U.S. patent application number 10/871471 was filed with the patent office on 2005-04-28 for probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same.
Invention is credited to Echwald, Soren Morgenthaler, Mouritzen, Peter, Ramsing, Niels B., Tolstrup, Niels.
Application Number | 20050089889 10/871471 |
Document ID | / |
Family ID | 45935360 |
Filed Date | 2005-04-28 |
United States Patent
Application |
20050089889 |
Kind Code |
A1 |
Ramsing, Niels B. ; et
al. |
April 28, 2005 |
Probes, libraries and kits for analysis of mixtures of nucleic
acids and methods for constructing the same
Abstract
The invention relates to nucleic acid probes, nucleic acid probe
libraries, and kits for detecting, classifying, or quantitating
components in a complex mixture of nucleic acids, such as a
transcriptome, and methods of using the same. The invention also
relates to methods of identifying nucleic acid probes useful in the
probe libraries and to methods of identifying a means for detection
of a given nucleic acid.
Inventors: |
Ramsing, Niels B.; (Risskov,
DK) ; Mouritzen, Peter; (Jyllinge, DK) ;
Echwald, Soren Morgenthaler; (Humlebaek, DK) ;
Tolstrup, Niels; (Klampenborg, DK) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
45935360 |
Appl. No.: |
10/871471 |
Filed: |
June 18, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60549346 |
Mar 2, 2004 |
|
|
|
Current U.S.
Class: |
506/3 ; 435/6.14;
506/16; 506/17; 506/32; 506/4; 506/41; 506/5; 506/8; 536/24.3 |
Current CPC
Class: |
C12Q 1/6876 20130101;
G16B 25/20 20190201; C12Q 2600/158 20130101; C12Q 1/6816 20130101;
C12N 15/1065 20130101; G16B 25/00 20190201; C12Q 1/6816 20130101;
C12Q 2531/113 20130101; C12Q 2527/101 20130101; C12Q 2525/179
20130101 |
Class at
Publication: |
435/006 ;
536/024.3 |
International
Class: |
C12Q 001/68; C07H
021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 20, 2003 |
DK |
PA200300933 |
Jul 12, 2003 |
DK |
PA200301066 |
Feb 17, 2004 |
DK |
PA200400242 |
Mar 1, 2004 |
DK |
PA200400353 |
Claims
1. A library of oligonucleotide probes wherein each probe in the
library consists of a recognition sequence tag and a detection
moiety wherein at least one monomer in each oligonucleotide probe
is a modified monomer analogue, increasing the binding affinity for
the complementary target sequence relative to the corresponding
unmodified oligodeoxyribonucleotid- e, such that the library probes
have sufficient stability for sequence-specific binding and
detection of a substantial fraction of a target nucleic acid in any
given target population and wherein the number of different
recognition sequences comprises less than 10% of all possible
sequence tags of a given length(s).
2. A library of oligonucleotide probes according to claim 1,
wherein the recognition sequence tag segment of the probes in the
library have been modified in at least one of the following ways:
i) substitution with at least one non-naturally occurring
nucleotide ii) substitution with at least one chemical moiety to
increase the stability of the probe.
3. A library of oligonucleotide probes according to claim 1 or 2
wherein the recognition sequence tag has a length of 6 to 12
nucleotides.
4. A library of oligonucleotide probes according to claim 3,
wherein the recognition sequence tag has a length of 8 or 9
nucleotides.
5. A library of oligonucleotide probes according to claim 4,
wherein the recognition sequence tags are substituted with LNA
nucleotides.
6. A library of oligonucleotide probes according to any one of the
preceding claims, wherein more than 90% of the oligonucleotide
probes can bind and detect at least two target sequences in a
nucleic acid population.
7. A library according to claim 6, wherein the recognition sequence
tag is complementary to at least two target sequences in the
nucleic acid population.
8. A library of oligonucleotide probes of 8 and 9 nucleotides in
length comprising a mixture of subsets of oligonucleotide probes
defined in any one of claims 1-7.
9. A library of oligonucleotide probes of any one of the preceding
claims, wherein the number of different target sequences in a
nucleic acid population is at least 100.
10. A library of oligonucleotide probes according to any one of the
preceding claims, wherein at least one nucleotide in each
oligonucleotide probe is substituted with a non-naturally occurring
nucleotide analogue, a deoxyribose or ribose analogue, or an
internucleotide linkage other than a phosphodiester linkage.
11. A library of oligonucleotide probes according to any one of the
preceding claims, wherein the detection moiety is a covalently or
non-covalently bound minor groove binder or an intercalator
selected from the group comprising asymmetric cyanine dyes, DAPI,
SYBR Green I, SYBR Green II, SYBR Gold, PicoGreen, thiazole orange,
Hoechst 33342, Ethidium Bromide, 1-O-(1-pyrenylmethyl)glycerol, and
Hoechst 33258.
12. The library oligonucleotide probes according to claim 10 or 11,
wherein the internucleotide linkage other than phosphodiester
linkage is a non-phosphate internucleotide linkage.
13. The library of oligonucleotide probes according to claim 12,
wherein the internucleotide linkage is selected from the group
consisting of alkyl phosphonate, phosphoramidite,
alkylphosphotriester, phosphorothioate, and phosphorodithioate
linkages.
14. The library of oligonucleotide probes according to any one of
the preceding claims, wherein said oligonucleotide probes contain
non-naturally occurring nucleotides, such as 2'-O-methyl, diamine
purine, 2-thio uracil, 5-nitroindole, universal or degenerate
bases, intercalating nucleic acids or minor-groove-binders, to
enhance their binding to a complementary nucleic acid sequence.
15. The library of oligonucleotide probes according to any one of
the preceding claims, wherein said different recognition sequences
comprise less than 1% of all possible oligonucleotides of a given
length.
16. The library of oligonucleotide probes according to any one of
the preceding claims, wherein each probe can be detected using a
dual label by the molecular beacon assay principle.
17. The library of oligonucleotide probes according to any one of
claims 1-15, wherein each probe can be detected using a dual label
by the 5' nuclease assay principle.
18. The library according to any one of the preceding claims,
wherein each probe contains a single detection moiety that can be
detected by the molecular beacon assay principle.
19. The library of oligonucleotide probes according to any one of
the preceding claims, wherein the target nucleic acid population is
an mRNA sample, a cDNA sample or a genomic DNA sample.
20. The library of oligonucleotide probes according to claim 19,
wherein said target mRNA or target cDNA population originates from
the transcriptomes of human, mouse or rat.
21. The library of oligonucleotide probes according to any one of
the preceding claims, wherein said probe target sequences occur at
least once within more than 4% of different target nucleic acids in
a target nucleic acid population.
22. The library of oligonucleotide probes according to any one of
the preceding claims, wherein self-complementary probe sequences
have been omitted from the said library.
23. The library of oligonucleotide probes according to claim 22,
wherein said self-complementary sequences have been
de-selected.
24. The library of oligonucleotide probes according to claim 22,
wherein said self-complementary sequences have been eliminated by
sequence-specific modifications, such as non-standard nucleotides,
nucleotides with SBC nucleobases, 2'-O-methyl, diamine purine,
2-thio uracil, universal or degenerate bases or
minor-groove-binders.
25. The library of oligonucleotide probes according to any one of
the preceding claims, wherein the melting temperature (T.sub.m) of
each probe is adjusted to be suitable for PCR-based assays by
substitution with non-occurring modifications, such as LNA,
optionally modified with SBC nucleobases, 2'-O-methyl, diamine
purine, 2-thio uracil, 5-nitroindole, universal or degenerate
bases, intercalating nucleic acids or minor-groove-binders, to
enhance their binding to a complementary nucleic acid sequence.
26. The library of oligonucleotide probes according to any one of
the preceding claims, wherein the melting temperature (T.sub.m) of
each probe is at least 50.degree. C.
27. The library of oligonucleotide probes according to any one of
the preceding claims, wherein each probe has a DNA nucleotide at
the 5'-end.
28. The library of oligonucleotide probes according to any one of
the preceding claims, wherein each probe contains a
fluorophore-quencher pair for detection.
29. The library of oligonucleotide probes according to any one of
the preceding claims, wherein each probe can be detected by the
molecular beacon principle.
30. The library of oligonucleotide probes according to any one of
the preceding claims, wherein each probe is attached to an
intercalating fluorophore or minor groove binder, which upon
binding to a double-stranded DNA or DNA-RNA hetero-duplex target
alter the fluorescence.
31. The library of oligonucleotide probes according to any one of
the preceding claims, wherein the target population is the human
transcriptome.
32. The library of oligonucleotide probes according to any one of
the preceding claims, wherein each oligonucleotide probe detects
the largest possible number of different target nucleic acids
resulting in maximum coverage for a given target nucleic acid
population by the said library.
33. The library of oligonucleotide probes according to any one of
the preceding claims, wherein the oligonucleotide probes are
selected to have as many target sequences or binding sites as
possible within the target population of nucleic acids in order to
obtain a maximum degree of detection.
34. The library of oligonucleotide probes according to any one of
the preceding claims, wherein the oligonucleotide probes are
selected to have at least one target sequence in as many target
nucleic acids as possible within the target population of nucleic
acids in order to obtain a maximum degree of detection.
35. The library of oligonucleotide probes in TABLE 1 or TABLE 1a or
FIG. 13 or FIG. 14 capable of detecting the complementary sequences
in any given nucleic acid population.
36. The library according to any one of the preceding claims, which
comprises probes each having a recognition element listed in TABLE
1 or TABLE 1a in the specification and/or which comprises probes
each having a recognition element complementary to the recognition
elements listed in said TABLE 1.
37. An oligonucleotide probe useful in a library according to any
one of the preceding claims, said probe being selected from probes
complementary to or identical with the sequences set forth in Table
1, FIG. 13, or FIG. 14.
38. An oligonucleotide probe according to claims 37, which has an
exact nucleotide sequence selected from table 1.
39. A method of selecting oligonucleotide sequences useful in the
library according to any one of the preceding claims, comprising a)
providing a first list of all possible oligonucleotides of a
predefined number of nucleotides, N, said oligonucleotides having a
melting temperature, T.sub.m, of at least 50.degree. C., b)
providing a second list of target nucleic acid sequences, c)
identifying and storing for each member of said first list, the
number of members from said second list, which include a sequence
complementary to said each member, d) selecting a member of said
first list, which in the identification in step c matches the
maximum number, identified in step c, of members from said second
list, e) adding the member selected in step d to a third list
consisting of the selected oligonucleotides useful in the library
according to any one of the preceding claims, f) subtracting the
member selected in step d from said first list to provide a revised
first list, m) repeating steps d through f until said third list
consists of members which together will be contemplary to at least
30% of the members on the list of target nucleic acid sequences
from step b.
40. The method according to claim 39, wherein T.sub.m is at least
60.degree..
41. The method according to any claim 39 or 40, wherein the first
list of oligonucleotides only includes oligonucleotides incapable
of self-hybridization.
42. The method according to any one of claims 39-41, which after
step f and before step m comprises the following steps: g)
subtracting all members from said second list which include a
sequence complementary to the member selected in step d to obtain a
revised second list, h) identifying and storing for each member of
said revised first list, the number of members from said revised
second list, which include a sequence complementary to said each
member, i) selecting a member of said first list, which in the
identification in step h matches the maximum number, identified in
step h, of members from said second list, or selecting a member of
said first list provides the maximum number obtained by multiplying
the number identified in step h with the number identified in step
c, j) adding the member selected in step i to said third list, k)
subtracting the member selected in step i from said revised first
list, and l) subtracting all members from said revised second list
which include a sequence or complementary to the member selected in
step i.
43. The method according to any one of claims 39-42, wherein
repetition in step m is continued until said third list consists of
members which together will be contemplary to at least 85% of the
members on the list of target nucleic acid sequences from step
b.
44. The method according to any one of claims 39-43, wherein, after
selection of the first member of said third list, the selection in
step d after step c is preceded by identification of those members
of said first list which hybridizes to more than a selected
percentage of the maximum number of members from said second list
so that only those members so identified are subjected to the
selection in step d.
45. The method according to claim 44, wherein the selected
percentage is 80%.
46. The method according to any one of claims 39-45, wherein N is
an integer selected from 6, 7, 8, 9, 10, 11, and 12.
47. The method according to claim 46, wherein N is 8 or 9.
48. The method according to any one of claims 39-47, wherein said
second list of step b comprises target nucleic acid sequences as
defined in claim 19 or 20.
49. The method according to any one of claims 39-48, essentially
performed as set forth in FIG. 2.
50. The method according to any one of claims 39-49, wherein said
first, second and third lists are stored in the memory of a
computer system, preferably in a database.
51. A computer program product providing instructions for
implementing the method according to any one of claims 39-50,
embedded in a computer-readable medium.
52. A system comprising a database of target sequences and an
application program for executing the computer program of claim
51.
53. A method for identifying a specific means for detection of a
target nucleic acid, the method comprising A) inputting, into a
computer system, data that uniquely identifies the nucleic acid
sequence of said target nucleic acid, wherein said computer system
comprises a database holding information of the composition of at
least one library of nucleic acid probes according to any one of
claims 1-36, and wherein the computer system further comprises a
database of target nucleic acid sequences for each probe of said at
least one library and/or further comprises means for acquiring and
comparing nucleic acid sequence data, B) identifying, in the
computer system, a probe from the at least one library, wherein the
sequence of the probe exists in the target nucleic acid sequence or
a sequence complementary to the target nucleic acid sequence, C)
identifying, in the computer system, primer that will amplify the
target nucleic acid sequence, and D) providing, as identification
of the specific means for detection, an output that points out the
probe identified in step B and the sequences of the primers
identified in step C.
54. The method according to claim 53, wherein step A also comprises
inputting, into the computer system, data that identifies the at
least one library of nucleic acids from which it is desired to
select a member for use in the specific means for detection.
55. The method according to claim 54, wherein the data that
identifies the composition of the at least one library is a product
code.
56. The method according to any one of claims 53-55, wherein
inputting in step A is performed via an internet web interface.
57. The method according to any one of claims 53-55, wherein the
primers identified in step C are chosen so as to minimize the
chance of amplifying genomic nucleic acids in a PCR reaction.
58. The method according to claim 57, wherein at least one of the
primers is selected so as to include a nucleotide sequence which in
genomic DNA is interrupted by an intron.
59. The method according to any one of claims 53-58, wherein the
primers selected in step C are chosen so as to minimize length of
amplicons obtained from PCR performed on the target nucleic acid
sequence.
60. The method according to any one of claims 53-59, wherein the
primers selected in step C are chosen so as to optimize the GC
content for performing PCR.
61. A computer program product providing instructions for
implementing the method according to any one of claims 53-60
embedded in a computer-readable medium.
62. A system comprising a database of nucleic acid probes as
defined in any one of claims 1-36 and an application program for
executing the computer program of claim 61.
63. A method for profiling a plurality of target sequences
comprising contacting a sample of target sequences with a library
according to any one of claims 1-36 and detecting, characterizing
or quantifying the probe sequences which bind to the target
sequences.
64. The method according to claim 63, providing detection of a
nucleic acid sequence which is present in less than 10% of the
plurality of sequences which are bound by the multi-probe
sequences.
65. The method according to claim 64, wherein the target mRNA
sequences or cDNA sequences comprise a transcriptome.
66. The method according to claim 65, wherein the transcriptome is
a human transcriptome.
67. The method according to any one of claims 63-66, wherein the
library of probes are covalently coupled to a solid support.
68. The method according to claim 67, wherein the solid support
comprises a microtiter plate and each well of the microtiter plate
comprises a different library probe.
69. The method according to any one of claims 63-68, wherein the
step of detecting is performed by amplifying a target nucleic acid
sequence containing a recognition sequence complementary to a
library probe.
70. The method of claim 69, wherein target nucleic acid
amplification is carried out by using a pair of oligonucleotide
primers flanking the recognition sequence complementary to a
library probe.
71. The method of claim 63-70, wherein the presence or expression
level of one or more target nucleic acid sequences is correlated
with a species' phenotype.
72. The method of claim 71, wherein the phenotype is a disease.
73. A method of analysing a mixture of nucleic acids using a
library according to any one of claims 1-36 comprising the steps of
(a) contacting a target oligonucleotide with a library of labelled
oligonucleotide probes, each of said oligonucleotide probes having
a known sequence and being attached to a solid support at a known
position, to hybridize said target oligonucleotide to at least one
member of said library of probes, thereby forming a hybridized
library; (b) contacting said hybridized library with a nuclease
capable of cleaving double-stranded oligonucleotides to release
from said hybridized library a portion of said labelled
oligonucleotide probes or fragments thereof; and (c) identifying
said positions of said hybridized library from which labelled
probes or fragments thereof have been removed, to determine the
sequence of said unlabelled target oligonucleotide.
74. A method of analysing a mixture of nucleic acids using a
library of any one of claims 1-36 comprising the steps of (a)
contacting a target oligonucleotide with a library of labelled
oligonucleotide probes, each of said oligonucleotide probes having
a known sequence and being attached to a solid support at a known
position, to hybridize said target oligonucleotide to at least one
member of said library of probes, thereby forming a hybridized
library; (b) identifying said positions of said hybridized library
at which labelled probes or fragments thereof have hybridized, to
determine the sequence of said target oligonucleotide; and (c)
identifying said positions of said hybridized library from which
labelled probes or fragments thereof have been removed, to
determine the sequence of said unlabelled target
oligonucleotide.
75. A method for quantitatively or qualitatively determining the
presence of a target nucleic acid in a sample, the method
comprising i) identifying, by means of the method according to any
one of claims 53-60, a specific means for detection of the target
nucleic acid, where the specific means for detection comprises an
oligonucleotide probe and a set of primers, ii) obtaining the
primers and the oligonucleotide probe identified in step i), iii)
subjecting the sample to a molecular amplification procedure in the
presence of the primers and the oligonucleotide probe from step
ii), and iv) determining the presence of the target nucleic acid
based on the outcome of step iii).
76. The method according to claim 75, wherein the primers obtained
in step ii) are obtained by synthesis.
77. The method according to claim 75 or 76 or, wherein the
oligonucleotide probe is obtained from a library according to any
one of claims 1-36.
78. The method according to any one of claims 75-77, wherein the
procedure in step iii) is a PCR or a NASBA procedure.
79. The method according to claim 78, wherein the PCR procedure is
a qPCR.
Description
FIELD OF THE INVENTION
[0001] The invention relates to nucleic acid probes, nucleic acid
probe libraries, and kits for detecting, classifying, or
quantitating components in a complex mixture of nucleic acids, such
as a transcriptome, and methods of using the same.
BACKGROUND OF THE INVENTION
[0002] With the advent of microarrays for profiling the expression
of thousands of genes, such as GeneChip.TM. arrays (Affymetrix,
Inc., Santa Clara, Calif.), correlations between expressed genes
and cellular phenotypes may be identified at a fraction at the cost
and labour necessary for traditional methods, such as Northern- or
dot-blot analysis. Microarrays permit the development of multiple
parallel assays for identifying and validating biomarkers of
disease and drug targets which can be used in diagnosis and
treatment. Gene expression profiles can also be used to estimate
and predict metabolic and toxicological consequences of exposure to
an agent (e.g., such as a drug, a potential toxin or carcinogen,
etc.) or a condition (e.g., temperature, pH, etc).
[0003] Microarray experiments often yield redundant data, only a
fraction of which has value for the experimenter. Additionally,
because of the highly parallel format of microarray-based assays,
conditions may not be optimal for individual capture probes. For
these reasons, microarray experiments are most often followed up
by, or sequentially replaced by, confirmatory studies using
single-gene homogeneous assays. These are most often quantitative
PCR-based methods such as the 5' nuclease assay or other types of
dual labelled probe quantitative assays. However, these assays are
still time-consuming, single-reaction assays that are hampered by
high costs and time-consuming probe design procedures. Further, 5'
nuclease assay probes are relatively large (e.g., 15-30
nucleotides). Thus, the limitations in homogeneous assay systems
currently known create a bottleneck in the validation of microarray
findings, and in focused target validation procedures.
[0004] An approach to avoid this bottleneck is to omit the
expensive dual-labelled indicator probes used in 5' nuclease assay
procedures and molecular beacons and instead use
non-sequence-specific DNA intercalating dyes such as SYBR Green
that fluoresce upon binding to double-stranded but not
single-stranded DNA. Using such dyes, it is possible to universally
detect any amplified sequence in real-time. However, this
technology is hampered by several problems. For example,
nonspecific priming during the PCR amplification process can
generate unintentional non-target amplicons that will contribute in
the quantification process. Further, interactions between PCR
primers in the reaction to form "primer-dimers" are common. Due to
the high concentration of primers typically used in a PCR reaction,
this can lead to significant amounts of short double-stranded
non-target amplicons that also bind intercalating dyes. Therefore,
the preferred method of quantitating mRNA by real-time PCR uses
sequence-specific detection probes.
[0005] One approach for avoiding the problem of random
amplification and the formation of primer-dimers is to use generic
detection probes that may be used to detect a large number of
different types of nucleic acid molecules, while retaining some
sequence specificity has been described by Simeonov, et al.
