Dimeric and multimeric antigen binding structure

Abstract

The present invention relates to dimeric and multimeric antigen binding structures, expression vectors encoding said structures, and diagnostic, as well as therapeutic, uses of said structures. The antigen binding structures are preferably in the form of a Fv-antibody construct.

Description

[0001] This application is a National Stage of International Application PCT/EP02/10307, filed Sep. 13, 2002, published Mar. 27, 2003 under PCT Article 21(2) in English; which claims the priority of EP 01122104.1 filed Sep. 14, 2001.

FIELD OF THE INVENTION

[0002] The present invention relates to dimeric and multimeric antigen binding structures, expression vectors encoding said structures, and diagnostic as well as therapeutic uses of said structures. The antigen binding structures are preferably in the form of a Fv-antibody construct.

[0003] Natural antibodies are themselves dimers, and thus, bivalent. If two hybridoma cells producing different antibodies are artificially fused, some of the antibodies produced by the hybrid hybridoma are composed of two monomers with different specificities. Such bispecific antibodies can also be produced by chemically conjugating two antibodies. Natural antibodies and their bispecific derivatives are relatively large and expensive to produce. The constant domains of mouse antibodies are also a major cause of the human anti-mouse antibody (HAMA) response, which prevents their extensive use as therapeutic agents. They can also give rise to unwanted effects due to their binding of Fc-receptors. For these reasons, molecular immunologists have been concentrating on the production of the much smaller Fab- and Fv-fragments in microorganisms. These smaller fragments are not only much easier to produce, they are also less immunogenic, have no effector functions, and, because of their relatively small size, they are better able to penetrate tissues and tumors. In the case of the Fab-fragments, the constant domains adjacent to the variable domains play a major role in stabilizing the heavy and light chain dimer.

[0004] The Fv-fragment is much less stable, and a peptide linker was therefore introduced between the heavy and light chain variable domains to increase stability. This construct is known as a single chain Fv(scFv)-fragment. A disulfide bond is sometimes introduced between the two domains for extra stability. Thus far, tetravalent scFv-based antibodies have been produced by fusion to extra polymerizing domains such as the streptavidin monomer that forms tetramers, and to amphipathic alpha helices. However, these extra domains can increase the immunogenicity of the tetravalent molecule.

[0005] Bivalent and bispecific antibodies can be constructed using only antibody variable domains. A fairly efficient and relatively simple method is to make the linker sequence between the V.sub.H and V.sub.L domains so short that they cannot fold over and bind one another. Reduction of the linker length to 3-12 residues prevents the monomeric configuration of the scFv molecule and favors intermolecular V.sub.H-V.sub.L pairings with formation of a 60 kDa non-covalent scFv dimer "diabody" (Holliger et al., 1993, Proc. Natl. Acad. Sci. USA 90, 6444-6448). The diabody format can also be used for generation of recombinant bispecific antibodies, which are obtained by the noncovalent association of two single-chain fusion products, consisting of the V.sub.H domain from one antibody connected by a short linker to the V.sub.L domain of another antibody. Reducing the linker length still further below three residues can result in the formation of trimers ("triabody", .about.90 kDa) or tetramers ("tetrabody", .about.120 kDa) (Le Gall et al., 1999, FEBS Letters 453, 164-168). However, the small size of bispecific diabodies (50-60 kDa) leads to their rapid clearance from the blood stream through the kidneys, thus requiring the application of relatively high doses for therapy. Moreover, bispecific diabodies have only one binding domain for each specificity. However, bivalent binding is an important means of increasing the functional affinity, and possibly the selectivity, for particular cell types carrying densely clustered antigens.

[0006] Thus, the technical problem underlying the present invention is to provide new dimeric and multimeric antigen binding structures which overcome the disadvantages of the Fv-antibodies of the prior art, and to provide a general way to form a structure with at least four binding domains which is monospecific or multispecific.

[0007] The solution to said technical problem is achieved by providing the embodiments characterized in the claims.

[0008] The present invention is further described with regard to the figures.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009] FIGS. 1, 2, and 3 depict schemes of the multimeric Fv molecules depending on the particular antibody domains and the length of the peptide linker LL between the variable domains that comprise the multimerization motif.

[0010] Abbreviations L0: The V.sub.H and V.sub.L domains are directly connected without intervening linker peptide; L1: linker sequence coding for Ser residue; L10: linker sequence coding for SerAlaLysThrThrProLysLeu- GlyGly polypeptide (SEQ ID NO:1) connecting V.sub.H and V.sub.L domains; LL: linker sequence coding for (Gly.sub.4Ser).sub.4 polypeptide (SEQ ID NO:2) connecting hybrid scFv fragments; L18: linker sequence coding for SerAlaLysThrThrProLysLeuGluGluGlyGluPheSerGluAlaArgVal polypeptide (SEQ ID NO:3) connecting V.sub.H and V.sub.L domains.

[0011] FIGS. 4 and 5 depict schemes of construction of the plasmids pHOG scFv.sub.18.alpha.CD3-LL-scFv.sub.10.alpha.CD19 and pHOG scFv.sub.18.alpha.CD19-LL-scFv.sub.10.alpha.CD3.

[0012] Abbreviations c-myc: sequence coding for an epitope recognized by mAb 9E10; His: sequence coding for six C-terminal histidine residues; PelB: signal peptide sequence of the bacterial pectate lyase (PelB leader); rbs: ribosome binding site; Stop: stop codon (TAA); V.sub.H and V.sub.L: variable region of the heavy and light chain; L10: linker sequence coding for SerAlaLysThrThrProLysLeuGlyGly polypeptide connecting V.sub.H and V.sub.L domains; LL: linker sequence coding for (Gly.sub.4Ser).sub.4 polypeptide connecting hybrid scFv-fragments; L18: linker sequence coding for SerAlaLysThrThrProLysLeuGluGluGlyGluPheSerGluA- laArgVal polypeptide connecting V.sub.H and V.sub.L domains; B: BamHI, Ea: EagI, E: EcoRI, Nc: NcoI; N. NotI, P: PvuII, X: XbaI.

[0013] FIG. 6 shows nucleotide (SEQ ID NO:4) and deduced amino acid sequences (SEQ ID NO:5) of the plasmid pSKK2 scFv3-LL-Db19.

[0014] Abbreviations His6 tail: sequence coding for six C-terminal histidine residues; .beta.-lactamase: gene encoding .beta.-lactamase that confers resistance to ampicillin resistance; bp: base pairs; c-myc epitope: sequence coding for an epitope recognized by mAb 9E10; Lac P/0: wt lac operon promoter/operator; Pel B leader: signal peptide sequence of the bacterial pectate lyase; V.sub.H and H.sub.L: variable region of the heavy and light chain; L10: linker sequence coding for SerAlaLysThrThrProLysLeuGlyGly polypeptide connecting V.sub.H and V.sub.L domains; LL: linker sequence coding for (Gly.sub.4Ser).sub.4 polypeptide connecting hybrid scFv-fragments; LI8: linker sequence coding for SerAlaLysThrThrProLysLeuGluGluGlyGluPheSerGluAlaArgVal polypeptide connecting V.sub.H and V.sub.L domains; rbs: ribosome binding site; V.sub.H and V.sub.L: variable region of the heavy and light chain; hok-sok: plasmid stabilizing DNA locus; lacI: gene coding for lac-repressor; lac P/0: wt lac operon promoter/operator; lacZ': gene coding for .alpha.-peptide of .beta.-galactosidase; skp gene: gene encoding bacterial periplasmic factor Skp/OmpH; tLPP: nucleotide sequence of the lipoprotein terminator; M13 ori: origin of the DNA replication; pBR322ori: origin of the DNA replication; tHP: strong terminator of transcription; SD1: ribosome binding site (Shine Dalgarno) derived from E. coli lacZ gene (lacZ); SD2 and SD3: Shine Dalgarno sequence for the strongly expressed T7 gene 10 protein (T7g10).

[0015] FIG. 7 shows nucleotide (SEQ ID NO:6; FIG. 7a) and deduced amino acid (SEQ ID NO:7; FIG. 7b) sequences of the plasmid pSKK2 scFv19-LL-Db3.

[0016] Abbreviations His6 tail: sequence coding for six C-terminal histidine residues; .beta.-lactamase: gene encoding .beta.-lactamase that confers resistance to ampicillin resistance; bp: base pairs; c-myc epitope: sequence coding for an epitope recognized by mAb 9E10; Lac P/0: wt lac operon promoter/operator; PelB leader: signal peptide sequence of the bacterial pectate lyase; V.sub.H and V.sub.L: variable region of the heavy and light chain; L10: linker sequence coding for SerAlaLysThrThrProLysLeuGlyGly polypeptide connecting V.sub.H and V.sub.L domains; LL: linker sequence coding for (Gly4Ser)4 polypeptide connecting hybrid scFv-fragments; Ll8: linker sequence encoding SerAlaLysThrThrProLysLeuGluGluGlyGluPheSerGluAlaArgVal polypeptide connecting V.sub.H and V.sub.L domains; rbs: ribosome binding site; hok-sok: plasmid stabilizing DNA locus; lacI: gene coding for lac-repressor; lac P/0: wt lac operon promoter/operator; lacZ': gene coding for .alpha.-peptide of .beta.-galactosidase; skp gene: gene encoding bacterial periplasmic factor Skp/OmpH; tLPP: nucleotide sequence of the lipoprotein terminator; M13 ori: origin of the DNA replication, pBR322ori: origin of the DNA replication; tHP: strong terminator of transcription; SD1: ribosome binding site (Shine Dalgarno) derived from E. coli lacZ gene (lacZ); SD2 and SD3: Shine Dalgarno sequence for the strongly expressed T7 gene 10 protein (T7g10).

[0017] FIG. 8 shows analyses of protein contents of peaks after IMAC.

[0018] Electrophoresis was carried out under reducing conditions; Western blot with anti-c-myc monoclonal antibody, in the case of scFv3-Db19 (FIG. 8A) and scFv 19.times.Db3 (FIG. 8B) molecules.

[0019] FIG. 9 shows size-exclusion FPLC chromatography elution profiles.

[0020] A calibrated Superdex 200 HR10/30 column was used and the analysis of protein contents of peaks by Western blot was carried out with anti-c-myc monoclonal antibody, in the case of scFv3-Db19 (FIG. 9A) and scFv19-Db3 (FIG. 9B) molecules.

[0021] FIG. 10 shows size-exclusion FPLC chromatography elution profiles. A calibrated Superdex 200 HR10/30 column for the scFv3-Db19, scFv19-Db3, scFv19-scFv3 and scFv3-scFv19 molecules was used.

[0022] FIG. 11 shows flow cytometry results on CD3.sup.+Jurkat and CD19.sup.+JOK-1 cells.

[0023] FIG. 12 shows an analysis of cell surface retention on CD19.sup.+JOK-1 (A,B) and CD3.sup.+Jurkat cells (C,D) for the scFv3-scFv19 and scFv3-Db19 molecules (A,C) and for scFv19-scFv3 and scFv 19.times.Db3 molecules (B,D).

[0024] FIG. 13 shows depletion of primary malignant CD19.sup.+ CLL-cells by recruitment of autologous T-lymphocytes through CD19.times.CD3 bispecific molecules.

[0025] Freshly isolated peripheral blood mononuclear cells (PBMC) from patient with chronic lymphocytic leukemia (CLL) were seeded in individual wells of a 12-well plate in 2 ml RPMI-Medium/10% FCS at a density of 2.times.10.sup.6 cells/ml. The recombinant antibodies scFv3-scFv19 and scFv3-Db19 were added at concentration of 5 .mu.g/ml. After 5 day incubation, the cells were harvested, counted, and stained with anti-CD3 MAb OKT3, anti-CD4 MAb Edu-2, anti-CD8 MAb UCH-T4, and anti-CD19 MAb HD37 for flow cytometric analysis. 10.sup.4 living cells were analyzed using a Beckman-Coulter flow cytometer and the relative amounts of CD3.sup.+, CD4.sup.+, CD8.sup.+ and CD19.sup.+ cells were plotted.

[0026] FIG. 14 is a schematic representation of the multimeric Fv-antibody construct formed by dimerizing via N-terminal "diabody" motif.

[0027] Abbreviations L7: 7 amino acid linker peptide Arg-Thr-Val-Ala-Ala-Pro-Ser (SEQ 10 NO:8) connecting the V.sub.L and V.sub.H domains in the dimerizing "diabody" motif; SL: 8 amino acid linker peptide Ala-Ala-Ala-Gly-Gly-Pro-Gly-Ser (SEQ ID NO:9) between the dimerizing motif and scFvs; L18: 18 amino acid linker peptide Ser-Ala-Lys-Thr-Thr-Pro-Lys-Leu-Glu-Glu-Gly-Glu-Phe-Ser-Glu-Ala-Arg-Val connecting the V.sub.H and V.sub.L domains in scFvs.

[0028] FIG. 15 is a diagram of the expression plasmid pSKK3-scFv.sub.L7anti-CD19-SL-scFv.sub.L18anti-CD3.

[0029] Abbreviations bla: gene of beta-lactamase responsible for ampicillin resistance; bp: base pairs; CDR-H1, CDR-H2 and CDR-H3: sequence encoding the complementarity determining regions (CDR) 1-3 of the heavy chain; CDR-L1, CDR-L2 and CDR-L3: sequence encoding the complementarity determining regions (CDR) 1-3 of the light chain; His6 tag: sequence encoding six C-terminal histidine residues; hok-sok: plasmid stabilizing DNA locus; L7 linker: sequence which encodes the 7 amino acid peptide Arg-Thr-Val-Ala-Ala-Pro-Ser connecting the anti-CD19 V.sub.L and V.sub.H domains; L18 linker: sequence which encodes the 18 amino acid peptide Ser-Ala-Lys-Thr-Thr-Pro-Lys-Leu-Glu-Glu-Gly-Glu-Phe-Se- r-Glu-Ala-Arg-Val connecting the anti-CD3 V.sub.H and V.sub.L domains; lacI: gene encoding lac-repressor; lac P/O: wild-type lac-operon promoter/operator; M13ori: intergenic region of bacteriophage M13; pBR322ori: origin of the DNA replication; PelB leader: signal peptide sequence of the bacterial pectate lyase; SD1: ribosome binding site derived from E. coli lacZ gene (lacZ); SD2 and SD3: ribosome binding site derived from the strongly expressed gene 10 of bacteriophage T7 (T7g10); skp gene: gene encoding bacterial periplasmic factor Skp/OmpH; SL linker: sequence which encodes the 9 amino acid peptide Ser-Ala-Ala-Ala-Gly-Gly-P- ro-Gly-Ser (SEQ 10 No:10) connecting the anti-CD19 and anti-CD3 V.sub.H domains; tHP: strong transcriptional terminator; tLPP: lipoprotein terminator of transcription; V.sub.H and V.sub.L: sequence coding for the variable region of the immunoglobulin heavy and light chain, respectively. Unique restriction sites are indicated.

[0030] FIG. 16 shows nucleotide (FIG. 16a) and deduced amino acid (FIG. 16b) sequences of the plasmid pSKK3-scFv.sub.L7anti-CD19-SL-scFv.sub.L18a- nti-CD3.

[0031] FIG. 17 shows an analysis of purified Db19-SL-scFv3 molecule by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions.

[0032] Lane 1: M.sub.r markers (kDa, M.sub.r in thousands) Lane 2: Db19-SL-scFv3. The gel was stained with Coomassie Blue.

[0033] FIG. 18 shows an analysis of purified Db19-SL-scFv3 molecule by size exclusion chromatography on a calibrated Superdex 200 column.

[0034] The elution positions of molecular mass standards are indicated.

[0035] FIG. 19 shows a Lineweaver-Burk analysis of fluorescence dependence on antibody concentration as determined by flow cytometry.

[0036] Binding of Db19-SL-scFv3 to CD3.sup.+ Jurkat (A) and CD19.sup.+ JOK-1 cells (B) was measured.

[0037] FIG. 20 shows depletion of primary malignant CD19.sup.+ CLL-cells by recruitment of autologous T-lymphocytes through Db19-SL-scFv3 molecule.

[0038] Freshly isolated peripheral blood mononuclear cells (PBMC) from a patient with chronic lymphocytic leukemia (CLL) were seeded in individual wells of a 12-well plate in 2 ml RPMI-Medium/10% FCS at a density of 2.times.10.sup.6 cells/ml. The recombinant scFv-antibody Db19-SL-scFv3 or CD19.times.CD3 tandem diabody (Tandab; Kipriyanov et al. 1999, J. Mol. Biol. 293, 41-56; Cochlovius et al. 2000, Cancer Res. 60, 4336-4341) was added at concentrations of 5 .mu.g/ml, 1 .mu.g/ml, and 0.1 .mu.g/ml. After 5 day incubation, the cells were harvested, counted, and stained with anti-CD3 MAb OKT3, anti-CD4 MAb Edu-2, anti-CD8 MAb UCH-T4, and anti-CD19 MAb HD37 for flow cytometric analysis. 10.sup.4 living cells were analyzed using a Beckman-Coulter flow cytometer and the relative amounts of CD3.sup.+, CD4.sup.+, CD8.sup.+ and CD19.sup.+ cells were plotted. n.d.: not determined due to CD19 coating and/or modulation.

[0039] FIG. 21 is a schematic representation of the multimeric scFv.sub.7-L.sub.6-scFv.sub.10 Fv-antibody construct formed by dimerizing via N-terminal "diabody" motif.

[0040] Abbreviations L7: 7 amino acid linker peptide Arg-Thr-Val-Ala-Ala-Pro-Ser connecting the V.sub.L and V.sub.H domains in the dimerizing "diabody" motif; L6: 6 amino acid linker peptide Ser-Ala-Lys-Thr-Thr-Pro (SEQ ID NO:13) between the dimerizing motif and scFvs; L10: 10 amino acid linker peptide Ser-Ala-Lys-Thr-Thr-Pro-Lys-Leu-- Gly-Gly connecting the V.sub.H and V.sub.L domains in the scFvs.

