U.S. patent application number 10/631660 was filed with the patent office on 2005-05-12 for methods of use of antibodies with reduced immunogenicity or toxicity.
This patent application is currently assigned to NeoRx Corporation. Invention is credited to Graves, Scott S., Hylarides, Mark D., Mallett, Robert W., Reno, John M..
Application Number | 20050100545 10/631660 |
Document ID | / |
Family ID | 24649226 |
Filed Date | 2005-05-12 |
United States Patent
Application |
20050100545 |
Kind Code |
A1 |
Graves, Scott S. ; et
al. |
May 12, 2005 |
Methods of use of antibodies with reduced immunogenicity or
toxicity
Abstract
Humanized antibodies which bind the NR-LU-13 antigen, conjugates
containing such antibodies, and their use in pretargeting methods
and conventional antibody therapy and immunodiagnosis are
provided.
Inventors: |
Graves, Scott S.; (Monroe,
WA) ; Reno, John M.; (Brier, WA) ; Mallett,
Robert W.; (Everett, WA) ; Hylarides, Mark D.;
(Stanwood, WA) |
Correspondence
Address: |
SCHWEGMAN, LUNDBERG, WOESSNER & KLUTH, P.A.
P.O. BOX 2938
MINNEAPOLIS
MN
55402
US
|
Assignee: |
NeoRx Corporation
Suite 500 300 Elliott Avenue West
Seattle
WA
98119
|
Family ID: |
24649226 |
Appl. No.: |
10/631660 |
Filed: |
July 31, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10631660 |
Jul 31, 2003 |
|
|
|
10056794 |
Jan 24, 2002 |
|
|
|
10056794 |
Jan 24, 2002 |
|
|
|
08871488 |
Jun 9, 1997 |
|
|
|
6358710 |
|
|
|
|
08871488 |
Jun 9, 1997 |
|
|
|
08660362 |
Jun 7, 1996 |
|
|
|
Current U.S.
Class: |
424/141.1 ;
530/388.15 |
Current CPC
Class: |
C07K 1/1133 20130101;
A61K 47/68 20170801; A61K 47/6898 20170801; C07K 2317/41 20130101;
A61K 38/00 20130101; B82Y 5/00 20130101; A61P 35/00 20180101; C07K
2317/734 20130101; C07K 2317/732 20130101; A61K 2039/505 20130101;
C07K 16/30 20130101; C07K 16/00 20130101; C07K 2319/00 20130101;
C07K 2317/24 20130101 |
Class at
Publication: |
424/141.1 ;
530/388.15 |
International
Class: |
A61K 039/395; C07K
016/44 |
Claims
1-50. (canceled)
51. A method for treating a patient in need thereof with a
therapeutic antibody or antigen-binding fragment thereof,
comprising administering to said patient in an amount effective for
treatment a therapeutic antibody or an antigen-binding fragment
thereof, wherein said antibody or said antibody fragment either
does not possess N-linked glycosylation or its N-linked
glycosylation has been modified post expression to reduce
immunogenicity or toxicity.
52. The method of claim 51 wherein said antibody or said antibody
fragment is humanized.
53. The method of claim 51 wherein said antibody or said antibody
fragment does not possess O-linked glycosylation.
54. The method of claim 51 wherein the nucleic acids encoding said
antibody or said antibody fragment have been mutated to prevent
N-linked glycosylation.
55. The method of claim 51 wherein the N-linked glycosylation of
said antibody or said antibody fragment has been modified
chemically.
56. The method of any one of claims 51-55 wherein an active agent
is conjugated to said antibody or said antibody fragment.
57. A therapeutic, humanized antibody or an antigen-binding
fragment thereof, wherein said antibody or said antibody fragment
either does not possess N-linked glycosylation or its N-linked
glycosylation has been modified post expression to reduce
immunogenicity or toxicity.
58. The antibody or antibody fragment of claim 57 wherein said
antibody or said antibody fragment does not possess O-linked
glycosylation.
59. The antibody or antibody fragment of claim 57 wherein the
polynucleotides encoding said antibody fragment have been
substituted or deleted to prevent N-linked glycosylation.
60. The antibody or antibody fragment of claim 57 wherein the
N-linked glycosylation has been chemically modified post
expression.
61. The antibody or antibody fragment of any one of claims 57-60
wherein an active agent is conjugated to said antibody or said
antibody fragment.
62. A method of preparing a therapeutic, humanized antibody, or an
antigen-binding fragment thereof, with reduced immunogenicity or
toxicity, comprising the steps of: (a) selecting an expression
system for the characteristic that said system does not N-link
glycosylate an antibody or an antibody fragment; and (b) expressing
in said expression system a nucleotide sequence comprising nucleic
acids encoding a therapeutic, humanized antibody or an
antigen-binding fragment thereof.
63. A method of preparing a therapeutic, humanized antibody, or an
antigen-binding fragment thereof, without N-linked glycosylation to
reduce immunogenicity or toxicity, comprising expressing in an
expression system a nucleotide sequence comprising nucleic acids
encoding a therapeutic, humanized antibody or antigen-binding
fragment thereof, wherein said expression system does not N-link
glycosylate said antibody or said antibody fragment.
64. The method of claim 62 or 63 wherein said antibody or said
antibody fragment does not possess O-linked glycosylation.
65. The method of claim 62 or 63 wherein an active agent is
conjugated to said antibody or said antibody fragment.
66. A method for imaging target cells in an individual, comprising
the steps of: (a) administering to an individual in an amount
effective for imaging, an antibody specific for target cells or an
antigen-binding fragment thereof, wherein said antibody or said
antibody fragment either does not possess N-linked glycosylation or
its N-linked glycosylation has been modified post expression to
reduce immunogenicity or toxicity; and (b) detecting said antibody
or said antibody fragment, thereby imaging target cells in said
individual.
67. The method of claim 66 wherein said antibody or said antibody
fragment is humanized.
68. The method of claim 66 wherein said antibody or said antibody
fragment does not possess O-linked glycosylation.
69. The method of claim 66 wherein the nucleic acids encoding said
antibody or said antibody fragment have been mutated to prevent
N-linked glycosylation.
70. The method of claim 66 wherein the N-linked glycosylation of
said antibody or said antibody fragment has been modified
chemically.
71. The method of any one of claims 66-70 wherein an imaging agent
is conjugated to said antibody or said antibody fragment.
72. The method of claim 71 wherein the imaging agent is a
radionuclide.
73. The method of claim 72 wherein the radionuclide is .sup.99mTc,
.sup.111In or .sup.18F.
74. A humanized antibody that is useful for imaging target cells or
an antigen-binding fragment thereof, wherein said antibody or said
antibody fragment either does not possess N-linked glycosylation or
its N-linked glycosylation has been modified post expression to
reduce immunogenicity or toxicity, and said antibody or said
antibody fragment is useful for imaging target cells.
75. The antibody or antibody fragment of claim 74 wherein said
antibody or said antibody fragment does not possess O-linked
glycosylation.
76. The antibody or antibody fragment of claim 74 wherein the
polynucleotides encoding said antibody fragment have been
substituted or deleted to prevent N-linked glycosylation.
77. The antibody or antibody fragment of claim 74 wherein the
N-linked glycosylation has been chemically modified post
expression.
78. The antibody or antibody fragment of any one of claims 74-77
wherein an imaging agent is conjugated to said antibody or said
antibody fragment.
79. The antibody or antibody fragment of claim 78 wherein the
imaging agent is a radionuclide.
80. The antibody or antibody fragment of claim 79 wherein the
radionuclide is .sup.99mTc, .sup.111In or .sup.18F.
81. A method of preparing a humanized antibody, or an
antigen-binding fragment thereof, with reduced immunogenicity or
toxicity and useful for imaging target cells, comprising the steps
of: (a) selecting an expression system for the characteristic that
said system does not N-link glycosylate an antibody or an antibody
fragment; and (b) expressing in said expression system a nucleotide
sequence comprising nucleic acids encoding a humanized antibody, or
an antigen-binding fragment thereof, that is useful for imaging
target cells.
82. A method of preparing a humanized antibody, or an
antigen-binding fragment thereof, without N-linked glycosylation to
reduce immunogenicity or toxicity and said antibody or said
antibody fragment is useful for imaging target cells, comprising
expressing in an expression system a nucleotide sequence comprising
nucleic acids encoding a humanized antibody or antigen-binding
fragment thereof that is useful for imaging target cells, wherein
said expression system does not N-link glycosylate said antibody or
said antibody fragment.
83. The method of claim 81 or 82 wherein said antibody or said
antibody fragment does not possess O-linked glycosylation.
84. The method of claim 81 or 82 wherein an active agent is
conjugated to said antibody or said antibody fragment.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 08/660,362, filed Jun. 7, 1996.
TECHNICAL FIELD
[0002] The present invention relates to humanized antibodies
derived from chimeric antibody NR-LU-13 or other antibodies having
the same or similar binding specificity, fragments thereof
(including, e.g., variable regions and scFv's), conjugates
(including fusion proteins) containing such humanized antibodies or
fragments, and the use of such humanized antibodies or fragments in
diagnostic and therapeutic pretargeting methods and compositions.
The present invention also relates to the use of such humanized
antibodies in conventional immunotherapeutic and immunodiagnostic
methods and compositions, e.g., for tumor treatment and
imaging.
BACKGROUND OF THE INVENTION
[0003] A specific antibody which has been previously disclosed to
be an effective targeting moiety is NR-LU-10, a murine monoclonal
antibody produced against a human cancer antigen. NR-LU-10 is a
nominal 150 kilodalton molecular weight murine IgG.sub.2b
pancarcinoma monoclonal antibody that recognizes an approximately
40 kilodalton glycoprotein antigen expressed on most carcinomas.
NR-LU-10 has been safely administered to hundreds of patients in
human clinical trials. However, its disadvantage is that it is a
murine derived monoclonal antibody. This is disadvantageous because
immunogenicity may potentially reduce targeting efficacy if the
antibody is administered repeatedly. While therapeutic efficacy may
be obtained using a single administration, multiple administrative
protocols are currently favored.
[0004] As a means of reducing immunogenicity of murine antibodies,
various methods have been reported in the literature. Such methods
include the production of chimeric antibodies which contain murine
variable regions and human constant regions, the production of
single chain antibodies which comprise variable binding sequences
derived from murine antibodies, the production of antigen-binding
fragments of murine antibodies which because of their smaller size
are potentially less immunogenic, the production of human
monoclonal antibodies and the production of "humanized"
antibodies.
[0005] Murine monoclonal antibodies may be made more human-like,
e.g., by genetically recombining the nucleotide sequence encoding
the murine Fv region (i.e., containing the antigen binding sites)
or the complementarity determining regions thereof with nucleotide
sequences encoding human constant region sequences (comprised in
the Fc region of antibody). These antibodies are typically referred
to as chimeric antibodies.
[0006] In this regard, a chimeric antibody derived from NR-LU-10,
referred to as NR-LU-13, has previously been reported. This
antibody contains the murine Fv region of NR-LU-10 and therefore
comprises the same binding specificity as NR-LU-10. Thus, this
chimeric antibody binds the NR-LU-10 antigen.
[0007] Humanization ideally provides an antibody that is
non-immunogenic; with complete retention of the antigen-binding
properties of the parent non-human antibody molecule.
Non-immunogenicity allows for the administration of multiple
dosages without adverse immunogenic reaction. Various methods for
producing humanized antibodies have been reported in the
literature. For example, humanized antibodies can potentially be
produced: (a) by grafting only the non-human CDRs onto human
framework and constant regions (Jones et al., Nature 321:522-25
(1986); Verhoeyen et al., Science 239:1534-1536 (1988)); or (b) by
transplanting the entire non-human variable domains (to preserve
ligand-binding properties) but also "cloaking" them with a
human-like surface by replacement of exposed residues to reduce
immunogenicity (also referred to as "veneered" antibodies) (Padlan,
Molec. Immun. 28:489-498 (1991); Padlan, Molec. Immun.
31(3):169-217 (1994)).
[0008] Retention of murine residues within human variable region
framework domains reportedly helps retain proper binding function
of the resultant humanized antibody. Humanized antibodies have been
reported to potentially decrease or eliminate the immunogenicity of
the antibody in a host recipient, thereby permitting an increase in
the bioavailability and a reduction in the possibility of adverse
immune reactions, thus potentially enabling multiple antibody
administrations. Also, the synthesis of scFv and antibody fragments
such as Fv, Fd, Fab, Fab', and F(ab).sub.2 fragments, derived from
antibodies having a desired binding specificity comprises another
known means of producing targeting moieties having lesser
immunogenicity than intact antibodies. Essentially, single chain
antibodies and antibody fragments because of their smaller size
could be less immunogenic than intact antibodies.
[0009] It is also known that recombinant proteins, e.g.,
antibodies, are glycosylated differently in different host cells
used for expression. Essentially, different host cells have a
characteristic manner by which they glycosylate specific sites on
proteins referred to as glycosylation sites or glycosylation
motifs.
[0010] For example, plant cells primarily glycosylate proteins by
O-linked glycosylation, whereas animal cells typically glycosylate
proteins by N-linked and O-linked glycosylation. Also, the specific
carbohydrates and the glycosylation pattern varies dependent upon
the particular host cells.
[0011] It has been reported in the literature that oligosaccharides
may be significant insofar as the targeting of proteins to specific
sites. Moreover, it is also known that carbohydrates may elicit an
immunogenic response. Accordingly, there is the possibility that
proteins expressed in foreign host cells may elicit an immunogenic
response because of carbohydrate residues which are introduced by
the host cells used for expression. This is particularly
problematic if the foreign host cells glycosylate very differently
from humans. For example, there is the possibility that mammalian
proteins expressed in plant cells may be immunogenic because plant
cells glycosylate proteins very dissimilarly to mammalian
cells.
[0012] Due to the difficulties related to immunogenicity of murine
or chimeric antibodies that bind to the antigen bound by antibody
NR-LU-13, there is a need in the art for improved compositions and
methods. The present invention fulfills this need and further
provides other related advantages.
SUMMARY OF THE INVENTION
[0013] It is an object of the invention to provide humanized
antibodies derived from NR-LU-13 (or from other non-human
antibodies which bind the antigen bound by NR-LU-13) or fragments
of such humanized antibodies, which exhibit reduced immunogenicity
or toxicity in humans but retain the ability to bind the NR-LU-13
antigen.
[0014] It is another object of the invention to provide conjugates
containing humanized antibodies derived from NR-LU-13 or from other
non-human antibodies or fragments thereof which bind the antigen
bound by NR-LU-13.
[0015] It is still another object of the invention to provide
improved two-step pretargeting methods wherein the improvement
comprises using as the targeting moiety a humanized antibody
derived from NR-LU-13 or from another non-human antibody or
fragments thereof which bind the antigen bound by NR-LU-13.
[0016] It is another object of the invention to provide improved
three-step targeting methods wherein the improvement comprises
using as the targeting moiety a humanized antibody derived from
NR-LU-13 or from another non-human antibody or fragments thereof
which bind the antigen bound by NR-LU-13.
[0017] It is yet another object of the invention to provide
compositions for treatment or diagnosis which contain conjugates
comprising humanized antibodies derived from NR-LU-13 or from other
non-human antibodies or fragments thereof which bind the antigen
bound by NR-LU-13.
[0018] It is a more specific object of the invention to provide
conjugates comprising a humanized antibody derived from NR-LU-13 or
a fragment thereof capable of binding the antigen bond by NR-LU-13,
directly or indirectly attached to a member of a ligand or
anti-ligand partner, preferably avidin or streptavidin or a
fragment or derivative thereof capable of binding biotin.
[0019] It is another object of the invention to provide a conjugate
comprising a humanized antibody derived from NR-LU-13 or a fragment
thereof, which binds the antigen bound by NR-LU-13, for use in a
method of treating or diagnosing cancer.
[0020] It is an even more specific object of the invention to
produce specific humanized variable heavy and light sequences
derived from NR-LU-13 referred to herein as humanized NRX451 or
fragments thereof which bind to the antigen bound by. NR-LU-13.
[0021] It is another specific object of the invention to provide
compositions for treating or diagnosing cancer using humanized
NRX451 or fragments thereof which bind the antigen bound by
NR-LU-13.
[0022] It is another object of the invention to produce antibodies,
in particular, murine, chimeric or humanized antibodies which have
been mutated so as to eliminate one or more potential glycosylation
sites and thereby reduce immunogenicity or toxicity.
[0023] It is another object of the invention to use antibodies,
preferably humanized antibodies, which have been mutated to
eliminate N-linked glycosylation or modified to reduce N-linked
glycosylation, in pretargeting methods and conventional antibody
therapy.