(Nucleic Acid Research 30(17): 91, 2002; U.S. patent Publication
20020197630) and involves the use of a library of probes comprising
more than 10% of all possible sequences of a given length (or
lengths). The library can include various non-natural nucleobases
and other modifications to stabilize binding of probes/primers in
the library to a target sequence. Even so, a minimal length of at
least 8 bases is required for most sequences to attain a degree of
stability that is compatible with most assay conditions relevant
for applications such as real time PCR. Because a universal library
of all possible 8-mers contains 65,536 different sequences, even
the smallest library previously considered by Simeonov, et al.
contains more than 10% of all possibilities, i.e. at least 6554
sequences which is impractical to handle and vastly expensive to
construct.
[0006] From a practical point of view, several factors limit the
ease of use and accessibility of contemporary homogeneous assays
applications. The problems encountered by users of conventional
assay technologies include:
[0007] prohibitively high costs when attempting to detect many
different genes in a few samples, because the price to purchase a
probe for each transcript is high.
[0008] the synthesis of labelled probes is time-consuming and often
the time from order to receipt from manufacturer is more than 1
week.
[0009] User-designed kits may not work the first time and validated
kits are expensive per assay.
[0010] it is difficult to quickly test for a new target or
iteratively improve probe design.
[0011] the exact probe sequence of commercial validated probes may
be unknown for the customer resulting in problems with evaluation
of results and suitability for scientific publication.
[0012] When assay conditions or components are obscure it may be
impossible to order reagents from alternative source.
[0013] The described invention address these practical problems and
aim to ensure rapid and inexpensive assay development of accurate
and specific assays for quantification of gene transcripts.
SUMMARY OF THE INVENTION
[0014] It is desirable to be able to quantify the expression of
most genes (e.g., >98%) in e.g. the human transcriptome using a
limited number of oligonucleotide detection probes in a homogeneous
assay system. The present invention solves the problems faced by
contemporary approaches to homogeneous assays outlined above by
providing a method for construction of generic multi-probes with
sufficient sequence specificity--so that they are unlikely to
detect a randomly amplified sequence fragment or primer-dimers--but
are still capable of detecting many different target sequences
each. Such probes are usable in different assays and may be
combined in small probe libraries (50 to 500 probes) that can be
used to detect and/or quantify individual components in complex
mixtures composed of thousands of different nucleic acids (e.g.
detecting individual transcripts in the human transcriptome
composed of >30,000 different nucleic acids.) when combined with
a target specific primer set.
[0015] Each multi-probe comprises two elements: 1) a detection
element or detection moiety consisting of one or more labels to
detect the binding of the probe to the target; and 2) a recognition
element or recognition sequence tag ensuring the binding to the
specific target(s) of interest. The detection element can be any of
a variety of detection principles used in homogeneous assays. The
detection of binding is either direct by a measurable change in the
properties of one or more of the labels following binding to the
target (e.g. a molecular beacon type assay with or without stem
structure) or indirect by a subsequent reaction following binding
(e.g. cleavage by the 5' nuclease activity of the DNA polymerase in
5' nuclease assays).
[0016] The recognition element is a novel component of the present
invention. It comprises a short oligonucleotide moiety whose
sequence has been selected to enable detection of a large subset of
target nucleotides in a given complex sample mixture. The novel
probes designed to detect many different target molecules each are
referred to as multi-probes. The concept of designing a probe for
multiple targets and exploit the recurrence of a short recognition
sequence by selecting the most frequently encountered sequences is
novel and contrary to conventional probes that are designed to be
as specific as possible for a single target sequence. The
surrounding primers and the choice of probe sequence in combination
subsequently ensures the specificity of the multi-probes. The novel
design principles arising from attempts to address the largest
number of targets with the smallest number of probes are likewise
part of the invention. This is enabled by the discovery that very
short 8-9 mer LNA mix-mer probes are compatible with PCR based
assays. In one aspect of the present invention modified or analogue
nucleobases, nucleosidic bases or nucleotides are incorporated in
the recognition element, possibly together with minor groove
binders and other modifications, that all aim to stabilize the
duplex formed between the probe and the target molecule so that the
shortest possible probe sequence with the widest range of targets
can be used. In a preferred aspect of the invention the
modifications are incorporation of LNA residues to reduce the
length of the recognition element to 8 or 9 nucleotides while
maintaining sufficient stability of the formed duplex to be
detectable under ordinary assay conditions.
[0017] Preferably, the multi-probes are modified in order to
increase the binding affinity of the probe for a target sequence by
at least two-fold compared to a probe of the same sequence without
the modification, under the same conditions for detection, e.g.,
such as PCR conditions, or stringent hybridization conditions. The
preferred modifications include, but are not limited to, inclusion
of nucleobases, nucleosidic bases or nucleotides that has been
modified by a chemical moiety or replaced by an analogue (e.g.
including a ribose or deoxyribose analogue) or by unsing
internucleotide linkages other than phosphodiester linkages (such
as non-phosphate internucleotide linkages), all to increase the
binding affinity. The preferred modifications may also include
attachment of duplex stabilizing agents e.g., such as
minor-groove-binders (MGB) or intercalating nucleic acids (INA).
Additionally the preferred modifications may also include addition
of non-discriminatory bases e.g., such as 5-nitroindole, which are
capable of stabilizing duplex formation regardless of the
nucleobase at the opposing position on the target strand. Finally,
multi-probes composed of a non-sugar-phosphate backbone, e.g. such
as PNA, that are capable of binding sequence specifically to a
target sequence are also considered as modification. All the
different binding affinity increased modifications mentioned above
will in the following be referred to as "the stabilizing
modification(s)", and the ensuing multi-probe will in the following
also be referred to as "modified oligonucleotide". More preferably
the binding affinity of the modified oligonucleotide is at least
about 3-fold, 4-fold, 5-fold, or 20-fold higher than the binding of
a probe of the same sequence but without the stabilizing
modification(s).
[0018] Most preferably, the stabilizing modification(s) is
inclusion of one or more LNA nucleotide analogs. Probes of from 6
to 12 nucleotides according to the invention may comprise from 1 to
8 stabilizing nucleotides, such as LNA nucleotides. When at least
two LNA nucleotides are included, these may be consecutive or
separated by one or more non-LNA nucleotides. In one aspect, LNA
nucleotides are alpha and/or xylo LNA nucleotides.
[0019] The invention also provides oligomer multi-probe library
useful under conditions used in NASBA based assays. NASBA is a
specific, isothermal method of nucleic acid amplification suited
for the amplification of RNA. Nucleic acid isolation is achieved
via lysis with guanidine thiocyanate plus Triton X-100 and ending
with purified nucleic acid being eluted from silicon dioxide
particles. Amplification by NASBA involves the coordinated
activities of three enzymes, AMV Reverse Transcriptase, RNase H,
and T7 RNA Polymerase. Quantitative detection is achieved by way of
internal calibrators, added at isolation, which are co-amplified
and subsequently identified along with the wild type of RNA using
electro chemiluminescence.
[0020] The invention also provides an oligomer multi-probe library
comprising multi-probes comprising at least one with stabilizing
modifications as defined above. Preferably, the probes are less
than about 20 nucleotides in length and more preferably less than
12 nucleotides, and most preferably about 8 or 9 nucleotides. Also,
preferably, the library comprises less than about 3000 probes and
more preferably the library comprises less than 500 probes and most
preferably about 100 probes. The libraries containing labelled
multi-probes may be used in a variety of applications depending on
the type of detection element attached to the recognition element.
These applications include, but are not limited to, dual or single
labelled assays such as 5' nuclease assay, molecular beacon
applications (see, e.g., Tyagi and Kramer Nat. Biotechnol. 14:
303-308, 1996) and other FRET-based assays.
[0021] In one aspect of the invention the multi-probes described
above, are designed together to complement each other as a
predefined subset of all possible sequences of the given lengths
selected to be able to detect/characterize/quantify the largest
number of nucleic acids in a complex mixture using the smallest
number of multi-probe sequences. These predesigned small subsets of
all possible sequences constitute a multi-probe library. The
multi-probe libraries described by the present invention attains
this functionality at a greatly reduced complexity by deliberately
selecting the most commonly occurring oligomers of a given length
or lengths while attempting to diversify the selection to get the
best possible coverage of the complex nucleic acid target
population. In one preferred aspect, probes of the library
hybridize with more than about 60% of a target population of
nucleic acids, such as a population of human mRNAs. More
preferably, the probes hybridize with greater than 70%, greater
than 80%, greater than 90%, greater than 95% and even greater than
98% of all target nucleic acid molecules in a population of target
molecules (see, e.g., FIG. 1).
[0022] In a most preferred aspect of the invention, a probe library
(i.e. such as about 100 multiprobes) comprising about 0.1% of all
possible sequences of the selected probe length(s), is capable of
detecting, classifying, and/or quantifying more than 98% of mRNA
transcripts in the transcriptome of any specific species,
particulary mammals and more particular humans (i.e., >35,000
different mRNA sequences). In fact, it is preferred that at least
85% of all target nucleic acids in a target population are covered
by a multi-probe library of the invention.
[0023] The problems with existing homogeneous assays mentioned
above are addressed by the use of a multi-probe library according
to the invention consisting of a minimal set of short detection
probes selected so as to recognize or detect a majority of all
expressed genes in a given cell type from a given organism. In one
aspect, the library comprises probes that detect each transcript in
a transcriptome of greater than about 10,000 genes, greater than
about 15,000 genes, greater than about 20,000 genes, greater than
about 25,000 genes, greater than about 30,000 genes or greater than
about 35,000 genes or equivalent numbers of different mRNA
transcripts. In one preferred aspect, the library comprises probes
that detect mammalian transcripts sequences, e.g., such as mouse,
rat, rabbit, monkey, or human sequences.
[0024] By providing a cost efficient multi-probe set useful for
rapid development of quantitative realtime and end-point PCR
assays, the present invention overcomes the limitations discussed
above for contemporary homogeneous assays. The detection element of
the multi-probes according to the invention may be single or doubly
labelled (e.g. by comprising a label at each end of the probe, or
an internal position). Thus, probes according to the invention can
be adapted for use in 5' nuclease assays, molecular beacon assays,
FRET assays, and other similar assays. In one aspect, the detection
multi-probe comprises two labels capable of interacting with each
other to produce a signal or to modify a signal, such that a signal
or a change in a signal may be detected when the probe hybridizes
to a target sequence. A particular aspect is when the two labels
comprise a quencher and a reporter molecule.
[0025] In another aspect, the probe comprises a target-specific
recognition segment capable of specifically hybridizing to a
plurality of different nucleic acid molecules comprising the
complementary recognition sequence. A particular detection aspect
of the invention referred to as a "molecular beacon with a stem
region" is when the recognition segment is flanked by first and
second complementary hairpin-forming sequences which may anneal to
form a hairpin. A reporter label is attached to the end of one
complementary sequence and a quenching moiety is attached to the
end of the other complementary sequence. The stem formed when the
first and second complementary sequences are hybridized (i.e., when
the probe recognition segment is not hybridized to its target)
keeps these two labels in close proximity to each other, causing a
signal produced by the reporter to be quenched by fluorescence
resonance energy transfer (FRET). The proximity of the two labels
is reduced when the probe is hybridized to a target sequence and
the change in proximity produces a change in the interaction
between the labels. Hybridization of the probe thus results in a
signal (e.g. fluorescence) being produced by the reporter molecule,
which can be detected and/or quantified.
[0026] In another aspect, the multi-probe comprises a reporter and
a quencher molecule at opposing ends of the short recognition
sequence, so that these moieties are in sufficient proximity to
each other, that the quencher substantially reduces the signal
produced by the reporter molecule. This is the case both when the
probe is free in solution as well as when it is bound to the target
nucleic acid. A particular detection aspect of the invention
referred to as a "5' nuclease assay" is when the multi-probe may be
susceptible to cleavage by the 5' nuclease activity of the DNA
polymerase. This reaction may possibly result in separation of the
quencher molecule from the reporter molecule and the production of
a detectable signal. Thus, such probes can be used in
amplification-based assays to detect and/or quantify the
amplification process for a target nucleic acid.
[0027] In a first aspect, the present invention relates to
libraries of multi-probes as discussed above. In such a library of
oligonucleotide probes, each probe comprises a detection element
and a recognition segment having a length of about x nucleotides,
where some or all of the nucleobases in said oligonucleotides are
substituted by non-natural bases having the effect of increasing
binding affinity compared to natural nucleobases, and/or some or
all of the nucleotide units of the oligonucleotide probe are
modified with a chemical moiety to increase binding affinity,
and/or where said oligonucleotides are modified with a chemical
moiety to increase binding affinity, such that the probe has
sufficient stability for binding to the target sequence under
conditions suitable for detection, and wherein the number of
different recognition segments comprises less than 10% of all
possible segments of the given length, and wherein more than 90% of
the probes can detect more than one complementary target in a
target population of nucleic acids such that the library of
oligonucleotide probes can detect a substantial fraction of all
target sequences in a target population of nucleic acids.
[0028] The invention therefore relates to a library of
oligonucleotide probes wherein each probe in the library consists
of a recognition sequence tag and a detection moiety wherein at
least one monomer in each oligonucleotide probe is a modified
monomer analogue, increasing the binding affinity for the
complementary target sequence relative to the corresponding
unmodified oligodeoxyribonucleotide, such that the library probes
have sufficient stability for sequence-specific binding and
detection of a substantial fraction of a target nucleic acid in any
given target population and wherein the number of different
recognition sequences comprises less than 10% of all possible
sequence tags of a given length(s).
[0029] The invention further relates to a library of
oligonucleotide probes wherein the recognition sequence tag segment
of the probes in the library have been modified in at least one of
the following ways:
[0030] i) substitution with at least one non-naturally occurring
nucleotide; and
[0031] ii) substitution with at least one chemical moiety to
increase the stability of the probe.
[0032] Further, the invention relates to a library of
oligonucleotide probes wherein the recognition sequence tag has a
length of 6 to 12 nucleotides (i.e. 6, 7, 8, 9, 10, 11 or 12), and
wherein the preferred length is 8 or 9 nucleotides.
[0033] Further, the invention relates to recognition sequence tags
that are substituted with LNA nucleotides.
[0034] Moreover, the inventon relates to libraries of the invention
where more than 90% of the oligonucleotide probes can bind and
detect at least two target sequences in a nucleic acid population,
preferably because the bound target sequences that are
complementary to the recognition sequence of the probes.
[0035] Also preferably, the probe is capable of detecting more than
one target in a target population of nucleic acids, e.g., the probe
is capable of hybridizing to a plurality of different nucleic acid
molecules contained within the target population of nucleic
acids.
[0036] The invention also provides a method, system and computer
program embedded in a computer readable medium ("a computer program
product") for designing multi-probes comprising at least one
stabilizing nucleobase. The method comprises querying a database of
target sequences (e.g., such as a database of expressed sequences)
and designing a small set of probes (e.g. such as 50 or 100 or 200
or 300 or 500) which: i) has sufficient binding stability to bind
their respective target sequence under PCR conditions, ii) have
limited propensity to form duplex structures with itself, and iii)
are capable of binding to and detecting/quantifying at least about
60%, at least about 70%, at least about 80%, at least about 90% or
at least about 95% of all the sequences in the given database of
sequences, such as a database of expressed sequences.
[0037] Probes are designed in silico, which comprise all possible
combinations of nucleotides of a given length forming a database of
virtual candidate probes. These virtual probes are queried against
the database of target sequences to identify probes that comprise
the maximal ability to detect the most different target sequences
in the database ("optimal probes"). Optimal probes so identified
are removed from the virtual probe database. Additionally, target
nucleic acids, which were identified by the previous set of optimal
probes, are subtracted from the target nucleic acid database. The
remaining probes are then queried against the remaining target
sequences to identify a second set of optimal probes. The process
is repeated until a set of probes is identified which can provide
the desired coverage of the target sequence database. The set may
be stored in a database as a source of sequences for transcriptome
analysis. Multi-probes may be synthesized having recognition
sequences, which correspond to those in the database to generate a
library of multi-probes.
[0038] In one preferred aspect, the target sequence database
comprises nucleic acid sequences corresponding to human mRNA (e.g.,
mRNA molecules, cDNAs, and the like).
[0039] In another aspect, the method further comprises calculating
stability based on the assumption that the recognition sequence
comprises at least one stabilizing nucleotide, such as an LNA
molecule. In one preferred aspect the calculated stability is used
to eliminate probe recognition sequences with inadequate stability
from the database of virtual candidate probes prior to the initial
query against the database of target sequence to initiate the
identification of optimal probe recognition sequences.
[0040] In another aspect, the method further comprises calculating
the propensity for a given probe recognition sequence to form a
duplex structure with itself based on the assumption that the
recognition sequence comprises at least one stabilizing nucleotide,
such as an LNA molecule. In one preferred aspect the calculated
propensity is used to eliminate probe recognition sequences that
are likely to form probe duplexes from the database of virtual
candidate probes prior to the initial query against the database of
target sequence to initiate the determination of optimal probe
recognition sequences.
[0041] In another aspect, the method further comprises evaluating
the general applicability of a given candidate probe recognition
sequence for inclusion in the growing set of optimal probe
candidates by both a query against the remaining target sequences
as well as a query against the original set of target sequences. In
one preferred aspect only probe recognition sequences that are
frequently found in both the remaining target sequences and in the
original target sequences are added to in the growing set of
optimal probe recognition sequences. In a most preferred aspect
this is accomplished by calculating the product of the scores from
these queries and selecting the probes recognition sequence with
the highest product that still is among the probe recognition
sequences with 20% best score in the query against the current
targets.
[0042] The invention also provides a computer program embedded in a
computer readable medium comprising instructions for searching a
database comprising a plurality of different target sequences and
for identifying a set of probe recognition sequences capable of
identifying to at least about 60%, about 70%, about 80%, about 90%
and about 95% of the sequences within the database. In one aspect,
the program provides instructions for executing the method
described above. In another aspect, the program provides
instructions for implementing an algorithm as shown in FIG. 2. The
invention further provides a system wherein the system comprises a
memory for storing a database comprising sequence information for a
plurality of different target sequences and also comprises an
application program for executing the program instructions for
searching the database for a set of probe recognition sequences
which is capable of hybridizing to at least about 60%, about 70%,
about 80%, about 90% and about 95% of the sequences within the
database.
[0043] Another aspect of the invention relates to an
oligonucleotide probe comprising a detection element and a
recognition segment each independently having a length of about 1
to 8 nucleotides, wherein some or all of the nucleotides in the
oligonucleotides are substituted by non-natural bases or base
analogues having the effect of increasing binding affinity compared
to natural nucleobases and/or some or all of the nucleotide units
of the oligonucleotide probe are modified with a chemical moiety or
replaced by an analogue to increase binding affinity, and/or where
said oligonucleotides are modified with a chemical moiety or is an
oligonucleotide analogue to increase binding affinity, such that
the probe has sufficient stability for binding to the target
sequence under conditions suitable for detection, and wherein the
probe is capable of detecting more than one complementary target in
a target population of nucleic acids.
[0044] A preferred embodiment of the invention is a kit for the
characterization or detection or quantification of target nucleic
acids comprising samples of a library of multi-probes. In one
aspect, the kit comprises in silico protocols for their use. In
another aspect, the kit comprises information relating to
suggestions for obtaining inexpensive DNA primers. The probes
contained within these kits may have any or all of the
characteristics described above. In one preferred aspect, a
plurality of probes comprises at least one stabilizing nucleotide,
such as an LNA nucleotide. In another aspect, the plurality of
probes comprises a nucleotide coupled to or stably associated with
at least one chemical moiety for increasing the stability of
binding of the probe. In a further preferred aspect, the kit
comprises about 100 different probes. The kits according to the
invention allow a user to quickly and efficiently develop an assay
for thousands of different nucleic acid targets.
[0045] The invention further provides a multi-probe comprising one
or more LNA nucleotide, which has a reduced length of about 8, or 9
nucleotides. By selecting commonly occurring 8 and 9-mers as
targets it is possible to detect many different genes with the same
probe. Each 8 or 9-mer probe can be used to detect more than 7000
different human mRNA sequences. The necessary specificity is then
ensured by the combined effect of inexpensive DNA primers for the
target gene and by the 8 or 9-mer probe sequence targeting the
amplified DNA (FIG. 1).
[0046] In a preferred embodiment the present invention relates to
an oligonucleotide multi-probe library comprising LNA-substituted
octamers and nonamers of less than about 1000 sequences, preferably
less than about 500 sequences, or more preferably less than about
200 sequences, such as consisting of about 100 different sequences
selected so that the library is able to recognize more than about
90%, more preferably more than about 95% and more preferably more
than about 98% of mRNA sequences of a target organism or target
organ.
[0047] Positive Control Samples:
[0048] A recurring problem in designing real-time PCR detection
assays for multiple genes is that the success-rate of these de-novo
designs is less than 100%. Troubleshooting a nonfunctional assay
can be cumbersome since ideally, a target specific template is
needed for each probe, to test the functionality of the detection
probe. Furthermore, a target specific template can be useful as a
positive control if it is unknown whether the target is available
in the test sample. When operating with a limited number of
detection probes in a probelibrary kit as described in the present
invention (eg. 90), it is feasible to also provide positive control
targets in the form of PCR-amplifiable templates containing all
possible targets for the limited number of probes (eg. 90). This
feature allows users to evaluate the function of each probe, and is
not feasible for non-recurring probe-based assays, and thus
constitutes a further beneficial feature of the invention. For the
suggested preferred probe recognition sequences listed in FIG. 13,
we have designed concatamers of control sequences for all probes,
containing a PCR-amplifiable target for every probe in the 40 first
probes.
