U.S. patent application number 10/633735 was filed with the patent office on 2005-05-12 for platelet-activating factor acetylhydrolase.
Invention is credited to Cousens, Lawrence S., Eberhardt, Christine D., Gray, Patrick, Tjoelker, Larry W., Trong, Hai Le, Wilder, Cheryl L..
Application Number | 20050100540 10/633735 |
Document ID | / |
Family ID | 22460373 |
Filed Date | 2005-05-12 |
United States Patent
Application |
20050100540 |
Kind Code |
A1 |
Cousens, Lawrence S. ; et
al. |
May 12, 2005 |
Platelet-activating factor acetylhydrolase
Abstract
The present invention provides purified and isolated
polynucleotide sequences encoding human plasma platelet-activating
factor acetylhydrolase. Also provided are materials and methods for
the recombinant production of platelet-activating factor
acetylhydrolase products which are expected to be useful in
regulating pathological inflammatory events.
Inventors: |
Cousens, Lawrence S.;
(Oakland, CA) ; Eberhardt, Christine D.; (Auburn,
WA) ; Gray, Patrick; (Seattle, WA) ; Trong,
Hai Le; (Edmonds, WA) ; Tjoelker, Larry W.;
(Kirkland, WA) ; Wilder, Cheryl L.; (Seattle,
WA) |
Correspondence
Address: |
MARSHALL, GERSTEIN & BORUN LLP
6300 SEARS TOWER
233 S. WACKER DRIVE
CHICAGO
IL
60606
US
|
Family ID: |
22460373 |
Appl. No.: |
10/633735 |
Filed: |
August 4, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10633735 |
Aug 4, 2003 |
|
|
|
10003978 |
Oct 13, 2001 |
|
|
|
10003978 |
Oct 13, 2001 |
|
|
|
08318905 |
Oct 6, 1994 |
|
|
|
5641669 |
|
|
|
|
08318905 |
Oct 6, 1994 |
|
|
|
08133803 |
Oct 6, 1993 |
|
|
|
Current U.S.
Class: |
424/94.64 |
Current CPC
Class: |
A61P 43/00 20180101;
A61P 17/00 20180101; C07K 16/40 20130101; A61P 11/16 20180101; A61P
31/04 20180101; C12N 9/18 20130101; A61P 1/04 20180101; A61P 11/02
20180101; A61P 15/06 20180101; A61P 29/00 20180101; A61P 9/00
20180101; C07K 2317/24 20130101; A61P 11/06 20180101; A61K 38/00
20130101; A61P 9/10 20180101; A61P 37/00 20180101; A61P 11/00
20180101; A61P 15/00 20180101 |
Class at
Publication: |
424/094.64 |
International
Class: |
A61K 038/46; A61K
038/48 |
Claims
We claim:
1. A pharmaceutical composition comprising PAF-AH enzyme and a
pharmaceutically acceptable diluent, adjuvant or carrier.
2. A method for treating a mammal susceptible to or suffering from
a PAF-mediated pathological condition comprising administering the
pharmaceutical composition of claim 1 to said mammal in an amount
sufficient to supplement endogenous PAF-AH activity and to
inactivate pathological amounts of PAF in said mammal.
3. A method for treating a mammal susceptible to or suffering from
pleurisy comprising administering the pharmaceutical composition of
claim 1 to said mammal in an amount sufficient to supplement
endogenous PAF-AH activity and to inactivate pathological amounts
of PAF of said mammal.
4. A method for treating a mammal susceptible to or suffering from
asthma comprising administering the pharmaceutical composition of
claim 1 to said mammal in an amount sufficient to supplement
endogenous PAF-AH activity and to inactivate pathological amounts
of PAF of said mammal.
5. A method for treating a mammal susceptible to or suffering from
rhinitis comprising administering the pharmaceutical composition of
claim 1 to said mammal in an amount sufficient to supplement
endogenous PAF-AH activity and to inactivate pathological amounts
of PAF in said mammal.
6. A method for treating a mammal susceptible to or suffering from
necrotizing enterocolitis comprising administering the
pharmaceutical composition of claim 1 to said mammal in an amount
sufficient to supplement endogenous PAF-AH activity and to
inactivate pathological amounts of PAF in said mammal.
7. A method for treating a mammal susceptible to or suffering from
acute respiratory distress syndrome comprising administering the
pharmaceutical composition of claim 1 to said mammal in an amount
sufficient to supplement endogenous PAF-AH activity and to
inactivate pathological amounts of PAF in said mammal.
Description
[0001] This application is a continuation-in-part of co-pending
U.S. patent application Ser. No. 08/318,905 filed Oct. 6, 1994,
which in turn is a continuation-in-part of co-pending U.S. patent
application Ser. No. 08/133,803 filed Oct. 6, 1993.
FIELD OF THE INVENTION
[0002] The present invention relates generally to
platelet-activating factor acetylhydrolase and more specifically to
novel purified and-isolated polynucleotides encoding human plasma
platelet-activating factor acetylhydrolase, to the
platelet-activating factor acetylhydrolase products encoded by the
polynucleotides, to materials and methods for the recombinant
production of platelet-activating factor acetylhydrolase products
and to antibody substances specific for platelet-activating factor
acetylhydrolase.
BACKGROUND
[0003] Platelet-activating factor (PAF) is a biologically active
phospholipid synthesized by various cell types. In vivo and at
normal concentrations of 10.sup.-10 to 10.sup.-9 M, PAF activates
target cells such as platelets and neutrophils by binding to
specific G protein-coupled cell surface receptors [Venable et al.,
J. Lipid Res., 34: 691-701 (1993)]. PAF has the structure
I-O-alkyl-2-acetyl-sn-glycero-- 3-phosphocholine. For optimal
biological activity, the sn-1 position of the PAF glycerol backbone
must be in an ether linkage with a fatty alcohol and the sn-3
position must have a phosphocholine head group.
[0004] PAF functions in normal physiological processes (e.g.,
inflammation, hemostasis and parturition) and is implicated in
pathological inflammatory responses (e.g., asthma, anaphylaxis,
septic shock and arthritis) [Venable et al., supra, and Lindsberg
et al., Ann. Neurol., 30: 117-129 (1991)]. The likelihood of PAF
involvement in pathological responses has prompted attempts to
modulate the activity of PAF and the major focus of these attempts
has been the development of antagonists of PAF activity which
interfere with binding of PAF to cell surface receptors. See, for
example, Heuer et al., Clin. Exp. Allergy, 22: 980-983 (1992).
[0005] The synthesis and secretion of PAF as well as its
degradation and clearance appear to be tightly controlled. To the
extent that pathological inflammatory actions of PAF result from a
failure of PAF regulatory mechanisms giving rise to excessive
production, inappropriate production or lack of degradation, an
alternative means of modulating the activity of PAF would involve
mimicing or augmenting the natural process by which resolution of
inflammation occurs. Macrophages [Stafforini et al., J. Biol.
Chem., 265(17): 9682-9687 (1990)], hepatocytes and the human
hepatoma cell line HepG2 [Satoh et al., J. Clin. Invest., 87:
476-481 (1991) and Tarbet et al., J. Biol. Chem., 266(25):
16667-16673 (1991)] have been reported to release an enzymatic
activity, PAF acetylhydrolase (PAF-AH), that inactivates PAF. In
addition to inactivating PAF, PAF-AH also inactivates oxidatively
fragmented phospholipids such as products of the arachidonic acid
cascade that mediate inflammation. See, Stremler et al., J. Biol.
Chem., 266(17): 11095-11103 (1991). The inactivation of PAF by
PAF-AH occurs primarily by hydrolysis of the PAF sn-2 acetyl group
and PAF-AH metabolizes oxidatively fragmented phospholipids by
removing sn-2 acyl groups. Two types of PAF-AH have been
identified: cytoplasmic forms found in a variety of cell types and
tissues such as endothelial cells and erythrocytes, and an
extracellular form found in plasma and serum. Plasma PAF-AH does
not hydrolyze intact phospholipids except for PAF and this
substrate specificity allows the enzyme to circulate in vivo in a
fully active state without adverse effects. The plasma PAF-AH
appears to account for all of the PAF degradation in human blood ex
vivo [Stafforini et al. J. Biol. Chem., 262(9): 4223-4230
(1987)].
[0006] While the cytoplasmic and plasma forms of PAF-AH appear to
have identical substrate specificity, plasma PAF-AH has biochemical
characteristics which distinguish it from cytoplasmic PAF-AH and
from other characterized lipases. Specifically, plasma PAF-AH is
associated with lipoprotein particles, is inhibited by diisopropyl
fluorophosphate, is not affected by calcium ions, is relatively
insensitive to proteolysis, and has an apparent molecular weight of
43,000 daltons. See, Stafforini et al. (1987), supra. The same
Stafforini et al. article describes a procedure for partial
purification of PAF-AH from human plasma and the amino acid
composition of the plasma material obtained by use of the
procedure. Cytoplasmic PAF-AH has been purified from erythrocytes
as reported in Stafforini et al., J. Biol. Chem., 268(6): 3857-3865
(1993) and ten amino terminal residues of cytoplasmic PAF-AH are
also described in the article. Hattori et al., J. Biol. Chem.,
268(25): 18748-18753 (1993) describes the purification of
cytoplasmic PAF-AH from bovine brain. Subsequent to filing of the
parent application hereto the nucleotide sequence of bovine brain
cytoplasmic PAF-AH was published in Hattori et al., J. Biol. Chem.,
269(237): 23150-23155 (1994). On Jan. 5, 1995, three months after
the filing date of the parent application hereto, a nucleotide
sequence for a lipoprotein associated phospholipase A.sub.2
(Lp-PLA.sub.2) was published in Smithkline Beecham PLC Patent
Cooperation Treaty (PCT) International Publication No. WO 95/00649.
The nucleotide sequence of the Lp-PLA.sub.2 differs at one position
when compared to the nucleotide sequence of the PAF-AH of the
present invention. The nucleotide difference (corresponding to
position 1297 of SEQ ID NO: 7) results in an amino acid difference
between the enzymes encoded by the polynucleotides. The amino acid
at position 379 of SEQ ID NO: 8 is a valine while the amino acid at
the corresponding position in Lp-PLA.sub.2 is an alanine. In
addition, the nucleotide sequence of the PAF-AH of the present
invention includes 124 bases at the 5' end and twenty bases at the
3' end not present in the Lp-PLA.sub.2 sequence. Three months
later, on Apr. 10, 1995, a Lp-PLA.sub.2 sequence was deposited in
GenBank under Accession No. U24577 which differs at eleven
positions when compared to the nucleotide sequence of the PAF-AH of
the present invention. The nucleotide differences (corresponding to
position 79, 81, 84, 85, 86, 121, 122, 904, 905, 911, 983 and 1327
of SEQ ID NO: 7) results in four amino acid differences between the
enzymes encoded by the polynucleotides. The amino acids at
positions 249, 250, 274 and 389 of SEQ ID NO: 8 are lysine,
aspartic acid, phenylalanine and leucine, respectively, while the
respective amino acid at the corresponding positions in the GenBank
sequence are isoleucine, arginine, leucine and serine.
[0007] The recombinant production of PAF-AH would make possible the
use of exogenous PAF-AH to mimic or augment normal processes of
resolution of inflammation in vivo. The administration of PAF-AH
would provide a physiological advantage over administration of PAF
receptor antagonists because PAF-AH is a product normally found in
plasma. Moreover, because PAF receptor antagonists which are
structurally related to PAF inhibit native PAF-AH activity, the
desirable metabolism of PAF and of oxidatively fragmented
phospholipids is thereby prevented. Thus, the inhibition of PAF-AH
activity by PAF receptor antagonists counteracts the competitive
blockade of the PAF receptor by the antagonists. See, Stremler et
al., supra. In addition, in locations of acute inflammation, for
example, the release of oxidants results in inactivation of the
native PAF-AH enzyme in turn resulting in elevated local levels of
PAF and PAF-like compounds which would compete with any exogenously
administed PAF receptor antagonist for binding to the PAF receptor.
In contrast, treatment with recombinant PAF-AH would augment
endogenous PAF-AH activity and compensate for any inactivated
endogenous enzyme.
[0008] There thus exists a need in the art to identify and isolate
polynucleotide sequences encoding human plasma PAF-AH, to develop
materials and methods useful for the recombinant production of
PAF-AH and to generate reagents for the detection of PAF-AH in
plasma.
SUMMARY OF THE INVENTION
[0009] The present invention provides novel purified and isolated
polynucleotides (i.e., DNA and RNA both sense and antisense
strands) encoding human plasma PAF-AH or enzymatically active
fragments thereof. Preferred DNA sequences of the invention include
genomic and cDNA sequences as well as wholly or partially
chemically synthesized DNA sequences. The DNA sequence encoding
PAF-AH that is set out in SEQ ID NO: 7 and DNA sequences which
hybridize to the noncoding strand thereof under standard stringent
conditions or which would hybridize but for the redundancy of the
genetic code, are contemplated by the invention. Also contemplated
by the invention are biological replicas (i.e., copies of isolated
DNA sequences made in vivo or in vitro) of DNA sequences of the
invention. Autonomously replicating recombinant constructions such
as plasmid and viral DNA vectors incorporating PAF-AH sequences and
especially vectors wherein DNA encoding PAF-AH is operatively
linked to an endogenous or exogenous expression control DNA
sequence and a transcription terminator are also provided.
[0010] According to another aspect of the invention, procaryotic or
eucaryotic host cells are stably transformed with DNA sequences of
the invention in a manner allowing the desired PAF-AH to be
expressed therein. Host cells expressing PAF-AH products can serve
a variety of useful purposes. Such cells constitute a valuable
source of immunogen for the development of antibody substances
specifically immunoreactive with PAF-AH. Host cells of the
invention are conspicuously useful in methods for the large scale
production of PAF-AH wherein the cells are grown in a suitable
culture medium and the desired polypeptide products are isolated
from the cells or from the medium in which the cells are grown by,
for example, immunoaffinity purification.
[0011] A non-immunological method contemplated by the invention for
purifying PAF-AH from plasma includes the following steps: (a)
isolating low density lipoprotein particles; (b) solubilizing said
low density lipoprotein particles in a buffer comprising 10 mM
CHAPS to generate a first PAF-AH enzyme solution; (c) applying said
first PAF-AH enzyme solution to a DEAE anion exchange column; (d)
washing said DEAE anion exchange column using an approximately pH
7.5 buffer comprising 1 mM CHAPS; (e) eluting PAF-AH enzyme from
said DEAE anion exchange column in fractions using approximately pH
7.5 buffers comprising a gradient of 0 to 0.5 M NaCl; (f) pooling
fractions eluted from said DEAE anion exchange column having PAF-AH
enzymatic activity; (g) adjusting said pooled, active fractions
from said DEAE anion exchange column to 10 mM CHAPS to generate a
second PAF-AH enzyme solution; (h) applying said second PAF-AH
enzyme solution to a blue dye ligand affinity column; (i) eluting
PAF-AH enzyme from said blue dye ligand affinity column using a
buffer comprising 10 mM CHAPS and a chaotropic salt; (j) applying
the eluate from said blue dye ligand affinity column to a Cu ligand
affinity column; (k) eluting PAF-AH enzyme from said Cu ligand
affinity column using a buffer comprising 10 mM CHAPS and
imidazole; (1) subjecting the eluate from said Cu ligand affinity
column to SDS-PAGE; and (m) isolating the approximately 44 kDa
PAF-AH enzyme from the SDS-polyacrylamide gel. Preferably, the
buffer of step (b) is 25 mM Tris-HCl, 10 mM CHAPS, pH 7.5; the
buffer of step (d) is 25 mM Tris-HCl, 1 mM CHAPS; the column of
step (h) is a Blue Sepharose Fast Flow column; the buffer of step
(i) is 25 mM Tris-HCl, 10 mM CHAPS, 0.5M KSCN, pH 7.5; the column
of step A) is a Cu Chelating Sepharose column; and the buffer of
step (k) is 25 mM Tris-HCl, 10 mM CHAPS. 0.5M NaCl. 50 mM imidazole
at a pH in a range of about pH 7.5-8.0.
[0012] A method contemplated by the invention for purifying
enzymatically-active PAF-AH from E. coli producing PAF-AH includes
the steps of: (a) preparing a centrifugation supernatant from lysed
E. coli producing PAF-AH enzyme; (b) applying said centrifugation
supernatant to a blue dye ligand affinity column; (c) eluting
PAF-AH enzyme from said blue dye ligand affinity column using a
buffer comprising 10 mM CHAPS and a chaotropic salt; (d) applying
said eluate from said blue dye ligand affinity column to a Cu
ligand affinity column; and (e) eluting PAF-AH enzyme from said Cu
ligand affinity column using a buffer comprising 10 mM CHAPS and
imidazole. Preferably, the column of step (b) is a Blue Sepharose
Fast Flow column; the buffer of step (c) is 25 mM Tris-HCl, 10 mM
CHAPS, 0.5M KSCN, pH. 7.5; the column of step (d) is a Cu Chelating
Sepharose column; and the buffer of step (e) is 25 mM Tris-HCl, 10
mM CHAPS, 0.5M NaCl, 100 mM imidazole, pH 7.5.
[0013] Another method contemplated by the invention for purifying
enzymatically-active PAF-AH from E. coli producing PAF-AH includes
the steps of: (a) preparing a centrifugation supernatant from lysed
E. coli producing PAF-AH enzyme; (b) diluting said centrifugation
supernatant in a low pH buffer comprising 10 mM CHAPS; (c) applying
said diluted centrifugation supernatant to a cation exchange column
equilibrated at about pH 7.5; (d) eluting PAF-AH enzyme from said
cation exchange column using 1M salt; (e) raising the pH of said
eluate from said cation exhange column and adjusting the salt
concentration of said eluate to about 0.5M salt; (f) applying said
adjusted eluate from said cation exchange column to a blue dye
ligand affinity column; (g) eluting PAF-AH enzyme from said blue
dye ligand affinity column using a buffer comprising about 2M to
about 3M salt; and (h) dialyzing said eluate from said blue dye
ligand affinity column using a buffer comprising about 0.1% Tween.
