacgctga cactgtggag gatgccttca 3240 tgagctacct cacctccttc gagcaagttg ccaacctcaa ggtcatctct gcttaccatg 3300 acaacatcaa caacgaccaa ggtctcacct acttcattgg tctctctgag actgatgctg 3360 gtgagtacta ctggagatcc gtggaccaca gcaagttcaa cgatggcaag ttcgctgcaa 3420 acgcttggtc tgagtggcac aagattgact gccctatcaa cccatacaag tccaccatca 3480 gacctgtcat ctacaagagc cgcctctact tgctctggct tgagcagaag gagatcacca 3540 agcaaactgg caactccaag gatggttacc aaactgagac tgactaccgc tacgagttga 3600 agttggctca catccgctac gatggtacct ggaacactcc aatcaccttc gatgtcaaca 3660 agaagatcag cgagttgaag ttggagaaga accgtgctcc tggtctctac tgcgctggtt 3720 accaaggtga ggacaccctc ttggtcatgt tctacaacca gcaagacacc cttgactcct 3780 acaagaacgc ttccatgcaa ggtctctaca tcttcgctga catggcttcc aaggacatga 3840 ctccagagca aagcaacgtc taccgtgaca actcctacca acagttcgac accaacaacg 3900 tcaggcgtgt caacaacaga tacgctgagg actacgagat cccaagctct gtcagctctc 3960 gcaaggacta cggctggggt gactactacc tcagcatggt gtacaacggt gacatcccaa 4020 ccatcaacta caaggctgcc tcttccgacc tcaaaatcta catcagccca aagctcagga 4080 tcatccacaa cggctacgag ggtcagaaga ggaaccagtg caacttgatg aacaagtacg 4140 gcaagttggg tgacaagttc attgtctaca cctctcttgg tgtcaaccca aacaacagct 4200 ccaacaagct catgttctac ccagtctacc aatactctgg caacacctct ggtctcaacc 4260 agggtagact cttgttccac agggacacca cctacccaag caaggtggag gcttggattc 4320 ctggtgccaa gaggtccctc accaaccaga acgctgccat tggtgatgac tacgccacag 4380 actccctcaa caagcctgat gacctcaagc agtacatctt catgactgac tccaagggca 4440 cagccactga tgtctctggt ccagtggaga tcaacactgc aatcagccca gccaaggtcc 4500 aaatcattgt caaggctggt ggcaaggagc aaaccttcac agctgacaag gatgtctcca 4560 tccagccaag cccatccttc gatgagatga actaccaatt caacgctctt gagattgatg 4620 gttctggcct caacttcatc aacaactctg cttccattga tgtcaccttc actgccttcg 4680 ctgaggatgg ccgcaagttg ggttacgaga gcttctccat cccagtcacc cttaaggttt 4740 ccactgacaa cgcactcacc cttcatcaca acgagaacgg tgctcagtac atgcaatggc 4800 aaagctaccg caccaggttg aacaccctct tcgcaaggca acttgtggcc cgtgccacca 4860 caggcattga caccatcctc agcatggaga cccagaacat ccaagagcca cagttgggca 4920 agggtttcta cgccaccttc gtcatcccac cttacaacct cagcactcat ggtgatgaga 4980 ggtggttcaa gctctacatc aagcacgtgg ttgacaacaa ctcccacatc atctactctg 5040 gtcaactcac tgacaccaac atcaacatca ccctcttcat cccacttgac gatgtcccac 5100 tcaaccagga ctaccatgcc aaggtctaca tgaccttcaa gaagtctcca tctgatggca 5160 cctggtgggg tccacacttc gtccgtgatg acaagggcat cgtcaccatc aacccaaagt 5220 ccatcctcac ccacttcgag tctgtcaacg ttctcaacaa catctcctct gagccaatgg 5280 acttctctgg tgccaactcc ctctacttct gggagttgtt ctactacaca ccaatgcttg 5340 tggctcaaag gttgctccat gagcagaact tcgatgaggc caacaggtgg ctcaagtacg 5400 tctggagccc atctggttac attgtgcatg gtcaaatcca gaactaccaa tggaacgtca 5460 ggccattgct tgaggacacc tcctggaact ctgacccact tgactctgtg gaccctgatg 5520 ctgtggctca acatgaccca atgcactaca aggtctccac cttcatgagg accttggacc 5580 tcttgattgc cagaggtgac catgcttacc gccaattgga gagggacacc ctcaacgagg 5640 caaagatgtg gtacatgcaa gctctccacc tcttgggtga caagccatac ctcccactca 5700 gcaccacttg gtccgaccca aggttggacc gtgctgctga catcaccact cagaacgctc 5760 atgactctgc cattgttgct ctcaggcaga acatcccaac tcctgctcca ctctccctca 5820 gatctgctaa caccctcact gacttgttcc tcccacagat caacgaggtc atgatgaact 5880 actggcaaac cttggctcaa agggtctaca acctcagaca caacctctcc attgatggtc 5940 aaccactcta cctcccaatc tacgccacac cagctgaccc aaaggctctt ctctctgctg 6000 ctgtggctac cagccaaggt ggtggcaagc tcccagagtc cttcatgtcc ctctggaggt 6060 tcccacacat gttggagaac gcccgtggca tggtctccca actcacccag ttcggttcca 6120 ccctccagaa catcattgag aggcaagatg ctgaggctct caacgctttg ctccagaacc 6180 aggcagctga gttgatcctc accaacttgt ccatccaaga caagaccatt gaggagcttg 6240 atgctgagaa gacagtcctt gagaagagca aggctggtgc ccaatctcgc ttcgactcct 6300 acggcaagct ctacgatgag aacatcaacg ctggtgagaa ccaggccatg accctcaggg 6360 cttccgcagc tggtctcacc actgctgtcc aagcctctcg cttggctggt gcagctgctg 6420 acctcgttcc aaacatcttc ggtttcgctg gtggtggctc cagatggggt gccattgctg 6480 aggctaccgg ttacgtcatg gagttctctg ccaacgtcat gaacactgag gctgacaaga 6540 tcagccaatc tgagacctac agaaggcgcc gtcaagagtg ggagatccaa aggaacaacg 6600 ctgaggcaga gttgaagcaa atcgatgctc aactcaagtc cttggctgtc agaagggagg 6660 ctgctgtcct ccagaagacc tccctcaaga cccaacagga gcaaacccag tcccagttgg 6720 ctttcctcca aaggaagttc tccaaccagg ctctctacaa ctggctcaga ggccgcttgg 6780 ctgccatcta cttccaattc tacgaccttg ctgtggccag gtgcctcatg gctgagcaag 6840 cctaccgctg ggagttgaac gatgactccg ccaggttcat caagccaggt gcttggcaag 6900 gcacctacgc tggtctcctt gctggtgaga ccctcatgct ctccttggct caaatggagg 6960 atgctcacct caagagggac aagagggctt tggaggtgga gaggacagtc tcccttgctg 7020 aggtctacgc tggtctccca aaggacaacg gtccattctc ccttgctcaa gagattgaca 7080 agttggtcag ccaaggttct ggttctgctg gttctggtaa caacaacttg gctttcggcg 7140 ctggtactga caccaagacc tccctccaag cctctgtctc cttcgctgac ctcaagatca 7200 gggaggacta cccagcttcc cttggcaaga tcaggcgcat caagcaaatc tctgtcaccc 7260 tcccagctct cttgggtcca taccaagatg tccaagcaat cctctcctac ggtgacaagg 7320 ctggtttggc gaacggttgc gaggctcttg ctgtctctca tggcatgaac gactctggtc 7380 aattccaact tgacttcaac gatggcaagt tcctcccatt cgagggcatt gccattgacc 7440 aaggcaccct caccctctcc ttcccaaacg cttccatgcc agagaaggga aagcaagcca 7500 ccatgctcaa gaccctcaac gatatcatcc tccacatcag gtacaccatc aagtgagctc 7560 6 7302 DNA Photorabdus luminescens 6 ccatggctga gttgattggt tacaacaacc agttctctgg cagagctagc cagtacgtgg 60 ctcctggtac agtctcctcc atgttcagcc cagccgctta cctcactgag ttgtaccgcg 120 aggctaggaa ccttcatgct tctgactccg tctactactt ggacacacgc agaccagacc 180 tcaagagcat ggccctcagc caacagaaca tggacattga gttgtccacc ctctccttga 240 gcaacgagct tctcttggag tccatcaaga ctgagagcaa gttggagaac tacaccaagg 300 tcatggagat gctctccacc ttcagaccaa gcggtgcaac tccataccat gatgcctacg 360 agaacgtcag ggaggtcatc caacttcaag accctggtct tgagcaactc aacgcttctc 420 cagccattgc tggtttgatg caccaggcat ccttgctcgg tatcaacgcc tccatctctc 480 ctgagttgtt caacatcttg actgaggaga tcactgaggg caacgctgag gagttgtaca 540 agaagaactt cggcaacatt gagccagcct ctcttgcaat gcctgagtac ctcaagaggt 600 actacaactt gtctgatgag gagctttctc aattcattgg caaggcttcc aacttcggtc 660 aacaggagta cagcaacaac cagctcatca ctccagttgt gaactcctct gatggcactg 720 tgaaggtcta ccgcatcaca cgtgagtaca ccacaaacgc ctaccaaatg gatgttgagt 780 tgttcccatt cggtggtgag aactacagac ttgactacaa gttcaagaac ttctacaacg 840 cctcctacct ctccatcaag ttgaacgaca agagggagct tgtcaggact gagggtgctc 900 ctcaagtgaa cattgagtac tctgccaaca tcaccctcaa cacagctgac atctctcaac 