[0024] Thus, the present invention provides a humanized antibody or
an antigen-binding humanized antibody fragment, wherein the
antibody or the antibody fragment binds specifically to the antigen
bound by antibody NR-LU-13, and preferably wherein the antibody or
the antibody fragment either does not possess N-linked
glycosylation or its N-linked glycosylation has been modified post
expression to reduce immunogenicity or toxicity. The present
invention also provides a method of reducing immunogenicity or
toxicity of an antibody or an antigen-binding antibody fragment of
IgG class, comprising the steps of: (a) selecting a host system for
the characteristic that the system does not N-link glycosylate an
antibody or an antibody fragment; and (b) expressing in the host
system a nucleotide sequence comprising nucleic acids (e.g., DNA or
RNA or functional equivalents) encoding an IgG antibody or an
antigen-binding antibody fragment. The present invention further
provides a method of eliminating N-linked glycosylation in an
antibody or an antigen-binding antibody fragment of IgG class to
reduce immunogenicity or toxicity, comprising expressing in a host
system a nucleotide sequence comprising nucleic acids (e.g., DNA or
RNA or functional equivalents) encoding an IgG antibody or an
antigen-binding antibody fragment, wherein the host system does not
N-link glycosylate the antibody or the antibody fragment. The
present invention further provides a method of modifying the
N-linked glycosylation of an antibody or an antigen-binding
antibody fragment of IgG class (e.g., to reduce immunogenicity or
toxicity), comprising subjecting the antibody or antibody fragment
to a post expression modification that modifies the N-linked
glycosylation. In a preferred embodiment, antibodies or fragments
of IgG class are modified chemically to reduce immunogenicity or
toxicity.
[0025] Conjugates are provided comprising a humanized antibody or
antibody fragment of the present invention, attached directly or
indirectly to a ligand, anti-ligand, diagnostic agent or
therapeutic agent. Pharmaceutical compositions are provided
comprising an antibody or antibody fragment or conjugate of the
present invention, in combination with a pharmaceutically
acceptable carrier or diluent. An antibody or antibody fragment or
conjugate or composition of the present invention is provided for
use as a diagnostic or as a medicament; for use in diagnostic or
therapeutic pretargeting methods; and in methods for the diagnosis
of cancer, or in methods for the treatment of cancer. In diagnostic
or therapeutic methods, an antibody or antibody fragment or
conjugate or composition of the present invention is administered
to a warm-blooded animal (such as a human) in an amount effective
for diagnosis or therapy, respectively.
[0026] These and other embodiments of the present invention will
become evident upon reference to the following detailed description
and attached drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 depicts schematically the sequence analysis and
computer modeling used to synthesize humanized antibodies from
NR-LU-13.
[0028] FIG. 2 contains the nucleotide and amino acid sequences of
NR-LU-13 light chain NR-LU-13 and heavy chain variable regions.
[0029] FIG. 3 contains the amino acid sequence of the preferred
humanized variable light sequence derived from NR-LU-13, referred
to as humanized NRX451-light.
[0030] FIG. 4 contains the amino acid sequence of the preferred
humanized variable heavy sequence derived from NR-LU-13, referred
to as humanized NRX451-heavy.
[0031] FIG. 5 is an alignment of the heavy and light variable
regions of NR-LU-13 and the humanized heavy and light variable
regions derived therefrom, referred to as NRX451 heavy and NRX451
light.
[0032] FIGS. 6a and 6b contain molecular models of (a) the Fv of
chimeric NR-LU-13 antibody and (b) a humanized Fv (NRX451) derived
therefrom.
[0033] FIG. 7a-7e contains amino acid frequencies for specific
positions of human antibody sequences.
[0034] FIG. 8 depicts a plasmid pcDNA3 which is an intermediate for
pNRX451-C, a plasmid used to express NRX451.
[0035] FIG. 9 depicts plasmid pNRX451-C used to express NRX451.
[0036] FIG. 10 contains results of kappa and gamma ELISAs for
specific NRX451 humanized antibody producing clones.
[0037] FIG. 11 compares immunoreactivity of humanized NRX451
antibody to intact NR-LU-10 antibody by competitive
immunoreactivity.
[0038] FIG. 12 compares the tissue biodistribution of different
radiolabeled antibodies including humanized antibodies produced
according to the invention.
[0039] FIG. 13 compares the biodistribution of humanized NR-LU-13
(NRX451) expressed in CHO cells, plant cells, and insect larvae to
murine NR-LU-10 produced in mouse hybridoma cells.
[0040] FIG. 14 compares the lectin binding profiles of the
oxidized/reduced and non-oxidized reduced NRX451.
[0041] FIGS. 15a-15c depict the complement mediated cytotoxicity
(C'MC) activity in unmodified and modified NRX451.
[0042] FIG. 15d depicts antibody dependent cellular cytotoxicity
(ADCC) activity in unmodified and modified NRX451.
[0043] FIGS. 16a-16c compare the biodistribution of 50/50
coinjection of labeled NRX451 and oxidized/reduced NRX451 in a
mouse model.
[0044] FIG. 17 compares the blood clearance of NRX451 and
oxidized/reduced NRX451 in human cancer patients.
[0045] FIG. 18 depicts complement-mediated cytotoxicity of MCF-7
cells exposed to log 10 dilutions of CHO expressed NRX451
(-.smallcircle.-), corn expressed NRX451 (-.quadrature.-) and the
corn expressed Asn to Gin mutant of NRX451 (-.DELTA.-). Human serum
at a final dilution of 10% was the source of complement. Results
are expressed as percent cytotoxicity.
[0046] FIG. 19 depicts MCF-7 cells exposed to log 10 dilutions of
CHO expressed NRX451 (-.smallcircle.-), corn expressed NRX451
(-.quadrature.-) and the corn expressed Asn to Gin mutant of NRX451
(-.DELTA.-). Human peripheral blood mononuclear cells were also
added at an effector to target cell ratio of 25:1. The results are
expressed as percent cytotoxicity.
[0047] FIG. 20 compares the blood disappearance of NRX451 and the
murine IgG analog, NR-LU-10, in mice.
[0048] FIGS. 21a-21b compare the biodistribution in tumored athymic
mice of NRX451 and the murine IgG analog, NR-LU-10.
[0049] FIG. 22 depicts the biodistribution in tumored athymic mice
of the N-linked glycosylated mutant NRX451 chemically conjugated to
streptavidin (SA), expressed in corn seed.
[0050] FIG. 23 contains results of the blood disappearance of the
radiolabeled corn expressed N-linked glycosylated mutant NRX451/SA
conjugate with and without the use of a synthetic clearing agent in
mice.
[0051] FIGS. 24a-24b contain the biodistribution in tumored athymic
mice of the radiolabeled corn expressed N-linked glycosylated
mutant NRX451/SA conjugate and subsequently administered
.sup.111I-DOTA-biotin using pretargeting methods.
DETAILED DESCRIPTION OF THE INVENTION
[0052] Prior to setting forth the invention, it may be helpful to
an understanding thereof to set forth definitions of certain terms
to be used hereinafter.
[0053] Antibody--As used herein, includes both polyclonal and
monoclonal antibodies; and may be an intact molecule, a fragment
thereof (such as Fv, Fd, Fab, Fab' and F(ab)'.sub.2 fragments, or
multimers or aggregates of intact molecules and/or fragments; and
may occur in nature or be produced, e.g., by immunization,
synthesis or genetic engineering.
[0054] Protein--As used herein, includes proteins, polypeptides and
peptides; and may be an intact molecule, a fragment thereof, or
multimers or aggregates of intact molecules and/or fragments; and
may occur in nature or be produced, e.g., by synthesis (including
chemical and/or enzymatic) or genetic engineering.
[0055] Humanized antibody--This refers to an antibody derived from
a non-human antibody (typically murine), or derived from a chimeric
antibody, that retains or substantially retains the antigen-binding
properties of the parent antibody but which is less immunogenic in
humans. This may be achieved by various methods, including by way
of example: (a) grafting only the non-human CDRs onto human
framework and constant regions (humanization), or (b)transplanting
the entire non-human variable domains, but "cloaking" them with a
human-like surface by replacement of surface residues
("veneering"). Such methods are disclosed, for example, in Jones et
al., Nature 321:522-525 (1986); Morrison et al., Proc. Natl. Acad.
Sci. 81:6851-6855 (1984); Morrison and Oi, Adv. Immunol. 44:65-92
(1988); Verhoeyer et al., Science 239:1534-1536 (1988); Padlan,
Molec. Immun. 28:489-498 (1991); Padlan, Molec. Immun.
31(3):169-217 (1994). In the present invention, humanized
antibodies will include "humanized" and "veneered" antibodies, but
exclude chimeric antibodies. A preferred method of humanization
comprises alignment of the non-human heavy and light chain
sequences to human heavy and light chain sequences, selection and
replacement of the non-human framework with a human framework based
on such alignment, molecular modeling to predict conformation of
the humanized sequence and comparison to the conformation of the
parent antibody, followed by repeated back mutation of residues in
the CDR region which disturb the structure of the CDRs until the
predicted conformation of the humanized sequence model closely
approximates the conformation of the non-human CDRs of the parent
non-human antibody. This method of humanization is depicted
schematically in FIG. 1. Also, such humanized antibodies may be
further derivatized to facilitate uptake and clearance, e.g., via
Ashwell receptors, or other receptor mediated clearance mechanisms
such as by the incorporation of galactose residues or other hexoses
(e.g., U.S. Pat. Nos. 5,530,101 and 5,585,089).
[0056] Humanized antibody fragment--This refers to fragments,
derived from a humanized antibody, which bind antigen and which may
be derivatized to exhibit structural features that facilitate
clearance and uptake, e.g., by the incorporation of galactose
residues. This includes, e.g., F(ab), F(ab)'.sub.2, scFv, light
chain variable region, heavy chain variable region, and
combinations thereof.
[0057] Complementarity Determining Region or CDR--The term CDR, as
used herein, refers to amino acid sequences which together define
the binding affinity and specificity of the natural Fv region of a
native immunoglobulin binding site (Chothia et al., J. Mol. Biol.
196:901-917 (1987); Kabat et al., U.S. Dept. of Health and Human
Services NIH Publication No. 91-3242 (1991)).
[0058] Framework Region or FR--The term FR, as used herein, refers
to amino acid sequences interposed between CDRs. One function of
these portions of the antibody is to hold the CDRs in appropriate
orientation (allows for CDRs to bind antigen).
[0059] Constant Region or CR--The term CR as used herein refers to
the portion of the antibody molecule which confers effector
functions. In the present invention, murine constant regions are
substituted by human constant regions. The constant regions of the
subject humanized antibodies are derived from human
immunoglobulins. The heavy chain constant region can be selected
from any of the five isotypes: alpha, delta, epsilon, gamma or mu.
Further, heavy chains of various subclasses (such as the IgG
subclasses of heavy chains) are responsible for different effector
functions and thus, by choosing the desired heavy chain constant
region, chimeric antibodies with desired effector function can be
produced. Preferred human constant regions are gamma 1 (IgG1),
gamma 2 (IgG2), gamma 3 (IgG3) and gamma 4 (IgG4). Preferred is an
Fc region of the gamma 1 (IgG1) isotype. The light chain constant
region can be of the kappa or lambda type, and is preferably of the
kappa type.
[0060] Chimeric antibody--This is an antibody containing sequences
derived from two different antibodies (e.g., U.S. Pat. No.
4,816,567), which typically are of different species. Most
typically chimeric antibodies comprise human and murine antibody
fragments, generally human constant and murine variable
regions.
[0061] NR-LU-10--A murine monoclonal antibody of the IgG2b isotype
that recognizes an approximately 40 kilodalton glycoprotein antigen
expressed on a large array of carcinomas. This antibody is a
pancarcinoma antibody that has been safely administered in human
clinical trials. The antigen bound by NR-LU-10 is expressed by
cancers including, e.g., small cell lung, non-small cell lung,
colon, breast, renal, ovarian, and pancreatic, among other
carcinoma tissues. This antibody has been previously used as a
targeting moiety in two-step and three-step pretargeting
methods.
[0062] NR-LU-13--A chimeric monoclonal antibody containing the
variable light and heavy regions of NR-LU-10 and human constant
domains. This antibody binds the same antigen as NR-LU-10.
[0063] NR-LU-10 or NR-LU-13 antigen--These terms are used
interchangeably and refer to the antigen bound by NR-LU-10 or
NR-LU-13, which is an approximately 40 kilodalton glycoprotein
antigen expressed by many carcinomas and noncancerous tissues.
[0064] Humanized NRX451 or humanized NRX451-light or humanized
NRX451-heavy--These terms refer to specific humanized variable
domain sequences derived from the Fv of NR-LU-13.
[0065] Humanized antibody or humanized antibody fragment
conjugates--Conjugates which contain the humanized antibodies or
humanized antibody fragments of the invention. These conjugates may
include a ligand or anti-ligand, and/or an active agent as defined
infra. The ligand, anti-ligand or active agent may be directly or
indirectly attached to the humanized antibody or humanized antibody
fragment, e.g., by the use of known linkers. These conjugates may
exhibit or be derivatized to exhibit structural features that
direct uptake and clearance thereof, e.g., by incorporation of
hexoses such as galactose that direct liver uptake via Ashwell
receptor mediated clearance.
[0066] Pretargeting--As defined herein, pretargeting involves
target site localization of a targeting moiety that is conjugated
with one member of a ligand/anti-ligand pair; after a time period
sufficient for optimal target-to-non-target accumulation of this
targeting moiety conjugate, active agent conjugated to the opposite
member of the ligand/anti-ligand pair is administered and is bound
(directly or indirectly) to the targeting moiety conjugate at the
target site. Pretargeting optionally also involves an additional
step of administering a clearing agent.
[0067] Targeting moiety--A molecule that binds to a defined
population of cells. The targeting moiety may bind any target, such
as a receptor, an oligonucleotide, an enzymatic substrate, an
antigenic determinant, or other binding site present on or in the
target cell population. The targeting moiety may be a protein,
peptide, antibody and antibody fragments thereof, fusion proteins,
and the like. Antibody is used throughout the specification as a
prototypical example of a targeting moiety. Tumor is used as a
prototypical example of a target.
[0068] Ligand/anti-ligand pair--A complementary/anti-complementary
set of molecules that demonstrate specific binding, generally of
relatively high affinity. Exemplary ligand/anti-ligand pairs
include zinc finger protein/dsDNA fragment, enzyme/inhibitor,
hapten/antibody, lectin/carbohydrate, ligand/receptor, and
biotin/avidin or streptavidin. Biotin/avidin or streptavidin is
used throughout the specification as a prototypical example of a
ligand/anti-ligand pair.
[0069] Ligand--As defined herein, a "ligand" is a relatively small,
soluble molecule that exhibits rapid serum, blood and/or whole body
clearance when administered intravenously in an animal or human.
Biotin and biotin analogs are used as the prototypical ligand.
Analogs of biotin having reduced or enhanced binding affinity to
avidin and streptavidin are well known in the art.
[0070] Anti-ligand--As defined herein, an "anti-ligand"
demonstrates high affinity, and preferably, multivalent binding of
the complementary ligand. Preferably, the anti-ligand when
conjugated to a targeting moiety is large enough to avoid rapid
renal clearance, and contains sufficient multivalence to accomplish
cross-linking and aggregation of targeting moiety-ligand
conjugates. Univalent anti-ligands are also contemplated by the
present invention. Anti-ligands of the present invention may
exhibit or be derivatized to exhibit structural features that
direct the uptake thereof, e.g., by the incorporation of hexose
residues that direct liver uptake. Avidin and streptavidin are used
herein as prototypical anti-ligands.
[0071] Avidin--As defined herein, "avidin" includes avidin,
streptavidin and derivatives and analogs thereof that are capable
of high affinity, multivalent or univalent binding of biotin.
Exemplary streptavidin molecules are described in U.S. Pat. Nos.
5,168,049 and 5,272,254.
[0072] Clearing agent--An agent capable of binding, complexing or
otherwise associating with an administered moiety (e.g., targeting
moiety-ligand, targeting moiety-anti-ligand or anti-ligand alone)
present in the recipients circulation, thereby facilitating
circulating moiety clearance from the recipient's body, removal
from blood circulation, or inactivation thereof in circulation. The
clearing agent is preferably characterized by physical properties,
such as size, charge, configuration or a combination thereof, that
limit clearing agent access to the population of target cells
recognized by a targeting moiety used in the same treatment
protocol as the clearing agent.