Preferably, the buffer of step (b) is 25 mM MES, 10 mM CHAPS, 1 mM
EDTA, pH 4.9; the column of step (c) is an S sepharose column
equilibrated in 25 mM MES, 10 mM CHAPS, 1 mM EDTA, 50 mM NaCl, pH
5.5; PAF-AH is eluted in step (d) using 1 mM NaCl; the pH of the
eluate in step (e) is adjusted to pH 7.5 using 2M Tris base; the
column in step (f) is a sepharose column; the buffer in step (g) is
25 mM Tris, 10 mM CHAPS, 3M NaCl, 1 mM EDTA, pH 7.5; and the buffer
in step (h) is 25 mM Tris, 0.5M NaCl, 0.1% Tween 80, pH 7.5.
[0014] Still another method contemplated by the invention for
purifying enzymatically-active PAF-AH from E. coli includes the
steps of: (a) preparing an E. coli extract which yields solubilized
PAF-AH supernatant after lysis in a buffer containing CHAPS; (b)
dilution of the said supernatant and application to a anion
exchange column equilibrated at about pH 8.0; (c) eluting PAF-AH
enzyme from said anion exchange column; (d) applying said adjusted
eluate from said anion exchange column to a blue dye ligand
affinity column; (e) eluting the said blue dye ligand affinity
column using a buffer comprising 3.0M salt; (f) dilution of the
blue dye eluate into a suitable buffer for performing
hydroxylapatite chromatography; (g) performing hydroxylapatite
chromatography where washing and elution is accomplished using
buffers (with or without CHAPS); (h) diluting said hydroxylapatite
eluate to an appropriate salt concentration for cation exchange
chromatography; (i) applying said diluted hydroxylapatite eluate to
a cation exchange column at a pH ranging between approximately 6.0
to 7.0; (j) elution of PAF-AH from said cation exchange column with
a suitable formulation buffer; (k) performing cation exchange
chromatography in the cold; and (l) formulation of PAF-AH in liquid
or frozen form in the absence of CHAPS.
[0015] Preferably in step (a) above the lysis buffer is 25 mM Tris,
100 mM NaCl, 1 mM EDTA, 20 mM CHAPS, pH 8.0; in step (b) the
dilution of the supernatant for anion exchange chromatography is
3-4 fold into 25 mM Tris, 1 mM EDTA, 10 mM CHAPS, pH 8.0 and the
column is a Q-Sepharose column equilibrated with 25 mM Tris, 1 mM
EDTA, 50 mM NaCl, 10 mM CHAPS, pH 8.0; in step (c) the anion
exchange column is eluted using 25 mM Tris, 1 mM EDTA, 350 mM NaCl,
10 mM CHAPS, pH 8.0; in step (d) the eluate from step (c) is
applied directly onto a blue dye affinity column; in step (e) the
column is eluted with 3M NaCl, 10 mM CHAPS, 25 mM Tris, pH 8.0
buffer; in step (f) dilution of the blue dye eluate for
hydroxylapatite chromatography is accomplished by dilution into 10
mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS, pH 6.2; in step (g)
hydroxylapatite chromatography is accomplished using a
hydroxylapatite column equilibrated with 10 mM sodium phosphate,
100 mM NaCl, 10 mM CHAPS and elution is accomplished using 50 mM
sodium phosphate, 100 mM NaCl (with or without) 10 mM CHAPS, pH
7.5; in step (h) dilution of said hydroxylapatite eluate for cation
exchange chromatography is accomplished by dilution into a buffer
ranging in pH from approximately 6.0 to 7.0 comprising sodium
phosphate (with or without CHAPS), in step (i) a S Sepharose column
is equilibrated with 50 mM sodium phosphate, (with or without) 10
mM CHAPS, pH 6.8; in step (6) elution is accomplished with a
suitable formulation buffer such as potassium phosphate 50 mM, 12.5
mM aspartic acid, 125 mM NaCl, pH 7.5 containing 0.01% Tween-80;
and in step (k) cation exchange chromatrography is accomplished at
2-8.degree. C. Examples of suitable formulation buffers for use in
step (l) which stabilize PAF-AH include 50 mM potassium phosphate,
12.5 mM Aspartic acid, 125 mM NaCl pH 7.4 (approximately, with and
without the addition of Tween-80 and or Pluronic F68) or 25 mM
potassium phosphate buffer containing (at least) 125 mM NaCl, 25 mM
arginine and 0.01% Tween-80 (with or without Pluronic F68 at
approximately 0.1 and 0.5%).
[0016] PAF-AH products may be obtained as isolates from natural
cell sources or may be chemically synthesized, but are preferably
produced by recombinant procedures involving procaryotic or
eucaryotic host cells of the invention. PAF-AH products having part
or all of the amino acid sequence set out in SEQ ID NO: 8 are
contemplated. The use of mammalian host cells is expected to
provide for such post-translational modifications (e.g.,
myristolation, glycosylation, truncation, lipidation and tyrosine,
serine or threonine phosphorylation) as may be needed to confer
optimal biological activity on recombinant expression products of
the invention. PAF-AH products of the invention may be full length
polypeptides, fragments or variants. Variants may comprise PAF-AH
analogs wherein one or more of the specified (i.e., naturally
encoded) amino acids is deleted or replaced or wherein one or more
nonspecified amino acids are added: (1) without loss of one or more
of the enzymatic activities or immunological characteristics
specific to PAF-AH; or (2) with specific disablement of a
particular biological activity of PAF-AH. Proteins or other
molecules that bind to PAF-AH may be used to modulate its
activity.
[0017] Also comprehended by the present invention are antibody
substances (e.g., monoclonal and polyclonal antibodies, single
chain antibodies, chimeric antibodies, CDR-grafted antibodies and
the like) and other binding proteins specific for PAF-AH.
Specifically illustrating binding proteins of the invention are the
monoclonal antibodies produced by hybridomas 90G11D and 90F2D which
were deposited with the American Type Culture Collection (ATCC).
12301 Parklawn Drive, Rockville, Md. 20852 on Sep. 30, 1994 and
were respectively assigned Accession Nos. HB 11724 and HB 11725.
Also illustrating binding proteins of the invention is the
monoclonal antibody produced by hybridoma 143A which was deposited
with the ATCC on Jun. 1, 1995 and assigned Accession No. HB 11900.
Proteins or other molecules (e.g., lipids or small molecules) which
specifically bind to PAF-AH can be identified using PAF-AH isolated
from plasma, recombinant PAF-AH, PAF-AH variants or cells
expressing such products. Binding proteins are useful, in turn, in
compositions for immunization as well as for purifying PAF-AH, and
are useful for detection or quantification of PAF-AH in fluid and
tissue samples by known immunological procedures. Anti-idiotypic
antibodies specific for PAF-AH-specific antibody substances are
also contemplated.
[0018] The scientific value of the information contributed through
the disclosures of DNA and amino acid sequences of the present
invention is manifest. As one series of examples, knowledge of the
sequence of a cDNA for PAF-AH makes possible the isolation by
DNA/DNA hybridization of genomic DNA sequences encoding PAF-AH and
specifying PAF-AH expression control regulatory sequences such as
promoters, operators and the like. DNA/DNA hybridization procedures
carried out with DNA sequences of the invention under conditions of
stringency standard in the art are likewise expected to allow the
isolation of DNAs encoding allelic variants of PAF-AH, other
structurally related proteins sharing one or more of the
biochemical and/or immunological properties of PAF-AH, and
non-human species proteins homologous to PAF-AH. The DNA sequence
information provided by the present invention also makes possible
the development, by homologous recombination or "knockout"
strategies [see, e.g., Kapecchi, Science, 244: 1288-1292 (1989)],
of rodents that fail to express a functional PAF-AH enzyme or that
express a variant PAF-AH enzyme. Polynucleotides of the invention
when suitably labelled are useful in hybridization assays to detect
the capacity of cells to synthesize PAF-AH. Polynucleotides of the
invention may also be the basis for diagnostic methods useful for
identifying a genetic alteration(s) in the PAF-AH locus that
underlies a disease state or states. Also made available by the
invention are anti-sense polynucleotides relevant to regulating
expression of PAF-AH by those cells which ordinarily express the
same.
[0019] Administration of PAF-AH preparations of the invention to
mammalian subjects, especially humans, for the purpose of
ameliorating pathological inflammatory conditions is contemplated.
Based on implication of the involvement of PAF in pathological
inflammatory conditions, the administration of PAF-AH is indicated,
for example, in treatment of asthma [Miwa et al., J. Clin. Invest.,
82: 1983-1991 (1988); Hsieh et al., J. Allergy Clin. Immunol., 91:
650-657 (1993); and Yamashita et al., Allergy, 49: 60-63 (1994)],
anaphylaxis [Venable et al., supra], shock [Venable et al., supra],
reperfusion injury and central nervous system ischemia [Lindsberg
et al. (1991), supra], antigen-induced arthritis [Zarco et al.,
Clin. Exp. Immunol., 88: 318-323 (1992)], atherogenesis [Handley et
al., Drug Dev. Res., 7: 361-375 (1986)], Crohn's disease [Denizot
et al., Digestive Diseases and Sciences, 37(3): 432-437 (1992)],
ischemic bowel necrosis/necrotizing enterocolitis [Denizot et al.,
supra and Caplan et al., Acta Paediatr., Suppl. 396: 11-17 (1994)],
ulcerative colitis (Denizot et al., supra), ischemic stroke [Satoh
et al., Stroke, 23: 1090-1092 (1992)], ischemic brain injury
[Lindsberg et al., Stroke, 21: 1452-1457 (1990) and Lindsberg et
al. (1991), supra], systemic lupus erythematosus [Matsuzaki et al.,
Clinica Chimica Acta, 210: 139-144 (1992)], acute pancreatitis
[Kald et al., Pancreas, 8(4): 440442 (1993)], septicemia (Kald et
al., supra), acute post streptococcal glomerulonephritis [Mezzno et
al., J. Am. Soc. Nephrol., 4: 235-242 (1993)], pulmonary edema
resulting from IL-2 therapy [Rabinovici et al., J. Clin. Invest.,
89: 1669-1673 (1992)], allergic inflammation [Watanabe et al., Br.
J. Pharmacol. 111: 123-130 (1994)], ischemic renal failure [Grino
et al., Annals of Internal Medicine, 121(5): 345-347 (1994);
preterm labor [Hoffman et al., Am. J. Obstet. Gynecol., 162(2):
525-528 (1990) and Maki et al., Proc. Natl. Acad. Sci. USA, 85:
728-732 (1988)]; and adult respiratory distress syndrome
[Rabinovici et al., J. Appl. Physiol., 74(4): 1791-1802 (1993);
Matsumoto et al., Clin. Exp. Pharmacol. Physiol., 19 509-515
(1992); and Rodriguez-Roisin et al., J. Clin. Invest., 93: 188-194
(1994)].
[0020] Animal models for many of the foregoing pathological
conditions have been described in the art. For example, a mouse
model for asthma and rhinitis is described in Example 16 herein; a
rabbit model for arthritis is described in Zarco et at., supra; rat
models for ischemic bowel necrosis/necrotizing enterocolitis are
described in Furukawa et al., Ped. Res., 34,(2): 237-241 (1993) and
Caplan et al., supra; a rabbit model for stroke is described in
Lindsberg et al., (1990), supra; a mouse model for lupus is
described in Matsuzaki et al., supra; a rat model for acute
pancreatitis is described in Kald et al., supra: a rat model for
pulmonary edema resulting from IL-2 therapy is described in
Rabinovici et al., supra; a rat model of allergic inflammation is
described in Watanabe et al., supra), a canine model of renal
allograft is described in Watson et al., Transplantation, 56(4):
1047-1049 (1993); and rat and guinea pig models of adult
respiratory distress syndrome are respectively described in
Rabinovici et al., supra. and Lellouch-Tubiana, Am. Rev. Respir.
Dis., 137: 948-954 (1988).
[0021] Specifically contemplated by the invention are PAF-AH
compositions for use in methods for treating a mammal susceptible
to or suffering from PAF-mediated pathological conditions
comprising administering PAF-AH to the mammal in an amount
sufficient to supplement endogenous PAF-AH activity and to
inactivate pathological amounts of PAF in the mammal.
[0022] Therapeutic/pharmaceutical compositions contemplated by the
invention include PAF-AH and a physiologically acceptable diluent
or carrier and may also include other agents having
anti-inflammatory effects. Dosage amounts indicated would be
sufficient to supplement endogenous PAF-AH activity and to
inactivate pathological amounts of PAF. For general dosage
considerations see Remmington's Pharmaceutical Sciences, 18th
Edition, Mack Publishing Co., Easton, Pa. (1990). Dosages will vary
between about 0.1 to about 1000 .mu.g PAF-AH/kg body weight.
Therapeutic compositions of the invention may be administered by
various routes depending on the pathological condition to be
treated. For example, administration may be by intraveneous,
subcutaneous, oral, suppository, and/or pulmonary routes.
[0023] For pathological conditions of the lung, administration of
PAF-AH by the pulmonary route is particularly indicated.
Contemplated for use in pulmonary administration are a wide range
of delivery devices including, for example, nebulizers, metered
dose inhalers, and powder inhalers, which are standard in the art.
Delivery of various proteins to the lungs and circulator system by
inhalation of aerosol formulations has been described in Adjei et
al., Pharm. Res. 7(6): 565-569 (1990) (leuprolide acetate); Braquet
et al., J. Cardio. Pharm., 13(Supp. 5): s. 143-146 (1989)
(endothelin-1); Hubbard et al., Annals of Internal Medicine,
111(3), 206-212 (1989) (.alpha.1-antitrypsin); Smith et al., J.
Clin. Invest., 84: 1145-1146 (1989) (.alpha.-1-proteinase
inhibitor); Debs et al., J. Immunol., 140: 3482-3488 (1933)
(recombinant gamma interferon and tumor necrosis factor alpha);
Patent Cooperation Treaty (PCT) International Publication No. WO
94/20069 published Sep. 15, 1994 (recombinant pegylated granulocyte
colony stimulating factor).
BRIEF DESCRIPTION OF THE DRAWING
[0024] Numerous other aspects and advantages of the present
invention will be apparent upon consideration of the following
detailed description thereof, reference being made to the drawing
wherein:
[0025] FIG. 1 is a photograph of a PVDF membrane containing PAF-AH
purified from human plasma;
[0026] FIG. 2 is a graph showing the enzymatic activity of
recombinant human plasma PAF-AH;
[0027] FIG. 3 is a schematic drawing depicting recombinant PAF-AH
fragments and their catalytic activity;
[0028] FIG. 4 is a bar graph illustrating blockage of PAF-induced
rat foot edema by locally administered recombinant PAF-AH of the
invention;
[0029] FIG. 5 is a bar graph illustrating blockage of PAF-induced
rat foot edema by intravenously administered PAF-AH;
[0030] FIG. 6 is a bar graph showing that PAF-AH blocks PAF-induced
edema but not zymosan A-induced edema;
[0031] FIGS. 7A and 7B present dose response results of PAF-AH
anti-inflammatory activity in rat food edema;
[0032] FIGS. 8A and 8B present results indicating the in vivo
efficacy of a single dose of PAF-AH over time;
[0033] FIG. 9 is a line graph representing the pharmacokinetics of
PAF-AH in rat circulation; and
[0034] FIG. 10 is a bar graph showing the anti-inflammatory effects
of PAF-AH in comparison to the lesser effects of PAF antagonists in
rat foot edema.
DETAILED DESCRIPTION
[0035] The following examples illustrate the invention. Example 1
presents a novel method for the purification of PAF-AH from human
plasma. Example 2 describes amino acid microsequencing of the
purified human plasma PAF-AH. The cloning of a full length cDNA
encoding human plasma PAF-AH is described in Example 3.
Identification of a putative splice variant of the human plasma
PAF-AH gene is described in Example 4. The cloning of genomic
sequences encoding human plasma PAF-AH is described in Example 5.
Example 6 desribes the cloning of canine, murine, bovine, chicken,
rodent and macaque cDNAs homologous to the human plasma PAF-AH
cDNA. Example 7 presents the results of an assay evidencing the
enzymatic activity of recombinant PAF-AH transiently expressed in
COS 7 cells. Example 8 describes the expression of human PAF-AH in
E. coli, S. cerevisiae and mammalian cells. Example 9 presents
protocols for purification of recombinant PAF-AH from E. coli and
assays confirming its enzymatic activity. Example 10 describes
various recombinant PAF-AH products including amino acid
substitution analogs and amino and carboxy-truncated products, and
describes experiments demonstrating that native PAF-AH isolated
from plasma is glycosylated. Results of a Northern blot assay for
expression of human plasma PAF-AH RNA in various tissues and cell
lines are presented in Example 11 while results of in situ
hybridzation are presented in Example 12. Example 13 describes the
development of monoclonal and polyclonal antibodies specific for
human plasma PAF-AH. Examples 14, 15, 16, 17 and 18 respectively
describe the in vivo therapeutic effect of administration of
recombinant PAF-AH products of the invention on acute inflammation,
pleurisy, asthma, necrotizing enterocolitis, and adult respiratory
distress syndrome in animal models. Example 19 presents the results
of immunoassays of serum of human patients exhibiting a deficiency
in PAF-AH activity and describes the identification of a genetic
lesion in the patients which is apparently responsible for the
deficiency.
EXAMPLE 1
[0036] PAF-AH was purified from human plasma in order to provide
material for amino acid sequencing.
[0037] A. Optimization of Purification Conditions
[0038] Initially, low density lipoprotein (LDL) particles were
precipitated from plasma with phosphotungstate and solubilized in
0.1% Tween 20 and subjected to chromatography on a DEAE column
(Pharmacia, Uppsala, Sweden) according to the method of Stafforini
et al. (1987), supra, but inconsistent elution of PAF-AH activity
from the DEAE column required reevaluation of the solubilization
and subsequent purification conditions.
[0039] Tween 20, CHAPS (Pierce Chemical Co., Rockford, Ill.) and
octyl glucoside were evaluated by centrifugation and gel filtration
chromatography for their ability to solubilize LDL particles. CHAPS
provided 25% greater recovery of solubilized activity than Tween 20
and 300% greater recovery than octyl glucoside. LDL precipitate
solubilized with 10 mM CHAPS was then fractionated on a DEAE
Sepharose Fast Flow column (an anion exchange column; Pharmacia)
with buffer containing 1 mM CHAPS to provide a large pool of
partially purified PAF-AH ("the DEAE pool") for evaluation of
additional columns.
