U.S. patent application number 10/984413 was filed with the patent office on 2005-04-28 for medicinal uses of dihydropyrazoles.
This patent application is currently assigned to The Procter & Gamble Company. Invention is credited to Almstead, Ji-In Kim, Izzo, Nicholas John, Jones, David Robert, Kawamoto, Richard Masaru.
Application Number | 20050090532 10/984413 |
Document ID | / |
Family ID | 23108338 |
Filed Date | 2005-04-28 |
United States Patent
Application |
20050090532 |
Kind Code |
A1 |
Almstead, Ji-In Kim ; et
al. |
April 28, 2005 |
Medicinal uses of dihydropyrazoles
Abstract
Compounds having a structure according to Formula (I): 1 are
effective in a method of increasing erythropoietin and
vascularization of tissue in a subject in need thereof.
Inventors: |
Almstead, Ji-In Kim;
(Holmdel, NJ) ; Izzo, Nicholas John; (Pittsburgh,
PA) ; Jones, David Robert; (Milford, OH) ;
Kawamoto, Richard Masaru; (Lebanon, OH) |
Correspondence
Address: |
THE PROCTER & GAMBLE COMPANY
INTELLECTUAL PROPERTY DIVISION
WINTON HILL TECHNICAL CENTER - BOX 161
6110 CENTER HILL AVENUE
CINCINNATI
OH
45224
US
|
Assignee: |
The Procter & Gamble
Company
|
Family ID: |
23108338 |
Appl. No.: |
10/984413 |
Filed: |
November 9, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10984413 |
Nov 9, 2004 |
|
|
|
10134873 |
Apr 29, 2002 |
|
|
|
60288720 |
May 4, 2001 |
|
|
|
Current U.S.
Class: |
514/341 ;
514/406 |
Current CPC
Class: |
A61P 7/06 20180101; A61P
9/00 20180101; A61K 31/415 20130101; A61K 31/427 20130101; C07D
401/14 20130101; C07D 231/06 20130101; C07D 417/04 20130101; C07D
401/04 20130101; A61K 31/4439 20130101 |
Class at
Publication: |
514/341 ;
514/406 |
International
Class: |
A61K 031/4439; A61K
031/415 |
Claims
1-14. (canceled)
15. A method of increasing vascularization of tissue in a mammalian
subject in need of such treatment comprising administering to said
subject a safe and effective amount of a compound having the
structure: 36wherein: (a) X is CH; and (b) R6 is selected from the
group consisting of nil, methyl, ethyl, methoxy, ethoxy, amino and
halo; or an optical isomer, diastereomer or enantiomer, or
pharmaceutically-acceptable salt, or biohydrolyzable amide, ester,
or imide thereof.
16. The method of claim 15, wherein the compound is selected from
the group consisting of
2-(5-Phenyl-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-y- l)-phenol;
2-(1-Pyridin-2-yl-5-p-tolyl-4,5-dihydro-1H-pyrazol-3-yl)-phenol- ;
2-[5-(4-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-phen-
ol;
2-[5-(2-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-ph-
enol; and
2-[5-(2-hydroxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3--
yl]-phenol.
17. The method of claim 16, wherein the compound is selected from
the group consisting of
2-(5-Phenyl-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-y-
l)-phenol.
18. The method of claim 16, wherein the compound is selected from
the group consisting of
2-(1-Pyridin-2-yl-5-p-tolyl-4,5-dihydro-1H-pyrazol-3--
yl)-phenol.
19. The method of claim 16, wherein the compound is selected from
the group consisting of
2-[5-(4-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-
-pyrazol-3-yl]-phenol.
20. The method of claim 16, wherein the compound is selected from
the group consisting of
2-[5-(2-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-
-pyrazol-3-yl]-phenol.
21. The method of claim 16, wherein the compound is selected from
the group consisting of
2-[5-(2-hydroxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-
-pyrazol-3-yl]-phenol.
22. A method of increasing erythropoietin in a mammalian subject in
need of such treatment comprising administering to said subject a
safe and effective amount of a compound having the structure:
37wherein: (c) X is CH; and (d) R6 is selected from the group
consisting of nil, methyl, ethyl, methoxy, ethoxy, amino and halo;
or an optical isomer, diastereomer or enantiomer, or
pharmaceutically-acceptable salt, or biohydrolyzable amide, ester,
or imide thereof.
23. The method of claim 22, wherein the compound is selected from
the group consisting of
2-(5-Phenyl-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-y- l)-phenol;
2-(1-Pyridin-2-yl-5-p-tolyl-4,5-dihydro-1H-pyrazol-3-yl)-phenol- ;
2-[5-(4-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-phen-
ol;
2-[5-(2-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-ph-
enol; and
2-[5-(2-hydroxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3--
yl]-phenol.
24. The method of claim 23, wherein the compound is selected from
the group consisting of
2-(5-Phenyl-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-y-
l)-phenol.
25. The method of claim 23, wherein the compound is selected from
the group consisting of
2-(1-Pyridin-2-yl-5-p-tolyl-4,5-dihydro-1H-pyrazol-3--
yl)-phenol.
26. The method of claim 23, wherein the compound is selected from
the group consisting of
2-[5-(4-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-
-pyrazol-3-yl]-phenol.
27. The method of claim 23, wherein the compound is selected from
the group consisting of
2-[5-(2-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-
-pyrazol-3-yl]-phenol.
28. The method of claim 23, wherein the compound is selected from
the group consisting of
2-[5-(2-hydroxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-
-pyrazol-3-yl]-phenol.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under Title 35, United
States Code 119(e) from Provisional Application Ser. No.
60/288,720, filed May 4, 2001.
TECHNICAL FIELD
[0002] This invention is directed to compounds that are useful in
methods of treating hypoxia related disorders. The invention is
also directed to pharmaceutical compositions comprising the
compounds.
BACKGROUND
[0003] Ischemic cardiac disease and peripheral vascular disease are
major health problems affecting hundreds of millions of people
worldwide. Ischemia results when there is a lack of oxygen supply.
It is estimated that about half of the deaths that occur in the
United States each year alone are caused by ischemic heart disease.
This invention relates, in part, to methods for the treatment of
such diseases and pharmaceutical compositions in the treatment
thereof.
[0004] Oxygen is essential for an organism's survival, given its
role in essential metabolic processes including oxidative
phosphorylation in which O.sub.2 serves as electron acceptor during
ATP formation. Tissue damage can result from hypoxia that is, when
oxygen supply in tissue is insufficient to meet metabolic demands.
Hypoxia can be caused by various medical conditions, including
atherosclerosis, chronic illness, trauma, and surgical procedures.
Accordingly, hypoxia plays an important role in the pathogenesis of
major causes of mortality, including cancer, cerebral and
myocardial ischemia, and chronic heart and lung diseases.
[0005] Organisms can sense O.sub.2 concentration and adaptively
respond to hypoxia. These adaptive responses either increase
O.sub.2 delivery or activate alternative metabolic pathways that do
not require O.sub.2. There are a number of hypoxia-inducible gene
products that participate in these responses. Included, are genes
that code for erythropoietin (hereinafter "EPO"), vascular
endothelia growth factor (hereinafter "VEGF"), tyrosine
hydroxylase, and glycolytic enzymes. See Bunn, H. F & Poyton,
R. O., "Oxygen sensing and molecular adaptation to hypoxia",
Physiol. Rev., Vol. 76, pp. 839-885 (1996): Semenza, G. L.,
"Regulation of mammalian O.sub.2 homeostasis by hypoxia-inducible
factor 1", Annu. Rev. Cell. Dev. Biol., Vol. 15, pp. 551-57(1999);
Shweiki, D. et al., "Induction of vascular endothelial growth
factor expression by hypoxia and by glucose deficiency in multicell
spheroids: implications for tumor angiogenesis", Proc. Natl. Acad.
Sci. U.S.A., Vol. 92, pp. 768-772 (1995). The transcriptional
regulator hypoxia-inducible factor 1 (hereinafter "HIF1") is an
essential mediator of O.sub.2 homeostasis and regulates the
transcription rate of many genes including the aforementioned
genes. See Wang, G. L., et al., Biochem. Biophys. Res. Commun.,
Vol. 86, pp. 15-22 (1995). The number of target genes activated by
HIF-1 includes genes whose protein products are involved in
angiogenesis, energy metabolism, erythropoiesis, cell proliferation
and viability, vascular remodeling, and vasomotor responses.
Semenza, G. L., "HIF-1: mediator of physiological and
pathophysiological responses to hypoxia." J. Appl. Physiol. Vol.
88, pp. 1474-1480 (2000); Semenza, G. L., "Hypoxia-inducible factor
1: master regulator of O.sub.2homeostasis," Genetics &
Development, Vol. 8, pp. 588-594 (1998).
[0006] Structurally, HIF-1 is a heterodimer of two subunits,
HIF-1.alpha. and HIF-1.beta.. The biological activity of HIF-1 is
determined by the expression and activity of the HIF-1.alpha.
subunit. See Jiang, B-H. et al., "Transactivation and inhibitory
domains of hypoxia-inducible factor 1.alpha.: modulation of
transcriptional activity by oxygen tension", J. Biol. Chem., Vol.
272, pp. 19253-60 (1997). The in vivo regulation of HIF-1.alpha.
biological activity occurs at multiple levels, including mRNA
expression, protein expression, nuclear localization, and
transactivation. Semenza, J. Appl. Physiol., Vol. 88, page 1476
(2000). Hypoxia, in turn, is known to have at least two independent
effects on HIF-1.alpha. activity: (1) hypoxia increases the
steady-state levels of HIF-1.alpha. protein by stabilizing it
(i.e., decreasing its degradation); and (2) hypoxia increases the
specific transcriptional activity of the protein (i.e., independent
of the protein concentration). Jiang, B. H., et al., "Dimerization,
DNA binding and transactivation properties of hypoxia-inducible
factor 1," J. Biol. Chem., Vol. 271, pp. 17771-78 (1996). Given
HIF-1's role in hypoxia, treatments utilizing HIF-1 in the
treatment of hypoxia-related disorders, have been described. For
example, U.S. Pat. Nos. 5,882,914; 6,020,462; 6,124,131 and
international publication number WO 00/10578.
[0007] Although the known number of target genes activated by HIF-1
continues to increase, the role of HIF-1 in the activation of VEGF
gene transcription in hypoxic cells is well established. Semenza,
J. Appl. Physiol, Vol. 88, page 1477 (2000). VEGF itself mediates a
number of responses including vasodilation, vascular permeability,
and endothelial cell migration and proliferation through receptors
that are restricted to vascular endothelium and certain
hematopoietic cells. The combined effects of VEGF are important to
the promotion of an angiogenic response. The restricted
localization of VEGF receptors provides a level of specificity that
makes VEGF an important target for angiogenic therapy. For example,
the promotion of blood vessel growth has been demonstrated in
animal models of coronary and limb ischemia. See Pearlman, J. D.,
et al., "Magnetic resonance mapping demonstrates benefits of
VEGF-induced myocardial angiogenesis", Nat. Med. Vol. 1. pp.
1085-1089 (1995); Takeshita, S., et al., "Therapeutic angiogenesis.
A single intraarterial bolus of vascular endothelial growth factor
augments revascularization in a rabbit ischemic hind limb model",
J. Clin. Invest., Vol. 93, pp. 662-670 (1994). There are several
clinical trials in progress to assess the efficacy of both
exogenously administered VEGF protein as well as expression vectors
for the VEGF gene. See Hendel, R. C., et al., "Effect of
intracoronary recombinant human vascular endothelial growth factor
on myocardial perfusion--Evidence for a dose-dependent effect",
Circulation, Vol. 101(2), pp. 118-121 (2000); Schwarz, et al.,
"Evaluation of the effects of intramyocardial injection of DNA
expressing vascular endothelial growth factor in a myocardial
infarction model in the rat--Angiogenesis and angioma formation",
J. Amer. Coll. Cardiol., Vol. 35(5), pp. 1323-1330 (2000).
[0008] Another approach to utilizing the effects of VEGF in
proangiogenic therapy is to stimulate its production from the
tissues needing new vessels. Secretion of VEGF appears to be
dependent on its rate of biosynthesis since the intracellular
storage of VEGF protein has not been demonstrated. The biosynthesis
of VEGF is primarily controlled by regulating the amount of VEGF
mRNA. See Shweiki, D., et al, "Vascular endothelial growth factor
induced by hypoxia may mediate hypoxia-initiated angiogenesis",
Nature, Vol. 359. pp. 843-845 (1992). In turn, the amount of mRNA
is controlled by activation of transcription through regulatory
elements located in the 5' promoter sequence of the VEGF gene as
well as by less characterized mechanisms that stabilize VEGF mRNA.