[0049] Probe Sequence Selection
[0050] An important aspect of the present invention is the
selection of optimal probe target sequences in order to target as
many targets with as few probes as possible, given a target
selection criteria. This may be achieved by deliberately selecting
target sequences that occur more frequently than what would have
been expected from a random distribution.
[0051] The invention therefore relates in one aspect to a method of
selecting oligonucleotide sequences useful in a multi-probe library
of the invention, the method comprising
[0052] a) providing a first list of all possible oligonucleotides
of a predefined number of nucleotides, N (typically an integer
selected from 6, 7, 8, 9, 10, 11, and 12, preferably 8 or 9), said
oligonucleotides having a melting temperature, Tm, of at least
50.degree. C. (preferably at least 60.degree. C.),
[0053] b) providing a second list of target nucleic acid sequences
(such as a list of a target nucleic acid population discussed
herein),
[0054] c) identifying and storing for each member of said first
list, the number of members from said second list, which include a
sequence complementary to said each member,
[0055] d) selecting a member of said first list, which in the
identification in step c matches the maximum number, identified in
step c, of members from said second list,
[0056] e) adding the member selected in step d to a third list
consisting of the selected oligonucleotides useful in the library
according to any one of the preceding claims,
[0057] f) subtracting the member selected in step d from said first
list to provide a revised first list, m) repeating steps d through
f until said third list consists of members which together will be
contemplary to at least 30% of the members on the list of target
nucleic acid sequences from step b (normally the percentage will be
higher, such as at least 40%, at least 50%, at least 60%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, or even higher such as at least 97%, at least 98% and
even as high as at least 99%).
[0058] It is preferred that the first list only includes
oligonucleotides incapable of self-hybridization in order to render
a subsequent use of the probes less prone to false positives.
[0059] The selection method may include a number of steps after
step f, but before step m
[0060] g) subtraction of all members from said second list which
include a sequence complementary to the member selected in step d
to obtain a revised second list,
[0061] h) identification and storing of, for each member of said
revised first list, the number of members from said revised second
list, which include a sequence complementary to said each member,
i) selecting a member of said first list, which in the
identification in step h matches the maximum number, identified in
step h, of members from said second list, or selecting a member of
said first list provides the maximum number obtained by multiplying
the number identified in step h with the number identified in step
c,
[0062] j) addition of the member selected in step i to said third
list,
[0063] k) subtraction of the member selected in step i from said
revised first list, and
[0064] l) subtraction of all members from said revised second list
which include a sequence or complementary to the member selected in
step i.
[0065] The selection in step d after step c is conveniently
preceded by identification of those members of said first list
which hybridizes to more than a selected percentage (60% or higher
such as the preferred 80%) of the maximum number of members from
said second list so that only those members so identified are
subjected to the selection in step d.
[0066] In the practical implementation of the selection method,
said first, second and third lists are stored in the memory of a
computer system, preferably in a database. The memory (also termed
"computer readable medium") can be both volatile and non-volatile,
i.e. any memory device conventionally used in computer systems: a
random access memory (RAM), a read-only memory (ROM), a data
storage device such as a hard disk, a CD-ROM, DVD-ROM, and any
other known memory device.
[0067] The invention also provides a computer program product
providing instructions for implementing the selection method,
embedded in a computer-readable medium (defined as above). That is,
the computer program may be compiled and loaded in an active
computer memory, or it may be loaded on a non-volatile storage
device (optionally in a compressed format) from where it can be
executed. Consequently, the invention also includes a system
comprising a database of target sequences and an application
program for executing the computer program. A source code for such
a computer program is set forth in FIG. 17.
[0068] In a randomly distributed nucleic acid population, the
occurrence of selected sequences of a given length will follow a
statistical distribution defined by:
[0069] N1=the complete length of the given nucleic acid population
(eg. 76.002.917 base pairs as in the 1 Jun. 30, 2003 release of
RefSeq).
[0070] N2=the number of fragments comprising the nucleic acid
population (eg 38.556 genes in the 1 Jun. 30, 2003 release of
RefSeq).
[0071] N3=the length of the recognition sequence (eg. 9 base
pairs)
[0072] N4=the occurrence frequency
N4=(N1-((N3-1).times.2.times.N2))/(4.sup.N3) 1 Eg . 76 , 002 , 917
- 8 .times. 2 .times. 38 , 556 4 9 = approximately 287 occurrences
or 9 - mer sequences or or 76 , 002 , 917 - 7 .times. 2 .times. 38
, 556 4 8 = approximately 1 , 151 occurr en ces of 8 - mer
sequences
[0073] Hence, as described in the example given above, a random
8-mer and 9-mer sequence would on average occur 1,151 and 287
times, respectively, in a random population of the described 38,556
mRNA sequences.
[0074] In the example above, the 76.002.917 base pairs originating
from 38.556 genes would correspond to an average transcript length
of 1971 bp, containing each 1971-16 or 1955 9-mer target sequences
each. Thus as a statistical minimum, 38.556/1955/287 or 5671 9-mer
probes would be needed for one probe to target each gene.
[0075] However, the occurrence of 9-mer sequences is not randomly
distributed. In fact, a small subset of sequences occur at
surprisingly high prevalence, up to over 30 times the prevalence
anticipated from a random distribution. In a specific target
population selected according to preferred criteria, preferably the
most common sequences should be selected to increase the coverage
of a selected library of probe target sequences. As described
previously, selection should be step-wise, such that the selection
of the most common target sequences is evaluated as well in the
starting target population as well as in the population remaining
after each selection step.
[0076] In a preferred embodiment of the invention the targets for
the probelibrary are the entire expressed transcriptome.
[0077] Because the success rate of the reverse transcriptase
reaction diminishes with the distance from the RT-primer used, and
since using a poly-T primer targeting the poly-A tract in mRNAs is
common, the above-mentioned target can further be restricted to
only include the 1000 most proximal bases in each mRNA. This may
result in the selection of another set of optimal probe target
sequences for optimal coverage.
[0078] Likewise the above-mentioned target may be restricted to
include only the 50 bp of coding region sequence flanking the
introns of a gene to ensure assays that preferably only monitor
mRNA and not genomic DNA or to only include regions not containing
di-, tri- or tetra repeat sequences, to avoid repetitive binding or
probes or primers or regions not containing know allelic variation,
to avoid primer or probe mis-annealing due to sequence variations
in target sequences or regions of extremely high GC-content to
avoid inhibition of PCR amplification.
[0079] Depending on each target selection the optimal set of probes
may vary, depending in the prevalence of target sequences in each
target selection.
[0080] Selection of Detection Means and Identification of Single
Nucleic Acids
[0081] Another part of the invention relates to identification of a
means for detection of a target nucleic acid, the method
comprising
[0082] A) inputting, into a computer system, data that uniquely
identifies the nucleic acid sequence of said target nucleic acid,
wherein said computer system comprises a database holding
information of the composition of at least one library of nucleic
acid probes of the invention, and wherein the computer system
further comprises a database of target nucleic acid sequences for
each probe of said at least one library and/or further comprises
means for acquiring and comparing nucleic acid sequence data,
[0083] B) identifying, in the computer system, a probe from the at
least one library, wherein the sequence of the probe exists in the
target nucleic acid sequence or a sequence complementary to the
target nucleic acid sequence,
[0084] C) identifying, in the computer system, primer that will
amplify the target nucleic acid sequence, and
[0085] D) providing, as identification of the specific means for
detection, an output that points out the probe identified in step B
and the sequences of the primers identified in step C.
[0086] The above-outlined method has several advantages in the
event it is desired to rapidly and specifically identify a
particular nucleic acid. If the researcher already has acquired a
suitable multi-probe library of the invention, the method makes it
possible within seconds to acquire information relating to which of
the probes in the library one should use for a subsequent assay,
and of the primers one should synthesize. The time factor is
important, since synthesis of a primer pair can be accomplished
overnight, whereas synthesis of the probe would normally be quite
time-consuming and cumbersome.
[0087] To facilitate use of the method, the probe library can be
identified (e.g. by means of a product code which essentially tells
the computer system how the probe library is composed). Step A then
comprises inputting, into the computer system, data that identifies
the at least one library of nucleic acids from which it is desired
to select a member for use in the specific means for detection.
[0088] The preferred inputting interface is an internet-based
web-interface, because the method is conveniently stored on a web
server to allow access from users who have acquired a probe library
of the present invention. However, the method also would be useful
as part of a installable computer application, which could be
installed on a single computer or on a local area network.
[0089] In preferred embodiments of this method, the primers
identified in step C are chosen so as to minimize the chance of
amplifying genomic nucleic acids in a PCR reaction. This is of
course only relevant where the sample is likely to contain genomic
material. One simple way to minimize the chance of amplification of
genomic nucleic acids is to include, in at least one of the
primers, a nucleotide sequence which in genomic DNA is interrupted
by an intron. In this way, the primer will only prime amplification
of transcripts where the intron has been spliced out.
[0090] A further optimization of the method is to choose the
primers in step C so as to minimize the length of amplicons
obtained from PCR performed on the target nucleic acid sequence and
it is further also preferred to select the primers so as to
optimize the GC content for performing a subsequent PCR.
[0091] As for the probe selection method, the selection method for
detection means can be provided to the end-user as a computer
program product providing instructions for implementing the method,
embedded in a computer-readable medium. Consequently, the invention
also provides for a system comprising a database of nucleic acid
probes of the invention and an application program for executing
this computer program.
[0092] The method and the computer programs and system allows for
quantitative or qualitative determination of the presence of a
target nucleic acid in a sample, comprising
[0093] i) identifying, by means of the detection means selection
method of the invention, a specific means for detection of the
target nucleic acid, where the specific means for detection
comprises an oligonucleotide probe and a set of primers,
[0094] ii) obtaining the primers and the oligonucleotide probe
identified in step i),
[0095] iii) subjecting the sample to a molecular amplification
procedure in the presence of the primers and the oligonucleotide
probe from step ii), and
[0096] iv) determining the presence of the target nucleic acid
based on the outcome of step iii).
[0097] Conveniently, primers obtained in step ii) are obtained by
synthesis and it is preferred that the oligonucleotide probe is
obtained from a library of the present invention.
[0098] The molecular amplification method is typically a PCR or a
NASBA procedure, but any in vitro method for specific amplification
(and, possibly, detection) of a nucleic acid is useful. The
preferred PCR procedure is a qPCR (also known as real-time reverse
transcription PCR or kinetic RT-PCR).
[0099] Other aspects of the invention are discussed infra.
BRIEF DESCRIPTION OF THE DRAWINGS
[0100] FIG. 1 illustrates the use of conventional long probes in
panel (A) as well as the properties and use of short multi-probes
(B) from a library constructed according to the invention. The
short multi-probes comprise a recognition segment chosen so that
each probe sequence may be used to detect and/or quantify several
different target sequences comprising the complementary recognition
sequence. FIG. 1A shows a method according to the prior art. FIG.
1B shows a method according to one aspect of the invention.
[0101] FIG. 2 is a flow chart showing a method for designing
multi-probe sequences for a library according to one aspect of the
invention. The method can be implemented by executing instructions
provided by a computer program embedded in a computer readable
medium. In one aspect, the program instructions are executed by a
system, which comprises a database of sequences such as expressed
sequences.
[0102] FIG. 3 is a graph illustrating the redundancy of probes
targeting each gene within a 100-probe library according to one
aspect of the invention. The y-axis shows the number of genes in
the human transcriptome that are targeted by different number of
probes in the library. It is apparent that a majority of all genes
are targeted by several probes. The average number of probes per
gene is 17.4.
[0103] FIG. 4 shows the theoretical coverage of the human
transcriptome by a selection of hyper-abundant oligonucleotides of
a given length. The graphs show the percentage of approximately
38.000 human mRNA sequences that can be detected by an increasing
number of well-chosen short multi-probes of different length. The
graph illustrates the theoretical cover-age of the human
transcriptome by optimally chosen (i.e. hyper-abundant, non-self
complementary and thermally stable) short multi-probes of different
lengths. The Homo sapiens transcriptome sequence was obtained from
European Bioinformatics Institute (EMBL-EBI). A region of 1000 nt
proximal to the 3' end of each mRNA sequence was used for the
analysis (from 50 nt to 1050 nt upstream from the 3' end). As the
amplification of each sequence is by PCR both strands of the
amplified duplex was considered a valid target for multi-probes in
the probe library. Probe sequences that even with LNA substitutions
have inadequate Tm, as well as self-complementary probe sequences
are excluded.
[0104] FIG. 5 shows the MALDI-MS spectrum of the oligonuclotide
probe EQ13992, showing [M-H].sup.-=4121,3 Da.
[0105] FIG. 6 shows representative real time PCR curves for 9-mer
multi-probes detecting target sequences in a dual labelled probe
assay. Results are from real time PCR reactions with 9 nt long LNA
enhanced dual labelled probes targeting different 9-mer sequences
within the same gene. Each of the three different dual labelled
probes were analysed in PCRs generating either the 469, the 570 or
the 671 SSA4 amplicons (each between 81 to 95 nt long). Dual
labelled probe 469, 570, and 671 is shown in Panel a, b, and c,
respectively. Each probe only detects the amplicon it was designed
to detect. The C.sub.t values were 23.7, 23.2, and 23.4 for the
dual labelled probes 469, 570, and 671, respectively.
2.times.10.sup.7 copies of the SSA4 cDNA were added as template.
The high similarity between results despite differences in both
probe sequences and their individual primer pairs indicate that the
assays are very robust.
[0106] FIG. 7 shows examples of real time PCR curves for Molecular
Beacons with a 9-mer and a 10-mer recognition site. Panel (A):
Molecular beacon probe with a 10-mer recognition site detecting the
469 SSA4 amplicon. Signal was only obtained in the sample where
SSA4 cDNA was added (2.times.10.sup.7 copies). A C.sub.t value of
24.0 was obtained. A similar experiment with a molecular beacon
having a 9-mer recognition site detecting the 570 SSA4 amplicon is
shown in panel (B). Signal was only obtained when SSA4 cDNA was
added (2.times.10.sup.7 copies).
[0107] FIG. 8 shows an example of a real time PCR curve for a
SYBR-probe with a 9-mer recognition site targeting the 570 SSA4
amplicon. Signal was only obtained in the sample where SSA4 cDNA
was added (2.times.10.sup.7 copies), whereas no signal was detected
without addition of template.
[0108] FIG. 9 shows a calibration curve for three different 9-mer
multi-probes using a dual labelled probe assay principle. Detection
of different copy number levels of the SSA4 cDNA by the three dual
labelled probes. The threshold cycle nr defines the cycle number at
which signal was first detected for the respective PCR. Slope
(.alpha.) and correlation coefficients (R.sup.2) of the three
linear regression lines are: .alpha.=-3.456 & R.sup.2=0.9999
(Dual-labelled-469), .alpha.=-3.468 & R.sup.2=0.9981
(Dual-labelled-570), and .alpha.=-3.499 & R.sup.2=0.9993
(Dual-labelled-671).
[0109] FIG. 10 shows the use of 9-mer dual labelled multi-probes to
quantify a heat shock protein before and after-exposure to heat
shock in a wild type yeast strain as well as a mutant strain where
the corresponding gene has been deleted. Real time detection of
SSA4 transcript levels in wild type (wt) yeast and in the SSA4
knockout mutant with the Dual-labelled-570 probe is shown. The
different strains were either cultured at 30.degree. C. till
harvest (-HS) or they were exposed to 40.degree. C. for 30 minutes
prior to harvest. The Dual-labelled-570 probe was used in this
example. The transcript was only detected in the wt type strain,
where it was most abundant in the +HS culture. C.sub.t values were
26,1 and 30.3 for the +HS and the -HS culture, respectively.
[0110] FIG. 11 shows an example of how more than one gene can be
detected by the same 9-mer probe while nucleic acid molecules
without the probe target sequence (i.e. complementary to the
recognition sequence) will not be detected. In (a)
Dual-labelled-469 detects both the SSA4 (469 amplicon) and the POL5
transcript with C.sub.t values of 29.7 and 30.1, respectively. No
signal was detected from the APG9 and HSP82 transcripts. In (b)
Dual-labelled-570 detects both the SSA4 (570 amplicon) and the APG9
transcript with C.sub.t values of 31.3 and 29.2 respectively. No
signal is detected from the POL5 and HSP82 transcripts. In (c)
probe Dual-labelled-671 detected both the SSA4 (671 amplicon) and
the HSP82 transcript with C.sub.t values of 29.8 and 25.6
respectively. No signal was detected from the POL5 and APG9
transcripts. The amplicon produced in the different PCRs is
indicated in the legend. The same amount of cDNA was used as in the
experiments depicted in FIG. 10. Only cDNA from non-heat shocked
wild type yeast was used.
[0111] FIG. 12 shows agarose gel electrophoresis of a fraction of
the amplicons generated in the PCR reactions shown in the example
of FIG. 11, demonstrating that the probes are specific for target
sequences comprising the recognition sequence but do not hybridize
to nucleic acid molecules which do not comprise the target
sequence. In lane 1 contain the SSA4-469 amplicon (81 bp), lane 2
contains the POL5 amplicon (94 bp), lane 3 contains the APG9
amplicon (97 bp) and lane 4 contains the HSP82 amplicon (88 bp).
Lane M contains a 50 bp ladder as size indicator. It is clear that
a product was formed in all four cases; however, only amplificates
containing the correct multi-probe target sequence (i.e. SSA4-467
and POL5) were detected by the dual labelled probe 467. That two
different amplificates were indeed produced and detected is evident
from the size difference in the detected fragments from lane 1 and
2.
[0112] FIG. 13: Preferred target sequences.
[0113] FIG. 14: Further Preferred target sequences.
[0114] FIG. 15: Longmers (positive controls). The sequences are set
forth in SEQ ID NOs. 32-46.
[0115] FIG. 16: Procedure for the selection of probes and the
designing of primers for qPCR.
[0116] FIG. 17: Source code for the program used in the calculation
of a multi-probe dataset.
DETAILED DESCRIPTION
[0117] The present invention relates to short oligonucleotide
probes or multi-probes, chosen and designed to detect, classify or
characterize, and/or quantify many different target nucleic acid
molecules. These multi-probes comprise at least one non-natural
modification (e.g. such as LNA nucleotide) for increasing the
binding affinity of the probes for a recognition sequence, which is
a subsequence of the target nucleic acid molecules. The target
nucleic acid molecules are otherwise different outside of the
recognition sequence.
[0118] In one aspect, the multi-probes comprise at least one
nucleotide modified with a chemical moiety for increasing binding
affinity of the probes for a recognition sequence, which is a
subsequence of the target nucleic acid sequence. In another aspect,
the probes comprise both at least one non-natural nucleotide and at
least one nucleotide modified with a chemical moiety. In a further
aspect, the at least one non-natural nucleotide is modified by the
chemical moiety. The invention also provides kits, libraries and
other compositions comprising the probes.
[0119] The invention further provides methods for choosing and
designing suitable oligonucleotide probes for a given mixture of
target sequences, ii) individual probes with these abilities, and
iii) libraries of such probes chosen and designed to be able to
detect, classify, and/or quantify the largest number of target
nucleotides with the smallest number of probe sequences. Each probe
according to the invention is thus able to bind many different
targets, but may be used to create a specific assay when combined
with a set of specific primers in PCR assays.
[0120] Preferred oligonucleotides of the invention are comprised of
about 8 to 9 nucleotide units, a substantial portion of which
comprises stabilizing nucleotides, such as LNA nucleotides. A
preferred library contains approximately 100 of these probes chosen
and designed to characterize a specific pool of nucleic acids, such
as mRNA, cDNA or genomic DNA. Such a library may be used in a wide
variety of applications, e.g., gene expression analyses, SNP
detection, and the like. (See, e.g., FIG. 1).
[0121] Definitions
[0122] The following definitions are provided for specific terms,
which are used in the disclosure of the present invention:
[0123] As used herein, the singular form "a", "an" and "the"
include plural references unless the context clearly dictates
otherwise. For example, the term "a cell" includes a plurality of
cells, including mixtures thereof. The term "a nucleic acid
molecule" includes a plurality of nucleic acid molecules.
[0124] As used herein, the term "transcriptome" refers to the
complete collection of transcribed elements of the genome of any
species.
[0125] In addition to mRNAs, it also represents non-coding RNAs
which are used for structural and regulatory purposes.
[0126] As used herein, the term "amplicon refers to small,
replicating DNA fragments.
[0127] As used herein, a "sample" refers to a sample of tissue or
fluid isolated from an organism or organisms, including but not
limited to, for example, skin, plasma, serum, spinal fluid, lymph
fluid, synovial fluid, urine, tears, blood cells, organs, tumors,
and also to samples of in vitro cell culture constituents
(including but not limited to conditioned medium resulting from the
growth of cells in cell culture medium, recombinant cells and cell
components).
[0128] As used herein, an "organism" refers to a living entity,
including but not limited to, for example, human, mouse, rat,
Drosophila, C. elegans, yeast, Arabidopsis, zebra fish, primates,
domestic animals, etc.
[0129] By the term "SBC nucleobases" is meant "Selective Binding
Complementary" nucleobases, i.e. modified nucleobases that can make
stable hydrogen bonds to their complementary nucleobases, but are
unable to make stable hydrogen bonds to other SBC nucleobases. As
an example, the SBC nucleobase A', can make a stable hydrogen
bonded pair with its complementary unmodified nucleobase, T.
