Novel modified nucleic acid sequences and methods for increasing mRNA levels and protein expression in cell systems

Abstract

The invention provides modified recombinant nucleic acid sequences (preferably DNA) and methods for increasing the mRNA levels and protein expression of proteins which are known to be, or are likely to be, difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic animals. The preferred "difficult" protein candidates for expression using the recombinant techniques of the invention are those proteins derived from heterologous cells preferably those of lower organisms such as parasites, bacteria, and virus, having DNA coding sequences comprising high overall AT content or AT rich regions and/or mRNA instability motifs and/or rare codons relative to the recombinant expression system to be used.

Description

BACKGROUND OF THE INVENTION

[0001] 1. Field of the Invention

[0002] The invention relates to heterologous gene expression. More particularly, the invention relates to the expression of microbial or parasitic organism genes in higher eukaryote cell systems.

[0003] 2. Summary of the Related Art

[0004] Recombinant production of certain heterologous gene products is often difficult in in vitro cell culture systems or in vivo recombinant production systems. For example, many researchers have found it difficult to express proteins derived from bacteria, parasites and virus in cell culture systems different from the cell from which the protein was originally derived, and particularly in mammalian cell culture systems. One example of a therapeutically important protein which has been difficult to produce by mammalian cells is the malaria merozoite surface protein (MSP-1).

[0005] Malaria is a serious heath problem in tropical countries. Resistance to existing drugs is fast developing and a vaccine is urgently needed. Of the number of antigens that get expressed during the life cycle of P. falciparum, MSP-1 is the most extensively studied and promises to be the most successful candidate for vaccination. Individuals exposed to P. falciparum develop antibodies against MSP-1, and studies have shown that there is a correlation between a naturally acquired immune response to MSP-1 and reduced malaria morbidity. In a number of studies, immunization with purified native MSP-1 or recombinant fragments of the protein has induced at least partial protection from the parasite (Diggs et al, (1993) Parasitol. Today, 9:300-302). Thus MSP-1 is an important target for the development of a vaccine against P. falciparum.

[0006] MSP-1 is a 190-220 kDA glycoprotein. The C-terminal region has been the focus of recombinant production for use as a vaccine. However, a major problem in developing MSP-1 as a vaccine is the difficulty in obtaining recombinant proteins in bacterial or yeast expression systems that are equivalent in immunological potency to the affinity purified native protein (Chang et al., (1992) J. Immunol. 148:548-555.) and in large enough quantities to make vaccine production feasible.

[0007] Improved procedures for enhancing expression of sufficient quantities of proteins derived from parasite, bacterial and viral organisms which have previously been difficult to produce recombinantly would be advantageous. In particular, a recombinant system capable of expressing MSP-1 in sufficient quantities would be particularly advantageous.

BRIEF SUMMARY OF THE INVENTION

[0008] The present invention provides improved recombinant DNA compositions and procedures for increasing the mRNA levels and protein expression of proteins derived from heterologous cells, preferably those of lower organisms such as bacteria, virus, and parasite, which have previously been difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic mammals. The preferred protein candidates for expression in an expression system in accordance with the invention are those proteins having DNA coding sequences comprising high overall AT content or AT rich regions, and/or mRNA instability motifs and/or rare codons relative to the recombinant expression systems.

[0009] In a first aspect, the invention features a modified known nucleic acid, preferably a gene from a bacterium, virus or parasite, capable of being expressed in a system, wherein the modification comprises a reduced AT content, relative to the unmodified sequence, and optionally further comprises elimination of at least one or all mRNA instability motifs present in the natural gene. In certain preferred embodiments the modification further comprises replacement of one or more codons of the natural gene with preferred codons of the cell system.

[0010] In a second aspect, the invention provides a process for preparing a modified nucleic acid of the invention comprising the steps of lowering the overall AT content of the natural gene encoding the protein, and/or eliminating at least one or all mRNA instability motifs and/or replacing one or more codons with a preferred codon of the cell system of choice, all by replacing one or more codons in the natural gene with codons recognizable to, and preferably with codons preferred by the cell system of choice and which code for the same amino acids as the replaced codon. This aspect of the invention further includes modified nucleic acids prepared according to the process of the invention.

[0011] In a third aspect, the invention also provides vectors comprising nucleic acids of the invention and promoters active in the cell line or organism of choice, and host cells transformed with nucleic acids of the invention.