See Levy, A. P., et al., "Transcriptional regulation of the rat
vascular endothelial growth factor gene by hypoxia", Drug Discov.
Today, Vol. 270, pp. 13333-13340 (1995); Ikeda, E., et al.,
"Hypoxia-induced transcriptional activation and increased mRNA
stability of vascular endothelial growth factor in C6 glioma
cells", J. Biol. Chem., Vol. 270, pp. 19761-19766 (1995); Levy, A.
P., et al., "Post-transcriptional regulation of vascular
endothelial growth factor by hypoxia", Drug Discov. Today, Vol.
271, pp. 2746-2753 (1996).
[0009] Various treatments using VEGF have been suggested (e.g.,
U.S. Pat. No. 5,073,492 issued Dec. 17, 1991; U.S. Pat. No.
5,194,596 issued Mar. 16, 1993; and U.S. Pat. No. 5,219,739 issued
Jun. 15, 1993) for ameliorating conditions such as myocardial
infarction, diabetic ulcers, and surgical wounds. In particular,
several small molecules have been described which mimic the hypoxic
induction of VEGF by activating HIF-1.alpha.. However, many of
these molecules, such as cobaltous chloride or deferoxamine cannot
be considered candidate drug-like molecules because of unfavorable
pharmacokinetic characteristics. Still other molecules, such as
mersalyl, cannot be considered because of their reactivity. See
Agani, F. & Semenza. G. L., "Mersalyl is a novel inducer of
vascular endothelial growth factor gene expression and
hypoxia-inducible factor 1 activity", Mol. Pharmacol., Vol. 54, pp.
749-754 (1998). Although several growth factors, such as platelet
derived growth factor-BB, transforming growth factor .beta.1, and
hepatocyte growth factor, have also been shown to induce VEGF,
their effects may be limited to certain tissue types and
transformed cell lines and therefore are probably not mediated
through HIF-1.alpha.. See Brogi, E., et al., "Indirect angiogenic
effect of scatter factor/hepatocyte growth factor via induction of
vascular endothelial growth factor: the case for paracrine
amplification of angiogenesis", Circulation, Vol. 90, pp. 649-652
(1994); Van, B. E., et al., "Potentiated angiogenic effect of
scatter factor/hepatocyte growth factor via induction of vascular
endothelial growth factor: the case for paracrine amplification of
angiogenesis", Circulation, Vol. 90, pp. 381-390 (1998). Therefore,
there exists a continuing need to identify classes of compounds
that induce VEGF at the transcriptional level to increase
vascularization of afflicted tissue for the treatment of the
aforementioned disorders.
[0010] HIF-1 is a transcription factor that also regulates the
hypoxia-inducible EPO gene. HIF-1 binding is required for EPO
transcriptional activation in response to hypoxia. Semenza, G. L.,
"Regulation of erythropoietin production: New insights into
molecular mechanisms of oxygen homeostasis", Hematol. Oncol. Clin
North Am., Vol. 8, pp. 863-884 (1994). In particular, HIF-1.alpha.
binds to the 3' hypoxia-response element of the EPO gene which
results in the marked enhancement of EPO transcription. Semenza, G.
L., et al. "Transcriptional regulation of genes encoding glycolytic
enzymes by hypoxia-inducible factor 1", J. Biol. Chem., Vol. 269,
pp. 23757-63 (1994). EPO, in turn, is essential for maintenance of
red blood cells by controlling the proliferation and
differentiation of erythroid progenitor cells into red blood cells.
Krantz. S. B., "Erythropoietin," Blood, Vol. 77, pp 419-434 (1991).
During fetal development, the liver serves as the primary source of
EPO. Shortly before birth, production of EPO in the liver decreases
and the kidney becomes the primary source of EPO. However, in
adults other organs such as the liver and brain produce small but
significant amounts of EPO. A erythropoietin deficiency is
associated with anemia. In humans, the most prevalent form of
anemia is associated with kidney failure.
[0011] Compounds have been described that enhance the biosynthesis
of EPO such as those described in U.S. Pat. No. 5,985,913 issued
Nov. 16, 1999. Another approach is using injectable recombinant
EPO, which is currently the therapy of choice for the treatment of
anemia due to chronic renal failure. EPO has been described in the
treatment of anemia: associated with chemotherapy; that occurs as a
consequence of AIDS; and due to prematurity and autologous blood
donation. EPO has even been suggested as a general use agent in
pre-operative elective surgery. However, its extensive use could be
limited by high production costs and lack of oral bioavailability.
See Qureshi, S. A., et al., "Mimicry of erythropoietin by a
nonpeptide molecule", PNAS, Vol. 96(21) pp. 12156-61 (1999).
Therefore, there exists a continuing need for the development of
classes of molecules that increase endogenous EPO at the
transcriptional level for the treatment of the aforementioned
disorders.
[0012] Thus, it would be advantageous to identify a class of
compounds that are effective in treating hypoxia related
disorders.
SUMMARY OF INVENTION
[0013] The present invention identifies and provides compounds that
are effective in treating hypoxia related disorders. While not
intending to be limited by theory, it is believed that the
compounds herein function by increasing endogenous EPO and
vascularization of tissue in a subject in need of such treatment.
Given the ability of these compounds to induce EPO, these molecules
can be important for the treatment and prophylaxis of anemia
associated with kidney disease, as a combination therapy with
chemotherapy, in preparation for autologous blood donation, and
other cases of chronic anemia. Furthermore, given the ability of
these compounds to increase vascularization in tissue, these
molecules can be important for the treatment of ischemic heart
disease, for treating peripheral vascular disease, and for the
enhancement of wound healing. Other uses of these compounds
include: neuroprotection in cerebral ischemic conditions; and
reducing or preventing hypoxia related disorders of cerebral,
coronary, or peripheral circulation.
[0014] In particular, the present invention relates to compounds
having a structure according to Formula (I): 2
[0015] wherein
[0016] (a) R.sub.1 is selected from the group consisting of alkyl,
alkene, alkyne, cycloalkyl. heteroalkyl, aryl, heteroaryl, and
heterocycloalkyl.
[0017] (b) R.sub.3 is selected from the group consisting of aryl,
heteroaryl, and heterocycloalkyl;
[0018] (c) R.sub.5 is selected from the group consisting of aryl
and heteroaryl.
[0019] This invention also includes optical isomers, diastereomers
and enantiomers of the formula above, and pharmaceutically
acceptable salts, biohydrolyzable amides, esters, and imides
thereof.
[0020] The compounds of Formula (I) are useful in the treatment of
hypoxia related disorders. In particular, the invention provides a
method of increasing vascularization of tissue in a subject, and a
method for increasing EPO in a subject, by administering the
compounds of Formula (I). Accordingly, the invention further
provides pharmaceutical compositions comprising these
compounds.
DETAILED DESCRIPTION OF THE INVENTION
I. TERMS AND DEFINITIONS
[0021] All percentages, ratios and proportions herein are by
weight, unless otherwise specified.
[0022] All documents described herein are hereby incorporated by
reference.
[0023] When describing the compounds involved in the subject
invention, the following terms have the following meanings unless
otherwise specified.
[0024] "Acyl" or "carbonyl" is a radical formed by removal of the
hydroxy from a carboxylic acid (i.e., R--C(.dbd.O)--). Preferred
acyl groups include (for example) acetyl, formyl, and
propionyl.
[0025] "Alkyl" is a saturated hydrocarbon chain having 1 to 15
carbon atoms, preferably 1 to 10. more preferably 1 to 4 carbon
atoms. "Alkene" is a hydrocarbon chain having at least one
(preferably only one) carbon-carbon double bond and having 2 to 15
carbon atoms, preferably 2 to 10, more preferably 2 to 4 carbon
atoms. "Alkyne" is a hydrocarbon chain having at least one
(preferably only one) carbon-carbon triple bond and having 2 to 15
carbon atoms, preferably 2 to 10, more preferably 2 to 4 carbon
atoms. Alkyl, alkene and alkyne chains (referred to collectively as
"hydrocarbon chains") may be straight or branched and may be
unsubstituted or substituted. Preferred branched alkyl, alkene and
alkyne chains have one or two branches, preferably one branch.
Preferred chains are alkyl. Alkyl, alkene and alkyne hydrocarbon
chains each may be unsubstituted or substituted with from 1 to 4
substituents; when substituted, preferred chains are mono-, di-, or
tri-substituted. Alkyl, alkene and alkyne hydrocarbon chains each
may be substituted with halo, hydroxy, aryloxy (e.g., phenoxy),
heteroaryloxy, acyloxy (e.g., acetoxy), carboxy, aryl (e.g.,
phenyl), heteroaryl, cycloalkyl, heterocycloalkyl, spirocycle,
amino, amido, acylamino, keto, thioketo, cyano, or any combination
thereof. Preferred hydrocarbon groups include methyl, ethyl,
propyl, isopropyl, butyl, vinyl, allyl, butenyl, and
exomethylenyl.
[0026] Also, as referred to herein, a "lower" alkyl, alkene or
alkyne moiety (e.g., "lower alkyl") is a chain comprised of 1 to 6,
preferably from 1 to 4, carbon atoms in the case of alkyl and 2 to
6, preferably 2 to 4, carbon atoms in the case of alkene and
alkyne.
[0027] "Alkoxy" is an oxygen radical having a hydrocarbon chain
substituent, where the hydrocarbon chain is an alkyl or alkenyl
(i.e., --O-alkyl or --O-alkenyl). Preferred alkoxy groups include
(for example) methoxy, ethoxy, propoxy and allyloxy.
[0028] "Aryl" is an aromatic hydrocarbon ring. Aryl rings are
monocyclic or fused bicyclic ring systems. Monocyclic aryl rings
contain from 5 to about 9 atoms, preferably from 5 to 7 atoms, most
preferably from 5 to 6 atoms, especially 6 carbon atoms in the
ring. Six carbon atom ring membered monocyclic aryl rings are also
referred to as phenyl rings. Bicyclic aryl rings contain from 8 to
17 carbon atoms, preferably 9 to 12 carbon atoms, in the ring.
Bicyclic aryl rings include ring systems wherein one ring is aryl
and the other ring is aryl, cycloalkyl, or heterocycloakyl.
Preferred bicyclic aryl rings comprise 5-, 6- or 7-membered rings
fused to 5-, 6-, or 7-membered rings. Aryl rings may be
unsubstituted or substituted with from 1 to 4 substituents on the
ring. Aryl may be substituted with halo, cyano, nitro, hydroxy,
carboxy, amino, acylamino, alkyl, heteroalkyl, haloalkyl, phenyl,
aryloxy, alkoxy, heteroalkyloxy, carbamyl, haloalkyl,
methylenedioxy, heteroaryloxy, or any combination thereof.
Preferred aryl rings include naphthyl, tolyl, xylyl, and phenyl.
The most preferred aryl ring radical is phenyl.
[0029] "Aryloxy" is an oxygen radical having an aryl substituent
(i.e., --O-aryl). Preferred aryloxy groups include (for example)
phenoxy, napthyloxy, methoxyphenoxy, and methylenedioxyphenoxy.
[0030] "Cycloalkyl" is a saturated or unsaturated hydrocarbon ring.