Likewise, the SBC nucleobase T' can make a stable hydrogen bonded
pair with its complementary unmodified nucleobase, A. However, the
SBC nucleobases A' and T' will form an unstable hydrogen bonded
pair as compared to the base-pairs A'-T and A-T'. Likewise, a SBC
nucleobase of C is designated C' and can make a stable hydrogen
bonded pair with its complementary unmodified nucleobase G, and a
SBC nucleobase of G is designated G' and can make a stable hydrogen
bonded pair with its complementary unmodified nucleobase C, yet C'
and G' will form an unstable hydrogen bonded pair as compared to
the basepairs C'-G and C-G'. A stable hydrogen bonded pair is
obtained when 2 or more hydrogen bonds are formed e.g. the pair
between A' and T, A and T', C and G', and C' and G. An unstable
hydrogen bonded pair is obtained when 1 or no hydrogen bonds is
formed e.g. the pair between A' and T', and C' and G'.
[0130] Especially interesting SBC nucleobases are 2,6-diaminopurine
(A', also called D) together with 2-thio-uracil (U', also called
.sup.25U)(2-thio-4-oxo-pyrimidine) and 2-thio-thymine (T', also
called .sup.25T)(2-thio-4-oxo-5-methyl-pyrimidine). FIG. 4
illustrates that the pairs A-.sup.25T and D-T have 2 or more than 2
hydrogen bonds whereas the D-.sup.25T pair forms a single
(unstable) hydrogen bond. Likewise the SBC nucleobases
pyrrolo-[2,3-d]pyrimidine-2(3H)-one (C', also called PyrroloPyr)
and hypoxanthine (G', also called I)(6-oxo-purine) are shown in
FIG. 9 where the pairs PyrroloPyr-G and C-I have 2 hydrogen bonds
each whereas the PyrroloPyr-I pair forms a single hydrogen
bond.
[0131] By "SBC LNA oligomer" is meant a "LNA oligomer" containing
at least one "LNA unit" where the nucleobase is a "SBC nucleobase".
By "LNA unit with an SBC nucleobase" is meant a "SBC LNA monomer".
Generally speaking SBC LNA oligomers include oligomers that besides
the SBC LNA monomer(s) contain other modified or naturally-occuring
nucleotides or nucleosides. By "SBC monomer" is meant a non-LNA
monomer with a SBC nucleobase. By "isosequential oligonucleotide"
is meant an oligonucleotide with the same sequence in a
Watson-Crick sense as the corresponding modified oligonucleotide
e.g. the sequences agTtcATg is equal to agTscD.sup.25Ug where s is
equal to the SBC DNA monomer 2-thio-t or 2-thio-u, D is equal to
the SBC LNA monomer LNA-D and .sup.25U is equal to the SBC LNA
monomer LNA .sup.25U.
[0132] As used herein, the terms "nucleic acid", "polynucleotide"
and "oligonucleotide" refer to primers, probes, oligomer fragments
to be detected, oligomer controls and unlabelled blocking oligomers
and shall be generic to polydeoxyribonucleotides (containing
2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose),
and to any other type of polynucleotide which is an N glycoside of
a purine or pyrimidine base, or modified purine or pyrimidine
bases. There is no intended distinction in length between the term
"nucleic acid", "polynucleotide" and "oligonucleotide", and these
terms will be used interchangeably. These terms refer only to the
primary structure of the molecule. Thus, these terms include
double- and single-stranded DNA, as well as double- and single
stranded RNA. The oligonucleotide is comprised of a sequence of
approximately at least 3 nucleotides, preferably at least about 6
nucleotides, and more preferably at least about 8-30 nucleotides
corresponding to a region of the designated nucleotide sequence.
"Corresponding" means identical to or complementary to the
designated sequence.
[0133] The oligonucleotide is not necessarily physically derived
from any existing or natural sequence but may be generated in any
manner, including chemical synthesis, DNA replication, reverse
transcription or a combination thereof. The terms "oligonucleotide"
or "nucleic acid" intend a polynucleotide of genomic DNA or RNA,
cDNA, semi synthetic, or synthetic origin which, by virtue of its
origin or manipulation: (1) is not associated with all or a portion
of the polynucleotide with which it is associated in nature; and/or
(2) is linked to a polynucleotide other than that to which it is
linked in nature; and (3) is not found in nature.
[0134] Because mononucleotides are reacted to make oligonucleotides
in a manner such that the 5'. phosphate of one mononucleotide
pentose ring is attached to the 3' oxygen of its neighbour in one
direction via a phosphodiester linkage, an end of an
oligonucleotide is referred to as the "5' end" if its 5' phosphate
is not linked to the 3' oxygen of a mononucleotide pentose ring and
as the "3' end" if its 3' oxygen is not linked to a 5' phosphate of
a subsequent mononucleotide pentose ring. As used herein, a nucleic
acid sequence, even if internal to a larger oligonucleotide, also
may be said to have a 5' and 3' ends.
[0135] When two different, non-overlapping oligonucleotides anneal
to different regions of the same linear complementary nucleic acid
sequence, the 3' end of one oligonucleotide points toward the 5'
end of the other; the former may be called the "upstream"
oligonucleotide and the latter the "downstream"
oligonucleotide.
[0136] The term "primer" may refer to more than one primer and
refers to an oligonucleotide, whether occurring naturally, as in a
purified restriction digest, or produced synthetically, which is
capable of acting as a point of initiation of synthesis along a
complementary strand when placed under conditions in which
synthesis of a primer extension product which is complementary to a
nucleic acid strand is catalyzed. Such conditions include the
presence of four different deoxyribonucleoside triphosphates and a
polymerization-inducing agent such as DNA polymerase or reverse
transcriptase, in a suitable buffer ("buffer" includes substituents
which are cofactors, or which affect pH, ionic strength, etc.), and
at a suitable temperature. The primer is preferably single-stranded
for maximum efficiency in amplification.
[0137] As used herein, the terms "PCR reaction", "PCR
amplification", "PCR" and "real-time PCR" are interchangeable terms
used to signify use of a nucleic acid amplification system, which
multiplies the target nucleic acids being detected. Examples of
such systems include the polymerase chain reaction (PCR) system and
the ligase chain reaction (LCR) system. Other methods recently
described and known to the person of skill in the art are the
nucleic acid sequence based amplification (NASBA.TM., Cangene,
Mississauga, Ontario) and Q Beta Replicase systems. The products
formed by said amplification reaction may or may not be monitored
in real time or only after the reaction as an end point
measurement.
[0138] The complement of a nucleic acid sequence as used herein
refers to an oligonucleotide which, when aligned with the nucleic
acid sequence such that the 5' end of one sequence is paired with
the 3' end of the other, is in "antiparallel association." Bases
not commonly found in natural nucleic acids may be included in the
nucleic acids of the present invention include, for example,
inosine and 7-deazaguanine. Complementarity may not be perfect;
stable duplexes may contain mismatched base pairs or unmatched
bases. Those skilled in the art of nucleic acid technology can
determine duplex stability empirically considering a number of
variables including, for example, the length of the
oligonucleotide, percent concentration of cytosine and guanine
bases in the oligonucleotide, ionic strength, and incidence of
mismatched base pairs.
[0139] Stability of a nucleic acid duplex is measured by the
melting temperature, or "T.sub.m". The T.sub.m of a particular
nucleic acid duplex under specified conditions is the temperature
at which half of the base pairs have disassociated.
[0140] As used herein, the term "probe" refers to a labelled
oligonucleotide, which forms a duplex structure with a sequence in
the target nucleic acid, due to complementarity of at least one
sequence in the probe with a sequence in the target region. The
probe, preferably, does not contain a sequence complementary to
sequence(s) used to prime the polymerase chain reaction. Generally
the 3' terminus of the probe will be "blocked" to prohibit
incorporation of the probe into a primer extension product.
"Blocking" may be achieved by using non-complementary bases or by
adding a chemical moiety such as biotin or even a phosphate group
to the 3' hydroxyl of the last nucleotide, which may, depending
upon the selected moiety, may serve a dual purpose by also acting
as a label.
[0141] The term "label" as used herein refers to any atom or
molecule which can be used to provide a detectable (preferably
quantifiable) signal, and which can be attached to a nucleic acid
or protein. Labels may provide signals detectable by fluorescence,
radioactivity, colorimetric, X-ray diffraction or absorption,
magnetism, enzymatic activity, and the like.
[0142] As defined herein, "5'.fwdarw.3' nuclease activity"or "5' to
3' nuclease activity" refers to that activity of a
template-specific nucleic acid polymerase including either a
5'.fwdarw.3' exonuclease activity traditionally associated with
some DNA polymerases whereby nucleotides are removed from the 5'
end of an oligonucleotide in a sequential manner, (i.e., E. coli
DNA polymerase I has this activity whereas the Klenow fragment does
not), or a 5'.fwdarw.3' endonuclease activity wherein cleavage
occurs more than one nucleotide from the 5' end, or both.
[0143] As used herein, the term "thermo stable nucleic acid
polymerase" refers to an enzyme which is relatively stable to heat
when compared, for example, to nucleotide polymerases from E. coli
and which catalyzes the polymerization of nucleosides. Generally,
the enzyme will initiate synthesis at the 3'-end of the primer
annealed to the target sequence, and will proceed in the
5'-direction along the template, and if possessing a 5' to 3'
nuclease activity, hydrolyzing or displacing intervening, annealed
probe to release both labelled and unlabelled probe fragments or
intact probe, until synthesis terminates. A representative thermo
stable enzyme isolated from Thermus aquaticus (Tag) is described in
U.S. Pat. No. 4,889,818 and a method for using it in conventional
PCR is described in Saiki et al., (1988), Science 239:487.
[0144] The term "nucleobase" covers the naturally occurring
nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and
uracil (U) as well as non-naturally occurring nucleobases such as
xanthine, diaminopurine, 8-oxo-N.sup.6-methyladenine,
7-deazaxanthine, 7-deazaguanine, N.sup.4,N.sup.4-ethanocytosin,
N.sup.6,N.sup.6-ethano-2,6- -diaminopurine, 5-methylcytosine,
5-(C.sup.3-C.sup.6)-alkynyl-cytosine, 5-fluorouracil,
5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-tr-
iazolopyridin, isocytosine, isoguanine, inosine and the
"non-naturally occurring" nucleobases described in Benner et al.,
U.S. Pat. No. 5,432,272 and Susan M. Freier and Karl-Heinz Altmann,
Nucleic Acid Research,25: 4429-4443, 1997. The term "nucleobase"
thus includes not only the known purine and pyrimidine
heterocycles, but also heterocyclic analogues and tautomers
thereof. Further naturally and non naturally occurring nucleobases
include those disclosed in U.S. Pat. No. 3,687,808; in chapter 15
by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke
and B. Lebleu, CRC Press, 1993; in Englisch, et al., Angewandte
Chemie, International Edition, 30: 613-722, 1991 (see, especially
pages 622 and 623, and in the Concise Encyclopedia of Polymer
Science and Engineering, J. I. Kroschwitz Ed., John Wiley &
Sons, pages 858-859, 1990, Cook, Anti-Cancer Drug Design 6:
585-607, 1991, each of which are hereby incorporated by reference
in their entirety).
[0145] The term "nucleosidic base" or "nucleobase analogue" is
further intended to include heterocyclic compounds that can serve
as like nucleosidic bases including certain "universal bases" that
are not nucleosidic bases in the most classical sense but serve as
nucleosidic bases. Especially mentioned as a universal base is
3-nitropyrrole a 5-nitroindole. Other preferred compounds include
pyrene and pyridyloxazole derivatives, pyrenyl,
pyrenylmethylglycerol derivatives and the like. Other preferred
universal bases include, pyrrole, diazole or triazole derivatives,
including those universal bases known in the art.
[0146] By "universal base" is meant a naturally-occurring or
desirably a non-naturally occurring compound or moiety that can
pair with a natural base (e.g., adenine, guanine, cytosine, uracil,
and/or thymine), and that has a T.sub.m differential of 15, 12, 10,
8, 6, 4, or 2.degree. C. or less as described herein.
[0147] By "oligonucleotide," "oligomer," or "oligo" is meant a
successive chain of monomers (e.g., glycosides of heterocyclic
bases) connected via internucleoside linkages. The linkage between
two successive monomers in the oligo consist of 2 to 4, desirably
3, groups/atoms selected from --CH.sub.2--, --O--, --S--,
--NR.sup.H--, >C.dbd.O, >C.dbd.NR.sup.H, >C.dbd.S,
--Si(R").sub.2--, --SO--, --S(O).sub.2--, --P(O).sub.2--,
--PO(BH.sub.3)--, --P(O,S)--, --P(S).sub.2--, --PO(R")--,
--PO(OCH.sub.3)--, and --PO(NHR.sup.H)--, where R.sup.H is selected
from hydrogen and C.sub.1-4-alkyl, and R" is selected from
C.sub.1-6-alkyl and phenyl. Illustrative examples of such linkages
are --CH.sub.2--CH.sub.2--CH.sub.2--, --CH.sub.2--CO--CH.sub.2--- ,
--CH.sub.2--CHOH--CH.sub.2--, --O--CH.sub.2--O--,
--O--CH.sub.2--CH.sub.2--, --O--CH.sub.2--CH.dbd. (including
R.sup.5 when used as a linkage to a succeeding monomer),
--CH.sub.2--CH.sub.2--O--, --NR.sup.H--CH.sub.2--CH.sub.2--,
--CH.sub.2--CH.sub.2--NR.sup.H, --CH.sub.2-NR.sup.H--CH.sub.2--,
----CH.sub.2--CH.sub.2--NR.sup.H--, --NR.sup.H--CO--O--,
--NR.sup.H--CO--NR.sup.H--, --NR.sup.H--CS--NR.sup.H- --,
--NR.sup.H--C(.dbd.NR.sup.H)--NR.sup.H--,
--NR.sup.H--CO--CH.sub.2NR.s- up.H--, --O--CO--O--,
--O--CO--CH.sub.2--O--, --O--CH.sub.2--CO--O--,
--CH.sub.2--CO--NR.sup.H--, O--CO--NR.sup.H--,
--NR.sup.H--CO--CH.sub.2--- , --O--CH.sub.2--CO--NR.sup.H--,
--O--CH.sub.2--CH.sub.2--NR.sup.H--, --CH.dbd.N--O--,
--CH.sub.2NR.sup.H--O--, --CH.sub.2--O--N.dbd. (including R.sup.5
when used as a linkage to a succeeding monomer),
--CH.sub.2--O--NR.sup.H--, --CO--NR.sup.H--CH.sub.2--,
--CH.sub.2--NR.sup.H--O--, --CH.sub.2--NR.sup.H--CO--,
--O--NR.sup.H--CH.sub.2--, --O--NR.sup.H--, --O--CH.sub.2--S--,
--S--CH.sub.2--O--, --CH.sub.2--CH.sub.2--S--,
--O--CH.sub.2--CH.sub.2--S- --, --S--CH.sub.2CH.dbd. (including
R.sup.5 when used as a linkage to a succeeding monomer),
--S--CH.sub.2--CH.sub.2--, --S--CH.sub.2--CH.sub.2--- O--,
--S--CH.sub.2--CH.sub.2--S--, --CH.sub.2--S--CH.sub.2--,
--CH.sub.2--SO--CH.sub.2--, --CH.sub.2--SO.sub.2--CH.sub.2--,
--O--SO--O--, --O--S(O).sub.2--O--, --O--S(O).sub.2--CH.sub.2--,
--O--S(O).sub.2--NR.sup.H--, --NR.sup.H--S(O).sub.2--CH.sub.2--,
--O--S(O).sub.2--CH.sub.2--, --O--P(O).sub.2--O--, --O--P(S)--O--,
--O--P(S).sub.2--O--, --S--P(O).sub.2--O--, --S--P(O,S)--O--,
--S--P(S).sub.2--O--, --O--P(O).sub.2S--, --O--P(O,S)--S--,
--O--P(S).sub.2--S--, --S--P(O).sub.2--S--, --S--P(O,S)--S--,
--S--P(S).sub.2--S--, --O--PO(R")--O--, --O--PO(OCH.sub.3)--O--,
--O--PO(OCH.sub.2CH.sub.3)--O--,
--O--PO(OCH.sub.2CH.sub.2S--R)--O--, --O--PO(BH.sub.3)--O--,
--O--PO(NHR.sup.N)--O--, --O--P(O).sub.2--NR.sup.- H--,
--NR.sup.H--P(O).sub.2--O--, --O--P(O,NR.sup.H)--O--,
--CH.sub.2--P(O).sub.2--O--, --O--P(O).sub.2--CH.sub.2--, and
--O--Si(R").sub.2--O--; among which --CH.sub.2--CO--NR.sup.H--,
--CH.sub.2--NR.sup.H--O--, --S--CH.sub.2--O--,
--O--P(O).sub.2--O--, --O--P(O,S)--O--, --O--P(S).sub.2--O--,
--NR.sup.H--P(O).sub.2--O--, --O--P(O,NR.sup.H)--O--,
--O--PO(R")--O--, --O--PO(CH.sub.3)--O--, and
--O--PO(NHR.sup.N)--O--, where R.sup.H is selected form hydrogen
and C.sub.1-4-alkyl, and R" is selected from C.sub.1-6-alkyl and
phenyl, are especially desirable. Further illustrative examples are
given in Mesmaeker et. al., Current Opinion in Structural Biology
1995, 5, 343-355 and Susan M. Freier and Karl-Heinz Altmann,
Nucleic Acids Research, 1997, vol 25, pp 4429-4443. The left-hand
side of the internucleoside linkage is bound to the 5-membered ring
as substituent P* at the 3'-position, whereas the right-hand side
is bound to the 5'-position of a preceding monomer.
[0148] By "LNA unit" is meant an individual LNA monomer (e.g., an
LNA nucleoside or LNA nucleotide) or an oligomer (e.g., an
oligonucleotide or nucleic acid) that includes at least one LNA
monomer. LNA units as disclosed in WO 99/14226 are in general
particularly desirable modified A nucleic acids for incorporation
into an oligonucleotide of the invention. Additionally, the nucleic
acids may be modified at either the 3' and/or 5' end by any type of
modification known in the art. For example, either or both ends may
be capped with a protecting group, attached to a flexible linking
group, attached to a reactive group to aid in attachment to the
substrate surface, etc. Desirable LNA units and their method of
synthesis also are disclosed in WO 00/47599, U.S. Pat. No.
6,043,060, U.S. Pat. No. 6,268,490, PCT/]P98/00945, WO 0107455, WO
0100641, WO 9839352, WO 0056746, WO 0056748, WO 0066604, Morita et
al., Bioorg. Med. Chem. Lett. 12(1):73-76, 2002; Hakansson et al.,
Bioorg. Med. Chem. Lett. 11(7):935-938, 2001; Koshkin et al., J.
Org. Chem. 66(25):8504-8512, 2001; Kvaerno etal., J. Org. Chem.
66(16):5498-5503, 2001; Hakansson et al., J. Org. Chem.
65(17):5161-5166, 2000; Kvaerno et al., J. Org. Chem.
65(17):5167-5176, 2000; Pfundheller et al., Nucleosides Nucleotides
18(9):2017-2030, 1999; and Kumar et al., Bioorg. Med. Chem. Lett.
8(16):2219-2222, 1998.
[0149] Preferred LNA monomers, also referred to as "oxy-LNA" are
LNA monomers which include bicyclic compounds as disclosed in PCT
Publication WO 03/020739 wherein the bridge between R.sup.4' and
R.sup.2' as shown in formula (I) below together designate
--CH.sub.2--O-- (methyloxy LNA) or --CH.sub.2--CH.sub.2--O--
(ethyloxy LNA, also designated ENA).
[0150] Further preferred LNA monomers are designated "thio-LNA" or
"amino-LNA" including bicyclic structures as disclosed in WO
99/14226, wherein the heteroatom in the bridge between R.sup.4' and
R.sup.2' as shown in formula (I) below together designate
--CH.sub.2--S--, --CH.sub.2--CH.sub.2--S--, --CH.sub.2--NH-- or
--CH.sub.2--CH.sub.2--NH--- .
[0151] By "LNA modified oligonucleotide" is meant a oligonucleotide
comprising at least one LNA monomeric unit of formula (I),
described infra, having the below described illustrative examples
of modifications: 1
[0152] wherein X is selected from --O--, --S--, --N(R.sup.N)--,
--C(R.sup.6R.sup.6*)--, --O--C(R.sup.7R.sup.7*)--,
--C(R.sup.6R.sup.6*)--O--, --S--C(R.sup.7R.sup.7*)--,
--C(R.sup.6R.sup.6*)--S--, --N(R.sup.N*)--C(R.sup.7R.sup.7*)--,
--C(R.sup.6R.sup.6*)--N(R.sup.N*)--, and
--C(R.sup.6R.sup.6*)--C(R.sup.7R- .sup.7*).
[0153] B is selected from a modified base as discussed above e.g.
an optionally substituted carbocyclic aryl such as optionally
substituted pyrene or optionally substituted pyrenylmethylglycerol,
or an optionally substituted heteroalicylic or optionally
substituted heteroaromatic such as optionally substituted
pyridyloxazole, optionally substituted pyrrole, optionally
substituted diazole or optionally substituted triazole moieties;
hydrogen, hydroxy, optionally substituted C.sub.1-4-alkoxy,
optionally substituted C.sub.1-4-alkyl, optionally substituted
C.sub.1-4-acyloxy, nucleobases, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands.