[0073] Active agent--A diagnostic or therapeutic agent, including
radionuclides, drugs, anti-tumor agents, cytokines, hormones,
toxins and the like. Radionuclide therapeutic agents are
prototypical active agents.
[0074] Target cell retention--The amount of time that a
radionuclide or other therapeutic agent remains at the target cell
surface or within the target cell. Catabolism of conjugates or
molecules containing such therapeutic agents appears to be
primarily responsible for the loss of target cell retention.
[0075] Conjugate--A conjugate is a molecule that is the combination
of two or more molecules (or portions of any or all) that are
directly (e.g., covalently or non-covalently bound) or indirectly
(e.g., incorporated or bound indirectly) associated with one
another. A conjugate includes chemical conjugates (covalently or
non-covalently bound), fusion proteins and the like. Conjugates may
possess a ligand or anti-ligand, and/or active agent.
[0076] Immunogenicity--A measure of the ability of a targeting
protein or therapeutic moiety to elicit an immune response (humoral
or cellular) when administered to a recipient. The present
invention is concerned with the immunogenicity of conjugates and
their component parts.
[0077] Aglycosylated antibody or aglycosylated humanized
antibody--These terms refer to antibodies or humanized antibodies,
or antigen binding fragments thereof which have been mutagenized by
site-specific mutagenesis to modify amino acid residues in sites
which would otherwise potentially be glycosylated so as to
eliminate or reduce glycosylation.
[0078] Humanized antibody of reduced immunogenicity--This refers to
a humanized antibody exhibiting reduced immunogenicity relative to
the parent antibody, e.g., humanized antibody containing humanized
NRX451-heavy and humanized NRX451-light sequences in relation to
NR-LU-13.
[0079] Humanized antibody substantially retaining the binding
properties of the parent antibody--This refers to a humanized
antibody which retains the ability to specifically bind the antigen
recognized by the parent antibody used to produce such humanized
antibody. For example, humanized antibodies which substantially
retain the binding properties of NR-LU-13 specifically bind to an
approximately 40 kilodalton protein expressed by many carcinomas,
and more preferably to the same epitope as NR-LU-13. Preferably the
humanized antibody will exhibit the same or substantially the same
antigen-binding affinity as the parent antibody. Generally, the
affinity will be within about the same order of magnitude as the
affinity of the parent antibody. Methods for assaying
antigen-binding affinity are well known in the art and include
half-maximal binding assays, competition assays, and Scatchard
analysis.
[0080] Where applicable, the above-recited definitions include
functional equivalents, i.e., molecules that differ in length,
structure, components, etc., but which nevertheless are able to
perform or achieve one or more of the functions of the defined
molecule. Functional equivalents of the aforementioned defined
molecules include functional equivalents of antibodies or antibody
fragments of the present invention. One functional equivalent is a
"mimetic" compound, i.e., an organic chemical construct designed to
mimic the proper configuration and/or orientation for antigen
binding. Another functional equivalent is a short polypeptide
designated as a "minimal" polypeptide, constructed using
computer-assisted molecular modeling and mutants having altered
binding affinity, which minimal polypeptides exhibit the antigen
binding affinity of the antibody.
[0081] As noted above, the subject invention is directed toward the
production of humanized antibodies, and antigen-binding fragments
thereof, derived from NR-LU-13 or other non-human antibodies which
bind to the antigen recognized by NR-LU-13 (at the same or
different epitopes), and their usage, especially in two-step and
three-step pretargeting methods. Moreover, given that the subject
humanized antibodies will typically contain human constant regions,
they also may be used as therapeutic antibodies. Specifically,
humanized antibodies which contain human constant regions typically
elicit human effector functions, e.g., complement mediated
cytotoxicity (C'MC) and antibody dependent cell-mediated
cytotoxicity (ADCC) activity. Such activity may result in direct
tumor cell lysis by complement proteins or ADCC effector cells, NK
polymorphonuclear cells and monocytes. Also, such activity may
result in the induction of an inflammatory response as typified by
infiltration of inflammatory effector cells, macrophage and
polymorphonuclear leukocytes. Therefore, these humanized antibodies
may potentiate tumor cell lysis absent the need for attachment to
another active agent, e.g., a radionuclide or a toxin.
[0082] Alternatively, humanized antibodies, and antigen-binding
fragments, with or without effector sequences may be attached to
active agents to effect a desired therapeutic function.
[0083] As previously described, NR-LU-13 is a chimeric antibody
containing murine Fv sequences and human constant domain sequences.
NR-LU-13 is an antibody that binds the NR-LU-13 antigen at the same
epitope as NR-LU-10. NR-LU-10 is a pancarcinoma antibody which is a
murine monoclonal antibody of the IgG2b isotype having a molecular
weight of 150 kilodaltons. As discussed, this monoclonal antibody
as well as the Fab fragment thereof have been safely administered
to many hundreds of patients in human clinical trials.
[0084] Radioimmunoassay, immunoprecipitation and
Fluorescence-Activated Cell Sorting (FACS) analysis have been used
to determine reactivity profiles of NR-LU-10. The NR-LU-10 target
antigen is present on either fixed cultured cells or in detergent
extracts of various types of cancer cells. For example, the
NR-LU-10 antigen is expressed by small cell lung, non-small cell
lung, colon, breast, renal, ovarian, pancreatic, and other
carcinoma tissues. Tumor reactivity of the NR-LU-10 antibody is set
forth in Table A, while NR-LU-10 reactivity with normal tissues is
set forth in Table B. The values in Table B are obtained as
described below. Positive NR-LU-10 tissue reactivity indicates
NR-LU-10 antigen expression by such tissues. The NR-LU-10 antigen
has been further described by Varki et al., "Antigens Associated
with a Human Lung Adenocarcinoma Defined by Monoclonal Antibodies,"
Cancer Research 44: 681-687 (1984), and Okabe et al., "Monoclonal
Antibodies to Surface Antigens of Small Cell Carcinoma of the
Lung," Cancer Research 44: 5273-5278 (1984).
[0085] The tissue specimens were scored in accordance with three
reactivity parameters: (1) the intensity of the reaction; (2) the
uniformity of the reaction within the cell type; and (3) the
percentage of cells reactive with the antibody. These three values
are combined into a single weighted comparative value between 0 and
500, with 500 being the most intense reactivity. This comparative
value facilitates comparison of different tissues. Table B includes
a summary reactivity value, the number of tissue samples examined
and the number of samples that reacted positively with
NR-LU-10.
[0086] Methods for preparing antibodies that bind to epitopes of
the NR-LU-10 antigen are also known and are described in U.S. Pat.
No. 5,084,396. Briefly, such antibodies may be prepared by the
following procedure:
[0087] absorbing a first monoclonal antibody directed against a
first epitope of a polyvalent antigen onto an inert, insoluble
matrix capable of binding immunoglobulin, thereby forming an
immunosorbent;
[0088] combining the immunosorbent with an extract containing
polyvalent NR-LU-10 antigen, forming an insolubilized immune
complex wherein the first epitope is masked by the first monoclonal
antibody;
[0089] immunizing an animal with the insolubilized immune
complex;
[0090] fusing spleen cells from the immunized animal to myeloma
cells to form a hybridoma capable of producing a second monoclonal
antibody directed against a second epitope of the polyvalent
antigen;
[0091] culturing the hybridoma to produce the second monoclonal
antibody; and
[0092] collecting the second monoclonal antibody as a product of
the hybridoma
[0093] Monoclonal antibodies NR-LU-01, NR-LU-O.sub.2, NR-LU-03 and
NR-LU-06 prepared in accordance with the procedures described in
the aforementioned patent, are exemplary antibodies which bind the
same cancer antigen as NR-LU-10, which are suitable for use in
pretargeting methods.
[0094] Additional antibodies reactive with the NR-LU-10 antigen may
also be prepared by standard hybridoma production and screening
techniques. Any hybridoma clones so produced and identified may be
further screened as described above to verify antigen and tissue
reactivity.
1TABLE A Intensity.sup.a Percent.sup.b Uniformity.sup.c Organ/Cell
#Pos/ Avg. Avg. Avg. Type Tumor Exam Range Range Range Pancreas
Carcinoma 6/6 3 3 100 100 2.3 2.3 Prostate Carcinoma 9/9 2.8 2.3 95
80-100 2 1.3 Lung Adenocarcinoma 8/8 3 3 100 100 2.2 1.3 Lung Small
Cell 2/2 3 3 100 100 2 2 Carcinoma Lung Squamous Cell 8/8 2.3 2.3
73 5-100 1.8 1.3 Carcinoma Renal Carcinoma 8/9 2.2 2.3 83 75-100 1
1 Breast 23/23 2.9 2.3 97 75-100 2.8 1.3 Adenocarcinoma Colon
Carcinoma 12/12 2.9 2.3 98 95-100 2.9 2.3 Malignant Melanoma 0/2 0
0 0 0 0 0 Ocular Malignant Melanoma 0/11 0 0 0 0 0 0 Ovarian
Carcinoma 35/35 2.9 2.3 100 100 2.2 1.3 Undifferentiated 1/1 2 2 90
90 2 2 Carcinoma Osteosarcoma 1/1 2 2 20 20 1 1 Synovial Sarcoma
0/1 0 0 0 0 0 0 Lymphoma 0/2 0 0 0 0 0 0 Liposarcoma 0/2 0 0 0 0 0
0 Uterine 0/1 0 0 0 0 0 0 Leiomyosarcoma
[0095]
2TABLE B Organ Cell Type #Pos/Exam Summary Reactivity Adenoid
Epithelium 3/3 433 Lymphoid Follicle-Central 0/3 0 Lymphoid
Follicie-Peripheral 0/3 0 Mucus Gland 2/2 400 Adipose Tissue Fat
Cells 0/3 0 Adrenal Zona Fasciculata Cortex 0/3 0 Zona Glomerulosa
Cortex 0/3 0 Zona Reticularis Cortex 0/3 0 Medulla 0/3 0 Aorta
Endothelium 0/3 0 Elastic Interna 0/3 0 Tunica Adventitia 0/3 0
Tunica Media 0/3 0 Brain-Cerebellum Axons, Myelinated 0/3 0
Microglia 0/3 0 Neurons 0/3 0 Purkenje's Cells 0/3 0 Brain-Cerebrum
Axons, Myelinated 0/3 0 Microglia 0/3 0 Neurons 0/3 0
Brain-Midbrain Axons, Myelinated 0/3 0 Microglia 0/3 0 Neurons 0/3
0 Colon Mucosal Epithelium 3/3 500 Muscularis Externa 0/3 0
Muscularis Mucosa 0/3 0 Nerve Ganglia 0/3 0 Serosa 0/1 0 Duodenum
Mucosal Epithelium 3/3 500 Muscularis Mucosa 0/3 0 Epididymis
Epithelium 3/3 419 Smooth Muscle 0/3 0 Spermatozoa 0/1 0 Esophagus
Epithelium 3/3 86 Mucosal Gland 2/2 450 Smooth Muscle 0/3 0 Gall
Bladder Mucosal Epithelium 0/3 467 Smooth Muscle 0/3 0 Heart
Myocardium 0/3 0 Serosa 0/1 0 Ileum Lymph Node 0/2 0 Mucosal
Epithelium 0/2 0 Muscularis Externa 0/1 0 Muscularis Mucosa 0/2 0
Nerve Ganglia 0/1 0 Serosa 0/1 0 Jejunum Lymph Node 0/1 0 Mucosal
Epithelium 2/2 400 Muscularis Externa 0/2 0 Muscularis Mucosa 0/2 0
Nerve Ganglia 0/2 0 Serosa 0/1 0 Kidney Collecting Tubules 2/3 160
Distal Convoluted Tubules 3/3 500 Glomerular Epithelium 0/3 0
Mesangial 0/3 0 Proximal Convoluted Tubules 3/3 500 Liver Bile Duct
3/3 500 Central Lobular Hepatocyte 1/3 4 Periportal Hepatocyte 1/3
40 Kupffer Cells 0/3 0 Lung Alveolar Macrophage 0/3 0 Bronchial
Epithelium 0/2 0 Bronchial Smooth Muscle 0/2 0 Pneumocyte Type I
3/3 354 Pneumocyte Type II 3/3 387 Lymph Node Lymphoid
Follicle-Central 0/3 0 Lymphoid Follicle-Peripheral 0/3 0 Mammary
Gland Aveolar Epithelium 3/3 500 Duct Epithelium 3/3 500
Myoepithelium 0/3 0 Muscle Skeletal Muscle Fiber 0/3 0 Nerve Axon
Myelinated 0/2 0 Endoneurium 0/2 0 Neurolemma 0/2 0 Neuron 0/2 0
Perineurium 0/2 0 Ovary Corpus Luteum 0/3 0 Epithelium 1/1 270
Granulosa 1/3 400 Serosa 0/3 0 Theca 0/3 0 Oviduct Epithelium 1/1
500 Smooth Muscle 0/3 0 Pancreas Acinar Cell 3/3 500 Duct
Epithelium 3/3 500 Islet Cell 3/3 500 Peritoneum Mesothelium 0/1 0
Pituitary Adenohypophysis 2/2 500 Neurohypophysis 0/2 0 Placenta
Trophoblasts 0/3 0 Prostate Concretions 0/3 0 Glandular Epithelium
3/3 400 Smooth Muscle 0/3 0 Rectum Lymph Node 0/2 0 Mucosal
Epithelium 0/2 0 Muscularis Externa 0/1 0 Muscularis Mucosa 0/3 0
Nerve Ganglia 0/3 0 Salivary Gland Acinar Epithelium 3/3 500 Duct
Epithelium 3/3 500 Skin Apocrine Glands 3/3 280 Basal Layer 3/3 33
Epithelium 1/3 10 Follicle 1/1 190 Stratum Corneum 0/3 0 Spinal
Cord Axons Myelinated 0/2 0 Microglial 0/2 0 Neurons 0/2 0 Spleen
Lymphoid Follicle-Central 0/3 0 Lymphoid Follicle-Peripheral 0/3 0
Trabecular Smooth Muscle 0/3 0 Stomach Chief Cells 3/3 290 Mucosal
Epithelium 3/3 367 Muscularis Mucosa/Externa 0/3 0 Parietal Cells
3/3 290 Smooth Muscle 0/3 0 Stromal Tissue Adipose 0/63 0
Arteriolar Smooth Muscle 0/120 0 Endothelium 0/120 0 Fibrous
Connective Tissue 0/120 0 Macrophages 0/117 0 Mast
Cells/Eosinophils 0/86 0 Testis Interstitial Cells 0/3 0 Sertoli
Cells 3/3 93 Thymus Hassal's Epithelium 3/3 147 Hassal's Keratin
3/3 333 Lymphoid Cortex 0/3 0 Lymphoid Medulla 3/3 167 Thyroid
C-cells 0/3 0 Colloid 0/3 0 Follicular Epithelium 3/3 500 Tonsil
Epithelium 1/3 500 Lymphoid Follicle-Central 0/3 0 Lymphoid
Follicle-Peripheral 0/3 0 Mucus Gland 1/1 300 Striated Muscle 0/3 0
Umbilical cord Epithelium 0/3 0 Urinary Bladder Mucosal Epithelium
3/3 433 Serosa 0/1 0 Smooth Muscle 0/3 0 Uterus Endometrial
Epithelium 3/3 500 Endometrial Glands 3/3 500 Smooth Muscle 0/3 0
Vagina/Cervix Epithelial Glands 1/1 500 Smooth Muscle 0/2 0
Squamous Epithelium 1/1 200
[0096] However, while the NR-LU-13 antibody and other antibodies of
non-human origin which bind the NR-LU-10 antigen possess
therapeutic and diagnostic utility, especially as targeting
moieties in pretargeting methods, they suffer from one potential
disadvantage. Specifically, because they contain non-human (e.g.,
murine) sequences, they may be immunogenic in humans. This is
disadvantageous because such immunogenicity may reduce targeting
efficacy upon repeated administration of antibody.
[0097] Thus, the present invention provides targeting moieties
having substantially the same antigen binding properties as
NR-LU-13, but which exhibit reduced immunogenicity. More
specifically, the present invention provides humanized antibodies,
and antigen-binding humanized antibody fragments, derived from
NR-LU-13 or other non-human antibodies which specifically bind the
same cancer antigen recognized by NR-LU-13, and more preferably the
same epitope. As used herein, a humanized antibody, or humanized
antibody fragment, that "binds specifically" to the antigen bound
by antibody NR-LU-13 means that the antibody or antibody fragment
has a binding affinity of at least about 10.sup.4 M.sup.-1.
Preferably, the binding affinity is at least about 10.sup.6
M.sup.-1, and more preferably at least about 10.sup.8 M.sup.-1.
