U.S. patent application number 10/802682 was filed with the patent office on 2005-04-28 for novel alcohol/aldehyde dehydrogenases.
This patent application is currently assigned to ROCHE VITAMINS INC.. Invention is credited to Asakura, Akira, Hoshino, Tatsuo, Ojima, Setsuko, Shinjoh, Masako, Tomiyama, Noribumi.
Application Number | 20050090645 10/802682 |
Document ID | / |
Family ID | 32178713 |
Filed Date | 2005-04-28 |
United States Patent
Application |
20050090645 |
Kind Code |
A1 |
Asakura, Akira ; et
al. |
April 28, 2005 |
Novel alcohol/aldehyde dehydrogenases
Abstract
The present invention is directed to a recombinant enzymes
having alcohol and aldehyde dehydrogenase activity which comprises
one or more recombinant polypeptides selected from the group
consisting of polypeptides which are identified by SEQ ID NO 5, SEQ
ID NO 6, SEQ ID NO 7, SEQ ID NO 8 and chimeric recombinant
polypeptides that are a chimeric combination of at least two of the
following amino acid sequences identified by SEQ ID NO 5, SEQ ID NO
6, SEQ ID NO 7, SEQ ID NO 8 and functional derivatives of the
polypeptides identified above which contain addition, insertion,
deletion and/or substitution of one or more amino acid residues,
wherein said enzymatic polypeptides have said alcohol and aldehyde
dehydrogenase activity. DNA molecules encoding the recombinant
polypeptides, vectors comprising such DNA molecules, host cells
transformed by such vectors and processes for the production of
such recombinant enzymes are provided. Furthermore, the recombinant
enzymes having alcohol and aldehyde dehydrogenase activity are used
for obtaining aldehydes, ketones or carboxylic acids, and
specifically, 2-keto-L-gulonic acid an intermediate for the
production of L-ascorbic acid (vitamin C).
Inventors: |
Asakura, Akira;
(Fujisawa-shi, JP) ; Hoshino, Tatsuo;
(Kamakura-shi, JP) ; Ojima, Setsuko;
(Fujisawa-shi, JP) ; Shinjoh, Masako;
(Kamakura-shi, JP) ; Tomiyama, Noribumi;
(Fujisawa-shi, JP) |
Correspondence
Address: |
Stephen M. Haracz, Esq.
BRYAN CAVE LLP
1290 Avenue of the Americas
New York
NY
10104-3300
US
|
Assignee: |
ROCHE VITAMINS INC.
|
Family ID: |
32178713 |
Appl. No.: |
10/802682 |
Filed: |
March 17, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10802682 |
Mar 17, 2004 |
|
|
|
09470667 |
Dec 22, 1999 |
|
|
|
6730503 |
|
|
|
|
09470667 |
Dec 22, 1999 |
|
|
|
08934506 |
Sep 19, 1997 |
|
|
|
Current U.S.
Class: |
530/350 |
Current CPC
Class: |
C12P 17/00 20130101;
C12P 7/40 20130101; C12P 7/24 20130101; C12N 9/0006 20130101; C12P
7/26 20130101; C12P 7/60 20130101 |
Class at
Publication: |
530/350 |
International
Class: |
C07K 014/47 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 19, 1996 |
EP |
96115001.8 |
Claims
1. An enzyme comprising a recombinant polypeptide containing an
amino acid sequence selected from the group consisting of SEQ ID
NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and amino acid
sequences with at least 80% identity to SEQ ID NO: 5, SEQ ID NO: 6,
SEQ ID NO: 7 or SEQ ID NO: 8 said recombinant polypeptide having
alcohol and aldehyde dehydrogenase activity.
2. An enzyme of claim 1, wherein the recombinant polypeptide is a
chimeric polypeptide including a combination of at least two amino
acid sequences each of said sequences being selected from the group
consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:
8, and amino acid sequences with at least 80% identity to SEQ ID
NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8, said recombinant
polypeptide having alcohol and aldehyde dehydrogenase activity.
3. An enzyme of claim 1, wherein the enzyme includes at least two
recombinant polypeptides in the form of a homodimer or a
heterodimer.
4-8. (canceled)
9. An enzyme produced by vector selected from the group consisting
of pSSA102R, pSSA'101R, pSSA"102, pSSB103R, pSSAP-B, pSSA/B101R,
pSSA/B102R, pSSA/B103R, pSSB/A101R, pSSB/A102R, pSSB/A103R, pSSsA2,
pSSsA21, PSSsA22 and PSSsB.
10-19. (canceled)
20. A process for producing an aldehyde product from a substrate
which comprises incubating a reaction mixture containing an enzyme
of claim 1 and said substrate wherein said substrate is selected
from the group consisting of n-propanol, isopropanol, D-sorbitol
and D-mannitol, and recovering the aldehyde product.
21. A process for producing a ketone product from a substrate which
comprises incubating a reaction mixture containing an enzyme of
claim 1 and said substrate wherein said substrate is selected from
the group consisting of n-propanol, isopropanol, D-sorbitol and
D-mannitol, and recovering the ketone product.
22. A process for producing a carboxylic acid product from a
substrate which comprises incubating a reaction mixture containing
an enzyme of claim 1 and said substrate wherein said substrate is
selected from the group consisting of L-sorbose, D-glucose,
D-fructose and L-sorbosone, and recovering the carboxylic acid
product.
23-24. (canceled).
25. A process for producing 2-keto-L-gulonic acid which comprises:
(a) incubating a reaction mixture containing a substrate selected
from the group consisting of D-sorbitol and L-sorbose, and a
recombinant enzyme including a recombinant polypeptide containing
an amino acid sequence selected from the group consisting of SEQ ID
NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and amino acid
sequences with at least 80% identity to SEQ ID NO: 5, SEQ ID NO: 6,
SEQ ID NO: 7 or SEQ ID NO: 8, said recombinant polypeptide having
alcohol and aldehyde dehydrogenase activity, and (b) converting the
substrate to 2-keto-L-gulonic acid.
26-27. (canceled).
28. A process for the production of L-ascorbic acid from
2-keto-L-gulonic acid comprising obtaining 2-keto-L-gulonic acid by
a process of claim 25 and transforming the 2-keto-L-gulonic acid
into L-ascorbic acid.
29. An enzyme according to claim 1 wherein the amino acid sequence
is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO:
6, SEQ ID NO: 7 and SEQ ID NO: 8.
30. An enzyme encoded by a recombinant expression vector comprising
a DNA sequence selected from the group consisting of SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and DNA sequences which
encode a polypeptide with at least 80% identity to SEQ ID NO: 5,
SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8, wherein the DNA
sequence is functionally linked to one or more genetic control
sequences and is capable of expression of an enzyme including at
least one recombinant polypeptide having alcohol and aldehyde
dehydrogenase activity.
31. An enzyme encoded by a recombinant expression vector comprising
a DNA sequence selected from the group consisting of SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and DNA sequences which
encode a polypeptide with at least 80% identity to SEQ ID NO: 5,
SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8, and having alcohol and
aldehyde dehydrogenase activity.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to recombinant enzymes,
particularly, novel recombinant alcohol/aldehyde dehydrogenases
(hereinafter referred to as AADH or AADHs) having alcohol and
aldehyde dehydrogenase activity. The present invention also relates
to novel recombinant DNA molecules encoding AADHs, recombinant
expression vectors containing said DNAs, and recombinant organisms
containing said recombinant DNA molecules and/or said recombinant
expression vectors. Furthermore, the present invention relates to a
process for producing recombinant AADHs and a process for producing
aldehydes, carboxylic acids and ketones, especially,
2-keto-L-gulonic acid (herein after referred to as 2KGA) by
utilizing said recombinant enzymes, and a process for producing
aldehydes, carboxylic acids and ketones, especially, 2KGA by
utilizing said recombinant organisms.
BACKGROUND OF THE INVENTION
[0002] 2-KGA is an important intermediate for the production of
L-ascorbic acid (vitamin C). For example, 2KGA can be converted
into ascorbic acid according to the well-known Reichstein method.
Numerous microorganisms are known to produce 2KGA from D-sorbitol
or L-sorbose. Japanese Patent Publication No. 51-40154 (1976)
discloses the production of 2KGA from D-sorbitol by microorganisms
of the genus Acetobacter, Bacterium or Pseudomonas. According to
Acta Microbiologica Sinica 21(2), 185-191 (1981), 2KGA can be
produced from L-sorbose by a mixed culture of microorganisms,
especially, Pseudomonas striata and Gluconobacter oxydans. European
Patent Publication No. 0221 707 discloses the production of 2KGA
from L-sorbose by Pseudogluconobacter saccharoketogenes with and
without concomitant bacteria European Patent Publication No. 0278
447 discloses a process for the production of 2KGA from L-sorbose
by a mixed culture, which is composed of strain DSM No. 4025
(Gluconobacter oxydans) and DSM No. 4026 (a Bacillus megaterium
strain). European Patent Publication No. 88116156 discloses a
process for the production of 2KGA from L-sorbose by Gluconobacter
oxydans DSM No. 4025.
[0003] From G. oxydans DSM No. 4025, AADH was purified and
characterized to catalyze the oxidation of alcohols and aldehydes,
and was thus capable of producing the corresponding aldehydes and
ketones from alcohols, and carboxylic acids from aldehydes (see
European Patent Publication No. 606621). More particularly, the
AADH catalyzed the oxidation of L-sorbose to 2KGA via L-sorbosone.
The physico-chemical properties of the purified sample of the AADH
were as follows:
[0004] a) Optimum pH: about 7.0-9.0
[0005] b) Optimum temperature: about 20.degree. C.-40.degree.
C.
[0006] c) Molecular weight: 135,000+/-5,000 dalton
[0007] (Consisting of two subunits in any combination of such
.alpha.-subunit and .beta.-subunit, each having a molecular weight
of 64,500+/-2,000 aid 62,500+/-2,000, respectively)
[0008] d) Substrate specificity: active on primary and secondary
alcohols and aldehydes including L-sorbose, L-sorbosone,
D-sorbitol, D-glucose, D-mannitol, D-fructose, DL-glyceraldehyde,
ethanol, 1-propanol, 1-butanol, 1-pentanol, 1-hexanol, 1-heptanol,
2-propanol, 2-butanol, propionaldehyde, PEG1000, PEG2000, PEG4000,
PEG6000 and polyvinyl alcohol
[0009] e) Prosthetic group: pyrroloquinoline quinone
[0010] f) Isoelectric point: about 4.4
[0011] Once the genes coding for said AADH have been cloned, they
can be used for the construction of a recombinant organism capable
of producing a large amount of the recombinant AADH or the various
aldehydes, ketones and carboxylic acids, especially, 2KGA. However,
there have been no reports so far of the cloning of such genes.
SUMMARY OF THE INVENTION
[0012] The present invention relates to novel recombinant AADHs
having alcohol and aldehyde dehydrogenase activity. Comprised by
the present invention are novel recombinant molecules encoding the
AADHs; recombinant expression vectors containing said DNAs;
recombinant organisms carrying the DNAs and/or recombinant
expression vectors; a process for producing the recombinant AADHs;
and a process for producing aldehydes, carboxylic acids and
ketones, especially, 2KGA utilizing the recombinant AADHs or the
recombinant organisms.
[0013] More particularly, an aspect of the present invention
concerns a recombinant enzyme having alcohol and aldehyde
dehydrogenase activity which comprises one or more recombinant
polypeptides which contain an amino acid sequence selected from SEQ
ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8 and functional
derivatives thereof which contain addition, insertion, deletion
and/or substitution of one or more amino acid residues, wherein the
recombinant polypeptides have said alcohol and aldehyde
dehydrogenase activity.
[0014] The present invention also provides AADH enzymes which
comprise chimeric recombinant polypeptides that are a chimeric
combination of at least two of the following amino acid sequences
identified by SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8,
and functional derivatives thereof which contain addition,
insertion, deletion and/or substitution of one or more amino acid
residues, wherein the recombinant polypeptides have said alcohol
and aldehyde dehydrogenase activity.
[0015] Another aspect of the present invention concerns a
recombinant DNA molecule encoding at least one recombinant
polypeptide containing an amino acid sequence selected from SEQ ID
NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, chimeric combinations
of at least two of the following amino acid sequences identified by
SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, and functional
derivatives thereof which contain addition, insertion, deletion
and/or substitution of one or more amino acid residues, wherein
said recombinant polypeptides have said alcohol and aldehyde
dehydrogenase activity.
[0016] The recombinant DNA molecules of the present invention
contain DNA sequences encoding the polypeptides with alcohol and
aldehyde dehydrogenase activity as disclosed, e.g., in the sequence
listings herein as well as their complementary strands, or those
which include these sequences, DNA sequences which hybridize under
standard conditions with such sequences or fragments thereof, and
DNA sequences which because of the degeneracy of the genetic code,
do not hybridize under standard conditions with such sequences but
which code for polypeptides having exactly the same amino acid
sequence.
[0017] Further aspects of the present invention concern a
recombinant expression vector which carries one or more of the
recombinant DNA molecules defined above and a recombinant organism
which carries the recombinant expression vector defined above
and/or carries one or more recombinant DNA molecules on a
chromosome.
[0018] A further aspect of the present invention concerns a process
for producing a recombinant enzyme having an alcohol and aldehyde
dehydrogenase activity as defined above, which comprises
cultivating a recombinant organism defined above in an appropriate
culture medium and recovering said recombinant enzyme.
[0019] Another aspect of the present invention concerns a process
for producing an aldehyde, ketone or carboxylic acid product from a
corresponding substrate which comprises converting said substrate
into the product by the use of a recombinant organism as defined
above.
[0020] Moreover another aspect of the present invention concerns a
process for producing 2-keto-L-gulonic acid which comprises the
fermentation of a recombinant organism as defined above in an
appropriate medium containing L-sorbose and/or D-sorbitol.
[0021] Another aspect of the present invention concerns a process
for producing an aldehyde, ketone or carboxylic acid product from a
corresponding substrate which comprises the incubation of a
reaction mixture containing a recombinant enzyme of the present
invention.
[0022] Furthermore another aspect of the present invention concerns
a process for producing 2-keto-L-gulonic acid which comprises the
incubation of a reaction mixture containing a recombinant AADH and
L-sorbose and/or D-sorbitol.
[0023] It is also an object of the present invention to provide an
intermediate, i.e., 2-keto-L-gulonic acid, for the production of
vitamin C whereby a process for the production of 2-keto-L-gulonic
acid as described above is effected and the 2-keto-L-gulonic acid
obtained by such process is transformed into vitamin C (L-ascorbic
acid) by methods known in the art.
[0024] Before describing the present invention in more detail a
short explanation of the attached figures is given.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 schematically illustrates the structures of the
recombinant expression vectors each carrying a recombinant DNA
molecule which encodes a recombinant Enzyme A or B of the present
invention.
[0026] FIG. 2 schematically illustrates the structures of
recombinant expression vectors each carrying a recombinant DNA
molecule which encodes a chimeric enzyme of the present
invention.
[0027] FIG. 3 schematically illustrates the structures of the
material plasmids each carrying a recombinant DNA molecule
containing tandem structural genes of Enzyme A and Enzyme B for
constructing the chimeras by a homologous recombination method.
[0028] FIG. 4 illustrates the recombinant expression vectors each
encoding the chimera Enzyme sA2, Enzyme sA21, Enzyme sA22, or
Enzyme sB, using preferable codon usage, wherein these chimeric
enzymes have structures denoted by the following particular amino
acid residue numbers of the mature amino acid sequences of Enzyme A
and Enzyme B: Enzyme sA2 has the structure of Enzyme A amino acid
residue Nos. 1-135, Enzyme B amino acid residue Nos. 136-180 and
Enzyme A amino acid residue Nos. 180-556; Enzyme sA21 has the
structure of Enzyme A amino acid residue Nos. 1-128, Enzyme B amino
acid residue Nos. 129-180 and Enzyme A amino acid residue Nos.
180-556; Enzyme sA22 has the structure of Enzyme A amino acid
residue Nos. 1-125, Enzyme B amino acid residue Nos. 126-180 and
Enzyme A amino acid residue Nos. 180-556; and Enzyme sB has the
structure of Enzyme A amino acid residue Nos. 1-95, Enzyme B amino
acid residue Nos. 96-180 and Enzyme A amino acid residue Nos.
180-556.
[0029] FIG. 5 shows the alignment of the amino acid sequences of
the mature Enzyme A and Enzyme B.
[0030] FIG. 6 illustrates the construction schemes of the
recombinant genes encoding chimeric enzymes of the present
invention.
[0031] FIG. 7 shows the restriction map of the genes of Enzymes A
and B.
[0032] FIG. 8 illustrates the construction of chimeric genes by
homologous recombination of two AADH genes in vivo at the conserved
nucleotide sequences in both genes.
[0033] FIG. 9 shows a site-directed mutagenesis to introduce a
BamHI site upstream of the Enzyme B gene.
[0034] FIG. 10 illustrates a scheme of the replacement of the
promoter for the Enzyme B gene.
[0035] FIG. 11 shows graphs illustrating the substrate specificity
of chimeric enzymes of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0036] The AADH genes of the present invention encode AADH enzymes
capable of catalyzing the oxidation of various alcohols and
aldehydes as described above. Specifically, particular genes
encoding AADHs present in Gluconobacter were cloned and expressed.
Alternative organisms from which AADH genes can be obtained, may be
identified by one skilled in the art using the teachings of the
present invention.
[0037] A specific and preferred Gluconobacter oxydans strain has
been deposited at the Deutsche Sammlung von Mikroorganismen in
Gottingen (Germany) under DSM No. 4025.
[0038] Moreover, a subculture of the strain has also been deposited
in the Agency of Industrial Science and Technology, Fermentation
Research Institute, Japan, under the deposit No.: FERM BP-3812.
European Patent publication No. 0278 477 discloses the
characteristics of this strain.
[0039] The AADH genes and the recombinant microorganisms utilized
in the present invention can be obtained by the following
steps:
[0040] (1) Cloning the AADH genes from a chromosomal DNA by colony-
or plaque-hybridization, PCR cloning, Western-blot analysis,
Southern-blot hybridization and the like;
[0041] (2) Determining the nucleotide sequences of such AADH genes
by usual methods and constructing recombinant expression vectors
which contain and express AADH genes efficiently; and
[0042] (3) Constructing recombinant microorganisms carrying
recombinant AADH genes on recombinant expression vectors or on
chromosomes by transformation, transduction, transconjugation and
electroporation.
[0043] The materials and the techniques applicable to the above
aspect of the present invention are exemplified in details as
described in the following:
[0044] A total chromosomal DNA can be purified by a procedure well
known in the art (Marmur J., J. Mol. Biol. 3:208, 1961). Then, a
genomic library of the strain for such genes can be constructed
with the chromosomal DNA and the vectors described below in detail.