[0154] P designates the radical position for an internucleoside
linkage to a succeeding monomer, or a 5'-terminal group, such
internucleoside linkage or 5'-terminal group optionally including
the substituent R.sup.5. One of the substituents R.sup.2, R.sup.2*,
R.sup.3, and R.sup.3* is a group P* which designates an
internucleoside linkage to a preceding monomer, or a 2'/3'-terminal
group. The substituents of R.sup.1*, R.sup.4*, R.sup.5, R.sup.5*,
R.sup.6, R.sup.6*, R.sup.7, R.sup.7*, R.sup.N, and the ones of
R.sup.2, R.sup.2*, R.sup.3, and R.sup.3* not designating P* each
designates a biradical comprising about 1-8 groups/atoms selected
from --C(R.sup.aR.sup.b)--, --C(R.sup.a).dbd.C(R.su- p.a)--,
--C(R.sup.a).dbd.N--, --C(R.sup.a)--O--, --O--,
--Si(R.sup.a).sub.2--, --C(R.sup.a)--S, --S--, --SO.sub.2--,
--C(R.sup.a)--N(R.sup.b)--, --N(R.sup.a)--, and >C=Q, wherein Q
is selected from --O--, --S--, and --N(R.sup.a)--, and R.sup.a and
R.sup.b each is independently selected from hydrogen, optionally
substituted C.sub.1-12-alkyl, optionally substituted
C.sub.2-12-alkenyl, optionally substituted C.sub.2-12-alkynyl,
hydroxy, C.sub.1-12-alkoxy, C.sub.2-12-alkenyloxy, carboxy,
C.sub.2-12-alkoxycarbonyl, C.sub.1-12-alkylcarbonyl, formyl, aryl,
aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl,
hetero-aryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino,
mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and
di(C.sub.1-6-alkyl)-amino-carbonyl, amino-C.sub.1-6-alkyl-amino-
carbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl- ,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands, where aryl and heteroaryl may be
optionally substituted, and where two geminal substituents R.sup.a
and R.sup.b together may designate optionally substituted methylene
(.dbd.CH.sub.2), and wherein two non-geminal or geminal
substituents selected from R.sup.a, R.sup.b, and any of the
substituents R.sup.1*, R.sup.2, R.sup.2, R.sup.3, R.sup.3*,
R.sup.4*, R.sup.5, R.sup.5*, R.sup.6 and R.sup.6, R.sup.7, and
R.sup.7* which are present and not involved in P, P* or the
biradical(s) together may form an associated biradical selected
from biradicals of the same kind as defined before; the pair(s) of
non-geminal substituents thereby forming a mono- or bicyclic entity
together with (i) the atoms to which said non-geminal substituents
are bound and (ii) any intervening atoms.
[0155] Each of the substituents R.sup.1*, R.sup.2, R.sup.2,
R.sup.3, R.sup.4*, R.sup.5, R.sup.5*, R.sup.6 and R.sup.6*,
R.sup.7, and R.sup.7* which are present sent and not involved in P,
P* or the biradical(s), is independently selected from hydrogen,
optionally substituted C.sub.1-12-alkyl, optionally substituted
C.sub.2-12-alkenyl, optionally substituted C.sub.2-12-alkynyl,
hydroxy, C.sub.1-12-alkoxy, C.sub.2-12-alkenyloxy, carboxy,
C.sub.1-12-alkoxycarbonyl, C.sub.1-12-alkylcarbonyl, formyl, aryl,
aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl,
heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino,
mono- and di(C.sub.1-6-alkyl)amino, carbamoyl, mono- and
di(C.sub.1-6-alkyl)-amino-carbonyl, amino-C.sub.1-6-alkyl-amino-
carbonyl, mono- and
di(C.sub.1-6-alkyl)amino-C.sub.1-6-alkyl-aminocarbonyl- ,
C.sub.1-6-alkyl-carbonylamino, carbamido, C.sub.1-6-alkanoyloxy,
sulphono, C.sub.1-6-alkylsulphonyloxy, nitro, azido, sulphanyl,
C.sub.1-6-alkylthio, halogen, DNA intercalators, photochemically
active groups, thermochemically active groups, chelating groups,
reporter groups, and ligands, where aryl and heteroaryl may be
optionally substituted, and where two geminal substituents together
may designate oxo, thioxo, imino, or optionally substituted
methylene, or together may form a spiro biradical consisting of a
1-5 carbon atom(s) alkylene chain which is optionally interrupted
and/or terminated by one or more heteroatoms/groups selected from
--O--, --S--, and --(NR.sup.N)-- where R.sup.N is selected from
hydrogen and C.sub.1-4-alkyl, and where two adjacent (non-geminal)
substituents may designate an additional bond resulting in a double
bond; and R.sup.N*, when present and not involved in a biradical,
is selected from hydrogen and C.sub.1-4-alkyl; and basic salts and
acid addition salts thereof.
[0156] Exemplary 5', 3', and/or 2' terminal groups include --H,
--OH, halo (e.g., chloro, fluoro, iodo, or bromo), optionally
substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g., methyl or
ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or benzoyl),
aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy,
nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl,
aralkoxycarbonyl, acylamino, aroylamino, alkylsulfonyl,
arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl,
heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio,
aralkylthio, heteroaralkylthio, amidino, amino, carbamoyl,
sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl,
4,4'-dimethoxytrityl, monomethoxytrityl, or
trityl(triphenylmethyl)), linkers (e.g., a linker containing an
amine, ethylene glycol, quinone such as anthraquinone), detectable
labels (e.g., radiolabels or fluorescent labels), and biotin.
[0157] It is understood that references herein to a nucleic acid
unit, nucleic acid residue, LNA unit, or similar term are inclusive
of both individual nucleoside units and nucleotide units and
nucleoside units and nucleotide units within an
oligonucleotide.
[0158] A "modified base" or other similar term refers to a
composition (e.g., a non-naturally occurring nucleobase or
nucleosidic base), which can pair with a natural base (e.g.,
adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair
with a non-naturally occurring nucleobase or nucleosidic base.
Desirably, the modified base provides a Tm differential of 15, 12,
10, 8, 6, 4, or 2.degree. C. or less as described herein. Exemplary
modified bases are described in EP 1 072 679 and WO 97/12896.
[0159] The term "chemical moiety" refers to a part of a molecule.
"Modified by a chemical moiety" thus refer to a modification of the
standard molecular structure by inclusion of an unusual chemical
structure. The attachment of said structure can be covalent or
non-covalent.
[0160] The term "inclusion of a chemical moiety" in an
oligonucleotide probe thus refers to attachment of a molecular
structure. Such as chemical moiety include but are not limited to
covalently and/or non-covalently bound minor groove binders (MGB)
and/or intercalating nucleic acids (INA) selected from a group
consisting of asymmetric cyanine dyes, DAPI, SYBR Green I, SYBR
Green II, SYBR Gold, PicoGreen, thiazole orange, Hoechst 33342,
Ethidium Bromide, 1-O-(1-pyrenylmethyl)gl- ycerol and Hoechst
33258. Other chemical moieties include the modified nucleobases,
nucleosidic bases or LNA modified oligonucleotides.
[0161] The term "Dual labelled probe" refers to an oligonucleotide
with two attached labels. In one aspect, one label is attached to
the 5' end of the probe molecule, whereas the other label is
attached to the 3' end of the molecule. A particular aspect of the
invention contain a fluorescent molecule attached to one end and a
molecule which is able to quench this fluorophore by Fluorescence
Resonance Energy Transfer (FRET) attached to the other end. 5'
nuclease assay probes and some Molecular Beacons are examples of
Dual labelled probes.
[0162] The term "5' nuclease assay probe" refers to a dual labelled
probe which may be hydrolyzed by the 5'-3' exonuclease activity of
a DNA polymerase. A 5' nuclease assay probes is not necessarily
hydrolyzed by the 5'-3' exonuclease activity of a DNA polymerase
under the conditions employed in the particular PCR assay. The name
"5' nuclease assay" is used regardless of the degree of hydrolysis
observed and does not indicate any expectation on behalf of the
experimenter. The term "5' nuclease assay probe" and "5' nuclease
assay" merely refers to assays where no particular care has been
taken to avoid hydrolysis of the involved probe. "5' nuclease assay
probes" are often referred to as a "TaqMan assay probes", and the
"5' nuclease assay" as "TaqMan assay". These names are used
interchangeably in this application.
[0163] The term "oligonucleotide analogue" refers to a nucleic acid
binding molecule capable of recognizing a particular target
nucleotide sequence. A particular oligonucleotide analogue is
peptide nucleic acid (PNA) in which the sugar phosphate backbone of
an oligonucleotide is replaced by a protein like backbone. In PNA,
nucleobases are attached to the uncharged polyamide backbone
yielding a chimeric pseudopeptide-nucleic acid structure, which is
homomorphous to nucleic acid forms.
[0164] The term "Molecular Beacon" refers to a single or dual
labelled probe which is not likely to be affected by the 5'-3'
exonuclease activity of a DNA polymerase. Special modifications to
the probe, polymerase or assay conditions have been made to avoid
separation of the labels or constituent nucleotides by the 5'-3'
exonuclease activity of a DNA polymerase. The detection principle
thus rely on a detectable difference in label elicited signal upon
binding of the molecular beacon to its target sequence. In one
aspect of the invention the oligonucleotide probe forms an
intramolecular hairpin structure at the chosen assay temperature
mediated by complementary sequences at the 5'- and the 3'-end of
the oligonucleotide. The oligonucleotide may have a fluorescent
molecule attached to one end and a molecule attached to the other,
which is able to quench the fluorophore when brought into close
proximity of each other in the hairpin structure. In another aspect
of the invention, a hairpin structure is not formed based on
complementary structure at the ends of the probe sequence instead
the detected signal change upon binding may result from interaction
between one or both of the labels with the formed duplex structure
or from a general change of spatial conformation of the probe upon
binding--or from a reduced interaction between the labels after
binding. A particular aspect of the molecular beacon contain a
number of LNA residues to inhibit hydrolysis by the 5'-3'
exonuclease activity of a DNA polymerase.
[0165] The term "multi-probe" as used herein refers to a probe
which comprises a recognition segment which is a probe sequence
sufficiently complementary to a recognition sequence in a target
nucleic acid molecule to bind to the sequence under moderately
stringent conditions and/or under conditions suitable for PCR, 5'
nuclease assay and/or Molecular Beacon analysis (or generally any
FRET-based method). Such conditions are well known to those of
skill in the art. Preferably, the recognition sequence is found in
a plurality of sequences being evaluated, e.g., such as a
transcriptome. A multi-probe according to the invention may
comprise a non-natural nucleotide ("a stabilizing nucleotide") and
may have a higher binding affinity for the recognition sequence
than a probe comprising an identical sequence but without the
stabilizing modification. Preferably, at least one nucleotide of a
multi-probe is modified by a chemical moiety (e.g., covalently or
otherwise stably associated with during at least hybridization
stages of a PCR reaction) for increasing the binding affinity of
the recognition segment for the recognition sequence.
[0166] As used herein, a multi-probe with an increased "binding
affinity" for a recognition sequence than a probe which comprises
the same sequence but which does not comprise a stabilizing
nucleotide, refers to a probe for which the association constant
(K.sub.a) of the probe recognition segment is higher than the
association constant of the complementary strands of a
double-stranded molecule. In another preferred embodiment, the
association constant of the probe recognition segment is higher
than the dissociation constant (K.sub.d) of the complementary
strand of the recognition sequence in the target sequence in a
double stranded molecule.
[0167] A "multi-probe library" or "library of multi-probes"
comprises a plurality of multi-probes, such that the sum of the
probes in the library are able to recognise a major proportion of a
transcriptome, including the most abundant sequences, such that
about 60%, about 70%, about 80%, about 85%, more preferably about
90%, and still more preferably 95%, of the target nucleic acids in
the transcriptome, are detected by the probes.
[0168] Monomers are referred to as being "complementary" if they
contain nucleobases that can form hydrogen bonds according to
Watson-Crick base-pairing rules (e.g. G with C, A with T or A with
U) or other hydrogen bonding motifs such as for example
diaminopurine with T, inosine with C, pseudoisocytosine with G,
etc.
[0169] The term "succeeding monomer" relates to the neighboring
monomer in the 5'-terminal direction and the "preceding monomer"
relates to the neighboring monomer in the 3'-terminal
direction.
[0170] As used herein, the term "target population" refers to a
plurality of different sequences of nucleic acids, for example the
genome or other nucleic acids from a particular species including
the transcriptome of the genome, wherein the transcriptome refers
to the complete collection of transcribed elements of the genome of
any species. Normally, the number of different target sequences in
a nucleic acid population is at least 100, but as will be clear the
number is often much higher (more than 200, 500, 1000, and
10000--in the case where the target population is a eukaryotic
tran.
[0171] As used herein, the term "target nucleic acid" refers to any
relevant nucleic acid of a single specific sequence, e.g., a
biological nucleic acid, e.g., derived from a patient, an animal (a
human or non-human animal), a plant, a bacteria, a fungi, an
archae, a cell, a tissue, an organism, etc. For example, where the
target nucleic acid is derived from a bacteria, archae, plant,
non-human animal, cell, fungi, or non-human organism, the method
optionally further comprises selecting the bacteria, archae, plant,
non-human animal, cell, fungi, or non-human organism based upon
detection of the target nucleic acid. In one embodiment, the target
nucleic acid is derived from a patient, e.g., a human patient. In
this embodiment, the invention optionally further includes
selecting a treatment, diagnosing a disease, or diagnosing a
genetic predisposition to a disease, based upon detection of the
target nucleic acid.
[0172] As used herein, the term "target sequence" refers to a
specific nucleic acid sequence within any target nucleic acid.
[0173] The term "stringent conditions", as used herein, is the
"stringency" which occurs within a range from about
T.sub.m-5.degree. C. (5.degree. C. below the melting temperature
(T.sub.m) of the probe) to about 20.degree. C. to 25.degree. C.
below T.sub.m. As will be understood by those skilled in the art,
the stringency of hybridization may be altered in order to identify
or detect identical or related polynucleotide sequences.
Hybridization techniques are generally described in Nucleic Acid
Hybridization, A Practical Approach, Ed. Hames, B. D. and Higgins,
S. J., IRL Press, 1985; Gall and Pardue, Proc. Natl. Acad. Sci.,
USA 63: 378-383, 1969; and John, et al. Nature 223: 582-587,
1969.
[0174] Multi-probes
[0175] Referring now to FIG. 1B, a multi-probe according to the
invention is preferably a short sequence probe which binds to a
recognition sequence found in a plurality of different target
nucleic acids, such that the multi-probe specifically hybridizes to
the target nucleic acid but do not hybridize to any detectable
level to nucleic acid molecules which do not comprise the
recognition sequence. Preferably, a collection of multi-probes, or
multi-probe library, is able to recognize a major proportion of a
transcriptome, including the most abundant sequences, such as about
60%, about 70%, about 80%, about 85%, more preferably about 90%,
and still more preferably 95%, of the target nucleic acids in the
transcriptome, are detected by the probes. A multi-probe according
to the invention comprises a "stabilizing modification" e.g. such
as a non-natural nucleotide ("a stabilizing nucleotide") and has
higher binding affinity for the recognition sequence than a probe
comprising an identical sequence but without the stabilizing
sequence. Preferably, at least one nucleotide of a multi-probe is
modified by a chemical moiety (e.g., covalently or otherwise stably
associated with the probe during at least hybridization stages of a
PCR reaction) for increasing the binding affinity of the
recognition segment for the recognition sequence.
[0176] In one aspect, a multi-probe of from 6 to 12 nucleotides
comprises from 1 to 6 or even up to 12 stabilizing nucleotides,
such as LNA nucleotides. An LNA enhanced probe library contains
short probes that recognize a short recognition sequence (e.g., 8-9
nucleotides). LNA nucleobases can comprise .alpha.-LNA molecules
(see, e.g., WO 00/66604) or xylo-LNA molecules (see, e.g., WO
00/56748).
[0177] In one aspect, it is preferred that the T.sub.m of the
multi-probe when bound to its recognition sequence is between about
55.degree. C. to about 70.degree. C.
[0178] In another aspect, the multi-probes comprise one or more
modified nucleobases. Modified base units may comprise a cyclic
unit (e.g. a carbocyclic unit such as pyrenyl) that is joined to a
nucleic unit, such as a 1'-position of furasonyl ring through a
linker, such as a straight of branched chain alkylene or alkenylene
group. Alkylene groups suitably having from 1 (i.e., --CH.sub.2--)
to about 12 carbon atoms, more typically 1 to about 8 carbon atoms,
still more typically 1 to about 6 carbon atoms. Alkenylene groups
suitably have one, two or three carbon-carbon double bounds and
from 2 to about 12 carbon atoms, more typically 2 to about 8 carbon
atoms, still more typically 2 to about 6 carbon atoms.
[0179] Multi-probes according to the invention are ideal for
performing such assays as real-time PCR as the probes according to
the invention are preferably less than about 25 nucleotides, less
than about 15 nucleotides, less than about 10 nucleotides, e.g., 8
or 9 nucleotides. Preferably, a multi-probe can specifically
hybridize with a recognition sequence within a target sequence
under PCR conditions and preferably the recognition sequence is
found in at least about 50, at least about 100, at least about 200,
at least about 500 different target nucleic acid molecules. A
library of multi-probes according to the invention will comprise
multiprobes, which comprise non-identical recognition sequences,
such that any two multi-probes hybridize to different sets of
target nucleic acid molecules. In one aspect, the sets of target
nucleic acid molecules comprise some identical target nucleic acid
molecules, i.e., a target nucleic acid molecule comprising a gene
sequence of interest may be bound by more than one multi-probe.
Such a target nucleic acid molecule will contain at least two
different recognition sequences which may overlap by one or more,
but less than x nucleotides of a recognition sequence comprising x
nucleotides.
[0180] In one aspect, a multi-probe library comprises a plurality
of different multi-probes, each different probe localized at a
discrete location on a solid substrate. As used herein, "localize"
refers to being limited or addressed at the location such that
hybridization event detected at the location can be traced to a
probe of known sequence identity. A localized probe may or may not
be stably associated with the substrate. For example, the probe
could be in solution in the well of a microtiter plate and thus
localized or addressed to the well. Alternatively, or additionally,
the probe could be stably associated with the substrate such that
it remains at a defined location on the substrate after one or more
washes of the substrate with a buffer. For example, the probe may
be chemically associated with the substrate, either directly or
through a linker molecule, which may be a nucleic acid sequence, a
peptide or other type of molecule, which has an affinity for
molecules on the substrate.
[0181] Alternatively, the target nucleic acid molecules may be
localized on a substrate (e.g., as a cell or cell lysate or nucleic
acids dotted onto the substrate).
[0182] Once the appropriate sequences are determined, multi-LNA
probes are preferably chemically synthesized using commercially
available methods and equipment as described in the art
(Tetrahedron 54: 3607-30, 1998). For example, the solid phase
phosphoramidite method can be used to produce short LNA probes
(Caruthers, et al., Cold Spring Harbor Symp. Quant. Biol.
47:411-418, 1982, Adams, et al., J. Am. Chem. Soc. 105: 661
(1983).
[0183] The determination of the extent of hybridization of
multi-probes from a multi-probe library to one or more target
sequences (preferably to a plurality of target sequences) may be
carried out by any of the methods well known in the art. If there
is no detectable hybridization, the extent of hybridization is thus
0. Typically, labelled signal nucleic acids are used to detect
hybridization. Complementary nucleic acids or signal nucleic acids
may be labelled by any one of several methods typically used to
detect the presence of hybridized polynucleotides. The most common
method of detection is the use of ligands, which bind to labelled
antibodies, fluorophores or chemiluminescent agents. Other labels
include antibodies, which can serve as specific binding pair
members for a labelled ligand. The choice of label depends on
sensitivity required, ease of conjugation with the probe, stability
requirements, and available instrumentation.
[0184] LNA-containing-probes are typically labelled during
synthesis. The flexibility of the phosphoramidite synthesis
approach furthermore facilitates the easy production of LNAs
carrying all commercially available linkers, fluorophores and
labelling-molecules available for this standard chemistry. LNA may
also be labelled by enzymatic reactions e.g. by kinasing.
[0185] Multi-probes according to the invention can comprise single
labels or a plurality of labels. In one aspect, the plurality of
labels comprise a pair of labels which interact with each other
either to produce a signal or to produce a change in a signal when
hybridization of the multiprobe to a target sequence occurs.
[0186] In another aspect, the multi-probe comprises a fluorophore
moiety and a quencher moiety, positioned in such a way that the
hybridized state of the probe can be distinguished from the
unhybridized state of the probe by an increase in the fluorescent
signal from the nucleotide. In one aspect, the multi-probe
comprises, in addition to the recognition element, first and second
complementary sequences, which specifically hybridize to each
other, when the probe is not hybridized to a recognition sequence
in a target molecule, bringing the quencher molecule in sufficient
proximity to said reporter molecule to quench fluorescence of the
reporter molecule. Hybridization of the target molecule distances
the quencher from the reporter molecule and results in a signal,
which is proportional to the amount of hybridization.