[0098] As discussed, it has been reported in the literature that
humanized antibodies may potentially be derived from murine
antibodies which exhibit the same or substantially some
antigen-binding characteristics, but which exhibit reduced
immunogenicity.
[0099] Humanized antibodies may be produced by a variety of
methods. These humanization methods include: (a) grafting only
non-human CDRs onto human framework and constant regions (e.g.,
Jones et al., Nature 321:522-525 (1986) (conventional humanized
antibodies); Verhoeyen et al., Science 239:1534-1536 (1988); and
(b) transplanting the entire non-human variable domains, but
cloaking (veneering) these domains by replacement of exposed
residues (to reduce immunogenicity) (e.g., Padlan, Molec. Immun
28:489-498 (1991) (veneered antibodies). As noted supra, humanized
antibodies as defined herein includes both conventional "humanized"
and "veneered antibodies".
[0100] Within the present invention, the election was made to
humanize NR-LU-13 using a humanization protocol which involves a
series of sequence analysis and molecular modeling steps. This
protocol is depicted schematically in FIG. 1. Essentially, it
comprises comparison of the murine heavy and light variable chain
sequences with a database of human heavy and light variable region
sequences; selection of the most similar human framework sequences;
replacement of selected framework residues based on sequence
similarity; generation of molecular models corresponding to parent
murine and putative humanized sequences; back mutating to modify
the residues believed to perturb conformation of complementarity
determining regions (CDRs) by comparison to the molecular model
corresponding to parent murine sequence; constructing a molecular
model based on the modified sequence; and comparison of this model
with the parent murine sequence. This analysis is continued until
the conformation of the CDRs in the humanized model closely match
the CDR conformation in the parent murine model. This protocol may
also be utilized to humanize other non-human (e.g., murine)
antibodies specific for the antigen bound by NR-LU-13, and more
preferably antibodies which bind the same epitope as NR-LU-13.
[0101] More specifically for the humanization of NR-LU-13, DNA
fragments encoding the NR-LU-13 antibody were cloned, and these DNA
fragments were sequenced by known methods, including the entire
variable heavy and light domains which includes the complementarity
determining regions (CDRs) and framework regions (FRs). The amino
acid sequences encoding the murine variable heavy and light
sequences were compared to a database of human sequence pairs
(immunoglobulin light and heavy chains originating from the same
clone). The DNA sequences and deduced amino acid sequences of the
cloned heavy and light chain variable regions of NR-LU-13 are
depicted in FIG. 2. The immunoglobulin sequence data used for such
comparison was obtained from Kabat et al., "Sequences of Proteins
of Immunological Interest," U.S. Dept. Health and Human Services,
Fifth Ed. 1991. Structural data was obtained from Bernstein et al.,
"The protein databank: A computer based archival file for
macromolecular structures, J. Mol. Biol. 112:535-542 (1977).
[0102] After sequence comparison, the most identical human antibody
sequence was selected to supply the initial framework for the
"grafted" antibody. The most identical sequence pair was found to
be that of the clone R3.5H5G'CL (Manheimer-Lory et al., J. Exp.
Med., 174 (December 1991) 1639-1642). The sequence of the original
murine CDRs derived from NR-LU-13 were then transferred to the
selected human framework structure. This process resulted in an
initial putative humanized Fv sequence. The initial putative
humanized sequence underwent a series of mutations as previously
described.
[0103] The initial putative humanized sequence was then "refined"
by testing the sequence in three-dimensional models. A molecular
model was constructed of the original murine sequence and the
initial humanized sequence. Equivalent residue positions in the
murine model and the humanized model were compared. Residues in the
humanized model which were predicted to perturb the structure of
the CDRs were "back mutated." A molecular model was then
constructed of the modified putative humanized sequence and again
compared to the murine molecular model. This cycle of putative
humanized sequence molecular modeling and "back mutation" followed
by comparison of the resultant modified humanized sequence model to
the murine model is repeated until the conformation of the CDRs in
the humanized model closely matches the CDR conformation of the
murine model. This humanization protocol is depicted schematically
in FIG. 1.
[0104] Using this methodology, with variable heavy and light
sequences derived from NR-LU-13 (referred to as NRX451-light and
NRX451-heavy sequences), humanized NRX451 heavy and light sequences
were obtained. These humanized light and heavy sequences are
respectively set forth in FIG. 3 and FIG. 4. In both of these
figures, the variable heavy or light framework residues which vary
from the parent NRX451 heavy and light murine sequence residues are
in bold type.
[0105] It can be seen upon review of FIGS. 3 and 4 that the
humanized variable heavy and light sequences (referred to as
NRX451-heavy and NRX451-light sequences) differ from the parent
murine antibody variable sequences mainly at the base of the Fv
domain towards the C portion of the Fab fragment. The numbering of
the subject NRX451 murine and humanized sequences is according to
UDB numbering. These humanized variable heavy and light sequences
are intended to result in humanized antibodies exhibiting less
immunogenicity than NR-LU-13.
[0106] Wile it is intended that the NRX451 sequences (given their
sequence similarity to human immunoglobulins) depicted in FIGS. 3
and 4 result in antibodies eliciting reduced immunogenicity in
humans (compared to murine NR-LU-10 or chimeric NR-LU-13) and may
moreover exhibit enhanced serum half-life, other modifications of
the above-identified NRX451 sequences are within the scope of the
present invention. For example, these humanized sequences may be
further modified by deletion, addition or substitution mutation. In
particular, they may be modified by the substitution of one or more
exposed framework residues according to the method of Padlan,
Molec. Immunol. 28:489-498 (1991), referenced herein. For example,
a particular amino acid residue contemplated for substitution is
the cysteine at position 60 of the heavy chain by another amino
acid, e.g., serine.
[0107] In particular, the invention embraces substitution
modifications which do not substantially adversely affect antigen
binding. For example, this includes conservative amino acid
substitutions, e.g., the substitution of an acidic amino acid by
another acidic amino acid. Conservative amino acid substitution
mutations are well known in the art.
[0108] Moreover, the invention specifically embraces NRX451-heavy
and NRX451-light sequences and fragments thereof which are
contained in pNRX451 which is a plasmid. A plasmid of NRX451
(pNRX451) is a mammalian expression vector derived from pcDNA3
(Invitrogen) containing cDNA encoding humanized heavy and light
chains.
[0109] Also, they may be truncated by the deletion of one or more
amino acid residues to produce functional (antigen-binding)
humanized sequences. For example, it has been observed during
expression of the subject humanized antibodies in CHO and insect
cells that fragments (apparently produced because of a cellular
cleavage mechanism or the purification method) which lack residues
of the subject humanized NRX451 sequences are functional, i.e.,
they still bind the NR-LU-13 antigen. In particular, it is observed
that humanized Fv sequences containing the above humanized
sequences, but lacking the first seven N-terminal residues of the
NRX451 humanized heavy chain sequence are functional. Based on
these results, it is expected that other deletions, e.g., other
N-terminal and C-terminal deletions of the subject humanized
NRX451, should also be functional (bind antigen). Functional
deletions can be identified by sequential expression of various
deletions, and screening the resultant deletion to determine its
ability to bind the NR-LU-13 antigen. As described below, mutated
antibody sequences may be expressed in any of a variety of host
systems, e.g., mammalian cells (such as CHO cells), insects, plant
cells, transgenic plants and transgenic animals.
[0110] As noted above, the subject invention further relates to the
modification of antibodies (especially IgG class) to eliminate
N-linked glycosylation (i.e., pre-expression modification of
antibodies to prevent N-linked glycosylation) or to modify N-linked
glycosylation (i.e., post expression modification of N-linked
glycosylation of antibodies). As described herein, elimination or
modification of N-linked glycosylation has the beneficial property
of reducing immunogenicity and/or toxicity. Antibodies are
glycoproteins which are glycosylated at characteristic sites
dependent upon their isotype. For example, IgGs are N-link
glycosylated as a bianternary complex at Asn-Xaa-Ser(Thr) motif in
each of the C.sub.H2 domains (wherein in this motif Xaa is any
amino acid and Ser and Thr are interchangeable). Glycosylation
occurs as a post translational event when oligosaccharides, ranging
in size from 8 to 90 saccharides, are N-linked to the motif at the
Asn residue (297).
[0111] The effects of glycosylation on the tertiary structure of
antibodies, and specifically the Fc region thereof, is known to be
structurally significant. For example, such significance has been
revealed by NMR studies (see R. A. Dwek et al, J. Anat. 187:279-292
(1995), "Glycobiology: The function of sugar in the IgG molecule".
Moreover, glycosylation is significant as C1q binding and antibody
binding to monocytes is significantly reduced in glycosylated
monoclonal antibodies.
[0112] Also, modification of glycosylation patterns in IgG has been
reported to be associated with many diseases including rheumatoid
arthritis, age and pregnancy (See Dwek et al, Ibid.). Consequently,
in the commercial production of monoclonal antibodies glycosylation
has recently become a concern. More specifically, inappropriate
glycosylation patterns have become a concern because monoclonal
antibody production has expanded to include new organisms, many of
which glycosylate proteins dissimilarly in relation to human cells.
Previously, monoclonal antibodies were only expressed in mammalian
cells. However, with the development of new and improved vector
systems, protein purification and culturing methods, antibodies,
e.g., murine, chimeric and humanized antibodies may be expressed in
many hosts and host cell systems, e.g., mammalian, yeast, insect
and plant cells. While this offers significant advantages, e.g.,
insects typically provide for high expression of recombinant
proteins; there is at least one potential problem with expressing
proteins in different hosts. Specifically, while the fidelity of
protein expression in different hosts is well controlled, post
translational modification is an innate property of the pertinent
host cell line. In general, host cells glycosylate proteins in a
characteristic manner, i.e., glycosylation pattern.
[0113] The post translational process of glycosylation in novel
expression systems has been believed to be potentially problematic
because it may affect the biodistribution of the resultant
glycoprotein because of altered carbohydrate recognition. In this
regard, it is widely accepted that oligosaccharides act as
recognition elements. For example, many animal proteins isolated
from cells and tissues have sequence motifs that recognize
carbohydrate domains. Therefore, modification of glycosylation
sites would be expected to alter the biodistribution of a
protein.
[0114] Moreover, because oligosaccharides affect antibody
structure, modification of glycosylation sites might be expected to
potentially adversely affect the structure and the binding
conformation of the antibody molecule. However, as shown in the
disclosure of the present invention, it was discovered that
elimination or modification of antibodies' carbohydrate moieties
(particularly humanized antibodies to the NR-LU-13 antigen) had
beneficial rather than deleterious effects.
[0115] In order to reduce or eliminate immunogenicity or toxicity
of IgG class antibodies, the present invention provides for
pre-expression or post expression modification of antibodies to
prevent or modify N-linked glycosylation. The elimination of
potential glycosylation sites in monoclonal antibodies, e.g.,
chimeric and humanized antibodies and fragments thereof, may be
accomplished by site specific mutagenesis. Specifically, the
present invention includes site-specifically mutagenizing DNA
sequences encoding antibodies or antibody fragments, preferably
humanized antibodies or humanized variable sequences which
introduce substitution mutations in or proximate to one or more
glycosylation sites.
[0116] This is accomplished by site-specific mutagenesis of a codon
in a DNA encoding an immunoglobulin sequence which corresponds to
an amino acid residue contained within a glycosylation site, or
which is sufficiently proximate thereto such that the modification
of such amino acid results in the elimination of glycosylation of
said glycosylation site. In general, this will involve site
specific mutagenesis of the Asn-Xaa-Ser(Thr) glycosylation motifs
which are present in immunoglobulins. For example, such
Asn-Xaa-Ser(Thr) motifs are known to be present in the C.sub.H2
domain of IgGs at observed sites in the antibody molecule.
[0117] Elimination of glycosylation at such site(s) is accomplished
by site specific mutagenesis of a glycosylation site contained in
an antibody sequence in order to alter (substitute or delete) one
or more of the amino acids contained therein and thereby prevent
glycosylation at such site. Methods for introducing site specific
mutations in DNA sequences at a desired site are well known in the
art.
[0118] In general, therefore the method will comprise cloning a DNA
sequence encoding a desired antibody, identifying the glycosylation
motifs contained therein, and modifying one or more codons in said
glycosylation motifs so as to introduce an amino acid substitution
mutation such that upon expression of such DNA in a selected host
cell the resultant antibody is not glycosylated at said site.
[0119] As noted, methods of site specific mutagenesis are well
known in the art. In site-directed mutagenesis, the substitution is
accomplished by chemically synthesizing an oligonucleotide
incorporating the desired base change, hybridizing the
oligonucleotide to the DNA encoding sequence to be altered, and
extending the mismatched primer with DNA polymerase to create the
new gene sequence. The mutated gene can subsequently be inserted
into a suitable host organism or expression system to yield the
mutant DNA or RNA or produce the altered protein product.
Typically, such modification will substitute the asparagine residue
in a glycosylation motif with another amino acid.
[0120] Alternatively, a glycosylation motif can be changed by
deletion of the DNA codon for either asparagine or serine/threonine
in the sequence, Asn-Xaa-Ser/Thr, which would prevent glycosylation
from occurring at that site. For example, DNA sequences between two
unique restriction sites flanking the glycosylation site can be
chemically synthesized without the asparagine codon. The original
wild type DNA sequence can then be replaced with the altered
sequence in the plasmid construct using the two restriction
sites.
[0121] For example, one means comprises the synthesis of two
different oligonucleotides that overlap the targeted sequence which
is to be modified, i.e., the portion of the DNA which encodes the
Asn-Xaa-Ser(Thr) motif, one of which contains the mutation which is
to be inserted; conducting two separate polymerase chain reactions
wherein in the first reaction the mutant oligonucleotide is
amplified; and conducting a second polymerase chain reaction
wherein a PCR "sewing reaction" is performed. This essentially
results in the combination of the mutated oligonucleotide with the
second oligonucleotide primer to create a single mutant cDNA which
contains the desired mutation. The amplified cDNA which contains
the mutation is then inserted into the appropriate insertion site
in a vector which contains the original (non-mutated) antibody DNA
sequence. The resultant clones are then sequenced to verify that
the mutation has been inserted at the appropriate site.
[0122] Mutations of glycosylation sites may be introduced into any
cloned antibody sequence, e.g., murine antibody sequences, chimeric
antibody sequences and humanized antibody sequences. The resultant
mutated antibody DNA sequences are then expressed in desired
expression systems to obtain antibodies having reduced or no
glycosylation.
[0123] Alternatively, N-linked glycosylation (and optionally
O-linked glycosylation) of an IgG antibody may be modified post
expression. It is further within the scope of the present invention
to modify an antibody (or fragment) both pre-expression and post
expression. Modification post expression means eliminating or
modifying (e.g., reducing) N-linked glycosylation post expression.
Post expression modifications include: expression of antibody
sequences in host systems (expression systems) that do not N-link
glycosylate an antibody or antibody fragment; chemical
modification; and enzymatic modification. Host systems are
discussed in more detail below. Glycosylation sites on an antibody
may be removed enzymatically. There are a number of glycosidases
capable of cleaving the carbohydrates on protein molecules.
Examples of some N glycosidases commonly used for deglycosylation
of N-linked carboxyhydrates includes: Endoglycosidase H, which
cleaves high mannose type and hybrid oligosaccharide chains;
Endoglycosidase F, which cleaves biantennary complex type
oligosaccharide; and Peptide N-glycosidase F, which cleaves tri and
tetraantennary complex type chains as well as others cleaved by the
above described N-glycosidases. O-linked carbohydrates can also be
removed enzymatically using O-glycanase, and the like. Glycosidases
are commercially available (e.g., Sigma Chemical Co., St. Louis,
Mo.). These enzymes and others known to one of ordinary skill in
the art are capable of removing some of the specified carbohydrates
using mild reaction conditions between pH 4.0 and 9.0. For example,
PNGase F is most active at pH 8.0, but will function adequately
.+-.one pH unit.
[0124] The chemical modification methodology of the present
invention, for modifying antibodies to reduce immunogenicity and/or
toxicity, is oxidation which can optionally be followed by a
reduction step. Oxidation of carbohydrates on the antibody generate
aldehyde groups which can be reduced to their corresponding
alcohols. The method involves using a mild oxidizing agent, such as
sodium meta periodate, followed by reduction with a mild reducing
agent, such as sodium borohydride. In the oxidation procedure,
thioether or a thioether containing compounds such as methionine
may be optionally added to the reaction mixture to protect
oxidation sensitive amino acids in the complement determining
region of the antibody. Other water soluble thioethers could also
be used for the same purpose. It would be evident to one of
ordinary skill in the art that the use of such a compound may be
optimized for the particular antibody being oxidized. Also, the
molarity of the oxidation and reduction agents as well as other
reaction parameters used in the procedure of the present invention
may be optimized for each antibody.