[0041] FIG. 22 is a diagram of the expression plasmid pSKK3-scFv.sub.L7anti-CD19-L6-scFv.sub.L10anti-CD3.

[0042] Abbreviations bla: gene of beta-lactamase responsible for ampicillin resistance; bp: base pairs; CDR-H1, CDR-H2 and CDR-H3: sequence encoding the complementarity determining regions (CDR) 1-3 of the heavy chain; CDR-L1, CDR-L2 and CDR-L3: sequence encoding the complementarity determining regions (CDR) 1-3 of the light chain; His6 tag: sequence encoding six C-terminal histidine residues; hok-sok: plasmid stabilizing DNA locus; L6 linker: sequence which encodes the 6 amino acid peptide Ser-Ala-Lys-Thr-Thr-Pro connecting the anti-CD19 and anti-CD3 V.sub.H domains; L7 linker: sequence which encodes the 7 amino acid peptide Arg-Thr-Val-Ala-Ala-Pro-Ser connecting the anti-CD19 V.sub.L and V.sub.H domains; L10 linker: sequence which encodes the 10 amino acid peptide Ser-Ala-Lys-Thr-Thr-Pro-Lys-Leu-Gly-Gly connecting the anti-CD3 V.sub.H and V.sub.L domains; lacI: gene encoding lac-repressor; lac P/O: wild-type lac-operon promoter/operator; M13ori: intergenic region of bacteriophage M13; pBR322ori: origin of the DNA replication; PelB leader: signal peptide sequence of the bacterial pectate lyase; SD1: ribosome binding site derived from E. coli lacZ gene (lacZ); SD2 and SD3: ribosome binding site derived from the strongly expressed gene 10 of bacteriophage T7 (T7g10); skp gene: gene encoding bacterial periplasmic factor Skp/OmpH; tHP: strong transcriptional terminator; tLPP: lipoprotein terminator of transcription; V.sub.H and V.sub.L: sequence coding for the variable region of the immunoglobulin heavy and light chain, respectively. Unique restriction sites are indicated.

[0043] FIG. 23 shows nucleotide (SEQ ID NO:11; FIG. 23a) and deduced amino acid (SEQ ID NO:1; FIG. 23b) sequences of the plasmid pSKK3-scFv.sub.L7anti-CD19-L6-scFv.sub.L10anti-CD3

[0044] FIG. 24 shows an analysis of purified Db19-L6-scFv3 molecule by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions.

[0045] Lane 1: M.sub.r markers (kDa, M.sub.r in thousands) Lane 2: Db19-L6-scFv3. The gel was stained with Coomassie Blue.

[0046] FIG. 25 shows an analysis of purified Db19-L6-scFv3 molecule by size exclusion chromatography on a calibrated Superdex 200 column.

[0047] The elution positions of molecular mass standards are indicated.

[0048] FIG. 26 shows a Lineweaver-Burk analysis of fluorescence dependence on concentration of Db19-L6-scFv3 as determined by flow cytometry.

[0049] Binding of Db19-L6-scFv3 to CD3.sup.+ Jurkat (A) and CD19.sup.+JOK-1 cells (B) was measured.

DETAILED DESCRIPTION OF THE INVENTION

[0050] The present invention is based on the observation that scFv-dimers, -trimers and -tetramers that are placed in the N-terminal or C-terminal part of the molecule can be used as multimerization motifs for construction of multimeric Fv-molecules. Thus, the present invention provides a general way to form a multimeric Fv molecule with at least four binding domains which is monospecific or multispecific. Each monomer of the Fv molecule of the present invention is characterized by a V.sub.H/V.sub.L antigen-binding unit and two antibody variable domains that form V.sub.H/V.sub.L antigen-binding units after binding non-covalently to the variable domains of other monomers (multimerization motif). Dimers, trimers or tetramers are formed depending on the variable domains and the length of the peptide linkers between the variable domains that comprise the multimerization motif (see FIGS. 1, 2, 3, 14, 21).

[0051] The dimeric or multimeric antigen binding structures of the present invention, preferably in form of multimeric Fv-antibodies, are expected to be very stable and have a higher binding capacity. They should also be particularly useful for therapeutic purposes, since the dimeric diabodies used so far are small and remove fairly quickly from the blood stream through the kidneys. Moreover, the single chain format of the multimeric Fv-antibodies of the present invention allows them to be made in eukaryotic organisms and not only in bacteria.

[0052] Accordingly, the present invention relates to a dimeric or multimeric structure comprising a single chain molecule that comprises four antibody variable domains, wherein

[0053] (a) either the first two or the last two of the four variable domains bind intramolecularly to one another within the same chain by forming an antigen binding scFv in the orientation V.sub.H/V.sub.L or V.sub.L/V.sub.H

[0054] (b) the other two domains bind intermolecularly with the corresponding V.sub.H or V.sub.L domains of another chain to form antigen binding V.sub.H/V.sub.L pairs.

[0055] In a particularly preferred embodiment the present invention relates to a multimeric Fv-antibody, characterized by the following features:

[0056] (a) the monomers of said Fv-antibody comprise at least four variable domains of which two neighboring domains of one monomer form an antigen-binding V.sub.H-V.sub.L or V.sub.L-V.sub.H scFv unit; these two variable domains are linked by a peptide linker of at least 5 amino acid residues, preferably of at least 6, 7, 8, 9, 10, 11, or 12 amino acids, which does not prevent the intramolecular formation of a scFv,

[0057] (b) at least two variable domains of the monomer are non-covalently bound to two variable domains of another monomer resulting in the formation of at least two additional antigen binding sites to form the multimerization motif; these two variable domains of each monomer are linked by a peptide linker of a maximum of 12, preferably a maximum of 10 amino acid residues.

[0058] A further preferred feature is that the antigen-binding V.sub.H-V.sub.L or V.sub.L-V.sub.H scFv unit formed by the two neighbouring domains of one monomer is linked to the other variable domains of the multimerization motif by a peptide linker of at least 5 amino acid residues, preferably of at least 6, 7, 8, 9, 10, 11, or 12 amino acid residues.

[0059] The term "Fv-antibody" relates to an antibody containing variable domains but not constant domains.

[0060] The term "peptide linker" relates to any peptide capable of connecting two variable domains with its length depending on the kinds of variable domains to be connected. The peptide linker might contain any amino acid residue with the amino acid residues glycine, serine and proline being preferred for the peptide linker linking the second and third variable domain.

[0061] The term "intramolecularly" means interaction between V.sub.H and V.sub.L domains which belong to the same polypeptide chain (monomer) with the formation of a functional antigen binding site.

[0062] The term "intermolecularly" means interaction of the V.sub.H and V.sub.L domains which belong to different monomers.

[0063] The dimeric or multimeric antigen binding construct, e.g., the multimeric Fv-antibody of the present invention, can be prepared according to standard methods. Preferably, said Fv-antibody is prepared by ligating DNA sequences encoding the peptide linkers with the DNA sequences encoding the variable domains, such that the peptide linkers connect the variable domains, resulting in the formation of a DNA sequence encoding a monomer of the multimeric Fv-antibody and expressing DNA sequences encoding the various monomers in a suitable expression system as described in the Examples below.

[0064] The antigen binding structures, in particular the Fv-antibodies, of the present invention can be further modified using conventional techniques known in the art, for example, by using amino acid deletion(s), insertion(s), substitution(s), addition(s), and/or recombination(s), and/or any other modification(s) known in the art either alone or in combination. Methods for introducing such modifications in the DNA sequence underlying the amino acid sequence of a variable domain or peptide linker are well known to the person skilled in the art; see, e.g., Sambrook, Molecular Cloning: A Laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory (1989) N.Y.

[0065] The antigen binding structures of the present invention can comprise at least one further protein domain, said protein domain being linked by covalent or non-covalent bonds. The linkage can be based on genetic fusion according to the methods known in the art and described above, or can be performed by, e.g., chemical cross-linking as described in, e.g., WO 94/04686. The additional domain present in the fusion protein comprising the structure employed in accordance with the invention may be linked preferably by a flexible linker, and advantageously by a peptide linker, wherein said peptide linker comprises plural, hydrophilic, peptide-bonded amino acids of a length sufficient to span the distance between the C-terminal end of said further protein domain and the N-terminal end of the Fv-antibody, or vice versa. The above described fusion protein may further comprise a cleavable linker or cleavage site for proteinases. The fusion protein may also comprise a tag, like a histidine-tag, e.g., (His).sub.6.

[0066] In a preferred embodiment of the present invention, the monomers of the antigen binding structure comprise four variable domains, and either the first and second, or the third and fourth, variable domains of the monomers are linked by a peptide linker of 12, 11, 10, or less amino acid residues, preferably less than five amino acid residues. In an even more preferred embodiment, either the first and second or the third and fourth domain are linked directly without intervening amino acid residues.

[0067] In another preferred embodiment of the present invention, the second and third variable domains of the monomers are linked by a peptide linker of at least 5 amino acid residues, preferably of at least 6, 7, 8, 9, 10, 11, or 12. Preferably, the maximum number of amino acid residues is 30.

[0068] In another preferred embodiment of the present invention, any variable domain is shortened by at least one amino acid residue at its N- and/or C-terminus. In some circumstances, this truncated form gives a better stability of the molecule, as described in German patent application 100 63 048.0.

[0069] In a particularly preferred embodiment of the present invention, the order of domains of a monomer is V.sub.H-V.sub.L-V.sub.H-V.sub.L,V.su- b.L-V.sub.H-V.sub.H-V.sub.L, V.sub.H-V.sub.L-V.sub.L-V.sub.H or V.sub.L-V.sub.H-V.sub.L-V.sub.H.

[0070] In some cases, it might be desirable to strengthen the association of two variable domains. Accordingly, in a further preferred embodiment of the multimeric Fv-antibody of the present invention, the binding of at least one pair of variable domains is strengthened by at least one intermolecular disulfide bridge. This can be achieved by modifying the DNA sequences encoding the variable domains accordingly, i.e., by introducing cysteine codons. The two most promising sites for introducing disulfide bridges appeared to be V.sub.H44-V.sub.L100 connecting framework 2 of the heavy chain with framework 4 of the light chain and V.sub.H105-V.sub.L43 that links framework 4 of the heavy chain with framework 2 of the light chain.

[0071] In a further preferred embodiment of the present invention, the multimeric Fv-antibody is a tetravalent dimer, hexavalent trimer, or octavalent tetramer. The formation of such forms is preferably determined by particular V.sub.H and V.sub.L domains comprising the multimerization motif and by the length of the linker.

[0072] In another preferred embodiment of the present invention, the multimeric Fv-antibody is a bispecific, trispecific, tetraspecific, . . . etc. antibody.

[0073] Multimerization of the monomeric subunits can be facilitated by the presence of a dimerization motif at the C-terminus of the fourth variable domain, which is, preferably, a (poly)peptide directly linked via a peptide bond. Examples of such dimerization motifs are known to the person skilled in the art and include streptavidin and amphipathic alpha helixes. Accordingly, in a further preferred embodiment, a dimerization motive is fused to the last domain of at least two monomers of the multimeric Fv-antibody of the present invention.

[0074] For particular therapeutic applications, at least one monomer of the multimeric antibody of the invention can be linked non-covalently or covalently to a biologically active substance (e.g., cytokines or growth hormones), a chemical agent (e.g. doxorubicin, cyclosporin), a peptide (e.g., .alpha.-Amanitin), a protein (e.g., granzyme A and B).

[0075] In an even more preferred embodiment, the multimeric Fv-antibody of the present invention is (I) a monospecific antibody capable of specifically binding the CD19 antigen of B-lymphocytes or the carcinoma embryonic antigen (CEA); or (II) a bispecific antibody capable of specifically binding (a) CD19 and the CD3 complex of the T-cell receptor, (b) CD19 and the CD5 complex of the T-cell receptor, (c) CD19 and the CD28 antigen on T-lymphocytes, (d) CD19 and CD16 on natural killer cells, macrophages and activated monocytes, (e) CEA and CD3, (f) CEA and CD28, or (g) CEA and CD16. The nucleotide sequences of the variable domains have already been obtained and described in the case of the antibody anti-CD19 (Kipriyanov et al., 1996, J. Immunol. Methods 200, 51-62), anti-CD3 (Kipriyanov et al., 1997, Protein Engineer. 10, 445-453), anti-CD28 (Takemura et al.; 2000, FEBS Lett. 476, 266-271), anti-CD16 (German Patent Application DE 199 37 264 A1), anti-CEA (Griffiths et al., 1993, EMBO J. 12, 725-734), and anti-CD5 (Better et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90, 457-461).

[0076] Surprisingly, a tetravalent structure as defined in claim 1 with the specificities anti-CD3 and anti-CD19 showed a much higher efficacy in vitro than a corresponding bivalent (scFv)x2 structure and a tetravalent structure in which all of the four domains formed pairs with corresponding domains of another chain.

[0077] Another object of the present invention is a process for the preparation of a multimeric Fv-antibody according to the present invention, wherein (a) DNA sequences encoding the peptid linkers are ligated with the DNA sequences encoding the variable domains, such that the peptide linkers connect the variable domains, resulting in the formation of a DNA sequence encoding a monomer of the multimeric Fv-antibody, and (b) the DNA sequences encoding the various monomers are expressed in a suitable expression system. The various steps of this process can be carried according to standard methods, e.g., methods described in Sambrook et al., or described in the Examples below.

[0078] The present invention also relates to DNA sequences encoding the multimeric Fv-antibody of the present invention and vectors, preferably expression vectors containing said DNA sequences.

[0079] A variety of expression vector/host systems may be utilized to contain and express sequences encoding the multimeric Fv-antibody. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems. The invention is not limited by the host cell employed.

[0080] The "control elements" or "regulatory sequences" are those non-translated regions of the vector-enhancers, promoters, 5' and 3' untranslated regions-which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the Bluescript.R.TM. phagemid (Stratagene, LaJolla, Calif.) or pSport1..TM. plasmid (Gibco BRL) and the like may be used. The baculovirus polyhedrin promoter may be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) may be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of the sequence encoding the multimeric Fv-antibody, vectors based on SV40 or EBV may be used with an appropriate selectable marker.

[0081] In bacterial systems, a number of expression vectors may be selected depending upon the use intended for the multimeric Fv-antibody. Vectors suitable for use in the present invention include, but are not limited to, the pSKK expression vector for expression in bacteria.

[0082] In the yeast, Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH may be used. For reviews, see Grant et al. (1987) Methods Enzymol. 153:516-544.

[0083] In cases where plant expression vectors are used, the expression of sequences encoding the multimeric Fv-antibody may be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV may be used alone or in combination with the omega leader sequence from TMV (Takamatsu, N. (1987) EMBO J. 6:307-311). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters may be used (Coruzzi, G. et al. (1984) EMBO J. 3:1671-1680; Broglie, R. et al. (1984) Science 224:838-843; and Winter, J. et al. (1991) Results Probl. Cell Differ. 17:85-105). These constructs can be introduced into plant cells by direct DNA transformation or pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (see, for example, Hobbs, S. or Murry, L. E. in McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill, New York, N.Y.; pp. 191-196.

[0084] An insect system may also be used to express the multimeric Fv-antibody. For example, in one such system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. The sequences encoding the multimeric Fv-antibody may be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of the multimeric Fv-antibody will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses may then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which APOP may be expressed (Engelhard, E. K. et al. (1994) Proc. Nat. Acad. Sci. 91:3224-3227).

[0085] In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, sequences encoding the multimeric Fv-antibody may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing the multimeric Fv-antibody in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81:3655-3659). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.

[0086] Human artificial chromosomes (HACs) may also be employed to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6 to 10M are constructed and delivered via conventional delivery methods (liposomes, polycationic amino polymers, or vesicles) for therapeutic purposes.

[0087] Specific initiation signals may also be used to achieve more efficient translation of sequences encoding the multimeric Fv-antibody. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding the multimeric Fv-antibody, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in the case where only the coding sequence is inserted, exogenous translational control signals including the ATG initiation codon should be provided. Furthermore, the initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons may be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used, such as those described in the literature (Scharf, D. et al. (1994) Results Probl. Cell Differ. 20:125-162).

[0088] In addition, a host cell strain may be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion. Post-translational processing which cleaves a "prepro" form of the protein may also be used to facilitate correct insertion, folding and/or function. Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and W138), are available from the American Type Culture Collection (ATCC; Bethesda, Md.), and may be chosen to ensure the correct modification and processing of the foreign protein.

[0089] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the multimeric Fv-antibody may be transformed using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced sequences. Resistant clones of stably transformed cells may be proliferated using tissue culture techniques appropriate to the cell type.

[0090] Any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, I. et al. (1980) Cell 22:817-23) genes which can be employed in tk.sup.- or aprt.sup.- cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection; for example, dhfr which confers resistance to methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77:3567-70); npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150:1-14) and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, supra). Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman, S. C. and R. C. Mulligan (1988) Proc. Natl. Acad. Sci. 85:8047-51). Recently, the use of visible markers has gained popularity with such markers as anthocyanins, .beta.-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, being widely used not only to identify transformants, but also to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes, C. A. et al. (1995) Methods Mol. Biol. 55:121-131).

[0091] A particular expression vector is pSKK2-scFv.sub.L18anti-CD3-LL-scF- v.sub.L10anti-CD19(pSKK2-scFv3LL Db19) (deposited with the DSMZ according to the Budapest Treaty under DSM 14470 at Aug. 22, 2001 or pSKK2-scFv.sub.L18anti-CD19-LL-scFv.sub.L10anti-CD3(pSKK2-scFv19LL Db3) (deposited with the DSMZ according to the Budapest Treaty under DSM 14471 at Aug. 22, 2001.