960 cattcgagat tggtttgacc agagtccttc cctctggctc ctgggcctac gctgcagcca 1020 agttcactgt tgaggagtac aaccagtact ctttcctctt gaagctcaac aaggcaattc 1080 gtctcagcag agccactgag ttgtctccca ccatcttgga gggcattgtg aggtctgtca 1140 accttcaact tgacatcaac actgatgtgc ttggcaaggt cttcctcacc aagtactaca 1200 tgcaacgcta cgccatccat gctgagactg cactcatcct ctgcaacgca cccatctctc 1260 aacgctccta cgacaaccag ccttcccagt tcgacaggct cttcaacact cctctcttga 1320 acggccagta cttctccact ggtgatgagg agattgacct caactctggc tccacaggtg 1380 actggagaaa gaccatcttg aagagggcct tcaacattga tgatgtctct ctcttccgtc 1440 tcttgaagat cacagatcac gacaacaagg atggcaagat caagaacaac ttgaagaacc 1500 tttccaacct ctacattggc aagttgcttg cagacatcca ccaactcacc attgatgagt 1560 tggacctctt gctcattgca gtcggtgagg gcaagaccaa cctctctgca atctctgaca 1620 agcagttggc aaccctcatc aggaagttga acaccatcac ctcctggctt cacacccaga 1680 agtggtctgt cttccaactc ttcatcatga ccagcacctc ctacaacaag accctcactc 1740 ctgagatcaa gaacctcttg gacacagtct accacggtct ccaaggcttc gacaaggaca 1800 aggctgactt gcttcatgtc atggctccct acattgcagc caccctccaa ctctcctctg 1860 agaacgtggc tcactctgtc ttgctctggg ctgacaagct ccaacctggt gatggtgcca 1920 tgactgctga gaagttctgg gactggctca acaccaagta cacaccaggc tcctctgagg 1980 ctgttgagac tcaagagcac attgtgcaat actgccaggc tcttgcacag ttggagatgg 2040 tctaccactc cactggcatc aacgagaacg ctttcagact cttcgtcacc aagcctgaga 2100 tgttcggtgc tgccacaggt gctgcacctg ctcatgatgc tctctccctc atcatgttga 2160 ccaggttcgc tgactgggtc aacgctcttg gtgagaaggc ttcctctgtc ttggctgcct 2220 tcgaggccaa ctccctcact gctgagcaac ttgctgatgc catgaacctt gatgccaacc 2280 tcttgctcca agcttccatt caagctcaga accaccaaca cctcccacct gtcactccag 2340 agaacgcttt ctcctgctgg acctccatca acaccatcct ccaatgggtc aacgtggctc 2400 agcaactcaa cgtggctcca caaggtgtct ctgctttggt cggtcttgac tacatccagt 2460 ccatgaagga gacaccaacc tacgctcaat gggagaacgc agctggtgtc ttgactgctg 2520 gtctcaactc ccaacaggcc aacaccctcc atgctttctt ggatgagtct cgctctgctg 2580 ccctctccac ctactacatc aggcaagtcg ccaaggcagc tgctgccatc aagtctcgcg 2640 atgacctcta ccaatacctc ctcattgaca accaggtctc tgctgccatc aagaccacca 2700 ggatcgctga ggccatcgct tccatccaac tctacgtcaa ccgcgctctt gagaacgttg 2760 aggagaacgc caactctggt gtcatctctc gccaattctt catcgactgg gacaagtaca 2820 acaagaggta ctccacctgg gctggtgtct ctcaacttgt ctactaccca gagaactaca 2880 ttgacccaac catgaggatt ggtcagacca agatgatgga tgctctcttg caatctgtct 2940 cccaaagcca actcaacgct gacactgtgg aggatgcctt catgagctac ctcacctcct 3000 tcgagcaagt tgccaacctc aaggtcatct ctgcttacca tgacaacatc aacaacgacc 3060 aaggtctcac ctacttcatt ggtctctctg agactgatgc tggtgagtac tactggagat 3120 ccgtggacca cagcaagttc aacgatggca agttcgctgc aaacgcttgg tctgagtggc 3180 acaagattga ctgccctatc aacccataca agtccaccat cagacctgtc atctacaaga 3240 gccgcctcta cttgctctgg cttgagcaga aggagatcac caagcaaact ggcaactcca 3300 aggatggtta ccaaactgag actgactacc gctacgagtt gaagttggct cacatccgct 3360 acgatggtac ctggaacact ccaatcacct tcgatgtcaa caagaagatc agcgagttga 3420 agttggagaa gaaccgtgct cctggtctct actgcgctgg ttaccaaggt gaggacaccc 3480 tcttggtcat gttctacaac cagcaagaca cccttgactc ctacaagaac gcttccatgc 3540 aaggtctcta catcttcgct gacatggctt ccaaggacat gactccagag caaagcaacg 3600 tctaccgtga caactcctac caacagttcg acaccaacaa cgtcaggcgt gtcaacaaca 3660 gatacgctga ggactacgag atcccaagct ctgtcagctc tcgcaaggac tacggctggg 3720 gtgactacta cctcagcatg gtgtacaacg gtgacatccc aaccatcaac tacaaggctg 3780 cctcttccga cctcaaaatc tacatcagcc caaagctcag gatcatccac aacggctacg 3840 agggtcagaa gaggaaccag tgcaacttga tgaacaagta cggcaagttg ggtgacaagt 3900 tcattgtcta cacctctctt ggtgtcaacc caaacaacag ctccaacaag ctcatgttct 3960 acccagtcta ccaatactct ggcaacacct ctggtctcaa ccagggtaga ctcttgttcc 4020 acagggacac cacctaccca agcaaggtgg aggcttggat tcctggtgcc aagaggtccc 4080 tcaccaacca gaacgctgcc attggtgatg actacgccac agactccctc aacaagcctg 4140 atgacctcaa gcagtacatc ttcatgactg actccaaggg cacagccact gatgtctctg 4200 gtccagtgga gatcaacact gcaatcagcc cagccaaggt ccaaatcatt gtcaaggctg 4260 gtggcaagga gcaaaccttc acagctgaca aggatgtctc catccagcca agcccatcct 4320 tcgatgagat gaactaccaa ttcaacgctc ttgagattga tggttctggc ctcaacttca 4380 tcaacaactc tgcttccatt gatgtcacct tcactgcctt cgctgaggat ggccgcaagt 4440 tgggttacga gagcttctcc atcccagtca cccttaaggt ttccactgac aacgcactca 4500 cccttcatca caacgagaac ggtgctcagt acatgcaatg gcaaagctac cgcaccaggt 4560 tgaacaccct cttcgcaagg caacttgtgg cccgtgccac cacaggcatt gacaccatcc 4620 tcagcatgga gacccagaac atccaagagc cacagttggg caagggtttc tacgccacct 4680 tcgtcatccc accttacaac ctcagcactc atggtgatga gaggtggttc aagctctaca 4740 tcaagcacgt ggttgacaac aactcccaca tcatctactc tggtcaactc actgacacca 4800 acatcaacat caccctcttc atcccacttg acgatgtccc actcaaccag gactaccatg 4860 ccaaggtcta catgaccttc aagaagtctc catctgatgg cacctggtgg ggtccacact 4920 tcgtccgtga tgacaagggc atcgtcacca tcaacccaaa gtccatcctc acccacttcg 4980 agtctgtcaa cgttctcaac aacatctcct ctgagccaat ggacttctct ggtgccaact 5040 ccctctactt ctgggagttg ttctactaca caccaatgct tgtggctcaa aggttgctcc 5100 atgagcagaa cttcgatgag gccaacaggt ggctcaagta cgtctggagc ccatctggtt 5160 acattgtgca tggtcaaatc cagaactacc aatggaacgt caggccattg cttgaggaca 5220 cctcctggaa ctctgaccca cttgactctg tggaccctga tgctgtggct caacatgacc 5280 caatgcacta caaggtctcc accttcatga ggaccttgga cctcttgatt gccagaggtg 5340 accatgctta ccgccaattg gagagggaca ccctcaacga ggcaaagatg tggtacatgc 5400 aagctctcca cctcttgggt gacaagccat acctcccact cagcaccact tggtccgacc 5460 caaggttgga ccgtgctgct gacatcacca ctcagaacgc tcatgactct gccattgttg 5520 ctctcaggca gaacatccca actcctgctc cactctccct cagatctgct aacaccctca 5580 ctgacttgtt cctcccacag atcaacgagg tcatgatgaa ctactggcaa accttggctc 5640 aaagggtcta caacctcaga cacaacctct ccattgatgg tcaaccactc tacctcccaa 5700 tctacgccac accagctgac ccaaaggctc ttctctctgc tgctgtggct accagccaag 5760 gtggtggcaa gctcccagag tccttcatgt ccctctggag gttcccacac atgttggaga 5820 acgcccgtgg catggtctcc caactcaccc agttcggttc caccctccag aacatcattg 5880 agaggcaaga tgctgaggct ctcaacgctt tgctccagaa ccaggcagct gagttgatcc 5940 tcaccaactt gtccatccaa gacaagacca ttgaggagct tgatgctgag aagacagtcc 6000 ttgagaagag caaggctggt gcccaatctc gcttcgactc ctacggcaag ctctacgatg 6060 agaacatcaa cgctggtgag aaccaggcca tgaccctcag ggcttccgca gctggtctca 6120 ccactgctgt ccaagcctct cgcttggctg gtgcagctgc tgacctcgtt ccaaacatct 6180 tcggtttcgc tggtggtggc tccagatggg gtgccattgc tgaggctacc ggttacgtca 6240 tggagttctc tgccaacgtc atgaacactg aggctgacaa