Cycloalkyl rings are not aromatic. Cycloalkyl rings are monocyclic,
or are fused spiro, or bridged bicyclic ring systems. Monocyclic
cycloalkyl rings contain from about 3 to about 9 carbon atoms,
preferably from 3 to 7 carbon atoms, in the ring. Bicyclic
cycloalkyl rings contain from 7 to 17 carbon atoms, preferably from
7 to 12 carbon atoms, in the ring. Preferred bicyclic cycloalkyl
rings comprise 4-, 5-, 6- or 7-membered rings fused to 5-, 6-, or
7-membered rings. Cycloalkyl rings may be unsubstituted or
substituted with from 1 to 4 substituents on the ring. Cycloalkyl
may be substituted with halo, cyano, alkyl, heteroalkyl, haloalkyl,
phenyl, keto, hydroxy, carboxy, amino, acylamino, aryloxy,
heteroaryloxy, or any combination thereof. Preferred cycloalkyl
rings include cyclopropyl, cyclopentyl, and cyclohexyl.
[0031] "Halo" or "halogen" is fluoro, chloro, bromo or iodo.
Preferred halo are fluoro, chloro and bromo; more preferred
typically are chloro and fluoro, especially fluoro.
[0032] "Haloalkyl" is a straight, branched, or cyclic hydrocarbon
substituted with one or more halo substituents. Preferred are
C.sub.1-C.sub.12 haloalkyls; more preferred are C.sub.1-C.sub.6
haloalkyls; still more preferred still are C.sub.1-C.sub.3
haloalkyls. Preferred halo substituents are fluoro and chloro. The
most preferred haloalkyl is trifluoromethyl.
[0033] "Heteroatom" is a nitrogen, sulfur, or oxygen atom. Groups
containing more than one heteroatom may contain different
heteroatoms.
[0034] "Heteroalkyl" is a saturated or unsaturated chain containing
carbon and at least one heteroatom, wherein no two heteroatoms are
adjacent. Heteroalkyl chains contain from 2 to 15 member atoms
(carbon and heteroatoms) in the chain, preferably 2 to 10, more
preferably 2 to 5. For example, alkoxy (i.e., --O-alkyl or
--O-heteroalkyl) radicals are included in heteroalkyl. Heteroalkyl
chains may be straight or branched. Preferred branched heteroalkyl
have one or two branches, preferably one branch. Preferred
heteroalkyl are saturated. Unsaturated heteroalkyl have one or more
carbon-carbon double bonds and/or one or more carbon-carbon triple
bonds. Preferred unsaturated heteroalkyls have one or two double
bonds or one triple bond, more preferably one double bond.
Heteroalkyl chains may be unsubstituted or substituted with from 1
to 4 substituents. Preferred substituted heteroalkyl are mono-,
di-, or tri-substituted. Heteroalkyl may be substituted with lower
alkyl, haloalkyl, halo, hydroxy, aryloxy, heteroaryloxy, acyloxy,
carboxy, monocyclic aryl, heteroaryl, cycloalkyl, heterocycloalkyl,
spirocycle, amino, acylamino, amido, keto, thioketo, cyano, or any
combination thereof.
[0035] "Heteroaryl" is an aromatic ring containing carbon atoms and
from 1 to about 6 heteroatoms in the ring. Heteroaryl rings are
monocyclic or fused bicyclic ring systems. Monocyclic heteroaryl
rings contain from about 5 to about 9 member atoms (carbon and
heteroatoms), preferably 5 or 6 member atoms, in the ring. Bicyclic
heteroaryl rings contain from 8 to 17 member atoms, preferably 8 to
12 member atoms, in the ring. Bicyclic heteroaryl rings include
ring systems wherein one ring is heteroaryl and the other ring is
aryl, heteroaryl, cycloalkyl, or heterocycloalkyl. Preferred
bicyclic heteroaryl ring systems comprise 5-, 6- or 7-membered
rings fused to 5-, 6-, or 7-membered rings. Heteroaryl rings may be
unsubstituted or substituted with from 1 to 4 substituents on the
ring. Heteroaryl may be substituted with halo, cyano, nitro,
hydroxy, carboxy, amino, acylamino, alkyl, heteroalkyl, haloalkyl,
phenyl, alkoxy, aryloxy, heteroaryloxy, or any combination thereof.
Preferred heteroaryl rings include, but are not limited to, the
following: 34567
[0036] "Heteroaryloxy" is an oxygen radical having a heteroaryl
substituent (i.e., --O-heteroaryl). Preferred heteroaryloxy groups
include (for example) pyridyloxy, furanyloxy, (thiophene)oxy,
(oxazole)oxy, (thiazole)oxy, (isoxazole)oxy, pyrmidinyloxy,
pyrazinyloxy, and benzothiazolyloxy.
[0037] "Heterocycloalkyl" is a saturated or unsaturated ring
containing carbon atoms and from 1 to about 4 (preferably 1 to 3)
heteroatoms in the ring. Heterocycloalkyl rings are not aromatic.
Heterocycloalkyl rings are monocyclic, or are fused, bridged, or
spiro bicyclic ring systems. Monocyclic heterocycloalkyl rings
contain from about 3 to about 9 member atoms (carbon and
heteroatoms), preferably from 5 to 7 member atoms, in the ring.
Bicyclic heterocycloalkyl rings contain from 7 to 17 member atoms,
preferably 7 to 12 member atoms, in the ring. Bicyclic
heterocycloalkyl rings contain from about 7 to about 17 ring atoms,
preferably from 7 to 12 ring atoms. Bicyclic heterocycloalkyl rings
may be fused, spiro, or bridged ring systems. Preferred bicyclic
heterocycloalkyl rings comprise 5-, 6- or 7-membered rings fused to
5-, 6-, or 7-membered rings. Heterocycloalkyl rings may be
unsubstituted or substituted with from 1 to 4 substituents on the
ring. Heterocycloalkyl may be substituted with halo, cyano,
hydroxy, carboxy, keto, thioketo, amino, acylamino, acyl, amido,
alkyl, heteroalkyl, haloalkyl, phenyl, alkoxy, aryloxy or any
combination thereof. Preferred substituents on heterocycloalkyl
include halo and haloalkyl. Preferred heterocycloalkyl rings
include, but are not limited to, the following: 89101112
[0038] "Spirocycle" is an alkyl or heteroalkyl diradical
substituent of alkyl or heteroalkyl wherein said diradical
substituent is attached seminally and wherein said diradical
substituent forms a ring, said ring containing 4 to 8 member atoms
(carbon or heteroatom), preferably 5 or 6 member atoms.
[0039] A "pharmaceutically-acceptable salt" is a cationic salt
formed at any acidic (e.g., hydroxamic or carboxylic acid) group,
or an anionic salt formed at any basic (e.g., amino) group. Many
such salts are known in the art, as described in World Patent
Publication 87/05297, Johnston, et al., published Sep. 11, 1987,
incorporated by reference herein. Preferred cationic salts include
the alkali metal salts (such as sodium and potassium), and alkaline
earth metal salts (such as magnesium and calcium) and organic
salts. Preferred anionic salts include the halides (such as
chloride salts), sulfonates, carboxylates, phosphates, and the
like.
[0040] Such salts are well understood by the skilled artisan, and
the skilled artisan is able to prepare any number of salts given
the knowledge in the art. Furthermore, it is recognized that the
skilled artisan may prefer one salt over another for reasons of
solubility, stability, formulation ease and the like. Determination
and optimization of such salts is within the purview of the skilled
artisan's practice.
[0041] A "biohydrolyzable amide" is an amide of a hydroxamic
acid-containing compound of Formula (I) that does not interfere
with the vascularizing or EPO increasing activity of these
compounds, or that is readily converted in vivo by an animal,
preferably a mammal, more preferably a human subject, to yield an
active compound of Formula I. Examples of such amide derivatives
are alkoxyamides, where the hydroxyl hydrogen of the hydroxamic
acid of Formula (I) is replaced by an alkyl moiety, and
acyloxyamides, where the hydroxyl hydrogen is replaced by an acyl
moiety (i.e., R--C(.dbd.O)--).
[0042] A "biohydrolyzable hydroxy imide" is an imide of a
hydroxamic acid-containing compound of Formula (I) that does not
interfere with the vascularizing or EPO increasing activity of
these compounds, or that is readily converted in vivo by an animal,
preferably a mammal, more preferably a human subject to yield an
active compound of Formula (I). Examples of such imide derivatives
are those where the amino hydrogen of the hydroxamic acid of
Formula (I) is replaced by an acyl moiety (i.e.,
R--C(.dbd.O)--).
[0043] A "biohydrolyzable ester" is an ester of a
hydroxy-containing compound of Formula (I) that does not interfere
with the vascularizing or EPO increasing activity of these
compounds or that is readily converted in vivo by an animal to
yield an active compound of Formula (I). Such esters include lower
alkyl esters, lower acyloxy-alkyl esters (such as acetoxymethyl,
acetoxyethyl, aminocarbonyloxymethyl, pivaloyloxymethyl and
pivaloyloxyethyl esters), lactonyl esters (such as phthalidyl and
thiophthalidyl esters), lower alkoxyacyloxyalkyl esters (such as
methoxycarbonyloxymethyl, ethoxycarbonyloxyethyl and
isopropoxycarbonyloxyethyl esters), alkoxyalkyl esters, choline
esters and alkyl acylamino alkyl esters (such as acetamidomethyl
esters).
[0044] The terms "optical isomer", "stereoisomer", and
"diastereomer" have the standard an recognized meanings (see, e.g.,
Hawley's Condensed Chemical Dictionary, 11th Ed.). The illustration
of specific protected forms and other derivatives of the compounds
of the instant invention is not intended to be limiting. The
application of other useful protecting groups, salt forms, etc. is
within the ability of the skilled artisan.
II. COMPOUNDS
[0045] The invention relates to the method of using the compounds
of Formula (I): 13
[0046] where R.sub.1, R.sub.3, and R.sub.5 have the meanings
described above. The following provides a description of
particularly preferred moieties, but is not intended to limit the
scope of the claims.
[0047] R.sub.1 is selected from the group consisting of: alkyl,
alkene, alkyne, cycloalkyl, heteroalkyl, aryl, heteroaryl, and
heterocycloalkyl. When R.sub.1 is a heteroaryl, R.sub.1 in one mode
has a heteroatom in the 2-position. R.sub.1 may be 2-pyridine.
[0048] R.sub.3 is selected from the group consisting of aryl,
heteroaryl, and heterocycloalkyl. In one mode, R.sub.3 is aryl or
heteroaryl. In another mode R.sub.3 is aryl substituted in the
2-position with at least hydroxy. In still another mode, R.sub.3 is
further selected from the group consisting of 2-pyridyl, phenyl,
2-hydroxyphenyl, 3-naphthyl.
[0049] R.sub.5 is selected from the group consisting of aryl and
heteroaryl. In one mode R.sub.5 is further selected from the group
consisting of phenyl, and m-chlorophenyl.
III. COMPOUND PREPARATION
[0050] The compounds of the invention can be prepared using a
variety of procedures. The starting materials used in preparing the
compounds of the invention are known, made by known methods, or are
commercially available. A particularly preferred synthesis is
described in the following general reaction scheme. Specific
examples for making the compounds of the present invention are set
forth in Section VII, below. 14
[0051] In the general reaction scheme, R.sub.1, R.sub.3, and
R.sub.5 are defined above. S1a and S1b starting materials are
generally commercially available (such as from Aldrich, TCI, or
Lancaster). Some di-aromatic enones or chalcones are generally
commercially available (such as from Aldrich, TCI, or Pfaltz and
Bauer). Hydrazine derivatives are generally commercially available
(such as from Aldrich, Pfatz & Bauer, or Lancaster). Compounds
described by S1d, that is Formula (I) can be made by methods known
to one of ordinary skill in the art, as described by the following
and in cited references.