[0012] In a fourth aspect, he invention provides transgenic expression vectors for the production of transgenic lactating animals comprising nucleic acids of the invention as well as transgenic non-human lactating animals whose germlines comprise a nucleic acid of the invention.

[0013] In a fifth aspect, he invention provides a transgenic expression vector for production of a transgenic lactating animal species comprising a nucleic acid of the invention, a promoter operatively coupled to the nucleic acid which directs mammary gland expression of the protein encoded by the nucleic acid into the milk of the transgenic animal.

[0014] In a sixth aspect, the invention provides a DNA vaccine comprising a modified nucleic acid according to the invention. A preferred embodiment of this aspect of the invention comprises a fragment of a modified MSP-1 gene according to the invention.

DESCRIPTION OF THE DRAWINGS

[0015] FIG. 1 depicts the cDNA sequence of MSP-1.sub.42 modified in accordance with the invention [SEQ ID NO 1] in which 306 nucleotide positions have been replaced to lower AT content and eliminate mRNA instability motifs while maintaining the same protein amino acid sequence of MSP-1.sub.42. The large letters indicate nucleotide substitutions.

[0016] FIG. 2 depicts the nucleotide sequence coding sequence of the "wild type" or native MSP-1.sub.42 [SEQ ID NO 2].

[0017] FIG. 3a is a codon usage table for wild type MSP-1.sub.42 (designated "MSP wt" in the table) and the new modified MSP-1.sub.42 gene (designated "edited MSP" in the table) and several milk protein genes (casein genes derived from goats and mouse). The numbers in each column indicate the actual number of times a specific codon appears in each of the listed genes. The new MSP-1.sub.42 synthetic gene was derived from the mammary specific codon usage by first choosing GC rich codons for a given amino acid combined with selecting the amino acids used most frequently in the milk proteins.

[0018] FIG. 3b is a codon usage table comparing the number of times each codon appears in both the wild type MSP-1.sub.42 (designated "MSP wt" in the table) and the new modified MSP-1.sub.42 gene (designated "edited MSP" in the table) as is also shown in the table in FIG. 3a. The table in FIG. 3b, also compares the frequency in which each codon appears in the wild type MSP-1.sub.42 and the new modified MSP-1.sub.42 gene, to the frequency of appearance of each codon in both E. coli genes and human genes. Thus, if the expression system were E. coli cells, this table may be used to determine what codons are recognized by, or preferred by E. coli.

[0019] FIG. 4a-c depict MSP-1.sub.42 constructs GTC 479, GTC 564, and GTC 627, respectively as are described in the examples.

[0020] FIG. 5 panel A is a Northern analysis wherein construct GTC627 comprises the new MSP-1.sub.42 gene modified in accordance with the invention, GTC479 is the construct comprising the native MSP-1.sub.42 gene, and construct GTC469 is a negative control DNA

[0021] FIG. 5 panel B is a Western analysis wherein the eluted fractions after affinity purifications. Numbers are collected fractions. The results show that fractions from GTC679 the modified MSP-1.sub.42 synthetic gene construct reacted with polyclonal antibodies to MSP-1 and the negative control GTC479 did not.

[0022] FIG. 6 depicts the nucleic acid sequences of OT1 [SEQ ID NO 3], OT2 [SEQ ID NO 4], MSP-8 [SEQ ID NO 5] MSP-2 [SEQ ID NO 6] and MSP1 [SEQ ID NO 7] described in the Examples.

[0023] FIG. 7 is a schematic representation of plasmid BC574.

[0024] FIG. 8 is a schematic representation of BC620.

[0025] FIG. 9 is a schematic representation of BC670.

[0026] FIG. 10 is a representation of a Western blot of MSP in transgenic milk.

[0027] FIG. 11 is a schematic representation of the nucleotide sequence of MSP42-2 [SEQ ID NO 8].

[0028] FIG. 12 is a schematic representation of the BC-718.

[0029] FIG. 13 is a representation of a Western blot of BC-718 expression in transgenic milk.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. The issued US patents, allowed applications, published foreign applications, and references cited herein are hereby incorporated by reference. Any conflicts between these references and the present disclosure shall be resolved in favor of the present disclosure.