The genes encoding AADHs can be cloned in either plasmid or phage
vectors from the total chromosomal DNA by the following
methods:
[0045] (i) determining the partial amino acid sequences of the
purified enzyme, according to the sequence information,
synthesizing the oligonucleotides, and selecting the objective gene
from the gene library by Southern-blot-, colony-, or
plaque-hybridization;
[0046] (ii) by amplifying the partial sequence of the desired gene
by polymerase chain reaction (PCR) with the oligonucleotides
synthesized as described above as the primers and with the PCR
product as a probe, selecting the complete sequence of the
objective gene from the gene library by Southern-blot-, colony-, or
plaque-hybridization;
[0047] (iii) by preparing the antibody reacting against the desired
enzyme protein by such a method as previously described, e.g. in
Methods in Enzymology, vol. 73, p 46, 1981, and selecting the clone
which expresses the desired polypeptide by immnunological analysis
including Western-blot analysis; and
[0048] (iv) by aligning the amino acid sequences of the homologs to
the one of the desired enzyme, selecting the amino acid sequences
which are well conserved, synthesizing the oligonucleotides
encoding the conserved sequences, amplifying the partial sequence
of the desired gene by PCR with the above oligonucleotides as the
primers, and selecting the complete sequence as described above
(ii).
[0049] The nucleotide sequence of the desired gene can be
determined by a well known method such as the dideoxy chain
termination method with the M13 phage (Sanger F., et al., Proc.
Natl. Acad. Sci. USA, 74:5463-5467, 1977).
[0050] By using the information of the so determined nucleotide
sequence (in consideration of the codon usage) a gene encoding
evolutionally divergent alcohol/aldehyde dehydrogenases, can be
isolated from a different organism by colony- or
Southern-hybridization with a probe synthesized according to the
amino acid sequence deduced from said nucleotide sequence or by the
polymerase chain reaction with primers also synthesized according
to said information, if necessary.
[0051] To express the desired gene or generally speaking the
desired DNA sequence of the present invention efficiently, various
promoters can be used; for example, the original promoter of said
gene, promoters of antibiotic resistance genes such as the
kanamycin resistant gene of Tn5 (Berg, D. E., and C. M. Berg. 1983.
Bio/Technology 1:417-435), the ampicillin resistant gene of pBR322,
a promoter of the beta-galactosidase gene of Escherichia coli
(lac), trp-, tac- trc-promoter, promoters of lambda phages and any
promoters which can be functional in the hosts consisting of
microorganisms including bacteria such as E. coli, P. putida,
Acetobacter xylinum, A. pasteurianus, A. aceti, A. hansenii and G.
oxydans, mammalian and plant cells.
[0052] Furthermore other regulatory elements, such as a
Shine-Dalgarno (SD) sequence (for example, AGGAGG etc. including
natural and synthetic sequences operable in the host cell) and a
transcriptional terminator (inverted repeat structure including any
natural and synthetic sequence operable in the host cell) which are
operable in the host cell into which the coding sequence will be
introduced can be used with the above described promoters.
[0053] DNA encoding a signal peptide containing from about 15 to
about 50 amino acid residues can be used to obtain expression of
periplasmic AADH polypeptides. DNA encoding a signal peptide can be
selected from any natural or synthetic sequence operable in the
host cell.
[0054] A wide variety of host/cloning vector combinations may be
employed in cloning the double-stranded DNA. Suitable cloning
vectors are generally plasmids or phage which contain a replication
origin, regulatory elemtents, a cloning site including a
multi-cloning site and selection markers such as antibiotic
resistance genes including resistance genes for ampicillin,
tetracycline, kanamycin, streptomycin, gentamicin, spectinomycin,
etc.
[0055] Preferred vectors for the expression of the DNA sequences of
the present invention in E. coli are selected from any vectors
usually used in E. coli, such as pBR322 or its derivatives
including pUC18 and pBluescript II, pACYC177 and pACYC184 (J.
Bacteriol., 134:1141-1156, 1978) and their derivatives, and a
vector derived from a broad host range plasmid such as RK2 and
RSF1010. A preferred vector for the expression of the DNA sequences
of the present invention in Gluconobacter including G. oxydans DSM
No. 4025 and P. putida is selected from any vectors which can
replicate in Gluconobacter and/or P. putida, as well as a preferred
cloning organism such as E. coli. The preferred vector is a
broad-host-range vector such as a cosmid vector like pVK102 and its
derivatives and RSF1010 and its derivatives, and a vector
containing a replication origin functional in Gluconobacter and
another origin functional in E. coli. Copy number and stability of
the vector should be carefully considered for stable and efficient
expression of the cloned gene and also for efficient cultivation of
the host cell carrying the cloned gene. DNA molecules containing
transposable elements such as Tn5 can be also used as a vector to
introduce the DNA sequence of the present invention into the
preferred host, especially on a chromosome. DNA molecules
containing any DNAs isolated from the preferred host together with
the desired DNA sequence of the present invention are also useful
to introduce the desired DNA sequence of the present invention into
the preferred host, especially on a chromosome. Such DNA molecules
can be transferred to the preferred host by transformation,
transduction, transconjugation or electroporation.
[0056] Useful hosts may include microorganisms, mammalian cells,
plant cells and the like. Preferable microorganisms, are bacteria
such as E. coli, P. putida, A. xylinum, A. pasteurianus, A. aceti,
A. hansenii, G. oxydans, and any Gram-negative bacteria which are
capable of producing recombinant AADHs. In accordance with the
present invention, functional equivalents, subcultures, mutants and
variants of said microorganism can also be used. Preferred strains
are E. coli K12 and its derivatives, P. putida or G. oxydans DSM
No. 4025.
[0057] The functional AADH encoding DNA sequence of the present
invention is ligated into a suitable vector containing a regulatory
region such as a promoter and a ribosomal binding site operable in
the host cell described above using well-known methods in the art
to produce an expression plasmid. Structures of such recombinant
expression vectors are specifically shown in FIGS. 1, 2, 4, and
10.
[0058] To construct a recombinant microorganism carrying a
recombinant expression vector, various gene transfer methods
including transformation, transduction, conjugal mating (Chapters
14 and 15, Methods for general and molecular bacteriology, Philipp
Gerhardt et al. ed., American Society for Microbiology, (1994), and
electroporation can be used. The method for constructing a
recombinant organism may be selected from the methods well-known in
the field of molecular biology. Usual transformation systems can be
used for E. coli, Pseudomonas and Acetobacter. A transduction
system can also be used for E. coli. Conjugal mating systems can be
widely used in Gram-positive and Gram-negative bacteria including
E. coli, P. putida and G. oxydans. A preferred conjugal mating
method is described in WO89/06688. The conjugation can occur in
liquid media or on a solid surface. The preferred recipient is
selected from E. coli, P. putida and G. oxydans which can produce
active AADHs with a suitable recombinant expression vector. The
preferred recipient for 2KGA production is G. oxydans DSM No. 4025.
To the recipient for conjugal mating, a selective marker is usually
added; for example, resistance against nalidixic acid or rifampicin
is usually selected.
[0059] The AADHs provided by the present invention catalyze the
oxidation of alcohols and aldehydes, and are thus capable of
producing aldehydes, ketones or carboxylic acids from corresponding
substrates. More particularly, the AADHs provided by the present
invention can catalyze the oxidation of L-sorbose to 2KGA via
L-sorbosone and/or the oxidation of D-sorbitol to L-sorbose.
[0060] The present invention provides AADHs that include one or
more of the following enzymes: Enzyme A, Enzyme A', Enzyme A", and
Enzyme B, which contain the amino acid sequences shown in SEQ ID NO
5, SEQ ID NO 6, SEQ ID NO 7, and SEQ ID NO 8, respectively, and
functional derivatives thereof that have alcohol and aldehyde
dehydrogenase activity, i.e., for example can oxidize substrates to
aldehydes, carboxylic acids and/or ketones. Furthermore, the AADHs
herein include chimeric recombinant polypeptides having any number
of and/or combination of amino acid sequences identified by SEQ ID
NOS. 5, 6, 7, 8 and functional derivatives thereof that have
alcohol and aldehyde dehydrogenase activity, i.e., for example can
oxidize substrates to aldehydes, carboxylic acids and/or
ketones.
[0061] Chimeric recombinant polypeptides encoding the AADHs of the
present invention can be produced by any conventional methods known
in the art. For example, the chimeras can be prepared by combining
two or more parts of DNA sequences of the present invention in
vitro at the conserved restriction site in both sequences with
restriction enzymes and T4-ligase as shown in FIG. 6, or by
recombining two AADH genes in vivo at the conserved nucleotide
sequences in both genes as shown in FIG. 8.
[0062] Functional derivatives of SEQ ID NOS. 5, 6, 7 and 8 contain
addition, insertion, deletion and/or substitution of one or more
amino acid residues of those sequences. Such functional derivatives
can be made by conventional methods known in the art such as
chemical peptide synthesis or by recombinant means, for example,
those methods disclosed by Sambrook et al. (Molecular Cloning, Cold
Spring Harbour Laboratory Press, New York, USA, second edition
1989). Amino acid exchanges in proteins and peptides which do not
generally alter the activity of such molecules are known in the
state of the art and are described, for example, by H. Neurath and
R. L. Hill in "The Proteins" (Academic Press, New York, 1979, see
especially FIG. 6, page 14). The most commonly occurring exchanges
are: Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn,
Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile,
Leu/Val, Ala/Glu, Asp/Gly as well as these exchanges in
reverse.
[0063] The functional derivatives of the AADH polypeptides also
include polypeptides with additional polypeptides at the
N-terminal, C-terminal and/or inside region of the AADH
polypeptides. Enzyme B, Enzyme A/B25, and Enzyme A/B3 fused with
cytochrome c polypeptides (17-18 kDa) of G. oxydans DSM 4025 at the
C-terminus showed comparable AADH activities with their
corresponding enzymes lacking the cytochrome c polypeptides i.e.,
Enzyme B described in Example 4 in the conversion of D-sorbitol to
L-sorbose, and Enzyme A/B25 and Enzyme A/B3 both described in
Example 14 in the conversion of L-sorbose to 2KGA. Thus, a
relatively long polypeptide can be added or inserted to the AADHs
provided by the present invention to form enzymes having comparable
AADH activity.
[0064] The functional derivatives of the AADH polypeptides
described above can have preferred characteristics such as a
desired substrate specificity, higher affinity to a substrate,
lower affinity to an inhibitory compound, higher stability against
temperature and/or pH, and higher catalytic speed. As described in
the working examples below, such derivatives would improve the
productivity of the desired products. The alcohol and aldehyde
dehydrogenase activity of enzymes that include recombinant
polypeptides which contain amino acid sequences that are functional
derivatives of SEQ ID NOS. 5, 6, 7, and/or 8 can be determined by
conventional methods known in the art, such as the preferred
standard assay described herein.
[0065] The enzymatic recombinant polypeptides of the present
invention are usually produced in the form of dimers. Such dimers
include homodimers of Enzyme A, A', A" or B, or the derivatives
including chimeras, and heterodimers consisting of two different
recombinant polypeptides mentioned above. Thus the recombinant
enzymes of the present invention also contain one or more of
said-homodimers and/or heterodimers.
[0066] The recombinant DNA molecules encoding the AADH polypeptides
of the present invention contain DNA sequences selected from SEQ ID
NO 1, SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4, as well as their
complementary strands, or those which include these sequences, DNA
sequences which hybridize under standard conditions with such
sequences or fragments thereof and DNA sequences, which because of
the degeneracy of the genetic code, do not hybridize under standard
conditions with such sequences but which code for polypeptides
having exactly the same amino acid sequence.
[0067] "Standard conditions" for hybridization mean in this context
the conditions which are generally used by one skilled in the art
to detect specific hybridization signals and which are described,
e.g. by Sambrook et al., "Molecular Cloning" second edition, Cold
Spring Harbor Laboratory Press 1989, New York. Such "standard
conditions" are preferably stringent hybridization and
non-stringent washing conditions, or more preferably, stringent
hybridization and stringent washing conditions familiar to those
skilled in the art and which are described, e.g. in Sambrook et al.
(s.a.).
[0068] The DNA sequences encoding the AADHs of the present
invention can be made by conventional methods known in the art,
such as, for example, the polymerase chain reaction by using
primers designed on the basis of the DNA sequences disclosed
herein. It is understood that the DNA sequences of the present
invention can also be made synthetically as described, e.g. in EP
747 483.
[0069] In accordance with the present invention, the DNA molecules
encoding the AADH polypeptides described herein can be
gene-homologs resulting from degeneracy of the genetic code or any
sequence of natural, synthetic or recombinant origin which has
significant homology to the AADH genes. The DNA sequence
derivatives can be functional mutants of the polypeptides
identified by SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 8
which contain addition, insertion, deletion and/or substitution of
one or more amino acid residues, wherein the enzymatic polypeptides
have alcohol and aldehyde dehydrogenase activity. The mutant genes
can be prepared by any conventional method, such as, for example,
treating AADH genes with a mutagen such as ultraviolet irradiation,
X-ray irradiation, .gamma.-ray irradiation or contact with a
nitrous acid, N-methyl-N'-nitro-N-nitrosoguanidine (NTG), or other
suitable mutagens, or isolating a clone occurring by spontaneous
mutation or by standard methods of in vitro mutagenesis known in
the art.
[0070] Enzyme A, A', A", and B genes, which have the nucleotide
sequences shown in SEQ ID NOS. 1, 2, 3, and 4, respectively, and
encode the polypeptides having the amino acid sequences shown in
SEQ ID NOS. 5, 6, 7, and 8, respectively can be derived from G.
oxydans strain DSM No. 4025.
[0071] The AADHs including Enzymes A, A', A" and B provided by the
present invention can be produced from a recombinant organism by
any conventional means for expressing, recovering and purifying a
recombinant protein. For example, the enzyme can be obtained by
culturing the recombinant organism containing the DNA encoding the
enzyme so as to produce the enzyme, disrupting the recombinant
organism, and isolating and purifying them from cell free extracts
of the disrupted recombinant organism, preferably from the soluble
fraction of the recombinant organism.
[0072] The recombinant organisms provided in the present invention
may be cultured in an aqueous medium supplemented with appropriate
nutrients under aerobic conditions. The cultivation may be
conducted at a pH between about 4.0 and 9.0, preferably between
about 6.0 and 8.0. While the cultivation period varies depending
upon pH, temperature and nutrient medium used, usually 2 to 5 days
will bring about favorable results. A preferred temperature range
for carrying out the cultivation is from about 13.degree. C. to
45.degree. C. preferably from about 18.degree. C. to 42.degree.
C.
[0073] It is usually required that the culture medium contains such
nutrients as assimilable carbon sources, digestible nitrogen
sources and inorganic substances, vitamins, trace elements and
other growth promoting factors. As assimilable carbon sources,
glycerol, D-glucose, D-mannitol, D-fructose, D-arabitol,
D-sorbitol, L-sorbose, and the like can be used.
[0074] Various organic or inorganic substances may also be used as
nitrogen sources, such as yeast extract, meat extract, peptone,
casein, corn steep liquor, urea, amino acids, nitrates, ammonium
salts and the like. As inorganic substances, magnesium sulfate,
potassium phosphate, ferrous and ferric chlorides, calcium
carbonate and the like may be used.
[0075] In the following, the properties of the purified recombinant
AADH enzymes specifically from P. putida and the production method
are summarized.
[0076] (1) Enzyme Activity
[0077] The AADHs of the present invention catalyze oxidation of
alcohols and aldehydes including D-sorbitol, L-sorbose, and
L-sorbosone in the presence of an electron acceptor according to
the following reaction formula
Alcohol+Electron acceptor.fwdarw.Aldehyde+Reduced electron
acceptor
Alcohol+Electron acceptor.fwdarw.Ketone+Reduced electron
acceptor
Aldehyde+Electron acceptor.fwdarw.Carboxylic acid+Reduced
acceptor
Sugar alcohol+Electron acceptor.fwdarw.Aldose+Reduced electron
acceptor
Sugar alcohol+Electron acceptor.fwdarw.Ketose+Reduced electron
acceptor
Aldehyde ketose+Electron acceptor.fwdarw.Ketocarboxylic
acid+Reduced electron acceptor
Carboxylic acid+Electron acceptor.fwdarw.Ketocarboxylic
acid+Reduced electron acceptor
[0078] The enzymes herein do not utilize molecular oxygen as an
acceptor. As an acceptor, 2,6-dichlorophenolindophenol (DCIP),
phenazine methosulphate (PMS), Wurster's blue, ferricyanide,
coenzyme Q or cytochrome c can be used.
[0079] The enzymatic activity of the AADHs herein can be determined
by methods known in the art, such as by photometric analysis using
a spectrophotometer. In accordance with the present invention, one
unit of enzyme activity was defined as the amount of enzyme which
catalyzed the reduction of 1 .mu.mole of DCIP per minute. The
extinction coefficient of DCIP at pH 8.0 was taken as 15 mM.sup.-1.
In a preferred standard assay for determining the enzyme activity
of the AADHs herein, a first cuvette includes a standard reaction
mixture (1.0 ml) containing 0.1 mM DCIP, 1 mM PMS, 2 to 125 mM
substrate, 50 mM Tris-malate-NaOH buffer (pH 8.0), and 10 .mu.l of
the enzyme solution. A second cuvette, i.e., a reference cuvette,
contains all the above components except the substrate. The
reference cuvette is used to standardize the background absorbance
resulting from a substrate-independent (endogenous) reaction.
Preferably, a double beam spectrophotometer is used to determine
the activity of the enzyme in the presence of a substrate with
respect to a standard reaction mixture in the absence of the
substrate.
[0080] (2) Properties of the AADHs
[0081] a) Substrate Specificity and Products of the Enzymatic
Reaction
[0082] The Enzymes A, A', A" and B were characterized by their
substrate specificities as described above using 8 substrates:
n-propanol, isopropanol, D-glucose, D-sorbitol, L-sorbosone,
D-mannitol, L-sorbose, and D-fructose. The results are indicated in
Table 1.
1TABLE 1 Substrate specificity of the Enzymes A, A', A" and B
(units/mg of purified protein) Enzyme Enzyme Enzyme Enzyme
Substrate A A'* A" B 50 mM n-Propanol 139.6 180.7 262.3 40.0 50 mM
Isopropanol 76.8 108.9 154.9 72.3 50 mM D-Glucose 2.4 0.0 17.8
943.9 125 mM D-Sorbitol 14.0 7.8 30.1 130.9 2 mM L-Sorbosone 23.15
5.0 26.5 73.6 50 mM D-Mannitol 7.1 1.3 6.2 517.4 125 mM L-Sorbose
47.4 1.6 30.3 8.4 125 mM D-Fructose 30.7 2.9 17.3 2.1 *: Values of
the Enzyme A' was corrected by 1.5-fold, since purity of the enzyme
was about 65%.
[0083] Enzyme B showed a high reactivity for D-glucose or
D-mannitol, but relatively low reactivity for n-propanol and
isopropanol. Enzyme A, Enzyme A' and Enzyme A" showed a high
reactivity for n-propanol and isopropanol, but a low reactivity for
D-glucose and D-mannitol; the enzymes showed similar substrate
specificity patterns, except that the Enzyme A' had a very low
reactivity for L-sorbose or D-fructose.