gatcagccaa tctgagacct 6300 acagaaggcg ccgtcaagag tgggagatcc aaaggaacaa cgctgaggca gagttgaagc 6360 aaatcgatgc tcaactcaag tccttggctg tcagaaggga ggctgctgtc ctccagaaga 6420 cctccctcaa gacccaacag gagcaaaccc agtcccagtt ggctttcctc caaaggaagt 6480 tctccaacca ggctctctac aactggctca gaggccgctt ggctgccatc tacttccaat 6540 tctacgacct tgctgtggcc aggtgcctca tggctgagca agcctaccgc tgggagttga 6600 acgatgactc cgccaggttc atcaagccag gtgcttggca aggcacctac gctggtctcc 6660 ttgctggtga gaccctcatg ctctccttgg ctcaaatgga ggatgctcac ctcaagaggg 6720 acaagagggc tttggaggtg gagaggacag tctcccttgc tgaggtctac gctggtctcc 6780 caaaggacaa cggtccattc tcccttgctc aagagattga caagttggtc agccaaggtt 6840 ctggttctgc tggttctggt aacaacaact tggctttcgg cgctggtact gacaccaaga 6900 cctccctcca agcctctgtc tccttcgctg acctcaagat cagggaggac tacccagctt 6960 cccttggcaa gatcaggcgc atcaagcaaa tctctgtcac cctcccagct ctcttgggtc 7020 cataccaaga tgtccaagca atcctctcct acggtgacaa ggctggtttg gcgaacggtt 7080 gcgaggctct tgctgtctct catggcatga acgactctgg tcaattccaa cttgacttca 7140 acgatggcaa gttcctccca ttcgagggca ttgccattga ccaaggcacc ctcaccctct 7200 ccttcccaaa cgcttccatg ccagagaagg gaaagcaagc caccatgctc aagaccctca 7260 acgatatcat cctccacatc aggtacacca tcaagtgagc tc 7302 7 5561 DNA Photorabdus luminescens 7 ccatggctaa cgagtccgtc aaggagatcc cagacgtcct caagtcccaa tgcggtttca 60 actgcctcac tgacatctcc cacagctcct tcaacgagtt cagacaacaa gtctctgagc 120 acctctcctg gtccgagacc catgacctct accatgacgc tcagcaagct cagaaggaca 180 acaggctcta cgaggctagg atcctcaaga gggctaaccc acaactccag aacgctgtcc 240 acctcgccat cttggctcca aacgctgagt tgattggtta caacaaccag ttctctggca 300 gagctagcca gtacgtggct cctggtacag tctcctccat gttcagccca gccgcttacc 360 tcactgagtt gtaccgcgag gctaggaacc ttcatgcttc tgactccgtc tactacttgg 420 acacacgcag accagacctc aagagcatgg ccctcagcca acagaacatg gacattgagt 480 tgtccaccct ctccttgagc aacgagcttc tcttggagtc catcaagact gagagcaagt 540 tggagaacta caccaaggtc atggagatgc tctccacctt cagaccaagc ggtgcaactc 600 cataccatga tgcctacgag aacgtcaggg aggtcatcca acttcaagac cctggtcttg 660 agcaactcaa cgcttctcca gccattgctg gtttgatgca ccaggcatcc ttgctcggta 720 tcaacgcctc catctctcct gagttgttca acatcttgac tgaggagatc actgagggca 780 acgctgagga gttgtacaag aagaacttcg gcaacattga gccagcctct cttgcaatgc 840 ctgagtacct caagaggtac tacaacttgt ctgatgagga gctttctcaa ttcattggca 900 aggcttccaa cttcggtcaa caggagtaca gcaacaacca gctcatcact ccagttgtga 960 actcctctga tggcactgtg aaggtctacc gcatcacacg tgagtacacc acaaacgcct 1020 accaaatgga tgttgagttg ttcccattcg gtggtgagaa ctacagactt gactacaagt 1080 tcaagaactt ctacaacgcc tcctacctct ccatcaagtt gaacgacaag agggagcttg 1140 tcaggactga gggtgctcct caagtgaaca ttgagtactc tgccaacatc accctcaaca 1200 cagctgacat ctctcaacca ttcgagattg gtttgaccag agtccttccc tctggctcct 1260 gggcctacgc tgcagccaag ttcactgttg aggagtacaa ccagtactct ttcctcttga 1320 agctcaacaa ggcaattcgt ctcagcagag ccactgagtt gtctcccacc atcttggagg 1380 gcattgtgag gtctgtcaac cttcaacttg acatcaacac tgatgtgctt ggcaaggtct 1440 tcctcaccaa gtactacatg caacgctacg ccatccatgc tgagactgca ctcatcctct 1500 gcaacgcacc catctctcaa cgctcctacg acaaccagcc ttcccagttc gacaggctct 1560 tcaacactcc tctcttgaac ggccagtact tctccactgg tgatgaggag attgacctca 1620 actctggctc cacaggtgac tggagaaaga ccatcttgaa gagggccttc aacattgatg 1680 atgtctctct cttccgtctc ttgaagatca cagatcacga caacaaggat ggcaagatca 1740 agaacaactt gaagaacctt tccaacctct acattggcaa gttgcttgca gacatccacc 1800 aactcaccat tgatgagttg gacctcttgc tcattgcagt cggtgagggc aagaccaacc 1860 tctctgcaat ctctgacaag cagttggcaa ccctcatcag gaagttgaac accatcacct 1920 cctggcttca cacccagaag tggtctgtct tccaactctt catcatgacc agcacctcct 1980 acaacaagac cctcactcct gagatcaaga acctcttgga cacagtctac cacggtctcc 2040 aaggcttcga caaggacaag gctgacttgc ttcatgtcat ggctccctac attgcagcca 2100 ccctccaact ctcctctgag aacgtggctc actctgtctt gctctgggct gacaagctcc 2160 aacctggtga tggtgccatg actgctgaga agttctggga ctggctcaac accaagtaca 2220 caccaggctc ctctgaggct gttgagactc aagagcacat tgtgcaatac tgccaggctc 2280 ttgcacagtt ggagatggtc taccactcca ctggcatcaa cgagaacgct ttcagactct 2340 tcgtcaccaa gcctgagatg ttcggtgctg ccacaggtgc tgcacctgct catgatgctc 2400 tctccctcat catgttgacc aggttcgctg actgggtcaa cgctcttggt gagaaggctt 2460 cctctgtctt ggctgccttc gaggccaact ccctcactgc tgagcaactt gctgatgcca 2520 tgaaccttga tgccaacctc ttgctccaag cttccattca agctcagaac caccaacacc 2580 tcccacctgt cactccagag aacgctttct cctgctggac ctccatcaac accatcctcc 2640 aatgggtcaa cgtggctcag caactcaacg tggctccaca aggtgtctct gctttggtcg 