[0031] The invention provides modified recombinant nucleic acid sequences (preferably DNA) and methods for increasing the mRNA levels and protein expression of proteins which are known to be, or are likely to be, difficult to express in cell culture systems, mammalian cell culture systems, or in transgenic animals. The preferred "difficult" protein candidates for expression using the recombinant techniques of the invention are those proteins derived from heterologous cells preferably those of lower organisms such as parasites, bacteria, and virus, having DNA coding sequences comprising high overall AT content or AT rich regions and/or mRNA instability motifs and/or rare codons relative to the recombinant expression system to be used.

[0032] In a first aspect, the invention features a modified known nucleic acid, preferably a gene from a bacterium virus or parasite, capable of being expressed in a cell system, wherein the modification comprises a reduced AT content, relative to the unmodified sequence, and optionally further comprises elimination of at least one or all mRNA instability motifs present in the natural gene. A "cell system" includes cell culture systems, tissue culture systems, organ culture systems and tissues of living animals. In certain preferred embodiments the modification further comprises replacement of one or more codons of the natural gene with preferred codons of the cell system. Each of these features are achieved by replacing one or more codons of the natural gene with codons recognizable to, and preferably preferred by the cell system that encode the same amino acid as the codon which was replaced in the natural gene. In accordance with the invention, such "silent" nucleotide and codon substitutions should be sufficient to achieve the goal lowering AT content and/or of eliminating mRNA instability motifs, and/or reducing the number of rare codons, white maintaining, and preferably improving the ability of the cell system to produce mRNA and express the desired protein.

[0033] Also included in the invention are those sequences which are specifically homologous to the modified nucleic acids of the invention under suitable stringent conditions, specifically excluding the known nucleic acids from which the modified nucleic acids are derived. A sequence is "specifically homologous" to another sequence if it is sufficiently homologous to specifically hybridize to the exact complement of the sequence. A sequence "specifically hybridizes" to another sequence if it hybridizes to form Watson-Crick or Hoogsteen base pairs either in the body, or under conditions which approximate physiological conditions with respect to ionic strength, e.g., 140 mM NaCl, 5 mM MgCl.sub.2. Preferably, such specific hybridization is maintained under stringent conditions, e.g., 0.2.times.SSC at 68.degree. C.

[0034] In preferred embodiments, the nucleic acid of the invention is capable of expressing the protein in mammalian cell culture, or in a transgenic animal at a level which is at least 25%, and preferably 50% and even more preferably at least 100% or more of that expressed by the natural gene in an in vitro cell culture system or in a transgenic animal under identical conditions (i.e. the same cell type, same culture conditions, same expression vector).

[0035] As used herein, the term "expression" is meant mRNA transcription resulting in protein expression. Expression may be measured by a number of techniques known in the art including using an antibody specific for the protein of interest. By "natural gene" or "native gene" is meant the gene sequence, or fragments thereof (including naturally occurring allelic variations), which encode the wild type form of the protein and from which the modified nucleic acid is derived. A "preferred codon" means a codon which is used more prevalently by the cell system of choice. Not all codon changes described herein are changes to a preferred codon, so long as the codon replacement is a codon which is at least recognized by the cell system. The term "reduced AT content" as used herein means having a lower overall percentage of nucleotides having A (adenine) or T (thymine) bases relative to the natural gene due to replacement of the A or T containing nucleotide positions or A and/or T containing codons with nucleotides or codons recognized by the cell system of choice and which do not change the amino acid sequence of the target protein. "Heterologous" is used herein to denote genetic material originating from a different species than that into which it has been introduced, or a protein produced from such genetic material.

[0036] Particularly preferred cell systems of the invention include mammalian cell culture systems such as COS cells and CHO cells, as well as transgenic animals, particularly the mammary tissue of transgenic animals. However, the invention also contemplates bacteria, yeast, E. coli, and viral expression systems such as baculovirus and even plant systems.