[0092] The present invention also relates to a pharmaceutical composition containing a multimeric Fv-antibody of the present invention, a DNA sequence, or an expression vector, preferably combined with suitable pharmaceutical carriers. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emuslions, various types of wetting agents, sterile solutions etc. Such carriers can be formulated by conventional methods and can be administered to the subject at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperetoneal, subcutaneous, intramuscular, topical, or intradermal administration. The route of administration, of course, depends on the nature of the disease, e.g., tumor, and the kind of compound contained in the pharmaceutical composition. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical arts, dosages for any one patient depend on many factors, including the patient's size, body surface area, age, sex, the particular compound to be administered, time and route of administration, the kind of the disorder, general health, and other drugs being administered concurrently.

[0093] Preferred medical uses of the compounds of the present invention are: (a) the treatment of a viral, bacterial, tumoral, or prion related diseases, (b) the agglutination of red blood cells, (c) linking cytotoxic cells, e.g., T or Natural killer cells of the immune system to tumor cells, or (d) linking activating cytokines, preferably IL-1, IL-2, IFN.gamma., TNF.alpha., or GM-CSF, cytotoxic substances (e.g., doxorubicin, cyclosporin, .alpha.-Amanitin), or a protease, preferably Granzyme B, to a target cell.

[0094] A further object of the present invention is the use of a multimeric Fv-antibody of the present invention for diagnosis. For use in the diagnostic research, kits are also provided by the present invention, said kits comprising a multimeric antibody of the present invention. The Fv-antibody can be detectably labeled. In a preferred embodiment, said kit allows diagnosis by ELISA, and contains the Fv-antibody bound to a solid support, for example, a polystyrene microtiter dish or nitrocellulose paper, using techniques known in the art. Alternatively, said kit is based on a RIA, and contains said Fv-antibody marked with a radioactive isotope. In a preferred embodiment of the kit of the invention, the antibody is labelled with enzymes, fluorescent compounds, luminescent compounds, ferromagnetic probes, or radioactive compounds.

[0095] The following Examples illustrate the invention.

EXAMPLES

Example 1

Construction of the plasmids pSKK2 scFv.sub.L18anti-CD3-LL-scFv.sub.L10ant- i-CD19 (scFv3-Db19) and pSKK2 scFv.sub.L18anti-CD19-LL-scFv.sub.L10anti-CD- 3 (scFv19-Db3) for Expression of Multimeric Fv Molecules in Bacteria

[0096] For generation of multimeric Fv constructs, the plasmids pHOG_HD37, pHOG_Dia_HD37, pHOG_mOKT3+NotI and pHOG_Dia_mOKT3 encoding the antibody fragments were derived either from hybridoma HD37 specific to human CD19 (Kipriyanov et al., 1996, J. Immunol. Meth. 196, 51-62; Le Gall et al., 1999, FEBS Lett., 453, 164-168) or from hybridoma OKT3 specific to human CD3 (Kipriyanov et al., 1997, Protein Eng. 10, 445-453) were used.

[0097] The anti-CD19 ScFV.sub.L10 gene followed by a segment coding for a c-myc epitope and a hexahistidinyl tail was cut with PvuII/XbaI from the plasmid pHOG Dia HD37, and recloned into the PvuII/XbaI linearized vector pDISC-1 LL (Kipriyanov et al., 1999, J. Mol. Biol. 293, 41-56) (FIG. 4). This hybrid plasmid was linearized by NcoI/NotI and the gene coding for the scFV.sub.L18 (cut by NcoI/NotI from the plasmid pHOG mOKT3+NotI) was ligated into this plasmid. The plasmid obtained is the pHOG scFv.sub.L18.alpha.CD3-LL-scFv.sub.L10.alpha.CD19 (scFv3-Db19) (FIG. 4).

[0098] The linearized hybrid plasmid NcoI/NotI was also used for the ligation of the gene coding for the scFv.sub.L18.alpha.CD19 from the plasmid pHOG HD37, and the plasmid obtained is the pHOG scFv.sub.L18.alpha.CD19-LL-scFv.sub.L10.alpha.CD19 (scFv19.times.Db19) (FIG. 4). This plasmid was linearized by PvuII/XbaI and the scFV.sub.L10 gene followed by a segment coding for a c-myc epitope and a hexahistidinyl tail was cut with PvuII/XbaI from the plasmid pHOG mDia OKT3. The plasmid obtained is the PHOG scFv.sub.L18.alpha.CD19-LL-scFv.su- b.L10.alpha.CD3 (scFv19-Db3) (FIG. 5).

[0099] To increase the yield of functional antibody fragments in the bacterial periplasm, an optimized expression vector pSKK2 was generated. This vector was constructed on the base of plasmid pHKK (Horn, 1996, Appl. Microbiol. Biotechnol., 46, 524-532) containing hok/sok plasmid-free cell suicide system (Thisted et al., 1994, EMBO J., 13, 1950-1956). First, the gene coding for hybrid scFv V.sub.H3-V.sub.L19 was amplified by PCR from the plasmid pHOG3-19 (Kipriyanov et al., 1998, Int. J. Cancer 77, 763-772) using the primers 5-NDE, 5'-GATATACATATGAAATACCTAT- TGCCTACGGC (SEQ ID NO:14), and 3-AFL, 5'-CGAATTCTTAAGTTAGCACAGGCCTCTAGAGAC- ACACAGATCTTTAG (SEQ ID NO:15). The resulting 921 bp PCR fragment was digested with NdeI and AflII, and cloned into the NdeI/AflII linearized plasmid PHKK, generating the vector pHKK3-19. To delete an extra XbaI site, a fragment of pHKK plasmid containing 3'-terminal part of the lacI gene (encodes the lac repressor), the strong transcriptional terminator t.sub.HP and wild-type lac promoter/operator was amplified by PCR using primers 5-NAR, 5'-CACCCTGGCGCCCAATACGCAAACCGCC (SEQ ID NO:16), and 3-NDE, 5'-GGTATTTCATATGTATATCTCCTTCTTCAGAAATTCGTAATCATGG (SEQ ID NO:17). The resulting 329 bp DNA fragment was digested with NarI and NdeI, and cloned into NarI/NdeI linearized plasmid pHKK3-19 generating the vector pHKK.DELTA.Xba. To introduce a gene encoding the Skp/OmpH periplasmic factor for higher recombinant antibody production (Bothmann and Pluckthun, 1998, Nat. Biotechnol., 16, 376-380), the skp gene was amplified by PCR with primers skp-3, 5'-CGAATTCTTAAGAAGGAGATATACATATGAAAA- AGTGGTTATTAGCTGCAGG (SEQ ID NO:18) and skp-4, 5'-CGAATTCTCGAGCATTATTTAACCT- GTTTCAGTACGTCGG (SEQ ID NO:19) using as a template the plasmid pGAH317 (Holck and Kleppe, 1988, Gene, 67, 117-124). The resulting 528 bp PCR fragment was digested with AflII and XhoI and cloned into the AflII/XhoI digested plasmid pHKK.DELTA.Xba resulting in the expression plasmid pSKK2.

[0100] The plasmids pHOG scFv.sub.L18.alpha.CD3-LL-scFv.sub.L10.alpha.CD19 (scFv3-Db19) and pHOG scFv.sub.L18.alpha.CD19-LL-scFv.sub.L10.alpha.CD3 (scFv19-Db3) were cut by NcoI/XbaI, and ligated in the NcoI/XbaI linearized plasmid pSKK2. The resulting plasmids are pSKK2 scFv.sub.L18.alpha.CD3-LL-scFv.sub.L10.alpha.CD19 and pSKK2 scFv.sub.L18.alpha.CD19-LL-scFv.sub.L10.alpha.CD3. The complete nucleotide and amino acid sequences are given in FIGS. 6 and 7, respectively.

Example 2

Expression and Purification of the Multimeric Fv Molecules in Bacteria

[0101] The E. coli K12 strain RV308 (Maurer et al., 1980, J. Mol. Biol. 139, 147-161), transformed with the expression plasmids pSKK2 scFv.sub.L18.alpha.CD3-LL-scFv.sub.L10.alpha.CD19 and pSKK2 scFv.sub.L18.alpha.CD19-LL-scFv.sub.L10.alpha.CD3, was grown overnight in 2xYT medium with 50 .mu.g/ml ampicillin and 100 mM glucose (2xYT.sub.GA) at 28.degree. C. Dilutions (1:50) of the overnight cultures in 2xYT.sub.GA were grown as flask cultures at 28.degree. C. with shaking at 200 rpm. When cultures reached OD.sub.600=0.8, bacteria were pelleted by centrifugation at 5,000.times.g for 10 min at 20.degree. C., and resuspended in the same volume of fresh YTBS medium (2xYT containing 1 M sorbitol and 2.5 mM glycine betaine; Blacwell & Horgan, 1991, FEBS Letters. 295, 10-12) containing 50 .mu.g/ml ampicillin. IPTG was added to a final concentration of 0.2 mM, and growth was continued at 20.degree. C. for 18-20 h. Cells were harvested by centrifugation at 9,000.times.g for 20 min and 4.degree. C. To isolate soluble periplasmic proteins, the pelleted bacteria were resuspended in 5% of the initial volume of ice-cold 50 mM Tris-HCl, 20% sucrose, and 1 mM EDTA, pH 8.0. After a 1 h incubation on ice with occasional stirring, the spheroplasts were centrifuged at 30,000.times.g for 30 min at 4.degree. C., leaving the soluble periplasmic extract as the supernatant and spheroplasts plus the insoluble periplasmic material as the pellet. The periplasmic fractions were dialyzed against start buffer (50 mM Tris-HCl, 1 M NaCl, 50 mM Imidazole, pH 7.0) at 4.degree. C. The dialyzed solution containing recombinant product was centrifuged at 30,000.times.g for 30 min at 4.degree. C. The recombinant product was concentrated by ammonium sulfate precipitation (final concentration 70% of saturation). The protein precipitate was collected by centrifugation (10,000.times.g, 4.degree. C., 40 min), and dissolved in 10% of the initial volume of 50 mM Tris-HCl, 1 M NaCl, pH 7.0. Immobilized metal affinity chromatography (IMAC) was performed at 4.degree. C. using a 5 ml column of Chelating Sepharose (Pharmacia) charged with Cu.sup.2+ and equilibrated with 50 mM Tris-HCl, 1 M NaCl, pH 7.0 (start buffer). The sample was loaded by passing the sample over the column. It was then washed with twenty column volumes of start buffer followed by start buffer containing 50 mM imidazole until the absorbency (280 nm) of the effluent was minimal (about thirty column volumes). Absorbed material was eluted with 50 mM Tris-HCl, 1 M NaCl, 250 mM imidazole, pH 7.0. The elution fractions containing the multimeric Fv-molecules were identified by Western-blot analysis using anti-c-myc Mab 9E10, performed as previously described (Kipriyanov et al., 1994, Mol. Immunol. 31, 1047-1058) and as illustrated in FIG. 8A for scFv3-Db19 and FIG. 8B for scFv19-Db3.

[0102] The positive fractions were collected and concentrated on an Ultrafree-15 centrifugal filter device (Millipore Corporation, Eschborn, Germany) until 0.5 ml was collected.

[0103] Further purification of the multimeric Fv-molecules was done by size-exclusion FPLC on a Superdex 200 HR10/30 column (Pharmacia) in PBSI (15 mM sodium phosphate, 0,15 M NaCl, 50 mM Imidazole, pH 7.0). Sample volumes for preparative chromatography were 500 .mu.l, and the flow rate was 0.5 ml/min, respectively. The column was calibrated with High and Low Molecular Weight Gel Filtration Calibration Kits (Pharmacia). The elution fractions containing the multimeric Fv-molecules were identified by Western-blot analysis using anti-c-myc Mab 9E10 performed as previously described (Kipriyanov et al., 1994, Mol. Immunol. 31, 1047-1058), and the results are presented in FIGS. 9A and 9B for scFv3-Db19 and scFv19-Db3 molecules, respectively. The fractions were collected and stored individually on ice.

[0104] The generated Fv molecules were compared with two scFv-scFv tandems, scFv3-scFv19 and scFv19-scFv3 (FIG. 10), produced and purified under the same conditions. FIG. 10 clearly demonstrates that higher molecular forms were obtained for the scFv3.times.Db 19 and scFv 19.times.Db3 in comparison with scFv3.times.scFv 19 and scFv 19.times.scFv3. The main peak for scFv3-scFv19 and scFv19-scFv3 molecules correspond to a molecular weight of about 67 kDa, and to about 232 kDa for the scFv3-Db19 and scFv19-Db3. The presence of the dimerization motif on the C-terminus of the molecule has a positive effect for the multimerisation of the molecules.

Example 3

Characterization of the Multimeric Fv Molecules by Flow Cytometry

[0105] The human CD3.sup.+/CD19.sup.- acute T cell leukemia line Jurkat and the CD19.sup.+/CD3.sup.-B cell line JOK-1 were used for flow cytometry. In brief, 5.times.10.sup.5 cells in 50 .mu.l RPMI 1640 medium (GIBCO BRL, Eggenstein, Germany) supplemented with 10% FCS and 0.1% sodium azide (referred to as complete medium) were incubated with 100 .mu.l of a multimeric Fv molecule preparation for 45 min on ice. After washing with complete medium, the cells were incubated with 100 .mu.l of 10 .mu.g/ml anti c-myc MAb 9E10 (IC Chemikalien, Ismaning, Germany) in the same buffer for 45 min on ice. After a second washing cycle, the cells were incubated with 100 .mu.l of FITC-labeled goat anti-mouse IgG (GIBCO BRL) under the same conditions as before. The cells were then washed again and resuspended in 100 .mu.l of 1 .mu.g/ml solution of propidium iodide (Sigma, Deisenhofen, Germany) in complete medium to exclude dead cells. The relative fluorescence of stained cells was measured using a FACScan flow cytometer (Becton Dickinson, Mountain View, Calif.) or Epics XL flow cytometer systems (Beckman Coulter, Miami, Fla.).

[0106] Flow cytometry experiments demonstrated specific interactions with both human CD3.sup.+Jurkat and the CD19.sup.+JOK-1 cells for all the multimeric Fv-molecules (FIG. 11).

[0107] For the CD19 and CD3 binding affinities, we decided to use the fractions corresponding to the monomers for scFv3.times.scFv 19 and scFv19-scFv3, and to the multimers for scFv3.times.Db 19 and scFv 19.times.Db3.

Example 4

In Vitro Cell Surface Retention Assay of the Multimeric Fv Molecules

[0108] Cell surface retention assays were performed at 37.degree. C. essentially as described (Adams et al., 1998, Cancer Res. 58, 485-490), except that the detection of the retained antibody fragments was performed using anti c-myc MAb 9E10 followed by FITC-labeled anti-mouse IgG. Kinetic dissociation constant (k.sub.off) and the half-life (t.sub.1/2) for dissociation of the multimeric Fv-molecules were deduced from a one-phase exponential decay fit of experimental data using "GraphPad" Prism (GraphPad Software, San Diego, Calif.). For control, the bispecific diabody CD19.times.CD3 (BsDb 19.times.3) described previously (Kipriyanov et al., 1998, Int. J. Cancer 77, 763-777; Cochlovius et al., 2000, J. Immunol. 165, 888-895) was used. The results of the experiments are shown in FIG. 12 and summarized in Table 1.

[0109] The scFv3-scFv19 had a relatively short retention half-life (t.sub.1/2) on CD19.sup.+JOK-1 cells, almost two time less than with the t.sub.1/2 of the BsDb 19.times.3 (Table 1). In contrast, the scFv3-Db19 was retained longer on the surface of JOK-1 cells. For the scFv19-scFv3, the t.sub.1/2 is in the same range as the t.sub.1/2 of the BsDb 19.times.3. The retention of the scFv3-Db19 is significantly higher, with t.sub.1/2=65.71 min, in comparison with the others molecules (Table 1). The half-lives of all the multispecific Fv-molecules on the surface of CD3.sup.+Jurkat cells were relatively short. The length of the linker appeared to have some influence on antigen binding, since the scFv3-Db19 and scFv19-Db3 showed a significantly slower k.sub.off for CD19-positive cells than for the BsDb 19.times.3, scFv3.times.scFv 19 and scFv19-scFv3.

1TABLE 1 Binding kinetics of recombinant bispecific molecules k.sub.off t.sub.1/2 k.sub.off (s.sup.-1/ t.sub.1/2 Antibody (s.sup.-1/10.sup.-3) (min) Antibody 10.sup.-3) (min) A. JOK-1 cells (CD3.sup.-/CD19.sup.+) B. JOK-1 cells (CD3.sup.-/CD19.sup.+) BsDb 19x3 0.9945 11.62 BsDb 19x3 0.1512 10.68 scFv3-scFv19 1.814 6.368 scFv19-scFv3 0.05547 8.622 scFv3-Db19 0.6563 17.6 scFv19-Db3 0.01171 65.71 C. Jurkat cells (CD3.sup.+/CD19.sup.-) D. Jurkat cells (CD3.sup.+/CD19.sup.-) BsDb 19x3 4.268 2.707 BsDb 19x3 4.268 2.707 scFv3-scFv19 2.912 3.967 scFv19-scFv3 6.91 1.672 scFv3-Db19 3.161 3.655 scFv19-Db3 3.4 3.394

Example 5

In Vitro Analysis of Anti-Tumor Activity of Recombinant Multivalent Molecules

[0110] Freshly isolated peripheral blood mononuclear cells (PBMC) from a patient with chronic lymphocytic leukemia (CLL) were seeded in individual wells of a 12-well plate in 2 ml RPMI-Medium/10% FCS (Invitrogen, Breda, The Netherlands) at a density of 2.times.10.sup.6 cells/ml. The recombinant antibodies scFv3-scFv19 and scFv3-Db19 were added at concentration of 5 .mu.g/ml. After a 5 day incubation, the cells were harvested, counted, and stained with anti-CD3 MAb OKT3 (DKFZ, Heidelberg, Germany), anti-CD4 MAb Edu-2 (Chemicon, Hofheim, Germany), anti-CD8 MAb UCH-T4 (Chemicon, Hofheim, Germany), and anti-CD19 MAb HD37 (DKFZ, Heidelberg, Germany) for flow cytometric analysis. 10.sup.4 living cells were analyzed using a Beckman-Coulter flow cytometer and the relative and absolute amounts of CD3.sup.+, CD4.sup.+, CD8.sup.+ and CD19.sup.+ cells were plotted.