2700 gtcttgacta catccagtcc atgaaggaga caccaaccta cgctcaatgg gagaacgcag 2760 ctggtgtctt gactgctggt ctcaactccc aacaggccaa caccctccat gctttcttgg 2820 atgagtctcg ctctgctgcc ctctccacct actacatcag gcaagtcgcc aaggcagctg 2880 ctgccatcaa gtctcgcgat gacctctacc aatacctcct cattgacaac caggtctctg 2940 ctgccatcaa gaccaccagg atcgctgagg ccatcgcttc catccaactc tacgtcaacc 3000 gcgctcttga gaacgttgag gagaacgcca actctggtgt catctctcgc caattcttca 3060 tcgactggga caagtacaac aagaggtact ccacctgggc tggtgtctct caacttgtct 3120 actacccaga gaactacatt gacccaacca tgaggattgg tcagaccaag atgatggatg 3180 ctctcttgca atctgtctcc caaagccaac tcaacgctga cactgtggag gatgccttca 3240 tgagctacct cacctccttc gagcaagttg ccaacctcaa ggtcatctct gcttaccatg 3300 acaacatcaa caacgaccaa ggtctcacct acttcattgg tctctctgag actgatgctg 3360 gtgagtacta ctggagatcc gtggaccaca gcaagttcaa cgatggcaag ttcgctgcaa 3420 acgcttggtc tgagtggcac aagattgact gccctatcaa cccatacaag tccaccatca 3480 gacctgtcat ctacaagagc cgcctctact tgctctggct tgagcagaag gagatcacca 3540 agcaaactgg caactccaag gatggttacc aaactgagac tgactaccgc tacgagttga 3600 agttggctca catccgctac gatggtacct ggaacactcc aatcaccttc gatgtcaaca 3660 agaagatcag cgagttgaag ttggagaaga accgtgctcc tggtctctac tgcgctggtt 3720 accaaggtga ggacaccctc ttggtcatgt tctacaacca gcaagacacc cttgactcct 3780 acaagaacgc ttccatgcaa ggtctctaca tcttcgctga catggcttcc aaggacatga 3840 ctccagagca aagcaacgtc taccgtgaca actcctacca acagttcgac accaacaacg 3900 tcaggcgtgt caacaacaga tacgctgagg actacgagat cccaagctct gtcagctctc 3960 gcaaggacta cggctggggt gactactacc tcagcatggt gtacaacggt gacatcccaa 4020 ccatcaacta caaggctgcc tcttccgacc tcaaaatcta catcagccca aagctcagga 4080 tcatccacaa cggctacgag ggtcagaaga ggaaccagtg caacttgatg aacaagtacg 4140 gcaagttggg tgacaagttc attgtctaca cctctcttgg tgtcaaccca aacaacagct 4200 ccaacaagct catgttctac ccagtctacc aatactctgg caacacctct ggtctcaacc 4260 agggtagact cttgttccac agggacacca cctacccaag caaggtggag gcttggattc 4320 ctggtgccaa gaggtccctc accaaccaga acgctgccat tggtgatgac tacgccacag 4380 actccctcaa caagcctgat gacctcaagc agtacatctt catgactgac tccaagggca 4440 cagccactga tgtctctggt ccagtggaga tcaacactgc aatcagccca gccaaggtcc 4500 aaatcattgt caaggctggt ggcaaggagc aaaccttcac agctgacaag gatgtctcca 4560 tccagccaag cccatccttc gatgagatga actaccaatt caacgctctt gagattgatg 4620 gttctggcct caacttcatc aacaactctg cttccattga tgtcaccttc actgccttcg 4680 ctgaggatgg ccgcaagttg ggttacgaga gcttctccat cccagtcacc cttaaggttt 4740 ccactgacaa cgcactcacc cttcatcaca acgagaacgg tgctcagtac atgcaatggc 4800 aaagctaccg caccaggttg aacaccctct tcgcaaggca acttgtggcc cgtgccacca 4860 caggcattga caccatcctc agcatggaga cccagaacat ccaagagcca cagttgggca 4920 agggtttcta cgccaccttc gtcatcccac cttacaacct cagcactcat ggtgatgaga 4980 ggtggttcaa gctctacatc aagcacgtgg ttgacaacaa ctcccacatc atctactctg 5040 gtcaactcac tgacaccaac atcaacatca ccctcttcat cccacttgac gatgtcccac 5100 tcaaccagga ctaccatgcc aaggtctaca tgaccttcaa gaagtctcca tctgatggca 5160 cctggtgggg tccacacttc gtccgtgatg acaagggcat cgtcaccatc aacccaaagt 5220 ccatcctcac ccacttcgag tctgtcaacg ttctcaacaa catctcctct gagccaatgg 5280 acttctctgg tgccaactcc ctctacttct gggagttgtt ctactacaca ccaatgcttg 5340 tggctcaaag gttgctccat gagcagaact tcgatgaggc caacaggtgg ctcaagtacg 5400 tctggagccc atctggttac attgtgcatg gtcaaatcca gaactaccaa tggaacgtca 5460 ggccattgct tgaggacacc tcctggaact ctgacccact tgactctgtg gaccctgatg 5520 ctgtggctca acatgaccca atgcactaca agtaggagct c 5561 8 5816 DNA Photorhabdus luminescens 8 ccatggctaa cgagtccgtc aaggagatcc cagacgtcct caagtcccaa tgcggtttca 60 actgcctcac tgacatctcc cacagctcct tcaacgagtt cagacaacaa gtctctgagc 120 acctctcctg gtccgagacc catgacctct accatgacgc tcagcaagct cagaaggaca 180 acaggctcta cgaggctagg atcctcaaga gggctaaccc acaactccag aacgctgtcc 240 acctcgccat cttggctcca aacgctgagt tgattggtta caacaaccag ttctctggca 300 gagctagcca gtacgtggct cctggtacag tctcctccat gttcagccca gccgcttacc 360 tcactgagtt gtaccgcgag gctaggaacc ttcatgcttc tgactccgtc tactacttgg 420 acacacgcag accagacctc aagagcatgg ccctcagcca acagaacatg gacattgagt 480 tgtccaccct ctccttgagc aacgagcttc tcttggagtc catcaagact gagagcaagt 540 tggagaacta caccaaggtc atggagatgc tctccacctt cagaccaagc ggtgcaactc 600 cataccatga tgcctacgag aacgtcaggg aggtcatcca acttcaagac cctggtcttg 660 agcaactcaa cgcttctcca gccattgctg gtttgatgca ccaggcatcc ttgctcggta 720 tcaacgcctc catctctcct gagttgttca acatcttgac tgaggagatc actgagggca 780 acgctgagga gttgtacaag aagaacttcg gcaacattga gccagcctct cttgcaatgc 840 ctgagtacct caagaggtac