[0125] Other methods may be used in handling (e.g., stabilizing)
the reactive aldehydes generated by oxidizing agents. For example,
where the reduction step is omitted after oxidation, aldehydes
could be oxidized to corresponding carboxylic acids. This
conversion is a facile reaction and can be accomplished using a
variety of mild oxidants such as, oxygen, hydrogen peroxide,
N-bromosuccinimide, silver oxide, sodium permanganate, and the
like. Still another methodology involves capping of aldehydes to
render them inactive toward any other functionalities that exist
within the antibody. Capping agents include hydroxylamines such as
carbomethoxyamine, or hydrazide derivatives such as acetic
hydrazide and methyl hydrazino-carboxylate. Reaction of either of
these two classes of capping agents results in the formation of
stable adducts. Another method involves conversion of the aldehyde
to a stable amine by reductive alkylation with a primary amine
(e.g., glycine) and sodium cyanoborohydride. All the above-recited
agents are commercially available (e.g., Aldrich Chemical Co.,
Milwaukee, Wis. and Sigma Chemical Co., St. Louis, Mo.) and
procedures for their use are known to those in the art.
[0126] In one embodiment of the present invention, oxidation of the
carbohydrates on NRX 451 using sodium meta periodate (NaIO.sub.4)
followed by reduction with sodium borohydride (NaBH.sub.4)
successfully inactivated complement mediated cytotoxicity (C'MC)
activity on the antibody without affecting antibody dependent
cellular cytotoxicity (ADCC) activity. For example,
N-Acetyl-D-Glucoseamine (GlcNac) is oxidized between carbons 3 and
4 to corresponding aldehyde groups. In this embodiment, methionine
was added to the reaction mixture to protect oxidation sensitive
amino acids in the complement determining region of the antibody.
It has been previously reported in the literature (Awwad et al.,
Cancer Immunol. Immunother. 38:23-30 (1994)) that oxidation with
NaIO.sub.4 does not alter C'MC activity of a monoclonal antibody.
However, surprisingly and advantageously it was discovered as
disclosed herein that the oxidation/reduction procedure of the
present invention altered the C'MC activity without affecting ADCC
activity. The degree of carbohydrate modification was monitored by
lectin binding ELISA. C'MC and ADCC activity was measured using in
vitro .sup.51Cr release cytotoxicity assays well known in the
art.
[0127] The antibody NRX451 produced in CHO cells demonstrated some
toxicity when given to human subjects in a Phase I clinical trial.
It was determined that this particular antibody had ADCC and C'MC
activity from in vitro analyses. Also, this monoclonal antibody was
cross-reactive with antigens located in the gut of humans which may
have been the cause of the toxicity, as well as being reactive at
tumor sites. Therefore, the present invention describes chemical
modification of the carbohydrates which removes C'MC activity and
the toxicity shown in patients. The results of clinical trails from
using the chemically modified NRX451 resulted in no toxic effects
in the patients. Data from seven patients studied with the
oxidized/reduced humanized antibody NRX451 indicate that the
antibody can be safely administered.
[0128] Using the above-described methodology or other humanization
methods referenced herein, humanized sequences may be derived from
other antibodies produced against the cancer antigen bound by
NR-LU-13. Such antibodies are exemplified in U.S. Pat. No.
5,084,396, referenced herein. These antibodies include NR-LU-01,
NR-LU-02, NR-LU-03 and NR-LU-06, and fragments thereof.
[0129] After the humanized variable sequences are identified, the
corresponding DNA sequences are synthesized and used for the
production of humanized antibodies. As discussed supra, these
humanized antibodies will preferably exhibit an antigen-binding
affinity for the antigen bound by NR-LU-13. Generally the binding
affinity will be at least about 10.sup.4 M.sup.-1; preferably at
least about 10.sup.6 M.sup.-1; and more preferably at least about
10.sup.8 M.sup.-1. Assays for determining affinity of antibodies
for antigen are well known in the art and include by way of example
half-optimal binding assays, competition assays, and Scatchard
analysis.
[0130] The humanized antibodies are obtained by expression of the
humanized variable heavy and light chains in an appropriate host
system. Essentially, as used herein an appropriate "host system"
refers to any expression system including host cell tissue or
multicellular organism and vector or vectors containing nucleic
acid sequences which encode the subject humanized antibodies or
fragments thereof, which in combination provide for the expression
of functional antibodies, i.e., the humanized heavy and light
chains associate to produce the characteristic antigen-binding
structure.
[0131] The following references are representative of methods and
host systems suitable for expression of recombinant
immunoglobulins: Weidle et al., Gene 51:21-29 (1987); Dorai et al.,
J. Immunol. 13(12):42324241 (1987); De Waele et al., Eur. J.
Biochem. 176:287-295 (1988); Colcher et al., Cancer Res.
49:1738-1745 (1989); Wood et al., J. Immunol. 145(a):3011-3016
(1990); Bulens et al., Eur. J. Biochem. 195:235-242 (1991);
Beggington et al., Biol. Technology 10:169 (1992); King et al.,
Biochem. J. 281:317-323 (1992); Page et al., Biol. Technology 9:64
(1991); King et al., Biochem. J. 290:723-729 (1993); Chaudary et
al., Nature 339:394-397 (1989); Jones et al., Nature 321:522-525
(1986); Morrison and Oi, Adv. Immunol. 44:65-92 (1988); Benhar et
al., Proc. Natl. Acad. Sci. USA 91:12051-12055 (1994); Singer et
al., J. Immunol. 150:2844-2857 (1993); Cooto et al., Hybridoma
13(3):215-219 (1994); Queen et al., Proc. Natl. Acad Sci. USA
86:10029-10033 (1989) Caron et al., Cancer Res. 32:6761-6767
(1992); Cotoma et al., J. Immunol. Meth. 152:89-109 (1992).
[0132] Expression host systems including vectors, host cells,
tissues and organisms capable of producing functional recombinant
antibodies, and in particular humanized and chimeric antibodies,
are well known in the art. Moreover, host systems suitable for
expression of recombinant antibodies are commercially
available.
[0133] Host cells known to be capable of expressing immunoglobulins
or antibody fragments include, by way of example, mammalian cells
such as Chinese Hamster Ovary (CHO) cells, COS cells, myeloma
cells; bacteria such as Escherichia coli; yeast cells such as
Saccharomyces cerevisiae; insect cells such as Spodoptera
frugiperda; among other host cells. CHO cells are used by many
researchers given their ability to effectively express and secrete
immunoglobulins. Also, insect cells are desirable because they are
capable of high expression of recombinant proteins.
[0134] Expression in insect cells or insects is preferably effected
using a recombinant baculovirus vector capable of expressing
heterologous proteins (herein humanized immunoglobulin sequences)
under the transcriptional control of a baculovirus polyhedrin
promoter. (E.g., U.S. Pat. No. 4,745,051 relating to
baculovirus/insect cell expression system). Polyhedrin is a highly
expressed protein, therefore its promoter provides for efficient
heterologous protein production. The preferred baculovirus is
Autographa californica (ACMNPV). Suitable baculovirus vectors are
commercially available from Invitrogen.
[0135] Essentially, these vectors are modified, e.g., by homologous
recombination to produce recombinant baculovirus containing
humanized NR-LU-13 variable heavy and light sequences operably
linked to the polyhedrin promoter. Insects or insect cells are then
infected with the recombinant baculovirus. Preferably, the
baculovirus will invade the cells of the wall of the insect gut,
migrate to the nucleus of these cells and replicate, resulting in
occlusion bodies which accumulate in infected cells and tissues,
which ultimately lyse the insect. The expressed humanized
antibodies are then recovered from the insect or insect
remains.
[0136] Also, the subject humanized antibodies may be expressed in
transgenic plants or animals. The subject humanized antibody
sequences may be operatively linked to a promoter that is
specifically activated in mammary tissue such as a milk-specific
promoter. Such methods are described in U.S. Pat. No. 4,873,316 and
U.S. Pat. No. 5,304,498.
[0137] Typically, such methods will use a vector containing a
signal peptide which enables secretion of an operably linked
polypeptide sequence, a milk specific promoter such as casein
promoter, an enhancer sequence and humanized immunoglobulin
sequences specific to the NR-LU-10 antigen, e.g., humanized
sequences derived from NR-LU-13.
[0138] This vector will be introduced in a suitable host, e.g.,
bovine, ovine, porcine, rabbit, rat, frog, or mouse embryo,
typically by microinjection under conditions whereby the expression
vector integrates into the genome of the particular embryo. The
resultant transgenic embryo is then transferred to a surrogate
mother, and offspring are screened to identify those transgenics
which contain and express the humanized antibodies in their milk.
Transgenics which contain and/or express the antibody sequences may
be identified, e.g., by Southern blot or Western blot analysis. The
milk produced by such transgenic animals is then collected and
humanized antibodies isolated therefrom. As noted, such methods are
described in detail in U.S. Pat. Nos. 4,873,316 and 5,304,498.
[0139] The subject humanized antibody sequences may also be
expressed in plants, e.g., transgenic plants, plant tissues, plant
seeds and plant cells. Such methods are described, e.g., in U.S.
Pat. No. 5,202,422.
[0140] Expression vectors suitable for transformation of plants,
plant tissues and plant cells are known in the art. In general,
such vectors include the DNA of interest (herein humanized antibody
sequences), a suitable promoter (typically plant, bacterial or
viral promoter) and a selectable marker functional in plants or
plant cells. Methods for introducing desired DNAs into plants and
plant cells include by way of example Agrobacterium-mediated
transformation, protoplast transformation, gene transfer into
pollen, injection into reproductive organs and injection into
immature embryos.
[0141] The transformed embryos or plants are then used to produce
progeny by traditional methods, e.g., cross-fertilization,
backcrossing, etc. Progeny which express the humanized antibody are
then identified, e.g., by Western blotting, cell binding assays,
etc. These progeny are then cultivated and harvested and used for
recovery of antibodies. Such methods are described in detail in
U.S. Pat. No. 5,202,422 and U.S. Pat. No. 5,004,863. Plants useful
for the expression of heterologous proteins are well known and
include, by way of example, tomatoes, tobacco, corn, soybean and
cotton plants. For example, the subject humanized antibodies which
optionally are further mutated to eliminate glycosylation sites may
be expressed in plant cells that do not N-link glycosylate and/or
O-link glycosylate antibodies and antibody fragments.
[0142] Recombinant expression of functional humanized antibodies
may be effected by one of two general methods. In the first method,
the host or host cells are transfected with a single vector which
provides for the expression of both heavy and light variable
sequences fused to appropriate constant regions. In the second
method, host cells are transfected with two vectors, which
respectively provide for expression of either the variable heavy or
light sequence fused to an appropriate constant region.
[0143] The subject humanized sequences derived from NR-LU-13 are
expressed in appropriate host cells under conditions that a
functional antibody fragment (e.g., Fv) or entire antibody is
obtained. Preferably such sequences will be fused to appropriate
human constant sequences, i.e., human heavy or light constant
sequences. Human constant sequences are well known and have been
reported in the literature. For example, Kabat et al., "Sequences
of Proteins of Immunological Interest," 5th Ed., U.S. Dept. Health
& Human Services (1991), contains such sequences. Known human
constant sequences used for the production of humanized antibodies
include, by way of example, human gamma 1, gamma 3 and gamma 4
(human heavy constant sequences) and kappa and lambda (human light
constant sequences). The selected human constant sequence affects
the effector function of the humanized antibody.
[0144] In expressing recombinant antibodies in cell culture, e.g.,
in CHO cells or insect cells, it is preferred to provide for the
secretion of the antibody by the host cell. This entails operably
linking the DNA's encoding the humanized heavy and light chain
sequences to appropriate signal peptide sequences i.e., those which
are recognized and processed by the particular host cell. Signal
peptides are well known and available. Typically, a signal peptide
is selected which is homologous to the host cell or the expressed
protein. For example, the endogenous signal peptides of murine
NR-LU-10 may be used.
[0145] The expression system (e.g., expression vector) will
preferably contain sequences which provide for the selection of
transfectants and expression of humanized antibodies. Therefore,
preferably the vector or vectors will contain genes which allow for
selection, e.g., antibiotic (or drug) resistance genes. Also, the
vector will preferably contain promoters which provide for
efficient expression of the heavy and light chains as well as other
regulatory sequences, e.g., polyadenylation regions, enhancer
regions, etc. The design of systems suitable for expression of
recombinant antibodies is well known and within the purview of the
ordinary skilled artisan, as evidenced by the above-identified
references relating to expression of recombinant
immunoglobulins.
[0146] A well known example of host cells suitable for expression
of immunoglobulins is CHO cells. In expressing immunoglobulins in
CHO cells, or other mammalian cells, it is desirable to include a
sequence which provides for amplification, so as to enhance vector
copy number and enhance antibody yields. Such sequences, includes,
by way of example dominant selectable markers, such as
dihydrofolate reductase (DHFR), neomycin phosphotransferase (NEO),
glutamine synthetase (GS), adenosine deaminase (ADA), among
others.
[0147] Examples of suitable promoters useful for the expression of
proteins in mammalian cells include, by way of example, viral
promoters such as the human cytomegalovous (CMV) early promoter,
SV40 early and late promoters, and the RSV promoter and enhancer.
Also, mammalian promoters may be used, e.g., immunoglobulin
promoters, growth hormone promoters such as bovine growth hormone
promoter, etc. It is preferable to select a strong promoter, i.e.,
one which provides for high levels of transcription.
[0148] Also, the vector will preferably contain polyadenylation
sequences (polyA) sequences which provide for polyadenylation of
mRNA which function to enhance mRNA stability, and thereby enhance
protein production. Examples of suitable poly A sequences include,
by way of example, SV40 poly A sequences, and bovine growth hormone
promoter (BGH) poly A sequence, among others.
[0149] In one embodiment of the present invention, it was elected
to express the subject humanized sequences in CHO (dhfr) cells,
which cells were transfected with a vector which was derived from a
commercially available vector but which was modified.
[0150] Plasmid vector pcDNA3 was obtained from Invitrogen Corp.
(San Diego, Calif.). This vector contains the human cytomegalovirus
(hCMV) promoter and enhancer (Boshart et al., Cell 41:521-530
(1985)) for target gene expression, a neomycin resistance gene for
selection in mammalian cells and a prokaryotic origin of
replication and beta-lactamase gene for propagation and selection
in E. coli. Vector pcDNA3 was modified to incorporate a second hCMV
promoter and enhancer, also a DHFR gene for gene amplification and
additional restriction sites to accommodate the antibody genes.
[0151] In one embodiment, it was elected to fuse the heavy and
light NRX451 humanized variable sequences to human .gamma.1 and K
constant regions. However, other human constant regions may be
substituted therefor. The exact methods which were used are
described in detail in the examples. Moreover, it is expected that
humanized antibodies containing the subject NRX451 humanized heavy
and light sequences may be expressed using other constant regions
or other known host systems which are capable of expressing
functional recombinant antibodies. In particular, it is expected
that the subject humanized antibodies may be expressed in
transgenic plants or animals, or in insects as described above.
[0152] After the humanized antibodies are expressed they are
purified and then assayed for their ability to bind antigen.
Methods for purifying recombinant immunoglobulins are well known
and are described in the references incorporated herein relating to
production of recombinant antibodies. For example, a well known
method of purifying antibodies involves protein A purification
because of the propensity of protein A to bind the Fc region of
antibodies.
[0153] The ability of the subject humanized antibodies to bind
antigen is determined by any of numerous known methods for assaying
antigen-antibody affinity. As discussed, the parent murine antibody
NR-LU-13 binds an approximately 40 kilodalton glycoprotein
expressed on numerous carcinomas. This antigen has been
characterized in Varki et al., Cancer Res. 44:681-687 (1984); Okabe
et al., Cancer Res. 44:5273-5278 (1989), referenced herein. Thus,
it is routine to test the ability of humanized antibodies produced
according to the invention in binding the NR-LU-13 antigen.
Moreover, methods for evaluating the ability of antibodies to bind
to epitopes of this antigen are known.
[0154] In one aspect of the invention, the humanized antibodies (or
fragments thereof) of the present invention would be useful tools
in methods for medical diagnostic and therapeutic purposes. A
diagnostic method or therapeutic method is described for detecting
the presence or absence of a target site within a mammalian host.