[0084] Products formed from a substrate in the reaction with Enzyme
A, Enzyme A', Enzyme A" or Enzyme B were analyzed by thin layer
chromatography (TLC) and/or high performance liquid chromatography
(HPLC) with authentic compounds. Enzyme A, Enzyme A' and Enzyme A"
(designated A group) converted D-sorbitol, L-sorbose, L-sorbosone,
D-mannitol, and D-fructose to D-glucose with L-gulose, L-sorbosone
with 2KGA, 2KGA, D-mannose, and 2-keto-D-gluconic acid (2KD),
respectively. Enzyme B (designated B group) converted D-glucose,
D-sorbitol, L-sorbosone, D-mannitol, L-idose, glycerol, D-gluconic
acid, D-mannoic acid to D-gluconate, L-sorbose, 2KGA, D-fructose,
L-idonic acid, dihydroxyacetone, 5-keto-D-gluconic acid, and
5-keto-D-mannoic acid, respectively. Similarly to the reactivity
for L-sorbosone, D-glucosone can be converted to 2KD by all of
above mentioned AADHs. A group enzymes can produce 2KD from
D-fructose whose possible direct product is D-glucosone. All of the
enzymes showed the activity for alcohols including sugar alcohol
such as D-sorbitol and D-mannitol, and aldehydes including aldose
such as D-glucose and ketose such as L-sorbosone.
[0085] b) Optimum pH
[0086] All the enzymes have their optimal point at pH 8.0-8.5 as
shown in Table 2. The Enzymes A" and B have a relatively wide pH
range toward a lower pH, compared with the Enzymes A and A'.
2TABLE 2 Optimal pH of the enzymes (Relative activity, %) pH Enzyme
A Enzyme A' Enzyme A" Enzyme B 6.0 6.5 2.1 35.0 21.0 6.5 13.0 9.3
57.3 51.6 7.0 33.1 22.5 74.8 61.6 7.5 57.7 46.8 90.0 75.3 8.0 100.0
100.0 100.0 100.0 8.5 113.2 142.7 85.6 62.2 9.0 50.0 2.1 46.5 8.0
9.5 19.6 1.8 23.9 0.0
[0087] c) pH Stability
[0088] Enzymes A, A', A" and B were incubated in buffers of various
pH-values for 3 hours at 25.degree. C. and the residual activities
were assayed and expressed as relative values against that obtained
by no incubation at pH 8. Enzymes A, A', A" and B were stable
between pH 6 to 9 as shown in Table 3.
3TABLE 3 pH stability of the enzymes (Relative activity, %) pH
Enzyme A Enzyme A' Enzyme A" Enzyme B 4.0 5.4 0.0 6.2 25.2 5.0 32.0
10.0 77.9 56.1 6.0 74.7 82.7 105.8 100.9 7.0 76.9 96.9 100.9 101.9
8.0 80.1 100.0 99.0 114.0 9.0 60.1 97.3 100.9 101.9 10.0 53.2 85.4
104.0 85.5 11.0 31.0 61.3 79.2 70.1
[0089] d) Thermal Stability
[0090] The residual activities after the treatment of the enzymes
at 4, 20, 30, 40, 50, and 60.degree. C. for 5 minutes are shown in
Table 4.
4TABLE 4 Thermal stability of the enzymes (Relative activity, %)
Temperature Enzyme A Enzyme A' Enzyme A" Enzyme B 4.degree. C.
100.0 100.0 100.0 100.0 20.degree. C. 91.5 100.8 96.0 97.2
30.degree. C. 78.0 103.6 86.1 95.4 40.degree. C. 19.9 78.9 72.8
84.6 50.degree. C. 4.1 0.6 26.6 29.2 60.degree. C. 2.9 0.0 13.3
0.0
[0091] e) Effect of Metal Ions and Inhibitors
[0092] Remaining activities after the treatment of the enzymes with
various metals and inhibitors are shown in Table 5. MgCl.sub.2 and
CaCl.sub.2 were nearly inert to the enzymes, while the other metal
ions, especially CuCl.sub.2, significantly affected the reactivity.
EGTA and EDTA inhibited the Enzymes A, A' and A", remarkably.
However, Enzyme B was less inhibited than the A group enzymes by
EDTA and EGTA.
5TABLE 5 Effect of metals and inhibitors on activities of the
Enzymes A, A', A" and B. (Relative remaining activity) Enzyme A A'
A" B Substrate L- n- L- D- Compound Sorbose Propanol Sorbose
Sorbitol 5 mM CoCl.sub.2 16.6 7.9 46.9 23.6 5 mM CuCl.sub.2 0.0 0.0
0.0 0.0 5 mM ZnCl.sub.2 1.5 6.1 19.2 0.0 5 mM MgCl.sub.2 96.3 85.3
78.8 100.0 5 mM CaCl.sub.2 98.8 95.3 123.0 102.9 5 mM MnCl.sub.2
0.0 45.7 0.0 0.0 5 mM FeCl.sub.2 16.6 0.0 0.0 5.9 5 mM FeCl.sub.3
7.8 0.0 44.7 0.0 5 mM NiSO.sub.4 42.7 59.7 90.3 79.4 10 mM EDTA
43.1 55.1 52.6 91.3 10 mM EGTA 20.4 16.7 56.4 74.0 1 mM NaF 98.2
97.1 94.9 100.8 2 mM NEM 91.7 97.2 94.9 100.8 1 mM ICH.sub.2COONa
97.2 78.3 95.3 100.2 0.5 mM Hydroxyl- 104.6 98.8 97.2 102.1
amine-HCl
[0093] f) Molecular Weight and Subunit
[0094] Enzymes A, A', A" and B purified from P. putida
transconjugants consist of one type of unit with the molecular
weight of about 64,000, 62,500, 62,500 and 60,000, respectively, as
measured by sodium dodecyl sulfate polyacrylamide gel
electrophoresis. They can be heterodimers consisting of any two
units of Enzymes A, A', A" and B when DNA sequences encoding
Enzymes A, A', A" and B are expressed in the same host.
[0095] g) N-Terminal Amino Acid Sequence
[0096] N-terminal sequences of mature Enzymes A and B are
[0097] Enzyme A: Gln-Val-Thr-Pro-Val-Thr--
[0098] Enzyme A": Blocked N-terminal residue
[0099] Enzyme B: Gln-Val-Thr-Pro-Ile-Thr-Asp-Glu-Leu-Leu-Ala--.
[0100] The N-terminus of the mature Enzyme A' is not determined
because of an insufficient purity of the sample.
[0101] (3) Production of the AADHs
[0102] Cells are harvested from the fermentation broth by
centrifugation or filtration. The cells are suspended in the buffer
solution and disrupted by means of a homogenizer, sonicator or
treatment with lysozyme and the like to give a disrupted solution
of cells.
[0103] AADHs are isolated and purified from a cell free extract of
disrupted cells, preferably from the soluble fraction of the
microorganisms by usual protein purification methods such as
ammonium sulfate precipitation, dialysis, ion exchange
chromatographies, gel filtration chromatographies, and affinity
chromatographies.
[0104] (4) Enzyme Reaction
[0105] Enzyme reaction was performed at pH values from about 6.0 to
about 9.0 at the temperature of about 10.degree. C. to about
50.degree. C., and preferrably about 20.degree. C. to 40.degree. C.
in the presence of an electron acceptor, for example, DCIP, PMS,
Wurster's blue, ferricyanide, coenzyme Q, cytochrome c and the like
in a buffer such as Tris-HCl buffer, phosphate buffer and the like.
The concentration of the substrate in a reaction mixture can vary
depending on the other reaction conditions but, in general, is
desirable to be about 1-200 g/l, and most preferably from about
1-100 g/l.
[0106] In the enzyme reaction, AADHs may also be used in an
immobilized state with an appropriate carrier. Any means of
immobilizing enzymes generally known to the art may be used. For
instance, the enzyme may be bound directly to membrane granules, or
the like, of a resin having functional groups, or it may be bound
through bridging compounds having functional groups, for example,
glutaraldehyde, to the resin.
[0107] The recombinant organisms provided by the present invention
are highly useful for the production of the recombinant enzymes
having alcohol and aldehyde dehydrogenase activity. Said organisms
are also useful for the production of aldehydes, carboxylic acids
and ketones, especially, 2KGA by utilizing said recombinant
enzymes, and by utilizing the recombinant organisms.
[0108] The production of 2KGA can be obtained from the recombinant
organisms by fermentation of the recombinant organisms with the
medium and culture conditions as described above. The production of
2KGA may be performed with the recombinant organisms described
above together with concomitant organisms such as E. coli, P.
putida and Bacillus megaterium.
[0109] In accordance with the present invention, 2KGA obtained by
the methods described herein can be transformed into vitamin C
(L-ascorbic acid) by methods known in the art.
EXAMPLES
Example 1
Cloning of AADH Genes
[0110] (1) Construction of a Genomic Library of G. oxydans DSM No.
4025
[0111] Chromosomal DNA was prepared as follows. G. oxydans DSM No.
4025 was cultivated on an agar plate containing 20 ml of NS2 medium
consisting of 5.0% D-mannitol, 0.25% MgSO.sub.4.7H.sub.2O, 1.75%
corn steep liquor, 5.0% baker's yeast (Oriental Yeast Co., Osaka,
Japan), 0.5% CaCO.sub.3, 0.5% urea (sterilized separately) and 2.0%
agar (pH 7.0 before sterilization) at 27.degree. C. for 3 days. The
cells were collected from the agar plate, washed with 10 ml of 10
mM Tris-HCl buffer (pH 8.0) containing 1 mM EDTA and resuspended in
5 ml of 10 mM Tris-HCl buffer (pH 8.0) containing 20 mM EDTA. The
cell suspension was treated with lysozyme (Sigma Chemicals Co., St.
Louis, Mo., USA) at a final concentration of 400 .mu.g/ml at
37.degree. C. for 30 minutes, then with pronase (400 units) at
37.degree. C. 30 minutes and with 1% SDS at 37.degree. C. for 1
hour. Chromosomal DNA was treated with phenol and RNase A
(Boheringer Mannheim, GmbH, Mannheim, Germany) according to the
method described by Maniatis et al. (Molecular cloning: a
laboratory manual. Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y., (1982). Chromosomal DNA (200 .mu.g) was digested with
168 units of SalI (Boehringer Mannheim) at 37.degree. C. for 5 to
90 minutes. The resulting partially digested fragments of 15-35 kb
were isolated by preparative agarose gel electrophoresis (agarose:
0.7%); the gel piece containing the desired fragments was cut out
and the DNAs were electro-eluted from the gel into TAE buffer
consisting of 40 mM Tris-acetate and 2 mM EDTA. Thus, 40 .mu.g of
the DNAs were obtained. In parallel, 8 .mu.g of the cosmid vector
pVK102 (ATCC 37158) was completely digested with SalI and treated
with calf intestine alkaline phosphatase (Boehringer Mannheim)
according to the supplier's recommendation. pVK102 (0.4 .mu.g) was
ligated with the 15-35 kb SalI fragments (0.2-2 .mu.g) by the
ligation kit (Takara Shuzo Co. Ltd., Kyoto, Japan) at 26.degree. C.
for 10 minutes. The ligated DNAs were then used for in vitro
packaging according to the method described by the supplier
(Amersham): mixing the ligated DNAs with the phage coat protein
parts. The resulting phage particles were used to infect E. coli
ED8767 (Murray, N. E., W. J. Brammar and K. Murray. Mol. Gen.
Genet., 150:53-61, 1977). About 3,000 Km.sup.r Tc.sup.s colonies
were obtained and all of the colonies tested (24 colonies)
possessed the insert DNAs; its average size was 26.5 kb. Another
cosmid library of G. oxydans DSM No. 4025 containing 55,000 clones
was constructed by using chromosomal DNA of G. oxydans DSM No. 4025
partially digested with EcoRI and inserting them into the EcoRI
site of pVK100 by almost the same method described above. All of
the colonies tested (24 colonies) possessed insert DNAs (average
size; 27 kb).
[0112] These two cosmid libraries in E. coli ED8767 were then
transferred into E. coli S 17-1 (Tra.sup.+, Bio/Technology,
1:784-791, 1983) by using the mixture of recombinant plasmid DNAs
extracted from E. coli ED8767 libraries. About 4,000 Km.sup.r
transformants of E. coli S17-1 were picked up, cultivated
individually in microtiter plates containing 100 .mu.l of LB
consisting of 10 g/l of Bactotrypton (Difco), 5 g/l of yeast
extract (Difco) and 5 g/l of NaCl supplemented with 50 .mu.g/ml
kanamycin at 37.degree. C., and stocked with 15% glycerol at
-80.degree. C. as cosmid libraries in E. coli S17-1.
[0113] The G. oxydans DSM No. 4025-SalI and -EcoRI cosmid libraries
were constructed in E. coli S17-1. From the library, 1,400 clones
were individually transferred from E. coli S17-1 into P. putida
ATCC 21812 by conjugal mating. 1,400 cultures stocked in microtiter
plates at -80.degree. C. were thawed and transferred to microtiter
plates containing 100 .mu.l of fresh LB medium in each well with a
plate transfer cartridge (Nunc) and cultivated at 37.degree. C.
overnight. Nalidixic acid resistant (Nal.sup.r) P. putida ATCC21812
was cultivated at 30.degree. C. overnight in 100 ml of MB medium
consisting of 2.5% mannitol, 0.5% yeast extract (Difco
Laboratories, Detroit, Mich.) and 0.3% Bactotryptone (Difco). Fifty
.mu.l of the P. putida culture was individually added to the 1,400
wells containing cultures of the cosmid library. The 1,400 cell
mixtures were spotted with plate transfer cartridges onto
nitrocellulose filters placed on the surface of FB agar medium
consisting of 5% fructose, 1% yeast extract (Difco), 1% polypeptone
(Daigo Eiyo, Japan) and 1.8% agar and cultivated at 27.degree. C.
overnight. Nalidixic acid was used for the counter-selection of
transconjugants against donor E. coli. The cells grown on the
filters were individually streaked onto MB agar medium containing
50 .mu.g/ml of nalidixic acid and 50 .mu.g/ml of kanamycin
hereinafter referred to as (MNK agar plate) and incubated for 4
days at 27.degree. C. for the selection of transconjugants. The
resulting colonies were purified by streaking on MNK agar plates as
mentioned above. Thus, 1,400 transconjugants of P. putida [gene
library of G. oxydans DSM No. 4025 in P. putida] were prepared.
[0114] (2) Immunological Screening of Clones of the AADH Gene of G.
oxydans DSM No. 4025.
[0115] At first, 350 transconjugants (175 from SalI library and 175
from EcoRI library) maintained MNK agar plates were individually
cultivated in test tubes containing 5 ml of MNK medium. The cells
were collected from 1.5 ml of each broth and treated for
Western-blot analysis as follows. The cells were suspended in 50
.mu.l of Laemmli buffer consisting of 62.5 mM Tris-HCl, pH 6.8, 10%
glycerol, 5% mercaptoethanol and 2% SDS. The cell suspension was
boiled for 3 minutes, and 10 .mu.l of the cell lysate was applied
on SDS-PAGE. The resulting protein bands were then electro-blotted
to a nitrocellulose filter by an electroblotting apparatus (Marysol
Industrial Co., Ltd.) operated at 40 V, 200 mA for 16 hours in 2.5
mM Tris-19.2 mM glycine buffer, pH 8.6, containing 20% methanol.
The filter was, then, incubated for 1 hour in 3% gelatin in TBS
buffer consisting of 20 mM Tris, pH 7.5, and 500 mM NaCl. After a
brief rinse in TTBS buffer consisting of 20 mM Tris, pH 7.5, 500 mM
NaCl and 0.05% Tween 20, the filter was incubated for 1 hour with a
first-antibody which contained 1:500-diluted anti-AADH antibody in
TTBS buffer containing 1% gelatin. The anti-AADH antibody had been
prepared by mixing the AADH proteins purified from G. oxydans DSM
No. 4025 with incomplete adjuvant, injecting the resulting mixture
into a white rabbit twice with 2 weeks' interval, collecting whole
blood 1 week after the second injection and preparing the serum
fraction as the anti-AADH antibody. Then, the filter was washed
twice (5 min each) in TTBS buffer and incubated for 1 hour in a
second-antibody (goat anti-rabbit IgG-horseradish peroxidase
conjugate) solution which contained 1:3,000-diluted second antibody
in TTBS containing 1% gelatin. After washing in TTBS buffer twice
and in TBS once, the filter was immersed in a color developing
solution until blue bands became visible with Konica Immunostaining
HRP Kit IS-50B (Konica, Tokyo, Japan) according to the supplier's
recommendation. For an actual screening, five cell lysates were
mixed and applied to one well for the first Western-blot screening.
Out of 70 mixtures, 14 exhibited positive bands; nine samples had
immuno-reactive proteins of approximate Mr 64,000, but two of these
exhibited weak signals; one had an immuno-reactive protein of
approximate Mr 60,000; and four samples had immuno-reactive
proteins of Mr 55,000.
[0116] Seven mixture samples showing strong signals at Mr 64,000
were individually subjected to a second Western-blot screening to
identify the clone in each mixture. One positive clone per one
mixture samples was identified; plasmids of the seven clones were
designated as p6E10, p16C8, p16F4, p17E8, p1E2, p24D4, and p26C3,
respectively. By restriction enzyme analysis, it was found that
four plasmids, p6E10, p16C8, p16F4, and p17E8, carried the same DNA
region and the other three carried different regions from that of
the former four plasmids.
[0117] (3) Screening of the AADH Genes from the Cosmid Libraries by
Colony-Blot and Southern-Blot Hybridization
[0118] To find the other AADH genes besides the genes obtained by
the immunological screening as described above, the whole cosmid
libraries of G. oxydans DSM No. 4025 in E. coli ED 8767
(SalI-library and EcoRI-libraries) were screened by colony- and
Southern-blot hybridization with a 0.9 kb SalI fragment of p24D4.
The 0.9 kb SalI fragment hybridized with a oligonucleotide probe,
ATGATGGT(GATC)AC(GATC)AA(TC)GT synthesized according to an internal
amino acid sequence of the natural AADH enzyme purified from G.
oxydans DSM No. 4025, MetMetValThrAsnValAspValGlnMetSerT- hrGlu,
which was obtained by digestion and sequenced by automatic
gas-phase sequencer (Applied Biosystems 470A). The cells of the
cosmid libraries were appropriately diluted and spread on LK agar
plates, and the resulting colonies were blotted onto nylon filters
and were analyzed by hybridization with the .sup.32P-labeled 0.9 kb
SalI fragment. About 1% of the colonies showed positive signals; 41
colonies were selected from the SalI library and 20 from EcoRI
library, and they were subjected to restriction enzyme analysis,
followed by Southern-blot analysis. Six different AADH gene-related
DNA regions were isolated in this screening as follows: four
already-isolated regions carried on p24D4, p1E2, p26C3 and, p17E8,
and two new regions carried on two separate plasmids designated as
pSS31 and pSS53. The other plasmid pSS33 carried both of the two
regions which were carried on p24D4 and pSS31.