tacaacttgt ctgatgagga gctttctcaa ttcattggca 900 aggcttccaa cttcggtcaa caggagtaca gcaacaacca gctcatcact ccagttgtga 960 actcctctga tggcactgtg aaggtctacc gcatcacacg tgagtacacc acaaacgcct 1020 accaaatgga tgttgagttg ttcccattcg gtggtgagaa ctacagactt gactacaagt 1080 tcaagaactt ctacaacgcc tcctacctct ccatcaagtt gaacgacaag agggagcttg 1140 tcaggactga gggtgctcct caagtgaaca ttgagtactc tgccaacatc accctcaaca 1200 cagctgacat ctctcaacca ttcgagattg gtttgaccag agtccttccc tctggctcct 1260 gggcctacgc tgcagccaag ttcactgttg aggagtacaa ccagtactct ttcctcttga 1320 agctcaacaa ggcaattcgt ctcagcagag ccactgagtt gtctcccacc atcttggagg 1380 gcattgtgag gtctgtcaac cttcaacttg acatcaacac tgatgtgctt ggcaaggtct 1440 tcctcaccaa gtactacatg caacgctacg ccatccatgc tgagactgca ctcatcctct 1500 gcaacgcacc catctctcaa cgctcctacg acaaccagcc ttcccagttc gacaggctct 1560 tcaacactcc tctcttgaac ggccagtact tctccactgg tgatgaggag attgacctca 1620 actctggctc cacaggtgac tggagaaaga ccatcttgaa gagggccttc aacattgatg 1680 atgtctctct cttccgtctc ttgaagatca cagatcacga caacaaggat ggcaagatca 1740 agaacaactt gaagaacctt tccaacctct acattggcaa gttgcttgca gacatccacc 1800 aactcaccat tgatgagttg gacctcttgc tcattgcagt cggtgagggc aagaccaacc 1860 tctctgcaat ctctgacaag cagttggcaa ccctcatcag gaagttgaac accatcacct 1920 cctggcttca cacccagaag tggtctgtct tccaactctt catcatgacc agcacctcct 1980 acaacaagac cctcactcct gagatcaaga acctcttgga cacagtctac cacggtctcc 2040 aaggcttcga caaggacaag gctgacttgc ttcatgtcat ggctccctac attgcagcca 2100 ccctccaact ctcctctgag aacgtggctc actctgtctt gctctgggct gacaagctcc 2160 aacctggtga tggtgccatg actgctgaga agttctggga ctggctcaac accaagtaca 2220 caccaggctc ctctgaggct gttgagactc aagagcacat tgtgcaatac tgccaggctc 2280 ttgcacagtt ggagatggtc taccactcca ctggcatcaa cgagaacgct ttcagactct 2340 tcgtcaccaa gcctgagatg ttcggtgctg ccacaggtgc tgcacctgct catgatgctc 2400 tctccctcat catgttgacc aggttcgctg actgggtcaa cgctcttggt gagaaggctt 2460 cctctgtctt ggctgccttc gaggccaact ccctcactgc tgagcaactt gctgatgcca 2520 tgaaccttga tgccaacctc ttgctccaag cttccattca agctcagaac caccaacacc 2580 tcccacctgt cactccagag aacgctttct cctgctggac ctccatcaac accatcctcc 2640 aatgggtcaa cgtggctcag caactcaacg tggctccaca aggtgtctct gctttggtcg 2700 gtcttgacta catccagtcc atgaaggaga caccaaccta cgctcaatgg gagaacgcag 2760 ctggtgtctt gactgctggt ctcaactccc aacaggccaa caccctccat gctttcttgg 2820 atgagtctcg ctctgctgcc ctctccacct actacatcag gcaagtcgcc aaggcagctg 2880 ctgccatcaa gtctcgcgat gacctctacc aatacctcct cattgacaac caggtctctg 2940 ctgccatcaa gaccaccagg atcgctgagg ccatcgcttc catccaactc tacgtcaacc 3000 gcgctcttga gaacgttgag gagaacgcca actctggtgt catctctcgc caattcttca 3060 tcgactggga caagtacaac aagaggtact ccacctgggc tggtgtctct caacttgtct 3120 actacccaga gaactacatt gacccaacca tgaggattgg tcagaccaag atgatggatg 3180 ctctcttgca atctgtctcc caaagccaac tcaacgctga cactgtggag gatgccttca 3240 tgagctacct cacctccttc gagcaagttg ccaacctcaa ggtcatctct gcttaccatg 3300 acaacatcaa caacgaccaa ggtctcacct acttcattgg tctctctgag actgatgctg 3360 gtgagtacta ctggagatcc gtggaccaca gcaagttcaa cgatggcaag ttcgctgcaa 3420 acgcttggtc tgagtggcac aagattgact gccctatcaa cccatacaag tccaccatca 3480 gacctgtcat ctacaagagc cgcctctact tgctctggct tgagcagaag gagatcacca 3540 agcaaactgg caactccaag gatggttacc aaactgagac tgactaccgc tacgagttga 3600 agttggctca catccgctac gatggtacct ggaacactcc aatcaccttc gatgtcaaca 3660 agaagatcag cgagttgaag ttggagaaga accgtgctcc tggtctctac tgcgctggtt 3720 accaaggtga ggacaccctc ttggtcatgt tctacaacca gcaagacacc cttgactcct 3780 acaagaacgc ttccatgcaa ggtctctaca tcttcgctga catggcttcc aaggacatga 3840 ctccagagca aagcaacgtc taccgtgaca actcctacca acagttcgac accaacaacg 3900 tcaggcgtgt caacaacaga tacgctgagg actacgagat cccaagctct gtcagctctc 3960 gcaaggacta cggctggggt gactactacc tcagcatggt gtacaacggt gacatcccaa 4020 ccatcaacta caaggctgcc tcttccgacc tcaaaatcta catcagccca aagctcagga 4080 tcatccacaa cggctacgag ggtcagaaga ggaaccagtg caacttgatg aacaagtacg 4140 gcaagttggg tgacaagttc attgtctaca cctctcttgg tgtcaaccca aacaacagct 4200 ccaacaagct catgttctac ccagtctacc aatactctgg caacacctct ggtctcaacc 4260 agggtagact cttgttccac agggacacca cctacccaag caaggtggag gcttggattc 4320 ctggtgccaa gaggtccctc accaaccaga acgctgccat tggtgatgac tacgccacag 4380 actccctcaa caagcctgat gacctcaagc agtacatctt catgactgac tccaagggca 4440 cagccactga tgtctctggt ccagtggaga tcaacactgc aatcagccca gccaaggtcc 4500 aaatcattgt caaggctggt ggcaaggagc aaaccttcac agctgacaag gatgtctcca 4560 tccagccaag cccatccttc gatgagatga actaccaatt