[0052] In the above general reaction scheme, the aryl or heteroaryl
ketone depicted as S1a is reacted with an aryl or heteroaryl
aldehyde depicted as S1b in a solvent that will allow the formation
of the enone to take place. Preferred solvents include small
(C1-C4) aliphatic alcohols that may or may not be wet with water,
or a higher boiling ether such as tetrahydrofuran. The more
preferred solvent is methanol or ethanol. The most preferred
solvent is ethanol. Subsequently, a base is added to the reaction.
Preferred bases include but are not limited to methoxides or
hydroxides. A preferred base is sodium hydroxide. The reaction is
allowed to proceed at a temperature preferably between about
-50.degree. C. and about 75.degree. C., more preferably between
about -20.degree. C. and about 45.degree. C., and most preferred
between about 0.degree. C. and about 25.degree. C. The reaction
time is preferably between about 1 and about 24 hours, more
preferably between about 4 and about 20 hours, and the most
preferred between about 8 and about 16 hours. Kohler, E. P.& H.
M. Chadwell, Org. Synth., Coll. Vol. 1, 2.sup.nd ed., p. 78; and
Hollinshead, S. P., Tetrahedron Letters, Vol. 37, pp. 9157-9160
(1996).
[0053] The resulting enone depicted as S1c is isolated by methods
known to those of ordinary skill in the art. Such methods include,
but are not limited to, extraction, solvent evaporation,
precipitation and filtration, or by flash chromatography on silica
gel (Merck, 230-400 mesh) using a mixture of solvents, preferably
hexanes and ethyl acetate, or dichloromethane and methanol, the
most preferred being dichloromethane and methanol. Most preferable
methods of isolation are precipitation and filtration, or
extraction into organic media, followed by flash column
chromatography.
[0054] The di-aryl/heteroaryl enone S1c is easily reacted with a
variety of hydrazines, either free base, or the mono- or
di-hydrochloride salt as depicted, for example, in Powers, D. G.,
et al., Tetrahedron, Vol. 54, pp. 4085-4096 (1998). The most
preferred hydrazine is free base. The enone intermediate S1c is
placed in a solvent suitable for the reaction in flasks open to
atmospheric pressure, or in tubes that are sealed during the
reaction while heating takes place, such as on a Quest.TM. 210
Organic Synthesizer (Argonaut Technologies) as to allow pressure to
build in the system. Preferred solvents include small aliphatic
alcohols (C1-C4) such as methanol, ethanol, or isopropanol, or
dimethyl sulfoxide, tetrahydrofuran, or dimethylformamide. More
preferred solvents are small aliphatic alcohols or
dimethylsulfoxide. The most preferred solvent is ethanol. An amount
of base is added dependent on the species of hydrazine, free base,
mono or dihydrochloride salt. A preferred base is sodium
hydroxide.
[0055] Addition of hydrazine is followed by heating the reaction.
The cyclization is carried out at a temperature between about
0.degree. C. and about 140.degree. C. The preferred temperature
range is between 30.degree. C. and 110.degree. C. The most
preferred range is between 55.degree. C. and 85.degree. C. The
preferred time for reaction completion is about 1 to about 15
hours. The more preferred reaction time is between about 3 and
about 12 hours. The most preferred reaction time is between about 5
and about 10 hours.
[0056] The 1,3,5-substituted dihydropyrazole noted as S1d is
isolated by methods known to one of ordinary skill in the art. Such
methods include, but are not limited to, extraction, solvent
evaportion, high pressure liquid chromatography (Gilson HPLC,
5%-95% methanol in water, 9 minute gradient, 210 nm), precipitation
followed by filtration, or crystallization followed by
filtration.
[0057] These steps may be varied to increase yield of desired
product. The skilled artisan will recognize the judicious choice of
reactants, solvents, and temperatures is an important
considerations in any successful synthesis. Determination of
optimal conditions, etc., is routine. Thus, the skilled artisan can
make a variety of compounds using the guidance of the scheme
above.
[0058] It is recognized that the skilled artisan in the art of
organic chemistry can readily carry out standard manipulations of
organic compounds without further direction; that is, it is well
within the scope and practice of the skilled artisan to carry out
such manipulations. These include, but are not limited to,
reduction of carbonyl compounds to their corresponding alcohols,
oxidations of hydroxyls and the like, acylations, aromatic
substitutions, both electrophilic and nucleophilic,
etherifications, esterification and saponification and the like.
Examples of these manipulations are discussed in standard texts
such as March, Advanced Organic Chemistry (Wiley). Carey and
Sundberg, Advanced Organic Chemistry (Vol. 2) and other art that
the skilled artisan is aware of.
[0059] The skilled artisan will also readily appreciate that
certain reactions are best carried out when another potentially
reactive functionality on the molecule is masked or protected, thus
avoiding any undesirable side reactions and/or increasing the yield
of the reaction. Often the skilled artisan utilizes protecting
groups to accomplish such increased yields or to avoid the
undesired reactions. These reactions are found in the literature
and are also well within the scope of the skilled artisan. Examples
of many of these manipulations can be found for example in T.
Greene, Protecting Groups in Organic Synthesis.
[0060] The compounds of the invention may have one or more chiral
centers. As a result, one may selectively prepare one optical
isomer, including diastereomer and enantiomer, over another, for
example by chiral starting materials, catalysts or solvents, or may
prepare both stereoisomers or both optical isomers, including
diastereomers and enantiomers, at once (a racemic mixture). Since
the compounds of the invention may exist as racemic mixtures,
mixtures of optical isomers, including diastereomers and
enantiomers, or stereoisomers may be separated using known methods,
such as chiral salts, chiral chromatography and the like.
[0061] In addition, it is recognized that one optical isomer,
including diastereomer and enantiomer, or stereoisomer may have
favorable properties over the other. Thus when disclosing and
claiming the invention, when one racemic mixture is disclosed, it
is clearly contemplated that both optical isomers, including
diastereomers and enantiomers, or stereoisomers substantially free
of the other are disclosed and claimed as well.
IV. METHODS OF USE
[0062] The compounds of present invention increase the biological
activity of HIF-1, thereby increasing the transcription of HIF-1
target genes. Without wishing to be bound by theory, the compounds
of the present invention are believed to increase the biological
activity of HIF-1 by one or more of the following mechanisms: i)
increasing the mRNA expression of HIF-1; ii) increasing the
expression of the protein HIF-1; iii) enhancing the nuclear
localization of HSF-1; and iv) enhancing the transactivation of
HIF-1. Semenza, J. Appl. Physiol., Vol. 88, page 1476 (2000). The
increased biological activity HIF-1, in turn, leads to the
increased expression of a number of HIF-1 target genes. A
non-exhaustive list of HIF-1 target genes include: adenylate kinase
3, .sub..alpha.1B-adrenergic receptor, adrenomedullin, aldolase A,
aldolase C, endothelin-1, enolase 1, EPO, glucose transporter 1,
glucose transporter 3, glyceraldehyde phosphate dehydrogenase, heme
oxygenase-1, hexokinase 1, hexokinase 2, insulin-like growth factor
II, IGF binding protein 1, IGF factor binding protein 3, lactate
dehydrogenase A, nitric oxide synthase 2, p21, p35srj,
phosphofructokinase L, phosphoglycerate kinase 1, pyruvate kinase
M, transferrin, transferrin receptor, VEGF, VEGF receptor FLT-1.
Semenza, J. Appl. Physiol., Vol. 88, pp. 1474-1480 (2000).
[0063] By increasing the transcription of these HIF-1 target genes,
the compounds of the present invention provide a method of
increasing the vascularization of tissue in a subject. As used
herein, "vascularization of tissue" means a pro-angiogenic response
whereby blood vessels or other vessels or ducts develop at or
around the afflicted tissue. The afflicted tissue need not be
hypoxic or ischemic per se, but rather the compounds Formula (I)
mimic the body's pro-angiogenic response to hypoxia. A non-limiting
example of "vascularization" includes capillary proliferation in a
non-healing wound or along the border of ischemic tissue. Thus,
these compounds enhance the ability of the body to revsacularize
damaged tissues or increase vasculature (e.g. to prevent hypoxic
damage). Non-limiting examples of "tissue" include: cardiac tissue,
such as myocardium and cardiac ventricles; skeletal muscle;
neurological tissue, such as from the cerebellum; internal organs,
such as the stomach, intestine, pancreas, liver, spleen, and lung;
and distal appendages such as fingers and toes.
[0064] The subject population that would benefit from treatment
with these compounds is large and includes any subjects requiring
pro-angiogenic treatment or recovery from endothelial cell damage
or loss. Examples would be subjects with hypoxia/ischemia-related
tissue damage or coronary, cerebral, or peripheral arterial
disease. Further examples include those subjects with
atherosclerosis, those with diabetic pathology including chronic
skin lesions, any subject with bone fractures or wounds that do not
heal readily, subjects recovering from surgeries that require rapid
revascularization of affected areas or where endothelium is damaged
(e.g., vascular graft surgery, balloon angioplasty) or many
surgically-related conditions (that is, conditions that often lead
to surgery and are caused by surgery) such as oral ulcers, peptic
ulcers, Crohn's disease, skin grafts, and wound healing, or those
with conditions such as frostbite, gangrene, erectile dysfunction,
hair loss, or poor circulation. Still further examples include
those subjects presenting with transient ischemic attacks or
angina. The compounds of the present invention may also be involved
in extra vascularization, where surrounding tissue needs to be
broken down to allow new blood vessels such as in angiofibroma and
hemangioma.
[0065] Vascularization of tissue can be measured by any person
skilled in the art using standard techniques. Non-limiting examples
of measuring vascularization in a subject include: SPECT (single
photon emission computed tomography); PET (positron emission
tomography); MRI (magnetic resonance imaging) and combinations
thereof, by measuring blood flow to the tissue before and after
treatment. These and other techniques are discussed in Simons, et
al., "Clinical trials in coronary angiogenesis", Circulation, Vol.
102, pp.73-86 (2000) incorporated herein by reference.
[0066] By increasing the transcription of these HIF-1 target genes,
the compounds of the present invention also provide a method of
increasing EPO in a subject. EPO transcription is subject to
physiological regulation at the level of gene transcription in
response to hypoxia a process that can be mimicked by the compounds
of the present invention by increasing the biological activity of
the transcription factor HIF-1. Thus, these compounds enhance the
ability of the body to increase EPO.
[0067] The subject population that would benefit from treatment
with these compounds is also large and includes any subjects
exhibiting an erythropoietin deficiency. As used herein,
"erythropoietin deficiency," refers to those conditions in which a
subject exhibits either a below normal hematocrit and a below
normal level of EPO, or a below normal hematocrit and an average
level of EPO, or a normal hematocrit and a below normal EPO. Any
person skilled in the art, using standard methods, can measure the
hematocrit and EPO levels in blood. A non-limiting example of
measuring EPO includes an EPO-ELISA kit from R&D Systems
(catalogue #DEP00, Minneapolis, Minn.). Another example of
measuring EPO includes a competitive radioimmunoassay as described
by Garcia, et al., "Radioimmunoassay of erythropoietin," Blood
Cells, Vol. 5, pp. 405-419 (1979) incorporated herein by
reference.
[0068] Examples of a subject population exhibiting an
erythropoietin deficiency include those subjects exhibiting an
erythropoietin deficiency associated with anemia. In another
example, the erythropoietin deficiency is associated with anemia
due to chronic renal failure. Other non-limiting examples of other
deficiencies associated with anemia include, but are not limited
to, anemia due to: prematurity; autologous blood donation; chronic
infection; rheumatoid arthritis; AIDS; AZT-treated HIV-infection;
malignancies; stem cell therapy; and anemia associated with:
irritable-bowel disease; hypothyroidism; malnutrition;
chemotherapy; and bone marrow transplantation.
[0069] Though not essential for activity or efficacy, certain
diseases, disorders, and unwanted conditions preferably are treated
with compounds that act on the afflicted tissues or regions of the
body. For example, a compound that displays a higher degree of
affinity for the heart would be preferred for treatment of ischemic
heart disease by increasing vascularization to the cardiac tissue
than other compounds that are less specific.