[0037] In a second aspect, the invention provides a process for preparing a modified nucleic acid of the invention comprising the steps of lowering the overall AT content of the natural gene encoding the protein, and/or eliminating at least one or all mRNA instability motifs and/or replacing one or more codons with a preferred codon of the cell system of choice, all by replacing one or more codons in the natural gene with codons recognizable to, and peferably with codons preferred by the cell system of choice and which code for the same amino acids as the replaced codon. Standard reference works describing the general principals of recombinant DNA technology include Watson, J. D. et al, Molecular Biology of the Gene, Volumes I and II the Benjamin/Cummings Publishing Company, Inc. publisher, Menlo Park, Calif. (1987) Darnell, J. E. et al., Molecular Cell Biology, Scientific American Books, Inc., Publisher, New York, N.Y. (1986); Old, R. W., et al., Principles of Gene Manipulation: An Introduction to Genetic Engineering, 2d edition, University of California Press, publisher, Berkeley Calif. (1981); Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed. Cold Spring Harbor Laboratory, publisher, Cold Spring Harbor, N.Y. (1989) and Current Protocols in Molecular Biology, Ausubel et al., Wiley Press, New York, N.Y. (1992). This aspect of the invention further includes modified nucleic acids prepared according to the process of the invention.

[0038] Without being limited to any theory, previous research has indicated that a conserved AU sequence (AUUUA) from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation (Shaw, G. and Kamen, R. Cell 46:659-667). The focus in the past has been on the presence of these instability motifs in the untranslated region of a gene. The instant invention is the first to recognize an advantage to eliminating the instability sequences in the coding region of a gene.

[0039] In a third aspect, the invention also provides vectors comprising nucleic acids of the invention and promoters active in the cell line or organism of choice, and host cells transformed with nucleic acids of the invention. Preferred vectors include an origin of replication and are thus replicatable in one or more cell type. Certain preferred vectors are expression vectors, and further comprise at least a promoter and passive terminator, thereby allowing transcription of the recombinant expression element in a bacterial, fungal, plant, insect or mammalian cell.

[0040] In a fourth aspect, he invention provides transgenic expression vectors for the production of transgenic lactating animals comprising nucleic acids of the invention as well as transgenic non-human lactating animals whose germlines comprise a nucleic acid of the invention. Such transgenic expression vectors comprise a promoter capable of being expressed as part of the genome of the host transgenic animal. General principals for producing transgenic animals are known in the art. See for example Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory, (1986); Simons et al, Bio/Technology 6:179-183, (1988); Wall et al., Biol. Reprod. 32:645-651, (1985); Buhler et al., Bio/Technology, 8:140-143 (1990); Ebert et al., Bio/Technology 9:835-838 (1991); Krimenfort et al., Bio/Technology 9:844-847 (1991); Wall et al., J. Cell. Biochem. 49:113-120 (1992). Techniques for introducing foreign DNA sequences into mammals and their germ cells were originally developed in the mouse. See e.g., Gordon et al., Proc. Natl. Acad. Sci. USA 77:7380-7384, (1980); Gordon and Ruddle, Science 214: 1244-1246 (1981); Palmiter and Brinster, Cell 41: 343-345, 1985; Brinster et al., Proc Natl. Acad. Sci., USA 82:4438-4442 (1985) and Hogan et al. (ibid.). These techniques were subsequently adapted for use with larger animals including cows and goats. Up until very recently, the most widely used procedure for the generation of transgenic mice or livestock, several hundred linear molecules of the DNA of interest in the form of a transgenic expression construct are injected into one of the pro-nuclei of a fertilized egg. Injection of DNA into the cytoplasm of a zygote is also widely used. Most recently cloning of an entire transgenic cell line capable of injection into an unfertilized egg has been achieved (KHS Campbell et al., Nature 380 64-66, (1996)).

[0041] In a fifth aspect; he invention provides a transgenic expression vector for production of a transgenic lactating animal species comprising a nucleic acid of the invention, a promoter operatively coupled to the nucleic acid which directs mammary gland expression of the protein encoded by the nucleic acid into the milk of the transgenic animal. The mammary gland expression system has the advantages of high expression levels, low cost, correct processing and accessibility. Known proteins, such as bovine and human alpha-lactalbumin have been produced in lactating transgenic animals by several researchers. (Wright et al, Bio/Technology 9:830-834 (1991); Vilotte et al, Eur. J. Biochem., 186:43-48 (1989); Hochi et al., Mol Reprod. And Devel. 33:160-164 (1992); Soulier et al., FEBS Letters 297(1,2):13-18 (1992)) and the system has been shown to produce high levels of protein.