[0111] The results shown in FIG. 13 demonstrated that tetravalent scFv3-Db19 molecules caused vigorous proliferation of autologous T cells and killing of C19.sup.+ tumor cells. In contrast, bivalent scFv3-scFv19 molecules had nearly no effect.

Example 6

Construction of the Plasmid pSKK3-scFv.sub.L7Anti-CD19-SL-scFv.sub.L18Anti- -CD3 for the Expression of Multimeric Fv-Antibody (Db19-SL-scFv3) in Bacteria

[0112] For generation of multimeric Fv constructs, the plasmids pHOG_HD37, pHOG_Dia_HD37, pHOG_mOKT3+NotI, and pHOG_Dia_mOKT3 encoding the antibody fragments derived either from hybridoma HD37 specific to human CD19 (Kipriyanov et al., 1996, J. Immunol. Meth. 196, 51-62; Le Gall et al., 1999, FEBS Lett., 453, 164-168) or from hybridoma OKT3 specific to human CD3 (Kipriyanov et al., 1997, Protein Eng. 10, 445-453) were used.

[0113] To generate a gene encoding the anti-CD19 scFv.sub.L7 with the V.sub.L-V.sub.H orientation, the V.sub.L-HD37 gene was amplified by PCR using as a template the plasmid DNA pHOG_HD37 (Kipriyanov et al., 1996, J. Immunol. Meth. 196, 51-62) and primers VL_Nco, 5'-CAGCCGGCCATGGCGGATAT- CTTGCTCACCCAAACTCCAGC (SEQ ID NO:20) and 3_Ck, 5'-AGACGGTGCAGCAACAGTACGTTT- GATTTCCAGC (SEQ ID NO:21). The resulting 371 bp PCR fragments code for the anti-CD19 VL domain followed by 7 amino acid Arg-Thr-Val-Ala-Ala-Pro-Ser linker. In turn, the V.sub.H-HD37 gene was amplified by PCR using as a template the plasmid DNA pHOG_HD37 (Kipriyanov et al., 1996, J. Immunol. Meth. 196, 51-62) and primers 5_Ck, 5'-CGTACTGTTGCTGCACCGTCTCAGGTGCAACTGC- AGCAGTC (SEQ ID NO:22) and VH_Not, 5'-GAAGATGGATCCAGCGGCCGCTGAGGAGACGGTGAC- TGAGGTTCC (SEQ ID NO:23). The resulting 416 bp PCR fragment codes for the anti-CD19 VH domain preceded by 7 amino acid Arg-Thr-Val-Ala-Ala-Pro-Ser linker. The whole gene for anti-CD19 scFv.sub.L7 was assembled by PCR from 371 bp and 416 bp DNA fragments using primers VL_Nco and VH_Not. The resulting 764 bp PCR fragment was digested with NcoI and NotI and cloned into NcoI/NotI-linearized plasmid pDISC2/SL (Kipriyanov et al., 1999, J. Mol. Biol. 293, 41-56), thus generating the plasmid pDISC-scFv.sub.L7anti-CD19-SL-scFV.sub.L10anti-CD3.

[0114] To increase the yield of functional scFv-antibodies in the bacterial periplasm, an optimized expression vector pSKK3 was generated (FIG. 15). This vector was constructed on the basis of plasmid pHKK (Horn et al., 1996, Appl. Microbiol. Biotechnol. 46, 524-532) containing hok/sok plasmid-free cell suicide system (Thisted et al., 1994, EMBO J. 13, 1960-1968). First, the gene coding for hybrid scFv V.sub.H3-V.sub.L19 was amplified by PCR from the plasmid pHOG3-19 (Kipriyanov et al., 1998, Int. J. Cancer 77, 763-772) using the primers 5-NDE, 5'-GATATACATATGAAATACCTATTGCCTACGGC, (SEQ ID NO:24) and 3-AFL, 5'-CGAATTCTTAAGTTAGCACAGGCCTCTAGAGACACACAGATCTTTAG (SEQ ID NO:25). The resulting 921 bp PCR fragment was digested with NdeI and AflII and cloned into the NdeI/AflII linearized plasmid pHKK, generating the vector pHKK3-19. To delete an extra XbaI site, a fragment of the PHKK plasmid containing the 3'-terminal part of the lacI gene (encoding the lac repressor), the strong transcriptional terminator tHP, and wild-type lac promoter/operator was amplified by PCR using primers 5-NAR, 5'-CACCCTGGCGCCCAATACGCAAACCGCC, (SEQ ID NO:16) and 3-NDE, 5'-GGTATTTCATATGTATATCTCCTTCTTCAGAAATTCGTAATCATGG (SEQ ID NO:17). The resulting 329 bp DNA fragment was digested with NarI and NdeI and cloned into NarI/NdeI-linearized plasmid pHKK3-19, generating the vector pHKK.DELTA.Xba. To introduce a gene encoding the Skp/OmpH periplasmic factor for higher recombinant antibody production (Bothmann and Pluckthun, 1998, Nat. Biotechnol. 16, 376-380), the skp gene was amplified by PCR with primers skp-3, 5'-CGAATTCTTAAGAAGGAGATATACATATGAAAA- AGTGGTTATTAGCTGCAGG (SEQ ID NO:18), and skp-4, 5'-CGAATTCTCGAGCATTATTTAACC- TGTTTCAGTACGTCGG (SEQ ID NO:19), using as a template the plasmid pGAH317 (Holck and Kleppe, 1988, Gene 67, 117-124). The resulting 528 bp PCR fragment was digested with AflII and XhoI and cloned into the AflII/XhoI digested plasmid pHKK.DELTA.Xba resulting in the expression plasmid pSKK2.

[0115] For removing the sequence encoding the potentially immunogenic c-myc epitope, the NcoI/XbaI-linearized plasmid pSKK2 was used for cloning the NcoI/XbaI-digested 902 bp PCR fragment encoding the scFv phOx31E (Marks et al., 1997, BioTechnology 10, 779-783), which was amplified with primers DP1 and His-Xba, 5'-CAGGCCTCTAGATTAGTGATGGTGATGGTG- ATGGG (SEQ ID NO:26). The resulting plasmid pSKK3 was digested with NcoI and NotI and used as a vector for cloning the gene coding for anti-CD3 scFv.sub.18, which was isolated as a 751 bp DNA fragment after digestion of plasmid pHOG21_dmOKT3+NotI (Kipriyanov et al., 1997, Protein Eng. 10, 445-453) with NcoI and NotI. The resulting plasmid pSKK3_scFv.sub.L18anti-CD3 was used as a template for PCR amplification of the gene encoding the anti-CD3 scFv.sub.18 with primers Bi3h, 5'-CCGGCCATGGCGCAGGTGCAGCTGCAGCAGTCTGG (SEQ ID NO:27), and P-skp 5'-GCTGCCCATGTTGACGATTGC (SEQ ID NO:28). The generated 919 bp PCR fragment was digested with PvuII and XbaI and cloned into PvuII/XbaI-cut plasmid pDISC-scFv.sub.L7anti-CD19-SL-scFv.sub.L10anti-CD3. The resulting plasmid pDISC-scFv.sub.L7anti-CD19-SL-scFv.sub.L18anti-CD3 was digested with NcoI and XbaI, and the 1536 bp DNA fragment was isolated and cloned into NcoI/XbaI-linearized vector pSKK3.

[0116] The generated plasmid pSKK3-scFv.sub.L7anti-CD19-SL-scFv.sub.L18ant- i-CD3 (FIG. 15) contains several features that improve plasmid performance and lead to increased accumulation of functional bivalent product in the E. coli periplasm under conditions of both shake-flask cultivation and high cell density fermentation. These are the hok/sok post-segregation killing system, which prevents plasmid loss, strong tandem ribosome-binding sites, and a gene encoding the periplasmic factor Skp/OmpH that increases the functional yield of antibody fragments in bacteria. The expression cassette is under the transcriptional control of the wt lac promoter/operator system and includes a short sequence coding for the N-terminal peptide of .beta.-galactosidase (lacZ') with a first rbs derived from the E. coli lacZ gene, followed by genes encoding the scFv-antibody and Skp/OmpH periplasmic factor under the translational control of strong rbs from gene 10 of phage T7 (T7g10). In addition, the gene of scFv-antibody is followed by a nucleotide sequence encoding six histidine residues for both immunodetection and purification of recombinant product by immobilized metal-affinity chromatography (IMAC).

Example 7

Expression in Bacteria and Purification of the Multimeric Fv-Antibodies

[0117] The E. coli K12 strain RV308 (.DELTA.lac.sub..chi.74 galISII::OP308strA) (Maurer et al., 1980, J. Mol. Biol. 139, 147-161) (ATCC 31608) was used for functional expression of scFv-antibodies. The bacteria transformed with the expression plasmid pSKK3-scFv.sub.7anti-CD1- 9-SL-scFv.sub.18anti-CD3 were grown overnight in 2xYT medium with 100 .mu.g/ml ampicillin and 100 mM glucose (2xYT.sub.GA) at 28.degree. C. The overnight culture was diluted in fresh 2xYT.sub.GA medium to an optical density at 600 nm (OD.sub.600) of 0.1, and continued to grow as flask cultures at 28.degree. C. with vigorous shaking (180-220 rpm) until OD.sub.600 reached 0.8. Bacteria were harvested by centrifugation at 5,000 g for 15 min at 20.degree. C., and resuspended in the same volume of fresh YTBS medium (2xYT containing 1 M sorbitol, 2.5 mM glycine betaine and 100 .mu.g/ml ampicillin). Isopropyl-.beta.-D-thiogalactopyran- oside (IPTG) was added to a final concentration of 0.2 mM, and growth was continued at 21.degree. C. for 18-20 h. Cells were harvested by centrifugation at 9,000 g for 20 min at 4.degree. C. To isolate soluble periplasmic proteins, the pelleted bacteria were resuspended in 5% of the initial volume of ice-cold 200 mM Tris-HCl, 20% sucrose, 1 mM EDTA, pH 8.0. After 1 h incubation on ice with occasional stirring, the spheroplasts were centrifuged at 30,000 g for 30 min at 4.degree. C. leaving the soluble periplasmic extract as the supernatant and spheroplasts plus the insoluble periplasmic material as the pellet. The periplasmic extract was thoroughly dialyzed against 50 mM Tris-HCl, 1 M NaCl, pH 7.0, and used as a starting material for isolating scFv-antibodies. The recombinant product was concentrated by ammonium sulfate precipitation (final concentration 70% of saturation). The protein precipitate was collected by centrifugation (10,000 g, 4.degree. C., 40 min) and dissolved in 2.5% of the initial volume of 50 mM Tris-HCl, 1 M NaCl, pH 7.0, followed by thorough dialysis against the same buffer. Immobilized metal affinity chromatography (IMAC) was performed at 4.degree. C. using a 5 ml column of Chelating Sepharose (Amersham Pharmacia, Freiburg, Germany) charged with Cu.sup.2+ and equilibrated with 50 mM Tris-HCl, 1 M NaCl, pH 7.0 (start buffer). The sample was loaded by passing the sample over the column by gravity flow. The column was then washed with twenty column volumes of start buffer followed by start buffer containing 50 mM imidazole until the absorbance (280 nm) of the effluent was minimal (about thirty column volumes). Absorbed material was eluted with 50 mM Tris-HCl, 1 M NaCl, 300 mM imidazole, pH 7.0, as 1 ml fractions. The eluted fractions containing recombinant protein were identified by Western-blot analysis using Anti-penta-His mAb (QIAGEN, Hilden, Germany) and goat anti-mouse IgG HRP-conjugated antibodies (Dianova, Hamburg, Germany) as previously described (Kipriyanov et al., 1994, Mol. Immunol. 31, 1047-1058). The positive fractions were pooled and subjected to buffer exchange for 50 mM imidazole-HCl, 50 mM NaCl (pH 6.0) using pre-packed PD-10 columns (Pharmacia Biotech, Freiburg, Germany). The turbidity of protein solution was removed by centrifugation (30,000 g, 1 h, 4.degree. C.).

[0118] The final purification was achieved by ion-exchange chromatography on a Mono S HR 5/5 column (Amersham Biosciences, Freiburg, Germany) in 50 mM imidazole-HCl, 50 mM NaCl, pH 6.0, with a linear 0.05-1 M NaCl gradient. The fractions containing multimeric Fv-antibodies were concentrated with simultaneous buffer exchange for PBS containing 50 mM imidazole, pH 7.0 (PBSI buffer), using an Ultrafree-15 centrifugal filter device (Millipore, Eschborn, Germany). Protein concentrations were determined by the Bradford dye-binding assay (Bradford, 1976, Anal. Biochem., 72, 248-254) using the Bio-Rad (Munich, Germany) protein assay kit. SDS-PAGE analysis demonstrated that Db19-SL-scFv3 migrated as single band with a molecular mass (M.sub.r) around 56 kDa (FIG. 17). Size-exclusion chromatography on a calibrated Superdex 200 HR 10/30 column (Amersham Biosciences, Freiburg, Germany) demonstrated that Db19-SL-scFv3 was mainly in a dimeric form with M.sub.r around 150 kDa(FIG. 18).

Example 8

Cell Binding Measurements

[0119] The human CD3.sup.+ T-cell leukemia cell line Jurkat and human CD19.sup.+ B-cell cell line JOK-1 were used for flow cytometry experiments. The cells were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum (FCS), 2 mM L-glutamine, 100 U/mL penicillin G sodium and 100 .mu.g/ml streptomycin sulfate (all from Invitrogen, Groningen, The Netherlands) at 37.degree. C. in a humidified atmosphere with 5% CO.sub.2. 1.times.10.sup.6 cells were incubated with 0.1 ml phosphate buffered saline (PBS, Invitrogen, Groningen, The Netherlands) supplemented with 2% heat-inactivated fetal calf serum (FCS, Invitrogen, Groningen, The Netherlands) and 0.1% sodium azide (Roth, Karlsruhe, Germany) (referred to as FACS buffer) containing diluted Db19-SL-scFv3 for 45 min on ice. After washing with FACS buffer, the cells were incubated with 0.1 ml of 0.01 mg/ml anti-(His).sub.6 mouse mAb 13/45/31-2 (Dianova, Hamburg, Germany) in the same buffer for 45 min on ice. After a second washing cycle, the cells were incubated with 0.1 ml of 0.015 mg/ml FITC-conjugated goat anti-mouse IgG (Dianova, Hamburg, Germany) under the same conditions as before. The cells were then washed again and resuspended in 0.5 ml of FACS buffer containing 2 .mu.g/ml propidium iodide (Sigma-Aldrich, Taufkirchen, Germany) to exclude dead cells. The fluorescence of 1.times.10.sup.4 stained cells was measured using a Beckman-Coulter Epics XL flow cytometer (Beckman-Coulter, Krefeld, Germany). Mean fluorescence (F) was calculated using System-II and Expo32 software (Beckman-Coulter, Krefeld, Germany) and the background fluorescence was subtracted. Equilibrium dissociation constants (K.sub.d) were determined by fitting the experimental values to the Lineweaver-Burk equation: 1/F=1/F.sub.max+(K.sub.d/F.sub.max) (1/[Ab]) using the software program PRISM (GraphPad Software, San Diego, Calif.).

[0120] The flow cytometry experiments demonstrated a specific interaction of Db19-SL-scFv3 molecule to Jurkat cells expressing CD3 on their surface and to JOK-1 cells expressing CD19 on their surface (FIG. 19, A and B). The measured affinity constants proved to be fairly comparable for both CD3 and CD19-binding parts of the molecule (Table 2).

2TABLE 2 Affinity of Db19-SL-scFv3 multimeric antibody binding to CD3.sup.+ Jurkat cells and CD19.sup.+ JOK-1 cells Cell line K.sub.d (nM) Jurkat (CD3.sup.+) 14.67 JOK-1 (CD19.sup.+) 10.02

[0121] The dissociation constants (K.sub.d) were deduced from Lineweaver-Burk plots shown in FIG. 19.

Example 9

In Vitro Analysis of Anti-Tumor Activity of Recombinant Multivalent Molecules

[0122] Freshly isolated peripheral blood mononuclear cells (PBMC) from a patient with chronic lymphocytic leukemia (CLL) were seeded in individual wells of a 12-well plate in 2 ml RPMI-Medium/10% FCS (Invitrogen, Breda, The Netherlands) at a density of 2.times.10.sup.6 cells/ml. The recombinant antibodies Db19-SL-scFv3 were added at concentration of 5, 1, 0.1 .mu.g/ml. After 6 days incubation, the cells were harvested, counted, and stained with anti-CD3 MAb OKT3 (DKFZ, Heidelberg, Germany), anti-CD4 MAb Edu-2 (Chemicon, Hofheim, Germany), anti-CD8 MAb UCH-T4 (Chemicon, Hofheim, Germany), and anti-CD19 MAb HD37 (DKFZ, Heidelberg, Germany) for flow cytometric analysis. 10.sup.4 living cells were analyzed using a Beckman-Coulter flow cytometer, and the relative amounts of CD3.sup.+, CD4.sup.+, CD8.sup.+ and CD19.sup.+ cells were plotted.

[0123] The results, shown in FIG. 20, demonstrated that tetravalent Db19-SL-scFv3 molecule caused vigorous proliferation of autologous T cells and killing of C19.sup.+ tumor cells. The observed T cell proliferation and killing CLL cells was even higher than those observed for previously described CD19.times.CD3 tandem diabody (Tandab; Kipriyanov et al. 1999, J. Mol. Biol. 293, 41-56; Cochlovius et al. 2000, Cancer Res. 60, 4336-4341).