[0119] (4) Immunological and Enzymatic Characterization of AADH
Clones
[0120] Western-blot analysis of cell lysates of P. putia carrying
p24D4, p1E2, p26C3, pSS31 and p17E8 showed that the five clones
encoded proteins with molecular weights of about 64,000, 62,500,
62,500, 60,000 and 62,000, respectively. Plasmid pSS33 encoded two
immuno-reactive proteins with molecular weights of about 64,000 and
60,000, whereas pSS53 did not produce any immuno-reactive
proteins.
[0121] Enzyme activities of each clone (cell free extract, soluble
fraction and membrane fraction) were measured by photometric
analysis. The cells of each clone were inoculated in 5 ml of MB
medium in a test tube and cultivated at 30.degree. C. for 24 hours.
The resulting broth was transferred into 200 ml of fresh MB medium
in 500 ml flask and the flask was shaken on the rotary flask shaker
at 30.degree. C. for 24 hours. The cells were collected by
centrifugation at 6,000.times.g for 10 minutes and washed with 40
ml of cold buffer consisting of 50 mM Tris-HCl, pH 7.5, 5 mM
MgCl.sub.2 and 0.5 mM phenylmethylsulfonyl fluoride and suspended
with the same buffer to prepare cell suspension of 1 g wet cells
per 5 ml. The cell suspension was subjected twice to a French press
cell disrupter (1,500 kg/cm.sup.2) and the resulting homogenate was
centrifuged at 6,000.times.g for 10 minutes to remove cell debris.
Thus obtained cell free extract (CFE) was centrifuged at
100,000.times.g for 60 minutes. The resulting supernatant and
pellet were collected as the cytosol fraction and the membrane
fraction, respectively and subjected to PMS-DCIP assay as follows.
The enzyme reaction mixture (1.0 ml) contained 100 .mu.M DCIP, 1 mM
PMS, 50 mM Tris malate-NaOH buffer, pH 8.0, a substrate and the
enzyme (10 .mu.l). Substrate-dependent decreasing rate of
absorbance of DCIP at 600 nm was measured at 25.degree. C. by using
a Kontron spectrophotometer UVIKON 810. Table 6 shows the level of
enzyme activities in the cell free extract and the soluble
fractions of the clones. According to the substrate specificity,
the enzyme encoded on each plasmid was classified into large three
groups, A-, B- and C-groups: A-group catalyzes the oxidation of
L-sorbose, D-sorbitol and 1-propanol; B-group catalyzes the
oxidation of D-glucose and D-sorbitol; C-group showed no clearly
detectable activities on the substrates used. In the A-group, there
were three types, A, A' and A" each of which was distinguished from
each other by their physical map of the DNA carried on each
plasmid. B- or C-group each consisted of only one type of protein
derived from one region of the chromosomal DNA.
6 TABLE 6 CFE Soluble fraction Enzyme Enzyme Sorbose Sorbose*1
Glucose*2 Sorbitol*3 Sorbosone*4 n-Propanol Group Name Plasmid 125
mM 125 mM 50 mM 125 mM 2 mM 50 mM A A p24D4 +++ +++ - +++ +++ ++++
A A' p1E2 + + - + + + A A" p26C3 + + - +/- + + B B pSS31 - - ++++
++ + + C -- p17E8 - - +/- - - - A and B A and B pSS33 +++ +++ ++++
++++ +++ ++++ Level of the activity; ++++ very high +++ high ++
medium + low +/- trace - not detected *1-*4 Oxidation product of
each substrate was determined by a resting cell reaction followed
by TLC analysis. *1 Oxidation product of L-sorbose by Enzymes A,
A', A", and [A and B] was 2KGA. *2 Oxidation product of D-glucose
by Enzyme B, and Enzyems [A and B] was D-gluconic acid. *3
Oxidation product of D-sorbitol by Enzymes A, A', and A" was mainly
D-glucose; that by Enzyme B was L-sorbose; and that by Enzymes [A
and B] was mixture of D-glucose and L-sorbose. *4 Oxidation product
of L-sorbosone by Enzymes A, A', A", B, and [A and B] was 2KGA.
Example 2
Nucleotide Sequencing
[0122] Nucleotide sequences of the genes for Enzymes A, A', A" and
B were determined with the plasmids, p24D4, p1E2, p26C3, and pSS31,
respectively, by the dideoxynucleotide chain termination method
using M13mp18 and M13mp19 (Boehringer Mannheim). One open reading
frame (ORF) for each gene was found; the nucleotide sequences of
the four genes are shown in the sequence list SEQ ID NOS. 1 to 4
and the amino acid sequences deduced from the nucleotide sequences
were shown in the sequence list SEQ ID NOS. 5 to 8. The ORFs for
Enzymes A, A', A" and B genes are 1737, 1737, 1734, and 1737-bp
long and encode 579, 579, 578 and 579 amino acid residues all
including 23 amino acid of signal sequences.
[0123] The homologies between Enzymes A, A', A" and B are shown in
Table 7.
7TABLE 7 Homologies of amino acid sequences among AADHs. (%) Enzyme
A Enzyme A' Enzyme A" Enzyme B Enzyme A 100 -- -- -- Enzyme A' 89
100 -- -- Enzyme A" 85 86 100 -- Enzyme B 83 82 81 100
[0124] FIG. 5 shows the amino acid sequences of mature Enzyme A and
Enzyme B which are aligned so as to be comparable.
[0125] Homology search of Enzymes A, A', A" and B revealed that
Enzymes A, A', A" and B showed rather low homology (26-31% homology
through the polypeptides) with several quino-proteins including
alcohol dehydrogenase of Acetobacter aceti (T. Inoue et al., J.
Bacteriol. 171: 3115-3122) or Acetobacter polyoxogenes (T. Tamaki
et al., B. B. A., 1088:292-300), and methanol dehydrogenase of
Paracoccus denitrificans (N. Harms et al., J. Bacteriol., 169:
3966-3975), Methylobacterium organophilum (S. M. Machlin et al., J.
Bacteriol., 170: 4739-4747), or Methylobacterium extorquens (D. J.
Anderson et al., Gene 90: 171-176).
Example 3
Subcloning of AADH Genes
[0126] Enzyme A gene was originally cloned as a cosmid clone of
p24D4 which has about 25 kb insert in EcoRI site of pVK100. Then,
it was further subcloned to use as an Enzyme A gene cassette. The
2.7 kb EcoRV fragment which includes ORF of Enzyme A gene with
about 500 bp of non-coding regions at the both ends was excised
from 3.4 kb NruI fragment, which was isolated from p24D4 in M13
mp18, and was ligated to HindIII site of pUC18 with HindIII linker
(CAAGCTTG). The resulting plasmid was designated pSSA202. Enzyme A
gene cassette (2.7 kb HindIII fragment) was then inserted at
HindIII site of pVK102 to produce pSSA102R. The plasmid pSSA102R
was introduced into nalidixic acid resistant P. putida [ATCC 21812]
by a conjugal mating method as described in Example 1-(1). The
transconjugant of P. putida carrying pSSA102R was selected on MB
agar medium containing 50 .mu.g/ml nalidixic acid and 10 .mu.g/ml
tetracycline (MNT agar medium) and subjected to a mini-resting cell
reaction. The reaction mixture (100 .mu.l) consisting of 20 g/l
L-sorbose, 3 g/l NaCl, 10 g/l CaCO.sub.3 and the cells collected
from the MNT agar culture with a toothpick was incubated at room
temperature with gentle shaking for 24 hours. The reaction mixture
was assayed with TLC and 2KGA was identified as the product, while
no 2KGA was observed by the same resting cell reaction with the
host, nalidixic acid resistant P. putida [ATCC 21812].
[0127] Enzyme B gene was originally cloned as a cosmid clone of
pSS31 which has about 30 kb insert in SalI site of pVK102. It was
subcloned as 6.5 kb BglII fragment into BglII site of pVK101 (ATCC
37157) to obtain pSSB102. Then, it was further subcloned to use as
a Enzyme B gene cassette. The 6.5 kb BglII fragment was cloned into
BamHI site of pUC18 to obtain pSSB202. Then, 2.3 kb XhoII fragment
was excised from pSSB202. The 2.3 kb XhoII fragment includes ORF of
Enzyme B with 120 bp of 5'-noncoding region and about 500 bp of
3'-noncoding region. The fragment was treated with Klenow fragment
to fill-in the cohesive ends and cloned into HindIII site of pUC18
with HindIII linker to produce pSSB203. The Enzyme B gene cassette
(2.3 kb HindIII fragment) was inserted at HindIII site of pVK102 to
make pSSB103R. The plasmid pSSB103R was introduced into nalidixic
acid resistant P. putida [ATCC 21812] by a conjugal mating method,
and the transconjugant of P. putida carrying pSSB103R was selected
on MNT agar medium and subjected to a mini-resting cell reaction.
P. putida carrying pSSB103R showed the Enzyme B actiuvity
(L-sorbose formation from D-sorbitol) in the resting cell reaction.
(Incidentally, XhoII fragment was found not to be a XhoII-XhoII
fragment, but a XhoII-XhoI fragment as a result of nucleotide
sequencing. XhoI might be present in the XhoII preparation.)
[0128] Enzyme A' and Enzyme A" genes were originally cloned as a
cosmid clone of p1E2 and p26C3 which have about 30 kb insert in
SalI site of pVK102 and further subcloned basically as described
above. Enzyme A' gene in 3.5 kb XhoII fragment was subcloned in
BglII site of pVK102 to construct pSSA'101R, and Enzyme A" gene in
2.7 kb EcoRV fragment was first subcloned into M13mp19 and then
re-subcloned between HindIII and BglII sites of pVK102 to construct
pSSA"102.
Example 4
Isolation and Characterization of AADHs from Transconjugants of P.
putida
[0129] (1) Cultivation of Microorganisms
[0130] P. putida [ATCC 21812] carrying cosmid vector pVK102
containing the Enzyme A, A', A" and B genes; pSSA102R, p1E2, p26C3
and pSSB103R, respectively, were cultivated in MB broth in the
presence of antibiotic. Antibiotics added into medium were as
follows; 5 .mu.g/ml tetracycline for pSSA102R (Enzyme A) and
pSSB103R (Enzyme B), 25 .mu.g/ml kanamycin for p1E2 (Enzyme A') and
p26C3 (Enzyme A"). From the agar plate of MB containing the
respective antibiotic, the cells were inoculated in 10 test tubes
containing 5 ml MB medium with the respective antibiotic and
cultivated with shaking at 30.degree. C. After 2 days of
cultivation, the cells were transferred to ten 500 ml-Erlenmeyer
flasks containing 100 ml of the same medium and cultivated with
shaking at 30.degree. C. After 1 day of cultivation, the seed
cultures were combined and transferred to 18 liters of the medium
in 30 L jar fermenter (Marubishi) and cultivated for 18 hours with
300 rpm agitation and 1.0 vvm aeration at 30.degree. C. The cells
were harvested by centrifuge at 6,000.times.g for 10 minutes,
washed once with 1.5 liters of 25 mM Tris-HCl, pH 7.5, containing 5
mM CaCl.sub.2, 1 mM MgCl.sub.2, 0.2 M NaCl, 2.5% sucrose, and 0.5
mM PMSF and stocked at -20.degree. C. until use. As a result, about
150 g wet weight cells were obtained.
[0131] (2) Purification of the Cloned Enzymes A, A', A", and B.
[0132] Purifications of the Enzymes A, A', A" and B were carried
out by the same procedure with almost the same scale. All
operations were carried out at 4-10.degree. C. unless otherwise
stated. The enzyme activity determination for Enzyme A, A', A" and
B were carried out with the substrates, L-sorbose, n-propanol,
n-propanol and D-glucose, respectively, by spectrophotometric assay
as described in Example 1 throughout the purification steps. The
cells (about 100 g wet weight cells containing 8-10 g of total
proteins) were thawed and suspended in about 200 ml of 25 mM
Tris-HCl, pH 8.0, and disrupted by passing through French press
(1500 kg/cm.sup.2) twice. Then, DNase and MgCl.sub.2 were added to
the suspension at the final concentration of 0.01 mg/ml and 1 mM,
respectively, to reduce viscosity of the solution due to DNA. Cell
debris was removed by centrifugation at 6,000.times.g for 10
minutes. The suspension was filled up to 240 ml with the 25 mM
Tris-HCl buffer, pH 8.0, and centrifuged at 100,000.times.g for 90
minutes to remove insoluble membrane fraction. The soluble
supernatant was filled up to 240 ml with the Tris buffer and, then,
pyrroloquinoline quinone (PQQ) and CaCl.sub.2 were added at the
final concentration of 12.5 .mu.M and 5 mM, respectively, and the
solution was stirred vigorously for 15 minutes at room temperature.
The soluble fraction prepared as above was fractionated by
(NH.sub.4).sub.2SO.sub.4. The fraction 35-60%-saturated
(NH.sub.4).sub.2SO.sub.4 was precipitated and resuspended in 100 ml
of 25 mM Tris-HCl buffer, pH 8.0, containing 5 mM CaCl.sub.2, and
5% sucrose and, then, PQQ was added again at the final
concentration of 12.5 .mu.M. The enzyme solution was dialyzed
against 1000 ml of the same buffer (without PQQ) overnight. Twenty
grams of solid polyethylene glycol #6000 was added to the dialysate
slowly with gentle stirring. After stirring for 30 minutes,
precipitates were removed by centrifugation at 10,000.times.g for
20 minutes, and the supernatant was filled up to 200 ml with the
buffer indicated as above.
[0133] The enzyme solution prepared as above was purified by
following three chromatography steps.
[0134] The First Step: DEAE-Toyopearl 650M
[0135] The crude enzyme solution was subjected to a column of
DEAE-Toyopearl 650M (2.5.times.40 cm) which had been equilibrated
with 25 mM Tris-HCl buffer, pH 8.0, containing 5 mM CaCl.sub.2, and
5% sucrose. The column was washed with 400 ml of the same buffer
and the enzyme was eluted by 2,000 ml of 0-0.5 M NaCl linear
gradient in the buffer at a flow rate of 150 ml/hour. The enzyme
active fractions were pooled and diluted 2-fold with the buffer
without NaCl.
[0136] The Second Step: Q-Sepharose (Fast Flow)
[0137] The enzyme solution was subjected to a column of Q-Sepharose
(Fast Flow) (1.5.times.20 cm) which had been equilibrated with the
buffer without NaCl. The column was washed with 200 ml of the
buffer containing 0.2 M NaCl and the enzyme was eluted by 600 ml of
0.2-0.6 M NaCl linear gradient in the buffer at a flow rate of 50
ml/hour. The enzyme active fractions were pooled and concentrated
to 2.5 ml by using ultrafilter:Amicon, PM-30 under N.sub.2 gas.
[0138] The Third Step: Sephacryl S-300 HR (Gel Filtration)
[0139] The concentrated enzyme was filtrated by a column of
Sephacryl S-300 HR (2.5.times.100 cm) which had been equilibrated
with 25 mM HEPES, pH 7.5, containing 5 mM CaCl.sub.2, 5% sucrose,
and 0.2 M NaCl. The column was developed by the same buffer at a
flow rate of 20 ml/hour. The enzyme active fractions were pooled
and concentrated to below 1 ml by the ultrafilter mentioned above
and, then, stocked at -80.degree. C. The enzymes concentrated in
the HEPES buffer was stable for at least 2 months at -80.degree.
C.
[0140] Consequently, 26.0 mg of Enzyme A, 0.35 mg of Enzyme A',
0.41 mg of Enzyme A", and 5.0 mg of Enzyme B were obtained.
[0141] (3) Properties of the Enzymes A, A', A" and B.
[0142] a) Molecular Weight and Subunit.
[0143] The Enzymes A, A', A" and B were eluted at the same position
from the same gel filtration column on Sephacryl S-300HR under the
same condition. The molecular weight of the enzymes was estimated
as approximately 135,000 comparing with the molecular weight
standard proteins (SDS-PAGE Standards, Low Range, Bio-Rad
Laboratories, Richmond, Calif., USA). The Enzymes A, A', A" and B
showed homogeneous single bands on SDS-PAGE analysis with molecular
weights of 64,000, 62,500, 62,500 and 60,000, respectively. All the
Enzyme bands A, A', A" and B were detected on Western blotting
analysis using anti-AADH rabbit serum. Therefore, it was concluded
that the enzymes consisted of two identical subunits as an
homo-dimeric form.
[0144] b) N-Terminal Amino Acid Sequence and Amino Acid
Composition.
[0145] N-terminal amino acid sequences of the mature Enzymes A, A"
and B were analyzed with automatic gas-phase sequencer (470A;
Applied Biosystems) by Edman method [Acta Chem. Scand., 4, 283-293,
{1950)]. The analysis of the Enzyme A' was not done because of an
insufficient purity of the sample. The results were as follows:
[0146] Enzyme A: Gln-Val-Thr-Pro-Val-Thr--
[0147] Enzyme A": Blocked N-terminal residue
[0148] Enzyme B: Gln-Val-Thr-Pro-Ile-Thr-Asp-Glu-Leu-Leu-Ala--.
[0149] The determined sequences of Enzyme A and B were identical to
the sequences (starting from the twenty-fourth residues) deduced
from the nucleotide sequences described in SEQ ID NOS. 5 and 8;
these results indicate that the initial 23 residues of the enzymes
are the signal sequences. By analogy of the Enzymes A and B, the
first 23 residues of Enzyme A' and A" are also deduced to be the
signal sequences.
[0150] The amino acid composition of the Enzyme A was determined.
The protein was hydrolyzed with 6 N HCl at 110.degree. C. for 24
hours or 4 M methanesulfonic acid (after oxidation with performic
acid) at 115.degree. C. for 24 hours. Amino acid analysis was
performed by using Kontron amino acid analyzer (ninhydrin system).
The analytical data were compared with the amino acid composition
deduced from the DNA sequence of Enzyme A gene. It indicated that
the purified Enzyme A was certainly a product of the Enzyme A
gene.
[0151] c) Substrate Specificity
[0152] The Enzymes A, A', A" and B were characterized by their
substrate specificities on PMS-DCIP assay as described above using
8 substrates, n-propanol, isopropanol, D-glucose, D-sorbitol,
L-sorbosone, D-mannitol, L-sorbose, and D-fructose. The results
were indicated in Table 1.
[0153] d) Physicochemical Property
[0154] Physicochemical studies of optimal pH, pH stability and
thermal-stability, of the Enzymes A (as L-sorbose dehydrogenase
activity), A' (as n-propanol dehydrogenase activity), A" (as
L-sorbose dehydrogenase activity) and B (as D-sorbitol
dehydrogenase activity), were performed by the PMS-DCIP assay.
[0155] Table 2 summarizes the results of optimal pH of the enzymes.
The enzyme activity was assayed by the PMS-DCIP spectrophotometric
assay using various pH buffers. The buffers were 50 mM
Tris-malate-NaOH, pH 6.0, 6.5, 7.0, 7.5, 8.0 and 8.5; 50 mM
glycine-NaOH, pH 9.0 and 9.5. The extinction coefficients of DCIP
at pH 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0 and 9.5 were taken as 10.8,
13.2, 14.5, 14.9, 15.0, 15.1, 15.1 and 15.1, respectively. All the
enzymes showed their optimal points at pH 8.0-8.5. The Enzymes A"
and B had relatively wide pH range toward lower pH, compared with
the Enzymes A and A'.