[0042] Preferred promoters are active in the mammary tissue. Particularly useful are promoters that are specifically active in genes encoding milk specific proteins such as genes found in mammary tissue, i.e. are more active in mammary tissue than in other tissues under physiological conditions where milk is synthesized. Most preferred are promoters that are both specific to and efficient in mammary tissue. Among such promoters, the casein, lactalbumin and lactalglobulin promoters are preferred, including, but not limited to the alpha, beta and gamma casein promoters and the alpha lactalbumin and beta-lactalglobulin promoters. Preferred among the promoters are those from rodent, goats and cows. Other promoters include those that regulate a whey acidic protein (WAP) gene.

[0043] In a preferred embodiment of the invention, a modified nucleic acid encoding MSP-1 or fragments thereof capable of expression in a cell culture system, mammalian cell culture system or in the milk of a transgenic animal is provided. Nucleic acid sequences encoding the natural MSP-1 gene are modified in accordance with the invention. First the overall AT content is reduced by replacing codons of the natural gene with codons recognizable to, and preferably with codons preferred by the cell system of choice, that encode the same amino acid but are sufficient to lower the AT content of the modified nucleic acid as compared to the native MSP-1 gene or gene fragment. Second, mRNA instability motifs (AUUUA, Shaw and Kamen, supra) in the native gene or gene fragment are eliminated from the coding sequence of the gene by replacing codons of the natural gene with codons recognizable to, and preferably prefrred by the cell system of choice that encode the same amino acid but are sufficient to eliminate the mRNA instability motif. Optionally, any other codon of the native gene may be replaced with a preferred codon of the expression system of choice as described.

[0044] In a sixth aspect, the invention provides a DNA vaccine comprising a modified nucleic acid according to the invention. In certain preferred embodiments, the DNA vaccine comprises a vector according to the invention, The DNA vaccine according to the invention may be in the form of a "naked" or purified modified nucleic acid according to the invention, which may or may not be operatively associated with a promoter. A nucleic acid is operatively associated with a promoter if it is associated with the promoter in a manner which allows the nucleic acid sequence to be expressed. Such DNA vaccines may be delivered without encapsulation, or they may be delivered as part of a liposome, or as part of a viral genome. Generally, such vaccines are delivered in an amount sufficient to allow expression of the nucleic acid and elicit an antibody response in an animal, including a human, which receives the DNA vaccine. Subsequent deliveries, at least one week after the first delivery, may be used to enhance the antibody response. Preferred delivery routes include introduction via mucosal membranes, as well as parenteral administration.

[0045] A preferred embodiment of this aspect of the invention comprises a fragment of a modified MSP-1 gene according to the invention. Such fragment preferably includes from about 5% to about 100% of the overall gene sequence and comprises one or more modification according to the invention.

[0046] Examples of codon usage from E coli and human are shown in FIG. 3b. FIG. 3b shows the frequency of codon usage for the MSP-1 native gene as well as the modified MSP-1 gene of the invention and also compares the frequency of codon usage to that of E. coli and human genes. Codon usage frequency tables are readily available and known to those skilled in the art for a number of other expression systems such as yeast, baculovirus and the mammalian, systems.

[0047] The following examples illustrate certain preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

EXAMPLES

[0048] Creation of Novel Modified MSP-1.sub.42 Gene

[0049] In one embodiment, a novel modified nucleic acid encoding the C-terminal fragment of MSP-1 is provided. The novel, modified nucleic acid of the invention encoding a 42 kD C-terminal part of MSP-1 (MSP-1.sub.42) capable of expression in mammalian cells of the invention is shown in FIG. 1. The natural MSP-1.sub.42 gene (FIG. 2) was not capable of being expressed in mammalian cell culture or in transgenic mice Analysis of the natural MSP-1.sub.42 gene suggested several characteristics that distinguish it from mammalian genes. First, it has a very high overall AT content of 76%. Second, the mRNA instability motif, AUUUA, occurred 10 times in this 1100 bp DNA segment (FIG. 2). To address these differences a new MSP-1.sub.42 gene was designed. Silent nucleotide substitution was introduced into the native MSP-1.sub.42 gene at 306 positions to reduce the overall AT content to 49.7%. Each of the 10 AUUUA mRNA instability motifs in the natural gene were eliminated by changes in codon usage as well. To change the codon usage, a mammary tissue specific codon usage table, FIG. 3a, was created by using several mouse and goat mammary specific proteins. The table was used to guide the choice of codon usage for the modified MSP-1.sub.42 gene as described above. For example as shown in the Table in FIG. 3a, in the natural gene, 65%, (25/38) of the Leu was encoded by TTA, a rare codon in the mammary gland. In the modified MSP-1.sub.42 gene, 100% of the Leu was encoded by CTG, a preferred codon for Leu in the mammary gland.