Example 10

Construction of the Plasmid pSKK3-scFv.sub.L7Anti-CD19-L6-scFv.sub.L10anti- -CD3 for the Expression of Multimeric Fv-Antibody (Db19-L6-scFv3) in Bacteria

[0124] For constructing the gene encoding the anti-CD3 scFV.sub.L10, the plasmid pHOG21-dmOKT3 containing the gene for anti-human CD3 scFv.sub.18 (Kipriyanov et al., 1997, Protein Engineering 10, 445-453) was used. To facilitate the cloning procedures, a NotI restriction site was introduced into the plasmid pHOG21-dmOKT3 by PCR amplification of scFv.sub.18 gene using primers Bi3sk, 5'-CAGCCGGCCATGGCGCAGGTGCAACTGCAGCAG (SEQ ID NO:29) and Bi9sk, 5'-GAAGATGGATCCAGCGGCCGCAGTATCAGCCCGGTT (SEQ ID NO:30). The resulting 776 bp PCR fragment was digested with NcoI and NotI, and cloned into the NcoI/NotI-linearized vector pHOG21-CD19 (Kipriyanov et al., 1996, J. Immunol. Methods 196, 51-62), thus generating the plasmid pHOG21-dmOKT3+Not. The gene coding for OKT3 V.sub.H domain with a Cys-Ser substitution at position 100A according to Kabat numbering scheme (Kipriyanov et al., 1997, Protein Engineering 10, 445-453) was amplified by PCR with primers DP1, 5'-TCACACAGAATTCTTAGATCTATTAAAGAGGAGAAATTAACC(SE- Q ID NO:31) and DP2, 5'-AGCACACGATATCACCGCCAAGCTTGGGTGTTGTTTTGGC (SEQ ID NO:32), to generate the gene for anti-CD3 V.sub.H followed by linker of 10 amino acids Ser-Ala-Lys-Thr-Thr-Pro-Lys-Leu-Gly-Gly. The resulting 507 bp PCR fragment was digested with NcoI and EcoRV, and cloned into NcoI/EcoRV-linearized plasmid pHOG21-dmOKT3+Not, thus generating the plasmid pHOG21-scFv10/anti-CD3.

[0125] To generate a gene encoding the anti-CD19 scFV.sub.L7 with the V.sub.L-V.sub.H orientation followed by 6 amino acid linker peptide Ser-Ala-Lys-Thr-Thr-Pro, the V.sub.L-HD37 gene was amplified by PCR using as a template the plasmid DNA pHOG_HD37 (Kipriyanov et al., 1996, J. Immunol. Meth. 196, 51-62) and primers VL_Nco, 5'-CAGCCGGCCATGGCGGATATCTT- GCTCACCCAAACTCCAGC and 3_Ck, 5'-AGACGGTGCAGCAACAGTACGTTTGATTTCCAGC. The resulting 371 bp PCR fragment codes for the anti-CD19 VL domain followed by 7 amino acid Arg-Thr-Val-Ala-Ala-Pro-Ser linker. In turn, the V.sub.H-HD37 gene was amplified by PCR using as a template the plasmid DNA pHOG_HD37 (Kipriyanov et al., 1996, J. Immunol. Meth. 196, 51-62) and primers 5_Ck, 5'-CGTACTGTTGCTGCACCGTCTCAGGTGCAACTGCAGCAGTC and VH-L6_Pvu, 5'-CTGCTGCAGCTGCACCTGGGGTGTTGTTTTGGCTGAGGAG (SEQ ID NO:33). The resulting 428 bp PCR fragment codes for the anti-CD19 VH domain preceded by 7 amino acid Arg-Thr-Val-Ala-Ala-Pro-Ser linker and followed by 6 amino acid linker peptide Ser-Ala-Lys-Thr-Thr-Pro. The whole gene for anti-CD19 scFv.sub.L7-L.sub.6 was assembled by PCR from 371 bp and 428 bp DNA fragments using primers VL_Nco and VH-L6_Pvu. The resulting 790 bp PCR fragment was digested with NcoI and PvuII and cloned into NcoI/PvuII-linearized plasmid pHOG21-scFv10/anti-CD3, thus generating the plasmid pDISC-scFv.sub.L7anti-CD19-L6-scFv.sub.L10anti-CD3.

[0126] To increase the yield of functional scFv-antibodies in the bacterial periplasm, the plasmid pDISC-scFv.sub.L7anti-CD19-L6-scFv.sub.L- 10anti-CD3 was digested with NcoI and XbaI, and the 1503 bp DNA fragment was isolated and cloned into NcoI/XbaI-linearized vector pSKK3 (see Example 6). The generated plasmid pSKK3-scFv.sub.L7anti-CD19-L6-scFv.sub.- L10anti-CD3 (FIG. 22) is suitable for expression of functional bivalent product in the E. coli periplasm under conditions of both shake-flask cultivation and high cell density fermentation.

Example 11

Characterization of Db19-L6-scFv3 Antibody

[0127] The recombinant scFv-antibody Db19-L6-scFv3 was expressed in E. coli RV308 cells transformed with the plasmid pSKK3-scFv.sub.L7anti-CD19-- L6-scFv.sub.L10anti-CD3 and purified from soluble periplasmic fraction essentially as described in Example 7. SDS-PAGE analysis demonstrated that Db19-L6-scFv3 migrated as single band with a molecular mass (M.sub.r) around 56 kDa (FIG. 24). Size-exclusion chromatography on a calibrated Superdex 200 HR 10/30 column (Amersham Biosciences, Freiburg, Germany) demonstrated that Db19-L6-scFv3 was mainly in a dimeric form with M.sub.r around 150 kDa (FIG. 25).

[0128] The human CD3.sup.+ T-cell leukemia cell line Jurkat and human CD19.sup.+ B-cell cell line JOK-1 were used for flow cytometry experiments. The cells were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum (FCS), 2 mM L-glutamine, 100 U/mL penicillin G sodium, and 100 .mu.g/ml streptomycin sulfate (all from Invitrogen, Groningen, The Netherlands) at 37.degree. C. in a humidified atmosphere with 5% CO.sub.2. 1.times.10.sup.6 cells were incubated with 0.1 ml phosphate buffered saline (PBS, Invitrogen, Groningen, The Netherlands) supplemented with 2% heat-inactivated fetal calf serum (FCS, Invitrogen, Groningen, The Netherlands) and 0.1% sodium azide (Roth, Karlsruhe, Germany) (referred to as FACS buffer) containing diluted Db19-SL-scFv3 for 45 min on ice. After washing with FACS buffer, the cells were incubated with 0.1 ml of 0.01 mg/ml anti-(His).sub.6 mouse mAb 13/45/31-2 (Dianova, Hamburg, Germany) in the same buffer for 45 min on ice. After a second washing cycle, the cells were incubated with 0.1 ml of 0.015 mg/ml FITC-conjugated goat anti-mouse IgG (Dianova, Hamburg, Germany) under the same conditions as before. The cells were then washed again and resuspended in 0.5 ml of FACS buffer containing 2 .mu.g/ml propidium iodide (Sigma-Aldrich, Taufkirchen, Germany) to exclude dead cells. The fluorescence of 1.times.10.sup.4 stained cells was measured using a Beckman-Coulter Epics XL flow cytometer (Beckman-Coulter, Krefeld, Germany). Mean fluorescence (F) was calculated using System-II and Expo32 software (Beckman-Coulter, Krefeld, Germany), and the background fluorescence was subtracted. Equilibrium dissociation constants (K.sub.d) were determined by fitting the experimental values to the Lineweaver-Burk equation: 1/F=1/F.sub.max+(K.sub.d/F.sub.max) (1/[Ab]) using the software program PRISM (GraphPad Software, San Diego, Calif.).

[0129] The flow cytometry experiments demonstrated a specific interaction of Db19-L6-scFv3 molecule to Jurkat cells expressing CD3 on their surface and to JOK-1 cells expressing CD19 on their surface (FIGS. 26,A and B). The measured affinity constants proved to be fairly comparable for both CD3 and CD19-binding parts of the molecule (Table 3).

3TABLE 3 Affinity of Db19-L6-scFv3 multimeric antibody binding to CD3.sup.+ Jurkat cells and CD19.sup.+ JOK-1 cells Cell line K.sub.d (nM) Jurkat (CD3.sup.+) 4.42 JOK-1 (CD19.sup.+) 8.49

[0130] The dissociation constants (K.sub.d) were deduced from Lineweaver-Burk plots shown in FIG. 26.