[0156] Table 3 indicates the results of pH-stabilities of the
enzymes. The enzyme (about 0.01 mg/ml) was incubated with 50 mM
buffer containing 5% sucrose, 0.2 M NaCl, and 5 mM CaCl.sub.2 at
25.degree. C. for 3 hours and assayed by PMS-DCIP
spectrophotometric method. The buffers were Na-acetate, pH4 and 5,
Tris-malate-NaOH, pH 6, 7 and 8, glycine-NaOH, pH 9 and 10. The
values in the table are expressed as relative activity against that
obtained by no incubation at pH 8.0. The substrates used for the
enzymes were 125 mM L-sorbose for Enzymes A and A", 50 mM
n-propanol for Enzyme A', and 125 mM D-sorbitol for Enzyme B.
Profiles of pH-stabilities of Enzymes A, A', A", and B were almost
the same; they were stable at the range of pH 6 to 9.
[0157] Table 4 indicates the results of thermal-stabilities of the
enzymes. The enzyme (about 0.05 mg/ml) in 25 mM HEPES buffer, pH
7.5, containing 5% sucrose, 0.2M NaCl, and 5 mM CaCl.sub.2 was
incubated at temperature indicated in the table (4-60.degree. C.)
for 5 minutes, cooled in ice bath and assayed by PMS-DCIP
spectrophotometric method. Remaining activity was expressed as
relative activity against that obtained by 4.degree. C. incubation.
The substrates used for the enzymes were 125 mM L-sorbose for
Enzyme A and Enzyme A", 50 mM n-propanol for Enzyme A', and 125 mM
D-sorbitol for Enzyme B. After the treatment of the enzymes at
40.degree. C. for 5 min, the residual activity of Enzyme A was 20%,
and those of Enzymes A', A", and B were 70-85%.
[0158] e) General Inhibitors
[0159] The enzyme (about 0.05 mg/ml) in 25 mM HEPES buffer, pH 7.5,
containing 5% sucrose was incubated with metal or inhibitor for 30
minutes at 25.degree. C. Remaining activity was assayed by PMS-DCIP
spectrophotometric assay as described in Example 1. Remaining
activity is expressed as relative activity against blank
incubation. Effects of metal ions on the enzymes are listed in
Table 5. MgCl.sub.2 and CaCl.sub.2 were nearly inert to the
enzymes, while the other metal ions, especially CuCl.sub.2,
significantly affected. Effects of inhibitors on the enzymes are
also included in Table 5. EGTA and EDTA inhibited the Enzyme A,
A'and A", remarkably. However, Enzyme B was less inhibited than the
A group enzymes by EDTA and EGTA.
Example 5
Efficient Production of Enzyme B in E. coli
[0160] The signal peptide region of the Enzyme B was replaced with
that of maltose binding protein (malE) of E. coli as follows. Two
oligonucleotides (SEQ ID NOS. 9 and 10) were synthesized with
Applied Biosystem 381A DNA synthesizer and annealed to generate a
double-stranded DNA fragment encoding a amino acid sequence (SEQ ID
NO. 11),
MetLysIleLysThrGlyAlaArgIleLeuAlaLeuSerAlaLeuThrThrMetMetPheSer
AlaSerAlaLeuAla(Gln), which was, then, treated with T4
polynucleotide kinase [J. Biol. Chem., 259, 10606-10613, (1984)].
pSSB203 (see Example 3) was digested with the restriction enzyme
SphI, treated with T4 DNA polymerase and digested with BstP1. The
resulting 1.72 kb DNA fragment carrying Enzyme B gene without the
region coding for the original signal sequence and the first amino
acid residue (Gln) of the mature Enzyme B was isolated from an
agarose gel after agarose gel electrophoresis. The E. coli
expression vector, pTrc99A (Pharmacia Co., Uppsala, Sweden), which
was digested with the restriction enzymes NcoI (at ATG start codon)
and SmaI was ligated with above two DNA fragments. The resulting
plasmid was designated as pTrcMal-EnzB and used to transform E.
coli JM109. The transformant was grown in two 2-liter flasks each
containing 600 ml of LB with 100 .mu.g/ml ampicillin at 28.degree.
C. and IPTG was added to 0.1 mM when cell concentration reached at
about 1.5 OD600. Following the addition of IPTG, the cells were
cultivated for an additional 3-4 hours. The cells were harvested by
centrifugation (4,000.times.g) at 25.degree. C. for 10 minutes,
suspended with 500 ml of 30 mM Tris-HCl, pH 8.0, containing 20%
sucrose at 25.degree. C. After EDTA was added to 1 mM into the cell
suspension, the cells were incubated with gentle shaking for 5
minutes at 25.degree. C. and collected by centrifugation
(8,000.times.g) at 4.degree. C. for 15 minutes. The cells were
resuspended with 500 ml of ice cold 5 mM MgSO.sub.4 solution and
incubated with gentle shaking for 5 minutes at 4.degree. C. The
cell suspension was centrifuged at 8,000.times.g for 10 minutes at
4.degree. C. to obtain a supernatant as a cold osmotic shock
extract, which was found to contain the Enzyme B protein (a
molecular weight of 60,000) with the purity more than 50-60% by
SDS-PAGE analysis. The supernatant was first supplemented with
Tris-HCl, pH 8.0, to 20 mM, and incubated at 25.degree. C. firstly
with EDTA at 10 mM final concentration for 10 min, secondly with
CaCl.sub.2 at 20 mM final concentration for 10 minutes and lastly
with PQQ at 25 .mu.M final concentration. For stabilization of the
enzyme, .alpha.-methyl-D-glucoside (a competitive inhibitor) was
added to 20 mM final concentration in the supernatant. The Enzyme B
was completely purified by following two chromatographies. At
first, the supernatant was loaded onto a Q-Sepharose column
(1.6.times.12 cm) which had been equilibrated with 20 mM Tris-HCl,
pH 8.0, containing 1 mM CaCl.sub.2 and 20 mM
.alpha.-methyl-D-glucoside, and the Enzyme B was eluted with 600 ml
of 0-0.4 M NaCl linear gradient in the same buffer. A red protein
peak eluted at about 0.25 M NaCl was collected and concentrated to
about 0.5 ml by Centricon-30 (Amicon). Finally, the Enzyme B was
passed through a SephacrylS-300HR column with 20 mM HEPES, pH 7.8,
containing 0.2 M NaCl, 1 mM CaCl.sub.2 and 20 mM
.alpha.-methyl-D-glucoside. A red protein peak eluted around a
molecular weight of 135,000 daltons position was collected as the
final purified Enzyme B. Consequently, about 8 mg of the purified
Enzyme B was obtained from 1.2 liters cultivation broth of E.
coli.
Example 6
Host-Vector System
[0161] A host-vector system for G. oxydans [DSM No. 4025] was
established by using the conjugal mating system with a
broad-host-range cosmid, pVK102. Initially, only one transconjugant
was isolated from G. oxydans [DSM No. 4025] having nalidixic acid
resistance. A new host, GOS2, was isolated from the
transconjugants, G. oxydans [DSM No. 4025] carrying pVK102 by
curing pVK102. A second host, GOS2R, was then derived from the GOS2
by adding rifampicin resistance (100 .mu.g/ml), which enables easy
selection of the transconjugants from the donor E. coli. The
plasmid transfer frequency into GOS2R was 10.sup.-3.about.10.sup.-4
transconjugants/recipient. The 2KGA productivity of GOS2R, however,
was about 10% lower than that of G. oxydans [DSM No. 4025]. The
third host, GORS6-35, was obtained from G. oxydans [DSM No. 4025]
by selecting the strain with rifampicin resistance, high 2KGA
productivity and relatively high competence through a series of
experiments, including the conjugation, curing and 2KGA
fermentation.
[0162] (1) Isolation of GOS2
[0163] Resistance to nalidixic acid was added to G. oxydans [DSM
No. 4025]. Cells of G. oxydans [DSM No. 4025] were streaked onto
Trypticase Soy Broth (BBL, Becton Dickinson Microbiology Systems
Cockeysville, Md. USA) (T) agar medium with 50 .mu.g/ml of
nalidixic acid (TN agar medium) and incubated at 27.degree. C. for
5 days. The resulting colonies were again streaked on the same agar
plates to obtain a nalidixic acid-resistant G. oxydans DSM No.
4025, GON. The broad-host-range cosmid pVK102 (Km.sup.r, Tc.sup.r)
was transferred from E. coli carrying pVK102 into the GON strain by
the tri-parental conjugal mating as follows. A helper strain, E.
coli carrying pRK2013 and a donor strain carrying pVK102 were
cultivated in LB medium with 50 .mu.g/mil of kanamycin at
37.degree. C. overnight. The cultures were transferred to fresh LB
medium with kanamycin and incubated for 5-6 hours. Recipient
strain, GON, was cultivated in TN liquid medium at 30.degree. C.
overnight. E. coli and GON strains were separately centrifuged and
re-suspended in equal- and one tenth-volumn of fresh T medium,
respectively. One hundred .mu.l of each cell suspension was mixed
together and 30 .mu.l portion of the mixture was spotted onto a
nitrocellulose filter placed on the surface of a NS2 agar plate.
Transconjugants were selected on the T agar medium containing 50
.mu.g/ml of nalidixic acid and 50 .mu.g/ml of kanamycin (TNK agar
medium). Several colonies were obtained on the selection plates
where many spontaneous mutants of E. coli (Nal.sup.r, Km.sup.r)
colonies also appeared. The plasmid and chromosomal DNAs of the
transconjugant candidates were prepared and compared with the
authentic pVK102 and chromosomal DNA of G. oxydans DSM No. 4025 by
restriction analysis and Southern-blot hybridization. Consequently,
one transconjugant of G. oxydans [DSM No. 4025] carrying pVK102,
GON8-1, was identified. The plasmid DNA prepared from GON8-1 was
identical to that of pVK102 and replicable in E. coli. The
chromosomal DNA of GON8-1 was identical to that of G. oxydans [DSM
No. 4025].
[0164] To isolate strains that could work as hosts with higher
competence for conjugal mating, the transconjugant GON8-1 was cured
of the plasmid pVK102. GON8-1 was cultivated in T broth without
antibiotics at 30.degree. C. for 2 days, 2% of the culture was
transferred into fresh T broth. After three such cultivation
cycles, the cells were spread on T agar plates, incubated at
27.degree. C. for 4 days, and the resulting colonies were picked
onto TNK and TN agar plates to select Km.sup.s strains. One of the
Km.sup.s strains was designated as GOS2 and was confirmed by
Southern-blot hybridization not to be carrying any DNA region of
pVK102. Then, pVK102 was transferred into strain GOS2 by a conjugal
mating; this strain showed 10.sup.2.about.10.sup.3 fold higher
competence (namely 10.sup.-5.about.10.sup.-6
transconjugants/recipient) than G. oxydans [DSM No.4025] did.
[0165] (2) Isolation of GOS2R, a Rifampicin-Resistant Mutant of
GOS2.
[0166] Rifampicin resistant (Rif.sup.r) mutants from GOS2 were
isolated through repeated transfer of GOS2 cells onto T agar medium
containing 20.about.100 .mu.g/ml rifampicin; one of the Rif.sup.r
strains was designated as GOS2R. Strain GOS2R showed very high
competence; 10.sup.-2.about.10.sup.-3 and 10.sup.-4
transconjugants/recipient on TRK agar (T agar medium containing 100
.mu.g/ml rifampicin and 50 .mu.g/ml kanamycin) plate and on TRT
agar (T agar medium containing 100 .mu.g/ml rifampicin and 3
.mu.g/ml tetracycline) plate, respectively.
[0167] 2KGA productivity from L-sorbose by GOS2R was compared with
that of G. oxydans [DSM No. 4025]. The cells maintained on NS2 agar
medium were inoculated into 5 ml of the seed culture medium
consisting of 8% L-sorbose (sterilized separtely), 0.05% glycerol,
0.25% MgSO.sub.4.7H.sub.2O, 1.75% corn steep liquor, 5.0% baker's
yeast, 1.5% CaCO.sub.3, and 0.5% urea (sterilized separately) (pH
7.0 before sterilization) and incubated at 30.degree. C. for 24
hours. The resulting seed culture (5 ml) was inoculated into a
500-ml Erlenmeyer flask containing 50 ml of the production medium
PMS10 consisting of 10% L-sorbose, (sterilized separtely), 0.05%
glycerol, 0.25% MgSO.sub.4.7H.sub.2O, 3% corn steep liquor, 6.25%
baker's yeast, 1.5% CaCO.sub.3, and 1.6% urea (sterilized
separately) (pH 7.5 before sterilization) and incubated at
30.degree. C. for 4 days with shaking (180 rpm). The quantitative
determination of 2KGA was assayed by high performance liquid
chromatography. GOS2R and G. oxydans [DSM No. 4025] produced 87.3
and 97.3 g/l of 2KGA, respectively.
[0168] (3) Isolation of GORS6-35 as a Host with High 2KGA
Productivity
[0169] To evaluate the self-cloning of AADH genes in the strain
with the same productivity of 2KGA from L-sorbose as G. oxydans
[DSM No. 4025], a new host was constructed by (i) adding
rifampicin-resistance (200 .mu.g/ml), (ii) introducing and curing
pVK102, and (iii) selecting 2KGA high producer from L-sorbose. Thus
obtained GORS6-35 shows the following two characteristics: (i)
almost the same 2KGA productivity (about 100 g/l 2KGA from 10%
L-sorbose) as the parent G. oxydans [DSM No. 4025]; and (ii) a
competence (10.sup.-6.about.10.sup.-7
transconjugants/recipient).
Example 7
Construction of Promoter-Replaced Enzyme B Gene
[0170] The promoter of Enzyme A gene (PA) is likely strong in G.
oxydans [DSM No. 4025] because Enzyme A was found to be one of the
highest-expressing proteins in amount in the cell when total cell
free extract of G. oxydans [DSM No.4025] was subjected to
SDS-polyacrylamide gel electrophoresis and the resulting gel was
stained with Coomassie Brilliant Blue R-250. The PA and another
promoter, a promoter of kanamycin resistant gene of Tn5 (PTn5),
which could express the kanamycin resistance in G. oxydans [DSM No.
4025], were attached to the structure gene with the SD sequence of
Enzyme B gene as shown in FIG. 10.
[0171] Enzyme B gene-containing 2.3 kb HindIII fragment was
inserted in M13 mp18 and the resulting phage DNA was subjected to
site-directed mutagenesis carried out with T7-GEN.TM. In Vitro
Mutagenesis Kit (TOYOBO Co., Ltd., Osaka Japan) according to the
recommendations by the supplier (FIG. 9). To insert various
promoters upstream of Enzyme B gene instead of Enzyme B promoter,
BamHI site was created upstream of the SD sequence. A primer for
the mutagenesis, GTTAGCGCGGTGGATCCCCATTGGAGG (27-mer including
BamHI site, SEQ-ID No. 12), were synthesized with Applied
Biosystems 381A DNA synthesizer. The resulting BamHI-HindIII
fragment carries Enzyme B SD and structural genes without the
Enzyme B promoter (PB).
[0172] Then promoter of Enzyme A gene (PA) was subcloned by PCR
method using primers tagged with the sequences for the HindIII and
BamHI sites. The PCR reaction was carried out with GeneAmpTM DNA
Amplification Reagent Kit (Takara Shuzo, Kyoto, Japan) with a
thermal cycler, Zymoreactor II (Atto Corp., Tokyo, Japan). The
reaction consists of pre-treatment before adding enzyme (94.degree.
C., 5 minutes.); 30 cycles of denaturation step (94.degree. C., 1
minute.), annealing step (60.degree. C., 1 minute.), and synthesis
step (72.degree. C., 1 minute.); and post-treatment (72.degree. C.,
5 minutes.). Plasmid pSSA202 (pUC18-Enzyme A gene in 2.7 kb
HindIII) was used as the template DNA. The reaction mixture
contained 200 .mu.M of dNTPs, 1 .mu.M of each primer, 1 ng of
template DNA and 2.5 u of AmpliTaq.TM. DNA polymerase in the buffer
supplied. Consequently, 300 bp fragment upstream from the SD
sequence was amplified. The PCR product was inserted into pUC18
between HindIII and BamHI sites and used for nucleotide sequencing;
the amplified sequences do not have any mutations caused by
misincorporation in PCR.
[0173] The promoter of the kanamycin resistant gene, PTn5, was
first obtained as a HindIII-PstI fragment from the plasmid pNeo
(Pharmacia Co., Uppsala, Sweden). The HindIII-PstI fragment was
then inserted into the multicloning site of pUC18, and finally the
PTn5 was excised as a HindIII-BamHI fragment.
[0174] The HindIII-BamHI fragments containing the PA and PTn5
promoters were inserted in the HindIII site of pUC18 together with
BamHI-HindIII fragment containing the PB promoter-removed Enzyme B
structural gene. The HindIII fragments from the resulting plasmids
were subcloned into pVK100 to produce pSSAP-B and pSSPTn5-B, which
were transferred into GOS2R by conjugal mating as described in
Example 6.
Example 8
2KGA Production by Transconjugants of GOS2R in Flask
[0175] (1) 2KGA Production from L-Sorbose by Enzyme-A
Gene-Amplified Transconjugant in Single Culture Fermentation in
Flask.
[0176] The Enzyme A plasmid, pSSA102R, and the vector plasmid,
pVK102, were introduced into GOS2R by a conjugal mating method as
described in Example 6. The resulting transconjugants were
maintained on NS2 agar medium containing 30 .mu.g/ml tetracycline
and subjected to 2KGA fermentation from L-sorbose. The cells of the
transconjugants were inoculated into 5 ml of the seed culture
medium described in Example 6 and incubated at 30.degree. C. for 24
hours. The resulting seed culture (5 ml) was inoculated into a
500-ml Erlenmeyer flask containing 50 ml of the PMS10 production
medium described in Example 6 or the PMS12 production medium
consisting of 12% L-sorbose, (sterilized separtely), 0.05%
glycerol, 0.25% MgSO.sub.4.7H.sub.2O, 3% corn steep liquor, 10%
baker's yeast, 1.5% CaCO.sub.3, and 2% urea (sterilized separately)
(pH 7.5 before sterilization) and incubated at 30.degree. C. for 4
or Sdays with shaking (180 rpm). As a result, GOS2R (pSSA102R) and
GOS2R (pVK102) produced 92.2 and 89.1 g/l 2KGA, respectively, from
10% L-sorbose in 4 days, and 105.7 and 99.9 g/l 2KGA, respectively,
from 12% L-sorbose in 5 days.
[0177] (2) 2KGA Production from D-Sorbitol by GOS2R (pSSB103R) in
Single Culture Fermentation in Flask.