[0040] The DEAE pool was used as starting material to test a
variety of chromatography columns for utility in further purifying
the PAF-AH activity. The columns tested included: Blue Sepharose
Fast Flow (Pharmacia), a dye ligand affinity column; S-Sepharose
Fast Flow (Pharmacia), a cation exchange column; Cu Chelating
Sepharose (Pharmacia), a metal ligand affinity column; Fractogel S
(EM Separations, Gibbstown, N.J.), a cation exchange column; and
Sephacryl-200 (Pharmacia), a gel filtration column. These
chromatographic procedures all yielded low, unsatisfactory levels
of purification when operated in 1 mM CHAPS. Subsequent gel
filtration chromatography on Sephacryl S-200 in 1 mM CHAPS
generated an enzymatically active fraction which eluted over a
broad size range rather than the expected 44 kDa approximate size.
Taken together, these results indicated that the LDL proteins were
aggregating in solution.
[0041] Different LDL samples were therefore evaluated by analytical
gel filtration chromatography for aggregation of the PAF-AH
activity. Samples from the DEAE pool and of freshly solubilized LDL
precipitate were analyzed on Superose 12 (Pharmacia) equilibrated
in buffer with 1 mM CHAPS. Both samples eluted over a very broad
range of molecular weights with most of the activity eluting above
150 kDa. When the samples were then analyzed on Superose 12
equilibrated with 10 mM CHAPS, the bulk of the activity eluted near
44 kDa as expected for PAF-AH activity. However, the samples
contained some PAF-AH activity in the high molecular weight region
corresponding to aggregates.
[0042] Other samples eluted PAF-AH activity exclusively in the
approximately 44 kDa range when they were subsequently tested by
gel filtration. These samples were an LDL precipitate solubilized
in 10 mM CHAPS in the presence of 0.5M NaCl and a fresh DEAE pool
that was adjusted to 10 mM CHAPS after elution from the DEAE
column. These data indicate that at least 10 mM CHAPS is required
to maintain non-aggregated PAF-AH. Increase of the CHAPS
concentration from 1 mM to 10 mM after chromatography on DEAE but
prior to subsequent chromatographic steps resulted in dramatic
differences in purification. For example, the degree of PAF-AH
purification on S-Sepharose Fast Flow was increased from 2-fold to
10-fold. PAF-AH activity bound the Blue Sepharose Past Flow column
irreversibly in 1 mM CHAPS, but the column provided the highest
level of purification in 10 mM CHAPS. The DEAE chromatography was
not improved with prior addition of 10 mM CHAPS.
[0043] Chromatography on Cu Chelating Sepharose after the Blue
Sepharose Fast Flow column concentrated PAF-AH activity 15-fold. It
was also determined that PAF-AH activity could be recovered from a
reduced SDS-polyacrylamide gel, as long as samples were not boiled.
The activity of material eluted from the Cu Chelating Sepharose
column when subjected to SDS-polyacrylamide gel electrophoresis
coincided with a major protein band when the gel was silver
stained.
[0044] B. PAF-AH Purification Protocol
[0045] The novel protocol utilized to purify PAF-AH for amino acid
sequencing therefore comprised the following steps which were
performed at 4.degree. C. Human plasma was divided into 900 ml
aliquots in 1 liter Nalgene bottles and adjusted to pH 8.6. LDL
particles were then precipitated by adding 90 ml of 3.85% sodium
phosphotungstate followed by 23 ml of 2M MgCl.sub.2. The plasma was
then centrifuged for 15 minutes at 3600 g. Pellets were resuspended
in 800 ml of 0.2% sodium citrate. LDL was precipitated again by
adding 10 g NaCl and 24 ml of 2M MgCl.sub.2. LDL particles were
pelleted by centrifugation for 15 minutes at 3600 g. This wash was
repeated twice. Pellets were then frozen at -20.degree. C. LDL
particles from 5 L of plasma were resuspended in 5 L of buffer A
(25 mM Tris-HCl, 10 mM CHAPS, pH 7.5) and stirred overnight.
Solubilized LDL particles were centrifuged at 3600 g for 1.5 hours.
Supernatants were combined and filtered with Whatman 113 filter
paper to remove any remaining solids. Solubilized LDL supernatant
was loaded on a DEAE Sepharose Fast Flow column (11 cm.times.10 cm;
1 L resin volume; 80 ml/minute) equilibrated in buffer B (25 mM
Tris-HCl, 1 mM CHAPS, pH 7.5). The column was washed with buffer B
until absorbance returned to baseline. Protein was eluted with an 8
L, 0-0.5M NaCl gradient and 480 ml fractions were collected. This
step was necessary to obtain binding to the Blue Sepharose Fast
Flow column below. Fractions were assayed for acetylhydrolase
activity essentially by the method described in Example 4.
[0046] Active fractions were pooled and sufficient CHAPS was added
to make the pool about 10 mM CHAPS. The DEAE pool was loaded
overnight at 4 ml/minute onto a Blue Sepharose Fast Flow column (5
cm.times.10 cm; 200 ml bed volume) equilibrated in buffer A
containing 0.5M NaCl. The column was washed with the equilibration
buffer at 16 ml/minute until absorbance returned to baseline.
PAF-AH activity was step eluted with buffer A containing 0.5M KSCN
(a chaotropic salt) at 16 ml/minute and collected in 50 ml
fractions. This step resulted in greater than 1000-fold
purification. Active fractions were pooled, and the pool was
adjusted to pH 8.0 with 1M Tris-HCl pH 8.0. The active pool from
Blue Sepharose Fast Flow chromatography was loaded onto a Cu
Chelating Sepharose column (2.5 cm.times.2 cm; 10 ml bed volume; 4
ml/minute) equilibrated in buffer C [25 mM Tris-HCl, 10 mM CHAPS,
0.5M NaCl, pH 8.0 (pH 7.5 also worked)], and the column was washed
with 50 ml buffer C. PAF-AH activity was eluted with 100 ml 50 mM
imidazole in buffer C and collected in 10 ml fractions. Fractions
containing PAF-AH activity were pooled and dialyzed against buffer
A. In addition to providing a 15-fold concentration of PAF-AH
activity, the Cu Chelating Sepharose column gave a small
purification. The Cu Chelating Sepharose pool was reduced in 50 mM
DTT for 15 minutes at 37.degree. C. and loaded onto a 0.75 mm, 7.5%
polyacrylamide gel. Gel slices were cut every 0.5 cm and placed in
disposable microfuge tubes containing 200 .mu.l 25 mM Tris-HCl, 10
mM CHAPS, 150 mM NaCl. Slices were ground up and allowed to
incubate overnight at 4.degree. C. The supernatant of each gel
slice was then assayed for PAF-AH activity to determine which
protein band on SDS-PAGE contained PAF-AH activity. PAF-AH activity
was found in an approximately 44 kDa band. Protein from a duplicate
gel was electrotransferred to a PVDF membrane (Immobilon-P.
Millipore) and stained with Coomassie Blue. A photograph of the
PVDF membrane is presented in FIG. 1.
[0047] As presented in Table I below, approximately 200 .mu.g
PAF-AH was purified 2.times.10.sup.6-fold from 5 L human plasma. In
comparison, a 3.times.10.sup.4-fold purification of PAF-AH activity
is described in Stafforini et al. (1987), supra.
1TABLE 1 Prot. Total Conc. Specific % Recovery Vol. Activity
Activity (mg/ Activity of Activity Fold Purification Sample (ml)
(cpm .times. 10.sup.6) (cpm .times. 10.sup.6) ml) (cpm .times.
10.sup.6) Step Cum. Step Cum. Plasma 5000 23 116 62 0.37 100 100 1
1 LDL 4500 22 97 1.76 12 84 84 33 33 DEAE 4200 49 207 1.08 46 212
178 3.7 124 Blue 165 881 14 0.02 54200 70 126 1190 1.5 .times.
10.sup.5 Cu 12 12700 152 0.15 82200 104 131 1.5 2.2 .times.
10.sup.5 SDS-PAGE -- -- -- -- -- -- -- -10 2.2 .times. 10.sup.6
[0048] In summary, the following steps were unique and critical for
successful purification of plasma PAF-AH for microsequencing: (1)
solubilization and chromatography in 10 mM CHAPS, (2)
chromatography on a blue ligand affinity column such as Blue
Sepharose Fast Flow, (3) chromatography on a Cu ligand affinity
column such as Cu Chelating Sepharose, and (4) elution of PAF-AH
from SDS-PAGE.
EXAMPLE 2
[0049] For amino acid sequencing, the approximately 44 kDa protein
band from the PAF-AH-containing PVDF membrane described in Example
1 was excised and sequenced using an Applied Biosystems 473A
Protein sequencer. N-terminal sequence analysis of the
approximately 44 kDa protein band corresponding to the PAF-AH
activity indicated that the band contained two major sequences and
two minor sequences. The ratio of the two major sequences was 1:1
and it was therefore difficult to interpret the sequence data.
[0050] To distinguish the sequences of the two major proteins which
had been resolved on the SDS gel, a duplicate PVDF membrane
containing the approximately 44 kDa band was cut in half such that
the upper part and the lower part of the membrane were separately
subjected to sequencing.
[0051] The N-terminal sequence obtained for the lower half of the
membrane was:
2 F K D L G E E N F K A L V L I A F SEQ ID NO: 1
[0052] A search of protein databases revealed this sequence to be a
fragment of human serum albumin. The upper half of the same PVDF
membrane was also sequenced and the N-terminal amino acid sequence
determined was:
3 I Q V L M A A A S F G Q T K I P SEQ ID NO: 2
[0053] This sequence did not match any protein in the databases
searched and was different from the N-terminal amino acid
sequence:
4 M K P L V V F V L G G SEQ ID NO: 3
[0054] which was reported for erythrocyte cytoplasmic PAF-AH in
Stafforini et al. (1993), supra. The novel sequence (SEQ ID NO: 2)
was utilized for cDNA cloning of human plasma PAF-AH as described
below in Example 3.
EXAMPLE 3
[0055] A full length clone encoding human plasma PAF-AH was
isolated from a macrophage cDNA library.
[0056] A. Construction of a Macrophage cDNA Library
[0057] Poly A.sup.+ RNA was harvested from peripheral blood
monocyte-derived macrophages. Double-stranded, blunt-ended cDNA was
generated using the Invitrogen Copy Kit (San Diego, Calif.) and
BstXI adapters were ligated to the cDNA prior to insertion into the
mammalian expression vector, pRc/CMV (Invitrogen). The resulting
plasmids were introduced into E. coli strain XL-1 Blue by
electroporation. Transformed bacteria were plated at a density of
approximately 3000 colonies per agarose plate on a total of 978
plates. Plasmid DNA prepared separately from each plate was
retained in individual pools and was also combined into larger
pools representing 300,000 clones each.
[0058] B. Library Screening by PCR
[0059] The macrophage library was screened by the polymerase chain
reaction utilizing a degenerate antisense oligonucleotide PCR
primer based on the novel N-terminal amino acid sequence described
in Example 2. The sequence of the primer is set out below in IUPAC
nomenclature and where "I" is an inosine.
5 5' ACATGAATTCGGIATCYTTIGTYTG1CCRAA 3' SEQ ID NO: 4
[0060] The codon choice tables of Wada et al., Nuc. Acids Res.,
19S: 1981-1986 (1991) were used to select nucleotides at the third
position of each codon of the primer. The primer was used in
combination with a primer specific for either the SP6 or T7
promoter sequences, both of which flank the cloning site of
pRc/CMV, to screen the macrophage library pools of 300,000 clones.
All PCR reactions contained 100 ng of template cDNA, 1 .mu.g of
each primer, 0.125 mM of each dNTP, 10 mM Tris-HCl pH 8.4, 50 mM
MgCl.sub.2 and 2.5 units of Taq polymerase. An initial denaturation
step of 94.degree. C. for four minutes was followed by 30 cycles of
amplification of 1 minute at 94.degree. C., 1 minute at 60.degree.
C. and 2 minutes at 72.degree. C. The resulting PCR product was
cloned into pBluescript SK (Stratagene, La Jolla, Calif.) and its
nucleotide sequence determined by the dideoxy chain termination
method. The PCR product contained the sequence predicted by the
novel peptide sequence and corresponds to nucleotides 1 to 331 of
SEQ ID NO: 7.
[0061] The PCR primers set out below, which are specific for the
cloned PCR fragment described above, were then designed for
identifying a full length clone.
6 (SEQ ID NO: 5) Sense Primer 5' TATTTCTAGAAGTGTGGTGGAACTCGCTGG 3'
(SEQ ID NO: 6) Antisense Primer 5' CGATGAATTCAGCTTGCAGCAGCCATCAGTAC
3'
[0062] PCR reactions utilizing the primers were performed as
described above to first screen the cDNA pools of 300,000 clones
and then the appropriate subset of the smaller pools of 3000
clones. Three pools of 3000 clones which produced a PCR product of
the expected size were then used to transform bacteria.
[0063] C. Library Screening by Hybridization
[0064] DNA from the transformed bacteria was subsequently screened
by hybridization using the original cloned PCR fragment as a probe.
Colonies were blotted onto nitrocellulose and prehybridized and
hybridized in 50% formamide, 0.75M sodium chloride, 0.075M sodium
citrate, 0.05M sodium phosphate pH 6.5, 1% polyvinyl pyrolidine, 1%
Ficoll, 1% bovine serum albumin and 50 ng/ml sonicated salmon sperm
DNA. The hybridization probe was labeled by random hexamer priming.
After overnight hybridization at 42.degree. C., blots were washed
extensively in 0.03M sodium chloride, 3 mM sodium citrate, 0.1% SDS
at 42.degree. C. The nucleotide sequence of 10 hybridizing clones
was determined. One of the clones, clone sAH 406-3, contained the
sequence predicted by the original peptide sequence of the PAF-AH
activity purified from human plasma. The DNA and deduced amino acid
sequences of the human plasma PAF-AH are set out in SEQ ID NOs: 7
and 8, respectively.
[0065] Clone sAH 406-3 contains a 1.52 kb insert with an open
reading frame that encodes a predicted protein of 441 amino acids.
At the amino terminus, a relatively hydrophobic segment of 41
residues precedes the N-terminal amino acid (the isoleucine at
position 42 of SEQ ID NO: 8) identified by protein microsequencing.
The encoded protein may thus have either a long signal sequence or
a signal sequence plus an additional peptide that is cleaved to
yield the mature functional enzyme. The presence of a signal
sequence is one characteristic of secreted proteins. In addition,
the protein encoded by clone sAH 406-3 includes the consensus GxSxG
motif (amino acids 271-275 of SEQ ID NO: 8) that is believed to
contain the active site serine of all known mammalian lipases,
microbial lipases and serine proteases. See Chapus et al.,
Biochimie, 70: 1223-1224 (1988) and Brenner, Nature, 334: 528-530
(1988).
[0066] Table 2 below is a comparison of the amino acid composition
of the human plasma PAF-AH of the invention as predicted from SEQ
ID NO: 8 and the amino acid composition of the purportedly purified
material described by Stafforini et al. (1987), supra.
7 TABLE 2 Clone sAH 406-3 Stafforini et al. Ala 26 24 Asp & Asn
48 37 Cys 5 14 Glu & Gln 36 42 Phe 22 12 Gly 29 58 His 13 24
Ile 31 17 Lys 26 50 Leu 40 26 Met 10 7 Pro 15 11 Arg 18 16 Ser 27
36 Thr 20 15 Val 13 14 Trp 7 Not determined Tyr 14 13
[0067] The amino acid composition of the mature form of the human
plasma PAF-AH of the invention and the amino acid composition of
the previously purified material that was purportedly the human
plasma PAF-AH are clearly distinct.
[0068] When alignment of the Hattori et al., supra nucleotide and
deduced amino acid sequences of bovine brain cytoplasmic PAF-AH
with the nucleotide and amino acid sequences of the human plasma
PAF-AH of the invention was attempted, no significant structural
similarity in the sequences was observed.
EXAMPLE 4
[0069] A putative splice variant of the human PAF-AH gene was
detected when PCR was performed on macrophage and stimulated PBMC
cDNA using primers that hybridized to the 5' untranslated region
(nucleotides 31 to 52 of SEQ ID NO: 7) and the region spanning the
translation termination codon at the 3' end of the PAF-AH cDNA
(nucleotides 1465 to 1487 of SEQ ID NO: 7). The PCR reactions
yielded two bands on a gel, one corresponding to the expected size
of the PAF-AH cDNA of Example 3 and the other was about 100 bp
shorter. Sequencing of both bands revealed that the larger band was
the PAF-AH cDNA of Example 3 while the shorter band lacked exon 2
(Example 5 below) of the PAF-AH sequence which encodes the putative
signal and pro-peptide sequences of plasma PAF-AH. The predicted
catalytic triad and all cysteines were present in the shorter
clone, therefore the biochemical activity of the protein encoded by
the clone is likely to match that of the plasma enzyme.
[0070] To begin to assess the biological relevance of the PAF-AH
splice variant that is predicted to encode a cytoplasmically active
enzyme, the relative abundance of the two forms in blood
monocyte-derived macrophages was assayed by RNase protection.
Neither message was present in freshly isolated monocytes but both
messages were found at day 2 of in vitro differentiation of the
monocytes into macrophages and persisted through 6 days of culture.
The quantity of the two messages was approximately equivalent
throughout the differentiation period. In contrast, similar analyes
of neural tissues revealed that only full length message predicted
to encode the full length extracellular form of PAF-AH is
expressed.
EXAMPLE 5
[0071] Genomic human plasma PAF-AH sequences were also isolated.
The structure of the PAF-AH gene was determined by isolating lambda
and P1 phage clones containing human genomic DNA by DNA
hybridization under conditions of high stringency. Fragments of the
phage clones were subcloned and sequenced using primers designed to
anneal at regular intervals throughout the cDNA clone sAH 406-3. In
addition, new sequencing primers designed to anneal to the intron
regions flanking the exons were used to sequence back across the
exon-intron boundaries to confirm the sequences. Exon/intron
boundaries were defined as the points where the genomic and cDNA
sequences diverged. These analyses revealed that the human PAF-AH
gene is comprised of 12 exons.
[0072] Exons 1, 2, 3, 4, 5, 6, and part of 7 were isolated from a
male fetal placental library constructed in lamda FIX (Stratagene).