[0070] In addition, certain compounds are more bioavailable to
certain tissues that others. Choosing a compound which is more
bioavailable to a certain tissue and which acts on the
hypoxia-related disorder found in that tissue provides for the
specific treatment of the disease, disorder, or unwanted condition.
For example, compounds of this invention may vary in their ability
to penetrate in neurological tissue. Thus, compounds may be
selected for neurological protection from hypoxia (e.g., stroke) by
increasing vascularization to the neurological tissue. See, e.g.,
Bergeron, S., et al., "Role of hypoxia-inducible factor-1 in
hypoxia-induced ischemic tolerance in neonatal rat brain," Ann.
Neuro., Vol. 48(3), pp. 285-96, (2000); Marti, H. J., et al.,
"Hypoxia-induced vascular endothelial growth factor expression
precedes neovascularization after cerebral ischemia," Am. J.
Pathol., Vol. 156(3), pp. 965-76 (2000).
[0071] Determination of the specificity of a compound to a
particular type of tissue is within the skill of the artisan in
that field. For example, if increasing EPO in an adult subject is
the therapeutic goal, the ability of compounds of the present
invention to increase EPO production in kidney cells can be
screened by their ability to increase blood plasma level of EPO via
a radioimmunoassay (e.g., DiaSorin).
[0072] The compounds of this invention are also useful for
prophylactic or acute treatment. They are administered in any way
the skilled artisan in the fields of medicine or pharmacology would
desire. It is immediately apparent to the skilled artisan that
preferred routes of administration would depend upon the disease
state being treated and the dosage form chosen. Preferred routes
for systemic administration include administration perorally or
parenterally.
[0073] However, the skilled artisan will readily appreciate the
advantage of administering the compounds of the present invention
directly to the affected area for many diseases, disorders, or
unwanted conditions. For example, given the compounds of the
present invention increase vascularization of tissue, it may be
advantageous to administer the compounds directly to the area of
the tissue in need of vascularization such as in the area affected
by surgical trauma (e. g., angioplasty), non-healing wound (e.g.,
topical to the skin), or for opthalmic and periodontal
indications.
V. COMPOSITIONS
[0074] The compositions of the invention comprise:
[0075] (a) a safe and effective amount of a compound of the
invention; and
[0076] (b) a pharmaceutically-acceptable carrier.
[0077] As discussed above, hypoxia plays an important role in the
pathogenesis of many diseases and disorders. The compounds of the
present invention are useful in therapy with regard to these
hypoxia related conditions as well a treating tissue in need of
pro-angiogenic therapy and increasing EPO.
[0078] The invention compounds can therefore be formulated into
pharmaceutical compositions for use in increasing vascularization
of tissue and increasing EPO. Standard pharmaceutical formulation
techniques are used, such as those disclosed in Remington's
Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa.,
latest edition.
[0079] A "safe and effective amount" of a Formula (I) compound is
an amount that is effective, to increase vascularization and/or
increase EPO at the site(s) of activity, in an animal, preferably a
mammal, more preferably a human subject, without undue adverse side
effects (such as toxicity, irritation, or allergic response),
commensurate with a reasonable benefit/risk ratio when used in the
manner or this invention. The specific "safe and effective amount"
will, obviously, vary with such factors as the particular condition
being treated, the physical condition of the patient, the duration
of treatment, the nature of concurrent therapy (if any), the
specific dosage form to be used, the carrier employed, the
solubility of the Formula (I) compound therein, and the dosage
regimen desired for the composition.
[0080] In addition to the subject compound, the compositions of the
subject invention contain a pharmaceutically-acceptable carrier.
The term "pharmaceutically-acceptable carrier", as used herein,
means one or more compatible solid or liquid filler diluents or
encapsulating substances which are suitable for administration to
an animal, preferably a mammal, more preferably a human. The term
"compatible", as used herein, means that the components of the
composition are capable of being commingled with the subject
compound, and with each other, in a manner such that there is no
interaction that would substantially reduce the pharmaceutical
efficacy of the composition under ordinary use situations.
Pharmaceutically-acceptable carriers must, of course, be of
sufficiently high purity and sufficiently low toxicity to render
them suitable for administration to the animal, preferably a
mammal, more preferably a human being treated.
[0081] Some examples of substances which can serve as
pharmaceutically-acceptable carriers or components thereof are:
sugars, such as lactose, glucose and sucrose; starches, such as
corn starch and potato starch; cellulose and its derivatives, such
as sodium carboxymethyl cellulose, ethyl cellulose, and methyl
cellulose; powdered tragacanth; malt; gelatin; talc; solid
lubricants, such as stearic acid and magnesium stearate; calcium
sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame
oil, olive oil, corn oil and oil of theobroma; polyols such as
propylene glycol, glycerine, sorbitol, mannitol, and polyethylene
glycol; alginic acid; emulsifiers, such as the Tweens.RTM.; wetting
agents, such sodium buryl sulfate; coloring agents; flavoring
agents; tableting agents, stabilizers; antioxidants; preservatives;
pyrogen-free water; isotonic saline; and phosphate buffer
solutions.
[0082] The choice of a pharmaceutically-acceptable carrier to be
used in conjunction with the subject compound is basically
determined by the way the compound is to be administered.
[0083] If the subject compound is to be injected, the preferred
pharmaceutically-acceptable carrier is sterile, physiological
saline, with a blood-compatible colloidal suspending agent, the pH
of which has been adjusted to about 7.4.
[0084] In particular, pharmaceutically-acceptable carriers for
systemic administration include sugars, starches, cellulose and its
derivatives, malt, gelatin, talc, calcium sulfate, vegetable oils,
synthetic oils, polyols, alginic acid, phosphate buffer solutions,
emulsifiers, isotonic saline, and pyrogen-free water. Preferred
carriers for parenteral administration include propylene glycol,
ethyl oleate, pyrrolidone, ethanol, and sesame oil. Preferably, the
pharmaceutically-acceptable carrier, in compositions for parenteral
administration, comprises at least about 90% by weight of the total
composition.
[0085] The compositions of this invention are preferably provided
in unit dosage form. As used herein, a "unit dosage form" is a
composition of this invention containing an amount of a Formula (I)
compound that is suitable for administration to an animal,
preferably a mammal, more preferably a human subject, in a single
dose, according to good medical practice. These compositions
preferably contain from about 5 mg (milligrams) to about 1000 mg,
more preferably from about 10 mg to about 500 mg, more preferably
from about 10 mg to about 300 mg, of a Formula (I) compound.
[0086] The compositions of this invention may be in any of a
variety of forms, suitable, for example, for oral, rectal, topical,
nasal, ocular or parenteral administration. Depending upon the
particular route of administration desired, a variety of
pharmaceutically-acceptable carriers well-known in the art may be
used. These include solid or liquid fillers, diluents, hydrotropes,
surface-active agents, and encapsulating substances. Optional
pharmaceutically-active materials may be included, which do not
substantially interfere with the inhibitory activity of the Formula
(I) compound. The amount of carrier employed in conjunction with
the Formula (I) compound is sufficient to provide a practical
quantity of material for administration per unit dose of the
Formula (I) compound. Techniques and compositions for making dosage
forms useful in the methods of this invention are described in the
following references, all incorporated by reference herein: Modern
Pharmaceutics, Chapters 9 and 10 (Banker & Rhodes, editors,
1979); Lieberman et al., Pharmaceutical Dosage Forms: Tablets
(1981); and Ansel, Introduction to Pharmaceutical Dosage Forms 2d
Edition (1976).
[0087] Various oral dosage forms can be used including such solid
forms as tablets. capsules, granules and bulk powders. These oral
forms comprise a safe and effective amount, usually at least about
5%, and preferably from about 25% to about 50%, of the Formula (I)
compound. Tablets can be compressed, tablet triturates,
enteric-coated, sugar-coated, film-coated, or multiple-compressed,
containing suitable binders, lubricants, diluents, disintegrating
agents, coloring agents, flavoring agents, flow-inducing agents,
and melting agents. Liquid oral dosage forms include aqueous
solutions, emulsions, suspensions, solutions and/or suspensions
reconstituted from non-effervescent granules, and effervescent
preparations reconstituted from effervescent granules, and
containing suitable solvents, preservatives, emulsifying agents,
suspending agents, diluents, sweeteners, melting agents, coloring
agents and flavoring agents.
[0088] The pharmaceutically-acceptable carrier suitable for the
preparation of unit dosage forms for peroral administration are
well-known in the art. Tablets typically comprise conventional
pharmaceutically-compatible adjuvants as inert diluents, such as
calcium carbonate, sodium carbonate, mannitol, lactose and
cellulose; binders such as starch, gelatin and sucrose;
disintegrants such as starch, alginic acid and croscarmelose;
lubricants such as magnesium stearate, stearic acid and talc.
Glidants such as silicon dioxide can be used to improve flow
characteristics of the powder mixture. Coloring agents such as the
FD&C dyes, can be added for appearance. Sweeteners and
flavoring agents, such as aspartame, saccharin, menthol,
peppermint, and fruit flavors, are useful adjuvants for chewable
tablets. Capsules typically comprise one or more solid diluents
disclosed above. The selection of carrier components depends on
secondary considerations like taste, cost, and shelf stability,
which are not critical for the purposes of the subject invention,
and can be readily made by a person skilled in the art.
[0089] Peroral compositions also include liquid solutions,
emulsions, suspensions, and the like. The
pharmaceutically-acceptable carriers suitable for preparation of
such compositions are well known in the art. Typical components of
carriers for syrups, elixirs, emulsions and suspensions include
ethanol, glycerol, propylene glycol, polyethylene glycol, liquid
sucrose, sorbitol and water. For a suspension, typical suspending
agents include methyl cellulose, sodium carboxymethyl cellulose,
Avicel.RTM. RC-591, tragacanth and sodium alginate; typical wetting
agents include lecithin and polysorbate 80; and typical
preservatives include methyl paraben and sodium benzoate. Peroral
liquid compositions may also contain one or more components such as
sweeteners, flavoring agents and colorants disclosed above.
[0090] Such compositions may also be coated by conventional
methods, typically with pH or time-dependent coatings, such that
the subject compound is released in the gastrointestinal tract in
the vicinity of the desired topical application, or at various
times to extend he desired action. Such dosage forms typically
include, but are not limited to, one or more of cellulose acetate
phthalate, polyvinylacetate phthalate, hydroxypropyl methyl
cellulose phthalate, ethyl cellulose, Eudragit.RTM. coatings, waxes
and shellac.
[0091] Compositions of the subject invention may optionally include
other drug actives.
[0092] Other compositions useful for attaining systemic delivery of
the subject compounds include sublingual, buccal, suppository, and
nasal dosage forms. Such compositions typically comprise one or
more of soluble filler substances such as sucrose, sorbitol and
mannitol; and binders such as acacia, microcrystalline cellulose,
carboxymethyl cellulose and hydroxypropyl methyl cellulose.
Glidants, lubricants, sweeteners, colorants, antioxidants and
flavoring agents disclosed above may also be included.
[0093] The compositions of this invention can also be administered
topically to a subject, e.g., by the direct laying on or spreading
of the composition on the epidermal or epithelial tissue of the
subject, or transdermally via a "patch". Such compositions include,
for example, lotions, creams, solutions, gels and solids. These
topical compositions preferably comprise a safe and effective
amount, usually at least about 0.1%, and preferably from about 1%
to about 5%, of the Formula (I) compound. Suitable carriers for
topical administration preferably remain in place on the skin as a
continuous film, and resist being removed by perspiration or
immersion in water. Generally, the carrier is organic in nature and
capable of having dispersed or dissolved therein the Formula (I)
compound. The carrier may include pharmaceutically-acceptable
emollients, emulsifiers, thickening agents, solvents and the
like.