[0050] An expression vector was created using the modified MSP-1.sub.42 gene by fusing the first 26 amino acids of goat beta-casein to the N-terminal of the modified MSP-1.sub.42 gene and a SalI-Xho I fragment which carries the fusion gene was subcloned into the XhoI site of the expression vector pCDNA3. A His6 tag was fused to the 3' end of the MSP-1.sub.42 gene to allow the gene product to be affinity purified. This resulted in plasmid GTC627 (FIG. 4c).

[0051] To compare the natural MSP-1.sub.42 gene construct to the modified MSP-1.sub.42 nucleic acid of the invention, an expression vector was also created for the natural MSP-1.sub.42 gene and the gene was added to mammalian cell culture and injected into mice to form transgenic mice as follows:

[0052] Construction of the Native MSP-1.sub.42 Expression Vector

[0053] To secrete the truncated the merozoite surface protein-I (MSP-1) of Plasmodium falciparum, the wild type gene encoding the 42 KD C-terminal part of MSP-1 (MSP-1.sub.42) was fused to either the DNA sequence that encodes the first 15 or the first 25 amino acids of the goat beta-casein. This is achieved by first PCR amplify the MSP-1 plasmid (received from Dr. David Kaslow, NIH) with primers MSP1 and MSP2 (FIG. 6), then cloned the PCR product into the TA vector (Invitrogen). The Bg1II-XhoI fragments of the PCR product was ligated with oligos OT1 and OT2 (FIG. 6) into the expression vector pCDNA3. This yielded plasmid GTC564 (FIG. 4b), which encodes the 15 amino acid beta-casein signal peptide and the first 11 amino acids of the mature goat beta-casein followed by the native MSP-1.sub.42 gene. Oligos MSP-8 and MSP-2 (FIG. 6) were used to amplify MSP-1 plasmid by PCR, the product was then cloned into TA vector. The XhoI fragment was exercised and cloned into the XhoI site of the expression vector pCDNA3 to yield plasmid GTC479 (FIG. 4a), which encoded 15 amino acid goat beta-casein signal peptide fused to the wild-type MSP-1.sub.42 gene. A His6 tag was added to the 3' end of MSP-1.sub.42 gene in GTC 564 and GTC 479.

[0054] Native MSP-1.sub.42 Gene is not Expressed in COS-7 Cells

[0055] Expression of the native MSP gene in cultured COS-7 cells was assayed by transient transfection assays. GTC479 and GTC564 plasmids DNA were introduced into COS-7 cells by lipofectamine (Gibco-BRL) according to manufacturer's protocols. Total cellular RNA was isolated from the COS cells two days post-transfection. The newly synthesized proteins were metabolically labeled for 10 hours by adding .sup.35S methionine added to the culture media two days-post transfection.

[0056] To determine the MSP mRNA expression in the COS cells, a Northern blot was probed with a .sup.32P labeled DNA fragment from GTC479. No MSP RNA was detected in GTC479 or GTC564 transfectants (data not shown). Prolonged exposure revealed residual levels of degraded MSP mRNA. The .sup.35S labeled culture supernatants and the lysates were immunoprecipitated with a polyclonal antibody raised against MSP. Immunoprecipitation experiments showed that no expression from either the lysates or the supernatants of the GTC479 or GTC564 transfected cells (data not shown). These results showed that the native MSP-1 gene was not expressed in COS cells.

[0057] Native MSP-1.sub.42 Gene is not Expressed in the Mammary Gland of Transgenic Mice

[0058] The SalI-XhoI fragment of GTC479, which encoded the 15 amino acids of goat beta-casein signal peptide, the first 11 amino acids of goat beta-casein, and the native MSP-1.sub.42 gene, was cloned into the XhoI site of the beta-casein expressed in vector BC350. This yielded plasmid BC574 (FIG. 7). A SalI-NotI fragment of BC574 was injected into the mouse embryo to generate transgenic mice. Fifteen lines of transgenic mice were established. Milk from the female founder mice was collected and subjected to Western analysis with polycolonal antibodies against MSP. None of the seven mice analyzed were found to express MSP-1.sub.42 protein in their milk. To further determine if the mRNA of MSP-1.sub.42 was expressed in the mammary gland, total RNA was extracted from day 11 lactating transgenic mice and analyzed by Northern blotting. No MSP-1.sub.42 mRNA was detected by any of the BC 574 lines analyzed. Therefore, the MSP-1.sub.42 transgene was not expressed in the mammary gland of transgenic mice. Taken together, these experiments suggest that native parasitic MSP-1.sub.42 gene could not be expressed in mammalian cells, and the block is as the level of mRNA abundance.