When determining the criteria for employing humanized antibodies or
antibody conjugates for in vivo administration for therapeutic
purposes, it is desirable that the general attainable targeting
ratio is high and that the absolute dose of therapeutic agent
delivered to the tumor is sufficient to elicit a significant tumor
response. Methods for utilizing the humanized antibodies described
in the present invention can be found, for example, in U.S. Pat.
Nos. 4,877,868, 5,175,343, 5,213,787, 5,120,526, and 5,202,169.
[0155] In a preferred embodiment of the invention, an antibody
conjugate or composition of the present invention is used in
pretargeting methods. Essentially, such pretargeting methods are
characterized by an improved targeting ratio or increased absolute
dose to the target cell sites in comparison to conventional cancer
diagnosis or therapy. A general description of pretargeting methods
may be found in U.S. Pat. Nos. 4,863,713, 5,578,287, and 5,630,996.
Moreover, typical pretargeting approaches are summarized below.
[0156] Pretargeting methods are of two general types: three-step
pretargeting methods and two-step pretargeting methods.
[0157] The three-step pretargeting protocol features administration
of an targeting moiety-ligand conjugate, which is allowed to
localize at a target site and to dilute in the circulation. This is
followed by administration of an anti-ligand which binds to the
targeting moiety-ligand conjugate and clears unbound targeting
moiety-ligand conjugate from the blood, as well as binds to
targeting moiety-ligand conjugate at the target site. Thus, the
anti-ligand fulfills a dual function by clearing targeting
moiety-ligand conjugate not bound to the target site as well as
attaches to the target site to form a targeting
moiety-ligand:anti-ligand complex. Finally, a diagnostic or
therapeutic active agent-ligand conjugate that exhibits rapid whole
body clearance is administered.
[0158] When the active agent-ligand conjugate in circulation comes
into close proximity to the targeting moiety-ligand:anti-ligand
complex bound to the target site, the anti-ligand portion of the
complex binds to the ligand portion of the circulating active
agent-ligand conjugate, thus producing a targeting moiety-ligand:
anti-ligand ligand-active agent "sandwich" at the target site.
Furthermore, because the unbound diagnostic or therapeutic active
agent is attached to a rapidly clearing ligand (rather than a
slowly clearing targeting moiety, such as antibody, antibody
fragment), this technique provides decreased non-target exposure to
the active agent.
[0159] Alternatively, the two-step pretargeting methods eliminate
the step of administering the above identified anti-ligand. These
"two-step" procedures feature targeting moiety-ligand or targeting
moiety-anti-ligand administration, followed by the administration
of active agent conjugated to the opposite member of the
ligand/anti-ligand pair.
[0160] As an optional step in the two-step pretargeting methods of
the present invention, ligand or anti-ligand, designed specifically
to provide a clearance function, is administered to facilitate the
clearance of circulating targeting moiety-ligand or targeting
moiety-anti-ligand. Thus, in the two-step pretargeting approach,
the clearing agent does not become bound to the target cell
population, either directly or through the previously administered
target cell bound targeting moiety-anti-ligand or targeting
moiety-ligand conjugate.
[0161] A targeting moiety in the pretargeting methods of the
present invention has the functional property that it binds to a
defined target cell population, such as tumor cells. Preferred
targeting moieties useful in this regard are antibodies (polyclonal
or monoclonal), such as human monoclonal antibodies or "humanized"
murine or chimeric antibodies are also useful as targeting moieties
in accordance with the present invention. Some examples of
humanized antibodies include those that are CHO produced, produced
in hosts such as plant (for example corn, soybean, tobacco, and the
like), insect, mammalian, yeast, and bacterial. The humanized
antibodies may be those that bind to the antigen bound by antibody
NR-LU-13. Preferably, the humanized antibody may not possess
N-linked glycosylation or its N-linked glycosylation has been
modified post expression to reduce immunogenicity or toxicity.
[0162] The subject humanized antibodies may potentially possess
antitumor activity even absent attachment to other diagnostic or
therapeutic active agents, because of the presence of human
constant sequences which may provide for human effector functions.
However, while antibody (therapeutic or diagnostic agent)
conjugates have known application in therapy and diagnostics alone,
in the preferred embodiments of the present invention, humanized
antibodies will be used in the pretargeting methods as prototypical
targeting moieties.
[0163] Ligand/Anti-ligand pairs suitable for use in the present
invention include biotin/avidin or streptavidin, haptens and
epitopes/antibody, fragments or analogs thereof, including
mimetics, lectins/carbohydrates, zinc finger proteins/dsDNA
fragments, enzyme inhibitors/enzymes; and analogs and derivatives
thereof. Preferred ligands and anti-ligands bind to each other with
an affinity of at least about K.sub.A.gtoreq.10.sup.9M- .sup.-1 or
K.sub.D.ltoreq.10.sup.-9M. Biotin/avidin or streptavidin is a
preferred ligand/anti-ligand pair.
[0164] In general such pretargeting methods will preferably include
the administration of a anti-ligand that provides a clearance
function. The clearance is probably attributable to cross-linking
and/or aggregation of conjugates that are circulating in the blood,
which leads to complex/aggregate clearance by the recipient's RES
(reticuloendothelial system). In one embodiment of the present
invention, the anti-ligand clearance of this type is preferably
accomplished with a multivalent molecule. However, a univalent
molecule of sufficient size to be cleared by the RES on its own
could also be employed.
[0165] Alternatively, receptor-based clearance mechanisms, e.g.,
Ashwell receptor or other receptors, may be exploited by addition
of hexose residues, such as galactose or mannose residues, to
provide for clearance of the anti-ligand, anti-ligand conjugate or
humanized antibody via the liver. Such clearance mechanisms are
less dependent upon the valency of the clearing agent than the RES
complex/aggregate clearance mechanisms described above.
[0166] For example, if the targeting moiety-ligand or targeting
moiety-anti-ligand has been derivatized to provide for clearance
(i.e., addition of a hexose residue) a clearing agent should not be
necessary. Preferred clearing agents are disclosed in U.S. Pat.
Nos. 5,624,896 and 5,616,690; as well as PCT Application
Publication Number WO 95/15978.
[0167] Diagnostic and therapeutic active agents of the present
invention include anti-tumor agents such as, radionuclides,
cytokines, drugs and toxins.
[0168] Radionuclides useful within the present invention include
gamma-emitters, positron-emitters, Auger electron-emitters, X-ray
emitters and fluorescence-emitters, with beta- or alpha-emitters
preferred for therapeutic use. Radionuclides are well-known in the
art and include .sup.123I, .sup.125I, .sup.130 I, .sup.131I,
.sup.133I, .sup.135I, .sup.47Sc, .sup.72As, .sup.72Se, .sup.90Y,
.sup.88Y, .sup.97Ru, .sup.100Pd, .sup.101mRh, .sup.119Sb,
.sup.128Ba, .sup.197Hg, .sup.211At, .sup.212 Bi, .sup.153Sm,
.sup.169Eu, .sup.212Pb, .sup.109Pd, .sup.111In, .sup.67Ga,
.sup.68Ga, .sup.64Cu, .sup.67Cu, .sup.75Br, .sup.76Br, .sup.77Br,
.sup.99mTc, .sup.11C, .sup.13N, .sup.15O, .sup.166Ho, and .sup.18F.
Preferred therapeutic radionuclides include .sup.188Re, .sup.186Re,
.sup.203Pb, .sup.212Pb, .sup.212Bi, .sup.109Pd, .sup.64Cu,
.sup.67Cu, .sup.90Y, .sup.125I, .sup.131I, .sup.77Br, .sup.211At,
.sup.97Ru, .sup.105Rh, .sup.198Au, .sup.166Ho, and .sup.199Ag or
.sup.177Lu.
[0169] Other anti-tumor agents, e.g., agents active against
proliferating cells, are useful in the present invention. Exemplary
anti-tumor agents include cytokines, such as IL-2, IL-12,
interferon .alpha., .beta. or .gamma., tumor necrosis factor or the
like, lectin inflammatory response promoters (selectins), such as
L-selectin, E-selectin, P-selectin or the like, and like
molecules.
[0170] Drugs suitable for use herein include conventional
chemo-therapeutics, such as vinblastine, doxorubicin, bleomycin,
methotrexate, 5-fluorouracil, 6-thioguanine, cytarabine,
cyclophosphamide and cis-platinum, as well as other conventional
chemotherapeutics as described in Cancer: Principles and Practice
of Oncology, 2d ed., V. T. DeVita, Jr., S. Hellman, S. A.
Rosenberg, J. B. Lippincott Co., Philadelphia, Pa., 1985, Chapter
14. A preferred drug within the present invention is a
trichothecene. Other preferred drugs suitable for use herein as a
diagnostic or therapeutic active agent in the practice of the
present invention include experimental drugs as described in NCI
Investigational Drugs, Pharmaceutical Data 1987, NIH Publication
No. 88-2141, Revised November 1987.
[0171] Several of the potent toxins useful within the present
invention consist of an A and a B chain. The A chain is the
cytotoxic portion and the B chain is the receptor-binding portion
of the intact toxin molecule (holotoxin). Preferred toxins in this
regard include holotoxins, such as abrin, ricin, modeccin,
Pseudomonas exotoxin A, Diphtheria toxin, pertussis toxin and Shiga
toxin; and A chain or "A chain-like" molecules.
[0172] In a preferred embodiment, the targeting moiety will
comprise a humanized antibody or a humanized antibody conjugate of
the present invention, the ligand/anti-ligand binding pair will be
biotin/avidin (e.g., streptavidin), and the active agent will be a
radionuclide in pretargeting methods. The particularly preferred
pretargeting method is the two-step method and the use of a
clearing agent. The preferred humanized antibody targeting moiety
is an antibody which specifically binds to the antigen bound by
NR-LU-13 and the humanized antibody does not possess glycosylation
or its glycosylation has been chemically modified.
[0173] One skilled in the art, based on the teachings in this
application and the applications referenced herein, can readily
determine an effective diagnostic or therapeutic effective dosage
and treatment protocol. This will depend upon factors such as the
particular selected therapeutic or diagnostic agent, route of
delivery, the type of target site(s), affinity of the targeting
moiety for target site of interest, any cross-reactivity of the
targeting moiety with normal tissue, condition of the patient,
whether the treatment is effected alone or in combination with
other treatments, among other factors. A therapeutic effective
dosage is one that treats a patient by extending the survival time
of the patient. Preferably, the therapy further treats the patient
by arresting the tumor growth and most preferably, the therapy
further eradicates the tumor.
[0174] For example, in the case of humanized antibody-avidin or
streptavidin conjugates in pretargeting strategies, a suitable
dosage will range from about 10 to about 2500 mg, more preferably
from about 50 to 1500 mg, and most preferably from about 100 to 800
mg. The dosage of the ligand-active agent conjugate, for example, a
radionuclide-biotin containing conjugate, will generally range from
about 0.001 to about 10 mg and more preferably from about 0.1 to 2
mg. For example, a suitable dosage of ligand-active agent,
Y-90-DOTA-biotin, ranges from about 10 to 300 mCi in 0.1 to 2.0 mg.
Also, In.sup.111 may be used at 1-10 mCi alone or in combination
with Y.sup.90. The radioactivity ranges are dependent upon the
isotope employed.
[0175] In general such pretargeting methods will include the
administration of a clearing agent. The dosage of the clearing
agent will be an amount which is sufficient to substantially clear
the previously administered conjugate from the circulation, i.e.,
at least about 50%, more preferably at least about 90%, and most
preferably approaching or at 100%. In general, this will be
administered several days after administration of the humanized
antibody-streptavidin conjugate, preferably about 1 to 5 days
after, more preferably at least about 1 to 2 days after. Generally,
the determination of when to administer the clearing agent depends
on the target uptake and endogenous clearance of targeting moiety
conjugate. Particularly preferred clearing agents are those which
provide for Ashwell receptor mediated clearance, such as
galactosylated proteins, e.g., galactosylated biotinylated human
serum albumin (HSA) and small molecule clearing agents containing
galactose and biotin. In the case of HSA based clearing agents, a
typical dosage of the clearing agent will range from about 100 to
1000 mg, and more preferably about 200-500 mg.
[0176] If a clearing agent is administered, the ligand-active agent
conjugate is preferably administered about 2 to 12 hours after.
[0177] The conjugates may be administered by known methods of
administration. Known methods of administration include, by way of
example, intraperitoneal injection, intravenous injection,
intramuscular injection, intranasal administration, among others.
Intravenous administration is generally preferred.
[0178] The present invention is further described through
presentation of the following examples. These examples are offered
by way of illustration and not by way of limitation.
EXAMPLES
Example 1
Humanized Sequences of NRX451
[0179] Essentially, the cDNA sequence encoding the variable regions
of NR-LU-13 antibody (hybridoma producing the antibody was
deposited with American Type Culture Collection" as ATCC Accession
No. SD3273, converted to ATCC Accession No. ______) were cloned and
sequenced by known methods. The cDNA sequences of the cloned light
and heavy sequence of NR-LU-13 are contained in FIG. 2. Using these
sequences, the amino acid sequence of the Fv region of NR-LU-13
which includes the entire variable light and variable heavy regions
was elucidated.
[0180] A. Humanization Protocol
[0181] Briefly, the humanization protocol comprises a cycle of
sequence analysis and molecular modeling, as outlined in FIG. 1.
Sequence Human Ab data was obtained from the immunoglobulin
sequence database (E. A. Kabat et al., Sequences of Proteins of
Immunological Interest, US Department of Health and Human Services,
Fifth Edition, 1991), and structural data was obtained from the
Brookhaven databank (F. C. Bernstein et al., J. Molec. Biol.
112:535-42, (1977)).
[0182] The antibody heavy and light chain sequences of NR-LU-13
were compared to a database of human sequence pairs (immunoglobulin
light and heavy chains originating from the same clone). Based on
this comparison, the most identical human sequence was chosen to
supply the framework for the grafted antibody. The sequences of the
murine complementarity determining regions (CDRs) of NR-LU-13 were
then transferred to the selected human framework. This process
provided the "initial" humanized Fv sequence.
[0183] This initial humanized sequence was then refined by testing
sequences in three-dimensional models. A model was constructed of
the original murine sequence and of the initial putative humanized
sequence. Equivalent residue positions in the murine model and the
humanized model were compared. Residues in the humanized model
which were predicted to perturb the structure of the CDRs were
"back mutated", i.e., murine framework residues were restored.
Models were then constructed using modified sequences, and were
again compared to the murine Fv model. This cycle of modeling a
"back mutation" and comparing it to the murine model was continued,
until the conformation of the CDRs in the humanized model closely
matched the CDR conformations in the parent murine model. The
specific stepwise process which resulted in the subject humanized
heavy and light sequences derived from NR-LU-13 is contained in
FIG. 1.
[0184] B. Sequence Analysis
[0185] The variable sequences of the NR-LU-13 antibody were
compared to 58 pairs of K-heavy chain pairs which are known CDR to
be expressed together as functional antibodies. The most identical
sequence pair was found to be that from the human antibody clone
R3.5H5G'CL (A. Manheimer-Lory et al., J. Exp. Med. 174:1639-52,
(1991)). The NR-LU-13 antibody contains a .kappa.V/hIIc chain pair.
The R3.5H5G'CL antibody is a .kappa.I/hI chain pair. Therefore,
both light and heavy chains were selected from the most homologous
human classes.
[0186] The NR-LU-13 light and heavy chain sequences were compared
with a database of immunoglobulin sequences, in order to identify
abnormal sequence positions. The relative frequency for each
residue position showed that the heavy chain framework region 3
(HFR3) was the most abnormal region within the NR-LU-13 antibody
sequence, and in particular, position Cys 181 was abnormal. In most
of the sequences examined (90%), this position was occupied by a
Tyr residue, forming an integral part of the
V.sub.L/V.sub.H-interface. Residue frequencies within selected
positions are depicted in FIG. 7a-7f.
[0187] C. Modeling Construction
[0188] i. Modeling Protocol
[0189] Models were constructed using the combined algorithm
previously described by Martin et al., Proc. Natl. Acad. Sci., USA
86:9268-72 (1989) and Pedersen et al., Immunomethods 1:126-36
(1992).
[0190] Whenever possible, CDRs were modeled from canonical loops
(Chothia et al., Nature 342:877-83 (1989)). Remaining loops were
modeled using a combination of database search and ab initio
methods, using the conformational search program CONGEN of R. E.
Bruccoleri and M. Karplus, Biopolymers 26:137-68 (1987). In the
case of NRX451 CDRs, L1, L2, L3, H1 and H2 were built from
canonical loops. CDR H3 was constructed using a database search at
the base of the CDR and ab initio fragment generation for the
central part of the loop to attempt to saturate conformational
space. CDR H3 was built onto a combining site containing only the
backbone atoms of the canonical loops, and all atoms from framework
residues. All CDR sidechains were reconstructed using CONGEN.
