U.S. patent application number 10/995812 was filed with the patent office on 2005-04-28 for high throughput methods for haplotyping.
This patent application is currently assigned to PolyGenyx, Inc.. Invention is credited to Landers, John E..
Application Number | 20050089920 10/995812 |
Document ID | / |
Family ID | 26889990 |
Filed Date | 2005-04-28 |
United States Patent
Application |
20050089920 |
Kind Code |
A1 |
Landers, John E. |
April 28, 2005 |
High throughput methods for haplotyping
Abstract
The invention relates to high throughput methods for determining
haplotypes. The high throughput methods are based on hybridization,
fluorescence detection, primer extension, MALDI TOF, and HPLC.
Inventors: |
Landers, John E.;
(Framingham, MA) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, PC
FEDERAL RESERVE PLAZA
600 ATLANTIC AVENUE
BOSTON
MA
02210-2211
US
|
Assignee: |
PolyGenyx, Inc.
Marlboro
MA
|
Family ID: |
26889990 |
Appl. No.: |
10/995812 |
Filed: |
November 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10995812 |
Nov 23, 2004 |
|
|
|
09823257 |
Mar 30, 2001 |
|
|
|
6844154 |
|
|
|
|
60194425 |
Apr 4, 2000 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6827 20130101;
C12Q 1/6818 20130101; C12Q 2565/501 20130101; C12Q 2535/131
20130101; C12Q 2565/101 20130101; C12Q 1/6827 20130101 |
Class at
Publication: |
435/006 |
International
Class: |
C12Q 001/68 |
Claims
I claim:
1-28. (canceled)
29. A method for haplotyping, comprising: analyzing a genotype of a
first SNP of a polymorphic locus of a nucleic acid within a sample
in solution by detecting the presence or absence of a first labeled
probe which specifically identifies a first putative allele of the
SNP and detecting the presence or absence of a second labeled probe
which specifically identifies a second putative allele of the SNP,
separating the nucleic acid sample based on the genotype of the
first SNP, analyzing a second SNP of the polymorphic locus of the
separated nucleic acid samples to identify the haplotype of the
nucleic acid.
30. The method of claim 29, wherein the analysis of the first SNP
is performed using fluorescence detection.
31. (canceled)
32. The method of claim 29, wherein the second SNP is analyzed
using a method selected from the group consisting of hybridization,
primer extension, MALDI TOF, and HPLC.
33. The method of claim 29, wherein the nucleic acid sample is
prepared by PCR amplification of a polymorphic locus from a genomic
DNA sample.
34. The method of claim 29, wherein the nucleic acid sample is a
reduced complexity genome.
35. The method of claim 29, wherein the second SNP is identified
using a capture reaction and wherein the nucleic acid is captured
by a method selected from the group consisting of OLA, primer
extension, and binding partner-ASO hybridization.
36. The method of claim 29, wherein the nucleic acid sample is an
RNA genome.
37. (canceled)
38. The method of claim 29, wherein the nucleic acid sample is
genomic DNA.
39. (canceled)
40. A method for haplotyping, comprising: labeling first and second
SNPs of a polymorphic locus of a nucleic acid within a sample in
solution with a first, second, third, and fourth labeled probe
which specifically identifies a first and second putative allele of
the first SNP and a first and second putative allele of the second
SNP respectively, separating the labeled nucleic acid sample into
single nucleic acid molecules, detecting the presence or absence of
the first, second, third, and fourth labeled probes on the single
nucleic acid molecules to identify the haplotype of the nucleic
acid.
41. The method of claim 40, wherein the probes are labeled with
fluorescence molecules.
42. (canceled)
43. (canceled)
44. The method of claim 40, wherein the nucleic acid sample is a
reduced complexity genome.
45. The method of claim 40, wherein the nucleic acid sample is an
RNA genome.
46. (canceled)
47. The method of claim 40, wherein the nucleic acid sample is
genomic DNA.
48. (canceled)
49. A method for haplotyping, comprising: performing four
hybridization reactions on a nucleic acid sample, each of the four
hybridization reactions involving one labeled probe specific for
one allele of one of two SNPs, each of the labeled probes labeled
with a spectrally distinct label and wherein each label on the
probe specific for a first of the two SNPs is a spectral pair with
the label on each probe specific for the second of the two SNPs,
bringing each of the labeled probes in each hybridization reaction
within energy transfer distance from one another, exciting one of
the labeled probes in each hybridization reaction, and detecting
electromagnetic radiation released from the other labeled probe as
a signal, wherein the presence or absence of a signal for each
hybridization reaction is an indicator of the haplotype of the
nucleic acid sample.
50. (canceled)
51. The method of claim 49, wherein the labeled probes are brought
within energy transfer proximity of one another using binding
partners.
52. (canceled)
53. The method of claim 49, wherein the labeled probes are labeled
ASOs.
54. (canceled)
55. (canceled)
56. The method of claim 49, wherein the nucleic acid sample is an
RNA genome.
57. (canceled)
58. The method of claim 49, wherein the nucleic acid sample is
genomic DNA.
59. (canceled)
60. A kit comprising: one or more containers housing: a first set
of ASOs, wherein the first set of ASOs represents two ASOs, each
containing one of the two alleles of a first SNP in a polymorphic
locus, a second set of ASOs, wherein the second set of ASOs
represents two ASOs, each containing one of the two alleles of a
second SNP in the polymorphic locus, and instructions for
performing a hybridization reaction to determine a haplotype from a
genomic DNA sample using the first and second sets of ASOs.
61. (canceled)
62. (canceled)
63. The kit of claim 60, wherein the spacer sequence is selected
from the group consisting of a poly-T, poly-A, poly-C, and
poly-G.
64. (canceled)
Description
RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. .sctn.119
to U.S. Provisional Patent Application No. 60/194,425, filed on
Apr. 4, 2000, the entire contents of which is hereby incorporated
by reference.
FIELD OF THE INVENTION
[0002] The invention relates to high throughput methods for single
nucleotide polymorphism (SNP) haplotyping. In particular, the
methods involve analysis of polymorphic loci of a nucleic acid
using techniques involving hybridization, primer extension, MALDI
TOF, HPLC, and/or fluorescence detection.
BACKGROUND OF THE INVENTION
[0003] In recent years, genetic alterations which cause or
contribute to many different diseases have been identified. A few
of the diseases associated with genetic alterations are genetically
simple and are associated with a single genetic alteration. Once
the genetic alteration associated with a genetically simple disease
is identified, characterization and diagnosis of the disease is
relatively simple. Most phenotypic traits and diseases, however,
are genetically complex. The genetic complexity can arise as a
result of the interaction or disruption of multiple genes,
incomplete penetrance, genetic heterogeneity, and/or
environmental/random causes (phenocopy). (Lander, E. S. and Schork,
N.J., Science, 265:2037-2048 (1994)). Mapping of complex traits or
diseases requires that the entire genome be scanned in order to
identify all genomic regions that potentially contribute to the
development of that trait or disease. In general, genome wide scans
are performed using polymorphic DNA markers to determine which
markers segregate with a complex trait of interest. The loci which
are identified as contributing to a disease can then be mapped to
specific genomic regions based on the known chromosomal locations
of the markers segregating with or "linked" to that trait.
[0004] Several types of DNA polymorphisms or markers occur in the
human genome and can be used in genome wide scans. These include
restriction fragment length polymorphisms (RFLPs), microsatellites
or simple sequence length polymorphisms (SSLPs), and single
nucleotide polymorphisms (SNPs).
[0005] RFLPs are single nucleotide changes (point changes or
insertion/deletion changes) which alter a restriction site and thus
the digestion pattern of a given segment of DNA. RFLPs were the
first type of polymorphism identified and were used as a tool to
construct early genetic linkage maps in humans. RFLPs are
unsuitable for a large scale analysis of populations, however,
because they are unreliable and not amenable to automation. RFLPs
are unreliable when used to analyze genetically-related
individuals, because RFLPs have only two alleles, one with the
restriction site and one without and related individuals generally
have the same allele on both chromosomes. Additionally, RFLPs are
not amenable to automation because RFLP detection requires the use
of Southern Blot techniques which are not easily automated.
[0006] Microsatellite markers or SSLPs are sequences that are
repeated in tandem, with the number of repeats resulting in
multiple alleles of different lengths. Microsatellite markers are
useful for identifying genes involved in traits which follow simple
Mendelian, monogenic patterns of inheritance. Microsatellites,
however, have proven to be unsuitable for studies involving traits
which follow non-Mendelian complex patterns of inheritance because
microsatellites are not optimally abundant, occurring only once
every few kilobases. Microsatellites also have a high mutation and
recombination rate which makes them genetically unstable.
Microsatellite markers are not amenable to high throughput analysis
because they can only be analyzed using PCR and gel-based assays,
which require a substantial investment in labor and time as well as
cost.
[0007] SNPs are single base pair positions in the genome at which
different sequence alternatives (alleles) exist in the population
at frequencies of greater than 1%. SNPs are extremely stable and
dense within the genome, but are not optimally informative because
they only identify a single loci, and thus have low statistical
power.
SUMMARY OF THE INVENTION
[0008] The invention relates to a high throughput method for
SNP-based haplotyping, which is capable of assessing multiple
alleles in large numbers of genomic samples. SNP haplotype analysis
is much more informative than single SNP loci analysis because it
enables the analysis of complex traits. Each haplotype segregates
as a contiguous set of alleles within families and consideration of
multiple closely-linked marker loci can provide a larger number of
alleles, each of low frequency. If a chromosomal region has
multiple polymorphic loci, none of which are individually very
informative, then haplotypes of these loci can be used to define a
new locus with a heterozygosity and informativeness significantly
beyond that of any single marker contained therein. The high
throughput method of SNP-haplotyping described and claimed herein
provides improved methods for SNP-haplotyping that can dramatically
increase the rate of haplotype analysis and enable large scale
haplotyping studies.
[0009] In one aspect the invention is a method for haplotyping. The
method involves analyzing a first polymorphic locus of a nucleic
acid within a sample by specifically capturing the nucleic acid on
a surface wherein the step of capturing the nucleic acid on the
surface identifies a first allele of a first SNP of the polymorphic
locus, repeating the analysis of the first polymorphic locus of the
nucleic acid to identify a second allele of the first SNP of the
polymorphic locus, separately analyzing a second SNP of a
polymorphic locus of the nucleic acid sample to identify both
alleles of the second SNP, and determining the haplotype based on
the identification of each allele of each SNP. The term
"separately" refers to analysis in discreet physical locations.
Although the first and second SNPs are analyzed separately, they
may be analyzed simultaneously. The different SNP alleles may also
be analyzed on the same surface (i.e. surface of a slide) as long
as they are analyzed on different spots or discreet locations of
the slide from one another.
[0010] In some embodiments the second SNP is analyzed using a
method selected from the group consisting of hybridization, primer
extension, MALDI TOF, and HPLC. In one preferred method the second
SNP is analyzed by hybridization of the nucleic acid sample with an
ASO complementary to a first allele of the second SNP and an ASO
complementary to a second allele of the second SNP.
[0011] In other embodiments the nucleic acid is captured by
hybridization with an ASO, and wherein the ASO is fixed to a
surface. Preferably a first ASO complementary to a first allele of
the first SNP and a second ASO complementary to a second allele of
the first SNP are hybridized to the surface and are used to capture
the nucleic acid.
[0012] In some embodiments each ASO corresponding to an allele of
the first SNP further includes a spacer sequence. Preferably the
spacer sequence is selected from the group consisting of a poly-T,
poly-A, poly-C, and poly-G.
[0013] In this embodiment each of the ASOs corresponding to an
allele of the second SNP may be hybridized independently to the
nucleic acid sample. Alternatively the alleles of the second SNP
are analyzed simultaneously with one another.
[0014] In preferred embodiments at least one of the ASOs
complementary to an allele of the first SNP and at least one of the
ASOs complementary to an allele of the second SNP contains a
fluorescent label or quencher, the fluorescent label or quencher of
the two ASOs, being distinct from one another.
[0015] The surface may be any type of solid support, such as, for
instance, a multiwell dish, a chip, a slide or a bead.
[0016] The nucleic acid sample may be prepared by any method known
in the art. For instance the nucleic acid may be prepared by PCR
amplification of a polymorphic locus from a genomic DNA sample.
Alternatively, the nucleic acid sample may be a reduced complexity
genome. In some embodiments the nucleic acid sample is labeled with
a first label.
[0017] According to other embodiments the presence of one set of
alleles at the polymorphic locus is associated with a disease and
the haplotyping method is performed to identify predisposition to
the disease.
[0018] The methods for haplotyping may also involve analysis of
more than two SNPs. In one embodiment a third SNP of a polymorphic
locus of the nucleic acid sample is analyzed to identify both
alleles of the third SNP, and the haplotype is determine based on
the identification of each allele of each SNP. In another
embodiment a fourth SNP of a polymorphic locus of the nucleic acid
sample is analyzed to identify both alleles of the fourth SNP, and
the haplotype is determine based on the identification of each
allele of each SNP. Many genes are known to have multiple SNPs, for
example the APOE gene has a reported 23 variable sites. Therefore
the haplotyping technology of the invention involves the analysis
of haplotypes containing multiple (i.e. >2) SNPs, e.g., using a
microarray-based haplotyping method that can determine the
haplotype for any number of SNPs with just two hybridizations.
[0019] The invention in other aspects relates to a method for
haplotyping by analyzing a genotype of a first SNP of a polymorphic
locus of a nucleic acid within a sample in solution by detecting
the presence or absence of a first labeled probe which specifically
identifies a first putative allele of the SNP and detecting the
presence or absence of a second labeled probe which specifically
identifies a second putative allele of the SNP, separating the
nucleic acid sample based on the genotype of the first SNP, and
analyzing a second SNP of the polymorphic locus of the separated
nucleic acid samples to identify the haplotype of the nucleic
acid.
[0020] In preferred embodiments the analysis of the first SNP is
performed using fluorescence detection and the nucleic acid sample
is separated using flow cytometry.
[0021] In other embodiments the second SNP is analyzed using a
method selected from the group consisting of hybridization, primer
extension, MALDI TOF, and HPLC.