caacgctctt gagattgatg 4620 gttctggcct caacttcatc aacaactctg cttccattga tgtcaccttc actgccttcg 4680 ctgaggatgg ccgcaagttg ggttacgaga gcttctccat cccagtcacc cttaaggttt 4740 ccactgacaa cgcactcacc cttcatcaca acgagaacgg tgctcagtac atgcaatggc 4800 aaagctaccg caccaggttg aacaccctct tcgcaaggca acttgtggcc cgtgccacca 4860 caggcattga caccatcctc agcatggaga cccagaacat ccaagagcca cagttgggca 4920 agggtttcta cgccaccttc gtcatcccac cttacaacct cagcactcat ggtgatgaga 4980 ggtggttcaa gctctacatc aagcacgtgg ttgacaacaa ctcccacatc atctactctg 5040 gtcaactcac tgacaccaac atcaacatca ccctcttcat cccacttgac gatgtcccac 5100 tcaaccagga ctaccatgcc aaggtctaca tgaccttcaa gaagtctcca tctgatggca 5160 cctggtgggg tccacacttc gtccgtgatg acaagggcat cgtcaccatc aacccaaagt 5220 ccatcctcac ccacttcgag tctgtcaacg ttctcaacaa catctcctct gagccaatgg 5280 acttctctgg tgccaactcc ctctacttct gggagttgtt ctactacaca ccaatgcttg 5340 tggctcaaag gttgctccat gagcagaact tcgatgaggc caacaggtgg ctcaagtacg 5400 tctggagccc atctggttac attgtgcatg gtcaaatcca gaactaccaa tggaacgtca 5460 ggccattgct tgaggacacc tcctggaact ctgacccact tgactctgtg gaccctgatg 5520 ctgtggctca acatgaccca atgcactaca aggtctccac cttcatgagg accttggacc 5580 tcttgattgc cagaggtgac catgcttacc gccaattgga gagggacacc ctcaacgagg 5640 caaagatgtg gtacatgcaa gctctccacc tcttgggtga caagccatac ctcccactca 5700 gcaccacttg gtccgaccca aggttggacc gtgctgctga catcaccact cagaacgctc 5760 atgactctgc cattgttgct ctcaggcaga acatcccaac tcctgctcca ctctcc 5816 9 5301 DNA Photorhabdus luminescens 9 ccatggctga gttgattggt tacaacaacc agttctctgg cagagctagc cagtacgtgg 60 ctcctggtac agtctcctcc atgttcagcc cagccgctta cctcactgag ttgtaccgcg 120 aggctaggaa ccttcatgct tctgactccg tctactactt ggacacacgc agaccagacc 180 tcaagagcat ggccctcagc caacagaaca tggacattga gttgtccacc ctctccttga 240 gcaacgagct tctcttggag tccatcaaga ctgagagcaa gttggagaac tacaccaagg 300 tcatggagat gctctccacc ttcagaccaa gcggtgcaac tccataccat gatgcctacg 360 agaacgtcag ggaggtcatc caacttcaag accctggtct tgagcaactc aacgcttctc 420 cagccattgc tggtttgatg caccaggcat ccttgctcgg tatcaacgcc tccatctctc 480 ctgagttgtt caacatcttg actgaggaga tcactgaggg caacgctgag gagttgtaca 540 agaagaactt cggcaacatt gagccagcct ctcttgcaat gcctgagtac ctcaagaggt 600 actacaactt gtctgatgag gagctttctc aattcattgg caaggcttcc aacttcggtc 660 aacaggagta cagcaacaac cagctcatca ctccagttgt gaactcctct gatggcactg 720 tgaaggtcta ccgcatcaca cgtgagtaca ccacaaacgc ctaccaaatg gatgttgagt 780 tgttcccatt cggtggtgag aactacagac ttgactacaa gttcaagaac ttctacaacg 840 cctcctacct ctccatcaag ttgaacgaca agagggagct tgtcaggact gagggtgctc 900 ctcaagtgaa cattgagtac tctgccaaca tcaccctcaa cacagctgac atctctcaac 960 cattcgagat tggtttgacc agagtccttc cctctggctc ctgggcctac gctgcagcca 1020 agttcactgt tgaggagtac aaccagtact ctttcctctt gaagctcaac aaggcaattc 1080 gtctcagcag agccactgag ttgtctccca ccatcttgga gggcattgtg aggtctgtca 1140 accttcaact tgacatcaac actgatgtgc ttggcaaggt cttcctcacc aagtactaca 1200 tgcaacgcta cgccatccat gctgagactg cactcatcct ctgcaacgca cccatctctc 1260 aacgctccta cgacaaccag ccttcccagt tcgacaggct cttcaacact cctctcttga 1320 acggccagta cttctccact ggtgatgagg agattgacct caactctggc tccacaggtg 1380 actggagaaa gaccatcttg aagagggcct tcaacattga tgatgtctct ctcttccgtc 1440 tcttgaagat cacagatcac gacaacaagg atggcaagat caagaacaac ttgaagaacc 1500 tttccaacct ctacattggc aagttgcttg cagacatcca ccaactcacc attgatgagt 1560 tggacctctt gctcattgca gtcggtgagg gcaagaccaa cctctctgca atctctgaca 1620 agcagttggc aaccctcatc aggaagttga acaccatcac ctcctggctt cacacccaga 1680 agtggtctgt cttccaactc ttcatcatga ccagcacctc ctacaacaag accctcactc 1740 ctgagatcaa gaacctcttg gacacagtct accacggtct ccaaggcttc gacaaggaca 1800 aggctgactt gcttcatgtc atggctccct acattgcagc caccctccaa ctctcctctg 1860 agaacgtggc tcactctgtc ttgctctggg ctgacaagct ccaacctggt gatggtgcca 1920 tgactgctga gaagttctgg gactggctca acaccaagta cacaccaggc tcctctgagg 1980 ctgttgagac tcaagagcac attgtgcaat actgccaggc tcttgcacag ttggagatgg 2040 tctaccactc cactggcatc aacgagaacg ctttcagact cttcgtcacc aagcctgaga 2100 tgttcggtgc tgccacaggt gctgcacctg ctcatgatgc tctctccctc atcatgttga 2160 ccaggttcgc tgactgggtc aacgctcttg gtgagaaggc ttcctctgtc ttggctgcct 2220 tcgaggccaa ctccctcact gctgagcaac ttgctgatgc catgaacctt gatgccaacc 2280 tcttgctcca agcttccatt caagctcaga accaccaaca cctcccacct gtcactccag 2340 agaacgcttt ctcctgctgg acctccatca acaccatcct ccaatgggtc aacgtggctc 2400 agcaactcaa cgtggctcca caaggtgtct ctgctttggt cggtcttgac tacatccagt 2460 ccatgaagga gacaccaacc tacgctcaat gggagaacgc agctggtgtc