[0191] The models were energy minimized. In the minimization, the
backbone of the framework was fixed, although the framework
sidechains and the CDRs were allowed to move.
[0192] ii. Outline of "Back Mutations"
[0193] Initial "back mutations" (replacement of murine framework
residues) from CDR-grafted NRX451 (the "initial" nominal sequence)
were identified where the canonical classification of the CDRs was
changed by the change in framework sequence. Only one such position
was identified--Arg 193 (R3.5H5G'CL)/Ala 193 (NRX451). This
position is a canonical determinant for CDR H2 (incorporated in
graft 2 and thereafter). Any residue position within 5 A of a CDR
residue which had altered residue type in the R3.5H5G'CL framework
sequence was "back mutated" if sidechain or backbone conformation
was significantly altered between the NRX451 and R3.5H5G'CL model.
Residue positions Ser 55, Thr 141, Tyr 181, Ala 182, Met 191, Ser
198 and Ala 218 were "back mutated" in this way (incorporated in
graft 4 and thereafter).
[0194] Finally, all residue differences between the R3.5H5G'CL
framework and the NRX451 framework were visually inspected. Two
additional residue positions close to the CDRs were identified (Thr
75 and Phe 77) and "back mutated".
[0195] iii. Humanized Model
[0196] In the final NRX451/R3.5H5G'CL models, the residues of the
light and heavy chain variable regions that differ between NR-LU-13
and NRX451-humanized sequences are mainly at the base of the Fv
domain towards the C portion of the Fab fragment (see FIG. 5).
Models were analyzed using ProCheck (v.2.1) (R. A. Laskowski et
al., Instruction Manual, "Procheck v.2.1: Programs to check the
stereochemical quality of protein studies", Oxford Molecular Ltd.
(1993)). FIG. 6 contains molecular models of the NR-LU-13 and the
first humanized Fv derived therefrom NRX451.
[0197] 4. Humanized Sequence
[0198] The humanized light and heavy sequences are respectively
derived from NR-LU-13, referred to as NRX451 heavy and light
chains, are presented in FIGS. 3 and 4. The variable sequences of
NR-LU-13 and humanized NRX451 are aligned in FIG. 5. The chains are
numbered separately.
[0199] Thus, based on these sequences, DNAs encoding such humanized
variable regions are synthesized.
Example 2
General Methodology for Construction of Humanized Variable
Regions
[0200] Variable Region Synthesis
[0201] The humanized variable regions were synthesized as a series
of overlapping oligonucleotides. Each complete variable region was
400 to 450 bases in length.
[0202] Approximately 16 oligonucleotides (oligos) were synthesized
to cover both heavy and light chains. Oligos ranged in size from 40
to 88 bases. The annealed gene fragments were amplified by PCR and
cloned. Each variable region included restriction sites to
facilitate cloning, a leader sequence to direct secretion from
eukaryotic cells, and a splice donor site to allow precise joining
with the constant region.
[0203] Eukaryotic Expression Vector
[0204] A vector was constructed which was able to stably transfect
eukaryotic cells and direct high level expression of the antibody
chains. A commercially available vector containing the CMV promoter
and enhancer and the neomycin resistance gene, was modified to
contain a second CMV promoter and enhancer, immunoglobulin constant
regions and a DHFR gene.
[0205] The vector pCDNA3 was purchased from Invitrogen Corp. (San
Diego, Calif.). This vector is depicted in FIG. 8. The neomycin
resistance gene of pCDNA3 allows selection of G418 resistant
transfectants in eukaryotic cells. This vector contains prokaryotic
elements which enable selection and propagation in E. coli.
[0206] A second CMV promoter and enhancer region were added using
PCR to copy the existing CMV elements followed by insertion into
pCDNA3. Specifically, oligonucleotides NX62
(CCTGACGAATTCGTTGACATTGATTATTGAC) and NX63
(CCTGACGCGGCCGCTTCGATAAGCCAGTAAGC) were synthesized to anneal to
the 5' and 3' ends of CMV, respectively. NX62 and NX63 were
synthesized to introduce EcoRI and NotI restriction sites,
respectively. PCR was performed by standard procedures and the
resulting fragment was restriction digested with EcoRI and NotI.
Plasmid pCDNA3 was likewise digested and the fragment was inserted
by standard procedures well known in the art. The resulting plasmid
was designated pCMV4.
[0207] The kappa constant region and preceding intron were isolated
from human peripheral blood lymphocyte DNA by PCR. Oligonucleotides
NX64 (GTTCGGCTCGAGCACAGCTAGCAATCTGGGATAAGCATGCTG) and NX65
(GTTACGGGGCCCCTAACACTCTCCCCTGTTGAAG) were synthesized to anneal to
the intron preceding the constant region exon and the 3' end of the
constant region, respectively. NX64 contained both XhoI and NheI
restriction sites. NX65 contained an ApaI restriction site
following the constant region stop codon. PCR was performed by
standard procedure. The fragment was digested with XhoI and ApaI
and inserted into pCMV4 by standard procedures. The resulting
plasmid was designated pC4-CK3.
[0208] The human gamma1 constant region, including the preceding
intron and succeeding polyadenylation site, was isolated from human
plasmacytoma (MC/CAR, ATCC CRL 8083) DNA by PCR. Oligonucleotides
NX66 (GTACGCGGATCCCAGACACTGGACGCTG) and NX67
(CATTCGGAATTCGAACCATCACAGTCTCGC) were synthesized to anneal to the
preceding intron and polyadenylation site, respectively. NX66
contained a BamHI site. NX67 contained an EcoRI site following the
polyadenylation site. PCR was performed by standard procedure. The
fragment was inserted into pCDNA3 by standard procedures. The
resulting plasmid was designated pGamma1-4.
[0209] The humanized variable regions of the heavy and light chains
were synthesized in similar manner. A series of eight overlapping
oligonucleotides were synthesized for each variable region plus
native murine leader sequence. The internal 6 oligonucleotides
ranged from 79 to 88 bases in length with overlaps of 19 to 26 base
pairs. The outside oligonucleotides were 40 to 44 bases in length
including restriction sites (Vh; HindIII and BamHI, Vk; NotI and
NheI). The 3' outside oligonucleotides also included intron splice
donor sites. The PCRs contained 1 pmol each of the internal
oligonucleotides and 30 pmol each of the outside primers. The
temperature profile of the reaction was as follows: 1 cycle of 5
min at 94.degree. C., and 1 cycle of 5 min at 72.degree. C. The
resulting PCR products were restriction digested with the
appropriate enzymes and inserted into pC4-CK3 (Vk) or pGamma1-4
(Vh) to give rise to plasmids pVKE and p4gammaB respectively. Both
plasmids were restriction endonuclease cleaved with BglII and
EcoRI. A 6 kilobase (kb) fragment from pVKE and a 3.2 kb fragment
from p4gammaB were joined to form pWE1A2. Plasmid pWE1A2 contained
the complete humanized heavy and light chains in essentially
genomic (intron-containing) form. Antibody expression from COS and
CHO cells transfected with pWE1A2 was very poor.
[0210] The plasmid was modified to contain the antibody genes in
cDNA form. An additional BGH polyadenylation region was added to
follow the heavy chain cDNA. The DHFR gene and control elements
were added.
[0211] The BGH polyadenylation region was copied from pCNA3 using
PCR and inserted into pWE1A2 as a BamHI/EcoRI fragment. The
resulting plasmid lacked the gamma constant region, but could now
accommodate the cDNA gamma chain as an XbaI/BamHI fragment.
[0212] RNA was extracted from pWE1A2 transfected CHO (dhfr) cells
with a commercially available RNA extraction kit (Glass Max, Gibco
BRL). Reverse transcriptase-PCR (RT-PCR) was performed as per
manufacturer's instructions (Perkin Elmer Cetus). In this
procedure, NX109 (GCTGACGAATTCTCATTTACCCGGAGACAGGGAG), which
anneals to the 3' terminus of the gamma chain constant region was
used to specifically prime a reverse transcriptase reaction in
which gamma chain messenger RNA was copied into cDNA. NX109 and
NX110 (CCGTCTATTACTGTFCTAGAGAGGTC), which anneals within the heavy
chain variable region, were used to amplify the cDNA generated in
the reverse transcription reaction. The PCR primers contained BamHI
(NX109) and XbaI (NX110) restriction sites to facilitate cloning.
The restricted PCR product was inserted into the plasmid to form
p1A2.C1.
[0213] A DHFR gene transcription unit was added to the plasmid to
allow gene amplification in eukaryotic cells. The DHFR coding
sequence was preceded by an SV40 promoter and followed by an SV40
polyadenylation signal. The DNA encoding DHFR and control elements
was generated by PCR and inserted into p1A2.C1 to form plasmid
p61.1.
[0214] The light chain genes were switched to cDNA by the identical
process used for the heavy chain. Oligonucleotide NX65
(GTTACGGGGCCCCTAACACTCTCCCCTGTTGAAG), which anneals to the 3' end
of the kappa constant region, was used for reverse transcription
and then NX65 and NXK1 (CAGCGTGCGGCCGCACCATGGACATCAGGGCTCCTGCTCAG)
were used for PCR amplification of the entire kappa chain gene. The
PCR product was inserted into p61.1 to form pNRX451. This plasmid
is depicted in FIG. 9.
Example 3
Expression and Isolation of Final Clone NRX451 C2-451C4-100 nM HP-2
.mu.M HP-161E12-50 .mu.M-12G4-3E7
[0215] CHO (dhfr-) (ATCC CRL 9096) cells were transfected in 6-well
plates using Lipofectace.TM. (Gibco) with linearized pNRX451
plasmid. Transfected cells were allowed to recover in Iscove's
Modified Dulbecco's Medium (IMDM) (Gibco) containing 10% dialyzed
Fetal Bovine Serum (dFBS) (Sigma) and 1.times. Hypoxanthine and
Thymidine (Gibco). After 2 days of recovery, transfected cells were
initially selected in IMDM containing 10% of dFBS and 800 .mu.g/mL
Geneticin.RTM. (Gibco) but lacking hypoxanthine and thymidine.
[0216] Surviving cells were subjected to gene amplification at 1000
cells/well in 96-well plates in IMDM containing 10% dFBS and 100 nM
Methotrexate (Sigma). Fourteen day supernatants were tested in
gamma/kappa ELISA for antibody production. The highest producing
wells were selected and pooled and designated C2-451C4-100 nM
HP.
[0217] These cells were then amplified at 100 cells/well in 96-well
plates in IMDM containing 10% dFBS and 2 .mu.M Methotrexate.
Fourteen day supernates were tested in gamma/kappa ELISA. The
highest producing wells were selected and pooled and designated
C2-451C4-100 nM HP-2 .mu.M HP.
[0218] This pool was cloned at 1 cell/well in 96-well plates in
IMDM containing 10% dFBS and 2 .mu.M Methotrexate.
Fourteen-twenty-one day supernates were tested in gamma/kappa
ELISA. The highest producing clones were maintained in IMDM
containing 10% dFBS and 2 .mu.M Methotrexate and passed into IMDM
containing 10% dFBS and 10, 50 or 200 .mu.M Methotrexate.
[0219] The highest producing clone was selected (C2-451C.sub.4-100
nM HP-2 .mu.M HP-161E12-50 .mu.M) and subjected to 2 rounds of
limiting dilution cloning in 96-well plates in IMDM containing 10%
dFBS and 50 .mu.M Methotrexate before cell banking. The final clone
was designated C2-451C.sub.4-100 nM HP-2 .mu.M HP-161E12-50
.mu.M-12G4-3E7 (hybridoma producing the antibody was deposited with
American Type Culture Collection as ATCC Accession No. SD3273,
converted to ATCC Accession No. ______).
Example 4
Immunoreactivity of NRX451
[0220] The humanized NRX451 antibody was shown to exhibit
immunoreactivity as determined by competitive immunoreactivity
ELISA using the murine NRLU-10 as a comparison. These results are
shown in FIG. 11. These results demonstrate that the humanized
antibody exhibited greater than 65% of the immunoreactivity of
NRLU-10.
[0221] The protocol for the competitive immunoreactivity ELISA is
set forth below.
[0222] Competitive Immunoreactivity ELISA
[0223] Immunoreactivity is assessed in a competitive binding ELISA
where standard murine NRLU-10 and test antibodies are allowed to
compete with peroxidase-labeled murine NRLU-10 for binding to an
NP40 (Sigma) extract of the KSA antigen-positive LS174 cell
line.
[0224] Plate preparation: Coat 96-well plate with 100 .mu.L/well
optimized dilution of NP40 extract of LS174. Incubate to dryness
overnight at 37.degree. C.
[0225] Reagent Prep:
[0226] Diluent: PBS+5% Chicken serum (Sigma)+0.5% Tween 20 (Sigma)
(PCT)
[0227] Standard and test antibodies:
[0228] Dilute standard and test antibodies to 12 .mu.g/mL in
PCT.
[0229] Perform 9 log2 dilutions in PCT.
[0230] Peroxidase-NRLU-10:
[0231] Dilute to optimized concentration in PCT.
[0232] Add 100 .mu.L Peroxidase-NRLU-10 to 500 .mu.L of each
dilution of standard and test antibodies for final concentrations
of 10 .mu.g/mL (66.67 nM) to 0.2 .mu.g/mL.
[0233] Assay: Wash plate in PBS+0.5% Tween 20 using automated plate
washer.
[0234] Add 100 .mu.L each dilution in duplicate to plate.
[0235] Incubate at room temperature for 60 minutes.
[0236] Wash as above.
[0237] Add 100 .mu.L Substrate buffer to each well.
[0238] Incubate at room temperature for 30 minutes.
[0239] Read on automated plate reader.
[0240] Calculations: Following a log-logit transformation of the
data where curves are fit to the same slope, the concentration of
the unlabeled competitor antibody required for 50% inhibition (k)
is determined.
[0241] k standard/k test.times.100=% Immunoreactivity.
Example 5
[0242] Some variability in tissue uptake of radiolabeled antibodies
from study to study is observed. The best method for in vivo
comparison of two different antibody constructs involves labeling
each with different isotopes (e.g., I-131 and I-125) and
co-injecting an equimolar mixture of the antibodies into tumored
nude mice. Experimentally, this removes a degree of inter-animal
variability from the biodistribution data. This was done for
comparison of CHO-produced humanized NR-LU-13 ("NRX451") and
hybridoma-produced murine NR-LU-10. As these are two fundamentally
different proteins, some differences in absolute pharmacokinetics
were expected, and were observed. However, when correcting for the
differing blood-pool concentration present in each tissue, these
two proteins were found to exhibit analogous profiles of
biodistribution at all timepoints. This may be appreciated from
FIG. 12. The value shown in FIG. 12 are the ratios defined by
taking (% injected dose/gram of tissue) divided by the (% injected
dose/gram of blood) for each antibody construct. Tissues sampled
were blood, tail (the site of injection), skin, muscle, bone, lung,
liver, spleen, stomach, kidney, intestines, and tumor (subcutaneous
SW-1222 colon carcinoma xenografts). With one exception, the
average values of all tissues remained below 1.0 for all major
organs and tissues, indicative of little specific retention of
radiolabeled antibody beyond the blood-born contribution of
radioactivity. The exception is tumor, where both constructs show
consistent increasing, specific localization over time of nearly
identical magnitude. The data support the in vitro assessment that
full immunoreactivity is retained by the humanized construct, and
that little perturbation in the overall non-target tissue
biodistribution has been imparted by the humanization process.
[0243] Despite the fact that neither the CHO nor the larval NRX451
has been produced in GMP purity, a preliminary dual label co-inject
study was performed in the same xenograft model as above. The
results of biodistributions performed at 4, 24, 48, and 168 hours
after co-injection of the proteins showed they possess remarkably
similar overall localization patterns. Also by flow cytometry there
was no detectable binding of any of NR-LU-10 to red blood cells,
granulocytes, monocytes, or lymphocytes.
[0244] Pharmacokinetic and biodistribution analyses of each form of
NRX451 were carried out in nude mice bearing a human colon
carcinoma xenograft (SW1222). FIG. 13 shows the biodistribution of
NRX451 produced in CHO cells, tobacco plant cells, and insect
larvae. The antibody in each instance was radiolabeled with
.sup.125I. Four mice per group were injected by the tail vein with
either 50 or 100 .mu.g of antibody. Distribution of the
radioactivity in the blood, tail, lung, liver, spleen, stomach,
kidney, intestine and tumor was determined at 4, 24, 48, 120, and
168 hours.