[0022] According to another aspect of the invention a method for
haplotyping is provided. The method involves labeling first and
second SNPs of a polymorphic locus of a nucleic acid within a
sample in solution with a first, second, third, and fourth labeled
probe which specifically identifies a first and second putative
allele of the first SNP and a first and second putative allele of
the second SNP respectively, separating the labeled nucleic acid
sample into single nucleic acid molecules, detecting the presence
or absence of the first, second, third, and fourth labeled probes
on the single nucleic acid molecules to identify the haplotype of
the nucleic acid.
[0023] In one embodiment the probes are labeled with fluorescence
molecules and optionally each of the fluorescent molecules of the
labeled probes is spectrally distinct.
[0024] The invention in another aspect is a method for haplotyping
by performing four hybridization reactions on a nucleic acid
sample, each of the four hybridization reactions involving one
labeled probe specific for one allele of one of two SNPs, each of
the labeled probes labeled with a spectrally distinct label and
wherein each label on the probe specific for a first of the two
SNPs is a spectral pair with the label on each probe specific for
the second of the two SNPs, bringing each of the labeled probes in
each hybridization reaction within energy transfer distance from
one another, exciting one of the labeled probes in each
hybridization reaction, and detecting electromagnetic radiation
released from the other labeled probe as a signal, wherein the
presence or absence of a signal for each hybridization reaction is
an indicator of the haplotype of the nucleic acid sample. The
method can be performed in solution or on a surface.
[0025] In some embodiments each hybridization reaction is performed
in a separate vessel. In other embodiments the labeled probes are
brought within energy transfer proximity of one another using
binding partners, such as avidin and biotin. In yet other
embodiments the labeled probes are labeled ASOs.
[0026] A kit is provided according to other aspects of the
invention. The kit includes one or more containers housing: a first
set of ASOs, wherein the first set of ASOs represents two ASOs,
each containing one of the two alleles of a first SNP in a
polymorphic locus, a second set of ASOs, wherein the second set of
ASOs represents two ASOs, each containing one of the two alleles of
a second SNP in the polymorphic locus, and instructions for
performing a hybridization reaction to determine a haplotype from a
genomic DNA sample using the first and second sets of ASOs.
[0027] Optionally the kit may include a set of PCR primers for
amplifying the polymorphic locus of the genomic DNA sample.
[0028] In some embodiments the first set of ASOs are fixed to a
surface and the second set of ASOs are labeled.
[0029] In other embodiments the ASOs include a spacer and the
spacer sequence is selected from the group consisting of a poly-T,
poly-A, poly-C, and poly-G.
[0030] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combination of elements, can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 is a flow chart and diagram depicting an exemplary
method for performing high throughput SNP haplotyping analysis.
[0032] FIG. 2 is a diagram depicting an exemplary arrangement for
performing hybridization reactions to determine haplotype.
[0033] FIG. 3 is a diagram depicting each potential result
resulting from a double hybridization method for a single
chromosome at a polymorphic locus. There are four possible
haplotypes, each individually depicted in one of the four rows.
Columns A-D refer to the hybridization surfaces schematically
pictured in FIG. 2.
[0034] FIG. 4 is a diagram depicting examples of nucleic acid
samples labeled with different fluorescent labels, to exemplify the
single molecule detection methods.
[0035] FIG. 5 is a graph depicting data generated from the
haplotyping of 4 individuals (column sets 1-4). Haplotypes for each
individual are as follows: #1-homozygote A-G, #2-homozygote A-G,
#3-heterozygote G-G, A-G, #4-homozygote A-A.
[0036] FIG. 6 is a diagram depicting four graphs that generated
from the haplotyping of 4 individuals (graphs 1-4). Haplotypes for
each individual are as follows: #1--homozygote G-C,
#2--heterozygote G-T, G-C, #3-heterozygote G-C, C-C,
#4--heterozygote G-T, C-C.
BRIEF DESCRIPTION OF THE SEQUENCES
[0037] SEQ ID NO.1 is a PCR primer for
M13.sup.(For)-CCTCAGTGACATCCTTGCCT.
[0038] SEQ ID NO.2 is a PCR primer for M13
.sup.(Rev)CATGCCCATTCTTCTCTGGT.
[0039] SEQ ID NO.3 is a SNP1-(G detecting) oligo:
NH.sub.2-(T).sub.15AGTCT- CCC(C)TTTCCCT.
[0040] SEQ ID NO.4 is SNP1-(T detecting) oligo:
NH.sub.2-(T).sub.15AGTCTCC- C(A)CTTTCCCT.
[0041] SEQ ID NO.5 is SNP2-(C detecting) oligo:
AGGGTGGT(G)CCAGAGGT.
[0042] SEQ ID NO. 6 is SNP2-(T-detecting) oligo:
AGGGTGGT(A)CCAGAGGT.
[0043] SEQ ID NO:7 is a PCR forward primer:
[PO4]-ACTTGACAGCGAGTGTGCTG.
[0044] SEQ ID NO:8 is a PCR reverse primer: GTCCCTTTGCTGCGTGAC.
[0045] SEQ ID NO:9 is a BAR-G oligo:
NH.sub.2-(T).sub.23CACCCAATGGAAGCCAT.
[0046] SEQ ID NO:10 is a BAR-A oligo:
NH.sub.2-(T).sub.23CACCCAATAGAAGCCAT- .
[0047] SEQ ID NO: 11 is a BARPIIGcc oligo: AGGAAATCGGCAGCTGT.
[0048] SEQ ID NO:12 is a BARPIIAcc oligo: AGGAAATCAGCAGCTGT.
[0049] SEQ ID NO: 13 is a biotinylated BAR-PIIG oligo:
[Bio]-AGGAAATCGGCAGCTGT.
[0050] SEQ ID NO:14 is a biotinylated BAR-PIIA oligo:
[Bio]-AGGAAATCAGCAGCTGT.
[0051] SEQ ID NO: 15 is a PCR forward primer:
GAACAGCAATGCACATTACCATGG.
[0052] SEQ ID NO: 16 is a PCR reverse primer:
CTGTCAAGTATTTCTCCGCAGCATA.
[0053] SEQ ID NO:17 is an amine-labeled 4035AmC oligo:
[0054] NH.sub.2(T).sub.23GCCACAATGAATGACAT.
[0055] SEQ ID NO: 18 is an amine-labeled 4035AmC oligo:
[0056] NH.sub.2(T).sub.23GCCACAATCAATGACAT.
[0057] SEQ ID NO:19 is a 4035ColdCompG oligo:
ATGTCATTGATTGTGGC.
[0058] SEQ ID NO:20 is a 4035ColdCompC oligo:
ATGTCATTCATTGTGGC.
[0059] SEQ ID NO:21 is a biotinylated 4035-CB oligo:
Biotin-TGTATAATCAGAATTAT.
[0060] SEQ ID NO:22 is a biotinylated 4035-TB oligo:
Biotin-TGTATAATTAGAATTAT.
[0061] SEQ ID NO:23 is a cold competitive 4035-C oligo:
TGTATAATCAGAATTAT.
[0062] SEQ ID NO:24 is a cold competitive 4035-T oligo:
TGTATAATTAGAATTAT.
DETAILED DESCRIPTION
[0063] In recent years, certain diseases have been identified where
the occurrence of certain polymorphic haplotypes are associated
with either an increase in susceptibility for developing disease or
with differences in the onset progression and/or severity of the
disease. These diseases include, for example, multiple sclerosis
(Kalman, B. and Lublin, F. D., Biomed and Pharmacother., 53:358-370
(1999)), insulin-dependent diabetes mellitus (Deschammps, I. and
Khalil, I., Diabetes Metabol. Rev., 9:71-92 (1993)), and narcolepsy
(Billiard, M and Seignaled, J, Lancet, 1:226-227 (1985)). The
haplotypes associated with these disease susceptibility loci have
been identified using standard technology, such as RFLP or
microsatellite analysis. Alzheimer's Disease is one of the few
diseases where the predisposing haplotype is composed of commonly
inherited SNPs (Corder, E. H, et al., Science, 261:921-923 (1993)).
These SNPs occur in the epsilon allele of the apolipoprotein E
locus (APOE). In Alzheimer's Disease, approximately half of
late-onset familial and sporadic Alzheimer's Disease (i.e.,
development of disease by the age of 70 years) is associated with
inheriting the e4/e4 SNP haplotype. Individuals inheriting any
other combination of the e2, e3, or e4 alleles have a significantly
reduced risk of developing late-onset Alzheimer's Disease, with the
lowest risk for Alzheimer's Disease being associated with the e2/e3
haplotype. Additionally, the precise haplotype an individual
inherits can also predict the age of onset of disease from younger
than 70 years for the e4/e4 haplotype to greater than 90 years for
the e2/e3 haplotype, a more than 20 year shift in
susceptibility.
[0064] The invention involves the identification of high throughput
methods for screening DNA to identify polymorphic haplotypes and to
enable identification of haplotypes associated with predisposition
to these and other diseases as well as other genetically associated
traits. The high throughput method is based on the analysis of
SNPs. In one aspect the invention involves the use of a capture
step to analyze the SNPs.
[0065] Two types of SNP haplotyping methods have been described in
the prior art, the 3' mismatch PCR-SSP and SMD methods. 3' mismatch
PCR-sequence-specific primers (PCR-SSP) or allele-specific
amplification (ASA) is a PCR-based method which utilizes a primer
pair such that the 3' base on each primer represents one of the
SNPs within a SNP1/SNP2 haplotype. The primers are mixed with the
nucleic acid sample and allowed to anneal each to its respective
SNP within the nucleic acid sample and PCR is performed. If the
nucleic acid sample contains both SNP 1 and SNP2, a PCR product
will be produced and detected in a gel or hybridization method. If
the nucleic acid sample does not contain either or both SNP 1 or
SNP2, then no PCR product will be produced. By mixing different
sets of 3' mismatch primers, one can determine the haplotype of the
SNPs in the targeted genomic region by determining which primer set
results in a PCR product. One of the disadvantages of this method
is that it requires extensive methodology including optimization of
PCR conditions for every primer pair utilized and electrophoretic
analysis. These methods are not conducive to high throughput
analysis of haplotypes.
[0066] Single molecule dilution (SMD) is a method which involves
serial dilution of genomic DNA until an average of one molecule or
haploid equivalent of DNA per 5-10 aliquots is reached. After
dilution, a multi-step PCR reaction known as a booster PCR is
performed with each of the 5-10 aliquots. The PCR reactions are
analyzed by gel electrophoresis and then with dot blot
hybridization or direct sequencing to determine haplotypes. There
are many disadvantages associated with this technique, including
the many laborious steps which prevent high throughput screening,
the increased likelihood of shearing due to the dilution steps, and
sensitivity of the reaction to any DNA contamination.
[0067] In order for a marker to be effective in genetically
dissecting complex traits in genome wide scans, the marker should
be abundant, stable, informative, amenable to high throughput
analysis, have high scoring power, and be useful in linkage
disequilibrium analysis. The ability for a marker to be amenable to
high throughput analysis is very important. Due to the genetic
complexity with which most phenotypic traits and diseases arise,
genome wide scan analysis requires the genotyping of thousands of
individuals in order to achieve adequate statistical power. The
polymorphic markers used, thus, must be amenable to a high
throughput and cost efficient method of analysis in order to
analyze the extremely large numbers of samples required. The
SNP-based methods of the invention are high throughput, whereas the
3' mismatch PCR-SSP and SMD methods are not.
[0068] Scoring power is also important. Scoring power refers to the
degree of ease, accuracy and reliability with which a marker's
presence or absence can be determined in the genome that is being
analyzed. In order to genotype thousands of test genomes in a time
and cost efficient manner, the polymorphic marker must be easily
scored as either present or absent and this scoring must be
accurate and reliable without the need for secondary rounds of
testing. Neither RFLP marker analysis nor microsatellite marker
analysis for complex traits are amenable to high throughput
analysis or scoring power. The scoring power of microsatellite
markers is low, since the determination of whether a marker is
present or absent requires highly skilled labor for reading gels
because of the difficulty associated with distinguishing alleles at
each locus on gels. The SNP haplotyping methods of the invention
have high scoring power.
[0069] Linkage disequilibrium analysis is the preferential
association within populations of one allele of one locus with
another allele of another locus, at a frequency greater than that
expected by chance. (Brookes, A. J, Gene, 234:177-186 (1999)). If a
new polymorphic allele develops within a grouping of other
polymorphic alleles at other contiguous loci and is so closely
linked with these other alleles that recombination within that
region is very unlikely, then, as the disease allele becomes
replicated over time, all the alleles would be replicated together.
Thus, linkage disequilibrium would have been established between
the disease allele and the alleles within that grouping. This is
important because the existence of linkage disequilibrium between
polymorphic alleles would enable an allele of one polymorphic
marker to be used as a beacon to locate the specific allele of
another polymorphism. Linkage disequilibrium is a powerful tool
that is useful in locating genes involved in the development of a
complex trait. This tool can only be used, however, if the
polymorphic markers are extremely stable and not prone to
recombination events which would disrupt the DNA sequence of the
polymorphic marker and very dense such that a sufficient number of
markers will be found in a non-recombinatorial distance to the
complex trait alleles, thereby assuring their association. SNPs are
extremely stable and dense within the genome and thus have high
statistical power as polymorphic markers for linkage disequilibrium
studies.
[0070] The high throughput SNP haplotyping method of the invention
overcomes many of the problems with the prior art methods of
haplotyping. The methods of the invention which involve either
capture of specific SNPs and/or solution phase detection are
amenable to high throughput and allow the simultaneous
discrimination and haplotyping of multiple SNP loci for both
chromosomes of an individual. Methods can be performed on many
nucleic acid samples at a time, thus, providing massive quantities
of haplotype information, which is useful in characterizing complex
traits and diseases. Additionally, the methods provide fewer false
readings than some prior art methods.