Sequence CWU 1

1

33 1 28 PRT Artificial linker sequence 1 Ser Glu Arg Ala Leu Ala Leu Tyr Ser Thr His Arg Thr His Arg Pro 1 5 10 15 Arg Leu Tyr Ser Leu Glu Gly Leu Tyr Gly Leu Tyr 20 25 2 48 PRT Artificial linker sequence 2 Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Ser Glu Arg Gly 1 5 10 15 Leu Tyr Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Ser Glu Arg Gly Leu 20 25 30 Tyr Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Ser Glu Arg Gly Leu Tyr 35 40 45 3 42 PRT Artificial linker sequence 3 Ser Glu Arg Ala Leu Ala Leu Tyr Ser Thr His Arg Thr His Arg Pro 1 5 10 15 Arg Leu Tyr Ser Leu Glu Gly Leu Gly Leu Gly Leu Tyr Gly Leu Pro 20 25 30 His Glu Ser Glu Arg Gly Leu Ala Leu Ala 35 40 4 1817 DNA Artificial Plasmid 4 ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa 60 caatttcaca caggaaacag ctatgaccat gattacgaat ttctgaagaa ggagatatac 120 atatgaaata cctattgcct acggcagccg ctggcttgct gctgctggca gctcagccgg 180 ccatggcgca ggtgcaactg cagcagtctg gggctgagct ggtgaggcct gggtcctcag 240 tgaagatttc ctgcaaggct tctggctatg cattcagtag ctactggatg aactgggtga 300 agcagaggcc tggacagggt cttgagtgga ttggacagat ttggcctgga gatggtgata 360 ctaactacaa tggaaagttc aagggtaaag ccactctgac tgcagacgaa tcctccagca 420 cagcctacat gcaactcagc agcctagcat ctgaggactc tgcggtctat ttctgtgcaa 480 gacgggagac tacgacggta ggccgttatt actatgctat ggactactgg ggtcaaggaa 540 cctcagtcac cgtctcctca gccaaaacaa cacccaagct tgaagaaggt gaattttcag 600 aagcacgcgt agatatcttg ctcacccaaa ctccagcttc tttggctgtg tctctagggc 660 agagggccac catctcctgc aaggccagcc aaagtgttga ttatgatggt gatagttatt 720 tgaactggta ccaacagatt ccaggacagc cacccaaact cctcatctat catgcatcca 780 atctagtttc tgggatccca cccaggttta gtggcagtgg gtctgggaca gacttcaccc 840 tcaacatcca tcctgtggag aaggtggatg ctgcaaccta tcactgtcag caaagtactg 900 aggatccgtg gacgttcggt ggaggcacca agctggaaat caaacgggct gatgctgcgg 960 ccgctggtgg tggtggttct ggcggcggtg gtagcggtgg tggcggctcc ggtggtggtg 1020 gtagccaggt gcagctgcag cagtctgggg ctgaactggc aagacctggg gcctcagtga 1080 agatgtcctg caaggcttct ggctacacct ttactaggta cacgatgcac tgggtaaaac 1140 agaggcctgg acagggtctg gaatggattg gatacattaa tcctagccgt ggttatacta 1200 attacaatca gaagttcaag gacaaggcca cattgactac agacaaatcc tccagcacag 1260 cctacatgca actgagcagc ctgacatctg aggactctgc agtctattac tgtgcaagat 1320 attatgatga tcattacagc cttgactact ggggccaagg caccactctc acagtctcct 1380 cagccaaaac aacacccaag cttggcggtg atatcgtgct cactcagtct ccagcaatca 1440 tgtctgcatc tccaggggag aaggtcacca tgacctgcag tgccagctca agtgtaagtt 1500 acatgaactg gtaccagcag aagtcaggca cctcccccaa aagatggatt tatgacacat 1560 ccaaactggc ttctggagtc cctgctcact tcaggggcag tgggtctggg acctcttact 1620 ctctcacaat cagcggcatg gaggctgaag atgctgccac ttattactgc cagcagtgga 1680 gtagtaaccc attcacgttc ggctcgggga caaagttgga aataaaccgg gctgatactg 1740 caccaactgg atccgaacaa aagctgatct cagaagaaga cctaaactca catcaccatc 1800 accatcacta atctaga 1817 5 1603 PRT Artificial Plasmid 5 Met Glu Thr Leu Tyr Ser Thr Tyr Arg Leu Glu Leu Glu Pro Arg Thr 1 5 10 15 His Arg Ala Leu Ala Ala Leu Ala Ala Leu Ala Gly Leu Tyr Leu Glu 20 25 30 Leu Glu Leu Glu Leu Glu Ala Leu Ala Ala Leu Ala Gly Leu Asn Pro 35 40 45 Arg Ala Leu Ala Met Glu Thr Ala Leu Ala Gly Leu Asn Val Ala Leu 50 55 60 Gly Leu Asn Leu Glu Gly Leu Asn Gly Leu Asn Ser Glu Arg Gly Leu 65 70 75 80 Tyr Ala Leu Ala Gly Leu Leu Glu Ala Leu Ala Ala Arg Gly Pro Arg 85 90 95 Gly Leu Tyr Ala Leu Ala Ser Glu Arg Val Ala Leu Leu Tyr Ser Met 100 105 110 Glu Thr Ser Glu Arg Cys Tyr Ser Leu Tyr Ser Ala Leu Ala Ser Glu 115 120 125 Arg Gly Leu Tyr Thr Tyr Arg Thr His Arg Pro His Glu Thr His Arg 130 135 140 Ala Arg Gly Thr Tyr Arg Thr His Arg Met Glu Thr His Ile Ser Thr 145 150 155 160 Arg Pro Val Ala Leu Leu Tyr Ser Gly Leu Asn Ala Arg Gly Pro Arg 165 170 175 Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Leu Glu Gly Leu Thr Arg Pro 180 185 190 Ile Leu Glu Gly Leu Tyr Thr Tyr Arg Ile Leu Glu Ala Ser Asn Pro 195 200 205 Arg Ser Glu Arg Ala Arg Gly Gly Leu Tyr Thr Tyr Arg Thr His Arg 210 215 220 Ala Ser Asn Thr Tyr Arg Ala Ser Asn Gly Leu Asn Leu Tyr Ser Pro 225 230 235 240 His Glu Leu Tyr Ser Ala Ser Pro Leu Tyr Ser Ala Leu Ala Thr His 245 250 255 Arg Leu Glu Thr His Arg Thr His Arg Ala Ser Pro Leu Tyr Ser Ser 260 265 270 Glu Arg Ser Glu Arg Ser Glu Arg Thr His Arg Ala Leu Ala Thr Tyr 275 280 285 Arg Met Glu Thr Gly Leu Asn Leu Glu Ser Glu Arg Ser Glu Arg Leu 290 295 300 Glu Thr His Arg Ser Glu Arg Gly Leu Ala Ser Pro Ser Glu Arg Ala 305 310 315 320 Leu Ala Val Ala Leu Thr Tyr Arg Thr Tyr Arg Cys Tyr Ser Ala Leu 325 330 335 Ala Ala Arg Gly Thr Tyr Arg Thr Tyr Arg Ala Ser Pro Ala Ser Pro 340 345 350 His Ile Ser Thr Tyr Arg Ser Glu Arg Leu Glu Ala Ser Pro Thr Tyr 355 360 365 Arg Thr Arg Pro Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Thr His Arg 370 375 380 Thr His Arg Leu Glu Thr His Arg Val Ala Leu Ser Glu Arg Ser Glu 385 390 395 400 Arg Ala Leu Ala Leu Tyr Ser Thr His Arg Thr His Arg Pro Arg Leu 405 410 415 Tyr Ser Leu Glu Gly Leu Gly Leu Gly Leu Tyr Gly Leu Pro His Glu 420 425 430 Ser Glu Arg Gly Leu Ala Leu Ala Ala Arg Gly Val Ala Leu Ala Ser 435 440 445 Pro Ile Leu Glu Val Ala Leu Leu Glu Thr His Arg Gly Leu Asn Ser 450 455 460 Glu Arg Pro Arg Ala Leu Ala Ile Leu Glu Met Glu Thr Ser Glu Arg 465 470 475 480 Ala Leu Ala Ser Glu Arg Pro Arg Gly Leu Tyr Gly Leu Leu Tyr Ser 485 490 495 Val Ala Leu Thr His Arg Met Glu Thr Thr His Arg Cys Tyr Ser Ser 500 505 510 Glu Arg Ala Leu Ala Ser Glu Arg Ser Glu Arg Ser Glu Arg Val Ala 515 520 525 Leu Ser Glu Arg Thr Tyr Arg Met Glu Thr Ala Ser Asn Thr Arg Pro 530 535 540 Thr Tyr Arg Gly Leu Asn Gly Leu Asn Leu Tyr Ser Ser Glu Arg Gly 545 550 555 560 Leu Tyr Thr His Arg Ser Glu Arg Pro Arg Leu Tyr Ser Ala Arg Gly 565 570 575 Thr Arg Pro Ile Leu Glu Thr Tyr Arg Ala Ser Pro Thr His Arg Ser 580 585 590 Glu Arg Leu Tyr Ser Leu Glu Ala Leu Ala Ser Glu Arg Gly Leu Tyr 595 600 605 Val Ala Leu Pro Arg Ala Leu Ala His Ile Ser Pro His Glu Ala Arg 610 615 620 Gly Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr 625 630 635 640 Thr His Arg Ser Glu Arg Thr Tyr Arg Ser Glu Arg Leu Glu Thr His 645 650 655 Arg Ile Leu Glu Ser Glu Arg Gly Leu Tyr Met Glu Thr Gly Leu Ala 660 665 670 Leu Ala Gly Leu Ala Ser Pro Ala Leu Ala Ala Leu Ala Thr His Arg 675 680 685 Thr Tyr Arg Thr Tyr Arg Cys Tyr Ser Gly Leu Asn Gly Leu Asn Thr 690 695 700 Arg Pro Ser Glu Arg Ser Glu Arg Ala Ser Asn Pro Arg Pro His Glu 705 710 715 720 Thr His Arg Pro His Glu Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Thr 725 730 735 His Arg Leu Tyr Ser Leu Glu Gly Leu Ile Leu Glu Ala Ser Asn Ala 740 745 750 Arg Gly Ala Leu Ala Ala Ser Pro Thr His Arg Ala Leu Ala Ala Leu 755 760 765 Ala Ala Leu Ala Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr 770 775 780 Ser Glu Arg Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Ser 785 790 795 800 Glu Arg Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Ser Glu 805 810 815 Arg Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr Ser Glu Arg 820 825 830 Gly Leu Asn Val Ala Leu Gly Leu Asn Leu Glu Gly Leu Asn Gly Leu 835 840 845 Asn Ser Glu Arg Gly Leu Tyr Ala Leu Ala Gly Leu Leu Glu Val Ala 850 855 860 Leu Ala Arg Gly Pro Arg Gly Leu Tyr Ser Glu Arg Ser Glu Arg Val 865 870 875 880 Ala Leu Leu Tyr Ser Ile Leu Glu Ser Glu Arg Cys Tyr Ser Leu Tyr 885 890 895 Ser Ala Leu Ala Ser Glu Arg Gly Leu Tyr Thr Tyr Arg Ala Leu Ala 900 905 910 Pro His Glu Ser Glu Arg Ser Glu Arg Thr Tyr Arg Thr Arg Pro Met 915 920 925 Glu Thr Ala Ser Asn Thr Arg Pro Val Ala Leu Leu Tyr Ser Gly Leu 930 935 940 Asn Ala Arg Gly Pro Arg Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Leu 945 950 955 960 Glu Gly Leu Thr Arg Pro Ile Leu Glu Gly Leu Tyr Gly Leu Asn Ile 965 970 975 Leu Glu Thr Arg Pro Pro Arg Gly Leu Tyr Ala Ser Pro Gly Leu Tyr 980 985 990 Ala Ser Pro Thr His Arg Ala Ser Asn Thr Tyr Arg Ala Ser Asn Gly 995 1000 1005 Leu Tyr Leu Tyr Ser Pro His Glu Leu Tyr Ser Gly Leu Tyr Leu 1010 1015 1020 Tyr Ser Ala Leu Ala Thr His Arg Leu Glu Thr His Arg Ala Leu 1025 1030 1035 Ala Ala Ser Pro Gly Leu Ser Glu Arg Ser Glu Arg Ser Glu Arg 1040 1045 1050 Thr His Arg Ala Leu Ala Thr Tyr Arg Met Glu Thr Gly Leu Asn 1055 1060 1065 Leu Glu Ser Glu Arg Ser Glu Arg Leu Glu Ala Leu Ala Ser Glu 1070 1075 1080 Arg Gly Leu Ala Ser Pro Ser Glu Arg Ala Leu Ala Val Ala Leu 1085 1090 1095 Thr Tyr Arg Pro His Glu Cys Tyr Ser Ala Leu Ala Ala Arg Gly 1100 1105 1110 Ala Arg Gly Gly Leu Thr His Arg Thr His Arg Thr His Arg Val 1115 1120 1125 Ala Leu Gly Leu Tyr Ala Arg Gly Thr Tyr Arg Thr Tyr Arg Thr 1130 1135 1140 Tyr Arg Ala Leu Ala Met Glu Thr Ala Ser Pro Thr Tyr Arg Thr 1145 1150 1155 Arg Pro Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Thr His Arg Ser 1160 1165 1170 Glu Arg Val Ala Leu Thr His Arg Val Ala Leu Ser Glu Arg Ser 1175 1180 1185 Glu Arg Ala Leu Ala Leu Tyr Ser Thr His Arg Thr His Arg Pro 1190 1195 1200 Arg Leu Tyr Ser Leu Glu Gly Leu Tyr Gly Leu Tyr Ala Ser Pro 1205 1210 1215 Ile Leu Glu Leu Glu Leu Glu Thr His Arg Gly Leu Asn Thr His 1220 1225 1230 Arg Pro Arg Ala Leu Ala Ser Glu Arg Leu Glu Ala Leu Ala Val 1235 1240 1245 Ala Leu Ser Glu Arg Leu Glu Gly Leu Tyr Gly Leu Asn Ala Arg 1250 1255 1260 Gly Ala Leu Ala Thr His Arg Ile Leu Glu Ser Glu Arg Cys Tyr 1265 1270 1275 Ser Leu Tyr Ser Ala Leu Ala Ser Glu Arg Gly Leu Asn Ser Glu 1280 1285 1290 Arg Val Ala Leu Ala Ser Pro Thr Tyr Arg Ala Ser Pro Gly Leu 1295 1300 1305 Tyr Ala Ser Pro Ser Glu Arg Thr Tyr Arg Leu Glu Ala Ser Asn 1310 1315 1320 Thr Arg Pro Thr Tyr Arg Gly Leu Asn Gly Leu Asn Ile Leu Glu 1325 1330 1335 Pro Arg Gly Leu Tyr Gly Leu Asn Pro Arg Pro Arg Leu Tyr Ser 1340 1345 1350 Leu Glu Leu Glu Ile Leu Glu Thr Tyr Arg Ala Ser Pro Ala Leu 1355 1360 1365 Ala Ser Glu Arg Ala Ser Asn Leu Glu Val Ala Leu Ser Glu Arg 1370 1375 1380 Gly Leu Tyr Ile Leu Glu Pro Arg Pro Arg Ala Arg Gly Pro His 1385 1390 1395 Glu Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu 1400 1405 1410 Arg Gly Leu Tyr Thr His Arg Ala Ser Pro Pro His Glu Thr His 1415 1420 1425 Arg Leu Glu Ala Ser Asn Ile Leu Glu His Ile Ser Pro Arg Val 1430 1435 1440 Ala Leu Gly Leu Leu Tyr Ser Val Ala Leu Ala Ser Pro Ala Leu 1445 1450 1455 Ala Ala Leu Ala Thr His Arg Thr Tyr Arg His Ile Ser Cys Tyr 1460 1465 1470 Ser Gly Leu Asn Gly Leu Asn Ser Glu Arg Thr His Arg Gly Leu 1475 1480 1485 Ala Ser Pro Pro Arg Thr Arg Pro Thr His Arg Pro His Glu Gly 1490 1495 1500 Leu Tyr Gly Leu Tyr Gly Leu Tyr Thr His Arg Leu Tyr Ser Leu 1505 1510 1515 Glu Gly Leu Ile Leu Glu Leu Tyr Ser Ala Arg Gly Ala Leu Ala 1520 1525 1530 Ala Ser Pro Ala Leu Ala Ala Leu Ala Ala Leu Ala Ala Leu Ala 1535 1540 1545 Gly Leu Tyr Ser Glu Arg Gly Leu Gly Leu Asn Leu Tyr Ser Leu 1550 1555 1560 Glu Ile Leu Glu Ser Glu Arg Gly Leu Gly Leu Ala Ser Pro Leu 1565 1570 1575 Glu Ala Ser Asn Ser Glu Arg His Ile Ser His Ile Ser His Ile 1580 1585 1590 Ser His Ile Ser His Ile Ser His Ile Ser 1595 1600 6 1817 DNA Artificial Plasmid 6 ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa 60 caatttcaca caggaaacag ctatgaccat gattacgaat ttctgaagaa ggagatatac 120 atatgaaata cctattgcct acggcagccg ctggcttgct gctgctggca gctcagccgg 180 ccatggcgca ggtgcaactg cagcagtctg gggctgaact ggcaagacct ggggcctcag 240 tgaagatgtc ctgcaaggct tctggctaca cctttactag gtacacgatg cactgggtaa 300 aacagaggcc tggacagggt ctggaatgga ttggatacat taatcctagc cgtggttata 360 ctaattacaa tcagaagttc aaggacaagg ccacattgac tacagacaaa tcctccagca 420 cagcctacat gcaactgagc agcctgacat ctgaggactc tgcagtctat tactgtgcaa 480 gatattatga tgatcattac agccttgact actggggcca aggcaccact ctcacagtct 540 cctcagccaa aacaacaccc aagcttgaag aaggtgaatt ttcagaagca cgcgtagata 600 tcgtgctcac tcagtctcca gcaatcatgt ctgcatctcc aggggagaag gtcaccatga 660 cctgcagtgc cagctcaagt gtaagttaca tgaactggta ccagcagaag tcaggcacct 720 cccccaaaag atggatttat gacacatcca aactggcttc tggagtccct gctcacttca 780 ggggcagtgg gtctgggacc tcttactctc tcacaatcag cggcatggag gctgaagatg 840 ctgccactta ttactgccag cagtggagta gtaacccatt cacgttcggc tcggggacaa 900 agttggaaat aaaccgggct gatactgcgg ccgctggtgg tggtggttct ggcggcggtg 960 gtagcggtgg tggcggctcc ggtggtggtg gtagccaggt gcagctgcag cagtctgggg 1020 ctgagctggt gaggcctggg tcctcagtga agatttcctg caaggcttct ggctatgcat 1080 tcagtagcta ctggatgaac tgggtgaagc agaggcctgg acagggtctt gagtggattg 1140 gacagatttg gcctggagat ggtgatacta actacaatgg aaagttcaag ggtaaagcca 1200 ctctgactgc agacgaatcc tccagcacag cctacatgca actcagcagc ctagcatctg 1260 aggactctgc ggtctatttc tgtgcaagac gggagactac gacggtaggc cgttattact 1320 atgctatgga ctactggggt caaggaacct cagtcaccgt ctcctcagcc aaaacaacac 1380 ccaagcttgg cggtgatatc ttgctcaccc aaactccagc ttctttggct gtgtctctag 1440 ggcagagggc caccatctcc tgcaaggcca gccaaagtgt tgattatgat ggtgatagtt 1500 atttgaactg gtaccaacag attccaggac agccacccaa actcctcatc tatgatgcat 1560 ccaatctagt ttctgggatc ccacccaggt ttagtggcag tgggtctggg acagacttca 1620 ccctcaacat ccatcctgtg gagaaggtgg atgctgcaac ctatcactgt cagcaaagta 1680 ctgacgatcc gtggacgttc ggtggaggca ccaagctgga aatcaaacgg gctgatgctt 1740 cggccgctgg atccgaacaa aagctgatct cagaagaaga cctaaactca catcaccatc 1800 accatcacta atctaga 1817 7 1602 PRT Artificial Plasmid 7 Met Glu Thr Leu Tyr Ser Thr Tyr Arg Leu Glu Leu Glu Pro Arg Thr 1 5 10 15 His Arg Ala Leu Ala Ala Leu Ala Ala Leu Ala Gly Leu Tyr Leu Glu 20 25 30 Leu Glu Leu Glu Leu Glu Ala Leu Ala Ala Leu Ala Gly Leu Asn Pro 35 40 45 Arg Ala Leu Ala Met Glu Thr Ala Leu Ala Gly Leu Asn Val Ala Leu 50 55 60 Gly Leu Asn Leu Glu Gly Leu Asn Gly Leu Asn Ser Glu Arg Gly Leu 65 70