[0187] In another aspect, where polymerization of strands of
nucleic acids can be detected using a polymerase with 5' nuclease
activity. Fluorophore and quencher molecules are incorporated into
the probe in sufficient proximity such that the quencher quenches
the signal of the fluorophore molecule when the probe is hybridized
to its recognition sequence. Cleavage of the probe by the
polymerase with 5' nuclease activity results in separation of the
quencher and fluorophore molecule, and the presence in increasing
amounts of signal as nucleic acid sequences
[0188] In the present context, the term "label" means a reporter
group, which is detectable either by itself or as a part of a
detection series. Examples of functional parts of reporter groups
are biotin, digoxigenin, fluorescent groups (groups which are able
to absorb electromagnetic radiation, e.g. light or X-rays, of a
certain wavelength, and which subsequently reemits the energy
absorbed as radiation of longer wavelength; illustrative examples
are DANSYL (5-di-methylamino)-1-naphtha- lenesulfonyl), DOXYL
(N-oxyl-4,4-dimethyloxazolidine), PROXYL
(N-oxyl-2,2,5,5-tetramethylpyrrolidine), TEMPO
(N-oxyl-2,2,6,6-tetramethy- lpiperidine), dinitrophenyl, acridines,
coumarins, Cy3 and Cy5 (trademarks for Biological Detection
Systems, Inc.), erythrosine, coumaric acid, umbelliferone, Texas
red, rhodamine, tetramethyl rhodamine, Rox,
7-nitrobenzo-2-oxa-1-diazole (NBD), pyrene, fluorescein, Europium,
Ruthenium, Samarium, and other rare earth metals), radio isotopic
labels, chemiluminescence labels (labels that are detectable via
the emission of light during a chemical reaction), spin labels (a
free radical (e.g. substituted organic nitroxides) or other
paramagnetic probes (e.g. Cu.sup.2+, Mg.sup.2+) bound to a
biological molecule being detectable by the use of electron spin
resonance spectroscopy). Especially interesting examples are
biotin, fluorescein, Texas Red, rhodamine, dinitrophenyl,
digoxigenin, Ruthenium, Europium, Cy5, Cy3, etc.
[0189] Suitable samples of target nucleic acid molecule may
comprise a wide range of eukaryotic and prokaryotic cells,
including protoplasts; or other biological materials, which may
harbour target nucleic acids. The methods are thus applicable to
tissue culture animal cells, animal cells (e.g., blood, serum,
plasma, reticulocytes, lymphocytes, urine, bone marrow tissue,
cerebrospinal fluid or any product prepared from blood or lymph) or
any type of tissue biopsy (e.g. a muscle biopsy, a liver biopsy, a
kidney biopsy, a bladder biopsy, a bone biopsy, a cartilage biopsy,
a skin biopsy, a pancreas biopsy, a biopsy of the intestinal tract,
a thymus biopsy, a mammae biopsy, a uterus biopsy, a testicular
biopsy, an eye biopsy or a brain biopsy, e.g., homogenized in lysis
buffer), archival tissue nucleic acids, plant cells or other cells
sensitive to osmotic shock and cells of bacteria, yeasts, viruses,
mycoplasmas, protozoa, rickettsia, fungi and other small microbial
cells and the like.
[0190] Target nucleic acids which are recognized by a plurality of
multi-probes can be assayed to detect sequences which are present
in less than 10% in a population of target nucleic acid molecules,
less than about 5%, less than about 1%, less than about 0.1%, and
less than about 0.01% (e.g., such as specific gene sequences). The
type of assay used to detect such sequences is a non-limiting
feature of the invention and may comprise PCR or some other
suitable assay as is known in the art or developed to detect
recognition sequences which are found in less than 10% of a
population of target nucleic acid molecules.
[0191] In one aspect, the assay to detect the less abundant
recognition sequences comprises hybridizing at least one primer
capable of specifically hybridizing to the recognition sequence but
substantially incapable of hybridizing to more than about 50, more
than about 25, more than about 10, more than about 5, more than
about 2 target nucleic acid molecules (e.g., the probe recognizes
both copies of a homozygous gene sequence), or more than one target
nucleic acid in a population (e.g., such as an allele of a single
copy heterozygous gene sequence present in a sample). In one
preferred aspect a pair of such primers is provided and flank the
recognition sequence identified by the multi-probe, i.e., are
within an amplifiable distance of the recognition sequence such
that amplicons of about 40-5000 bases can be produced, and
preferably, 50-500 or more preferably 60-100 base amplicons are
produced. One or more of the primers may be labelled.
[0192] Various amplifying reactions are well known to one of
ordinary skill in the art and include, but are not limited to PCR,
RT-PCR, LCR, in vitro transcription, rolling circle PCR, OLA and
the like. Multiple primers can also be used in multiplex PCR for
detecting a set of specific target molecules.
[0193] The invention further provides a method for designing
multi-probes sequences for use in methods and kits according to the
invention. A flow chart outlining the steps of the method is shown
in FIG. 2.
[0194] In one aspect, a plurality of n-mers of n nucleotides is
generated in silico, containing all possible n-mers. A subset of
n-mers are selected which have a Tm.gtoreq.60.degree. C.. In
another aspect, a subset of these probes is selected which do not
self-hybridize to provide a list or database of candidate n-mers.
The sequence of each n-mer is used to query a database comprising a
plurality of target sequences. Preferably, the target sequence
database comprises expressed sequences, such as human mRNA
sequences.
[0195] From the list of candidate n-mers used to query the
database, n-mers are selected that identify a maximum number of
target sequences (e.g., n-mers which comprise recognition segments
which are complementary to subsequences of a maximal number of
target sequences in the target database) to generate an
n-mer/target sequence matrix. Sequences of n-mers, which bind to a
maximum number of target sequences, are stored in a database of
optimal probe sequences and these are subtracted from the candidate
n-mer database. Target sequences that are identified by the first
set of optimal probes are removed from the target sequence
database. The process is then repeated for the remaining candidate
probes until a set of multi-probes is identified comprising n-mers
which cover more than about 60%, more than about 80%, more than
about 90% and more than about 95% of targets sequences. The optimal
sequences identified at each step may be used to generate a
database of virtual multi-probes sequences. Multi-probes may then
be synthesized which comprise sequences from the multi-probe
database.
[0196] In another aspect, the method further comprises evaluating
the general applicability of a given candidate probe recognition
sequence for inclusion in the growing set of optimal probe
candidates by both a query against the remaining target sequences
as well as a query against the original set of target sequences. In
one preferred aspect only probe recognition sequences that are
frequently found in both the remaining target sequences and in the
original target sequences are added to in the growing set of
optimal probe recognition sequences. In a most preferred aspect
this is accomplished by calculating the product of the scores from
these queries and selecting the probes recognition sequence with
the highest product that still is among the probe recognition
sequences with 20% best score in the query against the current
targets.
[0197] The invention also provides computer program products for
facilitating the method described above (see, e.g., FIG. 2). In one
aspect, the computer program product comprises program
instructions, which can be executed by a computer or a user device
connectable to a network in communication with a memory.
[0198] The invention further provides a system comprising a
computer memory comprising a data-base of target sequences and an
application system for executing instructions provided by the
computer program product.
[0199] Kits Comprising Multi-Probes
[0200] A preferred embodiment of the invention is a kit for the
characterisation or detection or quantification of target nucleic
acids comprising samples of a library of multi-probes. In one
aspect, the kit comprises in silico protocols for their use. In
another aspect, the kit comprises information relating to
suggestions for obtaining inexpensive DNA primers. The probes
contained within these kits may have any or all of the
characteristics described above. In one preferred aspect, a
plurality of probes comprises a least one stabilizing nucleobase,
such as an LNA nucleobase.
[0201] In another aspect, the plurality of probes comprises a
nucleotide coupled or stably associated with at least one chemical
moiety for increasing the stability of binding of the probe. In a
further preferred aspect, the kit comprises a number of different
probes for covering at least 60% of a population of different
target sequences such as a transcriptome. In one preferred aspect,
the transcriptome is a human transcriptome.
[0202] In another aspect, the kit comprises at least one probe
labelled with one or more labels. In still another aspect, one or
more probes comprise labels capable of interacting with each other
in a FRET-based assay, i.e., the probes may be designed to perform
in 5' nuclease or Molecular Beacon-based assays.
[0203] The kits according to the invention allow a user to quickly
and efficiently to develop assays for many different nucleic acid
targets. The kit may additionally comprise one or more re-agents
for performing an amplification reaction, such as PCR.
EXAMPLES
[0204] The invention will now be further illustrated with reference
to the following examples. It will be appreciated that what follows
is by way of example only and that modifications to detail may be
made while still falling within the scope of the invention.
[0205] In the following Examples probe reference numbers designate
the LNA-oligonucleotide sequences shown in the synthesis examples
below.
Example 1
[0206] Source of Transcriptome Data
[0207] The human transcriptome mRNA sequences were obtained from
ENSEMBL. ENSEMBL is a joint project between EMBL-EBI and the Sanger
Institute to develop a software system which produces and maintains
automatic annotation on eukaryotic genomes (see, e.g., Butler,
Nature 406 (6794): 333, 2000). ENSEMBL is primarily funded by the
Wellcome Trust. It is noted that sequence data can be obtained from
any type of database comprising expressed sequences, however,
ENSEMBL is particularly attractive because it presents up-to-date
sequence data and the best possible annotation for metazoan
genomes. The file "Homo_sapiens.cdna.fa" was downloaded from the
ENSEMBL ftp site: ftp)://ftp.ensembl.org/pub/curr- ent_human/data/
on May 14. 2003. The file contains all ENSEMBLE transcript
predictions (i.e., 37347 different sequences). From each sequence
the region starting at 50 nucleotides upstream from the 3' end to
1050 nucleotides upstream of the 3' end was extracted. The chosen
set of probe sequences (see best mode below) was further evaluated
against the human mRNA sequences in the Reference Sequence (RefSeq)
collection from NCBI. RefSeq standards serve as the basis for
medical, functional, and diversity studies; they provide a stable
reference for gene identification and characterization, mutation
analysis, expression studies, polymorphism discovery, and
comparative analyses. The RefSeq collection aims to provide a
comprehensive, integrated, non-redundant set of sequences,
including genomic DNA, transcript (RNA), and protein products, for
major research organisms. Similar coverage was found for both the
37347 sequences from ENSEMBL and the 19567 sequences in the RefSeq
collection, i.e., demonstrating that the type of database is a
non-limiting feature of the invention.
Example 2
[0208] Calculation of a Multi-Probe Dataset (Alfa Library)
[0209] Special software running on UNIX computers was designed to
calculate the optimal set of probes in a library. The algorithm is
illustrated in the flow chart shown in FIG. 2.
[0210] The optimal coverage of a transcriptome is found in two
steps. In the first step a sparse matrix of n_mers and genes is
determined, so that the number of genes that contain a given n_mer
can be found easily. This is done by running the getcover program
with the -p option and a sequence file in FASTA format as
input.
[0211] The second step is to determine the optimal cover with an
algorithm, based on the matrix determined in the first step. For
this purpose a program such as the getcover program is run with the
matrix as input. However, programs performing similar functions and
for executing similar steps may be readily designed by those of
skill in the art.
[0212] Obtaining Good Oligonucleotide Cover of the
Transcriptome.
[0213] 1. All 4.sup.n n-mers are generated and the expected melting
temperature is calculated. n-mers with a melting temperature below
60.degree. C. or with high self-hybridisation energy are removed
from the set. This gives a list of n-mers that have acceptable
physical properties.
[0214] 2. A list of gene sequences representing the human
transcriptome is extracted from the ENSEMBL database.
[0215] 3. Start of the main loop: Given the n-mer and gene list a
sparse matrix of n-mers versus genes is generated by identifying
all n-mers in a given gene and storing the result in a matrix.
[0216] 4. If this is the first iteration, a copy of the matrix is
put aside, and named the "total n-mer/gene matrix".
[0217] 5. The n-mer that covers most genes is identified and the
number of genes it covers is stored as "max_gene".
[0218] 6. The coverage of the remaining genes in the matrix is
determined and genes with coverage of at least 80% of max_gene are
stored in the "n-mer list with good coverage".
[0219] 7. The optimal n-mer is the one where the product of its
current coverage and the total coverage is maximal.
[0220] 8. The optimal n-mer is deleted from the n-mer list (step
1).
[0221] 9. The genes covered by this n-mer are deleted from the gene
list (step 2).
[0222] 10. The n-mer is added to the optimal n-mer list, the
process is continued from step 3 until no more n-mers can be
found.
[0223] The program code ("getcover" version 1.0 by Niels Tolstrup
2003) for calculation of a multi-probe dataset is listed in FIG.
17. It consists of three proprietary modules: getcover.c, dyp.c,
dyp.h
[0224] The program also incorporate four modules covered by the GNU
Lesser General Public Licence:
[0225] getopt.c, getopt.h, getopt1.c, getopt_init.c
[0226] /* Copyright (C) 1987, 88, 89, 90, 91, 92, 93, 94, 95, 96,
98, 99, 2000, 2001
[0227] Free Software Foundation, Inc.
[0228] These files are part of the GNU C Library. The GNU C Library
is free software; you can redistribute it and/or modify it under
the terms of the GNU Lesser General Public License as published by
the Free Software Foundation */
[0229] The software was compiled with aap. The main.aap file used
to make the program is like-wise listed in FIG. 17.
[0230] To run the compiled program the following command is
used:
[0231] getcover--I
9-p-f<h_sap_cdna.sub.--50.sub.--1050.fasta>h_sap_-
cdna.sub.--50.sub.--1050_I9.stat
[0232] getcover--I 9-i 1-d 10-t 60-c -n -m
-s<h_sap_cdna.sub.--50.sub.--
-1050.sub.--19.stat>h_sap_cdna.sub.--50.sub.--1050.sub.--19.cover
[0233] The computer program was used with instructions for
implementing the algorithm described above to analyze the human
transcriptome with the following parameter settings:
[0234] L89: probe length=8 or 9 nucleotides
[0235] i1: inclusion fraction=100%
[0236] d10: delta Tm required for target duplex against self
duplex=10.degree. C.
[0237] t60: minimum Tm for target duplex=60.degree. C.
[0238] c: complementary target sequence used as well
[0239] 10 m80: optimal probes selected among the most general
probes addressing the remaining targets with the product rule and
the 80% rule
[0240] n: LNA nucleotides were preferably included in the central
part of the recognition segment;
[0241] and resulted in the identification of a database of
multi-probe target sequences.
[0242] Target sequences in this database are exemplary optimal
targets for a multi-probe library. These optimal multi-probes are
listed in TABLE 1 below and comprise 5' fluorescein fluorophores
and 3' Eclipse quenchers (see below).
1TABLE 1 Dual label oligonucleotide probes cagcctcc cagagcca
agctgtga aggaggga aggaggag ctggaagc cagagagc tgtggaga cccaggag
cagccaga tgaggaga ctggggaa ctccagcc cttctggg acagtgga ctcctgca
ctcctcca ttctgcca acagccat tgaggtgg ctgctgcc aggagaga tttctcca
aaggcagc ctccagca ttcctgca cagtggtg ctgtggca ctgctggg tttgggga
aaagggga agaagggc cttcctgg caggcaga tgtgggaa tggatgga acagcagc
ctgtgcca actgggaa ttctggca cagctcca ttccctgg tcacagga cagaaggc
ccccaccc aaccccat ttcctccc atcccaga tggtggtg ctgcccag aggtggaa
caggtgct ttcctcca ctgaggca tgtggaca ctgtctcc ctgctcca ctgctggt
tggaggcc tgctgtga tggagaga cagtgcca atggtgaa agctggat aaggcaga
atggggaa ctggaagg tggagagc cagccagg agggagag caggcagc cttggtgg
cagcagga ctctgcca tcaggagc caccttgg ctgtgctg ctgctgag acacacac
cagccacc agaggaga ccctccca catcttca ctgtgacc ctgtggct aggaggca
cacctgca agggggaa cagtggct cactgcca ccagggcc tgggacca ttctccca
ctgtgtgg cagaggca acagggaa cctggagc ttcccagt ctgggact ctgggcaa
cccagcag tccagtgt ctgcctgt ctggagga ttctcctg ctcctccc tggaaggc
tccactgc cttcctgc cttcccca ctgtgcct ctgccacc ccacctcc ctctgcca
ctgtgctc acagcctca ttcctctg cagcaggt ctgtgagc ctgtggtc tggtgatg
ctccatcc tcctcctc cttcaggc tgtggctg tgctgtcc ctcagcca tctgggtc
cttctccc tcctctcc ctcttccc cttggagc ctgcctcc ctctgcct ctgggcac
ccaggctc ctccttcc ctggctgc tgggcatc tctctggt tcctgctc ccgccgcc
ctctggct cttgggct catcctcc ctcctcct tgctgggc ctgccatc aggagctg
cagcctgg ctgctctc cactggga tcctgctg cagcagcc ctggagtc tgccctga
ctcctcca tgctggag cttcagcc ttggtggt ccagccag cttcctcc cttccagc
ttgggact cagcccag ttcctggc tccaggtc ctgctgga ctccacca tcctcagc
cagcatcc caggagct ctccagcc aggagcag cagaggct ctcagcct tggctctg
ccaggagg ctgccttc ttctggct caggcagc cagcctcc ctgggaga ctgtctgc
ctgcctct agctggag cccagccc ctgtccca cttctgcc ctgctgcc cagctccc
tctgccca ctgctccc tggctgtg ccagccgc ctggacac tggtggaa cctggaga
cctcagcc ttgccatc agctggga ccagggcc tcctcttct cttcccct ctgcttcc
ccaccacc ctggctcc cttgggca cagcaggc tctgctgc ccagggca ttctggtc
tctggagc cagccacc ctccacct ccgccgcc catccagc cagaggag ctgcccca
cttcttctc atggctgc ctctcctc tgggcagc ttccctcc ctcctgcc caggagcc
ctggtctc ttcctcaga tggtggcc tctggtcc ctggggcc tccaaggc ctggggct
ctgtctcc cagtggca ttggggtc
[0243] These hyper-abundant 9-mer and 8-mer sequences fulfil the
selection criteria in FIG. 2., i.e.,
[0244] each probe target occurs in at least 6% of the sequences in
the human transcriptome (i.e., more than 2200 target sequences
each, more than 800 sequences targeted within 1000 nt proximal to
the 3' end of the transcript).
[0245] they are not self complementary (i.e. unlikely to form probe
duplexes). Self score is at least 10 below T.sub.m estimate for the
duplex formed with the target.
[0246] the formed duplex with their target sequence has a T.sub.m
at or above 60.degree. C.
[0247] They cover>98% of the mRNAs in the human transcriptome
when combined.
[0248] Especially preferred versions of the multi-probes of table 1
are presented in the following table 1a:
2TABLE 1a One hundred LNA substituted oligonucleotides cAgCCTCc
cAGAGCCa aGCTGTGa aGGAGGGa aGGAGGAg cTGGAAGc cAGAGAGc tGTGGAGa
ccCAGGAg cAGCCAGa tGAGGAGa ctGGGGAa cTCCAgCc cTTCTGGg aCAGTGGa
cTCCtGCa cTCCTCCa tTCTGCCa aCAGCCAt tGAGGtGg cTgCTGCc aGGAGAGa
tTTCTCCa aAGGCAGc cTCCAGCa tTCCTGCa cAGTGGTg ctGTGGCa cTGCTGgg
tTTGGGGa aAAGGGGa aGAAGGGc cTTCCTGg cAGGCAGa tGTGGGAa tGGATGGa
aCAGCAGc ctGTGCCa aCTGGGAa tTCTGGCa caGCTCCa tTCCCTGg tCACAGGa
cAGAAGGc cCCCACCc aACCCCAt tTCCTCCc aTCCCAGa tGGTGGTg ctGCCCag
aGGTGGAa cAGGtGCt tTCCTCCa cTGAGGCa tGTGGACa cTGTCTCc cTGCTCCa
cTGCtGGt tGGAGgCc tGCTGTGa tGGAGAGa cAGtGCCa atGGTGAA aGCTGGAt
aAGGCAGa aTGGGGAa cTGGAAGg tGGAGAGc cAGCcAGg aGGGAGAg cAGGcAGc
cTTGGTGg cAGGAGGa cTCtGCCa tCAGGaGc cACCTTGg cTGTGCTg cTGCTGAg
aCACACAC cAgCCACc aGAGGAGa cCCtCCCa cATCTTCA cTGTGACc ctGTGGCt
aGGAGGca cACCtGCa aGGGGGAa caGTGGCt cACtGCCa cCAGgGcc tGgGACCa
tTCTCCCa cTGTGTGg cAGAGGCa aCAGGGAa
[0249] wherein small letters designate a DNA monomer and capital
letters designate a LNA nucleotide.
[0250] >95.0% of the mRNA sequences are targeted within the 1000
nt near their 3' terminal, (position 50 to 1050 from 3' end) and
>95% of the mRNA contain the target sequence for more than one
probe in the library. More than 650,000 target sites for these 100
multiprobes were identified in the human transcriptome containing
37,347 nucleic acid sequences. The average number of multi-probes
addressing each transcript in the transcriptome is 17.4 and the
median value is target sites for 14 different probes.
[0251] The sequences noted above are also an excellent choice of
probes for other transcriptomes, though they were not selected to
be optimized for the particular organisms. We have thus evaluated
the coverage of the above listed library for the mouse and rat
genome despite the fact that the above probes were designed to
detect/characterize/quantify the transcripts in the human
transcriptome only. E.g. see table 2.
3 TABLE 2 Transcriptome Human probe library Human Mouse Rat no. of
mRNA sequences 37347 32911 28904 Coverage of full length mRNAs
96.7% 94.6% 93.5% Coverage 1000 nt near the 3'-end 91.0% -- -- At
least covered by two probes 89.8% 80.2% 77.0%
nt.about.nucleotides.