[0071] In one aspect, the invention is a method for haplotyping,
which involves the specific capture of a nucleic acid on the
surface. The method involves analyzing a first polymorphic locus of
a nucleic acid within a sample by specifically capturing the
nucleic acid on a surface wherein the step of capturing the nucleic
acid on the surface identifies a first allele of a first SNP of the
polymorphic locus, repeating the analysis of the first polymorphic
locus of the nucleic acid to identify a second allele of the first
SNP of the polymorphic locus, analyzing a second SNP of a
polymorphic locus of the nucleic acid sample to identify both
alleles of the second SNP, and determining the haplotype based on
the identification of each allele of each SNP.
[0072] Haplotyping is a process of genetic analysis which involves
identifying genetic markers within a linked genetic region. The
term haplotype is derived from the phrase "haploid genotype" and
refers to the allelic constitution of a single chromosome or
chromosomal region at two or more loci. The term has developed two
variant uses in the field of human genetics. The first use of
haplotype refers to the arrangement of alleles along a given
section of a chromosome and is frequently used in association with
disease mappings and studies to identify which closely linked
polymorphic markers in a number of affected individuals are held in
common by descent from a common ancestor who possessed the founder
chromosome. The second use of the term haplotype refers to a small
genetic region within which recombination is very rare, such that
specific allelic combinations of polymorphic markers are seldom, if
ever, disrupted by meiotic recombination. As a result, linkage
disequilibrium exists and certain allelic recombinations will occur
in the population much more frequently than would be expected by
chance while other combinations will occur much less frequently.
The haplotype analysis described herein is consistent with the
second use of the term haplotype.
[0073] Thus the term "haplotype" as used herein, refers to an
ordered combination of alleles in a defined genetic region that
co-segregate. Such alleles are said to be "linked." The alleles of
the haplotype may be within a gene, between genes, or in adjacent
genes or chromosomal regions that co-segregate with high
fidelity.
[0074] The term "linkage" refers to the degree to which regions of
a nucleic acid are inherited together. DNA on different chromosomes
are inherited together 50% of the time and do not exhibit
linkage.
[0075] The term "linkage disequilibrium" refers to the
co-segregation of two alleles at a linked loci such that the
frequency of the co-segregation of the alleles is greater than
would be expected from separate frequencies of occurrence of each
allele.
[0076] In one method for SNP haplotyping, at least one of the two
polymorphic loci is analyzed using a capture step. A nucleic acid
within a sample is specifically captured on a surface in order to
identify the first allele of a first SNP of the polymorphic locus.
The nucleic acid can be captured by any method known in the art for
sequence-specific nucleic acid capture. For instance, an
allele-specific oligonucleotide (ASO) which is complementary to a
sequence spanning the first SNP of the polymorphic locus of the
nucleic acid may be attached to the surface then caused to interact
with the nucleic acid by a hybridization reaction. Alternatively,
any binding molecule, which is specific for the first SNP of the
polymorphic locus of the nucleic acid, may be used to bind and
interact with the nucleic acid to capture it on the surface.
Additionally, a binding molecule, such as an ASO, which is linked
to a first binding partner, such as streptavidin, may be allowed to
hybridize or interact with the first SNP region of the nucleic acid
within the sample to form a complex. This complex may then be
interacted with a surface containing a second binding partner, such
as biotin, attached thereto. Other methods for capturing a nucleic
acid in a sequence-specific manner will be apparent to those of
ordinary skill in the art. For instance primer extension,
oligonucleotide ligation assay (OLA) or a combination of binding
partner-ASO hybridization can be used.
[0077] Binding partner-ASO hybridization is a method which involves
a tag attached to an ASO which can specifically hybridize to a
nucleic acid. The tag is a binding partner which can specifically
bind to another molecule and thus capture the ASO or ASO/nucleic
acid complex. Binding partners include for instance biotin, avidin,
flourescein, anti-flourescein antibodies, other antigens and
antibodies, haptens, chemical groups which are capable of
specifically interacting with specific compounds, nucleic acids
that can specifically hybridize with nucleic acids attached to a
surface.
[0078] The capture step is carried-out for each of the two alleles
of the first SNP of the polymorphic locus of the nucleic acid in
the sample. The capture steps performed on the first and second
allele may be the same (i.e., both may involve allele-specific
hybridization of the nucleic acid sample to an ASO attached to a
surface) or different (i.e., analysis of the first allele may
involve allele-specific hybridization and capture of the second
allele may involve use of binding partners). It is important to
identify using a capture step both the first and second alleles of
the first SNP. Thus, it is important to determine the identity of
both alleles of the first SNP within the nucleic acid sample.
[0079] Once the first two alleles of the first SNP are identified,
both alleles of the second SNP are identified to determine the
haplotype. The alleles of the second SNP may be determined using
any methods known in the art for identifying SNPs. These methods
include, but are not limited to, hybridization, primer extension,
MALDI-TOF, HPLC, solution phase detection, and fluorescence
detection.
[0080] Methods for identifying alleles of a SNP using hybridization
include the methods described above. For instance, an ASO/nucleic
acid sample complex, which is hybridized to a surface as described
above, may be subjected to a second hybridization reaction to
detect the identity of the second SNP in the nucleic acid sample.
In this method, probes such as ASOs, which are complementary to
both potential alleles of the second SNP, can be separately
hybridized to the ASO/nucleic acid sample complex attached to the
surface to identify the presence of the second SNP. If the probe or
ASOs are labeled, the presence of the bound label can be detected
to determine the presence or absence of the hybridization
reaction.
[0081] Primer extension can also be used to identify the alleles of
the second SNP. Primer extension is performed by hybridizing
primers which flank but do not span the second SNP, performing a
primer extension reaction to produce a PCR product. The primers may
hybridize directly to the nucleic acid adjacent to the polymorphic
site or they may hybridize to a site which is some distance away.
It is possible to determine which allele is present in the nucleic
acid sample in one of several ways. For instance, if one possible
allele is a G at the polymorphic site then a labeled G can be added
to the primer extension mixture instead of an unlabeled G. In some
cases the labeled nucleotide is a dideoxynucleotide which will stop
the production of the strand being created. The label may be any
type of detectable label, e.g., a fluorescent label or a binding
partner, e.g., biotin.
[0082] MALDI-TOF (matrix-assisted laser desorption ionization time
of flight) mass spectrometry provides for the spectrometric
determination of the mass of poorly ionizing or easily-fragmented
analytes of low volatility by embedding them in a matrix of
light-absorbing material and measuring the weight of the molecule
as it is ionized and caused to fly by volatilization. Combinations
of electric and magnetic fields are applied on the sample to cause
the ionized material to move depending on the individual mass and
charge of the molecule. U.S. Pat. No. 6,043,031, issued to Koster
et al., describes an exemplary method for identifying single-base
mutations within DNA using MALDI-TOF and other methods of mass
spectrometry. Other methods are described in U.S. Pat. Nos.
6,002,127; 5,965,363; 5,905,259; 5,885,775; and 5,288,644, each of
which is incorporated by reference.
[0083] HPLC (high performance liquid chromatography) is used for
the analytical separation of bio-polymers, based on properties of
the bio-polymers. HPLC can be used to separate nucleic acid
sequences based on size and/or charge. A nucleic acid sequence
having one base pair difference from another nucleic acid can be
separated using HPLC. Thus, nucleic acid samples, which are
identical except for a single allele may be differentially
separated using HPLC, to identify the presence or absence of a
particular allele. Preferably the HPLC is dHPLC (denatured HPLC).
dHPLC involves the denaturation of the nucleic acid sample,
followed be a reannealing step where the nucleic acid can assume a
secondary structure, which will differ somewhat in nucleic acid
samples having different alleles.
[0084] In some embodiments, the ASO or other probes or binding
molecules is fixed to a surface. A surface, as used herein, refers
to any type of solid support material to which a molecular
component such as an ASO is capable of being fixed. Surfaces
include, for instance, single or multi-well dishes, chips, slides,
membranes, beads, agarose or other types of solid support
mediums.
[0085] The nucleic acid sample being analyzed is any type of
nucleic acid in which potential SNP-haplotypes exist. For instance,
the nucleic acid sample may be an isolated genome or a portion of
an isolated genome. An isolated genome consists of all of the DNA
material from a particular organism, i.e., the entire genome. A
portion of an isolated genome, which is referred to herein as a
reduced complexity genome (RCG), is a plurality of DNA fragments
within an isolated genome but which does not include the entire
genome. Genomic DNA comprises the entire genetic component of a
species excluding, applicable, mitochondrial and chloroplast DNA.
Of course, the methods of the invention can also be used to analyze
mitochondrial, chloroplast, etc., DNA as well. Depending on the
particular species of the subject being analyzed, the genomic DNA
can vary in complexity. For instance, species which are relatively
low on the evolutionary scale, such as bacteria, can have genomic
DNA, which is significantly less complex than species higher on the
evolutionary scale. Bacteria, such as E coli have approximately
2.4.times.10.sup.9 grams/mol of haploid genome, and bacterial
genomes having a size of less than about 5 million base pairs (5
megabases) are known. Genomes of intermediate complexity, such as
those of plants, for instance, rice, have a genome size of
approximately 700-1000 megabases. Genomes of highest complexity,
such as maize or humans, have a genome size of approximately
10.sup.9-10.sup.11. Humans have approximately 7.4.times.10.sup.12
grams/mol of haploid genome.
[0086] The methods of the invention are useful for identifying
haplotype information in subjects. A subject, as used herein,
refers to any type of DNA-containing organism, and includes, for
example, bacteria, virus, fungi, animals, including vertebrates,
and invertebrates, and plants.
[0087] A "RCG" as used herein is a reproducible fraction of an
isolated genome which is composed of a plurality of DNA fragments.
The RCG can be composed of random or non-random segments or
arbitrary or non-arbitrary segments. The term "reproducible
fraction" refers to a portion of the genome which encompasses less
than the entire native genome. If a reproducible fraction is
produced twice or more using the same experimental conditions the
fractions produced in each repetition include at least 50% of the
same sequences. In some embodiments the fractions include at least
70%, 80%, 90%, 95%, 97%, or 99% of the same sequences, depending on
how the fractions are produced. For instance, if a RCG is produced
by PCR another RCG can be generated under identical experimental
conditions having at a minimum greater than 90% of the sequences in
the first RCG. Other methods for preparing a RCG such as size
selection are still considered to be reproducible but often produce
less than 99% of the same sequences.
[0088] A "plurality" of elements, as used throughout the
application refers to 2 or more of the element. A "DNA fragment" is
a polynucleotide sequence obtained from a genome at any point along
the genome and encompassing any sequence of nucleotides. The DNA
fragments of the invention can be generated according to any one of
two types mechanisms, and thus there are two types of RCGs,
PCR-generated RCGs and native RCGs.
[0089] The nucleic acid sample may be prepared using conventional
PCR amplification of a polymorphic locus from a genomic DNA sample
using known primers. Alternatively PCR-generated RCGs are randomly
primed. That is, each of the polynucleotide fragments in the
PCR-generated RCG all have common sequences at or near the 5' and
3' end of the fragment (When a tag is used in the primer, all of
the 5' and 3' ends are identical. When a tag is not used the 5' and
3`ends have a series of N`s followed by the TARGET sequence
(reading in a 5' to 3' direction). The TARGET sequence is identical
in each primer, with the exception of multiple-primed DOP-PCR) but
the remaining nucleotides within the fragments do not have any
sequence relation to one another. Thus, each polynucleotide
fragment in a RCG includes a common 5' and 3' sequence which is
determined by the constant region of the primer used to generate
the RCG. For instance, if the RCG is generated using DOP-PCR
(described in more detail below) each polynucleotide fragment would
have near the 5' or 3' end nucleotides that are determined by the
"TARGET nucleotide sequence". The TARGET nucleotide sequence is a
sequence which is selected arbitrarily but which is constant within
a set or subset (e.g. multiple primed DOP-PCR) of primers. Thus,
each polynucleotide fragment can have the same nucleotide sequence
near the 5' and 3' end arising from the same TARGET nucleotide
sequence. In some cases more than one primer can be used to
generate the RCG. When more than one primer is used, each member of
the RCG would have a 5' and 3' end in common with at least one
other member of the RCG and, more preferably, each member of the
RCG would have a 5' and 3' end in common with at least 5% of the
other members of the RCG. For example, if a RCG is prepared using
DOP-PCR with 2 different primers having different TARGET nucleotide
sequences, a population containing of four sets of PCR products
having common ends could be generated. One set of PCR products
could be generated having the TARGET nucleotide sequence of the
first primer at or near both the 5' and 3' ends and another set
could be generated having the TARGET nucleotide sequence of the
second primer at or near both the 5' and 3' ends. Another set of
PCR products could be generated having the TARGET nucleotide
sequence of the second primer at or near the 5' end and the TARGET
nucleotide sequence of the first primer at or near the 3' end. A
fourth set of PCR products could be generated having the TARGET
nucleotide sequence of the second primer at or near the 3' end and
the TARGET nucleotide sequence of the first primer at or near the
5' end. The PCR generated genomes are composed of synthetic DNA
fragments.
[0090] The DNA fragments of the native RCGs have arbitrary
sequences. That is, each of the polynucleotide fragments in the
native RCG do not have necessarily any sequence relation to another
fragment of the same RCG. These sequences are selected based on
other properties, such as size or, secondary characteristics. These
sequences are referred to as native RCGs because they are prepared
from native nucleic acid preparations rather than being
synthesized. Thus they are native-non-synthetic DNA fragments. The
fragments of the native RCG may share some sequence relation to one
another (e.g. if produced by restriction enzymes). In some
embodiments they do not share any sequence relation to one
another.
[0091] In some preferred embodiments, the RCG includes a plurality
of DNA fragments ranging in size from approximately 200 to 2,000
nucleotide residues. In a preferred embodiment, a RCG includes from
95 to 0.05% of the intact native genome. The fraction of the
isolated genome which is present in the RCG of the invention
represents at most 90% of the isolated genome, and in preferred
embodiments, contains less than 50%, 40%, 30%, 20%, 10%, 5%, or 1%
of the genome. A RCG preferably includes between 0.05 and 1% of the
intact native genome. In a preferred embodiment, the RCG
encompasses 10% or less of an intact native genome of a complex
organism.
[0092] Several methods can be used to generate PCR-generated RCG
including IRS-PCR, AP-PCR, DOP-PCR, multiple primed PCR,
adaptor-PCR and multiple-primed-DOP-PCR. Hybridization conditions
for particular PCR methods are selected in the context of the
primer type and primer length to produce to yield a set of DNA
fragments which is a percentage of the genome, as defined above.