[0178] The Enzyme B plasmid, pSSB103R, and the vector plasmid,
pVK102, were introduced into GOS2R by a conjugal mating method as
described in Example 6. The resulting transconjugants were
maintained on NS2 agar medium containing 30 .mu.g/ml tetracycline
and subjected to 2KGA fermentation from D-sorbitol. The cells of
the transconjugants were inoculated into 5 ml of the seed culture
medium consisting of 8% D-sorbitol, 0.05% glycerol, 0.25%
MgSO.sub.4.7H.sub.2O, 1.75% corn steep liquor, 5.0% baker's yeast,
1.5% CaCO.sub.3, and 0.5% urea (sterilized separately) (pH 7.0
before sterilization) and incubated at 30.degree. C. for 24 hours.
The resulting seed culture (5 ml) was inoculated into a 500-ml
Erlenmeyer flask containing 50 ml of three production media shown
in Table 8 and incubated at 30.degree. C. for 3 days with shaking
(180 rpm). As a result, GOS2R (pSSB103R) produced about 61.5, 71.5
and 73.0 g/l of 2KGA from 8%, 10% and 12% D-sorbitol, respectively,
while GOS2R (pVK102) produced 19.5, 25.4 and 30.2 g/l 2KGA,
respectively.
8 TABLE 8 (%) Ingredients PMSL8 PMSL10 PMSL12 D-Sorbitol 8.0 10.0
12.0 Glycerol 0.05 0.05 0.05 MgSO.sub.4.7H.sub.2O 0.25 0.25 0.25
CSL 3.0 3.0 3.0 Baker's yeast 5.0 6.25 10 Urea* 1.25 1.6 2.0
CaCO.sub.3 1.5 1.5 1.5 pH 7.5 before sterilization *: sterilized
separately
[0179] (3) 2KGA Production from D-Sorbitol by GOS2R (pSSAP-B) and
GOS2R (pSSPTn5-B) in Single Culture Fermentation in Flask.
[0180] The cells of GOS2R (pSSAP-B), GOS2R (pSSPTn5-B) and GOS2R
(pSSB103R), GOS2R (pVK100) were cultivated in the PMSL10 production
medium in Erlenmeyer flasks at 30.degree. C. for 3 days as
described in Example 8 (2). The amounts of 2KGA produced were shown
in Table 9.
9 TABLE 9 The amount of 2KGA (g/l) Strain 1 day 2 days 3 days GOS2R
(pSSA.sup.p-B) 47.2 67.0 67.7 GOS2R (pSSPTn5-B) 23.4 28.6 29.4
GOS2R (pSSB103R) 30.5 54.3 62.7 GOS2R (pVK100) 10.2 18.3 19.3 GOS2R
6.7 14.7 16.4
Example 9
2KGA Production from D-Sorbitol in 3-L Jar Fermentations by Single
Microorganism
[0181] (1) Single Culture Fermentation by GOS2R (pSSB103R)
[0182] Five ml portions of the seed culture prepared in test tubes
as described in Example 8-(2) were transferred to four 500-ml
Erlenmeyer flasks containing 50 ml of the same seed culture medium
and incubated at 30.degree. C. for 24 hours with shaking (180 rpm).
The resulting broth (200 ml of the seed culture) was inoculated
into 3-L jar fermentor containing 1800 ml of the PMSL10 production
medium containing 3 ml of antifoam. The fermentor was operated at
30.degree. C., 700 rpm and 0.5 vvm. D-Sorbitol was fed in ways: (i)
200 ml of 50% D-sorbitol was fed in 6 hours from the 24.sup.th to
the 30.sup.th hour; or (ii) 280 ml of 50% D-sorbitol was fed in 8.3
hours from the 24.sup.th to the 32.3.sup.th hour. As a result, 99.0
and 103.4 g/l 2KGA were produced by the fed-batch fermentations (i)
and (ii), respectively in 51 hours.
Example 10
2KGA Production from D-Sorbitol by Enzyme B Gene-Amplified GOS2R in
Mixed Culture Fermentation with E. coli in Flask
[0183] (1) Mixed-Culture Fermentations with B. megaterium, E. coli
and P. putida.
[0184] B. megaterium [DSM No. 4026], E. coli HB101 and P. putida
[ATCC 21812], growth factor suppliers, were cultivated in 150 ml of
the seed culture medium consisting of 0.3% yeast extract (Difco),
0.3% beef extract (Kyokuto Seiyaku, Tokyo, Japan), 3% corn steep
liquor, 1% polypeptone (Kyokuto), 0.1% urea, 0.1% KH.sub.2PO.sub.4,
0.02% MgSO.sub.4.7H.sub.2O, 2% L-sorbose, 0.1% CaCO.sub.3 (pH 7.1
before sterilization) for 24 hours at 37, 37, and 30.degree. C.,
respectively. Strain GOS2R (pSSB103R) was cultivated in two test
tubes containing 5 ml of the seed culture medium as described in
Example 8-(2) at 30.degree. C. for 24 hours. Four ml of GOS2R
(pSSB103R) seed cultures and 3.5 ml of growth factor supplier seed
culture were inoculated to a 500-ml of Erlenmeyer-flask containing
50 ml of the production medium for mixed culture fermentations
consisting of 8% D-sorbitol, 0.01% MgSO.sub.4.7H.sub.2O, 1% corn
steep liquor, 0.1% KH.sub.2PO.sub.4, 0.6% CaCO.sub.3, 1.5% urea
(sterilized separately) and antifoam (one drop per flask) (pH 7.0
before sterilization) and the flask was shaken at 30.degree. C. for
46.5 hours. As a result, mixed culture with B. megaterium DSM No.
4026, E. coli HB101 and P. putida ATCC 21812 produced 49.9, 54.1,
31.3 g/l 2KGA, respectively.
[0185] (2) Mixed Culture Fermentation of GOS2R (pSSAP-B) with E.
coli in Flask.
[0186] Mixed culture fermentations by GOS2R (pSSAP-B) with E. coli
was performed in the same manner as described above except for the
seed culture medium for E. coli containing 2% D-sorbitol instead of
2% L-sorbose. From 10% of D-sorbitol, GOS2R (pSSAP-B) produced 73.7
g/l 2KGA in 48.5 hours.
Example 11
2KGA Production by Recombinant AADH
[0187] A reaction mixture containing 1.7 mg/ml of purified Enzyme A
(purified according to Example 4), 50 mM Tris-HCl, pH 7.5, 5 mM
CaCl.sub.2, 8 mg/ml bovine serum albumine (BSA), 1 mM PMS, 20
.mu.g/ml PQQ, and 4% L-sorbose was incubated at 30.degree. C. with
gentle shaking for 20 hours. As a result, about 2 g/l 2KGA (TLC
assay) was produced.
[0188] The other reaction mixture containing 2.4 mg/ml each of
purified Enzyme A and Enzyme B (purified according to Example 4),
50 mM Tris-HCl, pH7.5, 5 mM CaCl.sub.2, 8 mg/ml BSA, 1 mM PMS, 20
.mu.g/ml PQQ, and 2% D-sorbitol was incubated at 30.degree. C. with
gentle shaking for 20 hours. As a result, 0.25 g/l 2KGA (HPLC
assay) and about 5 g/l L-sorbose (TLC assay) were produced.
Example 12
Production of Aldehydes from Alcohos, Ketones from Alcohols or
Carboxylic Aicds and Carboxylic Acids from Aldehydes
[0189] Enzyme reactions with purified Enzyme A or Enzyme B and
various substrates were performed as described in Example 11. The
resulting products were identified by TLC and/or HPLC as shown in
Table 10.
10 TABLE 10 Enzyme Substrate Product Enzyme A D-Sorbitol D-Glucose,
L-Gulose L-Sorbose L-Sorbosone, 2KGA L-Sorbosone 2KGA D-Mannitol
D-Mannose D-Fructose 2KD Enzyme B D-Glucose D-Gluconic acid
D-Sorbitol L-Sorbose L-Sorbosone 2KGA D-Mannitol D-Fructose L-Idose
L-Idonic acid Glycerol Dihydroxyacetone D-Gluconic acid
5-Keto-D-gluconic acid D-Mannoic acid 5-Keto-D-mannoic acid
[0190] Enzyme A converted D-fructose to 2KD; this means that
D-glucosone was also a product formed from D-fructose as the
intermediate.
Example 13
2KGA and L-Sorbose Production by a Transconjugant of P. putida
[0191] A resting cell mixture (2 ml) containing 1% CaCO.sub.3, 0.3%
NaCl, 1 mM PMS, 5 .mu.g/ml PQQ, 2% L-sorbose and 10 OD600
unit-cells of nalidixic acid resistant (Nal.sup.r) P. putida [ATCC
21812] carrying pSSA102R or pVK100 was incubated at 30.degree. C.
with gentle shaking for 17 hours. As a result, Nal.sup.r P. putida
[ATCC 21812] carrying pSSA102R or pVK100 produced 18.9 or 0.0 g/l
of 2KGA, respectively.
[0192] A resting cell mixture (2 ml) containing 1% CaCO.sub.3, 0.3%
NaCl, 1 mM PMS, 5 .mu.g/ml PQQ, 2% D-sorbitol and 10 OD600
unit-cells of Nal.sup.r P. putida [ATCC 21812] with pSSB103R or
with pVK100 was incubated at 30.degree. C. with gentle shaking for
17 hours. As a result, Nal.sup.r P. putida [ATCC 21812] carrying
pSSB103R or with pVK100 produced 7.8 or 0.0 g/l of L-sorbose,
respectively.
Example 14
Construction and Characterization of Chimera AADH Enzymes
[0193] (1) Construction of Chimera AADH Enzymes
[0194] To alternate substrate specificity of AADH enzymes, a
variety of chimera enzymes between Enzymes A and B were
constructed.
[0195] (i) FIG. 2 shows the structure of the chimera genes by
strategy I (restriction and ligation method). The restriction sites
conserved in both genes, Ava I (nucleotide No. 603 of Enzyme A
gene), EcoRI site (nucleotide No. 1084), and SalI site (nucleotide
No. 1470) (FIG. 7) were used for the construction. First, Enzyme A
and B gene cassettes (2.7 kb and 2.3 kb Hind III fragments,
respectively) were subcloned in the same direction in this order on
pUC18 to produce the plasmid pSSAB201, and Enzyme B and A gene
cassettes were also subcloned in the same direction in this order
on pUC18 to produce pSSBA201 (FIG. 3). After partial digestion of
these plasmids with each restriction enzyme, resulting digests were
ligated and used to transform E. coli JM109. Ampicillin resistant
transformants were analyzed for their plasmids, and Enzyme A
gene-headed and Enzyme B-headed chimera gene cassettes with the
expected HindIII fragment size of 2.7 kb and 2.3 kb, respectively,
were selected. Thus constructed chimera gene cassettes were
introduced into HindIII site of pVK102 to produce pSSA/B101R,
pSSA/B102R, pSSA/B103R, pSSB/A101R, pSSB/A102R, and pSSB/A103R
which encode Enzyme A/B1, EnzymeA/B2, EnzymeA/B3, EnzymeB/A1,
EnzymeB/A2, and EnzymeB/A3, respectively, as shown in FIG. 2. These
six plasmids were introduced into Nal.sup.r P. putida by a conjugal
mating method as described in Example 1.
[0196] (ii) FIG. 8 shows the scheme for constructing chimera genes
by strategy II; in vivo homologous recombination method to
construct chimeras recombinated at random positions for altering
the substrate specificity of AADH enzymes. The principle of this
method is as follows: (i) Locate two homologous genes to be
recombinated tandem in one plasmid with selective marker; (ii) Cut
it at restriction sites between the two genes, and transform rec
A.sup.+ E. coli cell with the linearized plasmid; (iii) Select
transformants showing selective marker which carry circularized
DNAs by recombination between the two genes at various positions.
Two plasmids pSSAB201 and pSSBA201 which have Enzyme A and Enzyme B
genes on pUC18 (FIG. 3) were linearized with pairs of restriction
enzymes as shown in FIG. 8. E. coli JM101(rec A.sup.+) was
transformed with these linearized DNAs. Transformants were obtained
at frequency of 10.sup.1-10.sup.2/.mu.g DNA. To begin with, DNA
size was determined to remove illegitimate recombinants. As a
result, correct recombinants were obtained at ratio of 30%.
XhoI-BalI fragment in which Enzyme A gene lost about two-third of
C-terminus was efficient to obtain chimeras recombinated within
one-third of N-terminus. Next, the recombinants were classified
into recombination site groups bordered by restriction sites of
three SmaI, SphI, SalI and BalI (FIG. 7). Thus constructed chimera
genes were subcloned on pVK100 as HindIII cassette and the plasmids
were introduced into Nal.sup.r P. putida by a conjugal mating
method.
[0197] (2) Characterization of Chimera AADH Enzymes
[0198] (i) Characteristics of the Chimeras Obtained by Restriction
and Ligation Method
[0199] The chimera enzymes expressed in Nal.sup.r P. putida were
characterized enzymatically by using soluble fractions of the cells
of the transconjugants as described in Example 1. Eight substrates
were used for the evaluation as shown in FIG. 11. Enzymes A/B 1 and
A/B3 showed Enzyme A-type substrate specificity, although their
expression level was lower than that of Enzyme A. On the other
hand, Enzymes B/A1, B/A2, and B/A3 showed Enzyme B-type substrate
specificity, although activity on n-propanol (Enzyme A type
activity) became higher in accordance with the increase of the
region from Enzyme A; the expression level of Enzyme B/A1 gene was
about 2-fold higher than that of wild Enzyme B gene. As a result
from the chimeras obtained by recombination and ligation method, it
was concluded that the N-terminal one third region of Enzyme A or
Enzyme B primarily determines its substrate specificity.
[0200] (ii) Characteristics of the Chimeras Obtained by Homologous
Recombination Method.
[0201] Among the chimeras obtained as above, seven out of eighteen
chimera enzymes obtained from the chimera genes recombined between
SmaI2 and SalI sites illustrated in FIG. 7 showed preferable
substrate specificity. The seven chimera enzymes converted
D-sorbitol to L-sorbose, not to D-glucose produced by Enzyme A, and
converted L-sorbose to 2KGA like Enzyme A. The recombination sites
were determined by nucleotide sequencing as described in Example 2.
These type of chimeras have an approximate structure of "N-terminal
2/9 of Enzyme A+C-terminal 7/9 of Enzyme B" was classified as
Enzyme superA-type. There were three Enzyme superA-type enzymes
according to the recombinated site: Enzyme A/B21(chimera consisting
of Enzyme A amino acid residue Nos. 1-128 and Enzyme B amino acid
residue Nos. 129-556), Enzyme A/B22 (chimera consisting of Enzyme A
amino acid residue Nos. 1-125 and Enzyme B amino acid residue Nos.
126-556) and Enzyme A/B25 (chimera consisting of Enzyme A amino
acid residue. Nos. 1-135 and Enzyme B amino acid residue Nos.
136-556). P. putida transconjugant expressing genes of Enzyme
A/B21, Enzyme A/B22 or Enzyme A/B25 converted D-sorbitol to
L-sorbose and did not convert D-sorbitol to D-glucose. The other
type of chimera Enzyme A/B31 (Enzyme A amino acid residue Nos. 1-95
and Enzyme B amino acid residue Nos. 96-556) converted D-sorbitol
to L-sorbose efficiently and did not convert L-sorbose to 2KGA;
this chimera showed Enzyme B-type activity. Expression level of
above mentioned chimeras was higher than that of wild Enzyme B
because it was found that the Enzyme B gene contains many rare
codons but Enzyme A does not when the genes were analyzed with the
program, Codon Preference (Wisconsin Sequence Analysis Package.TM.,
Genetics Computer Group).
[0202] (3) Improvement of Codon Usage in Chimera Genes
[0203] To further improve the chimeras, Enzyme A/B21, Enzyme A/B22,
Enzyme A/B25 and Enzyme A/B31 in the view point of the preferable
codon usage, the C-terminal two thirds consisting of Enzyme B
residues were replaced with the C-terminal two thirds consisting of
Enzyme A residues. Enzyme A/B21, Enzyme A/B22, Enzyme A/B25 and
Enzyme A/B31 genes were used for constructing new chimera genes of
Enzyme sA21 (Enzyme A amino acid residue Nos. 1-128, Enzyme B amino
acid residue Nos. 129-180 and Enzyme A amino acid residue Nos.
180-556), Enzyme sA22 (Enzyme A amino acid residue Nos. 1-125,
Enzyme B amino acid residue Nos. 126-180 and Enzyme A amino acid
residue Nos. 180-556), Enzyme sA2 (Enzyme A amino acid residue Nos.
1-135, Enzyme B amino acid residue Nos. 136-180 and Enzyme A amino
acid residue Nos. 180-556) and Enzyme sB (Enzyme A amino acid
residue Nos. 1-95, Enzyme B amino acid residue Nos. 96-180 and
Enzyme A amino acid residue Nos. 180-556) (FIG. 4). Actually, the
replacement experiments for Enzyme sA2 and Enzyme sB were performed
by partially digesting the plasmids, pUC18 carrying Enzyme sA gene
and Enzyme B/A1 gene and pUC 18 carrying Enzyme A/B31 gene and
Enzyme B/A1 gene with AvaI, ligating the resulting digests,
transforming E. coli JM109, analyzing the plasmid structure of the
transformants by restriction analysis, and determining the
nucleotide sequence to confirm the expected recombination site,
AvaI. The replacement experiments for Enzyme sA21 and Enzyme sA22
were performed by replacing the HindIII-SspI fragment of pSSsA2
encoding N-terminal part of Enzyme sA2 with the corresponding
HindIII-SspI fragment containing recombinated site of Enzyme A/B21
or Enzyme A/B22 gene (FIG. 4).
[0204] (4) Kinetic Properties of Chimera Enzymes
[0205] Tables 11 and 12 summarizes the kinetic properties of
chimera enzymes, Enzyme sA2 and Enzyme sB in comparison with Enzyme
A and Enzyme B, respectively.
11TABLE 11 Enzyme sA2 vs Enzyme A Enzyme sA2 Enzyme A
Km.sub.sorbose 128 mM 36 mM Km.sub.sorbitol 2140 388 Km.sub.glucose
20 --
[0206] Products from L-sorbose in product assay with Enzyme sA2 and
Enzyme A were 2KGA. Products from D-sorbitol in product assay with
Enzyme sA2 and Enzyme A were L-sorbose with trace amount of
D-glucose and D-glucose only, respectively. Thus, Enzyme sA2 showed
desired characteristics for 2KGA production from D-sorbitol;
L-sorbose/L-sorbosone dehydrogenase activity to produce 2KGA from
L-sorbose like Enzyme A and D-sorbitol dehydrogenase activity to
produce L-sorbose from D-sorbitol like Enzyme B.
12TABLE 12 Enzyme sB vs Enzyme B Enzyme sB Enzyme B Km.sub.sorbitol
61 mM 128 mM Ki.sub.sorbose 150 100
[0207] In comparison with Enzyme B, Enzyme sB showed higher
affinity to D-sorbitol and lower affinity to L-sorbose which is the
oxidation product of D-sorbitol and inhibitor in the conversion of
D-sorbitol to L-sorbose.