Phage plaques were blotted onto nitrocellulose and prehybridized
and hybridized in 50% formamide, 0.75M sodium chloride, 75 mM
sodium citrate, 50 mM sodium phosphate (pH 6.5), 1% polyvinyl
pyrolidine, 1% Ficoll, 1% bovine serum albumin, and 50 ng/ml
sonicated salmon sperm DNA. The hybridization probe used to
identify a phage clone containing exons 2-6 and part of 7 consisted
of the entire cDNA clone sAH 406-3. A clone containing exon 1 was
identified using a fragment derived from the 5' end of the cDNA
clone (nucleotides 1 to 312 of SEQ ID NO: 7). Both probes were
labelled with .sup.32P by hexamer random priming. After overnight
hybridization at 42.degree. C., blots were washed extensively in 30
mM sodium chloride, 3 mM sodium citrate, 0.1% SDS at 42.degree. C.
The DNA sequences of exons 1, 2, 3, 4, 5, and 6 along with partial
surrounding intron sequences are set out in SEQ ID NOs: 9, 10, 11,
12, 13, and 14, respectively.
[0073] The remainder of exon 7 as well as exons 8, 9, 10, 11, and
12 were subcloned from a P1 clone isolated from a human P1 genomic
library. P1 phage plaques were blotted onto nitrocellulose and
prehybridized and hybridized in 0.75M sodium chloride, 50 mM sodium
phosphate (pH 7.4), 5 mM EDTA, 1% polyvinyl pyrolidine, 1% Ficoll,
1% bovine serum albumin, 0.5% SDS, and 0.1 mg/ml total human DNA.
The hybridization probe, labeled with .sup.32P by hexamer random
priming, consisted of a 2.6 kb EcoR1 fragment of genomic DNA
derived from the 3' end of a lambda clone isolated above. This
fragment contained exon 6 and the part of exon 7 present on the
phage clone. After overnight hybridization at 65.degree. C., blots
were washed as described above. The DNA sequences of exons 7, 8, 9,
10, 11, and 12 along with partial surrounding intron sequences are
set out in SEQ ID NOs: 15, 16, 17, 18, 19, and 20,
respectively.
EXAMPLE 6
[0074] Full length plasma PAF-AH cDNA clones were isolated from
mouse, canine, bovine and chicken spleen cDNA libraries and a
partial rodent clone was isolated from a rat thymus cDNA library.
The clones were identified by low stringency hybridization to the
human cDNA (hybridization conditions were the same as described for
exons 1 through 6 in Example 5 above except that 20% formamide
instead of 50% formamide was used). A 1 kb HindIII fragment of the
human PAF-AH sAH 406-3 cDNA clone (nucleotides 309 to 1322 of SEQ
ID NO: 7) was used as a probe. In addition, a partial monkey clone
was isolated from macaque brain cDNA by PCR using primers based on
nucleotides 285 to 303 and 851 to 867 of SEQ ID NO: 7. The
nucleotide and deduced amino acid sequences of the mouse, canine,
bovine, chicken, rat, and macaque cDNA clones are set out in SEQ ID
NOs: 21, 22, 23, 24, 25, and 26, respectively.
[0075] A comparison of the deduced amino acid sequences of the cDNA
clones with the human cDNA clone results in the amino acid
percentage identity values set out in Table 3 below.
8 TABLE 3 Human Dog Mouse Bovine Chicken Dog 80 100 64 82 50 Mouse
66 64 100 64 47 Monkey 92 82 69 80 52 Rat 74 69 82 69 55 Bovine 82
82 64 100 50 Chicken 50 50 47 50 100
[0076] About 38% of the residues are completely conserved in all
the sequences. The most divergent regions are at the amino terminal
end (containing the signal sequence) and the carboxyl terminal end
which are shown in Example 10 as not critical for enzymatic
activity. The Gly-Xaa-Ser-Xaa-Gly motif (SEQ ID NO: 27) found in
neutral lipases and other esterases was conserved in the bovine,
canine, mouse, rat and chicken PAF-AH. The central serine of this
motif serves as the active site nucleophile for these enzymes. The
predicted aspartate and histidine components of the active site
(Example 10A) were also conserved. The human plasma PAF-AH of the
invention therefore appears to utilize a catalytic triad and may
assume the .alpha./.beta. hydrolase conformation of the neutral
lipases even though it does not exhibit other sequence homology to
the lipases.
[0077] Moreover, human plasma PAF-AH is expected to have a region
that mediates its specific interaction with the low density and
high density lipoprotein particles of plasma. Interaction with
these particles may be mediated by the N-terminal half of the
molecule which has large stretches of amino acids highly conserved
among species but does not contain the catalytic triad of the
enzyme.
EXAMPLE 7
[0078] To determine whether human plasma PAF-AH cDNA clone sAH
406-3 (Example 3) encodes a protein having PAF-AH activity, the
pRc/CMV expression construct was transiently expressed in COS 7
cells. Three days following transfection by a DEAE Dextran method,
COS cell media was assayed for PAF-AH activity.
[0079] Cells were seeded at a density of 300,000 cells per 60 mm
tissue culture dish. The following day, the cells were incubated in
DMEM containing 0.5 mg/ml DEAE dextran, 0.1 mM chloroquine and 5-10
.mu.g of plasmid DNA for 2 hours. Cells were then treated with 10%
DMSO in phosphate-buffered saline for 1 minute, washed with media
and incubated in DMEM containing 10% fetal calf serum previously
treated with diisopropyl fluorophosphate (DFP) to inactivate
endogenous bovine serum PAF-AH. After 3 days of incubation, media
from transfected cells were assayed for PAF-AH activity. Assays
were conducted in the presence and absence of either 10 mM EDTA or
1 mM DFP to determine whether the recombinant enzyme was
calcium-independent and inhibited by the serine esterase inhibitor
DFP as previously described for plasma PAF-AH by Stafforini et al.
(1987), supra. Negative controls included cells transfected with
pRc/CMV either lacking an insert or having the sAH 406-3 insert in
reverse orientation.
[0080] PAF-AH activity in transfectant supernatants was determined
by the method of Stafforini et al. (1990), supra, with the
following modifications. Briefly, PAF-AH activity was determined by
measuring the hydrolysis of .sup.3H-acetate from [acetyl-.sup.3H)
PAF (New England Nuclear, Boston, Mass.). The aqueous free
.sup.3H-acetate was separated from labeled substrate by
reversed-phase column chromatography over octadecylsilica gel
cartridges (Baker Research Products, Phillipsburg, Pa.). Assays
were carried out using 10 .mu.l transfectant supernatant in 0.1M
Hepes buffer, pH 7.2, in a reaction volume of 50 .mu.l. A total of
50 pmoles of substrate were used per reaction with a ratio of 1:5
labeled: cold PAF. Reactions were incubated for 30 minutes at
37.degree. C. and stopped by the addition of 40 .mu.l of 10M acetic
acid. The solution was then washed through the octadecylsilica gel
cartridges which were then rinsed with 0.1M sodium acetate. The
aqueous eluate from each sample was collected and counted in a
liquid scintillation counter for one minute. Enzyme activity was
expressed in counts per minute.
[0081] As shown in FIG. 2, media from cells transfected with sAH
406-3 contained PAF-AH activity at levels 4-fold greater than
background. This activity was unaffected by the presence of EDTA
but was abolished by 1 mM DFP. These observations demonstrate that
clone sAH 406-3 encodes an activity consistent with the human
plasma enzyme PAF-AH.
EXAMPLE 8
[0082] Human plasma PAF-AH cDNA was expressed in E. coli and yeast
and stably expressed in mammalian cells by recombinant methods.
[0083] A. Expression in E. coli
[0084] PCR was used to generate a protein coding fragment of human
plasma PAF-AH cDNA from clone sAH 406-3 which was readily amenable
to subcloning into an E. coli expression vector. The subcloned
segment began at the 5' end of the human gene with the codon that
encodes Ile.sub.42 (SEQ ID NO: 8), the N-terminal residue of the
enzyme purified from human plasma. The remainder of the gene
through the native termination codon was included in the construct.
The 5' sense PCR primer utilized was:
[0085] SEQ ID NO: 28
[0086] 5' TATTCTAGAATTATGATACAAGTATTAATGGCTGCTGCAAG 3' and
contained an XbaI cloning site as well as a translation initiation
codon (underscored). The 3' antisense primer utilized was:
9 SEQ ID NO: 29 5' ATTGATATCCTAATTGTATTTCTCTATTCCTG 3'
[0087] and encompassed the termination codon of sAH 406-3 and
contained an EcoRV cloning site. PCR reactions were performed
essentially as described in Example 3. The resulting PCR product
was digested with XbaI and EcoRV and subcloned into a pBR322 vector
containing the Trp promoter [deBoer et al., PNAS. 80:21-25 (1983)]
immediately upstream of the cloning site. E. coli strain XL-1 Blue
was transformed with the expression construct and cultured in L
broth containing 100 .mu.g/ml of carbenicillin. Transformants from
overnight cultures were pelleted and resuspended in lysis buffer
containing 50 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM CHAPS, 1 mM
EDTA, 100 .mu.g/ml lysozyme, and 0.05 trypsin-inhibiting units
(TIU)/ml Aprotinin. Following a 1 hour incubation on ice and
sonication for 2 minutes, the lysates were assayed for PAF-AH
activity by the method described in Example 4. E. coli transformed
with the expression construct (designated trp AH) generated a
product with PAF-AH activity. See Table 6 in Example 9.
[0088] Constructs including three additional promoters, the tacII
promoter (deBoer, supra), the arabinose (ara) B promoter from
Salmonella typhimurium [Horwitz et al., Gene, 14: 309-319 (1981)],
and the bacteriophage T7 promoter, were also utilized to drive
expression of human PAF-AH sequences in E. coli. Constructs
comprising the Trp promoter (pUC trp AH), the tacII promoter (pUC
tac AH), and the araB promoter (pUC ara AH) were assembled in
plasmid pUC19 (New England Biolabs, MA) while the construct
comprising the 17 promoter (pET AH) was assembled in plasmid pET15B
(Novagen, Madison, Wis.). A construct containing a hybrid promoter,
pHAB/PH, consisting of the araB promoter fused to the ribosome
binding sites of the T7 promoter region was also assembled in
pET15B. All E. coli constructs produced PAF-AH activity within a
range of 20 to 50 U/ml/OD.sub.600. This activity corresponded to a
total recombinant protein mass of .gtoreq.1% of the total cell
protein.
[0089] Several E. coli expression constructs were also evaluated
which produce PAF-AH with extended amino termini. The N-terminus of
natural plasma PAF-AH was identified as Ile.sub.42 by amino acid
sequencing (Example 2). However, the sequence immediately upstream
of Ile.sub.42 does not conform to amino acids found at signal
sequence cleavage sites [i.e., the "-3-1-rule" is not followed as
lysine is not found at position -1; see von Heijne, Nuc. Acids
Res., 14:4683-4690 (1986)]. Presumably a more classical signal
sequence (M.sub.1-A.sub.17) is recognized by the cellular secretion
system, followed by endoproteolytic cleavage. The entire coding
sequence for PAF-AH beginning at the initiating methionine
(nucleotides 162 to 1487 of SEQ ID NO: 7) was engineered for
expression in E. coli using the trp promoter. As shown in Table 4,
this construct made active PAF-AH, but expression was at about one
fiftieth of the level of the original construct beginning at
Ile.sub.42. Another expression construct, beginning at Val.sub.18
(nucleotides 213 to-1487 of SEQ ID NO: 7), produced active PAF-AH
at about one third the level of the original construct. These
results suggest that amino terminal end extensions are not critical
or necessary for activity of recombinant PAF-AH produced in E.
coli.
10 TABLE 4 PAF-AH activity (U/ml/OD.sub.600) Construct Lysate Media
pUC trp AH 177.7 0.030 pUC trp AH Met.sub.1 3.1 0.003 pUC trp AH
Val.sub.18 54.6 0.033
[0090] Recombinant human PAF-AH was also produced in E. coli using
a low copy number plasmid and a promoter that can be induced by the
addition of arabinose to the culture. The PAF-AH protein encoded
within the plasmid begins at the methionine forty-six residues from
the N-terminus of the polypeptide encoded by full length PAF-AH
cDNA.
[0091] The plasmid used for production of human PAF-AH in bacterial
cells was pBAR2/PH.2, which is a pBR322-based plasmid that carries
(1) nucleotides 297 to 1487 of SEQ ID NO: 7 encoding human PAF-AH
beginning with the methionine codon at position 46, (2) the araB-C
promoters and araC gene from the arabinose operon of Salmonella
typhimurium, (3) a transcription termination sequence from the
bacteriophage T7, and (4) a replication origin from bacteriophage
f1.
[0092] Specifically, pBAR2/PH.2 included the following segments of
DNA: (1) from the destroyed AatII site at position 1994 to the
EcoRI site at nucleotide 6274, vector sequence containing an origin
of replication and genes encoding resistance to either ampicillin
or tetracycline derived from the bacterial plasmid pBR322; (2) from
the EcoRI site at position 6274 to the XbaI site at position 131,
DNA from the Salmonella typhimurium arabinose operon (Genbank
accession numbers M11045, M11046, M11047, J01797); (3) from the
XbaI site at position 131 to the NcoI site at position 170, DNA
containing a ribosome binding site from pET-21b (Novagen. Madison,
Wis.); (4) from the NcoI site at position 170 to the XhoI site at
position 1363, human PAF-AH cDNA sequence; and (5) from the XhoI
site at position 1363 to the destroyed AatII site at position 1993,
a DNA fragment from pET-21b (Novagen) that contains a transcription
termination sequence from bacteriophae T7 and an origin of
replication from bacteriophage f1.
[0093] Expression of PAF-AH in pBAR2/PH.2 is under the control of
the araB promoter, which is tightly repressed in the presence of
glucose and absence of arabinose, but functions as a strong
promoter when L-arabinose is added to cultures depleted of glucose.
Selection for cells containing the plasmid can be accomplished
through the addition of either ampicillin (or related antibiotics)
or tetracycline to the culture medium.
[0094] The E. coli strain used for production of PAF-AH is MC1061
(ATCC 53338), which carries a deletion of the arabinose operon and
thereby cannot metabolize arabinose. The advantage of using a
strain that is unable to break down arabinose is that the inducer
(arabinose) for production of PAF-AH is not depleted from the
medium during the induction period, resulting in higher levels of
PAF-AH compared to that obtained with strains that are capable of
metabolizing arabinose. MC1061 is also a leucine auxotroph and was
cultivated by batch-fed process using a defined media containing
casamino acids that complement the leucine mutation. Cells were
grown at 30.degree. C. in batch media containing 2 gm/L glucose.
Glucose serves the dual purpose of carbon source for cell growth,
and repressor of the arabinose promoter. When batch glucose levels
were depleted (<50 mg/L), a nutrient feed (containing 300 gm/L
glucose) was started. The feed was increased linearly for 16 hours
at a rate which limited acid bi-product formation. At this point,
the nutrient feed was switched to media containing glycerol instead
of glucose. Simultaneously, 500 gm/L L-arabinose was added to a
final concentration of 5 gm/L. The glycerol feed was kept at a
constant feed rate for 22 hours. Cells were harvested using
hollow-fiber filtration to concentrate the suspension approximately
10-fold. Cell paste was stored at -70.degree. C. A final cell mass
of about 80 gm/L was obtained (OD.sub.600=50-60) with a PAF-AH
activity of 65-70 U/OD/ml representing about 10% of total cell
protein. The final culture volume of about 75 liters contained
50-60 gm PAF-AH.
[0095] B. Expression in Yeast Cells
[0096] Recombinant human PAF-AH was also expressed in Saccharomyces
cerevisiae. The yeast ADH2 promoter was used to drive rPAF-AH
expression and produced 7 U/ml/OD.sub.600 (Table 5 below).
11TABLE 5 Enzyme Activity Construct Promoter Strain (U/ml/OD) pUC
tac AH tac E. coli W3110 30 pUC trp AH trp E. coli W3110 40 pUC ara
AH araB E. coli W3110 20 pET AH T7 E. coli BL21 (DE3) 50 (Novagen)
pHAB/PH araB/T7 E. coli XL-1 34 pBAR2/PH.2 araB MC1061 90 pYep ADH2
AH ADH2 Yeast BJ2.28 7
[0097] C. Expression of PAF-AH in Mammalian Cells
[0098] 1. Expression of Human PAF-AH cDNA Constructs
[0099] Plasmids constructed for expression of PAF-AH, with the
exception of pSFN/PAFAH.1, employ a strong viral promoter from
cytomegalovirus, a polyadenylation site from the bovine growth
hormone gene, and the SV40 origin of replication to permit high
copy number replication of the plasmid in COS cells. Plasmids were
electroporated into cells.
[0100] A first set of plasmids was constructed in which the 5'
flanking sequence (pDC1/PAFAH.1) or both the 5' or 3' flanking
sequences (PDC1/PAFAH.2) of the human PAF-AH cDNA were replaced
with flanking sequences from other genes known to be expressed at
high levels in mammalian cells. Transfection of these plasmids into
COS, CHO or 293 cells led to production of PAF-AH at about the same
level (0.01 units/ml or 2-4 fold above background) as that cited
for clone sAH 406-3 in Example 7 after transient transfection of
COS cells. Another plasmid was constructed which included a Friend
spleen focus-forming virus promoter instead of the cytomegalovirus
promoter. The human PAF-AH cDNA was inserted into plasmid pmH-neo
Hahn et al., Gene, 127: 267 (1993)] under control of the Friend
spleen focus-forming virus promoter. Transfection of the myeloma
cell line NS0 with the plasmid which was designated pSFN/PAFAH.1
and screening of several hundred clones resulted in the isolation
of two transfectants (4B11 and 1C11) that made 0.15-0.5 units/ml of
PAF-AH activity. Assuming a specific activity of 5000
units/milligram, the productivity of these two NS0 transfectants
corresponds to about 0.1 mg/liter.
[0101] 2, Expression of Mouse-Human Chimeric PAF-AH Gene
Constructs
[0102] A construct (pRc/MS9) containing the cDNA encoding mouse
PAF-AH in the mammalian expression vector pRc/CMV resulted in
production of secreted PAF-AH at the level of 5-10 units/ml (1000
fold above background) after transfection into COS cells. Assuming
that the specific activity of the mouse PAF-AH is about the same as
that of the human enzyme, the mouse cDNA is therefore expressed at
a 500-1000 fold higher level than is the human PAF-AH cDNA.