PCR methods have been described in many references, see e.g., U.S.
Pat. Nos. 5,104,792; 5,106,727; 5,043,272; 5,487,985; 5,597,694;
5,731,171; 5,599,674; and 5,789,168. Basic PCR methods have been
described in e.g., Saiki et al., Science, 230: 1350 (1985) and U.S.
Pat. Nos. 4,683,195, 4,683,202 (both issued Jul. 18, 1987) and U.S.
Pat. No. 4,800,159 (issued Jan. 24, 1989).
[0093] Another method for generating RCGs is based on the
development of native RCGs. Several methods can be used to generate
native RCGs, including DNA fragment size selection, isolating a
fraction of DNA from a sample which has been denatured and
reannealed, pH-separation, separation based on secondary structure,
etc.
[0094] Size selection can be used to generate a RCG by separating
polynucleotides in a genome into different fractions wherein each
fraction contains polynucleotides of an approximately equal size.
One or more fractions can be selected and used as the RCG. The
number of fractions selected will depend on the method used to
fragment the genome and to fractionate the pieces of the genome, as
well as the total number of fractions. In order to increase the
complexity of the RCG, more fractions are selected. One method of
generating a RCG involves fragmenting a genome into arbitrarily
size pieces and separating the pieces on a gel (or by HPLC or
another size fractionation method). A portion of the gel is
excised, and DNA fragments contained in the portion are isolated.
Typically, restriction enzymes can be used to produce DNA fragments
in a reproducible manner.
[0095] Different nucleic acid sources may be used to generate RCGs.
For instance, mitochondrial DNA can be isolated and used as the
source of the RCG.
[0096] Separation based on secondary structure can be accomplished
in a manner similar to size selection. Different fractions of a
genome having secondary structure can be separated on a gel. One or
more fractions are excised from the gel, and DNA fragments are
isolated therefrom.
[0097] Another method for creating a native RCG involves isolating
a fraction of DNA from a sample which has been denatured and
reannealed. A genomic DNA sample is denatured, and denatured
nucleic acid molecules are allowed to reanneal under selected
conditions. Some conditions allow more of the DNA to be reannealed
than other conditions. These conditions are well known to those of
ordinary skill in the art. Either the reannealed or the remaining
denatured fractions can be isolated. It is desirable to select the
smaller of these two fractions in order to generate RCG. The
reannealing conditions used in the particular reaction determine
which fraction is the smaller fraction. Variations of this method
can also be used to generate RCGs. For instance, once a portion of
the fraction is allowed to reanneal, the double stranded DNA may be
removed (e.g., using column chromatography), the remaining DNA can
then be allowed to partially reanneal, and the reannealed fraction
can be isolated and used. This variation is particularly useful for
removing repetitive elements of the DNA, which rapidly
reanneal.
[0098] The amount of isolated genome used in the method of
preparing RCGs will vary, depending on the complexity of the
initial isolated genome. Genomes of low complexity, such as
bacterial genomes having a size of less than about 5 million base
pairs (5 megabases), usually are used in an amount from
approximately 10 picograms to about 250 nanograms. A more preferred
range is from 30 picograms to about 7.5 nanograms, and even more
preferably, about 1 nanogram. Genomes of intermediate complexity,
such as plants (for instance, rice, having a genome size of
approximately 700-1,000 megabases) can be used in a range of from
approximately 0.5 nanograms to 250 nanograms. More preferably, the
amount is between 1 nanogram and 50 nanograms. Genomes of highest
complexity (such as maize or humans, having a genome size of
approximately 3,000 megabases) can be used in an amount from
approximately 1 nanogram to 250 nanograms (e.g. for PCR).
[0099] In other aspects of the invention, the nucleic acid sample
can be an entire or a portion of an RNA genome. RNA genomes differ
from DNA genomes in that they are generated from RNA rather than
from DNA. An RNA genome can be, for instance, a cDNA preparation
made by reverse transcription of RNA obtained from cells of a
subject (e.g. human ovarian carcinoma cells). Thus, an RNA genome
can be composed of DNA sequences, as long as the DNA is derived
from RNA. RNA samples can also be used directly.
[0100] Each of the types of nucleic acid samples set forth herein
is described in more detail in co-pending U.S. patent application
Ser. No. 09/404,912, filed on Sep. 24, 1999, which is hereby
incorporated by reference.
[0101] The methods of the invention involve analysis of at least
two SNPs to identify the haplotype. The two SNPs are referred to as
SNP1 or the first SNP and SNP2 or the second SNP. The reference to
a first or second SNP does not provide an indication of the order
of the SNPs on the nucleic acid. A "single nucleotide polymorphism"
or "SNP" as used herein is a single base pair (i.e., a pair of
complementary nucleotide residues on opposite genomic strands)
within a DNA region wherein the identities of the paired nucleotide
residues vary from individual to individual. At the variable base
pair (alleles) in the SNP, two or more alternative base pairings
can occur at a relatively high frequency in a subject, (e.g. human)
population.
[0102] A "polymorphic region" is a region or segment of DNA the
nucleotide sequence of which varies from individual to individual.
The two DNA strands which are complementary to one another except
at the variable positions are referred to as alleles. A
polymorphism is allelic because some members of a species have one
allele and other members have a variant allele and some have both.
When only one variant sequence exists, a polymorphism is referred
to as a diallelic polymorphism. There are three possible genotypes
in a diallelic polymorphic DNA in a diploid organism. These three
genotypes arise because it is possible that a diploid individual's
DNA may be homozygous for one allele, homozygous for the other
allele, or heterozygous (i.e. having one copy of each allele). When
other mutations are present, it is possible to have triallelic or
higher order polymorphisms. These multiple mutation polymorphisms
produce more complicated genotypes.
[0103] A "polymorphic locus", as used herein, refers to a region of
a nucleic acid that includes more than one single nucleotide
polymorphism.
[0104] In one embodiment, the method for haplotyping involves a
bi-phasic allele-specific oligonucleotide hybridization technology.
Briefly, the method is carried out as shown in FIG. 1 for a
haplotype consisting of two SNP loci. During the first phase of the
method, a SNP1 allele-specific oligonucleotide (ASO) is synthesized
and attached to a surface. A nucleic acid sample is then prepared
using a method such as amplification of a genome to produce a
nucleic acid sample containing the polymorphic locus. Optionally,
the nucleic acid sample can be labeled. The sample is then allowed
to hybridize to the SNP1 ASO coated on the surface to produce a
SNP1/nucleic acid sample complex. Excess is removed. In Phase 2 a
SNP2 ASO, which is labeled is synthesized and allowed to hybridize
to the SNP 1 ASO/nucleic acid sample complex. The entire surface is
then scanned and the haplotype can be scored. The SNP 1 ASO is
actually a set of ASO which includes two allele-specific
oligonucleotides corresponding to an anti-sense version of each
allele of two SNPs of a polymorphic locus. The second set of ASOs
corresponds to the second SNP(SNP2) of the polymorphic locus. In
the method, the nucleic acid sample will only hybridize to the ASO
of the first set of ASOs, which is anti-sense to the allele of the
first SNP in the genomic sample. Likewise, only the ASO of the
second set of ASOs, which is anti-sense to the allele of the second
SNP present in the nucleic acid sample, will hybridize. These
haplotyping methods for identifying 2 SNPs generally involve the
analysis of 4 wells. If a subject is homozygous, analysis of their
DNA will result in a signal in one well. If a subject is
heterozygous, analysis of their DNA will result in a signal in two
wells.
[0105] In general, the high throughput SNP haplotyping methods of
the invention are useful in linkage disequilibrium studies for the
analysis of complex traits to localized genes involved in diseases
such as diabetes, multiple sclerosis, and asthma; diagnostic
analysis to determine the presence or absence of a predisposing
disease haplotype or other trait; pharmacogenomic analysis to
identify haplotypes that correlate with either positive or negative
responses to drugs and development; genome-wide scan studies for
complex trait analysis using SNP haplotypes, instead of single
SNPs, to increase the statistical power; etc.
[0106] Deletions, multiplications, or substitutions in genes can
result in genetic disease. Most of these deletions,
multiplications, or substitutions, causing multiple alleles,
produce indistinguishable or distinguishable "normal" phenotypes.
For instance, multiple alleles produce variable characteristics
like eye color. Some genetic alterations, however, are associated
with clinical disease like sickle cell anemia. The haplotyping
methods of the invention are useful for identifying both normal
phenotypes and disease phenotypes. Thus, the methods for the
invention are useful for identifying traits such as eye color as
well as for diagnostics to determine presence or absence of
predisposing disease haplotype in a subject. Some diseases which
are known to have a genetic element include colon cancer, breast
cancer, cystic fibrosis, neurofibromatosis type 2, LiFraumeni
disease, VonHippel-Lindau disease, thalassemia, ornithine,
transcarbamylase deficiency,
hypoxanthine-guanine-phosphoribosyl-transferase deficiency,
phenylketonuria, etc.
[0107] Another recently identified phenomenon is that the
inheritance of varying haplotypes within the same gene can alter a
disease phenotype altogether. This is exemplified by polymorphic
mutations in the prion gene, PrP. (Goldfarb, L. G. and Petersen, R.
B., Science, 258:806-808 (1992)). Individuals that inherit a SNP
polymorphism at codon 178 of the PRP gene, will develop a
Creutzfeldt-Jakob disease. If the individual also inherits a
concomitant SNP polymorphism at codon 129 of the PRP gene, then
that individual will develop a fatal familial insomnia instead.
Therefore, the precise haplotype inherited can change the effect of
the mutations involved, resulting in distinctly different
phenotypic diseases. The methods of the invention are useful for
making these types of distinctions.
[0108] Identification of haplotypes associated with phenotypic
traits is useful for many purposes in addition to identifying
predisposition to disease. For example, identification of a
correlation between susceptibility to a particular drug or a
therapeutic treatment and specific genetic alterations is
particularly useful for tailoring therapeutic treatments to a
specific individual. The methods are also useful in prenatal
screening to identify whether a fetus is afflicted with or is
predisposed to develop a serious disease. Additionally, this type
of information is useful for screening animals or plants bred for
the purposes of enhancing or exhibiting desired
characteristics.
[0109] Other methods for high throughput haplotyping, according to
the invention, involve the identification of SNPs in solution. In
one aspect the invention is a method for haplotyping by analyzing a
genotype of a first SNP of a polymorphic locus of a nucleic acid
within a sample in solution by detecting the presence or absence of
a first labeled probe which specifically identifies a first
putative allele of the SNP and detecting the presence or absence of
a second labeled probe which specifically identifies a second
putative allele of the SNP, separating the nucleic acid sample
based on the genotype of the first SNP, and analyzing a second SNP
of the polymorphic locus of the separated nucleic acid samples to
identify the haplotype of the nucleic acid.
[0110] The first and second allele of the first SNP of the
polymorphic locus are detected in solution using labeled probes.
The labeled probes are any type of molecule which specifically
binds to one allele of the SNP and not the other and which include
a detectable label. The molecule which specifically interacts with
one of the two alleles can be any type of molecule, for instance,
it may be a DNA-specific binding protein or an ASO complementary to
the allele containing DNA. A label may be a light-emissive label,
radioactive label, etc. Light-emissive labels can be added to the
molecule or may be naturally-occurring within the molecule. For
instance, some bases of a nucleotide are naturally-occurring
light-emissive labels. In the case when a naturally-occurring
light-emissive label is used, an extrinsic label does not need to
be added to the molecule. Light-emissive labels, which can be added
to molecules include fluorophors and quenchers, light-scattering
particles (such as gold particles which scatter light), etc.
Radioactive labels include, but are not limited to, .sup.3H,
.sup.32P, and .sup.35S. The use of each of these types of labels is
well-known to those of ordinary skill in the art.
[0111] Once the first SNP has been identified using a labeled
probe, the nucleic acid sample is separated such that the DNA
molecules containing the first allele are in a separate container
from the DNA samples containing the second allele. One method for
accomplishing this separation is through the use of flow cytometry
e.g., using a fluorescence-activated cell sorter (FACS). Flow
cytometry analysis involves the separation of single molecules
based on the presence of a particular fluorescence marker. Thus, a
nucleic acid molecule which includes a labeled probe that emits in
the red light wavelength will be separated from the nucleic acid
molecules hybridized to a labeled probe which emits light in the
green wavelength. Once the two samples are separated, each can be
separately analyzed to identify the presence or absence of an
allele at the second SNP. Other methods for separating the nucleic
acid samples based on the allele present in the sample, include but
are not limited to (1) the use of an ASO attached to different size
beads which can be separated by size, affinity, or weight, and (2)
the use of tags such as binding partners which can be separated
based on their specific binding interactions.
[0112] In other aspects, the invention involves solution phase
analysis that utilizes four labeled probes, each specific for an
allele of the two SNPS. In this analysis, the labeled probes are
allowed to interact with the nucleic acid sample to form complexes.
The labeled complexes are then separated such that each nucleic
acid complex is separate from one another. Thus, this analysis is
based on single molecule detection strategies. Each individual
nucleic acid is separated from other nucleic acid molecules. The
separate nucleic acid molecules are then detected for the presence
or absence of each of the four labeled probes.
[0113] The method can be accomplished, for example, as shown in the
schematic diagram of FIG. 4. In the figure, it is shown that each
single nucleic acid sample, which has been separated, includes two
of the four labeled probes, one specific for a first allele of the
first SNP and the other specific for an allele of the second SNP.