Example 15
2KGA Production from D-Sorbitol by GOS2R Derivative Strain
Amplified with Chimera AADH Enzymes
[0208] For evaluating Enzyme sA2 and Enzyme sB, GOB.DELTA.K and
GOI13 strains were constructed. GOB.DELTA.K was made from GOS2R by
deleting the whole Enzyme B gene and instead inserting 1.28 kb
Km.sup.r gene cassette isolated from pUC4K [4.1 kb, Km.sup.r,
Amp.sup.r; Pharmacia, Uppsala, Sweden; Viera, J., and Messing, J.,
Gene 19:259, (1982)] by using a suicide vector pSUP201 [Amp.sup.r,
Cm.sup.r, mob.sup.+, a derivative of pBR325, Bio/Technology,
1:784-791, (1983)].
[0209] GOI13 was constructed from GOB.DELTA.K by replacing wild
Enzyme A gene with Enzyme sB gene and deleting wild Enzyme A" gene
replaced with gentamicin (Gm) resistant gene cassette with the
suicide vector pSUP202 [Amp.sup.r, Cm.sup.r, Tc.sup.r, mob.sup.+, a
derivative of pBR325, Bio/Technology, 1:784-791, (1983)]. The
Gm.sup.r gene cassette was designed to have PstI site at both ends
by PCR amplification with the DNA fragment Tn5-GM [Sasagawa et al.,
Gene 56: 283-288, (1987)] as the template, and the resulting PCR
product was inserted into PstI site of pUC4K to produce pUC8G;
Gm.sup.r gene can be isolated from pUC8G by digesting with EcoRI,
BamHI, SalI, or PstI.
[0210] (1) Effect of Enzyme sA2 Amplification in 2KGA
Production
[0211] Plasmid pSSsA2, pVK100 with 2.7 kb HindIII cassette
containing Enzyme sA2 gene, and its control plasmid pSSA102R,
pVK102 with 2.7 kb HindIII cassette containing Enzyme A gene, were
introduced into GOI13 by a conjugal mating method as described in
Example 6. The resulting transconjugants were cultivated in PMSL10
medium at 30.degree. C. for 4 days as described in Example 8.
GOI13-carrying pSSsA2 and pSSA102R produced 66.3 and 38.5 g/l of
2KGA, respectively, and 8.4 and 25.9 g/l of 2KD (by-product of 2KGA
produced from D-sorbitol via D-glucose and D-gluconate),
respectively.
[0212] (2) Plasmids pSSsA21 and pSSsA22, which are pVK100 with 2.7
kb HindIII cassettes containing Enzyme sA21 and Enzyme sA22 genes,
respectively(FIG. 4), were introduced into GOI13 by a conjugal
mating method as described in Example 6. The resulting
transconjugants were cultivated in PMSL10 medium at at 30.degree.
C. for 4 days as described in Example 8. GOI13 carrying pSSsA21 and
pSSsA22 produced 66.8 and 77.4 g/l of 2KGA, respectively, and 0.3
and 0.4 g/l of 2KD, respectively.
[0213] (3) Effect of Enzyme sB in 2KGA Production
[0214] Plasmid pSSsB, pVK100 with 2.7 kb HindIII cassette
containing Enzyme sB gene (FIG. 4) and its control plasmid
pSSB103R, pVK102 containing 2.3 kb Enzyme B gene, were introduced
into GOB.DELTA.K by a conjugal mating method. GOB.DELTA.K carrying
pSSsB, GOB.DELTA.K carrying pSSB103R, and GOB.DELTA.K were
cultivated in PMSL8 medium as described in Example 8 (2) and
produced 52.0, 46.8, and 1.1 g/l of 2KGA, respectively, and 6.9,
9.3, 32.3 g/l of 2KD, respectively.
[0215] GOI13, which carries one copy of Enzyme sB on the
chromosomal DNA without wild genes of Enzyme B, Enzyme A, and
Enzyme A", was also cultivated in PMSL10 medium in 2 days. It
produced 79.3 g/l of L-sorbose.
[0216] The terms and expressions which have been employed and used
herein are terms of description and not of limitation, and there is
no intention in the use of such terms and expressions of excluding
any equivalents of the features shown and described or portions
Sequence CWU 1
1
12 1 1740 DNA Gluconobacter oxydans 1 atgaaaccga cttcgctgct
ttgggccagt gctggcgcac ttgcattgct tgccgcaccc 60 gcctttgctc
aagtgacccc cgtcaccgat gaattgctgg cgaacccgcc cgctggtgaa 120
tggatcagct acggtcagaa ccaagaaaac taccgtcact cgcccctgac gcagatcacg
180 actgagaacg tcggccaact gcaactggtc tgggcgcgcg gcatgcagcc
gggcaaagtc 240 caagtcacgc ccctgatcca tgacggcgtc atgtatctgg
caaacccggg cgacgtgatc 300 caggccatcg acgccaaaac tggcgatctg
atctgggaac accgccgcca actgccgaac 360 atcgccacgc tgaacagctt
tggcgagccg acccgcggca tggcgctgta cggcaccaac 420 gtttactttg
tttcgtggga caaccacctg gtcgccctcg acaccgcaac tggccaagtg 480
acgttcgacg tcgaccgcgg ccaaggcgaa gacatggttt cgaactcgtc gggcccgatc
540 gtggcaaacg gcgtgatcgt tgccggttcg acctgccaat actcgccgtt
cggctgcttt 600 gtctcgggcc acgactcggc caccggtgaa gagctgtggc
gcaactactt catcccgcgc 660 gctggcgaag agggtgatga gacttggggc
aacgattacg aagcccgttg gatgaccggt 720 gcctggggcc agatcaccta
tgaccccgtc accaaccttg tccactacgg ctcgaccgct 780 gtgggtccgg
cgtcggaaac ccaacgcggc accccgggcg gcacgctgta cggcacgaac 840
acccgtttcg ccgtgcgtcc tgacacgggc gagattgtct ggcgtcacca gaccctgccc
900 cgcgacaact gggaccagga atgcacgttc gagatgatgg tcaccaatgt
ggatgtccaa 960 ccctcgaccg agatggaagg tctgcagtcg atcaacccga
acgccgcaac tggcgagcgt 1020 cgcgtgctga ccggcgttcc gtgcaaaacc
ggcaccatgt ggcagttcga cgccgaaacc 1080 ggcgaattcc tgtgggcccg
tgataccaac taccagaaca tgatcgaatc catcgacgaa 1140 aacggcatcg
tgaccgtgaa cgaagatgcg atcctgaagg aactggatgt tgaatatgac 1200
gtctgcccga ccttcttggg cggccgcgac tggccgtcgg ccgcactgaa ccccgacagc
1260 ggcatctact tcatcccgct gaacaacgtc tgctatgaca tgatggccgt
cgatcaggaa 1320 ttcacctcga tggacgtcta taacaccagc aacgtgacca
agctgccgcc cggcaaggat 1380 atgatcggtc gtattgacgc gatcgacatc
agcacgggtc gtacgctgtg gtcggtcgaa 1440 cgtgctgcgg cgaactattc
gcccgtcttg tcgaccggcg gcggcgttct gttcaacggt 1500 ggtacggatc
gttacttccg cgccctcagc caagaaaccg gcgagaccct gtggcagacc 1560
cgccttgcaa ccgtcgcgtc gggccaggcc atctcttacg aggttgacgg catgcaatat
1620 gtcgccatcg caggtggtgg tgtcagctat ggctcgggcc tgaactcggc
actggctggc 1680 gagcgagtcg actcgaccgc catcggtaac gccgtctacg
tcttcgccct gccgcaataa 1740 2 1740 DNA Gluconobacter oxydans 2
atgaagacgt cgtctttgct ggttgcgagc gttgccgcgc ttgcaagcta tagctccttt
60 gcgcttgctc aagtgacccc cgtcaccgat gaattgctgg cgaacccgcc
cgctggtgaa 120 tggatcagct acggtcagaa ccaagaaaac taccgtcact
cgcccctgac gcagatcacg 180 actgagaacg tcggccaact gcaactggtc
tgggcgcgcg gcatgcagcc gggcaaagtc 240 caagtcacgc ccctgatcca
tgacggcgtc atgtatctgg caaacccggg cgacgtgatc 300 caggccatcg
acgccaaaac tggcgatctg atctgggaac accgccgcca actgccgaac 360
atcgccacgc tgaacagctt tggcgagccg acccgcggca tggcgctgta cggcaccaac
420 gtttactttg tttcgtggga caaccacctg gtcgccctcg acaccgcaac
tggccaagtg 480 acgttcgacg tcgaccgcgg ccaaggcgaa gacatggttt
cgaactcgtc gggcccgatc 540 gtggcaaacg gcgtgatcgt tgccggttcg
acctgccaat actcgccgtt cggctgcttt 600 gtctcgggcc acgactcggc
caccggtgaa gagctgtggc gcaactactt catcccgcgc 660 gctggcgaag
agggtgatga gacttggggc aacgattacg aagcccgttg gatgaccggc 720
gtctggggtc agatcaccta tgaccccgtt ggcggccttg tccactacgg ctcgtcggct
780 gttggcccgg cttcggaaac ccagcgcggc accaccggcg gcaccatgta
cggcaccaac 840 acccgtttcg ctgtccgtcc cgagactggc gagatcgtct
ggcgtcacca aactctgccc 900 cgcgacaact gggaccaaga gtgcaccttc
gagatgatgg ttgccaacgt tgacgtgcag 960 cccgcagctg acatggacgg
cgtccgctcg atcaacccga acgccgccac cggcgagcgt 1020 cgcgttctga
ccggcgttcc gtgcaaaacc ggcaccatgt ggcagttcga cgccgaaacc 1080
ggcgaattcc tgtgggcccg tgacaccagc tacgagaaca tcatcgaatc gatcgacgaa
1140 aacggcatcg tgaccgtcga cgagtcgaaa gttctgaccg agctggacac
cccctatgac 1200 gtctgcccgc tgctgctggg tggccgtgac tggccgtcgg
ctgcgctgaa ccccgatacc 1260 ggcatctact ttatcccgct gaacaacacc
tgcatggata tcgaagctgt cgaccaggaa 1320 ttcagctcgc tggacgtgta
caaccaaagc ctgaccgcca aaatggcacc gggtaaagag 1380 ctggttggcc
gtatcgacgc catcgacatc agcacaggcc gcaccctgtg gaccgctgag 1440
cgcgaagcct cgaactacgc gcctgtcctg tcgaccgctg gcggcgttct gttcaacggc
1500 ggcaccgacc gttacttccg cgctctcagc caagagaccg gcgagaccct
gtggcagacc 1560 cgtctggcga ctgtcgcttc gggccaagct gtctcgtacg
agatcgacgg cgtccaatac 1620 atcgccatcg gcggcggcgg cacgacctat
ggttcgttcc acaaccgtcc cctggccgag 1680 ccggtcgact cgaccgcgat
cggtaatgcg atgtacgtct tcgcgctgcc ccagcaataa 1740 3 1737 DNA
Gluconobacter oxydans 3 atgaaactga cgaccctgct gcaaagcagc gccgccctgc
ttgtgcttgg caccattccc 60 gcccttgccc aaaccgccat caccgatgaa
atgctggcga acccgcccgc tggtgaatgg 120 atcaactacg gtcagaacca
agagaactac cgccactcgc ccctgacgca gattaccgca 180 gacaacgtcg
gccaactgca actggtctgg gcgcgcggta tggaagcggg caagatccaa 240
gtgaccccgc ttgtccatga cggcgtcatg tatctggcaa accccggtga cgtgatccag
300 gccatcgacg ccgcgaccgg cgatctgatc tgggaacacc gccgccaact
gccgaacatc 360 gccacgctga acagctttgg tgagccgacc cgcggcatgg
ccctctatgg caccaacgtc 420 tatttcgtct cgtgggacaa ccacttggtc
gcgctggaca cctcgaccgg ccaagtcgta 480 ttcgacgtcg atcgcggtca
aggcacggat atggtctcga actcgtccgg cccgattgtc 540 gccaatggcg
tcatcgttgc gggctcgacc tgtcagtatt cgccgttcgg ctgtttcgtt 600
tcgggccacg actcggccac cggtgaagag ctgtggcgca acacctttat cccgcgcgcc
660 ggcgaagagg gtgatgagac ctggggcaat gattacgagg cccgctggat
gaccggcgtt 720 tggggccaga tcacctatga ccccgttggc ggccttgtcc
actacggcac ctcagcagtt 780 ggccctgcgg ccgagattca gcgcggcacc
gttggcggct cgatgtatgg caccaacacc 840 cgctttgctg tccgccccga
gaccggcgag atcgtctggc gtcaccaaac tctgccccgc 900 gacaactggg
accaagagtg tacgttcgag atgatggtcg tcaacgtcga cgtccagccc 960
tcggctgaga tggaaggcct gcacgccatc aaccccgatg ccgccacggg cgagcgtcgc
1020 gttgtgaccg gcgttccgtg caagaacggc accatgtggc agttcgacgc
cgaaaccggc 1080 gaattcctgt gggcgcgcga caccagctat cagaacctga
tcgaaagcgt cgatcccgat 1140 ggtctggtgc atgtgaacga agatctggtc
gtgaccgagc tggaagtggc ctatgaaatc 1200 tgcccgacct tcctgggtgg
ccgcgactgg ccgtcggctg cgctgaaccc cgatactggc 1260 atctatttca
tcccgctgaa caacgcctgt agcggtatga cggctgtcga ccaagagttc 1320
agctcgctcg atgtgtataa cgtcagcctc gactataaac tgtcgcccgg ttcggaaaac
1380 atgggccgta tcgacgccat cgacatcagc accggccgca cgctgtggtc
ggctgaacgc 1440 tacgcctcga actacgcgcc tgtcctgtcc accggcggcg
gcgtgctgtt caacggcggc 1500 accgaccgtt acttccgcgc cctcagccaa
gagaccggcg agacgctgtg gcagacccgt 1560 ctggcgactg tcgcctcggg
tcaagcgatt tcctatgaga tcgacggcgt gcaatatgtc 1620 gccatcgggc
gcggcggcac cagctatggc agcaaccaca accgcgccct gaccgagcgg 1680
atcgactcga ccgccatcgg cagcgcgatc tatgtctttg ctctgccgca gcagtaa 1737
4 1740 DNA Gluconobacter oxydans 4 atgaacccca caacgctgct tcgcaccagc
gcggccgtgc tattgcttac cgcgcccgcc 60 gcattcgcgc aggtaacccc
gattaccgat gaactgctgg cgaacccgcc cgctggtgaa 120 tggattaact
acggccgcaa ccaagaaaac tatcgccact cgcccctgac ccagatcact 180
gccgacaacg ttggtcagtt gcaactggtc tgggcccgcg ggatggaggc gggggccgta
240 caggtcacgc cgatgatcca tgatggcgtg atgtatctgg caaaccccgg
tgatgtgatc 300 caggcgctgg atgcgcaaac aggcgatctg atctgggaac
accgccgcca actgcccgcc 360 gtcgccacgc taaacgccca aggcgaccgc
aagcgcggcg tcgcccttta cggcacgagc 420 ctctatttca gctcatggga
caaccatctg atcgcgctgg atatggagac gggccaggtc 480 gtattcgatg
tcgaacgtgg atcgggcgaa gacggcttga ccagtaacac cacggggccg 540
attgtcgcca atggcgtcat cgtcgcgggt tccacctgcc aatattcgcc ctatggatgc
600 tttatctcgg ggcacgattc cgcgacgggt gaggagctgt ggcgcaacca
ctttatcccg 660 cagccgggcg aagagggtga cgagacttgg ggcaatgatt
tcgaggcgcg ctggatgacc 720 ggcgtctggg gtcagatcac ctatgatccc
gtgacgaacc ttgtgttcta tggctcgacc 780 ggcgtgggcc cagcgtccga
aacccagcgc ggcacgccgg gcggcacgct gtatggcacc 840 aacacccgct
ttgcggtgcg tcccgacacg ggcgagattg tctggcgtca ccagaccctg 900
ccgcgcgaca actgggacca agaatgcacg ttcgagatga tggtcgccaa cgtcgatgtg
960 caaccctcgg ccgagatgga gggtctgcgc gccatcaacc ccaatgcggc
gacgggcgag 1020 cgccgtgtgc tgacgggtgc gccttgcaag accggcacga
tgtggtcgtt tgatgcggcc 1080 tcgggcgaat tcctgtgggc gcgtgatacc
aactacacca atatgatcgc ctcgatcgac 1140 gagaccggcc ttgtgacggt
gaacgaggat gcggtgctga aagagctgga cgttgaatat 1200 gacgtctgcc
cgaccttcct gggtgggcgc gactggtcgt cagccgcact gaacccggac 1260
accggcattt acttcttgcc gctgaacaat gcctgctacg atattatggc cgttgatcaa
1320 gagtttagcg cgctcgacgt ctataacacc agcgcgaccg caaaactcgc
gccgggcttt 1380 gaaaatatgg gccgcatcga cgcgattgat atcagcaccg
ggcgcacctt gtggtcggcg 1440 gagcgccctg cggcgaacta ctcgcccgtt
ttgtcgacgg caggcggtgt ggtgttcaac 1500 ggcgggaccg accgctattt
ccgtgccctc agccaggaaa ccggcgagac tttgtggcag 1560 gcccgtcttg
cgacggtcgc gacggggcag gcgatcagct acgagttgga cggcgtgcaa 1620
tatatcgcca tcggtgcggg cggtctgacc tatggcacgc aattgaacgc gccgctggcc
1680 gaggcaatcg attcgacctc ggtcggtaat gcgatctatg tctttgcact
gccgcagtaa 1740 5 579 PRT Gluconobacter oxydans SIGNAL (1)..(23) 5