[0103] To examine the difference between the expression levels of
human and mouse PAF-AH in COS cells, two mouse-human chimeric genes
were constructed and tested for expression in COS cells. The first
of these constructs, pRc/PH.MHC1, contains the coding sequence for
the N-terminal 97 amino acids of the mouse PAF-AH polypeptide (SEQ
ID NO: 21) fused to the C-terminal 343 amino acids of human PAF-AH
in the expression vector pRc/CMV (Invitrogen, San Diego, Calif.).
The second chimeric gene, in plasmid pRc/PH.MHC2, contains the
coding sequence for the N-terminal 40 amino acids of the mouse
PAF-AH polypeptide fused to the C-terminal 400 residues of human
PAF-AH in pRc/CMV. Transfection of COS cells with pRc/PH.MHC1 led
to accumulation of 1-2 units/ml of PAF-AH activity in the media.
Conditioned media derived from cells transfected with pRc/PH.NIHC2
was found to contain only 0.01 units/ml of PAF-AH activity. From
these experiments, it appears that the difference in expression
level between mouse and human PAF-AH genes is attributable at least
in part to the polypeptide segment between the residues 40 and 97,
or the corresponding RNA or DNA segment encoding this region of the
PAF-AH protein.
[0104] 3. Recoding of the First 290 bp of the PAF-AH Coding
Sequence
[0105] One hypothesis for the low level of human PAF-AH synthesized
in transfected mammalian cells is that the codons utilized by the
natural gene are suboptimal for efficient expression. However, it
does not seem likely that codon usage can account for 500-1000 fold
difference in expression levels between the mouse and human genes
because optimizing codons generally has at most only a 10-fold
effect on expression. A second hypothesis to explain the difference
between the mouse and human PAF-AH expression levels is that the
human PAF-AH mRNA in the 5' coding region forms a secondary
structure that leads to either relatively rapid degradation of the
mRNA or causes inefficient translation initiation or
elongation.
[0106] To test these hypotheses, a synthetic fragment encoding the
authentic human PAF-AH protein from the amino-terminus to residue
96 but in which most of the codons have been substituted
("recoded") with a codon of a different sequence but encoding the
same amino acid was constructed. Changing the second codon from GTG
to GTA resulted in the creation of an Asp718 site, which was at one
end of the synthetic fragment and which is present in the mouse
cDNA. The other end of the fragment contained the BamHI site
normally found at codon 97 of the human gene. The approximately 290
bp Asp718/BamHI fragment was derived from a PCR fragment that was
made using the dual asymmetric PCR approach for construction of
synthetic genes described in Sandhu et al., Biotechniques, 12:
14-16 (1992). The synthetic Asp718/BamHI fragment was ligated with
DNA fragments encoding the remainder of the human PAF-AH molecule
beginning with nucleotide 453 of SEQ ID NO: 7 such that a sequence
encoding authentic human PAF-AH enzyme was inserted into the
mammalian expression vector pRc/CMV (Invitrogen, San Diego) to
create plasmid pRc/HPH.4. The complete sequence of the recoded gene
is set out in SEQ ID NO: 30. The 5' flanking sequence adjacent to
the human PAF-AH coding sequence in pRc/HPH.4 is from that of a
mouse cDNA encoding PAF-AH in pRc/MS9 (nucleotides 1 to 116 of SEQ
ID NO: 21).
[0107] To test expression of human PAF-AH from pRc/HPH.4, COS cells
were transiently transfected with pRc/HPH.4 (recoded human gene),
pRc/MS9 (mouse PAF-AH), or pRc/PH.MHC1 (mouse-human hybrid 1). The
conditioned media from the transfected cells were tested for PAF-AH
activity and found to contain 5.7 units/ml (mouse gene), 0.9
units/ml (mouse-human hybrid 1), or 2.6 units/ml (recoded human
gene). Thus, the strategy of recoding the first 290 bp of coding
sequence of human PAF-AH was successful in boosting expression
levels of human PAF-AH from a few nanograms/ml to about 0.5
microgram/ml in a transient COS cell transfection. The recoded
PAF-AH gene from pRc/HPH.4 will be inserted into a mammalian
expression vector containing the dihydrofolate reductase (DHFR)
gene and DHFR-negative chinese hamster ovary cells will be
transfected with the vector. The transfected cells will be
subjected to methotrexate selection to obtain clones malting high
levels of human PAF-AH due to gene amplification.
EXAMPLE 9
[0108] Recombinant human plasma PAF-AH (beginning at Ile.sub.42)
expressed in E. coli was purified to a single Coomassie-stained
SDS-PAGE band by various methods and assayed for activities
exhibited by the native PAF-AH enzyme.
[0109] A. Purification of Recombinant PAF-AH
[0110] The first purification procedure utilized is similar to that
described in Example 1 for native PAF-AH. The following steps were
performed at 4.degree. C. Pellets from 50 ml PAF-AH producing E.
coli (transformed with expression construct trp AH) were lysed as
described in Example 8. Solids were removed by centrifugation at
10,000 g for 20 minutes. The supernatant was loaded at 0.8
ml/minute onto a Blue Sepharose Fast Flow column (2.5 cm.times.4
cm; 20 ml bed volume) equilibrated in buffer D (25 mM Tris-HCl, 10
mM CHAPS, 0.5M NaCl, pH 7.5). The column was washed with 100 ml
buffer D and eluted with 100 ml buffer A containing 0.5M KSCN at
3.2 ml/minute. A 15 ml active fraction was loaded onto a 1 ml Cu
Chelating Sepharose column equilibrated in buffer D. The column was
washed with 5 ml buffer D followed by elution with 5 ml of buffer D
containing 100 mM imidazole with gravity flow. Fractions containing
PAF-AH activity were analyzed by SDS-PAGE.
[0111] The results of the purification are shown in Table 6 wherein
a unit equals .mu.mol PAF hydrolysis per hour. The purification
product obtained at 4.degree. C. appeared on SDS-PAGE as a single
intense band below the 43 kDa marker with some diffuse staining
directly above and below it. The recombinant material is
significantly more pure and exhibits greater specific activity when
compared with PAF-AH preparations from plasma as described in
Example 1.
12TABLE 6 Specific Activity Total Activity % Recovery Fold Volume
(units/ Act. Prot Conc (units/ of Activity Purification Sample (ml)
ml) (units .times. 10.sup.3) (mg/mL) mg) Step Cum. Step Cum. Lysate
4.5 989 4451 15.6 63 100 100 1 1 Blue 15 64 960 0.07 914 22 22 14.4
14.4 Cu 1 2128 2128 0.55 3869 220 48 4.2 61
[0112] When the same purification protocol was performed at ambient
temperature, in addition to the band below the 43 kDa marker, a
group of bands below the 29 kDa marker correlated with PAF-AH
activity of assayed gel slices. These lower molecular weight bands
may be proteolytic fragments of PAF-AH that retain enzymatic
activity.
[0113] A different purification procedure was also performed at
ambient temperature. Pellets (100 g) of PAF-AH-producing E. coli
(transformed with the expression construct pUC trp AH) were
resuspended in 200 ml of lysis buffer (25 mM Tris, 20 mM CHAPS, 50
mM NaCl, 1 mM EDTA, 50 .mu.g/ml benzamidine, pH 7.5) and lysed by
passing three times through a microfluidizer at 15,000 psi. Solids
were removed by centrifugation at 14,300.times.g for 1 hour. The
supernatant was diluted 10-fold in dilution buffer [25 mM MES
(2-[N-morpholino] ethanesulfonic acid), 10 mM CHAPS, 1 mM EDTA, pH
4.9] and loaded at 25 ml/minute onto an S Sepharose Fast Flow
Column (200 ml) (a cation exchange column) equilibrated in Buffer E
(25 mM MES, 10 mM CHAPS, 1 mM EDTA, 50 mM NaCl, pH 5.5). The column
was washed with 1 liter of Buffer E, eluted with 1M NaCl, and the
eluate was collected in 50 ml fractions adjusted to pH 7.5 with 0.5
ml of 2M Tris base. Fractions containing PAF-AH activity were
pooled and adjusted to 0.5M NaCl. The S pool was loaded at 1
ml/minute onto a Blue Sepharose Fast Flow column (2.5 cm.times.4
cm; 20 ml) equilibrated in Buffer F (25 mM Tris, 10 mM CHAPS, 0.5M
NaCl, 1 mM EDTA, pH 7.5). The column was washed with 100 ml Buffer
F and eluted with 100 ml Buffer F containing 3M NaCl at 4
ml/minute. The Blue Sepharose Fast Flow chromatography step was
then repeated to reduce endotoxin levels in the sample. Fractions
containing PAF-AH activity were pooled and dialyzed against Buffer
G (25 mM Tris pH 7.5, 0.5M NaCl, 0.1% Tween 80, 1 mM EDTA).
[0114] The results of the purification are shown in Table 7 wherein
a unit equals .mu.mol PAF hydrolysis per hour.
13TABLE 7 Specific Activity Total Activity % Recovery Fold Volume
(units/ Act. Prot Conc (units/ of Activity Purification Sample (ml)
ml) (units .times. 10.sup.3) (mg/mL) mg) Step Cum. Step Cum. Lysate
200 5640 1128 57.46 98 100 100 1 1 S 111 5742 637 3.69 1557 57 56
16 16 Blue 100 3944 394 0.84 4676 35 62 3 48
[0115] The purification product obtained appeared on SDS-PAGE as a
single intense band below the 43 kDa marker with some diffuse
staining directly above and below it. The recombinant material is
significantly more pure and exhibits greater specific activity when
compared with PAF-AH preparations from plasma as described in
Example 1.
[0116] Yet another purification procedure contemplated by the
present invention involves the following cell lysis, clarification,
and first column steps. Cells are diluted 1:1 in lysis buffer (25
mM Tris pH 7.5, 150 ml NaCl, 1% Tween 80, 2 mM EDTA). Lysis is
performed in a chilled microfluidizer at 15,000-20.000 psi with
three passes of the material to yield >99% cell breakage. The
lysate is diluted 1:20 in dilution buffer (25 mM Tris pH 8.5, 1 mM
EDTA) and applied to a column packed with Q-Sepharose Big Bead
chromatography media (Pharmacia) and equilibrated in 25 mM Tris pH
8.5, 1 mM EDTA, 0.015% Tween 80. The eluate is diluted 1:10 in 25
mM MES pH 5.5, 1.2M Ammonium sulfate, 1 mM EDTA and applied to
Butyl Sepharose chromography media (Pharmacia) equilibrated in the
same buffer. PAF-AH activity is eluted in 25 mM MES pH. 5.5, 0.1%
Tween 80, 1 mM EDTA.
[0117] Still another method contemplated by the invention for
purifying enzymatically-active PAF-AH from E. coli includes the
steps of: (a) preparing an E. coli extract which yields solubilized
PAF-AH supernatant after lysis in a buffer containing CHAPS; (b)
dilution of the said supernatant and application to a anion
exchange column equilibrated at about pH 8.0; (c) eluting PAF-AH
enzyme from said anion exchange column; (d) applying said adjusted
eluate from said anion exchange column to a blue dye ligand
affinity column; (e) eluting the said blue dye ligand affinity
column using a buffer comprising 3.0M salt; (f) dilution of the
blue dye eluate into a suitable buffer for performing
hydroxylapatite chromatography; (g) performing hydroxylapatite
chromatography where washing and elution is accomplished using
buffers (with or without CHAPS); (h) diluting said hydroxylapatite
eluate to an appropriate salt concentration for cation exchange
chromatography; (i) applying said diluted hydroxylapatite eluate to
a cation exchange column at a pH ranging between approximately 6.0
to 7.0; (j) elution of PAF-AH from said cation exchange column with
a suitable formulation buffer; (k) performing cation exchange
chromatography in the cold; and (l) formulation of PAF-AH in liquid
or frozen form in the absence of CHAPS.
[0118] Preferably in step (a) above the lysis buffer is 25 mM Tris,
100 mM NaCl, 1 mM EDTA, 20 mM CHAPS, pH 8.0; in step (b) the
dilution of the supernatant for anion exchange chromatography is
3-4 fold into 25 mM Tris, 1 mM EDTA, 10 mM CHAPS, pH 8.0 and the
column is a Q-Sepharose column equilibrated with 25 mM Tris, 1 mM
EDTA, 50 mM NaCl, 10 mM CHAPS, pH 8.0; in step (c) the anion
exchange column is eluted using 25 mM Tris, 1 mM EDTA, 350 mM NaCl,
10 mM CHAPS, pH 8.0; in step (d) the eluate from step (c) is
applied directly onto a blue dye affinity column; in step (e) the
column is eluted with 3M NaCl, 10 mM CHAPS. 25 mM Tris, pH 8.0
buffer; in step (f) dilution of the blue dye eluate for
hydroxylapatite chromatography is accomplished by dilution into 10
mM sodium phosphate, 100 mM NaCl, 10 mM CHAPS, pH 6.2; in step (g)
hydroxylapatite chromatography is accomplished using a
hydroxylapatite column equilibrated with 10 mM sodium phosphate,
100 mM NaCl, 10 mM CHAPS and elution is accomplished using 50 mM
sodium phosphate, 100 mM NaCl (with or without) 10 mM CHAPS, pH
7.5; in step (h) dilution of said hydroxylapatite eluate for cation
exchange chromatography is accomplished by dilution into a buffer
ranging in pH from approximately 6.0 to 7.0 comprising sodium
phosphate (with or without CHAPS); in step (i) a S Sepharose column
is equilibrated with 50 mM sodium phosphate, (with or without) 10
mM CHAPS, pH 6.8; in step (j) elution is accomplished with a
suitable formulation buffer such as potassium phosphate 50 mM, 12.5
mM aspartic acid, 125 mM NaCl, pH 7.5 containing 0.01% Tween-80;
and in step (k) cation exchange chromatrography is accomplished at
2-8.degree. C. Examples of suitable formulation buffers for use in
step (l) which stabilize PAF-AH include 50 mM potassium phosphate,
12.5 mM Aspartic acid, 125 mM NaCl pH 7.4 (approximately, with and
without the addition of Tween-80 and or Pluronic F68) or 25 mM
potassium phosphate buffer containing (at least) 125 mM NaCl, 25 mM
arginine and 0.01% Tween-80 (with or without Pluronic F68 at
approximately 0.1 and 0.5%).
[0119] B. Activity of Recombinant PAF-AH
[0120] The most remarkable property of the PAF acetylhydrolase is
its marked specificity for substrates with a short residue at the
sn-2 position of the substrate. This strict specificity
distinguishes PAF acetylhydrolase from other forms of PLA.sub.2.
Thus, to determine if recombinant PAF-AH degrades phospholipids
with long-chain fatty acids at the sn-2 position, hydrolysis of
1-palmitoyl-2-arachidonoyl-sn-glycero-3-- phosphocholine
(arachidonoylPC) was assayed since this is the preferred substrate
for a well-characterized form of PLA.sub.2. As predicted from
previous studies with native PAF-AH, this phospholipid was not
hydrolyzed when incubated with recombinant PAF-AH. In additional
experiments, arachidonoylPC was included in a standard PAF
hydrolysis assay at concentrations ranging from 0 to 125 .mu.M to
determine whether it inhibited the hydrolysis of PAF by recombinant
PAF-AH. There was no inhibition of PAF hydrolysis even at the
highest concentration of PAF-AH, which was 5-fold greater than the
concentration of PAF. Thus, recombinant PAF-AH exhibits the same
substrate selectivity as the native enzyme; long chain substrates
are not recognized. Moreover, recombinant PAF-AH enzyme rapidly
degraded an oxidized phospholipid (glutaroylPC) which had undergone
oxidative cleavage of the sn-2 fatty acid. Native plasma PAF-AH has
several other properties that distinguish it from other
phospholipases including calcium-independence and resistance to
compounds that modify sulfhydryl groups or disrupt disulfides.
[0121] Both the native and recombinant plasma PAF-AH enzymes are
sensitive to DFP, indicating that a serine comprises part of their
active sites. An unusual feature of the native plasma PAF
acetylhydrolase is that it is tightly associated with lipoproteins
in circulation, and its catalytic efficiency is influenced by the
lipoprotein environment. When recombinant PAF-AH of the invention
was incubated with human plasma (previously treated with DFP to
abolish the endogenous enzyme activity), it associated with low and
high density lipoproteins in the same manner as the native
activity. This result is significant because there is substantial
evidence that modification of low density lipoproteins is essential
for the cholesterol deposition observed in atheromas, and that
oxidation of lipids is an initiating factor in this process. PAF-AH
protects low density lipoproteins from modification under oxidizing
conditions in vitro and may have such a role in vivo.
Administration of PAF-AH is thus indicated for the suppression of
the oxidation of lipoproteins in atherosclerotic plaques as well as
to resolve inflammation.
[0122] These results all confirm that the cDNA clone sAH 406-3
encodes a protein with the activities of the the human plasma PAF
acetylhydrolase.
EXAMPLE 10
[0123] Various other recombinant PAF-AH products were expressed in
E. coli. The products included PAF-AH analogs having single amino
acid mutations and PAF-AH fragments.
[0124] A. PAF-AH Amino Acid Substitution Products
[0125] PAF-AH is a lipase because it hydrolyses the phospholipid
PAF. While no obvious overall similarity exists between PAF-AH and
other characterized lipases, there are conserved residues found in
comparisons of structurally characterized lipases. A serine has
been identified as a member of the active site. The serine, along
with an aspartate residue and a histidine residue, form a catalytic
triad which represents the active site of the lipase. The three
residues are not adjacent in the primary protein sequence, but
structural studies have demonstrated that the three residues are
adjacent in three dimensional space. Comparisons of structures of
mammalian lipases suggest that the aspartate residue is generally
twenty-four amino acids C-terminal to the active site serine. In
addition, the histidine is generally 109 to 111 amino acids
C-terminal to the active site serine.