75 80 Tyr Ala Leu Ala Gly Leu Leu Glu Val Ala Leu Ala Arg Gly Pro Arg 85 90 95 Gly Leu Tyr Ser Glu Arg Ser Glu Arg Val Ala Leu Leu Tyr Ser Ile 100 105 110 Leu Glu Ser Glu Arg Cys Tyr Ser Leu Tyr Ser Ala Leu Ala Ser Glu 115 120 125 Arg Gly Leu Tyr Thr Tyr Arg Ala Leu Ala Pro His Glu Ser Glu Arg 130 135 140 Ser Glu Arg Thr Tyr Arg Thr Arg Pro Met Glu Thr Ala Ser Asn Thr 145 150 155 160 Arg Pro Val Ala Leu Leu Tyr Ser Gly Leu Asn Ala Arg Gly Pro Arg 165 170 175 Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Leu Glu Gly Leu Thr Arg Pro 180 185 190 Ile Leu Glu Gly Leu Tyr Gly Leu Asn Ile Leu Glu Thr Arg Pro Pro 195 200 205 Arg Gly Leu Tyr Ala Ser Pro Gly Leu Tyr Ala Ser Pro Thr His Arg 210 215 220 Ala Ser Asn Thr Tyr Arg Ala Ser Asn Gly Leu Tyr Leu Tyr Ser Pro 225 230 235 240 His Glu Leu Tyr Ser Gly Leu Tyr Leu Tyr Ser Ala Leu Ala Thr His 245 250 255 Arg Leu Glu Thr His Arg Ala Leu Ala Ala Ser Pro Gly Leu Ser Glu 260 265 270 Arg Ser Glu Arg Ser Glu Arg Thr His Arg Ala Leu Ala Thr Tyr Arg 275 280 285 Met Glu Thr Gly Leu Asn Leu Glu Ser Glu Arg Ser Glu Arg Leu Glu 290 295 300 Ala Leu Ala Ser Glu Arg Gly Leu Ala Ser Pro Ser Glu Arg Ala Leu 305 310 315 320 Ala Val Ala Leu Thr Tyr Arg Pro His Glu Cys Tyr Ser Ala Leu Ala 325 330 335 Ala Arg Gly Ala Arg Gly Gly Leu Thr His Arg Thr His Arg Thr His 340 345 350 Arg Val Ala Leu Gly Leu Tyr Ala Arg Gly Thr Tyr Arg Thr Tyr Arg 355 360 365 Thr Tyr Arg Ala Leu Ala Met Glu Thr Ala Ser Pro Thr Tyr Arg Thr 370 375 380 Arg Pro Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Thr His Arg Ser Glu 385 390 395 400 Arg Val Ala Leu Thr His Arg Val Ala Leu Ser Glu Arg Ser Glu Arg 405 410 415 Ala Leu Ala Leu Tyr Ser Thr His Arg Thr His Arg Pro Arg Leu Tyr 420 425 430 Ser Leu Glu Gly Leu Gly Leu Gly Leu Tyr Gly Leu Pro His Glu Ser 435 440 445 Glu Arg Gly Leu Ala Leu Ala Ala Arg Gly Val Ala Leu Ala Ser Pro 450 455 460 Ile Leu Glu Leu Glu Leu Glu Thr His Arg Gly Leu Asn Thr His Arg 465 470 475 480 Pro Arg Ala Leu Ala Ser Glu Arg Leu Glu Ala Leu Ala Val Ala Leu 485 490 495 Ser Glu Arg Leu Glu Gly Leu Tyr Gly Leu Asn Ala Arg Gly Ala Leu 500 505 510 Ala Thr His Arg Ile Leu Glu Ser Glu Arg Cys Tyr Ser Leu Tyr Ser 515 520 525 Ala Leu Ala Ser Glu Arg Gly Leu Asn Ser Glu Arg Val Ala Leu Ala 530 535 540 Ser Pro Thr Tyr Arg Ala Ser Pro Gly Leu Tyr Ala Ser Pro Ser Glu 545 550 555 560 Arg Thr Tyr Arg Leu Glu Ala Ser Asn Thr Arg Pro Thr Tyr Arg Gly 565 570 575 Leu Asn Gly Leu Asn Ile Leu Glu Pro Arg Gly Leu Tyr Gly Leu Asn 580 585 590 Pro Arg Pro Arg Leu Tyr Ser Leu Glu Leu Glu Ile Leu Glu Thr Tyr 595 600 605 Arg Ala Ser Pro Ala Leu Ala Ser Glu Arg Ala Ser Asn Leu Glu Val 610 615 620 Ala Leu Ser Glu Arg Gly Leu Tyr Ile Leu Glu Pro Arg Pro Arg Ala 625 630 635 640 Arg Gly Pro His Glu Ser Glu Arg Gly Leu Tyr Ser Glu Arg Gly Leu 645 650 655 Tyr Ser Glu Arg Gly Leu Tyr Thr His Arg Ala Ser Pro Pro His Glu 660 665 670 Thr His Arg Leu Glu Ala Ser Asn Ile Leu Glu His Ile Ser Pro Arg 675 680 685 Val Ala Leu Gly Leu Leu Tyr Ser Val Ala Leu Ala Ser Pro Ala Leu 690 695 700 Ala Ala Leu Ala Thr His Arg Thr Tyr Arg His Ile Ser Cys Tyr Ser 705 710 715 720 Gly Leu Asn Gly Leu Asn Ser Glu Arg Thr His Arg Gly Leu Ala Ser 725 730 735 Pro Pro Arg Thr Arg Pro Thr His Arg Pro His Glu Gly Leu Tyr Gly 740 745 750 Leu Tyr Gly Leu Tyr Thr His Arg Leu Tyr Ser Leu Glu Gly Leu Ile 755 760 765 Leu Glu Leu Tyr Ser Ala Arg Gly Ala Leu Ala Ala Ser Pro Ala Leu 770 775 780 Ala Ala Leu Ala Ala Leu Ala Ala Leu Ala Gly Leu Tyr Gly Leu Tyr 785 790 795 800 Gly Leu Tyr Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Gly Leu Tyr Gly 805 810 815 Leu Tyr Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Gly Leu Tyr Gly Leu 820 825 830 Tyr Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Gly Leu Tyr Gly Leu Tyr 835 840 845 Gly Leu Tyr Ser Glu Arg Gly Leu Asn Val Ala Leu Gly Leu Asn Leu 850 855 860 Glu Gly Leu Asn Gly Leu Asn Ser Glu Arg Gly Leu Tyr Ala Leu Ala 865 870 875 880 Gly Leu Leu Glu Ala Leu Ala Ala Arg Gly Pro Arg Gly Leu Tyr Ala 885 890 895 Leu Ala Ser Glu Arg Val Ala Leu Leu Tyr Ser Met Glu Thr Ser Glu 900 905 910 Arg Cys Tyr Ser Leu Tyr Ser Ala Leu Ala Ser Glu Arg Gly Leu Tyr 915 920 925 Thr Tyr Arg Thr His Arg Pro His Glu Thr His Arg Ala Arg Gly Thr 930 935 940 Tyr Arg Thr His Arg Met Glu Thr His Ile Ser Thr Arg Pro Val Ala 945 950 955 960 Leu Leu Tyr Ser Gly Leu Asn Ala Arg Gly Pro Arg Gly Leu Tyr Gly 965 970 975 Leu Asn Gly Leu Tyr Leu Glu Gly Leu Thr Arg Pro Ile Leu Glu Gly 980 985 990 Leu Tyr Thr Tyr Arg Ile Leu Glu Ala Ser Asn Pro Arg Ser Glu Arg 995 1000 1005 Ala Arg Gly Gly Leu Tyr Thr Tyr Arg Thr His Arg Ala Ser Asn 1010 1015 1020 Thr Tyr Arg Ala Ser Asn Gly Leu Asn Leu Tyr Ser Pro His Glu 1025 1030 1035 Leu Tyr Ser Ala Ser Pro Leu Tyr Ser Ala Leu Ala Thr His Arg 1040 1045 1050 Leu Glu Thr His Arg Thr His Arg Ala Ser Pro Leu Tyr Ser Ser 1055 1060 1065 Glu Arg Ser Glu Arg Ser Glu Arg Thr His Arg Ala Leu Ala Thr 1070 1075 1080 Tyr Arg Met Glu Thr Gly Leu Asn Leu Glu Ser Glu Arg Ser Glu 1085 1090 1095 Arg Leu Glu Thr His Arg Ser Glu Arg Gly Leu Ala Ser Pro Ser 1100 1105 1110 Glu Arg Ala Leu Ala Val Ala Leu Thr Tyr Arg Thr Tyr Arg Cys 1115 1120 1125 Tyr Ser Ala Leu Ala Ala Arg Gly Thr Tyr Arg Thr Tyr Arg Ala 1130 1135 1140 Ser Pro Ala Ser Pro His Ile Ser Thr Tyr Arg Ser Glu Arg Leu 1145 1150 1155 Glu Ala Ser Pro Thr Tyr Arg Thr Arg Pro Gly Leu Tyr Gly Leu 1160 1165 1170 Asn Gly Leu Tyr Thr His Arg Thr His Arg Leu Glu Thr His Arg 1175 1180 1185 Val Ala Leu Ser Glu Arg Ser Glu Arg Ala Leu Ala Leu Tyr Ser 1190 1195 1200 Thr His Arg Thr His Arg Pro Arg Leu Tyr Ser Leu Glu Gly Leu 1205 1210 1215 Tyr Gly Leu Tyr Ala Ser Pro Ile Leu Glu Val Ala Leu Leu Glu 1220 1225 1230 Thr His Arg Gly Leu Asn Ser Glu Arg Pro Arg Ala Leu Ala Ile 1235 1240 1245 Leu Glu Met Glu Thr Ser Glu Arg Ala Leu Ala Ser Glu Arg Pro 1250 1255 1260 Arg Gly Leu Tyr Gly Leu Leu Tyr Ser Val Ala Leu Thr His Arg 1265 1270 1275 Met Glu Thr Thr His Arg Cys Tyr Ser Ser Glu Arg Ala Leu Ala 1280 1285 1290 Ser Glu Arg Ser Glu Arg Ser Glu Arg Val Ala Leu Ser Glu Arg 1295 1300 1305 Thr Tyr Arg Met Glu Thr Ala Ser Asn Thr Arg Pro Thr Tyr Arg 1310 1315 1320 Gly Leu Asn Gly Leu Asn Leu Tyr Ser Ser Glu Arg Gly Leu Tyr 1325 1330 1335 Thr His Arg Ser Glu Arg Pro Arg Leu Tyr Ser Ala Arg Gly Thr 1340 1345 1350 Arg Pro Ile Leu Glu Thr Tyr Arg Ala Ser Pro Thr His Arg Ser 1355 1360 1365 Glu Arg Leu Tyr Ser Leu Glu Ala Leu Ala Ser Glu Arg Gly Leu 1370 1375 1380 Tyr Val Ala Leu Pro Arg Ala Leu Ala His Ile Ser Pro His Glu 1385 1390 1395 Ala Arg Gly Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu Arg 1400 1405 1410 Gly Leu Tyr Thr His Arg Ser Glu Arg Thr Tyr Arg Ser Glu Arg 1415 1420 1425 Leu Glu Thr His Arg Ile Leu Glu Ser Glu Arg Gly Leu Tyr Met 1430 1435 1440 Glu Thr Gly Leu Ala Leu Ala Gly Leu Ala Ser Pro Ala Leu Ala 1445 1450 1455 Ala Leu Ala Thr His Arg Thr Tyr Arg Thr Tyr Arg Cys Tyr Ser 1460 1465 1470 Gly Leu Asn Gly Leu Asn Thr Arg Pro Ser Glu Arg Ser Glu Arg 1475 1480 1485 Ala Ser Asn Pro Arg Pro His Glu Thr His Arg Pro His Glu Gly 1490 1495 1500 Leu Tyr Ser Glu Arg Gly Leu Tyr Thr His Arg Leu Tyr Ser Leu 1505 1510 1515 Glu Gly Leu Ile Leu Glu Ala Ser Asn Ala Arg Gly Ala Leu Ala 1520 1525 1530 Ala Ser Pro Thr His Arg Ala Leu Ala Pro Arg Thr His Arg Gly 1535 1540 1545 Leu Tyr Ser Glu Arg Gly Leu Gly Leu Asn Leu Tyr Ser Leu Glu 1550 1555 1560 Ile Leu Glu Ser Glu Arg Gly Leu Gly Leu Ala Ser Pro Leu Glu 1565 1570 1575 Ala Ser Asn Ser Glu Arg His Ile Ser His Ile Ser His Ile Ser 1580 1585 1590 His Ile Ser His Ile Ser His Ile Ser 1595 1600 8 20 PRT Artificial linker sequence 8 Ala Arg Gly Thr His Arg Val Ala Leu Ala Leu Ala Ala Leu Ala Pro 1 5 10 15 Arg Ser Glu Arg 20 9 23 PRT Artificial Amino acid linker peptide 9 Ala Leu Ala Ala Leu Ala Ala Leu Ala Gly Leu Tyr Gly Leu Tyr Pro 1 5 10 15 Arg Gly Leu Tyr Ser Glu Arg 20 10 26 PRT Artificial linker sequence 10 Ser Glu Arg Ala Leu Ala Ala Leu Ala Ala Leu Ala Gly Leu Tyr Gly 1 5 10 15 Leu Tyr Pro Arg Gly Leu Tyr Ser Glu Arg 20 25 11 6844 DNA Artificial plasmid 11 acccgacacc atcgaatggc gcaaaacctt tcgcggtatg gcatgatagc gcccggaaga 60 gagtcaattc agggtggtga atgtgaaacc agtaacgtta tacgatgtcg cagagtatgc 120 cggtgtctct tatcagaccg tttcccgcgt ggtgaaccag gccagccacg tttctgcgaa 180 aacgcgggaa aaagtggaag cggcgatggc ggagctgaat tacattccca accgggtggc 240 acaacaactg gcgggcaaac agtcgttgct gattggcgtt gccacctcca gtctggccct 300 gcacgcgccg tcgcaaattg tcgcggcgat taaatctcgc gccgatcaac tgggtgccag 360 cgtggtggtg tcgatggtag aacgaagcgg cgtcgaagcc tgtaaagcgg cggtgcacaa 420 tcttctcgcg caacgcgtca gtgggctgat cattaactat ccgctggatg accaggatgc 480 cattgctgtg gaagctgcct gcactaatgt tccggcgtta tttcttgatg tctctgacca 540 gacacccatc aacagtatta ttttctccca tgaagacggt acgcgactgg gcgtggagca 600 tctggtcgca ttgggtcacc agcaaatcgc gctgttagcg ggcccattaa gttctgtctc 660 ggcgcgtctg cgtctggctg gctggcataa atatctcact cgcaatcaaa ttcagccgat 720 agcggaacgg gaaggcgact ggagtgccat gtccggtttt caacaaacca tgcaaatgct 780 gaatgagggc atcgttccca ctgcgatgct ggttgccaac gatcagatgg cgctgggcgc 840 aatgcgcgcc attaccgagt ccgggctgcg cgttggtgcg gatatctcgg tagtgggata 900 cgacgatacc gaagacagct catgttatat cccgccgtta accaccatca aacaggattt 960 tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa ctctctcagg gccaggcggt 1020 gaagggcaat cagctgttgc ccgtctcact ggtgaaaaga aaaaccaccc tggcgcccaa 1080 tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctgg cacgacaggt 1140 ttcccgactg gaaagcgggc agtgagcggt acccgataaa agcggcttcc tgacaggagg 1200 ccgttttgtt ttgcagccca cctcaacgca attaatgtga gttagctcac tcattaggca 1260 ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa 1320 caatttcaca caggaaacag ctatgaccat gattacgaat ttctgaagaa ggagatatac 1380 atatgaaata cctattgcct acggcagccg ctggcttgct gctgctggca gctcagccgg 1440 ccatggcgga tatcttgctc acccaaactc cagcttcttt ggctgtgtct ctagggcaga 1500 gggccaccat ctcctgcaag gccagccaaa gtgttgatta tgatggtgat agttatttga 1560 actggtacca acagattcca ggacagccac ccaaactcct catctatgat gcatccaatc 1620 tagtttctgg gatcccaccc aggtttagtg gcagtgggtc tgggacagac ttcaccctca 1680 acatccatcc tgtggagaag gtggatgctg caacctatca ctgtcagcaa agtactgagg 1740 atccgtggac gttcggtgga ggcaccaagc tggaaatcaa acgtactgtt gctgcaccgt 1800 ctcaggtgca actgcagcag tctggggctg agctggtgag gcctgggtcc tcagtgaaga 1860 tttcctgcaa ggcttctggc tatgcattca gtagctactg gatgaactgg gtgaagcaga 1920 ggcctggaca gggtcttgag tggattggac agatttggcc tggagatggt gatactaact 1980 acaatggaaa gttcaagggt aaagccactc tgactgcaga cgaatcctcc agcacagcct 2040 acatgcaact cagcagccta gcatctgagg actctgcggt ctatttctgt gcaagacggg 2100 agactacgac ggtaggccgt tattactatg ctatggacta ctggggtcaa ggaacctcag 2160 tcaccgtctc ctcagccaaa acaacacccc aggtgcagct gcagcagtct ggggctgaac 2220 tggcaagacc tggggcctca gtgaagatgt cctgcaaggc ttctggctac acctttacta 2280 ggtacacgat gcactgggta aaacagaggc ctggacaggg tctggaatgg attggataca 2340 ttaatcctag ccgtggttat actaattaca atcagaagtt caaggacaag gccacattga 2400 ctacagacaa atcctccagc acagcctaca tgcaactgag cagcctgaca tctgaggact 2460 ctgcagtcta ttactgtgca agatattatg atgatcatta cagccttgac tactggggcc 2520 aaggcaccac tctcacagtc tcctcagcca aaacaacacc caagcttggc ggtgatatcg 2580 tgctcactca gtctccagca atcatgtctg catctccagg ggagaaggtc accatgacct 2640 gcagtgccag ctcaagtgta agttacatga actggtacca gcagaagtca ggcacctccc 2700 ccaaaagatg gatttatgac acatccaaac tggcttctgg agtccctgct cacttcaggg 2760 gcagtgggtc tgggacctct tactctctca caatcagcgg catggaggct gaagatgctg 2820 ccacttatta ctgccagcag tggagtagta acccattcac gttcggctcg gggacaaagt 2880 tggaaataaa ccgggctgat actgcggccg ctggatccca tcaccatcac catcactaat 2940 ctagaggcct gtgctaactt aagaaggaga tatacatatg aaaaagtggt tattagctgc 3000 aggtctcggt ttagcactgg caacttctgc tcaggcggct gacaaaattg caatcgtcaa 3060 catgggcagc ctgttccagc aggtagcgca gaaaaccggt gtttctaaca cgctggaaaa 3120 tgagttcaaa ggccgtgcca gcgaactgca gcgtatggaa accgatctgc aggctaaaat 3180 gaaaaagctg cagtccatga aagcgggcag cgatcgcact aagctggaaa aagacgtgat 3240 ggctcagcgc cagacttttg ctcagaaagc gcaggctttt gagcaggatc gcgcacgtcg 3300 ttccaacgaa gaacgcggca aactggttac tcgtatccag actgctgtga aacccgttgc 3360 caacagccag gatatcgatc tggttgttga tgcaaacgcc gttgcttaca acagcagcga 3420 tgtaaaagac atcactgtcg acgtactgaa acaggttaaa taatgctcga ggaactgctg 3480 aaacatctga aggagctgct taaaggtgag ttctgataag cttgacctgt gaagtgaaaa 3540 atggcgcaca ttgtgcgaca ttttttttgt ctgccgttta ccgctactgc gtcacggatc 3600 cggccgaaca aactccggga ggcagcgtga tgcggcaaca atcacacgga tttcccgtga 3660 acggtctgaa tgagcggatt attttcaggg aaagtgagtg tggtcagcgt gcaggtatat 3720 gggctatgat gtgcccggcg cttgaggctt tctgcctcat gacgtgaagg tggtttgttg 3780 ccgtgttgtg tggcagaaag aagatagccc cgtagtaagt taattttcat taaccaccac 3840 gaggcatccc tatgtctagt ccacatcagg atagcctctt accgcgcttt gcgcaaggag 3900 aagaaggcca tgaaactacc acgaagttcc cttgtctggt gtgtgttgat cgtgtgtctc 3960 acactgttga tattcactta tctgacacga aaatcgctgt gcgagattcg ttacagagac 4020 ggacacaggg aggtggcggc tttcatggct tacgaatccg gtaagtagca acctagaggc 4080 gggcgcaggc ccgccttttc aggactgatg ctggtctgac tactgaagcg cctttataaa 4140 ggggctgctg gttcgccggt agcccctttc tccttgctga tgttgtggga atttcgagca 4200 agacgtttcc cgttgaatat ggctcataac accccttgta ttactgttta tgtaagcaga 4260 cagttttatt gttcatgatg atatattttt atcttgtgca atgtaacatc agagattttg 4320 agacacaacg tggctttccc ccccccccct gcaggggggg gggggcgctg aggtctgcct 4380 cgtgaagaag gtgttgctga ctcataccag gcctgaatcg ccccatcatc cagccagaaa 4440 gtgagggagc cacggttgat gagagctttg ttgtaggtgg accagttggt gattttgaac 4500 ttttgctttg ccacggaacg gtctgcgttg tcgggaagat gcgtgatctg gggatcccca 4560 cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc 4620 tacacttgcc agcgccctag cgcccgctcc tttcgctttc ttcccttcct ttctcgccac 4680 gttcgccggc tttccccgtc aagctctaaa tcggggcatc cctttagggt tccgatttag 4740 tgctttacgg cacctcgacc ccaaaaaact tgattagggt gatggttcac gtagtgggcc 4800 atcgccctga tagacggttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg 4860 actcttgttc caaactggaa caacactcaa ccctatctcg gtctattctt ttgatttata 4920 agggattttg ccgatttcgg cctattggtt aaaaaatgag ctgatttaac aaaaatttaa 4980 cgcgaatttt aacaaaatat taacgtttac aatttcaggt