VI. METHODS OF ADMINISTRATION
[0094] This invention also provides methods of increasing
vascularization of tissue and/or increasing EPO in a human or other
animal subject, by administering a safe and effective amount of a
Formula (I) compound to said subject. The methods of the invention
are useful in treating or preventing disorders described above.
[0095] Compositions of this invention can be administered topically
or systemically. Systemic application includes any method of
introducing Formula (I) compound into the tissues of the body,
e.g., intra-articular, intrathecal, epidural, intramuscular,
transdermal, intravenous, intraperitoneal, subcutaneous,
sublingual, rectal, ocular, and oral administration. The Formula
(I) compounds of the present invention are preferably administered
orally.
[0096] The specific dosage of inhibitor to be administered, as well
as the duration of treatment, and whether the treatment is topical
or systemic, are interdependent. The dosage and treatment regimen
will also depend upon such factors as the specific Formula (I)
compound used, the treatment indication, the ability of the Formula
(I) compound to reach minimum inhibitory concentrations to
vascularize affected tissue or to increase EPO to desired level,
and the personal attributes of the subject (such as weight),
compliance with the treatment regimen, and the presence and
severity of any side effects of the treatment.
[0097] When determining systemic dosage of a compound of Formula
(I) wherein the therapeutic goal is to increase vascularization in
tissue, any synergistic interactions of the compound with
endogenous events occurring in the injured tissue will be taken
into account to avoid undesired effects in non-injured tissues. To
the extent (if any) there is synergy between endogenous responses
to moderate degrees of hypoxia and the compounds of the present
invention, systemic administration can be used to generate a tissue
specific response. In this manner, angiogenesis would be stimulated
in tissues where it is required and potentially harmful
neovascularization (e.g., proliferative retinopathy) in already
well-vascularized tissues can be controlled or avoided.
[0098] Typically, for a human adult (weighing approximately 70
kilograms), from about 5 mg to about 3000 mg, more preferably from
about 5 mg to about 1000 mg, more preferably from about 10 ma to
about 100 mg, of Formula (I) compound are administered per day for
systemic administration. It is understood that these dosage ranges
are by way of example only, and that daily administration can be
adjusted depending on the factors listed above.
[0099] A preferred method of systemic administration is oral.
Individual doses of from bout 10 mg to about 1000 mg, preferably
from about 10 mg to about 300 mg, are preferred.
[0100] Topical administration can be used to deliver the Formula
(I) compound systemically, or to treat a subject locally. The
amounts of Formula (I) compound to be topically administered
depends upon such factors as skin sensitivity, type and location of
the tissue to be treated the composition and carrier (if any) to be
administered, the particular Formula (I) compound to be
administered, as well as the particular disorder to be treated and
the extent to which systemic (as distinguished from local) effects
are desired.
[0101] The compounds of the present invention can be targeted to
specific locations within the body by using targeting ligands well
known in the art. For example, to focus a Formula (I) compound to
ischemic cardiac tissue, the compound is conjugated to an antibody
or fragment thereof which is immunoreactive with a cardiac cell
marker as is broadly understood in the preparation of
immunopharmaceuticals in general. The targeting ligand can also be
a ligand suitable for a receptor that is present on the cardiac
tissue. Any targeting ligand that specifically reacts with a marker
for the intended tweet tissue can be used. Methods for coupling the
invention compound to the targeting ligand are well known and are
similar to those described below for coupling to a carrier. The
conjugates are formulated and administered as described above.
[0102] For localized conditions, topical administration is
preferred. For example, to treat a non-healing skin lesion, the
compound is applied locally and topically, in a gel, paste, salve
or ointment. For treatment of oral diseases, such as gingivitis,
the compound may be applied locally in a gel, paste, mouth wash, or
implant. The mode of treatment thus reflects the nature of the
condition and suitable formulations for any selected route are
available in the art.
[0103] In all of the foregoing, of course, the compounds of the
invention can be administered alone or as mixtures, and the
compositions may further include additional drugs or excipients as
appropriate for the indication.
VII. EXAMPLES
Compound Preparation
Examples 1-20
[0104] The following chart shows the structure of compounds made
according to the procedures described in Examples 1-20. 15
1TABLE I Example R1 R3 R5 EC.sub.50.sup.1 1. phenyl 2-pyridyl
phenyl 23 2. 2-pyridyl phenyl phenyl 6 3. 2-pyridyl 2-hydroxyphenyl
phenyl 1.7 4. 1-benzothiazole 2-hydroxyphenyl phenyl 27 5.
2-pyridyl 2-hydroxyphenyl p-toluyl 5.7 6. 2-pyridyl 2-hydroxyphenyl
p-methoxyphenyl 5.68 7. 2-pyridyl 2-hydroxyphenyl o-methoxyphenyl
5.5 8. 2-pyridyl 2-hydroxyphenyl 2-pyridyl 5.4 9. 2-pyridyl
2-hydroxyphenyl o-hydroxyphenyl 5.4 10. methyl 2-hydroxyphenyl
2-pyridyl 92 11. methyl 2-hydroxyphenyl 1-thiazole 12 12.
2-hydroxyethyl 2-hydroxyphenyl 2-pyridyl 65 13. 2-cyanoethyl
2-hydroxyphenyl 2-pyridyl 18 14. p-toluyl 2-pyridyl phenyl 2 15.
p-bromophenyl 2-pyridyl phenyl 6.3 16. phenyl 2-pyridyl
m-chlorophenyl 1.7 17. phenyl phenyl p-dimethylaminophenyl 6 18.
methyl 3-naphthyl p-methoxyphenyl 11 19. methyl 3-naphthyl
p-fluorophenyl 3.6 20. methyl 3-naphthyl p-trifluoromethylphenyl 13
.sup.1EC.sub.50 is the concentration of compound that induces the
production of an amount of VEGF equal to half the maximum amount of
VEGF induced by the compound.
[0105] Compounds are analyzed using .sup.1H and .sup.13C NMR
obtained on a Varian Unity plus 300 MHz spectrometer, chemical
shifts are reported in .delta. ppm downfield from TMS as an
internal standard. The compounds are also analyzed using elemental
analysis, mass spectra using a Fisons Platform-II quadrupole mass
spectrometer, high resolution mass spectra and/or IR spectra as
appropriate. Thin layer chromatography (hereinafter "TLC") analysis
is performed on glass mounted silica gel plates (200-300 mesh;
Baker or Analtech) with fluorescent indicator and visualized using
UV detection.
Example 1
2-(1,5-Diphenyl-4,5-dihydro-1H-pyrazol-3-yl)-pyridine
[0106] 16
3-Phenyl-1-pyridin-2-yl-propenone (1c)
[0107] Method A: To solution of 2-acetylpyridine 1a (10 mmol, 1
equiv.) and tetrahydrofuran (25 mL) is added benzaldehyde 1b (10
mmol, 1 equiv.). Sodium methoxide (12 mmol, 1.2 equiv.) in methanol
(24 mL, 0.5M) is introduced into the reaction and is agitated for
15 hours at room temperature. Hydrochloric acid (1N) is added until
a neutral pH is obtained. The solution is extracted with
dichloromethane twice, and washed once with water. The combined
organic layers are dried over MgSO.sub.4, and concentrated under
reduced pressure. The residue is purified by flash column
chromatography on SiO.sub.2 (33% ethyl acetate/hexanes) to give the
3-phenyl-1-pyridin-2-yl-propenone 1c as a pale yellow solid. See
Hollinshead, S. P., Tetrahedron Letters, Vol 37, pp. 9157-9160
(1996).
[0108] Method B: A solution of NaOH (12.8 mmol, 1.28 equiv.) in
water (4.55 g) and ethanol (2.32 g) are introduced into a round
bottom flask with a magnetic stirrer. Into the alkaline solution is
placed 2-acetyl pyridine 1a (10 mmol, 1 equiv.) and the flask is
rapidly surrounded by ice and the stirrer is started. The
temperature reaches 10.degree. C.-15.degree. C. and benzaldehyde 1b
(10 mmol, 1 equiv.) is added at once. The ice bath is removed and
the reaction is stirred for 15 hours. The reaction is filtered. The
filtrate is concentrated under reduced pressure and the product is
purified by flash column chromatography on SiO.sub.2 (33% ethyl
acetate/hexanes) to give the 3-phenyl-1-pyridin-2-yl- -propenone 1c
as a pale yellow solid. See Kohler. E. P. & H. M. Chadwell, H.
M., Org. Synth. Coll. Vol. 1, 2.sup.nd ed., p. 78.
2-(1,5-Diphenyl-4,5-dihydro-1H-pyrazol-3-yl)-pyridine (1d)
[0109] To a solution of a 3-phenyl-1-pyridin-2-yl-propenone 1c
(0.10 mmol, 1 equiv.) in ethanol (4 mL). is added phenyl hydrazine
free base (0.10 mmol, 1 equiv.) and sodium hydroxide (0.10 mmol. 1
equiv.). The mixture is stirred at 60.degree. C. for 8 hours
(temperature and reaction time can vary, higher temperature if in a
sealed system). Water and ethyl acetate is added to the reaction
and the phases are separated. The organic layer is washed until the
water runs clear, and the aqueous layer is extracted with ethyl
acetate two times. The combined organic layer is dried over
Na.sub.2SO.sub.4, decanted and concentrated under reduced pressure.
The residue is purified by high pressure liquid chromatography
(Gilson HPLC. 5%-95% methanol in water, 9 minute gradient. 210 nm),
and concentrated under reduced pressure to afford
2-(1,5-diphenyl4,5-dihydro-- 1H-pyrazol-3-yl)-pyridine 1d as a
yellow powder. Powers, D. G., et al,. Tetrahedron, Vol. 54, pp.
4085-4096 (1998).
Example 2
2-(3,5-Diphenyl-4,5-dihydro-pyrazol-1-yl)-pyridine
[0110] 17
[0111] Example 2 is prepared using 1-acetylbenzene and benzaldehyde
(method A) to afford 1,3-diphenyl-propenone. The propenone is
reacted with 2-hydrazinopyridine following the procedure described
for Example 1.
Example 3
2-(5-Phenyl-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl)-phenol
[0112] 18
[0113] Example 3 is prepared using 2-hydroxychalcone and
2-hydrazinopyridine following the procedure described for Example
1.
Example 4
2-(1-Benzothiazol-2-yl-5-phenyl-4,5-dihydro-1H-pyrazol-3-yl)-phenol
[0114] 19
[0115] Example 4 is prepared using 2-hydroxychalcone and
benzothiazol-2-yl-hydrazine following the procedure described for
Example 1.
Example 5
2-(1-Pyridin-2-yl-5-p-tolyl-4,5-dihydro-1H-pyrazol-3-yl)-phenol
[0116] 20
[0117] Example 5 is prepared using
1-(2-hydroxy-phenyl)-3-p-tolyl-propenon- e and 2-hydrazinopyridine
following the procedure described for Example 2.
Example 6
2-[5-(4-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-phenol
[0118] 21
Example 6 is prepared using
1-(2-hydroxy-phenyl)-3-p-methoxy-propenone and 2-hydrazinopyridine
following the procedure described for Example 2.
Example 7
2-[5-(2-Methoxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-phenol
[0119] 22
[0120] Example 7 is prepared using
1-(2-hydroxy-phenyl)-3-o-methoxy-propen- one and
2-hydrazinopyridine following the procedure described for Example
2.
Example 8
2-(1,5-Di-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl)-phenol
[0121] 23
[0122] Example 8 is prepared using 2-acetylbenzene and
2-pyridinecarboxaladehyde (method A) to afford
1-(2-hydroxy-phenyl)-3-pyr- idin-2-yl-propenone. The propenone is
reacted with 2-hydrazinopyridine following the procedure described
for Example 1.
Example 9
2-[5(2-hydroxy-phenyl)-1-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-phenol
[0123] 24
[0124] Example 9 is prepared using 2-acetylbenzene and
2-salicylaldehyde (method A) to afford
1,3-bis-(2-hydroxy-phenyl)-propenone. The propenone is reacted with
and 2-hydrazinopyridine following the procedure described for
Example 1.