Example 3
[0252] Expected Coverage of Human Transcriptome by Frequently
Occurring 9-mer Oligonucleotides
[0253] Experimental pilot data (similar to FIG. 6) indicated that
it is possible to reduce the length of the recognition sequence of
a dual-labelled probe for real-time PCR assays to 8 or 9
nucleotides depending on the sequence, if the probe is enhanced
with LNA. The unique duplex stabilizing properties of LNA are
necessary to ensure an adequate stability for such a short duplex
(i.e. T.sub.m>60.degree. C.). The functional real-time PCR probe
will be almost pure LNA with 6 to LNA nucleotides in the
recognition sequence. However, the short recognition sequence makes
it possible to use the same LNA probe to detect and quantify the
abundance of many different genes. By proper selection of the best
(i.e. most common) 8 or 9-mer recognition sequences according to
the algorithm depicted in FIG. 2 it is possible to get a coverage
of the human transcriptome containing about 37347 mRNAs (FIG.
3).
[0254] FIG. 3 shows the expected coverage as percentage of the
total number of mRNA sequences in the human transcriptome that are
detectable within a 1000 nt long stretch near the 3' end of the
respective sequences (i.e. the sequence from 50 nt to 1050 nt from
the 3' end) by optimized probes of different lengths. The probes
are required to be sufficiently stable (Tm>60 deg C.) and with a
low propensity for forming self duplexes, which eliminate many
9-mers and even more 8-mer probe sequences.
[0255] If all probes sequences of a given length could be used as
probes we would obviously get the best coverage of the
transcriptome by the shortest possible probe sequences. This is
indeed the case when only a limited number of probes (<55) are
included in the library (FIG. 4). However, because many short
probes with a low GC content have an inadequate thermal stability,
they were omitted from the library. The limited diversity of
acceptable 8-mer probes are less efficient at detecting low GC
content genes, and a library composed of 100 different 9-mer probes
consequently have a better coverage of the transcriptome than a
similar library of 8-mers. However, the best choice is a mixed
library composed of sequences of different lengths such as the
proposed best mode library listed above. The coverage of this
library is not shown in FIG. 4.
[0256] The designed probe library containing 100 of the most
commonly occurring 9-mer and 8-mers, i.e., the "Human mRNA probe
library" can be handled in a convenient box or microtiter plate
format.
[0257] The initial set of 100 probes for human mRNAs can be
modified to generate similar library kits for transcriptomes from
other organisms (mouse, rat, Drosophila, C. elegans, yeast,
Arabidopsis, zebrafish, primates, domestic animals, etc.).
Construction of these new probe libraries will require little
effort, as most of the human mRNA probes may be re-used in the
novel library kits (TABLE 2).
Example 4
[0258] Number of Probes in the Library that Target each Gene
[0259] Not only does the limited number of probes in the proposed
libraries target a large fraction (>98%) of the human
transcriptome, but there is also a large degree of redundancy in
that most of the genes (almost 95%) may be detected by more than
one probe. More than 650,000 target sites have been identified in
the human transcriptome (37347 genes) for the 100 probes in the
best mode library shown above. This gives an average number of
target sites per probe of 6782 (i.e. 18% of the transcriptome)
ranging from 2527 to 12066 sequences per probe. The average number
of probes capable of detecting a particular gene is 17.4, and the
median value is 14. Within the library of only 100 probes we thus
have at least 14 probes for more than 50% of all human mRNA
sequences.
[0260] The number of genes that are targeted by a given number of
probes in the library is depicted in FIG. 4.
Example 5
[0261] Design of 9-mer Probes to Demonstrate Feasibility
[0262] The SSA4 gene from yeast (Saccharomyces cerevisiae) was
selected for the expression assays because the gene transcription
level can be induced by heat shock and mutants are available where
expression is knocked out. Three different 9mer sequences were
selected amongst commonly occurring 9mer sequences within the human
transcriptome (Table 3). The sequences were present near the 3'
terminal end of 1.8 to 6.4% of all mRNA sequences within the human
transcriptome. Further selection criteria were a moderate level of
selfcomplementarity and a Tm of 60.degree. C. or above. All three
sequences were present within the terminal 1000 bases of the SSA4
ORF. Three 5' nuclease assay probes were constructed by
synthesizing the three sequences with a FITCH fluorophore in the
5'-end and an Eclipse quencher (Epoch Biosciences) in the 3' end.
The probes were named according to their position within the ORF
YER103W (SSA4) where position 1201 was set to be position 1. Three
sets of primer pairs were designed to produce three non-overlapping
amplicons, which each contained one of the three probe sequences.
Amplicons were named according to the probe sequence they
encompassed.
4TABLE 3 Designed 5' nuclease assay probes and primers Name of
Forward primer Reverse primer Amplicon Sequence probe sequence
sequence length aaCGAGAAG Dual-la- cgcgtttactttgaaa gcttccaatttcct
81 bp belled-469 aattctg ggcatc (SEQ ID NO: 1) (SEQ ID NO: 2)
cAAGGAAAg Dual-la- gcccaagatgcta- gggtttgcaacacc 95 bp belled-570
taaattggttag ttctagttc (SEQ ID NO: 3) (SEQ ID NO: 4) ctGGAGCaG
Dual-la- tacggagctgcaggtg gttgggccgttgtc 86 bp belled-671 gt tggt
(SEQ ID NO: 5) (SEQ ID NO: 6) bp .about. base pairs
[0263] Two Molecular Beacons were also designed to detect the SSA4
469- and the SSA4 570 sequence and named Beacon-469 and Beacon-570,
respectively. The sequence of the SSA4 469 beacon was CMGGAGAAGTTG
(SEQ ID NO: 7, 10-mer recognition site) which should enable this
oligonucleotide to form the intramolecular beacon structure with a
stem formed by the LNA-LNA interactions between the 5'-CAA and the
TTG-3'. The sequence of the SSA4 570 beacon was CAAGGAAAGttG (9-mer
recognition site) where the intramolecular beacon structure may
form between the 5'-CAA and the ttG-3'. Both the sequences were
synthesized with a fluorescein fluorophore in the 5' -end and a
Dabcyl quencher in the 3' end.
[0264] One SYBR Green labeled probe was also designed to detect the
SSA4 570 sequence and named SYBR-Probe-570. The sequence of this
probe was CAAGGMaG. This probe was synthesized with a amino-C6
linker on the 5'-end on which the fluorophore SYBR Green 101
(Molecular Probes) was attached according to the manufactures
instructions. Upon hybridization to the target sequence, the linker
attached fluorophore should intercalate in the generated LNA-DNA
duplex region causing increased fluorescence from the SYBR Green
101.
5TABLE 4 SEQUENCES EQ Position Number Name Type Sequence in gene
13992 Dual- 5' nuclease 5'-Fluor-aaGGAGAAG- 469-477 labelled- assay
probe Eclipse-3' 469 13994 Dual- 5' nuclease
5'-Fluor-cAAGGAAAg-Eclips- e-3' 570-578 labelled- assay probe 570
13996 Dual- 5' nuclease 5'-Fluor-ctGGAGCaG-Eclipse-3' 671-679
labelled- assay probe 671 13997 Beacon-469 Molecular
5'-Fluor-CAAGGAGAAGTTG-Dabcyl-3' Beacon (5'-Fluor-SEQ ID NO:
8-Dabcyl-3') 14148 Beacon-570 Molecular
5'-Fluor-CAAGGAAAGttG-Dabcyl-3' Beacon (5'-Fluor-SEQ ID NO:
9-Dabcyl-3') 14165 SYBR-Probe- SYBR-Probe
5'-SYBR101-NH2C6-cAAGGAAAg-3' 570 14012 SSA4-469-F Primer
cgcgtttactttgaaaaattctg (SEQ ID NO: 10) 14013 SSA4-469-R Primer
gcttccaatttcctggcatc (SEQ ID NO: 11) 14014 SSA4-570-F Primer
gcccaagatgctataaattggttag (SEQ ID NO: 12) 14015 SSA4-570-R Primer
gggtttgcaacaccttctagttc (SEQ ID NO: 13) 14016 SSA4-671-F Primer
tacggagctgcaggtggt (SEQ ID NO: 14) 14017 SSA4-671-R Primer
gttgggccgttgtctggt (SEQ ID NO: 15) 14115 POL5-469-F Primer
gcgagagaaaacaagcaagg (SEQ ID NO: 16) 14116 POL5-469-R Primer
attcgtcttcactggcatca (SEQ ID NO: 17) 14117 APG9-570-F Primer
cagctaaaaatgatgacaataatgg (SEQ ID NO: 18) 14118 APG9-570-R Primer
attacatcatgattagggaatgc (SEQ ID NO: 19) 14119 HSP82-671-F Primer
gggtttgaacattgatgagga (SEQ ID NO: 20) 14120 HSP82-671-R Primer
ggtgtcagctggaacctctt (SEQ ID NO: 21)
Example 6
[0265] Synthesis, Deprotection and Purification of Dual Labelled
Oligonucleotides
[0266] The dual labelled oligonucleotides EQ13992 to EQ14148 (Table
4) were prepared on an automated DNA synthesizer (Expedite 8909 DNA
synthesizer, PerSeptive Biosystems, 0.2 .mu.mol scale) using the
phosphoramidite approach (Beaucage and Caruthers, Tetrahedron Lett.
22: 1859-1862, 1981) with 2-cyanoethyl protected LNA and DNA
phosphoramidites, (Sinha, et al., Tetrahedron Lett.24: 5843-5846,
1983). CPG solid supports derivatized with either eclipse quencher
(EQ13992-EQ13996) or dabcyl (EQ13997-EQ14148) and 5'-fluorescein
phosphoramidite (GLEN Research, Sterling, Va., USA). The synthesis
cycle was modified for LNA phosphoramidites (250s coupling time)
compared to DNA phosphoramidites. 1H-tetrazole or
4,5-dicyanoimidazole (Proligo, Hamburg, Germany) was used as
activator in the coupling step.
[0267] The oligonucleotides were deprotected using 32% aqueous
ammonia (1h at room temperature, then 2 hours at 60.degree. C.) and
purified by HPLC (Shimadzu-SpectraChrom series; Xterra.TM. RP18
column, 10?m 7.8.times.150 mm (Waters). Buffers: A: 0.05M
Triethylammonium acetate pH 7.4. B. 50% acetonitrile in water.
Eluent: 0-25 min: 10-80% B; 25-30 min: 80% B). The composition and
purity of the oligonucleotides were verified by MALDI-MS
(PerSeptive Biosystem, Voyager DE-PRO) analysis, see Table 5. FIG.
5 is the MALDI-MS spectrum of EQ13992 showing [M-H]-=4121,3 Da.
This is a typical MALDI-MS spectrum for the 9-mer probes of the
invention.
6TABLE 5 EQ # Sequences MW (Calc.) MW (Found) 13992
5'-Fitc-aaGGAGAAG-EQL-3' 4091,8 Da. 4091,6 Da. 13994
5'-Fitc-cAAGGAAAg-EQL-3' 4051,9 Da. 4049,3 Da. 13996
5'-Fitc-ctGGAGmCaG-EQL-3' 4020,8 Da. 4021,6 Da.
5'-Fitc-mCAAGGAGAAGTTG-dabcyl-3' 13997 (5'-Fitc-SEQ ID NO:
22-dabcyl-3') 5426,3 Da. 5421,2 Da.
[0268] Capitals designate LNA monomers (A, G, mC, T), where mC is
LNA methyl cytosine. Small letters designate DNA monomers (a, g, c,
t). Fitc=Fluorescein; EQL=Eclipse quencher; Dabcyl=Dabcyl quencher.
MW=Molecular weight.
Example 7
[0269] Production of cDNA Standards of SSA4 for Detection with
9-mer Probes
[0270] The functionality of the constructed 9mer probes were
analysed in PCR assays where the probes ability to detect different
SSA4 PCR amplicons were questioned. Template for the PCR reaction
was cDNA obtained from reverse transcription of cRNA produced from
in vitro transcription of a downstream region of the SSA4 gene in
the expression vector pTRIamp18 (Ambion). The downstream region of
the SSA4 gene was cloned as follows:
[0271] PCR Amplification
[0272] Amplification of the partial yeast gene was done by standard
PCR using yeast genomic DNA as template. Genomic DNA was prepared
from a wild type standard laboratory strain of Sacharomyces
cerevisiae using the Nucleon MiY DNA extraction kit (Amersham
Biosciences) according to supplier's instructions. In the first
step of PCR amplification, a forward primer containing a
restriction enzyme site and a reverse primer containing a universal
linker sequence were used. In this step 20 bp was added to the
3'-end of the amplicon, next to the stop codon. In the second step
of amplification, the reverse primer was exchanged with a nested
primer containing a poly-T.sub.20 tail and a restriction enzyme
site. The SSA4 amplicon contains 729 bp of the SSA4 ORF plus a 20
bp universal linker sequence and a poly-A.sub.20 tail.
[0273] The PCR primers used were:
7 YER103W-For-SacI: acgtgagctcattgaaactgcaggtggtattatga (SEQ ID NO:
23) YER103W-Rev-Uni: gatccccgggaattgccatgctaatcaacctcttc- aaccgttgg
(SEQ ID NO: 24) Uni-polyT-BamHI:
acgtggatccttttttttttttttttttttgatccccgggaattgccatg. (SEQ ID NO:
25)
[0274] Plasmid DNA Constructs
[0275] The PCR amplicon was cut with the restriction enzymes,
EcoRI+BamHI. The DNA fragment was ligated into the pTRIamp18 vector
(Ambion) using the Quick Ligation Kit (New England Biolabs)
according to the supplier's instructions and transformed into E.
coli DH-5 by standard methods.
[0276] DNA Sequencing
[0277] To verify the cloning of the PCR amplicon, plasmid DNA was
sequenced using M13 forward and M13 reverse primers and analysed on
an ABI 377.
[0278] In vitro Transcription
[0279] SSA4 cRNA was obtained by performing in vitro transcription
with the Megascript T7 kit (Ambion) according to the supplier's
instructions.
[0280] Reverse Transcription
[0281] Reverse transcription was performed with 1 pg of cRNA and
0.2 U of the reverse transcriptase Superscript II RT (Invitrogen)
according to the suppliers instructions except that 20 U
Superase-In (RNAse inhibitor--Ambion) was added. The produced cDNA
was purified on a QiaQuick PCR purification column (Qiagen)
according to the supplier's instructions using the supplied
EB-buffer for elution. The DNA concentration of the eluted cDNA was
measured and diluted to a concentration of SSA4 cDNA copies
corresponding to 2.times.10.sup.7 copies pr .mu.L.
Example 8
[0282] Protocol for of Dual Label Probe Assays
[0283] Reagents for the dual label probe PCRs were mixed according
to the following scheme (Table 6):
8 TABLE 6 Reagents Final Concentration H.sub.2O GeneAmp 10 .times.
PCR buffer II 1.times. Mg.sup.2+ 5.5 mM DNTP 0.2 mM Dual Label
Probe 0.1 or 0.3 .mu.M* Template 1 .mu.L Forward primer 0.2 .mu.M
Reverse primer 0.2 .mu.M AmliTaq Gold 2.5 U Total 50 .mu.L *Final
concentration of 5' nuclease assay probe 0.1 .mu.M and
Beacon/SYBR-probe 0.3 .mu.M.
[0284] In the present experiments 2.times.10.sup.7 copies of the
SSA4 CDNA was added as template. Assays were performed in a DNA
Engine Opticon.RTM. (MJ Research) using the following PCR cycle
protocols:
9 TABLE 7 5' nuclease assays Beacon & SYBR-probe Assays
95.degree. C. for 7 minutes 95.degree. C. for 7 minutes & &
40 cycles of: 40 cycles of: 94.degree. C. for 20 seconds 94.degree.
C. for 30 seconds 60.degree. C. for 1 minute 52.degree. C. for 1
minute* Fluorescence detection Fluorescence detection 72.degree. C.
for 30 seconds *For the Beacon-570 with 9-mer recognition site the
annealing temperature was reduced to 44.degree. C.
[0285] The composition of the PCR reactions shown in Table 6
together with PCR cycle protocols listed in Table 7 will be
referred to as standard 5' nuclease assay or standard Beacon assay
conditions.
Example 9
[0286] Specificity of 9-mer 5' Nuclease Assay Probes
[0287] The specificity of the 5' nuclease assay probes were
demonstrated in assays where each of the probes was added to 3
different PCR reactions each generating a different SSA4 PCR
amplicon. As shown in FIG. 6, each probe only produces a
fluorescent signal together with the amplicon it was designed to
detect (see also FIGS. 10, 11 and 12). Importantly the different
probes had very similar cycle threshold C.sub.t values (from 23.2
to 23.7), showing that the assays and probes have a very equal
efficiency. Furthermore it indicates that the assays should detect
similar expression levels when used in used in real expression
assays. This is an important finding, because variability in
performance of different probes is undesirable.
Example 10
[0288] Specificity of 9 and 10-mer Molecular Beacon Probes
[0289] The ability to detect in real time, newly generated PCR
amplicons was also demonstrated for the molecular beacon design
concept. The Molecular Beacon designed against the 469 amplicon
with a 10-mer recognition sequence produced a clear signal when the
SSA4 cDNA template and primers for generating the 469 amplicon were
present in the PCR, FIG. 7A. The observed C.sub.t value was 24.0
and very similar to the ones obtained with the 5' nuclease assay
probes again indicating a very similar sensitivity of the different
probes. No signal was produced when the SSA4 template was not
added. A similar result was produced by the Molecular Beacon
designed against the 570 amplicon with a 9-mer recognition
sequence, FIG. 7B.
Example 11
[0290] Specificity of 9-mer SYBR-Probes.
[0291] The ability to detect newly generated PCR amplicons was also
demonstrated for the SYBR-probe design concept. The 9-mer
SYBR-probe designed against the 570 amplicon of the SSA4 cDNA
produced a clear signal when the SSA4 cDNA template and primers for
generating the 570 amplicon were present in the PCR, FIG. 8. No
signal was produced when the SSA4 template was not added.
Example 12
[0292] Quantification of Transcript Copy Number
[0293] The ability to detect different levels of gene transcripts
is an essential requirement for a probe to perform in a true
expression assay. The fulfilment of the requirement was shown by
the three 5' nuclease assay probes in an assay where different
levels of the expression vector derived SSA4 cDNA was added to
different PCR reactions together with one of the 5' nuclease assay
probes (FIG. 9). Composition and cycle conditions were according to
standard 5' nuclease assay conditions.
[0294] The cDNA copy number in the PCR before start of cycling is
reflected in the cycle threshold value C.sub.t, i.e., the cycle
number at which signal is first detected. Signal is here only
defined as signal if fluorescence is five times above the standard
deviation of the fluorescence detected in PCR cycles 3 to 10. The
results show an overall good correlation between the logarithm to
the initial cDNA copy number and the C.sub.t value (FIG. 9). The
correlation appears as a straight line with slope between -3.456
and -3.499 depending on the probe and correlation coefficients
between 0.9981 and 0.9999. The slope of the curves reflect the
efficiency of the PCRs with a 100% efficiency corresponding to a
slope of -3.322 assuming a doubling of amplicon in each PCR cycle.
The slopes of the present PCRs indicate PCR efficiencies between
94% and 100%. The correlation coefficients and the PCR efficiencies
are as high as or higher than the values obtained with DNA 5'
nuclease assay probes 17 to 26 nucleotides long in detection assays
of the same SSA4 cDNA levels (results not shown). Therefore these
result show that the three 9-mer 5' nuclease assay probes meet the
requirements for true expression probes indicating that the probes
should perform in expression profiling assays
Example 13
[0295] Detection of SSA4 Transcription Levels in Yeast
[0296] Expression levels of the SSA4 transcript were detected in
different yeast strains grown at different culture conditions (.+-.
heat shock). A standard laboratory strain of Saccharomyces
cerevisiae was used as wild type yeast in the experiments described
here. A SSA4 knockout mutant was obtained from EUROSCARF (accession
number Y06101). This strain is here referred to as the SSA4 mutant.
Both yeast strains were grown in YPD medium at 30.degree. C. till
an OD.sub.600 of 0.8 A. Yeast cultures that were to be heat shocked
were transferred to 40.degree. C. for 30 minutes after which the
cells were harvested by centrifugation and the pellet frozen at
-80.degree. C. Non-heat shocked cells were in the meantime left
growing at 30.degree. C. for 30 minutes and then harvested as
above.
[0297] RNA was isolated from the harvested yeast using the FastRNA
Kit (Bio 101) and the FastPrep machine according to the supplier's
instructions.
[0298] Reverse transcription was performed with 5 .mu.g of anchored
oligo(dT) primer to prime the reaction on 1 .mu.g of total RNA, and
0.2 U of the reverse transcriptase Superscript II RT (Invitrogen)
according to the suppliers instructions except that 20 U
Superase-In (RNAse inhibitor--Ambion) was added. After a two-hour
incubation, enzyme inactivation was performed at 70.degree. for 5
minutes. The cDNA reactions were diluted 5 times in 10 mM Tris
buffer pH 8.5 and oligonucleotides and enzymes were removed by
purification on a MicroSpin.TM. M S-400 HR column (Amersham
Pharmacia Biotech). Prior to performing the expression assay the
cDNA was diluted 20 times. The expression assay was performed with
the Dual-labelled-570 probe using standard 5' nuclease assay
conditions except 2 .mu.L of template was added. The template was a
100 times dilution of the original reverse transcription reactions.