[0126] By site-directed mutagenesis and PCR, individual codons of
the human PAF-AH coding sequence were modified to encode alanine
residues and were expressed in E. coli. As shown in Table 8 below
wherein, for example, the abbreviation "S108A" indicates that the
serine residue at position 273 was changed to an alanine, point
mutations of Ser.sub.273, Asp.sub.296, or His.sub.351 completely
destroy PAF-AH activity. The distances between active site residues
is similar for PAF-AH (Ser to Asp, 23 amino acids; Ser to His, 78
amino acids) and other lipases. These experiments demonstrate that
Ser.sub.273, Asp.sub.296, and His.sub.351 are critical residues for
activity and are therefore likely candidates for catalytic triad
residues. Cysteines are often critical for the functional integrity
of proteins because of their capacity to form disulfide bonds. The
plasma PAF-AH enzyme contains five cysteines. To determine whether
any of the five is critical for enzyme actvity, each cysteine was
mutated individually to a serine and the resulting mutants were
expressed in E. coli. As shown below in Table 8, a significant but
not total loss of PAF-AH activity resulted from the conversion of
either Cys.sub.229, r Cys.sub.291 to serine. Therefore, these
cysteines appear to be necessary for full PAF-AH activity. Other
point mutations had little or no effect on PAF-AH catalytic
activity. In Table 8, "++++" represent wild type PAF-AH activity of
about 40-60 U/ml/OD.sub.600, "+++" represents about 20-40
U/ml/OD.sub.600 activity, "++" represents about 10-20
U/ml/OD.sub.600 activity, "+" represents 1-10 U/ml/OD.sub.600
activity, and "-" indicates <1 U/ml/OD.sub.600 activity.
14 TABLE 8 Mutation PAF-AH activity Wild type ++++ S108A ++++ S273A
- D286A - D286N ++ D296A - D304A ++++ D338A ++++ H351A - H395A,
H399A ++++ C67S +++ C229S + C291S + C334S ++++ C407S +++
[0127] B. PAF-AH Fragment Products
[0128] C-terminal deletions were prepared by digesting the 3' end
of the PAF-AH coding sequence with exonuclease III for various
amounts of time and then ligating the shortened coding sequence to
plasmid DNA encoding stop codons in all three reading frames. Ten
different deletion constructs were characterized by DNA sequence
analysis, protein expression, and PAF-AH activity. Removal of
twenty-one to thirty C-terminal amino acids greatly reduced
catalytic activity and removal of fifty-two residues completely
destroyed activity. See FIG. 3.
[0129] Similar deletions were made at the amino terminal end of
PAF-AH. Fusions of PAF-AH with E. coli thioredoxin at the
N-terminus were prepared to facilitate consistent high level
expression PAF-AH activity [LaVallie et al., Bio/technology,
11:187-193 (1993)]. Removal of nineteen amino acids from the
naturally processed N-terminus (Ile.sub.42) reduced activity by 99%
while removal of twenty-six amino acids completely destroyed
enzymatic activity in the fusion protein. See FIG. 3. Deletion of
twelve amino acids appeared to enhance enzyme activity about four
fold.
[0130] In subsequent purifications of PAF-AH from fresh human
plasma by a method similar to that described in Example 1 (Microcon
30 filter from Amicon were utilized to concentrate Blue sepharose
eluate instead of a Cu column), two N-termini in addition to
Ile.sub.42 were identified, Ser.sub.35 and Lys.sub.55. The
heterogeneity may be the natural state of the enzyme in plasma or
may occur during purification.
[0131] The purified material described above was also subject to
analysis for glycosylation. Purified native PAF-AH was incubated in
the presence or absence of N-Glycanase, an enzyme that removes
N-linked carbohydrates from glycoproteins. The treated PAF-AH
samples were electrophoresed through a 12% SDS polyacrylamide gel
then visualized by Western blotting using rabbit polyclonal
antisera. Protein not treated with N-Glycanase migrated as a
diffuse band of 45-50 kDa whereas the protein treated with the
glycanase migrated as a tight band of about 44 kDa, demonstrating
that native PAF-AH is glycosylated.
EXAMPLE 11
[0132] A preliminary analysis of expression patterns of human
plasma PAF-AH mRNA in human tissues was conducted by Northern blot
hybridization.
[0133] RNA was prepared from human cerebral cortex, heart, kidney,
placenta, thymus and tonsil using RNA Stat 60 (Tel-Test "B",
Friendswood, Tex.). Additionally, RNA was prepared from the human
hematopoietic precursor-like cell line, THP-1 (ATCC TIB 202), which
was induced to differentiate to a macrophage-like phenotype using
the phorbol ester phorbolmyristylacetate (PMA). Tissue RNA and RNA
prepared from the premyelocytic THP-1 cell line prior to and 1 to 3
days after induction were electrophoresed through a 1.2% agarose
formaldehyde gel and subsequently transferred to a nitrocellulose
membrane. The full length human plasma PAF-AH cDNA, sAH 406-3, was
labelled by random priming and hybridized to the membrane under
conditions identical to those described in Example 3 for library
screening. Initial results indicate that the PAF-AH probe
hybridized to a 1.8 kb band in the thymus, tonsil, and to a lesser
extent, the placental RNA.
[0134] PAF is synthesized in the brain under normal physiological
as well as pathophysiological conditions. Given the known
pro-inflammatory and potential neurotoxic properties of the
molecule, a mechanism for localization of PAF synthesis or for its
rapid catabolism would be expected to be critical for the health of
neural tissue. The presence of PAF acetylhydrolase in neural
tissues is consistent with it playing such a protective role.
Interestingly, both a bovine heterotrimeric intracellular PAF-AH
(the cloning of which is described in Hattori et al., J. Biol.
Chem., 269(37): 2315023155 (1994)] and PAF-AH of the invention have
been identified in the brain. To determine whether the two enzymes
are expressed in similar or different compartments of the brain,
the human homologue of the bovine brain intracellular PAF-AH cDNA
was cloned, and its mRNA expression pattern in the brain was
compared by Northern blotting to the mRNA expression pattern of the
PAF-AH of the invention by essentially the same methods as
described in the foregoing paragraph. The regions of the brain
examined by Northern blotting were the cerebellum, medulla, spinal
cord, putamen, amygdala, caudate nucleus, thalamus, and the
occipital pole, frontal lobe and temporal lobe of the cerebral
cortex. Message of both enzymes was detected in each of these
tissues although the heterotrimeric heterotrimeric intracellular
form appeared in greater abundance than the secreted form. Northern
blot analysis of additional tissues further revealed that the
heterotrimeric intracellular form is expressed in a broad variety
of tissues and cells, including thymus, prostate, testis, ovary,
small intestine, colon, peripheral blood leukocytes, macrophages,
brain, liver, skeletal muscle, kidney, pancreas and adrenal gland.
This ubiquitous expression suggests that the heterotrimeric
intracellular PAF-AH has a general housekeeping function within
cells.
[0135] The expression of PAF-AH RNA in monocytes isolated from
human blood and during their spontaneous differentiation into
macrophages in culture was also examined. Little or no RNA was
detected in fresh monocytes, but expression was induced and
maintained during differentiation into macrophages. There was a
concomitant accumulation of PAF-AH activity in the culture medium
of the differentiating cells. Expression of the human plasma PAF-AH
transcript was also observed in the THP-1 cell RNA at 1 day but not
3 days following induction. THP-1 cells did not express mRNA for
PAF-AH in the basal state.
EXAMPLE 12
[0136] PAF-AH expression in human and mouse tissues was examined by
in situ hybridization.
[0137] Human tissues were obtained from National Disease Research
Interchange and the Cooperative Human Tissue Network. Normal mouse
brain and spinal cord, and EAE stage 3 mouse spinal cords were
harvested from S/JLJ mice. Normal S/JLJ mouse embryos were
harvested from eleven to eighteen days after fertilization.
[0138] The tissue sections were placed in Tissue Tek II cryomolds
(Miles Laboratories, Inc., Naperville, Ill.) with a small amount of
OCT compound (Miles, Inc., Elkhart, Ind.). They were centered in
the cryomold, the cryomold filled with OCT compound, then placed in
a container with 2-methylbutane [C.sub.2H.sub.5CH(CH.sub.3).sub.2,
Aldrich Chemical Company, Inc., Milwaukee, Wis.] and the container
placed in liquid nitrogen. Once the tissue and OCT compound in the
cryomold were frozen, the blocks were stored at -80.degree. C.
until sectioning. The tissue blocks were sectioned at 6 .mu.m
thickness and adhered to Vectabond (Vector Laboratories, Inc.,
Burlingame, Calif.) coated slides and stored at -70.degree. C. and
placed at 50.degree. C. for approximately 5 minutes to warm them
and remove condensation and were then fixed in 4% paraformaldehyde
for 20 minutes at 4.degree. C., dehydrated (70%, 95%, 100% ethanol)
for 1 minute at 4.degree. C. in each grade, then allowed to air dry
for 30 minutes at room temperature. Sections were denatured for 2
minutes at 70.degree. C. in 70% formamide/2.times.SSC, rinsed twice
in 2.times.SSC, dehydrated and then air dried for 30 minutes. The
tissues were hybridized in situ with radiolabeled single-stranded
mRNA generated from DNA derived from an internal 1 Kb HindIII
fragment of the PAF-AH gene (nucleotides 308 to 1323 of SEQ ID NO:
7) by in vitro RNA transcription incorporation .sup.35S-UTP
(Amersham) or from DNA derived from the heterotrimeric
intracellular PAS-AH cDNA identified by Hattori et al. The probes
were used at varying lengths from 250-500 bp. Hybridization was
carried out overnight (12-16 hours) at 50.degree. C.; the
.sup.3S-labeled riboprobes (6.times.10.sup.5 cpm/section), tRNA
(0.5 .mu.g/section) and diethylpyrocarbonate (depc)-treated water
were added to hybridization buffer to bring it a final
concentration of 50% formamide, 0.3M NaCl, 20 mM Tris pH 7.5, 10%
dextran sulfate, 1.times. Denhardt's solution, 100 mM dithiothretol
(DTT) and 5 mM EDTA. After hybridization, sections were washed for
1 hour at room temperature in 4.times.SSC/10 mM DTT, then for 40
minutes at 60.degree. C. in 50% formamide/1.times.SSC/10 mM DTT, 30
minutes at room temperature in 2.times.SSC, and 30 minutes at room
temperature in 0.1.times.SSC. The sections were dehydrated, air
dried for 2 hours, coated with Kodak NTB2 photographic emulsion,
air dried for 2 hours, developed (after storage at 4.degree. C. in
complete darkness) and counterstained with hematoxylin/eosin.
[0139] A. Brain
[0140] Cerebellum. In both the mouse and the human brains, strong
signal was seen in the Purkinje cell layer of the cerebellum, in
basket cells, and individual neuronal cell bodies in the dentate
nucleus (one of the four deep nuclei in the cerebellum). Message
for the intracellular PAF-AH was also observed in these cell types.
Additionally, plasma PAF-AH signal was seen on individual cells in
the granular and molecular layers of the grey matter.
[0141] Hippocampus. In the human hippocampus section, individual
cells throughout the section, which appear to be neuronal cell
bodies, showed strong signal. These were identified as polymorphic
cell bodies and granule cells. Message for the heterotrimeric
intracellular PAF-AH was also observed in hippocampus.
[0142] Brain stem. On both human and mouse brain stem sections,
there was strong signal on individual cells in the grey matter.
[0143] Cortex. On human cortex sections taken from the cerebral,
occipital, and temporal cortexes, and on mouse whole brain
sections, individual cells throughout the cortex showed strong
signal. These cells were identified as pyramidal, stellate and
polymorphic cell bodies. There does not appear to be
differentiation in the expression pattern in the different layers
of the cortex. These in situ hybridization results are different
from the results for cerebral cortex obtained by Northern blotting.
The difference is likely to result from the greater sensitivity of
in situ hybridization compared to that of Northern blotting. As in
the cerebellum and hippocampus, a similar pattern of expression of
the heterotrimeric intracellular PAF-AH was observed.
[0144] Pituitary. Somewhat weak signal was seen on scattered
individual cells in the pars distalis of the human tissue
section.
[0145] B. Human Colon
[0146] Both normal and Crohn's disease colons displayed signal in
the lymphatic aggregations present in the mucosa of the sections,
with the level of signal being slightly higher in the section from
the Crohn's disease patient. The Crohn's disease colon also had
strong signal in the lamina propria. Similarly, a high level of
signal was observed in a diseased appendix section while the normal
appendix exhibited a lower but still detectable signal. The
sections from the ulcerative colitis patient showed no evident
signal in either the lymphatic aggregations or the lamina
propria.
[0147] C. Human Tonsil and Thymus
[0148] Strong signal was seen on scattered groups of individual
cells within the germinal centers of the tonsil and within the
thymus.
[0149] D. Human Lymph Node
[0150] Strong signal was observed on the lymph node section taken
from a normal donor, while somewhat weak signal was observed in the
lymph nodules of the section from a donor with septic shock.
[0151] E. Human Small Intestine
[0152] Both normal and Crohn's disease small intestine had weak
signal in the Peyer's patches and lamina propria in the sections,
with the signal on the diseased tissue slightly higher.
[0153] F. Human Spleen and Lung
[0154] Signal was not observed on any of the spleen (normal and
splenic abcess sections) or lung (normal and emphysema sections)
tissues.
[0155] G. Mouse Spinal Cord
[0156] In both the normal and EAE stage 3 spinal cords, there was
strong signal in the grey matter of the spinal cord, with the
expression being slightly higher in the EAE stage 3 spinal cord. In
the EAE stage 3 spinal cord, cells in the white matter and
perivascular cuffs, probably infiltrating macrophages and/or other
leukocytes, showed signal which was absent in the normal spinal
cord.
[0157] F. Mouse Embryos
[0158] In the day 11 embryo signal was apparent in the central
nervous system in the fourth ventricle, which remained constant
throughout the embryo time course as it developed into the
cerebellum and brain stem. As the embryos matured, signal became
apparent in central nervous system in the spinal cord (day 12),
primary cortex and ganglion Gasseri (day 14), and hypophysis (day
16). Signal was observed in the peripheral nervous system
(beginning on day 14 or 15) on nerves leaving the spinal cord, and,
on day 17, strong signal appeared around the whiskers of the
embryo. Expression was also seen in the liver and lung at day 14,
the gut (beginning on day 15), and in the posterior portion of the
mouth/throat (beginning on day 16). By day 18, the expression
pattern had differentiated into signal in the cortex, hindbrain
(cerebellum and brain stem), nerves leaving the lumbar region of
the spinal cord, the posterior portion of the mouth/throat, the
liver, the kidney, and possible weak signal in the lung and
gut.
[0159] G. Summary
[0160] PAF-AH mRNA expression in the tonsil, thymus, lymph node,
Peyer's patches, appendix, and colon lymphatic aggregates is
consistent with the conclusions that the probable predominant in
vivo source of PAF-AH is the macrophage because these tisues all
are populated with tissue macrophages that serve as phagocytic and
antigen-processing cells.
[0161] Expression of PAF-AH in inflamed tissues would be consistent
with the hypothesis that a role of monocyte-derived macrophages is
to resolve inflammation. PAF-AH would be expected to inactivate PAF
and the pro-inflammatory phospholipids, thus down-regulating the
inflammatory cascade of events initiated by these mediators.
[0162] PAF has been detected in whole brain tissue and is secreted
by rat cerebellar granule cells in culture. In vitro and in vivo
experiments have demonstrated that PAF binds a specific receptor in
neural tissues and induces functional and phenotypic changes such
as calcium mobilization, upregulation of transcription activating
genes, and differentiation of the neural precursor cell line, PC12.
These observations suggested a physiologic role for PAF in the
brain, and consistent with this, recent experiments using
hippocampal tissue section cultures and PAF analogs and antagonists
have implicated PAF as an important retrograde messenger in
hippocampal long term potentiation. Therefore, in addition to its
pathological effect in inflammation, PAF appears to participate in
routine neuronal signalling processes. Expression of the
extracellular PAF-AH in the brain may serve to regulate the
duration and magnitude of PAF-mediated signalling.
EXAMPLE 13
[0163] Monoclonal antibodies specific for recombinant human plasma
PAF-AH were generated using E. coli produced PAF-AH as an
immunogen.
[0164] Mouse #1342 was injected on day 0, day 19, and day 40 with
recombinant PAF-AH. For the prefusion boost, the mouse was injected
with the immunogen in PBS, four days later the mouse was sacrificed
and its spleen removed sterilely and placed in 10 ml serum free
RPMI 1640. A single-cell suspension was formed by grinding the
spleen between the frosted ends of two glass microscope slides
submerged in serum free RPMI 1640, supplemented with 2 mM
L-glutamine, 1 mM sodium pyruvate, 100 units/ml penicillin, and 100
.mu.g/ml streptomycin (RPMI) (Gibco, Canada). The cell suspension
was filtered through sterile 70-mesh Nitex cell strainer (Becton
Dickinson, Parsippany, N.J.), and washed twice by centrifuging at
200 g for 5 minutes and resuspending the pellet in 20 ml serum free
RPMI. Thymocytes taken from 3 naive Balb/c mice were prepared in a
similar manner. NS-1 myeloma cells, kept in log phase in RPMI with
11% fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan,
Utah) for three days prior to fusion, were centrifuged at 200 g for
5 minutes, and the pellet was washed twice as described in the
foregoing paragraph.
[0165] One.times.10.sup.8 spleen cells were combined with
2.0.times.10.sup.7 NS-1 cells, centrifuged and the supernatant was
aspirated. The cell pellet was dislodged by tapping the tube and 1
ml of 37.degree. C. PEG 1500 (50% in-75 mM Hepes, pH 8.0)
(Boehringer Mannheim) was added with stirring over the course of 1
minute, followed by adding 7 ml of serum free RPMI over 7 minutes.
An additional 8 ml RPMI was added and the cells were centrifuged at
200 g for 10 minutes. After discarding the supernatant, the pellet
was resuspended in 200 ml RPMI containing 15% FBS, 100 .mu.M sodium
hypoxanthine, 0.4 .mu.M aminopterin, 16 .mu.M thymidine (HAT)
(Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and
1.5.times.10.sup.6 thymocytes/ml and plated into 10 Corning flat
bottom 96 well tissue culture plates (Corning, Corning N.Y.).
[0166] On days 2, 4, and 6, after the fusion, 100 .mu.l of medium
was removed from the wells of the fusion plates and replaced with
fresh medium. On day 8, the fusion was screened by ELISA, testing
for the presence of mouse IgG binding to recombinant PAF-AH.