ttgactgctg 2520 gtctcaactc ccaacaggcc aacaccctcc atgctttctt ggatgagtct cgctctgctg 2580 ccctctccac ctactacatc aggcaagtcg ccaaggcagc tgctgccatc aagtctcgcg 2640 atgacctcta ccaatacctc ctcattgaca accaggtctc tgctgccatc aagaccacca 2700 ggatcgctga ggccatcgct tccatccaac tctacgtcaa ccgcgctctt gagaacgttg 2760 aggagaacgc caactctggt gtcatctctc gccaattctt catcgactgg gacaagtaca 2820 acaagaggta ctccacctgg gctggtgtct ctcaacttgt ctactaccca gagaactaca 2880 ttgacccaac catgaggatt ggtcagacca agatgatgga tgctctcttg caatctgtct 2940 cccaaagcca actcaacgct gacactgtgg aggatgcctt catgagctac ctcacctcct 3000 tcgagcaagt tgccaacctc aaggtcatct ctgcttacca tgacaacatc aacaacgacc 3060 aaggtctcac ctacttcatt ggtctctctg agactgatgc tggtgagtac tactggagat 3120 ccgtggacca cagcaagttc aacgatggca agttcgctgc aaacgcttgg tctgagtggc 3180 acaagattga ctgccctatc aacccataca agtccaccat cagacctgtc atctacaaga 3240 gccgcctcta cttgctctgg cttgagcaga aggagatcac caagcaaact ggcaactcca 3300 aggatggtta ccaaactgag actgactacc gctacgagtt gaagttggct cacatccgct 3360 acgatggtac ctggaacact ccaatcacct tcgatgtcaa caagaagatc agcgagttga 3420 agttggagaa gaaccgtgct cctggtctct actgcgctgg ttaccaaggt gaggacaccc 3480 tcttggtcat gttctacaac cagcaagaca cccttgactc ctacaagaac gcttccatgc 3540 aaggtctcta catcttcgct gacatggctt ccaaggacat gactccagag caaagcaacg 3600 tctaccgtga caactcctac caacagttcg acaccaacaa cgtcaggcgt gtcaacaaca 3660 gatacgctga ggactacgag atcccaagct ctgtcagctc tcgcaaggac tacggctggg 3720 gtgactacta cctcagcatg gtgtacaacg gtgacatccc aaccatcaac tacaaggctg 3780 cctcttccga cctcaaaatc tacatcagcc caaagctcag gatcatccac aacggctacg 3840 agggtcagaa gaggaaccag tgcaacttga tgaacaagta cggcaagttg ggtgacaagt 3900 tcattgtcta cacctctctt ggtgtcaacc caaacaacag ctccaacaag ctcatgttct 3960 acccagtcta ccaatactct ggcaacacct ctggtctcaa ccagggtaga ctcttgttcc 4020 acagggacac cacctaccca agcaaggtgg aggcttggat tcctggtgcc aagaggtccc 4080 tcaccaacca gaacgctgcc attggtgatg actacgccac agactccctc aacaagcctg 4140 atgacctcaa gcagtacatc ttcatgactg actccaaggg cacagccact gatgtctctg 4200 gtccagtgga gatcaacact gcaatcagcc cagccaaggt ccaaatcatt gtcaaggctg 4260 gtggcaagga gcaaaccttc acagctgaca aggatgtctc catccagcca agcccatcct 4320 tcgatgagat gaactaccaa ttcaacgctc ttgagattga tggttctggc ctcaacttca 4380 tcaacaactc tgcttccatt gatgtcacct tcactgcctt cgctgaggat ggccgcaagt 4440 tgggttacga gagcttctcc atcccagtca cccttaaggt ttccactgac aacgcactca 4500 cccttcatca caacgagaac ggtgctcagt acatgcaatg gcaaagctac cgcaccaggt 4560 tgaacaccct cttcgcaagg caacttgtgg cccgtgccac cacaggcatt gacaccatcc 4620 tcagcatgga gacccagaac atccaagagc cacagttggg caagggtttc tacgccacct 4680 tcgtcatccc accttacaac ctcagcactc atggtgatga gaggtggttc aagctctaca 4740 tcaagcacgt ggttgacaac aactcccaca tcatctactc tggtcaactc actgacacca 4800 acatcaacat caccctcttc atcccacttg acgatgtccc actcaaccag gactaccatg 4860 ccaaggtcta catgaccttc aagaagtctc catctgatgg cacctggtgg ggtccacact 4920 tcgtccgtga tgacaagggc atcgtcacca tcaacccaaa gtccatcctc acccacttcg 4980 agtctgtcaa cgttctcaac aacatctcct ctgagccaat ggacttctct ggtgccaact 5040 ccctctactt ctgggagttg ttctactaca caccaatgct tgtggctcaa aggttgctcc 5100 atgagcagaa cttcgatgag gccaacaggt ggctcaagta cgtctggagc ccatctggtt 5160 acattgtgca tggtcaaatc cagaactacc aatggaacgt caggccattg cttgaggaca 5220 cctcctggaa ctctgaccca cttgactctg tggaccctga tgctgtggct caacatgacc 5280 caatgcacta caagtgagct c 5301 10 1750 DNA Photorhabdus luminescens 10 ccatggctca gatctgctaa caccctcact gacttgttcc tcccacagat caacgaggtc 60 atgatgaact actggcaaac cttggctcaa agggtctaca acctcagaca caacctctcc 120 attgatggtc aaccactcta cctcccaatc tacgccacac cagctgaccc aaaggctctt 180 ctctctgctg ctgtggctac cagccaaggt ggtggcaagc tcccagagtc cttcatgtcc 240 ctctggaggt tcccacacat gttggagaac gcccgtggca tggtctccca actcacccag 300 ttcggttcca ccctccagaa catcattgag aggcaagatg ctgaggctct caacgctttg 360 ctccagaacc aggcagctga gttgatcctc accaacttgt ccatccaaga caagaccatt 420 gaggagcttg atgctgagaa gacagtcctt gagaagagca aggctggtgc ccaatctcgc 480 ttcgactcct acggcaagct ctacgatgag aacatcaacg ctggtgagaa ccaggccatg 540 accctcaggg cttccgcagc tggtctcacc actgctgtcc aagcctctcg cttggctggt 600 gcagctgctg acctcgttcc aaacatcttc ggtttcgctg gtggtggctc cagatggggt 660 gccattgctg aggctaccgg ttacgtcatg gagttctctg ccaacgtcat gaacactgag 720 gctgacaaga tcagccaatc tgagacctac agaaggcgcc gtcaagagtg ggagatccaa 780 aggaacaacg ctgaggcaga gttgaagcaa atcgatgctc aactcaagtc cttggctgtc 840 agaagggagg ctgctgtcct ccagaagacc tccctcaaga cccaacagga gcaaacccag 900 tcccagttgg ctttcctcca aaggaagttc tccaaccagg ctctctacaa ctggctcaga 960 ggccgcttgg ctgccatcta cttccaattc tacgaccttg ctgtggccag gtgcctcatg 1020 gctgagcaag cctaccgctg ggagttgaac gatgactccg ccaggttcat caagccaggt 1080 gcttggcaag gcacctacgc tggtctcctt gctggtgaga ccctcatgct ctccttggct 1140 caaatggagg atgctcacct caagagggac aagagggctt tggaggtgga gaggacagtc 1200 tcccttgctg aggtctacgc tggtctccca aaggacaacg gtccattctc ccttgctcaa 1260 gagattgaca agttggtcag ccaaggttct ggttctgctg gttctggtaa caacaacttg 1320 gctttcggcg ctggtactga caccaagacc tccctccaag cctctgtctc cttcgctgac 1380 ctcaagatca gggaggacta cccagcttcc cttggcaaga tcaggcgcat caagcaaatc 1440 tctgtcaccc tcccagctct cttgggtcca taccaagatg tccaagcaat cctctcctac 1500 ggtgacaagg ctggtttggc gaacggttgc gaggctcttg ctgtctctca tggcatgaac 1560 gactctggtc aattccaact tgacttcaac gatggcaagt tcctcccatt cgagggcatt 1620 gccattgacc aaggcaccct caccctctcc ttcccaaacg cttccatgcc agagaaggga 1680 aagcaagcca ccatgctcaa gaccctcaac gatatcatcc tccacatcag gtacaccatc 1740 aagtgagctc 1750