[0245] The overall pattern shows a consistent declining
concentration of antibody in the blood and all soft tissues at
successive time points. In vivo immunoreactivity is demonstrated by
the positive ratio of tumor to blood counts at all time points from
24-168 hours and by the increase in tumor counts over the 0-48 hour
period. No significant non-target retention of radiolabel was
evident beyond the blood pool activity in each organ.
Example 6
Chemical Modification of NRX 451
[0246] The oxidation/reduction method used for the chemical
modification of NRX451, produced according to Examples 1 through 3
is described. In this example, 50 mg of CHO produced NRX451 was
diluted to 5.0 mg/ml with phosphate buffered saline (PBS) in a 50
ml Erlenmeyer flask. The solution was stirred constantly throughout
the procedure at 150 rpm using a magnetic stir plate. Added to the
antibody solution was 1.0 ml (10% v/v) of 0.4 M sodium phosphate,
pH 7.0, making the pH of the final solution 7.0. Methionine (8.2
mg) was then added to the reaction mixture such that the final
concentration is 5.0 mM. For the oxidation step, 117.6 mg of sodium
meta periodate (NaIO.sub.4) was added to the stirred antibody
solution to achieve a final concentration of 50 mM. The oxidation
reaction-was allowed to stir for 20 minutes at 25.degree. C. and
then the reaction mixture was quenched with 310 .mu.l of ethylene
glycol. After an additional 20 minutes, the reaction mixture was
diluted to 2.0 mg/ml with cold 0.5 M sodium borate at pH 9.0 (25%
of final volume) and 7.44 ml of PBS.
[0247] For the reduction step, the above solution was cooled to
4.degree. C. in an ice bath followed by an addition of 94.6 mg of
sodium borohydride (NaBH.sub.4) to obtain a final concentration of
100 mM. After stirring at 4.degree. C. for 3 hours, the mixture was
treated with sodium tetrathionate and the oxidized/reduced antibody
solution was then buffer exchanged into PBS, a suitable storage
buffer.
[0248] The lectin binding profiles of the oxidized/reduced CHO
produced NRX451 and non-oxidized/reduced CHO produced NRX451 were
compared to determine the extent of carbohydrate modification.
There is a noticeable change in the lectin binding profiles of
NRX451 and oxidized/reduced NRX451 as can be seen in FIG. 14. The
terminally linked sialic acid alpha (2-) to galactose or
N-acetylgalactoseamine and a galactose-B (1-40-N acetylglucosamine
present on the non-oxidized NRX451 have been altered. Both of these
carbohydrates are susceptible to oxidation by periodate and appear
to be perturbed.
[0249] The C'MC and ADCC assays were performed on two different
cell lines MCF-7, ATCC No. HTB 22 and SW1222 which express the
antigen reactive with NRX451. FIGS. 15a and b illustrate that there
is very little C'MC activity associated with the oxidized/reduced
NRX451. However, untreated NRX451 has high levels of C'MC activity.
FIG. 15c shows two controls of NRX451, one which has been
deglycosylated using N-glycosidase F (PNGase F), an enzyme that is
known to hydrolyze all types of asparagine bound N-glycans. The
other control is NRX451 that has been cultured in the presence of
tunicamycin, a known glycosylation inhibitor. Both of the controls
show reduced C'MC activity in the in vitro assays. FIG. 15d shows
that the ADCC activity remains intact on all of the controls as
well as the oxidized/reduced NRX451. When NRX451 and
oxidized/reduced NRX451 were injected into a mouse model, the
biodistribution was identical, as shown in FIGS. 16a, b, and c.
[0250] NRX451 and oxidized/reduced NRX451 was prepared according to
GMP and an appropriate dosage amount following the pretargeting
methodology was given to patients with cancer to observe and
compare the blood clearance. FIG. 17 shows that the blood clearance
of the two types of NRX451 was equivalent out to 24 hours post
injection.
Example 7
Clinical Activity of CHO Expressed NRX451
[0251] In one example of this technology, corn cells are
transfected with an appropriate vector (e.g., U.S. Pat. Nos.
5,120,657; 5,015,580; 5,149,655; 5,405,779; 5,503,998; 5,506,125;
5,525,510 or 5,584,807) containing the genes for NRX451 and the
deglycosylated mutant of NRX451. The deglycosylated mutant of
NRX451 was made by creating a point mutation at position 297 (end
of the C.sub.H2 domain) on the heavy chain of an Asn to Gln thereby
eliminating the N-linked glycosylation site. The antibodies were
expressed and purified and tested for ADCC and C'MC against the
human breast adenocarcinoma cell line MCF-7 (HTB 22 ATCC
repository).
[0252] For the C'MC studies, MCF-7 cells (2.times.10.sup.6) were
labeled with .sup.51Cr for 2 hours at 37.degree. C. After multiple
washings in culture medium (DMEM/F12, 10% fetal calf serum) the
cells were added to 96 well, round bottom microtiter plates at
10.sup.4 cells per well. NRX451 antibody produced in CHO cells
(mammalian), produced in corn, and the deglycosylated mutant also
produced in corn was added in log 10 dilutions starting at 5 ug/ml.
In addition, human serum was added as a source of complement at a
final dilution of 10%. The volumes of the wells were brought to 200
.mu.l. After a 3.5 hour incubation period at 37.degree. C., the
plates were centrifuged and 100 .mu.l volumes were collected from
each well and counted in a Packard Gamma counter. In addition to
specific release induced by the antibody and complement,
spontaneous release of .sup.51Cr was determined by collecting
supernatants from wells containing cells alone. Total release was
determined by adding 0.1% of NP40 to the wells and collecting 100
ul volumes as above. Specific release was calculated by subtracting
spontaneous release from each test sample and the total releasable
and dividing the adjusted test release by the adjusted total
release (percent cytotoxicity). All samples were collected in
triplicate and the data presented as the mean and standard
deviation of these values.
[0253] In the case of ADCC analysis, the same procedures were used
as described for C'MC except that in place of 10% human serum,
human peripheral blood lymphocyte effector cells were added at an
effector to target cell ratio of 25:1. The plate was centrifuged
prior to the 3.5 hour incubation assay to facilitate effector and
target cell binding.
[0254] The results show in FIGS. 18 and 19 that the NRX451 antibody
produced in CHO cells efficiently mediates C'MC and ADCC. In
addition, NRX451 produced in corn cells mediates ADCC but not C'MC.
Finally, the Asn to Gin mutant produced in corn cells was
completely ineffective in mediating either C'MC or ADCC.
[0255] These results indicate that one skilled in the art can
produce IgG1 humanized antibodies that are unable to mediate C'MC
because of post translational modification differences between
plant and mammalian cell expression. In addition, a mutation of an
Asn to Gln results in elimination of ADCC through disruption of a
glycosylation site. Together these data indicate that one can
tailor-make an antibody for effector function based on the
selection of the expression system or a combination of a single
site mutation for N-linked glycosylation and selection of a plant
expression system.
Example 8
Site Specific Mutagenesis of NRX 451
[0256] The N-glycosylation site in the CH.sub.2-domain of the human
immunoglobulin heavy chain was site specific mutagenized by
polymerase chain reaction (PCR). Oligonucleotides NX156 (5'
AGCAGTAC CAA AGC ACG TAC CGG GTG 3') and NX157 (5' TACGTGCTTTG GTA
CTG CTC CTC 3') were synthesized (DNAgency, Malvern, Pa.) to anneal
to the coding (NX156) and noncoding (NX157) strands of the human
heavy chain gene over the region containing the N-glycosylation
site (Asn-Ser-Thr). Both oligonucleotides contained a two-base
mismatch designed to mutate a codon from AAC (asparagine) to CAA
(glutamine). In the first round of PCR, NX156 was paired with a
downstream primer NX113 (5' GCTGACGGAT CCTCATTTAC CCGGAGACAG GGAG
3') and NX157 was paired with an upstream primer NX110 (5'
CCGTCTATTA CTGTTCTAGA GAGGTC 3') in separate reactions using
plasmid PNRX451 as a template and Ultma DNA polymerase according to
the manufacturer's specifications (Perkin Elmer, Branchburg, N.J.).
The resulting PCR products were 476 base pairs for the NX110/NX157
primers and 634 base pairs for the NX156/NX113 primer pair; and
comprised portions of the heavy chain extending upstream and
downstream from the mutation, respectively. These PCR products were
purified from agarose gels via Geneclean (Biolol, Vista, Calif.)
and combined into a contiguous fragment in a second PCR using
primers NX110 and NX113. The resulting PCR product was 1190 base
pairs and contained the desired mutation. The product was digested
with restriction enzymes SstII and Bami to generate a 471 base pair
fragment which was cloned into the expression vector pNRX451,
replacing the N-glycosylation site containing wildtype gene
fragment.
Example 9
In Vivo Evaluation of NRX451 Whole Antibody Produced in Corn
Seed
[0257] Purified NRX451 whole antibody from corn seed was
radiolabeled with .sup.125I and compared with the CHO cell produced
murine NR-LU-10 whole antibody radiolabeled with .sup.131I. An
equimolar mixture of the two antibodies (25 .mu.g/25 .mu.g) was
injected intravenously into nude mice (20-25 g) bearing
sub-cutaneous SW-1222 colon carcinoma xenografts, and blood
clearance was assessed following i.v. injection of the % same
mixture into non-tumored mice.
[0258] Study #:
[0259] T=0, i.v. injection of a mixture of 25 .mu.g
.sup.131I-murine NR-LU-10 whole antibody (muLU-10) and 25 .mu.g
.sup.125I-corn-produced NRX451 whole antibody into nude mice (20-25
g) bearing subcutaneous SW-1222 colon carcinoma xenografts. Animals
were sacrificed at 4, 24, 48, 120, and 168 hours after
administration and dissected. Tumor and non-target tissues were
weighed and counted for detection of .sup.131I and .sup.125I. A
separate group of non-tumored, Balb/c mice were injected with the
same mixture, and serial blood samples were taken to compare the
rate of disappearance of radioactivity from blood.
[0260] Results:
[0261] As shown in FIG. 20, both isotopes were eliminated from the
blood at nearly identical rates, both in the early (.alpha.-phase)
distribution, and later elimination-dominated (.beta.-phase) phase.
Elimination half-lives were calculated to be 77.0 hr for the
humanized NR-LU-13 antibody (huLu-13) versus 74.3 for the
co-injected murine form. In terms of blood residence time, there is
no appreciable difference between NRX451 whole antibody and murine
NR-LU-10.
[0262] Biodistribution of the co-injected constructs were very
similar, as well. Shown in FIGS. 21A and 21B are the blood, soft
tissue and tumor concentrations of radioactivity in tumored nude
mice at progressive time after administration. Both constructs show
similar declining concentrations in all soft tissues, which follows
the time-course of elimination from blood. There is little evidence
of non-specific retention of radioactivity in any tissue, save
tumor. The tumor uptake profile shows an increase in concentration
of radioactivity out to 48 hours, with the % i.d./g values at 120
hours being diminished due to continued tumor growth (the actual
amount, % i.d., of both isotopes in tumor at 120 hours is almost
double that of any prior timepoints). Both the murine and humanized
antibodies show quantitatively similar tumor uptake profiles, in
terms of rate, extent, and retention of uptake. In the in vivo
evaluation of each whole antibody, there is no appreciable
difference between huNR-LU-13 whole antibody (expressed in corn
seed) and the murine form (hybridoma cells).
[0263] Study #2:
[0264] Design:
[0265] T=0, i.v. injection of 50 .mu.g .sup.125I-NRX451 chemically
conjugated to streptavidin (NRX451/SA) into nude mice (20-25 g)
bearing subcutaneous SW-1222 colon carcinoma xenografts. Animals
were sacrificed at 4, 24, 48, 120 and 168 hours after
administration and dissected. Tumor and non-target tissues were
weighed and counted for detection of 1251.
[0266] Results:
[0267] Evaluation of the purified NRX451 whole antibody from corn
seed continued with the chemical conjugation of this material to
streptavidin, and subsequent utilization in pretargeted tumor
delivery. First, however, an evaluation of the streptavidin
conjugate alone was done. Shown in FIG. 22 are the blood, soft
tissue and tumor concentrations of radioactivity in tumored nude
mice at progressive time after administration. There is little
evidence of non-specific retention of radioactivity in any tissue,
save tumor. The tumor uptake profile shows an increase in
concentration of radioactivity out to 120 hours. The overall
pattern shows a consistent declining concentration of antibody in
blood and all soft tissues at successive timepoints. In vivo
immunoreactivity is demonstrated by the positive ratio of tumor to
blood concentrations at all timepoints from 24-168 hours, and by
the increase in tumor localization over the 0-48 hour period. Tumor
uptake peaking at 40-50% ID/g is similar to that observed with
muNR-LU-10/SA, as well as the with the unconjugated antibodies
described above. Tumor retention over time is similar to historical
controls of muNR-LU-10/SA. Little significant non-target retention
of radiolabel is evident beyond the blood pool activity in each
organ at the timepoints 24-168 hours. High values in all
well-perfused tissues at 4 hours may be related to high blood pool
activity at this timepoint.
[0268] Study #2 (Cont'd):
[0269] Design:
[0270] T=0, i.v. injection of 400 .mu.g .sup.125I-NRX451 whole
antibody (corn seed) chemically conjugated to streptavidin
(NRX451/SA) into nude mice (20-25 g) bearing subcutaneous SW-1222
colon carcinoma xenografts. t=20 hours, i.v. injection of 100 .mu.g
of synthetic clearing agent (GN16LCBT). t=26 hours, i.v. injection
of 1.0 .mu.g n-DOTA-biotin. Animals were sacrificed at 2, 24, 48,
and 120 hours after administration of .sup.111In-DOTA-biotin (28,
50, 74, and 144 hours from t=0) and dissected. Tumor and non-target
tissues were weighed and counted for detection of 1251 and
.sup.111In. Separate groups of non-tumored, Balb/c mice were
injected with 400 .mu.g .sup.125I-NRX451/SA, followed at 24 hours
with saline or 100 g of synthetic clearing agent (GN16LCBT), and
serial blood samples were taken to compare the rate of
disappearance of radioactivity from blood.
[0271] Results:
[0272] As shown in FIG. 23, radioactivity was slowly eliminated
from the blood in a manner similar to the unconjugated antibody,
both in the early (.alpha.-phase) distribution, and later
elimination-dominated (.beta.-phase) phase. Injection of synthetic
clearing agent at 24 hours produced a rapid decline of blood
radioactivity to levels <10% of the original concentration. A
slight rebound in blood radioactivity concentration (<1%) is
seen from 24-48 hours, consistent with historical results achieved
with the muLU-10/SA conjugate. The nadir in serum concentration was
sufficient to produce a reduced background for pretargeting
experimentation.
[0273] Evaluation of NRX451/SA in the fill pretargeting mode was
achieved by following the dosing schedule listed above. Shown in
FIG. 24A are the blood, soft tissue and tumor concentrations of
.sup.125I radioactivity associated with the NRX451/SA conjugate at
the time points following clearing agent and DOTA-biotin
administration. Blood levels are quite low, consistent with the
results of the studies in non-tumored mice, and the radioactivity
usually present in the blood has been localized to liver,
consistent with the receptor-mediated clearance associated with use
of the GN16LCBT clearing agent. Tumor uptake, while apparently
lower than that in FIG. 22, is actually greater in stoichiometric
amounts of NRX451/SA, considering that the data in FIG. 22 resulted
from administration of 50%1 g of NRX451/SA versus 400 .mu.g of
NRX451/SA in the FIG. 24A data. Tumor retention over time is
similar to historical controls of muNR-LU-10/SA used in the same
dosing format. Little significant non-target retention of
radiolabel is evident beyond the blood pool activity in each organ
and the material being processed by the liver.
[0274] FIG. 24B shows the corresponding blood, soft tissue and
tumor concentrations of .sup.111In radioactivity associated with
the DOTA-biotin administration. Low concentrations in all tissues
except tumor are seen, with the rate, extent, and retention of
tumor-associated radioactivity at all time points being consistent
with those observed using the muLU-10/SA as a targeting agent. In
the full pretargeting application, utilizing chemical conjugates to
streptavidin, there are no appreciable differences between NRX451
whole antibody (expressed in corn seed) and the murine form
(hybridoma expressed).
[0275] From the foregoing, it will be evident that, although
specific embodiments of the invention have been described herein
for purposes of illustration, various modifications may be made
without deviating from the spirit and scope of the invention.
Sequence CWU 1
1
* * * * *