In the examples shown, the first labeled probe includes a label
which is stimulated in the red wavelength of light to produce a
signal detected in the green wavelength. The second labeled probe
is capable of detecting light in the orange wavelength and emitting
light in the yellow wavelength. The single molecule, when subjected
to light within the red wavelength spectrum, will emit green light
that can be detected. Likewise, the sample, when exposed to light
within the orange wavelength, will emit yellow light. Thus, if the
sample, when exposed to red and orange light, emits green and
yellow, this is indicative that the first and third labeled probes,
specifically identifying the first allele of the first SNP and the
first allele of the second SNP are present. Alternatively, when
light of red and orange wavelengths are used to stimulate the
sample and blue and red light wavelengths are emitted, this is
indicative that the second and fourth labeled probes have bound to
the nucleic acid sample, thus identifying the presence of the
second allele of the first SNP and the second allele of the second
SNP. Other combinations would be indicative of other haplotypes
which are possible in this two SNP system. Other combinations of
labels can be used. For instance, each of the 4 labeled probes can
be labeled with a molecule that is stimulated in one wavelength of
light, e.g., red, as long as each labeled probe emits in a
different spectrum (or one may quench). Alternatively, each of the
4 labeled probes can be labeled with a molecule that is stimulated
by distinct wavelengths of light, but all can emit in the same or
different spectrums.
[0114] In some preferred embodiments fluorescence detection of
single molecules is used to identify the components of the
polymorphic locus. A fluorescent label or fluorophore is a
substance which is capable of exhibiting fluorescence within a
detectable range. Fluorophores include, but are not limited to,
fluorescein, isothiocyanate, fluorescein amine, eosin, rhodamine,
dansyl, umbelliferone, 5-carboxyfluorescein (FAM),
2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), rhodamine,
6 carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine
(TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'-dimethylaminophenylazo)
benzoic acid (DABCYL), 5-(2'-aminoethyl)
aminonaphthalene-1-sulfonic acid (EDANS),
4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid,
acridine, acridine isothiocyanate,
r-amino-N->3-vinylsulfonyl)phenyl!naphthalimi- de-3,5,
disulfonate (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide-
, anthranilamide, Brilliant Yellow, coumarin,
7-amino-4-methylcoumarin, 7-amino-4-trifluoromethylcouluarin
(Coumaran 151), cyanosine, 4', 6-diaminidino-2-phenylindole (DAPI),
5',5"-diaminidino-2-phenylindole (DAPI),
5',5"-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red),
7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin
diethylenetriamine pentaacetate,
4,4'-diisothiocyanatodihydro-stilbene-2,- 2'-disulfonic acid,
4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid,
4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC), eosin
isothiocyanate, erythrosin B, erythrosin isothiocyanate, ethidium,
5-(4,6-dichlorotriazin-2-yl) aminofluorescein (DTAF), QFITC
(XRITC), fluorescamine, IR144, IR1446, Malachite Green
isothiocyanate, 4-methylumbelliferone, ortho cresolphthalein,
nitrotyrosine, pararosaniline, Phenol Red, B-phycoerythrin,
o-phthaldialdehyde, pyrene, pyrene butyrate, succinimidyl 1-pyrene
butyrate, Reactive Red 4 (Cibacron. RTM. Brilliant Red 3B-A),
lissamine rhodamine B sulfonyl chloride, rhodamine B, rhodamine
123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine
101, sulfonyl chloride derivative of sulforhodamine 101, (Texas
Red), tetramethyl rhodamine, tetramethyl rhodamine isothiocyanate
(TRITC), riboflavin, rosolic acid, and terbium chelate
derivatives.
[0115] Fluorescence is measured using a fluorometer. The optical
emission from the fluorescence molecule can be detected by the
fluorometer and processed as a signal. When fluorescence is being
measured in a sample fixed to various portions of the surface, the
surface can be moved using a multi-access translation stage in
order to position the different areas of the surface, such that the
signal can be collected. Many types of flourometers have been
developed. For instance, a new sensitive instrument for measuring
FRET is described in U.S. Pat. No. 5,911,952.
[0116] In other aspects the invention is a method for haplotyping
which is accomplished by performing four hybridization reactions on
a nucleic acid sample, each of the four hybridization reactions
involving one ASO specific for one allele of one of two SNPs, each
of the ASOs labeled with a spectrally distinct label and wherein
each label on the ASO specific for a first of the two SNPs is a
spectral pair with the label on each ASO specific for the second of
the two SNPs, bringing each of the labeled ASOs in each
hybridization reaction within energy transfer distance from one
another, exciting one of the labeled ASOs in each hybridization
reaction, and detecting light released from the other labeled ASO
as a signal, wherein the presence or absence of a signal for each
hybridization reaction is an indicator of the haplotype of the
nucleic acid sample.
[0117] A process referred to as a molecular beacon for nucleic acid
detection has previously been described. The method involves the
use of a probe which is in the form of a stem loop structure, such
that the 3' and 5' ends of the nucleic acid probe are adjacent one
another in the stem section. The 5' and 3' ends are labeled with a
donor fluorophore and a quencher. When this probe encounters a
complementary nucleic acid within the sample, the secondary
structure stem loop is destabilized and the 5' and 3' ends are
moved away from one another. This causes the fluorescent group to
emit light which is no longer quenched and thus an increase in
fluorescence emission occurs. (Discussed in U.S. Pat. No.
5,989,823). This type of analysis has been used in the detection of
alleles within a nucleic acid sample. (Kostrikis, et al., Science,
279:1228-1229 (1998) and Tyagi, et al. (1998), Nature Biotechnology
16:49-53)).
[0118] This method is similar to the methods of the invention,
except that binding partners are used to bring the fluorophores
within proximity of one another. Binding partners are two molecules
which specifically interact with one another when brought into
proximity with one another. Many types of binding partners are
known in the art. Some well known examples of a binding partners
are biotin and avidin or streptavidin, as well as antibody and
antigen. These binding partners are used to bring the regions of
the nucleic acid housing the two SNPs within proximity of one
another. For instance, the first SNP may be labeled with an ASO
which is conjugated to biotin. The second SNP may be hybridized
with an ASO which is conjugates to avidin. Either the biotin or the
avidin may contain fluorophores, which when brought within
proximity of one another, will produce a signal or the ASO may
contain the fluorophore label which would be brought in proximity
with the other fluorophore label when the biotin and avidin
interact.
[0119] Streptavidin and biotin labeled with various fluorophores
are commercially available from several sources including Molecule
Probes (Eugene, Oreg.), Intergen (Purchase, N.Y.) and NEN (Boston,
Mass.).
[0120] Fluorescence resonance energy transfer (FRET) is the
transfer of electronic excitation energy by the Forster mechanism.
FRET is useful for measuring the distance between a pair of
fluorophores (donor and acceptor) which are in a range of 10-80
angstroms from one another. FRET has previously been used to study
the hybridization of complementary oligodeoxynucleotides (Cardullo
et al., PNAS, USA, 85:8790-8794 (1988)), and various other binding
assays.
[0121] FRET arises from certain fluorophores which when excited by
exposure to a particular wavelength of light will emit light at a
different wavelength. A donor fluorophore absorbs a photon of
energy and transfers this energy non-radiatively to the acceptor
fluorophore. When the excitation and emission spectra of two
fluorophores which are brought within close proximity of one
another overlap, the excitation of one fluorophore will cause it to
emit light at a wavelength that is absorbed and that can stimulate
the second fluorophore causing it to fluoresce. During this
process, the fluorescence of the donor molecule is quenched and
fluorescence intensity of the acceptor molecule is enhanced. If the
donor is in proximity with a fluorophore which is a non-acceptor
(referred to as a quencher), the fluorescence of the donor is still
quenched but there is no subsequent emission of fluorescence by the
second fluorophore, or quencher. Thus, there is no emission of
light.
[0122] When selecting fluorophores for FRET analysis several
parameters can be considered. U.S. Pat. No. 4,996,143 describes
some of the parameters that should be considered when designing
fluorescent probes, such as the spacing of the fluorescent moieties
and the length of the portion of the molecule which connects the
fluorescent moiety to the base unit of the nucleic acid. In order
for FRET to occur, the donor and acceptor molecules should be
within 100 angstroms of one another. When attached to nucleic
acids, preferably, the donor and acceptor fluorophores are within 1
to 20 base pairs of one another for FRET analysis. Additionally,
when performing FRET analysis flourophores which are spectral pairs
should be used. Two fluorophores are spectral pairs when one of the
two fluorophores emits light at a wavelength which either causes
the other fluorophore to emit light of a different wavelength or to
quench the light emitted by the first fluorophore without producing
additional light. For instance FAM is excited by light with a
wave-length of approximately 488 nm and emits light with a spectrum
of 500-650 nm. Thus, FAM is a suitable donor fluorophore for use
with JOE, TAMRA and ROX, all of which have an excitation maximum of
514 nm and a spectral pair is formed when FAM is matched with
either JOE, TAMRA or ROX. Appropriate spectral pairs among the
known flourophores are well known to those of ordinary skill in the
art.
EXAMPLES
Example 1
Haplotype Analysis of Multiple Individuals Using a Double
Hybridization Method
[0123] Two single nucleotide polymorphisms (spaced 212 nucleotides
apart) commonly occur in the dopamine D.sub.2 receptor gene. SNP1
is a T to G transversion at nucleotide 3208 and SNP2 is a C to T
transition at nucleotide 3420 (Sarkar, G., et al., Genomics,
11:8-14 (1991)).
[0124] These polymorphisms were shown to be common in all races
examined, with allele frequencies ranging from 39% to 49% (Sarkar,
G., et al., Genomics, 11:8-14 (1991)). This system has been
previously used to demonstrate the 3' mismatch PCR-SSP haplotyping
technique (Sarkar, G., et al., Biotechniques, 10:437-440 (1991)).
This system is also ideal for demonstrating the efficacy of the
SNP-Haplotyping Method of the invention for the following
reasons:
[0125] 1. These polymorphisms are commonly represented in the
population, i.e. exhibit high allele frequencies.
[0126] 2. They are in close proximity to one another facilitating
the generation of PCR products containing both polymorphisms from
test genomes.
[0127] 3. They exhibit no linkage disequilibrium such that no
single haplotype at this locus dominates in the population.
[0128] 1. Verification of the Double Hybridization SNP-Haplotyping
Method.
[0129] To verify the feasibility, efficacy and reliability of the
SNP-Haplotyping Method, haplotypes at the D.sub.2 receptor locus
are determined for multiple individuals, using standard sequence
analysis. The haplotypes determined by sequence analysis are used
for comparison to the haplotypes determined by the SNP-Haplotyping
Method of the invention.
[0130] The sequencing step is performed as follows:
[0131] 1. Primer 1 (M13.sup.(For)--CCTCAGTGACATCCTTGCCT) (SEQ ID
NO: 1) and Primer 2 (M13 .sup.(Rev)CATGCCCATTCTTCTCTGGT) (SEQ ID
NO:2) flank the region containing SNP1/SNP2 of the D.sub.2 receptor
polymorphic locus. Primer 1 contains an M13 forward sequence at the
5' end and Primer 2 contains an M13 reverse sequences at the 5' end
to facilitate sequencing of the PCR products. The expected size of
the PCR product is 350 base pairs.
[0132] 2. DNA from unrelated individuals is obtained from the
National Human Genome Research Institute (NHGR1) which is a
database containing a standardized collection of DNA from 450
unrelated individuals. Primers 1 and 2 are used to PCR amplify the
polymorphic locus from the D.sub.2 receptor gene from all of the
individuals using a proof-reading thermostable DNA polymerase such
as Pfu polymerase, as previously described (Sarkar, G., et al.,
Genomics, 11:8-14, (1991)).
[0133] 3. Each of the PCR reactions is separated by agarose gel
electrophoresis and the PCR products cut from the gel and purified.
These purified PCR products represent the D.sub.2 receptor
polymorphic locus from the individuals.
[0134] 4. The genotype of the polymorphic locus for each individual
is determined by sequencing an aliquot of each purified PCR product
using dye-labeled M13 forward and reverse primers.
[0135] 5. The haplotype of the polymorphic locus for each
individual is determined as follows:
[0136] a) An aliquot of each purified PCR product is subcloned into
a plasmid vector such as TA vector (Invitrogen), and transformed
into the appropriate strain of E. coli. This results in multiple
transformations, one for each individual.
[0137] b) Six colonies are picked from each transformation and
plasmid DNA is isolated from all colonies. Picking 6
colonies/transformation results in a>96% chance that the loci
from both chromosomes (alleles) of each individual is represented
and therefore analyzed.
[0138] c) The plasmid inserts, representing the D.sub.2 receptor
polymorphic locus for each individual, are sequenced using
vector-specific primers. The sequences are analyzed to determine
the haplotype of the SNP1/SNP2 locus for each of the
individuals.
[0139] Genotypes
[0140] Nine combinations of (SNP 1: SNP2) genotypes are possible
for the two SNP loci and each of the tested individuals is expected
to possess one of the following:
1 G/T:C/T G/G:C/T T/T:C/T G/T:C/C G/G:C/C T/T:C/C G/T:T/T G/G:T/T
T/T:T/C
[0141] Haplotypes
[0142] Four haplotypes of the two SNP loci (SNP1=G/T and SNP2+C/T)
are possible:
2 Haplotype I (G--C) Haplotype III (T--C) Haplotype II (G--T)
Haplotype IV (T--T)
[0143] Each chromosome will have its own haplotype for the two SNP
loci, therefore, each individual is expected to possess two
haplotypes. Since the maternal and paternal chromosomes cannot be
distinguished, ten possible haplotype combinations between the two
chromosomes are possible and each individual is scored as
possessing one of the following haplotype combinations:
3 I, I II, II III, III IV, IV I, II II, III III, IV I, III II, IV
I, IV
[0144] 2. Genotype analysis of a Single Locus (the SNP1 Locus of
the D2 Receptor Gene) Using Phase I Allele-Specific Oligonucleotide
Hybridization on Immobilized SNP1 Allele-Specific
Oligonucleotides.
[0145] The SNP-Haplotyping Method of the invention depends, in some
aspects, on the ability to discriminate between polymorphic loci
using differential ASO hybridizations. The technique of ASO
hybridization has been established in the literature (Wang D., et
al., Science, 280:1077-1082 (1998); Guo, S., et al., Nucleic Acids
Res., 22:5456-5465 (1994); Sapolsky, R., et al., Genet. Anal.
Biomed, Engin. 14:187-192 (1999)). Phase I of this method involves
the accurate genotyping of multiple individuals, for the SNP1
locus, using ASO hybridization techniques. The following protocol
is outlined in FIG. 1, which outlines Phase I Hybridization
Protocol and Expected Results.