Immulon 4 plates (Dynatech, Cambridge, Mass.) were coated for 2
hours at 37.degree. C. with 100 ng/well recombinant PAF-AH diluted
in 25 mM TRIS, pH 7.5. The coating solution was aspirated and 200
ul/well of blocking solution [0.5% fish skin gelatin (Sigma)
diluted in CMF-PBS] was added and incubated for 30 minutes at
37.degree. C. Plates were washed three times with PBS with 0.05%
Tween 20 (PBST) and 50 .mu.l culture supernatant was added. After
incubation at 37.degree. C. for 30 minutes, and washing as above,
50 .mu.l of horseradish peroxidase conjugated goat anti-mouse
IgG(fc) (Jackson ImmunoResearch, West Grove, Pa.) diluted 1:3500 in
PBST was added. Plates were incubated as above, washed four times
with PBST and 100 .mu.L substrate, consisting of 1 mg/ml
o-phenylene diamine (Sigma) and 0.1 .mu.l/ml 30% H.sub.2O.sub.2 in
100 mM Citrate, pH 4.5, was added. The color reaction was stopped
in 5 minutes with the addition of 50 .mu.l of 15% H.sub.2SO.sub.4.
A.sub.490 was read onn a plate reader (Dynatech).
[0167] Selected fusion wells were cloned twice by dilution into 96
well plates and visually scoring the number of colonies/well after
5 days. Hybridomas cloned were 90D1E, 90E3A, 90E6C, 90G11D (ATCC HB
11724), and 90F2D (ATCC HB 11725).
[0168] The monoclonal antibodies produced by hybridomas were
isotyped using the Isostrip system (Boehringer Mannheim,
Indianapolis, Ind.). Results showed that the monoclonal antibodies
produced by hybridomas from fusion 90 were all IgG.sub.1.
[0169] All of the monoclonal antibodies produced by hybridomas from
fusion 90 functioned well in ELISA assays but were unable to bind
PAF-AH on Western blots. To generate antibodies that could
recognize PAF-AH by Western, mouse #1958 was immunized with
recombinant enzyme. Hybridomas were generated as described for
fusion 90 but were screened by Western blotting rather than ELISA
to identify Western-competent clones.
[0170] For Western analyses, recombinant PAF-AH was mixed with an
equal volume of sample buffer containing 125 mM Tris, pH 6.8, 4%
SDS, 100 mM dithiothreitol and 0.05% bromphenol blue and boiled for
five minutes prior to loading onto a 12% SDS polyacrylamide gel
(Novex). Following electrophoresis at 40 mAmps, proteins were
electrotransferred onto a polyvinylidene fluoride membrane (Pierce)
for 1 hour at 125 V in 192 mM glycine, 25 mM Tris base, 20%
methanol, and 0.01% SDS. The membrane was incubated in 20 mM Tris,
100 mM NaCl (TBS) containing 5% bovine serum albumin (BSA, Sigma)
overnight at 4.degree. C. The blot was incubated 1 hour at room
temperature with rabbit polyclonal antisera diluted 1/8000 in TBS
containing 5% BSA, and then washed with TBS and incubated with
alkaline phosphatase-conjugated goat anti-mouse IgG in TBS
containing 5% BSA for 1 hour at room temperature. The blot was
again washed with TBS then incubated with 0.02%
5-bromo-4-chloro-3-indolyl phosphate and 0.03% nitroblue
tetrazolium in 100 mM Tris-HCl, pH 9.5, 100 mM NaCl, and 5 mM
MgCl.sub.2. The reaction was stopped with repeated water
rinses.
[0171] Selected fusion wells, the supernatants of which were
positive in Western analyses, were processed as described above.
Hybridoma 143A reacted with PAF-AH in Western blots and was cloned
(ATCC HB 11900).
[0172] Polyclonal antisera specific for human plasma PAF-AH was
raised in rabbits by three monthly immunizations with 100 Ag of
purified recombinant enzyme in Fruend's adjuvant.
EXAMPLE 14
[0173] Experimental studies were performed to evaluate the in vivo
therapeutic effects of recombinant PAF-AH of the invention on acute
inflammation using a rat foot edema model [Henriques et al., Br. J.
Pharmacol., 106: 579-582 (1992)]. The results of these studies
demonstrated that PAF-AH blocks PAF-induced edema. Parallel studies
were done to compare the effectiveness of PAF-AH with two
commercially available PAF antagonists.
[0174] A. Preparation of PAF-AH
[0175] E. coli transformed with the PAF-AH expression vector puc
trp AH were lysed in a microfluidizer, solids were centrifuged out
and the cell supernatants were loaded onto a S-Sepharose column
(Pharmacia). The column was washed extensively with buffer
consisting of 50 mM NaCl, 10 mM CHAPS, 25 mM MES and 1 mM EDTA, pH
5.5. PAF-AH was eluted by increasing the NaCl concentration of the
buffer to 1M. Affinity chromatography using a Blue Sepharose column
(Pharmacia) was then used as an additional purification step. Prior
to loading the PAF-AH preparation on the Blue Sepharose column, the
sample was diluted 1:2 to reduce the NaCl concentration to 0.5M and
the pH was adjusted to 7.5. After washing the Blue Sepharose column
extensively with buffer consisting of 0.5M NaCl, 25 mM tris, 10 mM
CHAPS and 1 mM EDTA, pH 7.5 the PAF-AH was eluted by increasing the
NaCl concentration to 3.0M.
[0176] Purity of PAF-AH isolated in this manner was generally 95%
as assessed by SDS-PAGE with activity in the range of 5000-10,000
U/ml. Additional quality controls done on each PAF-AH preparation
included determining endotoxin levels and hemolysis activity on
freshly obtained rat erythrocytes. A buffer containing 25 mM Tris,
10 mM CHAPS, 0.5M NaCl, pH 7.5 functioned as storage media of the
enzyme as well as carrier for administration. Dosages used in
experiments were based on enzyme activity assays conducted
immediately prior to experiments.
[0177] B. Induction of Edema
[0178] Six to eight-week-old female Long Evans rats (Charles River,
Wilmington, Mass.), weighing 180-200 grams, were used for all
experiments. Prior to experimental manipulations, animals were
anesthetized with a mixture of the anesthetics Ketaset (Fort Dodge
laboratories, Fort Dodge, Iowa), Rompun (Miles, Shawnee Mission,
Kans.), and Ace Promazine (Aveco, Fort Dodge, Iowa) administered
subcutaneously at approximately 2.5 mg Ketaset, 1.6 mg Rompun, 0.2
mg Ace Promazine per animal per dose. Edema was induced in the foot
by administration of either PAF or zymosan as follows. PAF (Sigma
#P-1402) was freshly prepared for each experiment from a 19.1 mM
stock solution stored in chloroform/methanol (9:1) at -20.degree.
C. Required volumes were dried down under N.sub.2, diluted 1:1000
in a buffer containing 150 mM NaCl, 10 nM Tris pH 7.5, and 0.25%
BSA, and sonicated for five minutes. Animals received 50 .mu.l PAF
(final dose of 0.96 nmoles) subcutaneously between the hind foot
pads, and edema was assessed after 1 hour and again after 2 hours
in some experiments. Zymosan A (Sigma #A-8800) was freshly prepared
for each experiment as a suspension of 10 mg/ml in PBS. Animals
received 50 .mu.l of zymosan (final dose of 500 .mu.g)
subcutaneously between the hind foot pads and edema was assessed
after 2 hours.
[0179] Edema was quantitated by measuring the foot volume
immediately prior to administration of PAF or zymosan and at
indicated time point post-challenge with PAF or zymosan. Edema is
expressed as the increase in foot volume in milliliters. Volume
displacement measurements were made on anesthetized animals using a
plethysmometer (UGO Basile, model #7150) which measures the
displaced water volume of the immersed foot. In order to insure
that foot immersion was comparable from one time point to the next,
the hind feet were marked in indelible ink where the hairline meets
the heel. Repeated measurements of the same foot using this
technique indicate the precision to be within 5%.
[0180] C. PAF-AH Administration Routes and Dosages
[0181] PAF-AH was injected locally between the foot pads, or
systematically by IV injection in the tail vein. For local
administration rats received 100 .mu.l PAF-AH (4000-6000 U/ml)
delivered subcutaneously between the right hind foot pads. Left
feet served as controls by administration of 100 .mu.l carrier
(buffered salt solution). For systemic administration of PAF-AH,
rats received the indicated units of PAF-AH in 300 .mu.L of carrier
administered IV in the tail vein. Controls received the appropriate
volume of carrier IV in the tail vein.
[0182] D. Local Administration of PAF-AH
[0183] Rats (N=4) were injected with 100 .mu.l of PAF-AH (4000-6000
U/ml) subcutaneously between the right foot pads. Left feet were
injected with 100 .mu.l carrier (buffered salt solution). Four
other rats were injected only with carrier. All rats were
immediately challenged with PAF via subcutaneous foot injection and
foot volumes assessed 1 hour post-challenge. FIG. 4, wherein edema
is expressed as average increase in foot volume (ml).+-.SEM for
each treatment group, illustrates that PAF-induced foot edema is
blocked by local administration of PAF-AH. The group which received
local PAF-AH treatment prior to PAF challenge showed reduced
inflammation compared to the control injected group. An increase in
foot volume of 0.08 ml.+-.0.08 (SEM) was seen in the PAF-AH group
as compared to 0.63.+-.0.14 (SEM) for the carrier treated controls.
The increase in foot volume was a direct result of PAF injection as
animals injected in the foot only with carrier did not exhibit an
increase in foot volume.
[0184] E. Intravenous Administration of PAF-AH
[0185] Rats (N=4 per group) were pretreated IV with either PAF-AH
(2000 U in 300 .mu.l carrier) or carrier alone, 15 minutes prior to
PAF challenge. Edema was assessed 1 and 2 hours after PAF
challenge. FIG. 5, wherein edema is expressed as average increase
in volume (ml).+-.SEM for each treatment group, illustrates that IV
administration of PAF-AH blocked PAF induced foot edema at one and
two hours post challenge. The group which received 2000 U of PAF-AH
given by the IV route showed a reduction in inflammation over the
two hour time course. Mean volume increase for the PAF-AH treated
group at two hours was 0.10 ml.+-.0.08 (SEM), versus 0.56
ml.+-.0.11 for carrier treated controls.
[0186] F. Comparison of PAF-AH Protection in Edema Induced by PAF
or Zymosan
[0187] Rats (N=4 per group) were pretreated IV with either PAF-AH
(2000 U in 300 .mu.l carrier) or carrier alone. Fifteen minutes
after pretreatment, groups received either PAF or zymosan A, and
foot volume was assessed after 1 and 2 hours, respectively. As
shown in FIG. 6, wherein edema is expressed as average increase in
volume (ml).+-.SEM for each treatment group, systemic
administration of PAF-AH (2000 U) was effective in reducing
PAF-induced foot edema, but failed to block zymosan induced edema.
A mean increase in volume of 0.08.+-.0.02 was seen in the PAF-AH
treated group versus 0.49.+-.0.03 for the control group.
[0188] G. Effective Dose Titration of PAF-AH Protection
[0189] In two separate experiments, groups of rats (N=3 to 4 per
group) were pretreated IV with either serial dilutions of PAF-AH or
carrier control in a 300 .mu.l volume, 15 minutes prior to PAF
challenge. Both feet were challenged with PAF (as described above)
and edema was assessed after 1 hour. FIG. 7 wherein edema is
expressed as average increase in volume (ml).+-.SEM for each
treatment group, illustrates the increase in protection from
PAF-induced edema in rats injected with increasing dosages of
PAF-AH. In the experiments, the ID.sub.50 of PAF-AH given by the IV
route was found to be between 40 and 80 Upper rat.
[0190] H. In Vivo Efficacy of PAF-AH as a Function of Time After
Administration
[0191] In two separate experiments, two groups of rats (N=3 to 4
per group) were pretreated IV with either PAF-AH (2000 U in 300
.mu.l carrier) or carrier alone. After administration, groups
received PAF at time points ranging from 15 minutes to 47 hours
post PAF-AH administration. Edema was then assessed 1 hour after
PAF challenge. As shown in FIG. 8, wherein edema is expressed as
average increase in volume (ml).+-.SEM for each treatment group,
administration of 2000 U of PAF-AH protects rats from PAF induced
edema for at least 24 hours.
[0192] I. Pharmacokinetics of PAF-AH
[0193] Four rats received 2000 U of PAF-AH by IV injection in a 300
.mu.l volume. Plasma was collected at various time points and
stored at 4.degree. C. and plasma concentrations of PAF-AH were
determined by ELISA using a double mAb capture assay. In brief,
monoclonal antibody 90G11D (Example 13) was diluted in 50 mM
carbonate buffer pH 9.6 at 100 ng/ml and immobilized on Immulon 4
ELISA plates overnight at 4.degree. C. After extensive washing with
PBS containing 0.05/Tween 20, the plates were blocked for 1 hour at
room temperature with 0.5% fish skin gelatin (Sigma) diluted in
PBS. Serum samples diluted in PBS with 15 mM CHAPS were added in
duplicate to the washed ELISA plate and incubated for 1 hour at
room temperature. After washing, a biotin conjugate of monoclonal
antibody 90F2D (Example 13) was added to the wells at a
concentration of 5 .mu.g/ml diluted in PBS and incubated for 1 hour
at room temperature. After washing, 50 .mu.l of a 1:1000 dilution
of ExtraAvidin (Sigma) was added to the wells and incubated for 1
hour at room temperature. After washing, wells were developed using
OPD as a substrate and quantitated. Enzyme activity was then
calculated from a standard curve. FIG. 9, wherein data points
represent means.+-.SEM, shows that at one hour plasma enzyme levels
approached the predicted concentration based on a 5-6 ml plasma
volume for 180-200 gram rats, mean=374 U/ml.+-.58.2. Beyond one
hour plasma levels steadily declined, reaching a mean plasma
concentration of 19.3 U/ml.+-.3.4 at 24 hours, which is still
considerably higher than endogenous rat PAF-AH levels which have
been found to be approximately 4 U/ml by enzymatic assays.
[0194] J. Effectiveness of PAF-AH Versus PAF Antagonists
[0195] Groups of rats (N=4 per group) were pretreated with one of
three potential antiinflammatories: the PAF antagonist CV3988
(Biomol #L-103) administered IP (2 mg in 200 .mu.l EtOH), the PAF
antagonist Alprazolam (Sigma #A-8800) administered IP (2 mg in 200
.mu.l EtOH), or PAF-AH (2000 U) administered IV. Control rats were
injected IV with a 300 .mu.l volume of carrier. The PAF antagonists
were administered IP because they are solubilized in ethanol. Rats
injected with either CV3988 or Alprazolam were challenged with PAF
30 minutes after administration of the PAF antagonist to allow the
PAF antagonist to enter circulation, while PAF-AH and
carrier-treated rats were challenged 15 minutes after enzyme
administration. Rats injected with PAF-AH exhibited a reduction in
PAF-induced edema beyond that afforded by the established PAF
antagonists CV3988 and Alprazolam. See FIG. 10 wherein edema is
expressed as average increase in volume (ml).+-.SEM for each
treatment group.
[0196] In summary, PAF-AH is effective in blocking edema mediated
by PAF in vivo. Administration of PAF-AH can be either local or
systemic by IV injection. In dosing studies, IV injections in the
range of 160-2000 U/rat were found to dramatically reduce PAF
mediated inflammation, while the ID.sub.50 dosage appears to be in
the range of 40-80 U/rat. Calculations based on the plasma volume
for 180-200 gram rats predicts that a plasma concentration in the
range of 25-40 U/ml should block PAF-elicited edema. These
predictions are supported by preliminary pharmacokinetic studies. A
dosage of 2000 U of PAF-AH was found to be effective in blocking
PAF mediated edema for at least 24 hours. At 24 hours following
administration of PAF-AH plasma concentrations of the enzyme were
found to be approximately 25 U/ml. PAF-AH was found to block
PAF-induced edema more effectively than the two known PAF
antagonists tested.
[0197] Collectively, these results demonstrate that PAF-AH
effectively blocks PAF induced inflammation and may be of
therapeutic value in diseases where PAF is the primary
mediator.
EXAMPLE 15
[0198] Recombinant PAF-AH of the invention was tested in a second
in vivo model, PAF-induced pleurisy. PAF has previously been shown
to induce vascular leakage when introduced into the pleural space
[Henriques et al., supra]. Female rats (Charles River, 180-200 g)
were injected in the tail vein with 200 .mu.l of 1% Evans blue dye
in 0.9% with 300 .mu.l recombinant PAF-AH (1500 .mu.mol/ml/hour,
prepared as described in Example 14) or with an equivalent volume
of control buffer. Fifteen minutes later the rats received an 100
.mu.l injection of PAF (2.0 nmol) into the pleural space. One hour
following PAF challenge, rats were sacrificed and the pleural fluid
was collected by rinsing the cavity with 3 ml heparinized phosphate
buffered saline. The degree of vascular leak was determined by the
quantity of Evans blue dye in the pleural space which was
quantitated by absorbance at 620 nm. Rats pretreated with PAF-AH
were found to have much less vascular leakage than control animals
(representing more than an 80% reduction in inflammation).
[0199] The foregoing results support the treatment of subjects
suffering from pleurisy with recombinant PAF-AH enzyme of the
invention.
EXAMPLE 16
[0200] Recombinant PAF-AH enzyme of the invention was also tested
for efficacy in a model of antigen-induced eosinophil recruitment.
The accumulation of eosinophils in the airway is a characteristic
feature of late phase immune responses which occur in asthma,
rhinitis and eczema. BALB/c mice (Charles River) were sensitized by
two intraperitoneal injections consisting of 1 .mu.g of ovalbumin
(OVA) in 4 mg of aluminum hydroxide (Imject alum, Pierce
Laboratories, Rockford. Ill.) given at a 2 week interval. Fourteen
days following the second immunization, the sensitized mice were
challenged with either aerosolized OVA or saline as a control.
[0201] Prior to challenge mice were randomly placed into four
groups, with four mice/group. Mice in groups 1 and 3 were
pretreated with 140 .mu.l of control buffer consisting of 25 mM
tris, 0.5M NaCl, 1 mM EDTA and 0.1% Tween 80 given by intravenous
injection. Mice in groups 2 and 4 were pretreated with 750 units of
PAF-AH (activity of 5,500 units/ml given in 140 .mu.l of PAF-AH
buffer). Thirty minutes following administration of PAF-AH or
buffer, mice in groups 1 and 2 were exposed to aerosolized PBS as
described below, while mice in groups 3 and 4 were exposed to
aerosolized OVA. Twenty-four hours later mice were treated a second
time with either 140 .mu.l of buffer (groups 1 and 3) or 750 units
of PAF-AH in 140 .mu.l of buffer (groups 2 and 4) given by
intravenous injection.
[0202] Eosinophil infiltration of the trachea was induced in the
sensitized mice by exposing the animals to aerosolized OVA.