[0059] Expression of MSP in the Mammalian Cells

[0060] Transient transfection experiments were performed to evaluate the expression of the modified MSP-1.sub.42 gene of the invention in COS cells. GTC627 and GTC479 DNA were introduced into the COS-7 cells. Total RNA was isolated 48 hours post-transfection for Northern analysis. The immobilized RNA was probed with .sup.32P labeled SalI-XhoI fragment of GTC627. A dramatic difference was observed between GTC479 and GTC627. While no MSP-1.sub.42 mRNA was detected in the GTC479 transfected cells as shown previously, abundant MSP-1.sub.42 mRNA was expressed by GTC627 (FIG. 5, Panel A). GTC 469 was used as a negative control and comprises the insert of GTC564 cloned into cloning vector PU19, a commercially available cloning vector. A metabolic labeling experiment with .sup.35S methionine followed by immunoprecipitation with polyclonal antibody (provided by D. Kaslow NIAID, NIH) against MSP showed that MSP-1.sub.42 protein was synthesized by the transfected COS cells (FIG. 5, Panel B). Furthermore, MSP-1.sub.42 was detected in the transfected COS supernatant, indicating the MSP-1.sub.42 protein was also secreted. Additionally, using Ni-NTA column, MSP-1.sub.42 was affinity purified from the GTC627 transfected COS supernatant.

[0061] These results demonstrated that the modification of the parasitic MSP-1.sub.42 gene lead to the expression of MSP mRNA in the COS cells. Consequently, the MSP-1.sub.42 product was synthesized and secreted by mammalian cells.

[0062] Polyclonal antibodies used in this experiment may also be prepared by means well known in the art (Antibodies: A Laboratory Manual, Ed Harlow and David Lane, eds. Cold Spring Harbor Laboratory, publishers (1988)). Production of MSP serum antibodies is also described in Chang et al., Infection and Immunity (1996) 64:253-261 and Chang et al., (1992) Proc Natl. Acad. Sci. USA 86:6343-6347.

[0063] The results of this analysis indicate that the modified MSP-1.sub.42 nucleic acid of the invention is expressed at a very high level compared to that of the natural protein which was not expressed at all. These results represent the first experimental evidence that reducing the AT % in a gene leads to expression of the MSP gene in heterologous systems and also the first evidence that removal of AUUUA mRNA instability motifs from the MSP coding region leads to the expression of MSP protein in COS cells.

[0064] Thus, the data presented here suggest that certain heterologous proteins that may be difficult to express in cell culture or transgenic systems because of high AT content and/or the presence of instability motifs, and or the usage of rare codons which are unrecognizable to the cell system of choice may be reengineered to enable expression in any given system with the aid of codon usage tables for that system. The present invention represents the first time that a DNA sequence has been modified with the goal of removing suspected sequences responsible for degradation resulting in low RNA levels or no RNA at all. The results shown in the FIG. 5, Panel A Northern (i.e. no RNA with native gene and reasonable levels with a modified DNA sequence in accordance with the invention), likely explains the increase in protein production.

[0065] The following examples describe the expression of MSP1-42 as a native non-fusion (and non-glycosylated) protein in the milk of transgenic mice.