ggcgaattcc ccggggaatt 5040 cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa 5100 tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa 5160 gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct 5220 tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg 5280 tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg 5340 ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt 5400 atcccctatt gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga 5460 cttggttgag tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga 5520 attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac 5580 gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg 5640 ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac 5700 gatgcctgta gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct 5760 agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct 5820 gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg 5880 gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat 5940 ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg 6000 tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat 6060 tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct 6120 catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 6180 gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 6240 aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 6300 gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta 6360 gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 6420 gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 6480 atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 6540 cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 6600 cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 6660 agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 6720 tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 6780 gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 6840 catg 6844 12 1422 PRT Artificial plasmid 12 Ala Ser Pro Ile Leu Glu Leu Glu Leu Glu Thr His Arg Gly Leu Asn 1 5 10 15 Thr His Arg Pro Arg Ala Leu Ala Ser Glu Arg Leu Glu Ala Leu Ala 20 25 30 Val Ala Leu Ser Glu Arg Leu Glu Gly Leu Tyr Gly Leu Asn Ala Arg 35 40 45 Gly Ala Leu Ala Thr His Arg Ile Leu Glu Ser Glu Arg Cys Tyr Ser 50 55 60 Leu Tyr Ser Ala Leu Ala Ser Glu Arg Gly Leu Asn Ser Glu Arg Val 65 70 75 80 Ala Leu Ala Ser Pro Thr Tyr Arg Ala Ser Pro Gly Leu Tyr Ala Ser 85 90 95 Pro Ser Glu Arg Thr Tyr Arg Leu Glu Ala Ser Asn Thr Arg Pro Thr 100 105 110 Tyr Arg Gly Leu Asn Gly Leu Asn Ile Leu Glu Pro Arg Gly Leu Tyr 115 120 125 Gly Leu Asn Pro Arg Pro Arg Leu Tyr Ser Leu Glu Leu Glu Ile Leu 130 135 140 Glu Thr Tyr Arg Ala Ser Pro Ala Leu Ala Ser Glu Arg Ala Ser Asn 145 150 155 160 Leu Glu Val Ala Leu Ser Glu Arg Gly Leu Tyr Ile Leu Glu Pro Arg 165 170 175 Pro Arg Ala Arg Gly Pro His Glu Ser Glu Arg Gly Leu Tyr Ser Glu 180 185 190 Arg Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Thr His Arg Ala Ser Pro 195 200 205 Pro His Glu Thr His Arg Leu Glu Ala Ser Asn Ile Leu Glu His Ile 210 215 220 Ser Pro Arg Val Ala Leu Gly Leu Leu Tyr Ser Val Ala Leu Ala Ser 225 230 235 240 Pro Ala Leu Ala Ala Leu Ala Thr His Arg Thr Tyr Arg His Ile Ser 245 250 255 Cys Tyr Ser Gly Leu Asn Gly Leu Asn Ser Glu Arg Thr His Arg Gly 260 265 270 Leu Ala Ser Pro Pro Arg Thr Arg Pro Thr His Arg Pro His Glu Gly 275 280 285 Leu Tyr Gly Leu Tyr Gly Leu Tyr Thr His Arg Leu Tyr Ser Leu Glu 290 295 300 Gly Leu Ile Leu Glu Leu Tyr Ser Ala Arg Gly Thr His Arg Val Ala 305 310 315 320 Leu Ala Leu Ala Ala Leu Ala Pro Arg Ser Glu Arg Gly Leu Asn Val 325 330 335 Ala Leu Gly Leu Asn Leu Glu Gly Leu Asn Gly Leu Asn Ser Glu Arg 340 345 350 Gly Leu Tyr Ala Leu Ala Gly Leu Leu Glu Val Ala Leu Ala Arg Gly 355 360 365 Pro Arg Gly Leu Tyr Ser Glu Arg Ser Glu Arg Val Ala Leu Leu Tyr 370 375 380 Ser Ile Leu Glu Ser Glu Arg Cys Tyr Ser Leu Tyr Ser Ala Leu Ala 385 390 395 400 Ser Glu Arg Gly Leu Tyr Thr Tyr Arg Ala Leu Ala Pro His Glu Ser 405 410 415 Glu Arg Ser Glu Arg Thr Tyr Arg Thr Arg Pro Met Glu Thr Ala Ser 420 425 430 Asn Thr Arg Pro Val Ala Leu Leu Tyr Ser Gly Leu Asn Ala Arg Gly 435 440 445 Pro Arg Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Leu Glu Gly Leu Thr 450 455 460 Arg Pro Ile Leu Glu Gly Leu Tyr Gly Leu Asn Ile Leu Glu Thr Arg 465 470 475 480 Pro Pro Arg Gly Leu Tyr Ala Ser Pro Gly Leu Tyr Ala Ser Pro Thr 485 490 495 His Arg Ala Ser Asn Thr Tyr Arg Ala Ser Asn Gly Leu Tyr Leu Tyr 500 505 510 Ser Pro His Glu Leu Tyr Ser Gly Leu Tyr Leu Tyr Ser Ala Leu Ala 515 520 525 Thr His Arg Leu Glu Thr His Arg Ala Leu Ala Ala Ser Pro Gly Leu 530 535 540 Ser Glu Arg Ser Glu Arg Ser Glu Arg Thr His Arg Ala Leu Ala Thr 545 550 555 560 Tyr Arg Met Glu Thr Gly Leu Asn Leu Glu Ser Glu Arg Ser Glu Arg 565 570 575 Leu Glu Ala Leu Ala Ser Glu Arg Gly Leu Ala Ser Pro Ser Glu Arg 580 585 590 Ala Leu Ala Val Ala Leu Thr Tyr Arg Pro His Glu Cys Tyr Ser Ala 595 600 605 Leu Ala Ala Arg Gly Ala Arg Gly Gly Leu Thr His Arg Thr His Arg 610 615 620 Thr His Arg Val Ala Leu Gly Leu Tyr Ala Arg Gly Thr Tyr Arg Thr 625 630 635 640 Tyr Arg Thr Tyr Arg Ala Leu Ala Met Glu Thr Ala Ser Pro Thr Tyr 645 650 655 Arg Thr Arg Pro Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Thr His Arg 660 665 670 Ser Glu Arg Val Ala Leu Thr His Arg Val Ala Leu Ser Glu Arg Ser 675 680 685 Glu Arg Ala Leu Ala Leu Tyr Ser Thr His Arg Thr His Arg Pro Arg 690 695 700 Gly Leu Asn Val Ala Leu Gly Leu Asn Leu Glu Gly Leu Asn Gly Leu 705 710 715 720 Asn Ser Glu Arg Gly Leu Tyr Ala Leu Ala Gly Leu Leu Glu Ala Leu 725 730 735 Ala Ala Arg Gly Pro Arg Gly Leu Tyr Ala Leu Ala Ser Glu Arg Val 740 745 750 Ala Leu Leu Tyr Ser Met Glu Thr Ser Glu Arg Cys Tyr Ser Leu Tyr 755 760 765 Ser Ala Leu Ala Ser Glu Arg Gly Leu Tyr Thr Tyr Arg Thr His Arg 770 775 780 Pro His Glu Thr His Arg Ala Arg Gly Thr Tyr Arg Thr His Arg Met 785 790 795 800 Glu Thr His Ile Ser Thr Arg Pro Val Ala Leu Leu Tyr Ser Gly Leu 805 810 815 Asn Ala Arg Gly Pro Arg Gly Leu Tyr Gly Leu Asn Gly Leu Tyr Leu 820 825 830 Glu Gly Leu Thr Arg Pro Ile Leu Glu Gly Leu Tyr Thr Tyr Arg Ile 835 840 845 Leu Glu Ala Ser Asn Pro Arg Ser Glu Arg Ala Arg Gly Gly Leu Tyr 850 855 860 Thr Tyr Arg Thr His Arg Ala Ser Asn Thr Tyr Arg Ala Ser Asn Gly 865 870 875 880 Leu Asn Leu Tyr Ser Pro His Glu Leu Tyr Ser Ala Ser Pro Leu Tyr 885 890 895 Ser Ala Leu Ala Thr His Arg Leu Glu Thr His Arg Thr His Arg Ala 900 905 910 Ser Pro Leu Tyr Ser Ser Glu Arg Ser Glu Arg Ser Glu Arg Thr His 915 920 925 Arg Ala Leu Ala Thr Tyr Arg Met Glu Thr Gly Leu Asn Leu Glu Ser 930 935 940 Glu Arg Ser Glu Arg Leu Glu Thr His Arg Ser Glu Arg Gly Leu Ala 945 950 955 960 Ser Pro Ser Glu Arg Ala Leu Ala Val Ala Leu Thr Tyr Arg Thr Tyr 965 970 975 Arg Cys Tyr Ser Ala Leu Ala Ala Arg Gly Thr Tyr Arg Thr Tyr Arg 980 985 990 Ala Ser Pro Ala Ser Pro His Ile Ser Thr Tyr Arg Ser Glu Arg Leu 995 1000 1005 Glu Ala Ser Pro Thr Tyr Arg Thr Arg Pro Gly Leu Tyr Gly Leu 1010 1015 1020 Asn Gly Leu Tyr Thr His Arg Thr His Arg Leu Glu Thr His Arg 1025 1030 1035 Val Ala Leu Ser Glu Arg Ser Glu Arg Ala Leu Ala Leu Tyr Ser 1040 1045 1050 Thr His Arg Thr His Arg Pro Arg Leu Tyr Ser Leu Glu Gly Leu 1055 1060 1065 Tyr Gly Leu Tyr Ala Ser Pro Ile Leu Glu Val Ala Leu Leu Glu 1070 1075 1080 Thr His Arg Gly Leu Asn Ser Glu Arg Pro Arg Ala Leu Ala Ile 1085 1090 1095 Leu Glu Met Glu Thr Ser Glu Arg Ala Leu Ala Ser Glu Arg Pro 1100 1105 1110 Arg Gly Leu Tyr Gly Leu Leu Tyr Ser Val Ala Leu Thr His Arg 1115 1120 1125 Met Glu Thr Thr His Arg Cys Tyr Ser Ser Glu Arg Ala Leu Ala 1130 1135 1140 Ser Glu Arg Ser Glu Arg Ser Glu Arg Val Ala Leu Ser Glu Arg 1145 1150 1155 Thr Tyr Arg Met Glu Thr Ala Ser Asn Thr Arg Pro Thr Tyr Arg 1160 1165 1170 Gly Leu Asn Gly Leu Asn Leu Tyr Ser Ser Glu Arg Gly Leu Tyr 1175 1180 1185 Thr His Arg Ser Glu Arg Pro Arg Leu Tyr Ser Ala Arg Gly Thr 1190 1195 1200 Arg Pro Ile Leu Glu Thr Tyr Arg Ala Ser Pro Thr His Arg Ser 1205 1210 1215 Glu Arg Leu Tyr Ser Leu Glu Ala Leu Ala Ser Glu Arg Gly Leu 1220 1225 1230 Tyr Val Ala Leu Pro Arg Ala Leu Ala His Ile Ser Pro His Glu 1235 1240 1245 Ala Arg Gly Gly Leu Tyr Ser Glu Arg Gly Leu Tyr Ser Glu Arg 1250 1255 1260 Gly Leu Tyr Thr His Arg Ser Glu Arg Thr Tyr Arg Ser Glu Arg 1265 1270 1275 Leu Glu Thr His Arg Ile Leu Glu Ser Glu Arg Gly Leu Tyr Met 1280 1285 1290 Glu Thr Gly Leu Ala Leu Ala Gly Leu Ala Ser Pro Ala Leu Ala 1295 1300 1305 Ala Leu Ala Thr His Arg Thr Tyr Arg Thr Tyr Arg Cys Tyr Ser 1310 1315 1320 Gly Leu Asn Gly Leu Asn Thr Arg Pro Ser Glu Arg Ser Glu Arg 1325 1330 1335 Ala Ser Asn Pro Arg Pro His Glu Thr His Arg Pro His Glu Gly 1340 1345 1350 Leu Tyr Ser Glu Arg Gly Leu Tyr Thr His Arg Leu Tyr Ser Leu 1355 1360 1365 Glu Gly Leu Ile Leu Glu Ala Ser Asn Ala Arg Gly Ala Leu Ala 1370 1375 1380 Ala Ser Pro Thr His Arg Ala Leu Ala Ala Leu Ala Ala Leu Ala 1385 1390 1395 Gly Leu Tyr Ser Glu Arg His Ile Ser His Ile Ser His Ile Ser 1400 1405 1410 His Ile Ser His Ile Ser His Ile Ser 1415 1420 13 17 PRT Artificial linker sequence 13 Ser Glu Arg Ala Leu Ala Leu Tyr Ser Thr His Arg Thr His Arg Pro 1 5 10 15 Arg 14 32 DNA Artificial primer 14 gatatacata tgaaatacct attgcctacg gc 32 15 47 DNA Artificial primer 15 cgaattctta agttagcaca ggcctctaga gacacacaga tctttag 47 16 28 DNA Artificial primer 16 caccctggcg cccaatacgc aaaccgcc 28 17 46 DNA Artificial primer 17 ggtatttcat atgtatatct ccttcttcag aaattcgtaa tcatgg 46 18 52 DNA Artificial primer 18 cgaattctta agaaggagat atacatatga aaaagtggtt attagctgca gg 52 19 40 DNA Artificial primer 19 cgaattctcg agcattattt aacctgtttc agtacgtcgg 40 20 41 DNA Artificial primer 20 cagccggcca tggcggatat cttgctcacc caaactccag c 41 21 34 DNA Artificial primer 21 agacggtgca gcaacagtac gtttgatttc cagc 34 22 41 DNA Artificial primer 22 cgtactgttg ctgcaccgtc tcaggtgcaa ctgcagcagt c 41 23 45 DNA Artificial primer 23 gaagatggat ccagcggccg ctgaggagac ggtgactgag gttcc 45 24 32 DNA Artificial primer 24 gatatacata tgaaatacct attgcctacg gc 32 25 47 DNA Artificial primer 25 cgaattctta agttagcaca ggcctctaga gacacacaga tctttag 47 26 35 DNA Artificial primer 26 caggcctcta gattagtgat ggtgatggtg atggg 35 27 35 DNA Artificial primer 27 ccggccatgg cgcaggtgca gctgcagcag tctgg 35 28 21 DNA Artificial primer 28 gctgcccatg ttgacgattg c 21 29 33 DNA Artificial primer 29 cagccggcca tggcgcaggt gcaactgcag cag 33 30 36 DNA Artificial primer 30 gaagatggat ccagcggccg cagtatcagc ccggtt 36 31 42 DNA Artificial primer 31 tcacacagaa ttcttagatc tattaaagag gagaaattaa cc 42 32 40 DNA Artificial primer 32 agcacacgat atcaccgcca agcttgggtg ttgttttggc 40 33 40 DNA Artificial primer 33 ctgctgcagc tgcacctggg gtgttgtttt ggctgaggag 40

Claims

1. A multimeric structure comprising two or more identical protein monomers, characterized by the following features: (a) the monomers of said structure comprise at least four variable domains of which the first or last two variable domains of which the first or last two variable domains form an antigen-binding VH-VL or VL-VH scFv unit wherein two variable domains are linked by a peptide linker of at least 5 amino acid residues which does not prevent the intramolecular formation of a scFv; (b) the other two neighboring variable domains of the monomer are non-covalently bound to the complementary domains of another monomer resulting in the formation of at least two additional antigen binding sites to form the multimerisation motif.

2. The multimeric structure of claim 1, in form of a multimeric Fv-antibody, having the following features: (a) the monomers of said Fv-antibody comprise at least four variable domains of which the first or last two variable domains are linked by a peptide linker of 5 to 30 acid residues, which does not prevent the intramolecular formation of a scFv. (b) the other two neighboring variable domains of the monomer are non-covalently bound to two complementary variable domains of another monomer resulting in the formation of at least two additional antigen binding sites to form a multimerization motif, wherein said two variable domains are linked by a peptide linker of a maximum of 12 amino aid residues.

3. The multimeric Fv-antibody of claim 2, wherein a further feature is that the antigen-binding V.sub.H-V.sub.L or V.sub.L-V.sub.H scFv unit formed by the two neighboring domains of one monomer is linked to the other variable domains of the multimerization motif by a peptide linker of 5 to 30 amino acid residues.

4. The mutlimeric structure of claim 1, wherein said monomers comprise four variable domains and wherein the third and fourth variable domains of said one end of the monomers are linked by a peptide linker, said peptide linker having 12 or less amino acid residues.

5. The mutlimeric structure of claim 1, wherein said monomers comprise four variable domains and wherein the first and second variable domains of said one end of the monomers are linked by a peptide linker, said peptide linker having 12 or less amino residues.

6. The multimeric structure of claim 2, wherein the second and third variable domain of the monomers are linked by a peptide linker consisting of 5 to 30 amino acid residues.

7. The multimeric structure of claim 1, wherein any variable domain of the monomers is shortened by at least one amino acid residue at their N- and/or C-terminus.

8. The multimeric structure of claim 1, wherein the order of domains of a monomer is V.sub.H-V.sub.L-V.sub.H-V.sub.L, V.sub.L-V.sub.H-V.sub.H-V.sub- .L, V.sub.H-V.sub.L-V.sub.L-V.sub.H or V.sub.L-V.sub.H-V.sub.L-V.sub.H.

9. The multimeric structure of claim 1, wherein the non-covalent binding of at least one pair of variable domains is strengthened by at least one disulfide bridge.

10. The multimeric structure of claim 1, which is a tetravalent dimer, hexavalent trimer or octavalent tetramer.

11. The multimeric structure of claim 1, which is a bisepcific, of trispecific or tetraspecific antibody.

12. The multimeric structure of claim 1, wherein at least one monomer is linked to a biologically active substance, a chemical agent, a peptide, a protein or a drug.

13. The multimeric structure of claim 1, which is a monospecific antibody capable of specifically binding the CD19 antigen of B-lymphocytes or the CEA antigen.

14. The multimeric structure of claim 1, which is a bispecific antibody capable of specifically bi9dning: (a) CD19 and the CD3 complex of the T-cell receptor; (b) CD19 and the CD5 complex of the T-cell receptor; (c) CD19 and the CD28 antigen on T-lymphocytes; (d) CD19 and the CD16 on natural killer cells, macrophages and activated monocytes; (e) CEA and CD3; (f) CEA and CE28; or (g) CEA and CDE16.

15. A process for the preparation of a multimeric structure of claim 1, wherein (a) DNA sequences encoding the peptide linkers are ligated with the DNA sequences encoding the variable domains such that the peptide linkers connect the variable domains resulting in the formation of a DNA sequence encoding a monomer of the multivalent multimeric structure and (b) the DNA sequences encoding the various monomers are expressed in a suitable expression system.

16. A DNA sequence encoding a multimeric structure of claim 1.

17. An expression vector containing the DNA sequence of claim 16.

18. The expression vector of claim 17, which is pSKK2-scFv.sub.L18anti-CD3- -LL-scFv.sub.L10anti-CD19 (pSKK2-scFv3LL Db19) (DSM 14470) or psKK2-scFv.sub.L18antiCD19-LL-scFv.sub.L10anti-CD3(pSKK2-scFv19LL Db3) (DSM 14471).

19. A host cell containing the expression vector of claim 17.

20. A pharmaceutical composition comprising a dimeric or multimeric structure of claim 1.

21. Use of a dimeric or multimeric structure of claim 1 for diagnosis.

22. Use of a dimeric or multimeric structure of claim 1 for the preparation of a pharmaceutical composition for (a) the treatment of a viral, bacterial, tumoral or prion related disease, (b) the agglutination of red blood cells, (c) linking cytotoxic cells of the immune system to tumor cells, or (d) linking activating cytokines, cytotoxic substances or a protease to a target cell.

23. A diagnostic kit comprising a multimeric structure of claim 1.

24. A pharmaceutical composition comprising a DNA sequence of claim 17.

25. A pharmaceutical composition comprising an expression vector of claim 18.