[0146] Step 1: Synthesis of anti-sense SNP1 allele-specific
oligonucleotides
[0147] Step 2: Attachment of anti-sense SNP1 allele-specific oligos
to wells
[0148] Step 3: Amplification of the SNP1/SNP2 polymorphic Locus
from individuals using a Cy3-labeled PCR reaction
[0149] Step 4: Hybridization of Cy3-labeled PCR products from each
individual to duplicate SNP 1-(G) allele wells and duplicate SNP
1-(T) allele wells
[0150] Step 1 involves Synthesis of Oligonucleotides Representing
the Antisense Strand of the Two SNP1 Alleles. Two oligonucleotides
are synthesized, each representing one allele of the SNP1 (G/T)
locus of the D.sub.2 receptor. The oligonucleotides represent the
antisense (complementary) strand for each allele as follows:
4 SNP1-(G detecting) oligo: NH.sub.2-(T).sub.15AGTCTCCC- (C)TTTCCCT
(SEQ ID NO: 3) SNP1-(T detecting) oligo:
NH.sub.2-(T).sub.15AGTCTCCC(A)CTTTCCCT (SEQ ID NO: 4)
[0151] The amino group is added to facilitate binding to the
surface of the wells. The addition of 15 Ts on the 5' end of the
oligonucleotide functions as a "spacer" sequence. Spacer sequences
have been shown to greatly enhance the hybridization signal,
presumably by lifting the hybridization sequence off the support
surface thereby decreasing the steric interference produced by that
surface (Guo, S., et al., Nucleic Acids Res., 22:5456-5465 (1994)),
but are not essential.
[0152] Step 2 involves Binding of Oligonucleotides to Solid
Surface. Each oligonucleotide is covalently attached to one 96-well
Xenobind Black plate (Xenopore, Corp., Hawthorne, N.J.) as
follows:
[0153] a) 200 pmol of each oligonucleotide is resuspended in 0.05 M
phosphate buffer, pH 7.0 and placed into the wells of a Xenobind
plate. One plate contains SNP 1-(G-detecting) oligos and the second
plate contains SNP 1-(T detecting) oligos.
[0154] b) Plates are incubated at 37.degree. C. for 2 hours.
[0155] c) Plates are washed once with 0.2% SDS and twice with
ddH.sub.2O.
[0156] d) Unbound sites are blocked with blocking solution (1 g
sodium borate in 400 mls of 25% ethanol in PBS) for 5 minutes.
[0157] e) Wells are washed, as above, and air dried in the dark at
room temperature.
[0158] Step 3 involves Amplification of the Polymorphic Locus from
the Test Subjects. The polymorphic locus (SNP1 and SNP2) from the
receptor gene is PCR-amplified from each of the individual test
subjects. The primers used are the primers outlined above (SEQ ID
NO:1 and 3), except that the M13 sequences are omitted. The PCR is
carried out in the presence of Cy3-dCTP, to fluorescently label the
products, and the PCR products are purified using a PCR
purification column system (QIAGEN).
[0159] Step 4 involves Hybridization of the Polymorphic Locus PCR
Products from the Individual Test Subjects to the
SNP1-(G-detecting) oligo and SNP1-(T detecting) oligo bound
wells.
[0160] a) Each of the 48 fluorescently labeled PCR products is
denatured by boiling and diluted to 0.5 pmol/ml of TMAC
hybridization solution (3.0 M TMAC/0.6% SDS/10 mM sodium phosphate
pH 6.5/5X Denhardt's solution/40 .mu.g/ml yeast tRNA). TMAC (Sigma,
Inc.) allows the hybridizations to progress independent of G/C
content and intrinsic melting temperatures.
[0161] b) 200 .mu.l each of the diluted PCR products is added in
duplicate to two wells (# of individuals (i.e. 48
individuals).times.2 wells=96 wells) of the SNP1-(G detecting)
oligo plate and two wells of the SNP1-(T detecting) oligo plate.
Hybridizations are incubated overnight at 52.degree. C. with gentle
agitation.
[0162] c) Plates are washed twice for 30 minutes at room
temperature and once for 20 minutes at 54.degree. C. in wash buffer
(3.0 M TMAC/0.6% SDS/10 mM sodium phosphate, pH 6.8)
[0163] d) Plates are read on an Ultra Reader fluorescent microplate
reader (Tecan Instruments) to determine which wells have a positive
hybridization signal.
[0164] Control wells are set up to monitor background produced by
non-specific binding to unattached sites of the wells, insufficient
blocking, random DNA/DNA interactions etc. To control for and
subtract out background signals from the ASO hybridizations, a
random segment of human DNA is amplified from genomic DNA. This
random segment is of equal length (350 base pairs) and of
approximately equal G/C and A/T content to the locus specific PCR
products from the test individuals. These control DNA segments are
hybridized to wells bound with each of the SNP 1 allele-specific
oligos as outlined above.
[0165] If the Cy3-labeled PCR product from an individual binds to
the oligonucleotides attached to the wells, then a fluorescent
signal is detected in that well. If the PCR product does not bind
to the oligonucleotide attached to the well, then no fluorescent
signal is detected. The following genotypes are possible:
[0166] a) G/T heterozygote
[0167] b) G/G homozygote
[0168] c) TT homozygote
[0169] The hybridization pattern for each genotype are descrbed for
the possible hybridization patterns expected for the SNP1 (G/T)
locus of the D2 receptor gene. G/T heterozygote, G/G homozygote,
T/T homozygote.
[0170] 1. G/T Heterozygote: If an individual is a G/T heterozygote
then the hybridization of the Cy3-labeled PCR product occurs in
wells containing both the SNP-1 (G detecting) oligo and the SNP1-(T
detecting) oligo. As a result a fluorescent signal is detected for
wells bound with oligonucleotides representing both SNP 1
alleles.
[0171] 2. G/G Homozygote: If an individual is a G/G homozygote then
the hybridization of the Cy3-labeled PCR product occurs only in the
wells containing the SNP 1-(G detecting) oligo. As a result, a
fluorescent signals are detected only in wells bound with
oligonucleotides representing the SNP1-G allele.
[0172] 3. T/T Homozygote: If an individual is a T/T homozygote then
the hybridization of the Cy3-labeled PCR product occurs only to the
wells containing the SNP1-(T detecting) oligo. As a result, a
fluorescent signal is detected only in wells bound with
oligonucleotides representing the SNP1-allele.
[0173] Control Wells: Negligible fluorescent signals are obtained
with wells hybridized with control PCR products. Any background
signal is subtracted from the fluorescent signals obtained with the
test wells and these values are used as the adjusted results.
[0174] The conditions outlined herein, particularly the use of TMAC
in the hybridization reactions, have been shown to accurately
discriminate single base mismatches in ASO hybridizations. In order
to minimize any potential indiscriminate binding in the reaction
the following optional steps can be performed.
[0175] 1. Cold competitor (unlabeled oligos of the opposite allele)
is added to the hybridization reactions to compete-out binding to
the indiscriminate allele.
[0176] 2. Enhanced discrimination of SNPs by artificial mismatch
hybridization can also be used (Guo, Z., et al., Nature Biotech,
15:331-335 (1997)). It has been shown that the ability to
discriminate between 1 vs. 2 mismatches is 200% greater than the
discrimination between 0 vs. 1 mismatch. Therefore, the difference
in stability of hybridized DNA segments with 2 mismatches versus 1
mismatch is significantly greater than the stability differences
between 0 mismatches and 1 mismatch. Therefore, the addition of an
artificial mismatch into the SNP1 allele-specific oligonucleotides
bound to the wells, can be expected to abolish any non-specific
binding between an individual's SNP1 locus and the erroneous
SNP1-specific allele oligonucleotide.
[0177] 3. Haplotype Analysis of Two Loci (the SNP1 and SNP2 Loci of
the D2 Receptor Gene) Using Phase I and II Allele-Specific
Oligonucleotide Hybridization on Immobilized SNP1 Allele-Specific
Oligonucleotides.
[0178] Phase I of the Method of Haplotyping (outlined above)
involves hybridizing CY3-labeled PCR products from the SNP1/SNP2
loci of each individual to SNP1 allele-specific oligonucleotides.
Phase II involves an additional hybridization with SNP2
allele-specific oligonucleotides which simultaneously determines:
1) the genotype of the SNP2 locus for each individual and 2) the
phase of the SNP2 genotype with the SNP1 genotype, in other words,
the haplotype.
[0179] SNP1 Antisense Allele-specific Oligonucleotides are bound to
the Wells of a Xenobind Black 96-Well Plate. SNP1-(G)-detecting and
SNP1-(T)-detecting antisense allele-specific oligonucleotides (SEQ
ID NO:3 and 4) are synthesized. Each SNP1 oligo is bound to two 96
well Xenobind Black plates (4 plates total) as outlined above.
[0180] PCR Amplification and Phase I Hybridization of the SNP1/SNP2
Locus from the Individual Test Subjects to the SNP1-(G detecting)
Oligo and SNP1-(T detecting) Oligo Bound Wells is performed. The
SNP1/SNP2 locus is PCR amplified from the test subjects in the
presence of Cy3-dCTP and hybridized to two wells each of the 4
plates containing immobilized SNP1 (G) or (T) allele-specific
oligos. However, after the last wash at 54.degree. C., the plates
are not read on a fluorometer. They are, instead, subjected to the
next Step in the SNP-Haplotyping Protocol.
[0181] Synthesis of Oligonucleotides Representing the Antisense
Sequence of the Two SNP2 Alleles is performed next. Phase II
Hybridization to the Immobilized SNP 1 allele-specific
oligo:SNP1/SNP2 locus complex Bound to the Xenobind Plates.
[0182] Oligonucleotides are synthesized, each representing one
allele of the SNP2 (C/T) locus in the presence of Cy5-dCTP. The
oligonucleotides represent the antisense sequence for each SNP2
allele as follows:
5 SNP2-(C detecting) oligo: AGGGTGGT(G)CCAGAGGT (SEQ ID NO: 5)
SNP2-(T-detecting) oligo: AGGGTGGT(A)CCAGAGGT (SEQ ID NO: 6)
[0183] As outlined in FIGS. 1 and 2, the SNP2--(C)-oligo and
SNP2-(T)-oligo are each hybridized to one Xenobind plate bound with
the SNP1 (G) oligo individual PCR products complex (FIG. 2, plates
2 & 4). Each SNP2 allele-specific oligonucleotide is diluted to
0.5 pmol/ml in TMAC hybridization solution+50.times.cold
competitor. The hybridization protocol is identical to the protocol
described in above (Step 4). Plates are read on a fluorescent
microplate reader which can differentiate Cy3 and Cy5 signals. Cy5
signals are read to determine haplotype.
[0184] Phase II Hybridization Setup is shown in FIG. 2. Phase II
hybridization setup is represented in Plates A-D. Plate A) SNP1 (G)
allele-specific oligo is bound to the plate and Phase I-hybridized
with 48 test genomes, each in duplicate wells. Plate A is then
Phase II-hybridized with SNP2 (C) allele-specific oligo. Plate B)
SNP1 (T) allele-specific oligo is bound to the plate and Phase
I-hybridized with 48 test genomes, each in duplicate wells. Plate B
is then Phase II-hybridized with SNP2 (C) allele-specific oligo.
Plate C)SNP 1 (G) allele-specific oligo is bound to the plate and
Phase I-hybridized with 48 test genomes, each in duplicate wells.
Plate C is then Phase II;-hybridized with SNP2 (T) allele-specific
oligo. Plate D) SNP1 (T) allele-specific oligo is bound to the
plate and Phase I-hybridized with 48 test genomes, each in
duplicate wells. Plate D is then Phase II-hybridized with SNP2 (T)
allele-specific oligo.
[0185] Four haplotypes of the two SNP loci (SNP1=G/T and SNP2=C/T)
are possible:
[0186] Haplotype I (G-C)
[0187] Haplotype II (G-T)
[0188] Haplotype III (T-C)
[0189] Haplotype IV (T-T)
[0190] A schematic diagram depicting the determination of haplotype
is shown in FIG. 3. In FIG. 3, the expected Phase II hybridization
patterns are shown for the four possible haplotypes (rows 1-4) of
the SNP1 (G/T) locus and the SNP2 (C/T) locus. Columns A-D refer to
Plates A-D as outlined in FIG. 2. The (G-C) haplotype gives a
positive signal on Plate A (well 1A). The (G-T) haplotype gives a
positive signal on Plate B (well 2B). The (T-C) haplotype gives a
signal on Plate C (well 3C). The (T/T) haplotype gives a signal on
Plate D (well 4D).
[0191] SNP1 Genotype: If an individual possesses a G allele at the
SNP1 locus, then that individual's PCR product will hybridize only
to those wells containing the SNP1-(G)-detecting-oligo (FIG. 3,
wells 1A, 1B, 2A and 2B). If this individual however, possesses a T
allele at the SNP1 locus then hybridization will occur to those
wells containing the SNP1-(T)-detecting-oligo (FIG. 3, wells 3C,
3D, 4C and 4D). Since the PCR products are Cy3 labeled, the
genotype at SNP1 can be determined by detecting which wells have a
Cy3 signal.
[0192] Haplotyping for One Chromosome: The haplotype for a
particular chromosome is determined by hybridizing with either the
SNP2-(C) or the SNP2-(T) allele-specific oligo. If an individual
has a SNP 1-SNP2 haplotype of G-C on one chromosome, then a Cy5
signal results when the SNP2 (C) specific oligo binds to a (G-C)PCR
product/SNP1 (G) specific oligo complex bound to a well (FIG. 3,
well 1A). If the individual, however, possesses a SNP1-SNP2
haplotype of G-T, then a Cy5 signal results when the SNP2 (T)
specific oligo binds to a (G-T) PCR product/SNP 1(G) specific oligo
complex (FIG. 3, well 2B).