Claims

What is claimed is:

1. A nucleic acid construct comprising at least one structural gene of interest functionally linked to one or more of a UTR selected from the group consisting of SEQ. ID. 1, SEQ. ID. No. 2, SEQ. ID No. 3. and derivatives or functional equivalents of any thereof.

2. The nucleic acid construct of claim 1, wherein the at least one structural gene of interest comprises a gene capable of conferring a non-native phenotype in a plant.

3. The nucleic acid construct of claim 1, wherein the at least one structural gene of interest comprises a gene capable of conferring insecticide or herbicide resistance in a plant.

4. The nucleic acid construct of claim 1, wherein the at least one structural gene of interest comprises an insect resistance gene isolated or derived from the group consisting of SEQ. ID. Nos. 6, 7, 8, 9, and 10.

5. The construct of claim 1, wherein the at least one structural gene of interest comprises SEQ. ID. No. 5 or a derivative thereof.

6. A plant or plant cell transformed with the nucleic acid construct of claim 1.

7. The plant or plant cell of claim 6 further comprising an additional structural gene of interest stacked with the at least one gene of interest.

8. The plant or plant cell of claim 7, wherein the additional structural gene of interest is functionally linked to one or more of a UTR selected from the group consisting of SEQ. ID. 1, SEQ. ID. No. 2, SEQ. ID No. 3. and derivatives or functional equivalents of any thereof.

9. A vector comprising the nucleic acid construct of claim 1.

10. A method for recombinantly producing a peptide or protein comprising: functionally linking a nucleic acid sequence consisting of an osmotin UTR element with a structural gene of interest.

11. A method of increasing expression of a gene in a plant cell comprising: functionally linking at least one nucleic acid sequence including of an osmotin UTR element comprising at least one of SEQ. ID. Nos. 1-3 with a structural gene of interest to create a nucleic acid construct; transforming the plant cell with the nucleic acid construct; and growing the transformed cell under conditions in which the structural gene of interest is expressed.

12. A recombinant DNA construct comprising a gene of interest and at least of a UTR selected from the group consisting of a 5' and a 3' UTR from an osmotin gene.

13. A 5' UTR from an osmotin gene or a derivative thereof functionally linked to a heterologous gene.

14. A 3' UTR from an osmotin gene or a derivative thereof functionally linked to a heterologous gene.

15. A recombinant nucleic acid construct comprising 5' and/or 3' UTR isolated or derived from an osmotin gene, the 5' and/or 3' UTR functionally linked to a structural gene of interest.

16. The recombinant nucleic acid construct of claim 15, wherein the 5' and/or 3' UTR is derived from an osmotin gene from tobacco.