Met Lys Pro Thr Ser Leu Leu Trp Ala Ser Ala Gly Ala Leu Ala Leu 1 5
10 15 Leu Ala Ala Pro Ala Phe Ala Gln Val Thr Pro Val Thr Asp Glu
Leu 20 25 30 Leu Ala Asn Pro Pro Ala Gly Glu Trp Ile Ser Tyr Gly
Gln Asn Gln 35 40 45 Glu Asn Tyr Arg His Ser Pro Leu Thr Gln Ile
Thr Thr Glu Asn Val 50 55 60 Gly Gln Leu Gln Leu Val Trp Ala Arg
Gly Met Gln Pro Gly Lys Val 65 70 75 80 Gln Val Thr Pro Leu Ile His
Asp Gly Val Met Tyr Leu Ala Asn Pro 85 90 95 Gly Asp Val Ile Gln
Ala Ile Asp Ala Lys Thr Gly Asp Leu Ile Trp 100 105 110 Glu His Arg
Arg Gln Leu Pro Asn Ile Ala Thr Leu Asn Ser Phe Gly 115 120 125 Glu
Pro Thr Arg Gly Met Ala Leu Tyr Gly Thr Asn Val Tyr Phe Val 130 135
140 Ser Trp Asp Asn His Leu Val Ala Leu Asp Thr Ala Thr Gly Gln Val
145 150 155 160 Thr Phe Asp Val Asp Arg Gly Gln Gly Glu Asp Met Val
Ser Asn Ser 165 170 175 Ser Gly Pro Ile Val Ala Asn Gly Val Ile Val
Ala Gly Ser Thr Cys 180 185 190 Gln Tyr Ser Pro Phe Gly Cys Phe Val
Ser Gly His Asp Ser Ala Thr 195 200 205 Gly Glu Glu Leu Trp Arg Asn
Tyr Phe Ile Pro Arg Ala Gly Glu Glu 210 215 220 Gly Asp Glu Thr Trp
Gly Asn Asp Tyr Glu Ala Arg Trp Met Thr Gly 225 230 235 240 Ala Trp
Gly Gln Ile Thr Tyr Asp Pro Val Thr Asn Leu Val His Tyr 245 250 255
Gly Ser Thr Ala Val Gly Pro Ala Ser Glu Thr Gln Arg Gly Thr Pro 260
265 270 Gly Gly Thr Leu Tyr Gly Thr Asn Thr Arg Phe Ala Val Arg Pro
Asp 275 280 285 Thr Gly Glu Ile Val Trp Arg His Gln Thr Leu Pro Arg
Asp Asn Trp 290 295 300 Asp Gln Glu Cys Thr Phe Glu Met Met Val Thr
Asn Val Asp Val Gln 305 310 315 320 Pro Ser Thr Glu Met Glu Gly Leu
Gln Ser Ile Asn Pro Asn Ala Ala 325 330 335 Thr Gly Glu Arg Arg Val
Leu Thr Gly Val Pro Cys Lys Thr Gly Thr 340 345 350 Met Trp Gln Phe
Asp Ala Glu Thr Gly Glu Phe Leu Trp Ala Arg Asp 355 360 365 Thr Asn
Tyr Gln Asn Met Ile Glu Ser Ile Asp Glu Asn Gly Ile Val 370 375 380
Thr Val Asn Glu Asp Ala Ile Leu Lys Glu Leu Asp Val Glu Tyr Asp 385
390 395 400 Val Cys Pro Thr Phe Leu Gly Gly Arg Asp Trp Pro Ser Ala
Ala Leu 405 410 415 Asn Pro Asp Ser Gly Ile Tyr Phe Ile Pro Leu Asn
Asn Val Cys Tyr 420 425 430 Asp Met Met Ala Val Asp Gln Glu Phe Thr
Ser Met Asp Val Tyr Asn 435 440 445 Thr Ser Asn Val Thr Lys Leu Pro
Pro Gly Lys Asp Met Ile Gly Arg 450 455 460 Ile Asp Ala Ile Asp Ile
Ser Thr Gly Arg Thr Leu Trp Ser Val Glu 465 470 475 480 Arg Ala Ala
Ala Asn Tyr Ser Pro Val Leu Ser Thr Gly Gly Gly Val 485 490 495 Leu
Phe Asn Gly Gly Thr Asp Arg Tyr Phe Arg Ala Leu Ser Gln Glu 500 505
510 Thr Gly Glu Thr Leu Trp Gln Thr Arg Leu Ala Thr Val Ala Ser Gly
515 520 525 Gln Ala Ile Ser Tyr Glu Val Asp Gly Met Gln Tyr Val Ala
Ile Ala 530 535 540 Gly Gly Gly Val Ser Tyr Gly Ser Gly Leu Asn Ser
Ala Leu Ala Gly 545 550 555 560 Glu Arg Val Asp Ser Thr Ala Ile Gly
Asn Ala Val Tyr Val Phe Ala 565 570 575 Leu Pro Gln 6 579 PRT
Gluconobacter oxydans SIGNAL (1)..(23) 6 Met Lys Thr Ser Ser Leu
Leu Val Ala Ser Val Ala Ala Leu Ala Ser 1 5 10 15 Tyr Ser Ser Phe
Ala Leu Ala Gln Val Thr Pro Val Thr Asp Glu Leu 20 25 30 Leu Ala
Asn Pro Pro Ala Gly Glu Trp Ile Ser Tyr Gly Gln Asn Gln 35 40 45
Glu Asn Tyr Arg His Ser Pro Leu Thr Gln Ile Thr Thr Glu Asn Val 50
55 60 Gly Gln Leu Gln Leu Val Trp Ala Arg Gly Met Gln Pro Gly Lys
Val 65 70 75 80 Gln Val Thr Pro Leu Ile His Asp Gly Val Met Tyr Leu
Ala Asn Pro 85 90 95 Gly Asp Val Ile Gln Ala Ile Asp Ala Lys Thr
Gly Asp Leu Ile Trp 100 105 110 Glu His Arg Arg Gln Leu Pro Asn Ile
Ala Thr Leu Asn Ser Phe Gly 115 120 125 Glu Pro Thr Arg Gly Met Ala
Leu Tyr Gly Thr Asn Val Tyr Phe Val 130 135 140 Ser Trp Asp Asn His
Leu Val Ala Leu Asp Thr Ala Thr Gly Gln Val 145 150 155 160 Thr Phe
Asp Val Asp Arg Gly Gln Gly Glu Asp Met Val Ser Asn Ser 165 170 175
Ser Gly Pro Ile Val Ala Asn Gly Val Ile Val Ala Gly Ser Thr Cys 180
185 190 Gln Tyr Ser Pro Phe Gly Cys Phe Val Ser Gly His Asp Ser Ala
Thr 195 200 205 Gly Glu Glu Leu Trp Arg Asn Tyr Phe Ile Pro Arg Ala
Gly Glu Glu 210 215 220 Gly Asp Glu Thr Trp Gly Asn Asp Tyr Glu Ala
Arg Trp Met Thr Gly 225 230 235 240 Val Trp Gly Gln Ile Thr Tyr Asp
Pro Val Gly Gly Leu Val His Tyr 245 250 255 Gly Ser Ser Ala Val Gly
Pro Ala Ser Glu Thr Gln Arg Gly Thr Thr 260 265 270 Gly Gly Thr Met
Tyr Gly Thr Asn Thr Arg Phe Ala Val Arg Pro Glu 275 280 285 Thr Gly
Glu Ile Val Trp Arg His Gln Thr Leu Pro Arg Asp Asn Trp 290 295 300
Asp Gln Glu Cys Thr Phe Glu Met Met Val Ala Asn Val Asp Val Gln 305
310 315 320 Pro Ala Ala Asp Met Asp Gly Val Arg Ser Ile Asn Pro Asn
Ala Ala 325 330 335 Thr Gly Glu Arg Arg Val Leu Thr Gly Val Pro Cys
Lys Thr Gly Thr 340 345 350 Met Trp Gln Phe Asp Ala Glu Thr Gly Glu
Phe Leu Trp Ala Arg Asp 355 360 365 Thr Ser Tyr Glu Asn Ile Ile Glu
Ser Ile Asp Glu Asn Gly Ile Val 370 375 380 Thr Val Asp Glu Ser Lys
Val Leu Thr Glu Leu Asp Thr Pro Tyr Asp 385 390 395 400 Val Cys Pro
Leu Leu Leu Gly Gly Arg Asp Trp Pro Ser Ala Ala Leu 405 410 415 Asn
Pro Asp Thr Gly Ile Tyr Phe Ile Pro Leu Asn Asn Thr Cys Met 420 425
430 Asp Ile Glu Ala Val Asp Gln Glu Phe Ser Ser Leu Asp Val Tyr Asn
435 440 445 Gln Ser Leu Thr Ala Lys Met Ala Pro Gly Lys Glu Leu Val
Gly Arg 450 455 460 Ile Asp Ala Ile Asp Ile Ser Thr Gly Arg Thr Leu
Trp Thr Ala Glu 465 470 475 480 Arg Glu Ala Ser Asn Tyr Ala Pro Val
Leu Ser Thr Ala Gly Gly Val 485 490 495 Leu Phe Asn Gly Gly Thr Asp
Arg Tyr Phe Arg Ala Leu Ser Gln Glu 500 505 510 Thr Gly Glu Thr Leu
Trp Gln Thr Arg Leu Ala Thr Val Ala Ser Gly 515 520 525 Gln Ala Val
Ser Tyr Glu Ile Asp Gly Val Gln Tyr Ile Ala Ile Gly 530 535 540 Gly
Gly Gly Thr Thr Tyr Gly Ser Phe His Asn Arg Pro Leu Ala Glu 545 550
555 560 Pro Val Asp Ser Thr Ala Ile Gly Asn Ala Met Tyr Val Phe Ala
Leu 565 570 575 Pro Gln Gln 7 578 PRT Gluconobacter oxydans SIGNAL
(1)..(23) 7 Met Lys Leu Thr Thr Leu Leu Gln Ser Ser Ala Ala Leu Leu
Val Leu 1 5 10 15 Gly Thr Ile Pro Ala Leu Ala Gln Thr Ala Ile Thr
Asp Glu Met Leu 20 25 30 Ala Asn Pro Pro Ala Gly Glu Trp Ile Asn
Tyr Gly Gln Asn Gln Glu 35 40 45 Asn Tyr Arg His Ser Pro Leu Thr
Gln Ile Thr Ala Asp Asn Val Gly 50 55 60 Gln Leu Gln Leu Val Trp
Ala Arg Gly Met Glu Ala Gly Lys Ile Gln 65 70 75 80 Val Thr Pro Leu
Val His Asp Gly Val Met Tyr Leu Ala Asn Pro Gly 85 90 95 Asp Val
Ile Gln Ala Ile Asp Ala Ala Thr Gly Asp Leu Ile Trp Glu 100 105 110
His Arg Arg Gln Leu Pro Asn Ile Ala Thr Leu Asn Ser Phe
Gly Glu 115 120 125 Pro Thr Arg Gly Met Ala Leu Tyr Gly Thr Asn Val
Tyr Phe Val Ser 130 135 140 Trp Asp Asn His Leu Val Ala Leu Asp Thr
Ser Thr Gly Gln Val Val 145 150 155 160 Phe Asp Val Asp Arg Gly Gln
Gly Thr Asp Met Val Ser Asn Ser Ser 165 170 175 Gly Pro Ile Val Ala
Asn Gly Val Ile Val Ala Gly Ser Thr Cys Gln 180 185 190 Tyr Ser Pro
Phe Gly Cys Phe Val Ser Gly His Asp Ser Ala Thr Gly 195 200 205 Glu
Glu Leu Trp Arg Asn Thr Phe Ile Pro Arg Ala Gly Glu Glu Gly 210 215
220 Asp Glu Thr Trp Gly Asn Asp Tyr Glu Ala Arg Trp Met Thr Gly Val
225 230 235 240 Trp Gly Gln Ile Thr Tyr Asp Pro Val Gly Gly Leu Val
His Tyr Gly 245 250 255 Thr Ser Ala Val Gly Pro Ala Ala Glu Ile Gln
Arg Gly Thr Val Gly 260 265 270 Gly Ser Met Tyr Gly Thr Asn Thr Arg
Phe Ala Val Arg Pro Glu Thr 275 280 285 Gly Glu Ile Val Trp Arg His
Gln Thr Leu Pro Arg Asp Asn Trp Asp 290 295 300 Gln Glu Cys Thr Phe
Glu Met Met Val Val Asn Val Asp Val Gln Pro 305 310 315 320 Ser Ala
Glu Met Glu Gly Leu His Ala Ile Asn Pro Asp Ala Ala Thr 325 330 335
Gly Glu Arg Arg Val Val Thr Gly Val Pro Cys Lys Asn Gly Thr Met 340
345 350 Trp Gln Phe Asp Ala Glu Thr Gly Glu Phe Leu Trp Ala Arg Asp
Thr 355 360 365 Ser Tyr Gln Asn Leu Ile Glu Ser Val Asp Pro Asp Gly
Leu Val His 370 375 380 Val Asn Glu Asp Leu Val Val Thr Glu Leu Glu
Val Ala Tyr Glu Ile 385 390 395 400 Cys Pro Thr Phe Leu Gly Gly Arg
Asp Trp Pro Ser Ala Ala Leu Asn 405 410 415 Pro Asp Thr Gly Ile Tyr
Phe Ile Pro Leu Asn Asn Ala Cys Ser Gly 420 425 430 Met Thr Ala Val
Asp Gln Glu Phe Ser Ser Leu Asp Val Tyr Asn Val 435 440 445 Ser Leu
Asp Tyr Lys Leu Ser Pro Gly Ser Glu Asn Met Gly Arg Ile 450 455 460
Asp Ala Ile Asp Ile Ser Thr Gly Arg Thr Leu Trp Ser Ala Glu Arg 465
470 475 480 Tyr Ala Ser Asn Tyr Ala Pro Val Leu Ser Thr Gly Gly Gly
Val Leu 485 490 495 Phe Asn Gly Gly Thr Asp Arg Tyr Phe Arg Ala Leu
Ser Gln Glu Thr 500 505 510 Gly Glu Thr Leu Trp Gln Thr Arg Leu Ala
Thr Val Ala Ser Gly Gln 515 520 525 Ala Ile Ser Tyr Glu Ile Asp Gly
Val Gln Tyr Val Ala Ile Gly Arg 530 535 540 Gly Gly Thr Ser Tyr Gly
Ser Asn His Asn Arg Ala Leu Thr Glu Arg 545 550 555 560 Ile Asp Ser
Thr Ala Ile Gly Ser Ala Ile Tyr Val Phe Ala Leu Pro 565 570 575 Gln
Gln 8 579 PRT Gluconobacter oxydans SIGNAL (1)..(23) 8 Met Asn Pro
Thr Thr Leu Leu Arg Thr Ser Ala Ala Val Leu Leu Leu 1 5 10 15 Thr
Ala Pro Ala Ala Phe Ala Gln Val Thr Pro Ile Thr Asp Glu Leu 20 25
30 Leu Ala Asn Pro Pro Ala Gly Glu Trp Ile Asn Tyr Gly Arg Asn Gln
35 40 45 Glu Asn Tyr Arg His Ser Pro Leu Thr Gln Ile Thr Ala Asp
Asn Val 50 55 60 Gly Gln Leu Gln Leu Val Trp Ala Arg Gly Met Glu
Ala Gly Ala Val 65 70 75 80 Gln Val Thr Pro Met Ile His Asp Gly Val
Met Tyr Leu Ala Asn Pro 85 90 95 Gly Asp Val Ile Gln Ala Leu Asp
Ala Gln Thr Gly Asp Leu Ile Trp 100 105 110 Glu His Arg Arg Gln Leu
Pro Ala Val Ala Thr Leu Asn Ala Gln Gly 115 120 125 Asp Arg Lys Arg
Gly Val Ala Leu Tyr Gly Thr Ser Leu Tyr Phe Ser 130 135 140 Ser Trp
Asp Asn His Leu Ile Ala Leu Asp Met Glu Thr Gly Gln Val 145 150 155
160 Val Phe Asp Val Glu Arg Gly Ser Gly Glu Asp Gly Leu Thr Ser Asn
165 170 175 Thr Thr Gly Pro Ile Val Ala Asn Gly Val Ile Val Ala Gly
Ser Thr 180 185 190 Cys Gln Tyr Ser Pro Tyr Gly Cys Phe Ile Ser Gly
His Asp Ser Ala 195 200 205 Thr Gly Glu Glu Leu Trp Arg Asn His Phe
Ile Pro Gln Pro Gly Glu 210 215 220 Glu Gly Asp Glu Thr Trp Gly Asn
Asp Phe Glu Ala Arg Trp Met Thr 225 230 235 240 Gly Val Trp Gly Gln
Ile Thr Tyr Asp Pro Val Thr Asn Leu Val Phe 245 250 255 Tyr Gly Ser
Thr Gly Val Gly Pro Ala Ser Glu Thr Gln Arg Gly Thr 260 265 270 Pro
Gly Gly Thr Leu Tyr Gly Thr Asn Thr Arg Phe Ala Val Arg Pro 275 280
285 Asp Thr Gly Glu Ile Val Trp Arg His Gln Thr Leu Pro Arg Asp Asn
290 295 300 Trp Asp Gln Glu Cys Thr Phe Glu Met Met Val Ala Asn Val
Asp Val 305 310 315 320 Gln Pro Ser Ala Glu Met Glu Gly Leu Arg Ala
Ile Asn Pro Asn Ala 325 330 335 Ala Thr Gly Glu Arg Arg Val Leu Thr
Gly Ala Pro Cys Lys Thr Gly 340 345 350 Thr Met Trp Ser Phe Asp Ala
Ala Ser Gly Glu Phe Leu Trp Ala Arg 355 360 365 Asp Thr Asn Tyr Thr
Asn Met Ile Ala Ser Ile Asp Glu Thr Gly Leu 370 375 380 Val Thr Val
Asn Glu Asp Ala Val Leu Lys Glu Leu Asp Val Glu Tyr 385 390 395 400
Asp Val Cys Pro Thr Phe Leu Gly Gly Arg Asp Trp Ser Ser Ala Ala 405
410 415 Leu Asn Pro Asp Thr Gly Ile Tyr Phe Leu Pro Leu Asn Asn Ala
Cys 420 425 430 Tyr Asp Ile Met Ala Val Asp Gln Glu Phe Ser Ala Leu
Asp Val Tyr 435 440 445 Asn Thr Ser Ala Thr Ala Lys Leu Ala Pro Gly
Phe Glu Asn Met Gly 450 455 460 Arg Ile Asp Ala Ile Asp Ile Ser Thr
Gly Arg Thr Leu Trp Ser Ala 465 470 475 480 Glu Arg Pro Ala Ala Asn
Tyr Ser Pro Val Leu Ser Thr Ala Gly Gly 485 490 495 Val Val Phe Asn
Gly Gly Thr Asp Arg Tyr Phe Arg Ala Leu Ser Gln 500 505 510 Glu Thr
Gly Glu Thr Leu Trp Gln Ala Arg Leu Ala Thr Val Ala Thr 515 520 525
Gly Gln Ala Ile Ser Tyr Glu Leu Asp Gly Val Gln Tyr Ile Ala Ile 530
535 540 Gly Ala Gly Gly Leu Thr Tyr Gly Thr Gln Leu Asn Ala Pro Leu
Ala 545 550 555 560 Glu Ala Ile Asp Ser Thr Ser Val Gly Asn Ala Ile
Tyr Val Phe Ala 565 570 575 Leu Pro Gln 9 82 DNA synthetic
oligonucleotide 9 catgaaaata aaaacaggtg cacgcatcct cgcattatcc
gcattaacga cgatgatgtt 60 ttccgcctcg gctctcgccc ag 82 10 83 DNA
synthetic oligonucleotide 10 gttacctggg cgagagccga ggcggaaaac
atcatcgtcg ttaatgcgga taatgcgagg 60 atgcgtgcac ctgtttttat ttt 83 11
27 PRT Escherichia coli SIGNAL (1)..(26) 11 Met Lys Ile Lys Thr Gly
Ala Arg Ile Leu Ala Leu Ser Ala Leu Thr 1 5 10 15 Thr Met Met Phe
Ser Ala Ser Ala Leu Ala Gln 20 25 12 27 DNA synthetic
oligonucleotide 12 gttagcgcgg tggatcccca ttggagg 27
* * * * *