Sensitized mice were placed in 50 ml conical centrifuge tubes
(Corning) and forced to breath aerosolized OVA (50 mg/ml) dissolved
in 0.9% saline for 20 minutes using a nebulizer (Model 646,
DeVilbiss Corp., Somerset, Pa.). Control mice were treated in a
similar manner with the exception that 0.9% saline was used in the
nebulizer. Forty-eight hours following the exposure to aerosolized
OVA or saline, mice were sacrificed and the tracheas were excised.
Tracheas from each group were inbeded in OCT and stored at
-70.degree. until sections were cut.
[0203] To evaluate eosinophil infiltration of the trachea, tissue
sections from the four groups of mice were stained with either Luna
solution and hematoxylin-eosin solution or with peroxidase. Twelve
6 .mu.m thick sections were cut from each group of mice and
numbered accordingly. Odd numbered sections were stained with Luna
stain as follows. Sections were fixed in formal-alcohol for 5
minutes at room temperature, rinsed across three changes of tap
water for 2 minutes at room temperature then rinsed in two changed
of dH.sub.2O for 1 minute at room temperature. Tissue sections were
stained with Luna stain 5 minutes at room temperature (Luna stain
consisting of 90 ml Weigert's Iron hematoxylin and 10 ml of 1%
Biebrich Scarlet). Stained slides were dipped in 1% acid alcohol
six times, rinsed in tap water for 1 minute at room temperature,
dipped in 0.5% lithium carbonate solution five times and rinsed in
running tap water for 2 minutes at room temperature. Slides were
dehydrated across 70%-95%-100% ethanol 1 minute each, at room
temperature, then cleared in two changes of xylene for 1 minute at
room temperature and mounted in Cytoseal 60.
[0204] For the peroxidase stain, even numbered sections were fixed
in 4.degree. C. acetone for 10 minutes and allowed to air dry. Two
hundred .mu.l of DAB solution was added to each section and allowed
to sit 5 minutes at room temperature. Slides were rinsed in tap
water for 5 minutes at room temperature and 2 drops of 1% osmic
acid was applied to each section for 3-5 seconds. Slides were
rinsed in tap water for 5 minutes at room temperature and
counterstained with Mayers hematoxylin at 25.degree. C. at room
temperature. Slides were then rinsed in running tap water for 5
minutes and dehydrated across 70%-95%-100% ethanol 1 minute each at
room temperature. Slides were cleared through two changes of xylene
for 1 minute each at room temperature and mounted in Cytoseal
60.
[0205] The number of eosinophils in the submucosal tissue of the
trachea was evaluated. Trachea from mice from groups 1 and 2 were
found to have very few eosinophils scattered throughout the
submucosal tissue. As expected tracheas from mice in group 3, which
were pretreated with buffer and exposed to nebulized OVA, were
found to have large numbers of eosinophils throughout the
submucosal tissue. In contrast, the tracheas from mice in group 4,
which were pretreated with PAF-AH and exposed to nebulized OVA were
found to have very few eosinophils in the submucosal tissue
comparable to what was seen in the two control groups, groups 1 and
2.
[0206] Thus, therapeutic treatment with PAF-AH of subjects
exhibiting a late phase immune response involving the accumulation
of eosinophils in the airway, such as that which occurs in asthma
and rhinitis is indicated.
EXAMPLE 17
[0207] PAF-AH of the invention was also tested in a rat model for
treatment of necrotizing enterocolitis (NEC), an acute hemorrhagic
necrosis of the bowel which occurs in low birth weight infants and
causes a significant morbidity and mortality. Previous experiments
have demonstrated that treatment with glucocorticoids decreases the
incidence of NEC in animals and in premature infants, and the
activity of glucocorticoids has been suggested to occur via an
increase in the activity of plasma PAF-AH.
[0208] A. Prevention of NEC
[0209] Recombinant PAF-AH (25,500 units in 0.3 ml, groups 2 and 4)
or vehicle/buffer alone (25 mM tris, 0.5M NaCl, 1 mM EDTA and 0.1
Tween 80) (groups 1 and 3) was administered into the tail veins of
female Wistar rats (n=3) weighing 180-220 grams. Either BSA
(0.25%)--saline (groups 1 and 2) or PAF (0.2 .mu.g/100 gm)
suspended in BSA saline (groups 3 and 4) was injected into the
abdominal aorta at the level of the superior mesenteric artery 15
minutes after PAF-AH or vehicle injection as previously described
by Furukawa, et al. [J. Pediatr. Res. 34:237-241 (1993)]. The small
intestines were removed after 2 hours from the ligament of Trietz
to the cecum, thoroughly washed with cold saline and examined
grossly. Samples were obtained from microscopic examination from
the upper, middle and lower portions of the small intestine. The
tissues were fixed in buffered formalin and the sample processed
for microscopic examination by staining with hematoxylin and eosin.
The experiment was repeated three times.
[0210] Gross findings indicated a normal appearing bowel in groups
treated with the vehicle of BSA saline. Similarly, PAF-AH injected
in the absence of PAF had no effect on the gross findings. In
contrast, the injection of PAF into the descending aorta resulted
in rapid, severe discoloration and hemorrhage of the serosal
surface of the bowel. A similar hemorrhage was noted when a section
of the small bowel was examined on the mucosal side and the
intestine appeared to be quite necrotic. When PAF-AH was injected
via the tail vein 15 minutes prior to the administration of PAF
into the aorta the bowel appeared to be normal.
[0211] Upon microscopic examination, the intestine obtained from
groups 1, 2 and 4 demonstrated a normal villous architecture and a
normal population of cells within the lamina propria. In contrast,
the group treated with PAF alone showed a full thickness necrosis
and hemorrhage throughout the entire mucosa.
[0212] The plasma PAF-AH activities were also determined in the
rats utilized in the experiment described above. PAF-AH activity
was determined as follows. Prior to the tail vein injection, blood
samples were obtained. Subsequently blood samples were obtained
from the vena cava just prior to the injection of PAF and at the
time of sacrifice. Approximately 50 .mu.l of blood was collected in
heparinized capillaries. The plasma was obtained following
centrifugation (980.times.g for 5 minutes). The enzyme was assayed
as previously described by Yasuda and Johnston, Endocrinology,
130:708-716 (1992).
[0213] The mean plasma PAF-AH activity of all rats prior to
injection was found to be 75.5.+-.2.5 units (1 unit equals 1
nmoles.times.min.sup.-1.ti- mes.ml.sup.-1 plasma). The mean plasma
PAF-AH activities 15 minutes following the injection of the vehicle
were 75.2.+-.2.6 units for group 1 and 76.7.+-.3.5 units for group
3. After 15 minutes, the plasma PAF-AH activity of the animals
injected with 25,500 units recombinant PAF-AH was 2249.+-.341 units
for group 2 and 2494.+-.623 units for group 4. The activity of
groups 2 and 4 remained elevated (1855.+-.257 units) until the time
of sacrifice (21/4 hours after PAF-AH injection) (Group
2=1771.+-.308; Group 4=1939.+-.478). These results indicate that
plasma PAF-AH activity of the rats which were injected with the
vehicle alone (groups 1 and 3) did not change during the course of
the experiment. All the animals receiving the PAF injection alone
developed NEC while all rats that were injected with PAF-AH
followed by PAF injection were completely protected.
[0214] B. Dose-Dependency of Prevention of NEC
[0215] In order to determine if the protection against NEC in rats
was dose dependent, animals were treated with increasing doses of
PAF-AH 15 minutes prior to PAF administration. Initially, PAF-AH,
ranging from 25.5 to 25,500 units were administered into the tail
vein of rats. PAF (0.4 .mu.g in 0.2 ml of BSA-saline) was
subsequently injected into the abdominal aorta 15 minutes after the
administration of PAF-AH. The small intestine was removed and
examined for NEC development 2 hours after PAF administration.
Plasma PAF-AH activity was determined prior to the exogenous
administration of the enzyme, and 15 minutes and 21/4 hours after
PAF-AH administration. The results are the mean of 2-5 animals in
each group.
[0216] Gross findings indicated that all rats receiving less than
2,000 units of the enzyme developed NEC. Plasma PAF-AH activity in
animals receiving the lowest protective amount of enzyme (2040
units) was 363 units per ml of plasma after 15 minutes,
representing a five-fold increase over basal levels. When PAF-AH
was administered at less than 1,020 total units, resultant plasma
enzyme activity averaged approximately 160 or less, and all animals
developed NEC.
[0217] C. Duration of Protection Against NEC
[0218] In order to determine the length of time exogenous PAF-AH
afforded protection against development of NEC, rats were injected
once with a fixed amount of the enzyme via the tail vein and
subsequently challenged with PAF at various time points. PAF-AH
(8,500 units in 0.3 ml) or vehicle alone was administered into the
tail vein of rats, and PAF (0.36 .mu.g in 0.2 ml of BSA-saline) was
injected into the abdominal aorta at the various times after the
enzyme administration. The small intestines were removed 2 hours
after the PAF injection for gross and histological examinations in
order to evaluate for NEC development. Plasma PAF-AH activities
were determined at various times after enzyme administration and
two hours after PAF administration. The mean value.+-.standard
error for enzyme activity was determined for each group.
[0219] Results indicated that none of the rats developed NEC within
the first eight hours after injection of PAF-AH, however 100% of
the animals challenged with PAF at 24 and 48 hours following
injection of the enzyme developed NEC.
[0220] D. Reversal of NEC
[0221] In order to determine if administration of PAF-AH was
capable of reversing development of NEC induced by PAF injection,
25,500 units of enzyme was administered via injection into the vena
cava two minutes following PAF administration (0.4 .mu.g). None of
the animals developed NEC. However, when PAF-AH was administered
via this route 15 minutes after the PAF injection, all animals
developed NEC, consistent with the rapid time course of NEC
development as induced by the administration of PAF previously
reported Furukawa et al. [supra].
[0222] The sum of these observations indicate that a relatively
small (five-fold) increase in the plasma PAF-AH activity is capable
of preventing NEC. These observations combined with previous
reports that plasma PAF-AH activity in fetal rabbits [Mali, et al.,
Proc. Natl. Acad. Sci. (USA) 85:728-732 (1988)] and premature
infants [Caplan, et al., J. Pediatr. 116:908-964 (1990)] has been
demonstrated to be relatively low suggests that prophylactic
administration of human recombinant PAF-AH to low birth weight
infants may be useful in treatment of NEC.
EXAMPLE 18
[0223] The efficacy of PAF-AH in a guinea pig model of acute
respiratory distress syndrome (ARDS) was examined.
[0224] Platelet-activating factor (PAF) injected intravenously into
guinea pigs produces a profound lung inflammation reminiscent of
early ARDS in humans. Within minutes after intravenous
administration of PAF, the lung parenchyma becomes congested with
constricted bronchi and bronchioles [Lellouch-Tubiana et al.,
supra. Platelets and polymorphonuclear neutrophils begin to
marginate and cellular aggregates are easily identified along
arterioles of the lung [Lellouch-Tubiana, Br. J. Exp Path.,
66:345-355 (1985)]. PAF infusion also damages bronchial epithelial
cells which dissociate from the airway walls and accumulate in the
airway lumens. This damage to airway epithelial cells is consistent
with hyaline membrane formation that occurs in humans during the
development of ARDS. Margination of the neutrophils and platelets
is quickly followed by diapedesis of these cells into the alveolar
septa and alveolar spaces of the lung. Cellular infiltrates
elicited by PAF are accompanied by significant vascular leakage
resulting in airway edema [Kirsch, Exp. Lung Res., 18:447-459
(1992)]. Evidence of edema is further supported by in vitro studies
where PAF induces a dose-dependent (1-1000 ng/ml) extravasation of
.sup.125I labeled fibrinogen in perfused guinea pig lungs [Basran,
Br. J. Pharmacol., 77:437 (1982)].
[0225] Base on the above observations, an ARDS model in guinea pigs
% as developed. A cannula is placed into the jugular vein of
anaesthetized male Hartly guinea pigs (approximately 350-400 grams)
and PAF diluted in a 500 .mu.l volume of phosphate buffered saline
with 0.25% bovine serum albumin as a carrier (PBS-BSA) is infused
over a 15 minute period of time at a total dosage ranging from
100-400 ng/kg. At various intervals following PAF infusion, animals
are sacrificed and lung tissue is collected. In guinea pigs infused
with PAF, dose dependent lung damage and inflammation is clearly
evident by 15 minutes and continues to be present at 60 minutes.
Neutrophils and red blood cells are present in the alveolar spaces
of PAF treated guinea pigs but absent in control or sham infused
animals. Evidence of epithelial cell damage is also evident and
reminiscent of hyaline membrane formation in human ARDS patients.
Protein determinations done on bronchoalveolar lavage (BAL) samples
taken from guinea pigs infused with PAF shows a dramatic
accumulation of protein in the inflamed lung, clear evidence of
vascular leakage.
[0226] PAF-AH was found to completely protect against PAF mediated
lung injury in the guinea pig model of ARDS. Groups of guinea pigs
were pretreated with either PAF-AH (2000 units in 500 .mu.l) or 500
.mu.l of the PAF-AH buffer only. Fifteen minutes later these guinea
pigs were infused with 400 ng/kg PAF in a 500 .mu.l volume, infused
over a 15 minute period. In addition, a sham group of guinea pigs
was infused with 500 .mu.l of PBS-BSA. At the completion of the PAF
infusion the animals were sacrificed and BAL fluid was collected by
lavaging the lungs 2.times. with 10 ml of saline containing 2
.mu./ml heparin to prevent clotting. To determine protein
concentration in the BAL, samples were diluted 1:10 in saline and
the OD 280 was determined. BAL fluid from sham guinea pigs was
found to have a protein concentration of 2.10.+-.1.3 mg/ml. In
sharp contrast, BAL fluid from animals infused with PAF was found
to have a protein concentration of 12.55.+-.1.65 mg/ml. In guinea
pigs pretreated with PAF-AH, BAL fluid was found to have a protein
concentration of 1.13.+-.0.25 mg/ml which is comparable to the sham
controls and demonstrates that PAF-AH completely blocks lung edema
in response to PAF.
EXAMPLE 19
[0227] Nearly four percent of the Japanese population has low or
undetectable levels of PAF-AH activity in their plasma. This
deficiency has been correlated with severe respiratory symptoms in
asthmatic children [Miwa et al., J. Chin. Invest, 82: 1983-1991
(1988)] who appear to have inherited the deficiency in an autosomal
recessive manner.
[0228] To determine if the deficiency arises from an inactive but
present enzyme or from an inability to synthesize PAF-AH, plasma
from multiple patients deficient in PAF-AH activity was assayed
both for PAF-AH activity (by the method described in Example 10 for
transfectants) and for the presence of PAF-AH using the monoclonal
antibodies 90G11D and 90F2D (Example 13) in a sandwich ELISA as
follows. Immulon 4 flat bottom plates (Dynatech, Chantilly, Va.)
were coated with 100 ng/well of monoclonal antibody 90G11D and
stored overnight. The plates were blocked for 1 hour at room
temperature with 0.5% fish skin gelatin (Sigma) diluted in CMF-PBS
and then washed three times. Patient plasma was diluted in PBS
containing 15 mM CHAPS and added to each well of the plates (50
.mu.l/well). The plates were incubated for 1 hour at room
temperature and washed four times. Fifty .mu.l of 5 .mu.g/ml
monoclonal antibody 90F2D, which was biotinylated by standard
methods and diluted in PBST, was added to each well, and the plates
were incubated for 1 hour at room temperature and then washed three
times. Fifty .mu.l of ExtraAvidin (Sigma) diluted 1/1000 in
CMF-PBST was subsequently added to each well and plates were
incubated for 1 hour at room temperature before development.
[0229] A direct correlation between PAF-AH activity and enzyme
levels was observed. An absence of activity in a patient's serum
was reflected by an absence of detectable enzyme. Similarly, plasma
samples with half the normal activity contained half the normal
levels of PAF-AH. These observations suggested that the deficiency
of PAF-AH activity was due to an inability to synthesize the enzyme
or due to an inactive enzyme which the monoclonal antibodies did
not recognize.
[0230] Further experiments revealed that the deficiency was due to
a genetic lesion in the human plasma PAF-AH gene. Genomic DNA from
PAF-AH deficient individuals was isolated and used as template for
PCR reactions with PAF-AH gene specific primers. Each of the coding
sequence exons were initially amplified and sequenced from one
individual. A single nucleotide change within exon 9 was observed
(a G to T at position 996 of SEQ ID NO: 7). The nucleotide change
results in an amino acid substitution of a phenylalanine for a
valine at position 279 of the PAF-AH sequence (V279F). Exon 9 was
amplified from genomic DNA from an additional eleven PAF-AH
deficient individuals who were found to have the same point
mutation.
[0231] To test whether this mutation crippled the enzyme, an E.
coli expression construct containing the mutation was generated by
methods similar to that described in Example 10. When introduced
into E. coli, the expression construct generated no PAF-AH activity
while a control construct lacking the mutation was fully active.
This amino acid substitution presumably results in a structural
modification which causes the observed deficiency of activity and
lack of immunoreactivity with the PAF-AH antibodies of the
invention.
[0232] PAF-AH specific antibodies of the invention may thus be used
in diagnostic methods to detect abnormal levels of PAF-AH in serum
(normal levels are about 1 to 5 U/ml) and to follow the progression
of treatment of pathological conditions with PAF-AH. Moreover,
identification of a genetic lesion in the PAF-AH gene allows for
genetic screening for the PAF-AH deficiency exhibited by the
Japanese patients. The mutation causes the gain of a restriction
endonuclease site (Mae II) and thus allows for the simple method of
Restriction Fragment Length Polymorphism (RFLP) analysis to
differentiate between active and mutant alleles. See Lewin, pp.
136-141 in Genes V, Oxford University Press, New York, N.Y.
(1994).
[0233] Screening of genomic DNA from twelve PAF-AH deficient
patients was carried out by digestion of the DNA with MaeII,
Southern blotting, and hybridization with an exon 9 probe
(nucleotides 1-396 of SEQ ID NO: 17). All patients were found to
have RFLPs consistent with the mutant allele.
[0234] While the present invention has been described in terms of
specific embodiments, it is understood that variations and
modifications will occur to those skilled in the art. Accordingly,
only such limitations as appear in the appended claims should be
placed on the invention.
Sequence CWU 0
0
* * * * *