Example 10
2-(1-Methyl-5-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl)-phenol
[0125] 25
[0126] Example 10 is prepared using
1-(2-hydroxy-phenyl)-3-pyridin-2-yl-pr- openone and methylhydrazine
following the procedure described for Example 1.
Example 11
2-(1-Methyl-5-thiazol-2-yl-4,5-dihydro-1H-pyrazol-3-yl)-phenol
[0127] 26
[0128] Example 11 is prepared using 2-acetylbenzene and
thiazole-2-carbaldehyde (method A) to afford
1-(2-hydroxy-phenyl)-3-thiaz- ol-2-yl-propenone. The propenone is
reacted with methylhydrazine following the procedure described for
Example 1.
Example 12
2-[1-(2-Hydroxy-ethyl)-5-pyridin-2-yl-4,5-dihydro-1H-pyrazol-3-yl]-phenol
[0129] 27
[0130] Example 12 is prepared using
1-(2-hydroxy-phenyl)-3-pyridin-2-yl-pr- openone and
2-hydrazino-ethanol following the procedure described for Example
1.
Example 13
3-[3-(2-Hydroxy-phenyl)-5-pyridin-2-yl-4,5-dihydro-pyrazol-1-yl]-propionit-
rile
[0131] 28
[0132] Example 13 is prepared using
1-(2-hydroxy-phenyl)-3-pyridin-2-yl-pr- openone and
3-hydrazino-propionitrile following the procedure described for
Example 1.
Example 14
2-(5-Phenyl-1-p-tolyl-4,5-dihydro-1H-pyrazol-3-yl)-pyridine
[0133] 29
[0134] Purchased from Sigma.
Example 15
2-[1-(4-Bromo-phenyl)-5-phenyl-4,5-dihydro-1H-pyrazol-3-yl]-pyridine
[0135] 30
[0136] Purchased from Sigma.
Example 16
2-[5-(3-Chloro-phenyl)-1-phenyl-4,5-dihydro-1H-pyrazol-3-yl]-pyridine
[0137] 31
[0138] Purchased from Sigma.
Example 17
[4-(2,5-Diphenyl-3,4-dihydro-2H-pyrazol-3-yl)-phenyl]-dimethyl-amine
[0139] 32
[0140] Purchased from Sigma.
Example 18
5-(4-Methoxy-phenyl)-1-methyl-3-naphthalen-2-yl-4,5-dihydro-1H-pyrazole
[0141] 33
[0142] Purchased from Maybridge.
Example 19
5-(4-Fluoro-phenyl)-1-methyl-3-naphthalen-2-yl-4,5-dihydro-1H-pyrazole
[0143] 34
[0144] Purchased from Maybridge.
Example 20
1-Methyl-3-naphthalen-2-yl-5-(4-trifluoromethyl-phenyl)-4,5-dihydro-1H-pyr-
azole
[0145] 35
[0146] Purchased from Maybridge.
VIII. EXAMPLES
Methods of Screening Compounds
[0147] A compound of Formula (I) can be screened for the
appropriate therapeutic use in a number of different ways. The
following assays also may be used to optimize therapeutic doses of
the compounds. In turn, toxicity would be established according to
standard tests well known in the art for determination of compound
toxicity.
[0148] Examples I-VI teach methods of screening compounds
appropriate for the therapeutic goal of increasing vascularization
of tissue. Although the following examples may focus on the HIF-1
target gene VEGF as a well known mediator of angiogenesis, one
skilled in the art will appreciate that these, and other methods,
can be readily adapted to screen the compounds of Formula (I) to
other HIF-1 target genes as well as other therapeutic goals.
Indeed, given that compounds increase the biological activity of a
transcription factor, HIF-1 controls the expression of multiple
genes involved in angiogenesis and thus will presumably give a
superior clinical outcome compared to treatment with a single
angiogenic factor such as VEGF. On the other hand, if the
therapeutic goal is to increase EPO, these methods can be adapted
to screen for compounds of Formula (I) that increase the
transcription of EPO.
[0149] Example I details a VEGF-luciferase reporter gene assay that
measures a compound's ability to stimulate transcription of a
luciferase gene linked to an upstream VEGF promoter-enhancer
sequence. Example II details an enzyme-linked immunosorbancy assay
(ELISA) for VEGF that measures the ability of a compound of the
present invention to stimulate secretion of VEGF from a cell.
Example III details a gene panel assay. Messenger RNA for eight
different genes is measured from a cell line that is treated with a
compound of the present invention. Example IV details an immunoblot
assay for the induction of HIF-1. Example V details the effect the
compounds of the present invention have upon increased amount of
VEGF in rat cardiac tissue. Example VI details the level of EPO in
blood after rats are treated with the compounds of the present
invention.
Example I
[0150] Any compound of the present invention can be screened by a
VEGF-luciferase assay. The assay evaluates the transcriptional
activity of the compounds. A VEGF-luciferase cell line is prepared
in a ELEM parental line as described in Engelmann, G. L., et al.,
"Formation of fetal rat cardiac cell clones by retroviral
transformation: retention of select myocyte characteristics", J.
Mol. Cell. Cardio., Vol. 25, pp. 2979-84 (1998). ELEM cells are
v-H-ras transformed neonatal rat ventricular cardiomyocytes. A
luciferase reporter plasmid is constructed using the pGL2-basic
(Promega) plasmid containing an insert consisting of 2.65 kb of the
vegf promoter (bp -2274 to +379 relative to the transcription
initiation site) fused to the firefly luciferase coding sequences
as well as SV40 intron and polyadenylation signals. This reporter
plasmid, along with a control plasmid containing an SV40-neomyocin
and Cytomeagalovirus (CMV)-.beta.gal construct, are transfected
into ELEM cells and stable transfectants are selected in G418.
Responses of the VEGF-luciferase reporter to hypoxia and to
desferoximine, a mimetic of hypoxic responses, are tested, and a
clone with strong and reproducible responses are selected. ELEM
cells and their transfectants are grown in Dulbecco's Modified
Eagle's Medium/F12 (1:1) (Life Technologies) that include 10%
heat-inactivated fetal bovine serum, unless otherwise indicated
(Life Technologies), a 1.times. penicillin/streptomysin mixture
(Life Technologies) and 500 .mu.g/ml G418 (Life Technologies).
Tissue culture plates are precoated with fibronectin. The standard
condition for assaying is established as follows: cells are plated
in 96-well plates at a density of 6.times.10.sup.3 cells per well
in 100 .mu.l of media per well. 42 hrs later, compounds are added
to the wells in 10 .mu.l aliquots. Six hours after addition of
compounds, cells are lysed and assayed for luciferase and
.beta.-galactosidase activity. Compounds for pharmaceutical use are
selected based upon cells exhibiting the greatest luciferase and
.beta.-galactosidase activity.
Example II
[0151] Any compound of the present invention can be screened by a
VEGF-ELISA assay. VEGF secretion is assayed in the HL-1
cardiomyocyte cell line as described in Claycomb. W. C., "HL-1
cells: a cardiac muscle cell line that contracts and retains
phenotypic characteristics of the adult cardiomyocyte", Proc. Natl.
Acad. Sci U.S.A., Vol. 95, pp. 2979-84 (1998). For experiments,
HL-1 cells are plated in 96-well plates at a density of
2.times.10.sup.4 cells per well in growth medium: EXCEL 320 media
(JRH Biosciences, Lenexia, Kans.) plus 10% fetal bovine serum
(BioWhitaker), 100 nM retinoic acid (Sigma, St. Louis, Mo.), 10
.mu.M norepinephrine (Sigma), 10 .mu.g/ml insulin (Life
Technologies, Grand Island, N.Y.), 1.times. non-essential amino
acid supplement (Life Technologies), 50 .mu.g/ml endothelial cell
growth supplement (Upstate Biotechnology, Lake Placid, N.Y.), 100
units/ml penicillin, 100 units/ml streptomycin (Life Technologies).
After 24 hrs, the media is replaced with a low-growth media (HL-1
media with 2% fetal bovine serum and without endothelial cell
growth supplement) containing test compounds with 0.5% dimethyl
sulfoxide (DMSO). After 18 hrs, conditioned media from the treated
cells was assayed for VEGF content with a Murine VEGF-ELISA kit
(R&D Systems, Minneapolis, Minn.). The amount of VEGF secreted
into the media over an 18 hr period is normalized to positive
control wells which are treated with a maximally effective
concentration (1 mM) of deferoxamine mesylate (Sigma, St. Louis)
and are reported as "percent activity," where the VEGF in
unstimulated wells is defined as 0% and the VEGF in wells treated
with 1 mM deferoxamine is defined as 100%. Potency is determined by
stimulating cells with 10 concentrations of test compounds (200 nM
to 100 .mu.M) and fitting the data to a variable slope sigmoidal
dose-response curve using GraphPad Prism version 3.00 for Windows
95 (GraphPad Software, San Diego, Calif.). Determinations for each
test compound are performed in three separate experiments and the
means .+-. standard deviation of the Log(EC5) and maximum response
are evaluated. Compounds for pharmaceutical use are selected based
upon the greatest percent activity.
Example III
[0152] Any compound of the present invention can be screened by a
gene selectivity panel assay to determine the specificity of
induction of VEGF. Messenger RNA for eight genes expressed in HL-1
cells is quantified using real-time reverse
transcriptase-polymerase chain reaction (TaqMan) in duplex
reactions using .beta.-actin as a control reference gene as
described in Heid, C. A., et al., "Real time quantitative PCR",
Genome Res., Vol. 6, pp.986-994 (1996). HL-1 cells are treated for
18 hr with lest compounds at concentrations equal to 10 times the
EC.sub.50, and total RNA is prepared using TriReagent (Molecular
Research Center, Cincinnati, Ohio). Polymerase Chain Reaction (PCR)
primers specific to each gene of the panel are designed to span
introns where possible and are generated using the Primer
Express.TM. Oligo Design Software System (Applied Biosystems) and
compared with sequences in the GenBank database to eliminate
cross-hybridization with other genes. All TaqMan probes designed
against target genes are 5'-labeled with 6-FAM
(6-carboxy-fluorescein) reporter dye and 3'-labeled with TAMRA
(6-carboxy-tetramethyl-rhodamine) quencher dye (see Table II). The
TaqMan.RTM. probe specific for the .beta.-actin control gene are
5'-labeled with VIC (Applied Biosystems) reporter dye (see Table
II) to enable dual amplification and resolution of target and
control products in the same reaction for normalization. Primers
and probe monocyte chemoattractant protein-1 (MCP-1) are from
Applied Biosystems sold as TaqMan.RTM. PDAR Target Reagents.
[0153] Primer concentrations are optimized to ensure that both
genes in each reaction are amplified with equal efficiencies and
that primers for one gene do not affect the efficiency of
amplification of the other. All genes are amplified in a reaction
mixture containing 15 ng RNA, 3.12 mM manganese acetate, 1.25 mM
deoxyadenine triphosphate (dATP), deoxycytidine triphosphate
(dCTP), deoxyguanidine triphosphate (dGTP), 2.5 mM deoxyuridine
triphosphate (dUTP), 2.5 units rTth DNA Polymerase, 1 unit AmpErase
UNG, 150 nM target probe and 150 nM .beta.-actin probe. VEGF,
transforming growth Factor-.beta. 1 (TGF-.beta.1), sarcolemal
endoplasmic reticulum calcium ATPase (SERCA), angiopoietin-1
(Ang-1), and .beta.-myosin heavy chain (.beta.-MHC) RNA are each
amplified in separate reactions containing the reaction mixture as
previously described as well as 300 nM forward and reverse target
primers and 60 nM .beta.-actin forward and reverse primers.