[0193] Haplotype for Both Chromosomes: By examining the
hybridization patterns, (i.e. which plates have wells with a Cy5
signal), the haplotype can be determined for both chromosomes. As
outlined in FIG. 2: Plate A will detect SNP1 (G)/SNP2 (C); Plate B
will detect SNP1 (G)/SNP2 (T); Plate C will detect SNP1 (T)/SNP2
(C) and Plate D will detect SNP1 (T)/SNP2 (T). Therefore,
haplotypes can be scored for hybridization signals seen on each
plate. They are as follows:
6 Plate SNP1-SNP2 Haplotype A G-C I B G-T II C T-C III D T-T IV
[0194] Since each individual possesses two chromosomes, two
haplotypes are expected to be detected per person. Since the
maternal and paternal chromosome cannot be distinguished, ten
haplotype combinations are possible. Their expected hybridization
patterns are outlined in Table 1.
7TABLE 1 Hybridization Patterns Expected For All 10 Possible
Haplotype Combinations Plates Where Signal Is Detected For
Haplotype Each Individual I, I A I, II A, B I, III A, C I, IV A, D
II, II B II, III B, C II, IV B, D III, III C III, IV C, D IV, IV
D
[0195] The ten possible haplotype combinations for both chromosomes
are indicated in the left column of the chart. The plate (A-D)
where the signal is expected to be detected for each haplotype
combination, is indicated in the right column of the chart. It is
expected that the haplotypes generated for the shuffled test
samples will match the known haplotypes generated by
sequencing.
Example 2
Haplotyping Procedure
[0196] Introduction
[0197] The following is the protocol used to detect genetic
haplotypes consisting of two Single Nucleotide Polymorphisms (SNPs)
in the human Beta-Adrenergic Receptor (BAR) gene. The assay was
conducted in 96 well plate format, in which a set of four wells was
used to detect each sample's haplotype. In order to distinguish the
allele present for the first SNP detected, an amine labeled oligo
was bound to the surface of the wells. One pair of wells contain an
oligo, BAR-G, complimentary to a 17 base pair region including one
allele of the SNP, while the remaining two wells contained an
oligo, BAR-A, complimentary to a 17 base pair region including the
other allele of the first SNP. This creates a situation where the
Beta-Adrenergic Receptor gene probe binds preferentially to one set
of wells over the other if only one allele of that SNP is present.
If both alleles are present in the samples genome, the probe,
produced using the Polymerase Chain Reaction (PCR), will bind to
both sets of wells with proportionately equal success.
[0198] Following binding of the amine labeled oligo, the wells of
the assay plate are washed to remove unbound oligo. The plate is
then treated with blocking agents to prevent nonspecific binding of
the subsequent hybridization and detection components to the wells.
Further washing removes the blocking agent and prepares the assay
plate for hybridization.
[0199] In the hybridization, the sample of interest's BAR PCR
product probe is introduced into each of the four wells used in the
haplotype detection. In order to detect the genotype of the second
SNP, a pair of biotin-labeled oligos, BAR-PIIG and BAR-PIIA,
complimentary to the 17 base pair region including the two SNP
alleles of the second SNP, are added as follows:
8 Amine Oligo Biotin Oligo Positive Haplotype Detected Well 1 BAR-G
BAR-PIIG G-G Well 2 BAR-G BAR-PIIA G-A Well 3 BAR-A BAR-PIIG A-G
Well 4 BAR-A BAR-PIIA A-A
[0200] Also added to the hybridization is either member of a pair
of unlabeled cold competitor oligos. The cold competitor oligo DNA
sequence is identical to the biotin-labeled oligo except does not
contain a biotin label. The cold competitor oligo is added to the
opposite wells as above and in some cases helps to enhance SNP
discrimination. The addition of the cold competitor oligos is shown
below.
9 Cold Competitor Oligo Well 1 BARPIIAcc Well 2 BARPIIGcc Well 3
BARPIIAcc Well 4 BARPIIGcc
[0201] Hybridization occurs by incubating the components together
in the assay plate wells overnight. Probe that is non-complimentary
to the amine oligo is washed from the wells, consequently removing
any biotin oligo from the wells as well. Biotin oligo is also
removed from wells in which the probe binds the amine oligo at the
first SNP location but does not contain the allele of the second
SNP that is complimentary to the SNP present in the biotin oligo
sequence. Thus, biotin-labeled oligo remains after
post-hybridization washing only in wells in which the probe is
complimentary to the SNPs contained in the amine-labeled oligo and
the biotin labeled oligo added to that well. This well will produce
a positive signal for the haplotype it detects. Wells that do not
meet this criterion will produce no signal, a "negative"
signal.
[0202] The haplotypes present, of which there can be at most two of
the four possible demonstrated haplotypes (one if the person has a
homozygous haplotype), are detected by addition of a
streptavidin-horseradish peroxidase conjugate to the assay plate.
Biotin-streptavidin binding ensures that the peroxidase remains in
the wells containing the positive haplotypes. Detection takes
advantage of this with the addition of peroxidase substrates that
form a chemiluminescent product in the positive wells and
relatively none in the negative wells.
[0203] Haplotyping Protocol
[0204] Procedure
[0205] PCR Product Preparation for Use as Haplotyping Hybridization
Probe
[0206] PCR Preparation
[0207] The PCR Reactions were Prepared as Follows:
[0208] 1. ABgene PCR Master Mix (Marsh Biomedical Products,
Inc.,Rochester, N.Y., cat. #AB-0575)
[0209] Final conc. 1X
10 2. Forward primer 5' [PO4]-ACTTGACAGCGAGTGTGCTG 3' (SEQ ID NO:
7) 3. Reverse primer 5' GTCCCTTTGCTGCGTGAC 3' (SEQ ID NO: 8)
[0210] Final primer concentration 0.1 .mu.M for each primer
[0211] 4. Genomic DNA template
[0212] Final conc. 1 ng/.mu.l
[0213] Total reaction volume=50 .mu.l
[0214] The PCR reaction was conducted in PTC-225 DNA Engine Tetrad
MJ Research (Waltham, Mass.)using the following PCR profile:
[0215] 5 minutes at 94.degree. C.
[0216] 1 minute at 96.degree. C.
[0217] 1 minute at 56.degree. C.
[0218] 1:30 minutes at 72.degree. C.
[0219] Repeat from step 2, 34 times
[0220] 10 minutes at 72.degree. C.
[0221] 4.degree. C. constant hold
[0222] The final product of this PCR reaction was an 1140 base pair
fragment of the Beta-Adrenergic Receptor (BAR) gene sequence.
[0223] PCR Product Preparation Protocol
[0224] A. Purification of PCR Products
[0225] Each 50 .mu.l PCR reaction was transferred to a
MultiScreen-PCR Plate (Millipore, Bedford, Mass., cat. # MANU 030
50). The MultiScreen plate was placed on the vacuum manifold and
the vacuum was engaged for ten minutes. Then 50 .mu.l of H.sub.2O
was added to each well of the multiScreen plate and the plate was
shaken at 98 rpm at room temperature for five minutes. The DNA was
eluted from the MultiScreen plate as described below in step
B-3.
[0226] B. Exonuclease Digestion
[0227] Following the purification Lambda Exonuclease Digestion was
preformed to produce single-stranded DNA. To do this: Gibco Lambda
exonuclease, 6U/ul, (Life Technologies, Rockville, Md., cat.
#28023-018) was added to 2.times.Lambda exonuclease buffer (10
mg/ml Glycine, 5 mM MgCl.sub.2 pH 9.4) at a rate of 1:50. Then 50
.mu.l of the enzyme/buffer mix per well was dispensed from above to
a Skirted Thermo-Fast 96 96 well PCR plate (Marsh cat. # AB-0800).
The Millipore Multiscreen-PCR Plate purified PCR products were
eluted and transferred to the PCR plate containing the
2.times.lambda exonuclease enzyme/buffer mixture. The PCR products
were then digested for thirty minutes at 37.degree. C. in PTC-225
DNA Engine Tetrad (MJ Research) and the reaction was heated 10 min.
at 75.degree. C. to stop the reaction.
[0228] C. Purification of Lambda Exonuclease Digested PCR
Products
[0229] The 100 .mu.l lambda exonuclease digest was transferred to a
Millipore MultiScreen plate and purified as described above. Then
the ssDNA was eluted in 50 .mu.l H.sub.2O as described above.
[0230] D. Quantification of Purified Lambda Exonuclease Digested
PCR Product
[0231] 50 .mu.l of the product from step C-3 above was placed into
a COSTAR 96 well flatbottom UV plate (Corning, Inc., Acton, Mass.,
cat. #3635). Then the sample DNA concentrations were determined by
reading the A260 of the samples in the TECAN Spectrafluor Plus
(Durham, N.C.) compared to a standard curve of known ssDNA
concentrations of equal volumes.
[0232] Haplotyping Hybridization Protocol
[0233] A. Bind Amine Labeled Oligo to Well of Assay Plate
[0234] Amine labeled oligo
11 BAR-G 5' NH.sub.2-(T).sub.23CACCCAATGGAAGCCAT 3' (SEQ ID NO: 9)
BAR-A 5' NH.sub.2-(T).sub.23CACCCAATAGAA- GCCAT 3' (SEQ ID NO:
10)
[0235] 150 pmol of amine labeled oligo was bound into the well of
COSTAR DNA-BIND plate (Corning, Inc. cat. #2498) in oligo binding
buffer (100 .mu.l of Disodium phosphate, 50 mM, and EDTA, 1 mM, pH
8.5). Wells of the assay plate used for negative "no oligo"
controls received 100 .mu.l of binding buffer without amine-labeled
oligo added. The oligo was allowed to bind by incubating for two
hours at 37.degree. C. while shaking at 98 rpm.
[0236] B. Removal of Unbound Oligo from the Assay Plate
[0237] Oligo binding buffer was removed by inverting the assay
plate and dumping the contents of the wells into the sink. The
plate was then gently shaken to remove any residual droplets of
binding buffer. Any amine oligo was removed by washing the wells of
the assay plate three times with 200 .mu.l of 1.times.PBS wash
buffer. Washes were added via a 12-channel pipettor and removed by
the technique described above. One wash consisted of addition of
the 200 .mu.l wash buffer to the dry assay plate and its removal.
All subsequent washes were carried out in an identical manner.
[0238] C. Block Assay Plate to Prevent Nonspecific Binding
[0239] After removal of the third wash, the wells of the assay
plate were blocked with 200 .mu.l blocking buffer (Disodium
phosphate, 50 mM, and EDTA, 1 mM, pH 8.5, 3% Bovine Serum Albumin,
0.05% Tween 20). The plate was allowed to block by incubation for 1
hour at 37.degree. C. while shaking at 98 rpm.
[0240] D. Prehybridization Wash
[0241] The plate was washed three times with 1.times.PBS, 200 .mu.l
per wash, as described above. Then the plate was washed once with
200 .mu.l of TMAC-B solution (3M Tetramethyl-ammonium Chloride
(Sigma-Aldrich Inc. St. Louis, Mo., product # T 3411), 50 mM Tris
pH 8.0, 0.1% SDS, 1 mM EDTA) and the wash was allowed to incubate
for 7 minutes at room temperature.
[0242] E. Hybridization Solution Addition
[0243] Hybridization solution was prepared in 96 well PCR plate
using the following procedure.
[0244] Contents:
[0245] 0.4 pmol single-stranded BAR gene DNA probe
[0246] 100.0 pmol cold competitor to bind opposite allele of SNP2
on BAR PCR product
12 BARPIIGcc 5' AGGAAATCGGCAGCTGT 3' (SEQ ID NO: 11) BARPIIAcc 5'
AGGAAATCAGCAGCTGT 3' (SEQ ID NO: 12)
[0247] 3. 100.0 pmol biotinylated SNP2 detection oligo
13 BAR-PIIG 5' [Bio]-AGGAAATCGGCAGCTGT 3' (SEQ ID NO: 13) BAR-PIIA
5' [Bio]-AGGAAATCAGCAGCTGT 3' (SEQ ID NO: 14)
[0248] 4. The final volume was brought up to 100 .mu.l such that
hybridization occurs in TMAC-B solution as described above.
[0249] The Hybridization Solution was heated for 7 minutes at
95.degree. C. in a PTC-100 Peltier Thermal Cycler from MJ research.
Then 100 .mu.l of hybridization solution was transferred to COSTAR
DNA-BIND plate and hybridized overnight at 52.degree. C. with
shaking at 98 rpm.
[0250] F. Post-Hybridization Washes
[0251] The plate was washed three times with TMAC-B solution at
room temperature with incubation in the third wash for 5 minutes at
room temperature with shaking at 98 rpm. The plate was then washed
once with TMAC-B solution at 52.degree. C., with the wash incubated
for five minutes at 52.degree. C., with shaking at 98 rpm. The
plate was then washed twice with 2.times.SSC followed by one wash
with oligo binding buffer.
[0252] G. Perform Detection.
[0253] 100 .mu.l of blocking buffer containing 1:500
Peroxidase-labeled Streptavidin (Kirkegaard and Perry Laboratories,
cat. # 474-3000) was added to each well of the assay plate. The
plate was incubated 30 minutes at 37.degree. C. with shaking at 98
rpm.
[0254] H. Remove Unbound Detection Molecules
[0255] The assay plate was washed three times with
1.times.PBS+0.05% Tween 20 wash buffer followed by washing twice
with 1.times.PBS wash buffer.
[0256] I. Detect Haplotype
[0257] 100 .mu.l of 1:1 SuperSignal ELISA Femto Luminol/Enhancer
Solution and SuperSignal ELISA Femto Stable Peroxide Solution
(Pierce Chemical Company, Rockford, Ill., product #37075) was added
and the assay plate shaken 1 minute at 98 rpm at room temperature.
The assay plate chemiluminescence was then read using Tecan
Spectrafluor Plus in chemiluminescence mode, with the gain set to
130.
[0258] Results
[0259] The graph in FIG. 5 represents data generated from the
haplotyping of 4 individuals. The signal generated from a negative
control well (no PCR product added) was subtracted from the signal
generated for each of the four wells analyzed for each individual.
The background-subtracted signal was plotted for each well. From
this analysis, the determined haplotypes for each individual are as
follows: #1-homozygote A-G, #2-homozygote A-G, #3-heterozygote G-G,
A-G, #4-homozygote A-A. Sequence analysis of several subcloned BAR
products for each individual have confirmed these haplotypes. The
data was normalized for hybridization differences between A and G
of SNP #2.