The four different cDNA templates used were derived from wild type
or mutant with or without heat shock. The assay produced the
expected results (FIG. 10) showing increased levels of the SSA4
transcript in heat shocked wild type yeast (C.sub.t=26.1) compared
to the wild type yeast that was not submitted to elevated
temperature (C.sub.t=30.3). No transcripts were detected in the
mutant yeast irrespective of culture conditions. The difference in
C.sub.t values of 3.5 corresponds to a 17 fold induction in the
expression level of the heat shocked versus the non-heat shocked
wild type yeast and this value is close to the values around 19
reported in the literature (Causton, et al. 2001). These values
were obtained by using the standard curve obtained for the
Dual-labelled-570 probe in the quantification experiments with
known amounts of the SSA4 transcript (see FIG. 9). The experiments
demonstrate that the 9-mer probes are capable of detecting
expression levels that are in good accordance with published
results.
Example 14
[0299] Multiple Transcript Detection with Individual 9-mer
Probes
[0300] To demonstrate the ability of the three 5' nuclease assay
probes to detect expression levels of other genes as well, three
different yeast genes were selected in which one of the probe
sequences was present. Primers were designed to amplify a 60-100
base pair region around the probe sequence. The three selected
yeast genes and the corresponding primers are shown in Table.
10TABLE 8 Design of alternative expression assays Matching Forward
primer Reverse primer Amplicon Sequence/Name Probe sequence
sequence length YEL055C/POL5 Dual- gcgagagaaaaca- attcgtcttcact- 94
bp labelled- agcaagg ggcatca 469 (SEQ ID NO: 26) (SEQ ID NO: 27)
YDL149W_APG9 Dual- cagctaaaaatga- attacatcatgat- 97 bp labelled-
tgacaataatgg tagggaatgc 570 (SEQ ID NO: 28) (SEQ ID NO: 29)
YPL240C_HSP82 Dual- gggtttgaacatt- ggtgtcagctgga- 88 bp labelled-
gatgagga acctctt 671 (SEQ ID NO: 30) (SEQ ID NO: 31)
[0301] Total CDNA derived from non-heat shocked wild type yeast was
used as template for the expression assay, which was performed
using standard 5' nuclease assay conditions except 2 .mu.L of
template was added. As shown in FIG. 11, all three probes could
detect expression of the genes according to the assay design
outlined in Table 8. Expression was not detected with any other
combination of probe and primers than the ones outlined in Table 8.
Expression data are available in the literature for the SSA4, POL5,
HSP82, and the APG9 (Holstege, et al. 1998). For non-heat shocked
yeast, these data describe similar expression levels for SSA4 (0.8
transcript copies per cell), POL5 (0.8 transcript copies per cell)
and HSP82 (1.3 transcript copies per cell) whereas APG9 transcript
levels are somewhat lower (0.1 transcript copies per cell).
[0302] This data is in good correspondence with the results
obtained here since all these genes showed similar C.sub.t values
except HSP82, which had a C.sub.t value of 25.6. This suggests that
the HSP82 transcript was more abundant in the strain used in these
experiments than what is indicated by the literature. Agarose gel
electrophoresis was performed with the PCRs shown in FIG. 11a for
the Dual-labelled-469 probe. The agarose gel (FIG. 12) shows that
PCR product was indeed generated in reactions where no signal was
obtained and therefore the lack fluorescent signal from these
reactions was not caused by failure of the PCR. Furthermore, the
different length of amplicons produced in expression assays for
different genes indicate that the signal produced in expression
assays for different genes are indeed specific for the gene in
question.
Example 15
[0303] Selection of Targets
[0304] Using the EnsMart software release 16.1 from
httD://www.ensembl.org/EnsMart, the 50 bases from each end off all
exons from the Homo Sapiens NCBI 33 dbSNP115 Ensembl Genes were
extracted to form a Human Exon50 target set. Using the GetCover
program (cf. FIG. 17), occurrence of all probe target sequences was
calculated and probe target sequences not passing selection
criteria according to excess self-complimentarity, excessive GC
content etc. were eliminated. Among the remaining sequences, the
most abundant probe target sequences was selected (No. 1, covering
3200 targets), and subsequently all the probe targets having a
prevalence above 0.8 times the prevalence of the most abundant
(3200.times.0.8) or above 2560 targets. From the remaining sample
the number of new hits for each probe was computed and the product
of number of new hits per probe target compared to the existing
selection and the total prevalence of the same probe target was
computed and used to select the next most abundant probe target
sequence by selecting the highest product number. The probe target
length (n), and sequence (nmer) and occurrence in the total target
(cover), as well as the number of new hits per probe target
selection (Newhit), the product of Newhit and cover
(newhit.times.cover) and the number of accumulated hits in the
target population from all accumulated probes (sum) is exemplified
in the table below.
11 No n nmer Newhit Cover newhit .times. cover sum 1 8 ctcctcct
3200 3200 10240000 3200 2 8 ctggagga 2587 3056 7905872 5787 3 8
aggagctg 2132 3074 6553768 7919 4 8 cagcctgg 2062 2812 5798344 9981
5 8 cagcagcc 1774 2809 4983166 11755 6 8 tgctggag 1473 2864 4218672
13228 7 8 agctggag 1293 2863 3701859 14521 8 8 ctgctgcc 1277 2608
3330416 15798 9 8 aggagcag 1179 2636 3107844 16977 10 8 ccaggagg
1044 2567 2679948 18021 11 8 tcctgctg 945 2538 2398410 18966 12 8
cttcctcc 894 2477 2214438 19860 13 8 ccgccgcc 1017 2003 2037051
20877 14 8 cctggagc 781 2439 1904859 21658 15 8 cagcctcc 794 2325
1846050 22452 16 8 tggctgtg 805 2122 1708210 23257 17 8 cctggaga
692 2306 1595752 23949 18 8 ccagccag 661 2205 1457505 24610 19 8
ccagggcc 578 2318 1339804 25188 20 8 cccagcag 544 2373 1290912
25732 21 8 ccaccacc 641 1916 1228156 26373 22 8 ctcctcca 459 3010
1381590 26832 23 8 ttctcctg 534 1894 1011396 27366 24 8 cagcccag
471 2033 957543 27837 25 8 ctggctgc 419 2173 910487 28256 26 8
ctccacca 426 2097 893322 28682 27 8 cttcctgc 437 1972 861764 29119
28 8 cttccagc 415 1883 781445 29534 29 8 ccacctcc 366 2018 738588
29900 30 8 ttcctctg 435 1666 724710 30335 31 8 cccagccc 354 1948
689592 30689 32 8 tggtgatg 398 1675 666650 31087 33 8 tggctctg 358
1767 632586 31445 34 8 ctgccttc 396 1557 616572 31841 35 8 ctccagcc
294 2378 699132 32135 36 8 tgtggctg 304 1930 586720 32439 37 8
cagaggag 302 1845 557190 32741 38 8 cagctccc 275 1914 526350 33016
39 8 ctgcctcc 262 1977 517974 33278 40 8 tctgctgc 267 1912 510504
33545 41 8 ctgcttcc 280 1777 497560 33825 42 8 cttctccc 291 1663
483933 34116 43 8 cctcagcc 232 1863 432216 34348 44 8 ctccttcc 236
1762 415832 34584 45 8 cagcaggc 217 1868 405356 34801 46 8 ctgcctct
251 1575 395325 35052 47 8 ctccacct 215 1706 366790 35267 48 8
ctcctccc 205 1701 348705 35472 49 8 cttcccca 224 1537 344288 35696
50 8 cttcagcc 203 1650 334950 35899 51 8 ctctgcca 201 1628 327228
36100 52 8 ctgggaga 192 1606 308352 36292 53 8 cttctgcc 195 1533
298935 36487 54 8 cagcaggt 170 1711 290870 36657 55 8 tctggagc 206
1328 273568 36863 56 8 tcctgctc 159 1864 296376 37022 57 8 ctggggcc
159 1659 263781 37181 58 8 ctcctgcc 155 1733 268615 37336 59 8
ctgggcaa 185 1374 254190 37521 60 8 ctggggct 149 1819 271031 37670
61 8 tggtggcc 145 1731 250995 37815 62 8 ccagggca 147 1613 237111
37962 63 8 ctgctccc 146 1582 230972 38108 64 8 tgggcagc 135 1821
245835 38243 65 8 ctccatcc 161 1389 223629 38404 66 8 ctgcccca 143
1498 214214 38547 67 8 ttcctggc 155 1351 209405 38702 68 8 atggctgc
157 1285 201745 38859 69 8 tggtggaa 155 1263 195765 39014 70 8
tgctgtcc 135 1424 192240 39149 71 8 ccagccgc 159 1203 191277 39308
72 8 catccagc 122 1590 193980 39430 73 8 tcctctcc 118 1545 182310
39548 74 8 agctggga 121 1398 169158 39669 75 8 ctggtctc 128 1151
147328 39797 76 8 ttcccagt 142 1023 145266 39939 77 8 caggcagc 108
1819 196452 40047 78 8 tcctcagc 105 1654 173670 40152 79 8 ctggctcc
103 1607 165521 40255 80 9 tcctcttct 127 1006 127762 40382 81 8
tccagtgt 123 968 119064 40505
Example 16
[0305] qPRC for Human Genes
[0306] Use of the Probe library is coupled to the use of a
real-time PCR design software which can:
[0307] recognise an input sequence via a unique identifier or by
registering a submitted nucleic acid sequence
[0308] identify all probes which can target the nucleic acid
[0309] sort probes according to target sequence selection criteria
such as proximity to the 3' end or proximity to intron-exon
boundaries
[0310] if possible, design PCR primers that flank probes targeting
the nucleic acid sequence according to PCR design rules
[0311] suggest available real-time PCR assays based on above
procedures.
[0312] The design of an efficient and reliable qPCR assay for a
human gene is carried out via the software found on
www.probelibrary.com
[0313] The ProbeFinder software designs optimal qPCR probes and
primers fast and reliably for a given human gene.
[0314] The design comprises the following steps:
[0315] 1) Determination of the intron positions
[0316] Noise from chromosomal DNA is eliminated by selecting intron
spanning qPCR's. Introns are determined by a blast search against
the human genome. Regions found on the DNA, but not in the
transcript are considered to be introns.
[0317] 2) Match of the Probe Library to the gene
[0318] Virtually all human transcripts are covered by at least one
of the 90 probes, the high coverage is made possible by LNA
modifications of the recognition sequence tags.
[0319] 3) Design of primers and selection of optimal qPCR assay
[0320] Primers are designed with `Primer3` (Whitehead Inst. For
Biomedical Research, S. Rozen and H. J. Skaletsky). Finally the
probes are ranked according to selected rules ensuring the best
possible qPCR. The rules favor intron spanning amplicons to remove
false signals from DNA contamination, small amplicon size for
reproducible and comparable assays and a GC content optimized for
PCR.
Example 17
[0321] Preparation of Ena-Monomers and Oligomers
[0322] ENA-T monomers are prepared and used for the preparation of
dual labelled probes of the invention.
[0323] In the following sequences the X denotes a
2'-O,4'-C-ethylene-5-met- hyluridine (ENA-T). The synthesis of this
monomer is described in WO 00/47599. The reaction conditions for
incorporation of a
5'-O-Dimethoxytrityl-2'-O,4'-C-ethylene-5-methyluridine-3'-O-(2-cyanoethy-
l-N,N-diisopropyl)phosphoramidite corresponds to the reaction
conditions for the preparation of LNA oligomers as described in
EXAMPLE 6.
[0324] The following three dual labelled probes are preparted:
12 EQ # Sequences MW (Calc.) MW (Found) 16533
5'-Fitc-ctGmCXmCmCAg-EQL-3' 4002 Da. 4001 Da. 16534
5'-Fitc-cXGmCXmCmCA-EQL-3' 3715 Da. 3716 Da. 16535
5'-Fitc-tGGmCGAXXX-EQL-3' 4128 Da. 4130 Da.
[0325] X designate ENA-T monomer. Small letters designate DNA
monomers (a, g, c, t). Fitc=Fluorescein; EQL=Eclipse quencher;
Dabcyl=Dabcyl quencher. MW=Molecular weight. Capital letters other
than `X` designate methyloxy LNA nucleotides.
[0326] References and Notes
[0327] 1. Helen C. Causton, Bing Ren, Sang Seok Koh, Christopher T.
Harbison, Elenita Kanin, Ezra G. Jennings, Tong Ihn Lee, Heather L.
True, Eric S. Lander, and Richard A. Young (2001). Remodelling of
Yeast Genome Expression in Response to Environmental Changes. Mol.
Biol. Cell 12:323-337 (2001).
[0328] 2. Frank C. P. Holstege, Ezra G. Jennings, John J. Wyrick,
Tong Ihn Lee, Christoph J. Hengartner, Michael R. Green, Todd R.
Golub, Eric S. Lander, and Richard A. Young (1998). Dissecting the
Regulatory Circuitry of a Eukaryotic Genome. Cell 1998 95:
717-728.
[0329] 3. Simeonov, Anton and Theo T. Nikiforov, Single nucleotide
polymorphism genotyping using short, fluorescently labelled locked
nucleic acid (LNA) probes and fluorescence polarization detection,
Nucleic Acid Research, 2002, Vol.30 No 17 e 91.
[0330] Variations, modifications, and other implementations of what
is described herein will occur to those skilled in the art without
departing from the spirit and scope of the invention as described
and claimed herein and such variations, modifications, and
implementations are encompassed within the scope of the
invention.
[0331] The references, patents, patent applications, and
international applications disclosed above are incorporated by
reference herein in their entireties.
Sequence CWU 1
1
46 1 23 DNA Artificial Sequence Synthetic Sequence 1 cgcgtttact
ttgaaaaatt ctg 23 2 20 DNA Artificial Sequence Synthetic Sequence 2
gcttccaatt tcctggcatc 20 3 25 DNA Artificial Sequence Synthetic
Sequence 3 gcccaagatg ctataaattg gttag 25 4 23 DNA Artificial
Sequence Synthetic Sequence 4 gggtttgcaa caccttctag ttc 23 5 18 DNA
Artificial Sequence Synthetic Sequence 5 tacggagctg caggtggt 18 6
18 DNA Artificial Sequence Synthetic Sequence 6 gttgggccgt tgtctggt
18 7 13 DNA Artificial Sequence Synthetic Sequence 7 caaggagaag ttg
13 8 13 DNA Artificial Sequence Synthetic Sequence 8 caaggagaag ttg
13 9 12 DNA Artificial Sequence Synthetic Sequence 9 caaggaaagt tg
12 10 23 DNA Artificial Sequence Synthetic Sequence 10 cgcgtttact
ttgaaaaatt ctg 23 11 20 DNA Artificial Sequence Synthetic Sequence
11 gcttccaatt tcctggcatc 20 12 25 DNA Artificial Sequence Synthetic
Sequence 12 gcccaagatg ctataaattg gttag 25 13 23 DNA Artificial
Sequence Synthetic Sequence 13 gggtttgcaa caccttctag ttc 23 14 18
DNA Artificial Sequence Synthetic Sequence 14 tacggagctg caggtggt
18 15 18 DNA Artificial Sequence Synthetic Sequence 15 gttgggccgt
tgtctggt 18 16 20 DNA Artificial Sequence Synthetic Sequence 16
gcgagagaaa acaagcaagg 20 17 20 DNA Artificial Sequence Synthetic
Sequence 17 attcgtcttc actggcatca 20 18 25 DNA Artificial Sequence
Synthetic Sequence 18 cagctaaaaa tgatgacaat aatgg 25 19 23 DNA
Artificial Sequence Synthetic Sequence 19 attacatcat gattagggaa tgc
23 20 21 DNA Artificial Sequence Synthetic Sequence 20 gggtttgaac
attgatgagg a 21 21 20 DNA Artificial Sequence Synthetic Sequence 21
ggtgtcagct ggaacctctt 20 22 13 DNA Artificial Sequence Synthetic
Sequence 22 naaggagaag ttg 13 23 35 DNA Artificial Sequence
Synthetic Sequence 23 acgtgagctc attgaaactg caggtggtat tatga 35 24
44 DNA Artificial Sequence Synthetic Sequence 24 gatccccggg
aattgccatg ctaatcaacc tcttcaaccg ttgg 44 25 50 DNA Artificial
Sequence Synthetic Sequence 25 acgtggatcc tttttttttt tttttttttt
gatccccggg aattgccatg 50 26 20 DNA Artificial Sequence Synthetic
Sequence 26 gcgagagaaa acaagcaagg 20 27 20 DNA Artificial Sequence
Synthetic Sequence 27 attcgtcttc actggcatca 20 28 25 DNA Artificial
Sequence Synthetic Sequence 28 cagctaaaaa tgatgacaat aatgg 25 29 23
DNA Artificial Sequence Synthetic Sequence 29 attacatcat gattagggaa
tgc 23 30 21 DNA Artificial Sequence Synthetic Sequence 30
gggtttgaac attgatgagg a 21 31 20 DNA Artificial Sequence Synthetic
Sequence 31 ggtgtcagct ggaacctctt 20 32 164 DNA Artificial Sequence
Synthetic Sequence 32 caccgttcgg catatccata tttcccacag ccaccaccag
gaaggcagca gccaggagga 60 gcagcctcct cagagaagca gcctggagac
ttcctccagc tccagggccg ccgcctgctg 120 gagcagcagc accagaagag
ggggaggtac ggttggttgt acga 164 33 108 DNA Artificial Sequence
Synthetic Sequence 33 tggcggacgc acaccgctta cccctgctgg aggaagctga
ggaggagcag cctggagcag 60 cagcagccag ctccgccgcc aggaagccga
ctcacgggcc acgcatta 108 34 115 DNA Artificial Sequence Synthetic
Sequence 34 gggtgcgacc gtgagtcaat ggtctccagg aggctgtctt ctggtgctgc
tcctctgctg 60 cctccagctt ctctggccct ggtggtggct gtgggtaatg
cgtggcccgt gagtc 115 35 106 DNA Artificial Sequence Synthetic
Sequence 35 attgactcac ggtcgcacca aactctgctg ggctgcctgg aagctccagg
agaacttcca 60 gccagctcct ccaccagcag gaagaataac cgtggaacgc ggtcat
106 36 124 DNA Artificial Sequence Synthetic Sequence 36 atacccatcc
aaggcgtccc taaaggaggc agaggaaggg agctgccttc ccagcccttc 60
tcccagcaca gcagagcaga gccacctcca gccacatcac caaaatgacc gcgttccacg
120 gtta 124 37 115 DNA Artificial Sequence Synthetic Sequence 37
attgactcac ggtcgcacca aacctggaag gcagaggaac tgcctcctcc accatcacca
60 ctgctgggct gggaagcttc cagcacagca ggaaataacc gtggaacgcg gtcat 115
38 121 DNA Artificial Sequence Synthetic Sequence 38 atacccatcc
aaggcgtccc taaacttctc ccagagccac ctccagccag ccacaccagc 60
agagcaggaa ggagctgcct ggagcagctc ccaggagaaa aatgaccgcg ttccacggtt
120 a 121 39 115 DNA Artificial Sequence Synthetic Sequence 39
attgactcac ggtcgcacca aattcctctg ccttcctgct ctgctgggag aaggaggtgg
60 tgatgtggct ggaaggaggc agctccagga gaaaataacc gtggaacgcg gtcat 115
40 114 DNA Artificial Sequence Synthetic Sequence 40 atacccatcc
aaggcgtccc taaacttcca ggcagctccc tccagccagc aggacttccc 60
agcccagctc ctccaccagc acagcagagc caaaatgacc gcgttccacg gtta 114 41
114 DNA Artificial Sequence Synthetic Sequence 41 ttagggacgc
cttggatggg tatggctgag gcggctggct cctgcatcct cttctgcctc 60
tgctcccagc tgagccatgc cctggcttcc accaattgcc gacccaccgg gata 114 42
122 DNA Artificial Sequence Synthetic Sequence 42 attcgctacg
gcccaacacc ttactccacc tcctgcccca ctggggctga agtccagtgt 60
ctggagctgc ttcccagtgg gcagccatcc agcaggccac catatcccgg tgggtcggca
120 at 122 43 124 DNA Artificial Sequence Synthetic Sequence 43
taaggtgttg ggccgtagcg aatcgctctg ccactggggc ctggtctcca tcctctcctc
60 cctgggcaac ctgctgtcct tggcagtggg gaagctgtgc caattgtcct
ccgcccggac 120 tcat 124 44 122 DNA Artificial Sequence Synthetic
Sequence 44 ttagggacgc cttggatggg tatctctgcc actggctcca gatcctcttc
tgccccactg 60 ccatgggcag ctggggcctc ctccctccac ctggcttccc
caattgccga cccaccggga 120 ta 122 45 118 DNA Artificial Sequence
Synthetic Sequence 45 attcgctacg gcccaacacc ttacctcagc cccagctcca
tccagccgcc aaggactggt 60 ctcctgccct gggcaactgg gaatggctgc
ttccaccata tcccggtggg tcggcaat 118 46 124 DNA Artificial Sequence
Synthetic Sequence 46 taaggtgttg ggccgtagcg aatctgcctc ttcagccgct
ctgctcccag ctgagccatc 60 cagtgtgcag gagaggacag caggtggcac
agcaggccac caattgtcct ccgcccggac 120 tcat 124
* * * * *
References