Glyceraldehyde phosphate dehydrogenase (GAPDH), .alpha.-myosin
heavy chain (.alpha.-MHC), and atrial natriuretic peptide (ANP) are
each amplified in separate reactions containing the reaction
mixture as previously described as well as 80 nM forward and
reverse target primers and 60 nM .beta.-actin forward and reverse
primers. MCP-1 is amplified using a 20.times. primer and probe
stock solution prepared and supplied by Applied Biosystems and is
used as 1.times. in the PCR reaction. PCR Thermal cycling for all
reactions is 50.degree. C..times.2 min. 60.degree. C..times.30 min,
95.degree. C..times.5 min, followed by 40 cycles of 94.degree.
C..times.20 seconds and 62.degree. C..times.1 min.). Raw Cycle
Threshold (CT) values for each target gene are calculated by the
Sequence Detection Software (Applied Biosystems). Each target gene
level is then compared relative to the .beta.-actin level in that
same ample by subtracting the CT for .beta.-actin from the CT for
the target gene to arrive at a .DELTA.-CT level. In turn,
.DELTA.-CT levels for treated samples are then subtracted from
.DELTA.-CT level of vehicle treated samples to arrive at a
.DELTA..DELTA.-CT level for that gene. .DELTA..DELTA.-CT levels can
be converted to a percent change according to the relationship
100.times.2.sup.-(.DELTA..DELTA.Ct)=% change. Compounds for
pharmaceutical use are selected based on having a high % change in
VEGF or GAPDH expression and low % change for the non-hypoxia
regulated genes.
2TABLE II Primer Sequences Probe Sequence Probe Gene (5' to 3') (5'
to 3') Dye VEGF Forward: ACCATGCCAAGTGGTCCCAGGC FAM
ACCCTGGCTTTACTGCTGTACCT (SEQ ID NO:3) (SEQ ID NO:1) Reverse:
TGGGACTTCTGCTCTCCTTCTG (SEQ ID NO:2) SERC Forward:
ACTACAGTCAAACATGCGCTGTGAG- AAGCTG FAM A
GTAGACAGATGTTGGTGCAATACAAGTA (SEQ ID NO:6) (SEQ ID NO:4) Reverse:
CAATACCTGTTACCAGCACAGAAACT (SEQ ID NO:5) TGF- Forward:
CCACGTGGAAATCAACGGGATCAGC FAM .beta.1 GCTCTTGTGACAGCAAAGATAACAA
(SEQ ID NO:9) (SEQ ID NO:7) Reverse: GGTCGCCCCGACGTTT (SEQ ID NO:8)
ANP Forward: ATGGATTTCAAGAACCTGCTAGACCACCTGG FAM
TGCGGTGTCCAACACAGATC (SEQ ID NO: 12) (SEQ ID NO:10) Reverse:
GCTTCCTCAGTCTGCTCACTCA (SEQ ID NO:11) .beta.- Forward:
CCCAGCTCTAAGGGTGCCCGTGAA FAM MHC GTGCCAAGGGCCTGAATG (SEQ ID NO:15)
(SEQ ID NO:13) Reverse: CACCTAAAGGGCTGTTGCAAA (SEQ ID NO:14)
.alpha.-MHC Forward: ATGTCCCGGCTCTTGGCCCG FAM GGAGGAGAGGGCGGACAT
(SEQ ID NO:18) (SEQ ID NO:16) Reverse: AGAGGTTATTCCTCGTCGTGCAT (SEQ
ID NO:17) GAPD Forward: CAGAAGACTGTGGATGGCCCCTC FAM H
TGCACCACCAACTGCTTAG (SEQ ID NO:21) (SEQ ID NO:19) Reverse:
GGATGCAGGGATGATGTFC (SEQ ID NO:20) MCP-1 proprietary proprietary
FAM (Applied Biosystems) (Applied Biosystems) .beta.-actin Forward:
CAGGAGTACGATGAGTCCGGCCC- C VIC GTCCACCTTCCAGCAGATGTG (SEQ ID NO:24)
(SEQ ID NO:22) Reverse: CAGTCCGCCTAGAAGCACTTG (SEQ ID NO:23)
Example IV
[0154] Any compound of the present invention can be screened by an
imnnunoplot assay for the HIF-1.alpha. protein. HEK-293 cells are
treated with test compounds for 2 to 18 hrs and nuclear and
cytoplasmic extracts are made. Cells are lysed at 4 C in a lysis
buffer consisting of: 10 MM Tris HCl, pH 7.4, 10 mM NaCl, 3 mM
MgCl.sub.2, 0.5% Np-40, and containing protease inhibitors: 10 mM
NaF, 1 mM PMSF, 2 .mu.g/ml leupeptin, 2 .mu.g/ml pepstatin, 2 mM
sodium orthovanadate and crude cytoplasmic fractions were removed.
Nuclear pellets were extracted for 20 min at 4 C in 20 mM HEPES, pH
7.9, 1 mM EDTA 420 mM NaCl, and 20% glycerol with protease
inhibitors and the supernatants are collected following
centrifugation for 15 min at 10,000.times.g. Protein concentration
of extracts are measured using a BCA Assay Kit (Pierce, Rockford,
Ill.) and 10 .mu.g of each is run on a 10% acrylarnide Tris-glycine
gel (Novus Biologicals, Littleton Colo.), transferred to
nitrocellulose membranes and probed with a monoclonal antibody to
human HIF-1.alpha. (BD Transduction Labs, Lexington, Ky.).
Compounds for pharmaceutical use are selected based on an 140
kDalton protein recognized by the anti-HIF-1.alpha. antibody.
Example V
[0155] Any compound of the present invention can be screened by
measuring the amount of VEGF protein in cardiac tissue after
treatment. Sprague Dawley rats are treated with IV infusions of a
test compound for 6 to 12 hr. Animals are euthanized by
exsanguinations. Hearts are removed and frozen in liquid N.sub.2.
To extract VEGF, pieces of cardiac tissue are homogenized on ice in
10 mM Tris, 2 mM MgCl2, 150 mM NaCl. 1% riton X-100 and protease
inhibitors (Complete.TM. Proteinase Inhibitors, Boehringer
Manheim). Aliquots of the crude homogenate are sonicated and
centrifuged at 11,000.times.g for 10 min at 4.degree. C. The
supernates are analyzed for VEGF content using a ELISA kit (R&D
Systems). Total protein concentration of the crude homogenate is
also determiner using a BCA Assay kit (Pierce). Final VEGF levels
are expressed as a percentage of extractable VEGF per mg of
protein. Compounds for pharmaceutical use are selected based on
highest percentages.
Example VI
[0156] Any compound of the present invention can be screened by
measuring the amount of EPO in serum. After the compounds are
administered to Spraque-Dawley rats, blood is drawn and allowed to
clot in polypropylene tubes for 2 hrs at room temperature. Clotted
blood is precipitated by centrifugation and serum supernates are
collected and analyzed using an EPO-Trac.TM. .sup.125I
Radioimmunoassay Kit (Diasorin, Stillwater, Minn.) according to the
instruction protocol provided. Prior to analysis, serum samples are
diluted 1:4 or 1:8 in EPO-Trac standard buffer. Final values are
corrected to account for the dilution. Compounds for pharmaceutical
use are selected based on their ability to induce the highest
plasma EPO values.
[0157] It is contemplated that not only are the present examples
non-limiting, but also may be used in combination to select a
compound of the present invention to the desired therapeutic
goal(s) such as increasing vascularization of tissue in a subject.
To this end, a compound that is found to induce the VEGF-luciferase
reporter of Example I can be tested in the VEGF-ELISA assay of
Example II to determine if the compound stimulates VEGF protein
production from an endogenous VEGF gene. Further, the compound can
then be tested in the gene selectivity panel assay of Example III
to assess the specificity of the response. Further still, the
compound can be assessed in the immunoblot assay for HIF-1 of
Example IV to determine if the compound increases HIF-1. Further
even still, the compound can be further tested in vivo for its
ability to increase VEGF protein expression in rat tissue of
Example V or increase EPO protein levels in rat serum of Example
VI.
IX. EXAMPLES
Compositions and Methods of Use
[0158] The compounds of the invention are useful to prepare
compositions for the treatment of ailments associated with hypoxia.
The following composition and method examples do not limit the
invention, but provide guidance to the skilled artisan to prepare
and use the compounds, compositions and methods of the invention.
The skilled practitioner will appreciate that the examples may be
varied based on the condition being treated and the patient.
Example A
[0159] A tablet composition for oral administration, according to
the present invention, is made comprising:
3 Component Amount (mg per tablet) Compound of Example 3 5
Microcrystalline Cellulose 100 Sodium Starch Glycollate 30
Magnesium Stearate 3
[0160] When administered orally once daily, the above composition
substantially increases EPO in a subject suffering from anemia.
Example B
[0161] A capsule for oral administration, according to the present
invention, is made comprising:
4 Component Amount (% w/w) The compound of Example 14 15%
Polyethylene glycol 85%
[0162] wherein 1.5 grams of the compound is placed in a standard
gelatin capsule.
[0163] A human subject suffering from angina is treated by a method
of this invention. With a regimen of three capsules per day
administered orally to the subject, the patient's angina is
relieved. At the end of the treatment period, the subject is
examined and is found to have increased vascularization to the once
ischemic cardiac tissue.
Example C
[0164] A topical composition for local administration, according to
the present invention, is made comprising:
5 Component Composition (% w/v) The compound of Example 16 0.20
Benzalkonium chloride 0.02 Thimerosal 0.002 d-Sorbitol 5.00 Glycine
0.35 Sensates, including oil 0.075 of wintergreen Purified water
q.s. Total = 100.00
[0165] A diabetic subject suffering from a non-healing wound
applies the topical to the wound twice a day. After one month, the
wound is substantially healed.
[0166] While particular embodiments of the subject invention have
been described, it would be apparent to those skilled in the art
that various changes and modifications to the compositions
disclosed herein can be made without departing from the spirit and
scope of the invention. It is intended to cover, in the appended
claims, all such modifications that are within the scope of this
invention.
Sequence CWU 1
1
24 1 23 DNA Homo sapiens 1 accctggctt tactgctgta cct 23 2 22 DNA
Homo sapien 2 tgggacttct gctctccttc tg 22 3 22 DNA Homo sapien 3
accatgccaa gtggtcccag gc 22 4 28 DNA Homo sapien 4 gtagacagat
gttggtgcaa tacaagta 28 5 26 DNA Homo sapien 5 caatacctgt taccagcaca
gaaact 26 6 31 DNA Homo sapien 6 actacagtca aacatgcgct gtgagaagct g
31 7 25 DNA Homo sapien 7 gctcttgtga cagcaaagat aacaa 25 8 16 DNA
Homo sapien 8 ggtcgccccg acgttt 16 9 25 DNA Homo sapien 9
ccacgtggaa atcaacggga tcagc 25 10 20 DNA Homo sapien 10 tgcggtgtcc
aacacagatc 20 11 22 DNA Homo sapien 11 gcttcctcag tctgctcact ca 22
12 31 DNA Homo sapien 12 atggatttca agaacctgct agaccacctg g 31 13
18 DNA Homo sapien 13 gtgccaaggg cctgaatg 18 14 21 DNA Homo sapien
14 cacctaaagg gctgttgcaa a 21 15 24 DNA Homo sapien 15 cccagctcta
agggtgcccg tgaa 24 16 18 DNA Homo sapien 16 ggaggagagg gcggacat 18
17 23 DNA Homo sapien 17 agaggttatt cctcgtcgtg cat 23 18 20 DNA
Homo sapien 18 atgtcccggc tcttggcccg 20 19 19 DNA Homo sapien 19
tgcaccacca actgcttag 19 20 19 DNA Homo sapien 20 ggatgcaggg
atgatgttc 19 21 23 DNA Homo sapien 21 cagaagactg tggatggccc ctc 23
22 21 DNA Homo sapien 22 gtccaccttc cagcagatgt g 21 23 21 DNA Homo
sapien 23 cagtccgcct agaagcactt g 21 24 24 DNA Homo sapien 24
caggagtacg atgagtccgg cccc 24
* * * * *