Example 3
Haplotyping Assay Using Asymmetric PCR Products Introduction
[0260] The hybridization described in Example 2 can also be
performed in two steps. The PCR product and an appropriate cold
competitor are added to wells containing bound amine-labeled oligo.
These components are allowed to hybridize, then washed thoroughly
to remove nonspecific binding. The second set of hybridization
components are then added to the wells and allowed to hybridize. In
this protocol, detection was carried out using a
Streptavidin-alkaline phosphatase conjugate. Fluorescent products
were then formed upon the addition of alkaline phosphatase
substrates.
[0261] An alternate method of preparing the PCR product probe
utilizes a method known as asymmetric PCR. In this method, the
strand of interest is produced at a much higher frequency than its
compliment during the PCR reaction. This is accomplished by
increasing the concentration of the primer that initiates
replication of the desired strand relative to the concentration of
the primer producing the strand's compliment. This results in a
large number of copies of the strand of interest being produced
that have no compliment with which to bind. These single-stranded
DNA fragments are readily available to take place in the
hybridization that follows. Therefore, digestion of the opposite
strand via exonuclease is not necessary when the PCR product is
produced with asymmetric primer concentrations.
[0262] The locus of interest in this procedure can be found using
accession # G54849 to search the Website of the National Center for
Biotechnology Information's (NCBI) Genbank Database.
[0263] Procedure
14 A. Hybridization Components Well # Haplotype Detected Amine
oligo bound 1. G-T 4035AmG 2. G-C 4035AmG 3. C-T 4035AmC 4. C-C
4035AmC
[0264] Phase I Components (An equal amount of an asymmetric PCR
reaction was added to each well in this hybridization)
15 Well Cold Competitor 1. 4035ColdCompG 2. 4035ColdCompG 3.
4035ColdCompC 4. 4035ColdCompC
[0265] Phase II Components
16 Well Cold Competitor Biotinylated SNP Detection Oligo 1. 4035Ccc
4035-TB 2. 4035Tcc 4035-CB 3. 4035Ccc 4035-TB 4. 4035Tcc
4035-CB
[0266] Protocol for Haplotyping with Asymmetric PCR Product
[0267] PCR Preparation PCR reactions were performed as follows:
[0268] 1. ABgene PCR Master Mix (Marsh Biomedical Products, Inc.,
cat. #AB-0575)
[0269] Final conc. 1X
17 2. Forward primer (5' GAACAGCAATGCACATTACCATGG 3') (SEQ ID NO:
15)
[0270] Final primer concentration 0.2 .mu.M
18 3. Reverse primer (5' CTGTCAAGTATTTCTCCGCAGCATA 3') (SEQ ID NO:
16)
[0271] Final primer concentration 1.0 .mu.M
[0272] 4. Genomic DNA template
[0273] Final conc. 1 ng/.mu.l
[0274] Total reaction volume=50 .mu.l
[0275] The PCR reaction was conducted in PTC-225 DNA Engine Tetrad
(MJ Research) using the following PCR profile:
[0276] 5 minutes at 94.degree. C.
[0277] 1 minute at 94.degree. C.
[0278] 1 minute at 56.degree. C.
[0279] 1 minute at 72.degree. C.
[0280] Repeat from step 2, 34 times
[0281] 10 minutes at 72.degree. C.
[0282] 4.degree. C. constant hold
[0283] The final product of this PCR reaction was a 289 base pair
fragment of the human genome described above. This fragment
contains SNPS at base pairs 35 (G/C) and 234 (C/T) of the PCR
product. These two SNPs were the focus of this study.
[0284] Hybridization Protocol
[0285] A. Amine-Labeled Oligo was Bound to Well of Assay Plate:
19 4035AmC 5' NH.sub.2-(T).sub.23GCCACAATGAATGACAT (SEQ ID NO: 17)
4035AmG or 5' NH.sub.2-(T).sub.23GCCACAATCAATGACAT (SEQ ID NO:
18)
[0286] 150 pmol of amine labeled oligo was bound into the well of
COSTAR DNA-BIND assay plate (Corning, Inc. cat. #2498) in oligo
binding buffer (1001 of Disodium phosphate, 50 mM, and EDTA, 1 mM,
pH 8.5). Wells of the assay plate used for negative "no oligo"
controls receive 100 .mu.l binding buffer without amine-labeled
oligo added. The oligo was allowed to bind by incubating overnight
at 4.degree. C.
[0287] B. Removal of Unbound Oligo from Assay Plate
[0288] Oligo binding buffer was removed with a 12 channel vacuum
apparatus. The remaining amine oligo was removed by washing the
wells of the assay plate three times with 200 .mu.l of 1.times.PBS
wash buffer. Washes were added via a 12-channel pipettor and
removed by the technique described above. One wash consists of
addition of the 200 .mu.l wash buffer to the dry assay plate and
its removal. All subsequent washes are carried out in an identical
manner.
[0289] C. Blocking Assay Plate to Prevent Nonspecific Binding
[0290] After removal of the third wash, the wells of the assay
plate were blocked with 200 .mu.l blocking buffer (Disodium
phosphate, 50 mM, and EDTA, 1 mM, pH 8.5, 3% Bovine Serum Albumin).
The plate was allowed to block by incubation for 1 hour at
37.degree. C. with shaking at 98 rpm.
[0291] D. Prehybridization Wash
[0292] The wells were washed once with 1.times.PBS, 200 .mu.l per
wash, as described above. The wells were then washed once with 200
.mu.l of TMAC-B solution (3M Tetramethyl-ammonium Chloride
(Sigma-Aldrich Inc. product # T 3411), 50 mM Tris pH 8.0, 0.1% SDS,
1 mM EDTA). The final wash was allowed to incubate for 7 minutes at
room temperature while treating the hybridization solution.
[0293] E. Perform Hybridizations
[0294] Phase I Hybridization
[0295] Hybridization solution was prepared in 96 well PCR plate
using the following procedure:
[0296] Contents:
[0297] 1) 5-10 .mu.l of 4035 locus asymmetric PCR DNA probe, with
estimated concentration of 80 ng/.mu.l.
[0298] 2) 15 pmol cold competitor to inhibit binding of PCR product
with SNP allele not being detected:
20 4035ColdCompG 5'ATGTCATTGATTGTGGC 3' or (SEQ ID NO: 19)
4035ColdCompC 5'ATGTCATTCATTGTGGC 3' (SEQ ID NO: 20)
[0299] 3) The final volume was then brought up to 100 P such that
hybridization occurs in TMAC-B solution as described above.
[0300] The Hybridization Solution was heated for 7 minutes at
95.degree. C. Then 100 .mu.l of hybridization solution was
transferred to COSTAR DNA-BIND plate and allowed to hybridize
overnight at 52.degree. C. with shaking at 98 rpm.
[0301] Post-Hybridization Washes for Phase I Hybridization
[0302] Following the hybridization the plate was washed three times
with TMAC-B solution at room temperature. The plate was then
incubated 5 minutes at room temperature with shaking at 98 rpm. The
plate was then washed once with TMAC-B solution at 52.degree. C.
with an incubation for five minutes at 52.degree. C. with shaking
at 98 rpm.
[0303] Phase II Hybridization
[0304] Contents
[0305] 1) 45 pmol Biotinylated Phase II Detection oligo to bind
2.sup.nd SNP:
21 4035-CB 5' Biotin-TGTATAATCAGAATTAT 3' (SEQ ID NO: 21) or
4035-TB 5' Biotin-TGTATAATTAGAATTAT 3' (SEQ ID NO: 22)
[0306] 2. 90 pmol Phase II cold competitor to inhibit binding of
biotinylated oligo to 2nd SNP loci containing allele not being
detected:
22 4035-C 5' TGTATAATCAGAATTAT 3' or (SEQ ID NO: 23) 4035-T 5'
TGTATAATTAGAATTAT 3' (SEQ ID NO: 24)
[0307] 3. The final volume is then brought up to 100 .mu.l such
that hybridization occurs in TMAC-B solution as described
above.
[0308] 100 .mu.l of hybridization solution was transferred to
COSTAR DNA-BIND plate and allowed to hybridize overnight at
52.degree. C., with shaking at 98 rpm.
[0309] F. Post-Hybridization Washes for Phase II Hybridization
[0310] The plate was washed three times with TMAC-B solution at
room temperature and then incubated 5 minutes at room temperature
with shaking at 98 rpm. The plate was then washed once with TMAC-B
solution at 52C and incubate five minutes at 52.degree. C. with
shaking at 98 rpm. Then the plate was wash twice with 2.times.SSC,
with the washes carried out as described above. Then the plaste was
washed once with oligo binding buffer.
[0311] Perform Detection
[0312] 200 .mu.l of 4C.sub.1.times.Elf Wash (ELF 97 mRNA In Situ
Hybridization Kit, Component A. Molecular Probes, Eugene, Oreg.,
Cat. # E-6605) was added to the plate, the plate was incubated 5
minutes at room temperature, and the wash removed. 200 .mu.l of Elf
Blocking Buffer (ELF 97 mRNA In Situ Hybridization Kit, Component
B) was then added, the plate incubated 45 minutes at room
temperature, and the block removed. Then, 100 .mu.l Elf
Streptavidin Alkaline Phosphatase Conjugate (ELF 97 mRNA In Situ
Hybridization Kit, Component J) diluted 1:50 in Elf Blocking
Buffer, was added to the plate. The plate was incubated 30 minutes
at room temperature with shaking at 98 rpm.
[0313] Following the incubation, the plate was washed the plate
three times with 4C 1X Elf Wash. Then 100 .mu.l of ELF 97
phosphatase substrate working solution (ELF 97 mRNA In Situ
Hybridization Kit, Component D 1:10, Component E 1:500, Component F
1:500, in Component C) was added to the plate and incubated 10
minutes in the dark. Following the incubation, the assay plate
fluorescence (excitation 360 nm, emission 535 nm) was read.
[0314] After 45 minutes, the assay plate was washed once with 4C 1X
Elf Wash, and the wash was left in the plate. Then the assay plate
fluorescence was read again as above.
[0315] Results:
[0316] Sample Data
[0317] The four graphs in FIG. 6 represent data generated from the
haplotyping of 4 individuals. The signal generated from a negative
control well (no PCR product added) was subtracted from the signal
generated for each of the four wells analyzed for each individual.
The background-subtracted signal was plotted for each well. From
this analysis, the determined haplotypes for each individual are as
follows: #1--homozygote G-C, #2--heterozygote G-T, G-C,
#3-heterozygote G-C, C-C, #4--heterozygote G-T, C-C. Sequence
analysis of several subcloned products for each individual have
confirmed these haplotypes.
[0318] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not limited in scope by the
examples provided, since the examples are intended as illustrations
of various aspects of the invention and other functionally
equivalent embodiments are within the scope of the invention.
Various modifications of the invention in addition to those shown
and described herein will become apparent to those skilled in the
art from the foregoing description and fall within the scope of the
inventive claims. The advantages and objectives of the invention
are not necessarily encompassed by each embodiment of the
invention. All references, patents, and patent publications which
are cited in this application are incorporated in their entirety
here and by reference.
Sequence CWU 1
1
24 1 20 DNA Artificial Sequence Synthetic Human Oligonucleotide 1
cctcagtgac atccttgcct 20 2 20 DNA Artificial Sequence Synthetic
Human Oligonucleotide 2 catgcccatt cttctctggt 20 3 31 DNA
Artificial Sequence Synthetic Human Oligonucleotide 3 tttttttttt
tttttagtct cccctttccc t 31 4 32 DNA Artificial Sequence Synthetic
Human Oligonucleotide 4 tttttttttt tttttagtct cccactttcc ct 32 5 17
DNA Artificial Sequence Synthetic Human Oligonucleotide 5
agggtggtgc cagaggt 17 6 17 DNA Artificial Sequence Synthetic Human
Oligonucleotide 6 agggtggtac cagaggt 17 7 20 DNA Artificial
Sequence Synthetic Human Oligonucleotide 7 acttgacagc gagtgtgctg 20
8 18 DNA Artificial Sequence Synthetic Human Oligonucleotide 8
gtccctttgc tgcgtgac 18 9 40 DNA Artificial Sequence Synthetic Human
Oligonucleotide 9 tttttttttt tttttttttt tttcacccaa tggaagccat 40 10
40 DNA Artificial Sequence Synthetic Human Oligonucleotide 10
tttttttttt tttttttttt tttcacccaa tagaagccat 40 11 17 DNA Artificial
Sequence Synthetic Human Oligonucleotide 11 aggaaatcgg cagctgt 17
12 17 DNA Artificial Sequence Synthetic Human Oligonucleotide 12
aggaaatcag cagctgt 17 13 17 DNA Artificial Sequence Synthetic Human
Oligonucleotide 13 aggaaatcgg cagctgt 17 14 17 DNA Artificial
Sequence Synthetic Human Oligonucleotide 14 aggaaatcag cagctgt 17
15 24 DNA Artificial Sequence Synthetic Human Oligonucleotide 15
gaacagcaat gcacattacc atgg 24 16 25 DNA Artificial Sequence
Synthetic Human Oligonucleotide 16 ctgtcaagta tttctccgca gcata 25
17 40 DNA Artificial Sequence Synthetic Human Oligonucleotide 17
tttttttttt tttttttttt tttgccacaa tgaatgacat 40 18 40 DNA Artificial
Sequence Synthetic Human Oligonucleotide 18 tttttttttt tttttttttt
tttgccacaa tcaatgacat 40 19 17 DNA Artificial Sequence Synthetic
Human Oligonucleotide 19 atgtcattga ttgtggc 17 20 17 DNA Artificial
Sequence Synthetic Human Oligonucleotide 20 atgtcattca ttgtggc 17
21 17 DNA Artificial Sequence Synthetic Human Oligonucleotide 21
tgtataatca gaattat 17 22 17 DNA Artificial Sequence Synthetic Human
Oligonucleotide 22 tgtataatta gaattat 17 23 17 DNA Artificial
Sequence Synthetic Human Oligonucleotide 23 tgtataatca gaattat 17
24 17 DNA Artificial Sequence Synthetic Human Oligonucleotide 24
tgtataatta gaattat 17
* * * * *