[0066] Construction of MSP Transgene

[0067] To fuse MSP1-42 to the 15 amino acid .beta.-casein signal peptide, a pair of oligos, MSP203 and MSP204 (MS P203: ggccgctcgacgccaccatgaaggtcc- tcataattgcc tgtctggtggctctggccattgcagtcactccctccgtcat, MSP204: cgatgacggagggagtgacggctg caatggccagagccaccagacaggcattatgaggaccttcatggtggc- gtcgagc), which encode the 15 amino acid--casein signal and the first 5 amino acid of the MSP1-42 ending at the Cla I site, was ligated with a Cla I-Xho I fragment of BC620 (Fit. 8) which encodes the rest of the MSP1-42 gene, into the Xho I site of the expression vector pCDNA3. A Xho I fragment of this plasmid (GTC669) was then cloned into the Xho I site of milk specific expression vector BC350 Lo generate B670 (FIG. 9)

[0068] Expression of MSP1-42 in the Milk of Transgenic Mice

[0069] A Sal I-Not I fragment was prepared from plasmid BC670 and microinjected into the mouse embryo to generate transgenic mice. Transgenic mice was identified by extracting mouse DNA from tail biopsy followed by PCR analysis using oligos GTC17 and MSP101 (sequences of oligos: GTC17, GATTGACAAGTAATACGCTGTTTCCTC, Oligo MSP 101, GGATTCAATAGATACGG). Milk from the female founder transgenic mice was collected at day 7 and day 9 of lactation, and subjected to western analysis to determine the expression level of MSP-1-42 using an polyclonal anti-MSP antibody and monoclonal anti MSP antibody 5.2 (Dr. David Kaslow. NIH). Results indicated that the level of MSP-1-42 expression in the milk of transgenic mice was at 1-2 mg/ml (FIG. 10).

[0070] Construction of MSP1-42 Glycosylation Sites Minus Mutants

[0071] Our analysis of the milk produced MSP revealed that the transgenic MSP protein was N-glycosylated. To eliminate the N-glycosylation sites in the MSP1-42 gene, Asn. (N) at positions 181 and 262 were substituted with Gln.(Q). The substitutions were introduced by designing DNA oligos that anneal to the corresponding region of MSP1 and carry the AAC to CAG mutations. These oligos were then used as PCR primers to produce DNA fragments that encode the N to Q substitutions.

[0072] To introduce N262-Q mutation, a pair of oligos, MSPGYLYCO-3 (CAGGGAATGCTGCAGATCAGC) AND MSP42-2 (AATTCTCGAGTTAGTG GTGGTGGTGGTGGTGATCGCAGAAAATACCATG, FIG. 11), were used to PCR amplify plasmid GTC627, which contains the synthetic MSP1-42 gene. The PCR product was cloned into pCR2.1 vector (Invitrogen). This generated plasmid GTC716.

[0073] To introduce N181-Q mutation, oligos MSPGLYCO-1 (CTCCTTGTTCAGG AACTTGTAGGG) and MSPGLCO-2 (GTCCTGCAGTACACATATGAG. FIG. 4) were used to amplify plasmid GTC 627. The PCR product was cloned into pCR2.1. This generated plasmid GTC700.

[0074] The MSP double glycosylation mutant was constructed by the following three steps: first, a Xho I-Bsm I fragment of BC670 and the Bsm I-Xho I fragment of GTC716 is ligated into the Xho I site of vector pCR2.1. This resulted a plasmid that contain the MSP-1-42 gene with N262-Q mutation. EcoN I-Nde I fragment of this plasmid was then replaced by the EcoN I-Nde I fragment from plasmid GTC716 to introduce the second mutation, N181-Q. A Xho I fragment of this plasmid was finally cloned into BC350 to generate BC718 (FIG. 12).

[0075] Expression of Nonglycosylated MSP1 in Transgenic Animals

[0076] BC718 has the following characteristics: it carries the MSP 1-42 gene under the control of the .beta.-casein promoter so it can be expressed in the mammary gland of the transgenic animal during lactation. Further, it encodes a 15 amino acid .beta.-casein leader sequence fused directly to MSP 1-42, so that the MSP1-42, without any additional amino acid at its N-terminal, can be secreted into the milk. Finally, because the N-Q substitutions, the MSP produced in the milk of the transgenic animal by this construct will not be N-glycosylated. Taken together, the transgenic MSP produced in the milk by BC718 is the same as the parasitic MSP.

[0077] A SalI/XhoI fragment was prepared from plasmid BC718 and microinjected into mouse embryos to generate transgenic mice. Transgenic animals were identified as described previously. Milk from female founders was collected and analyzed by Western blotting with antibody 5.2. The results, shown in FIG. 13, indicate expression of nonglycosylated MSP1 at a concentration of 0.5 to 1 mg/ml.

[0078] Equivalents

[0079] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents are considered to be within the scope of this invention, and are covered by the following claims.

Sequence CWU 1

1

19 1 1065 DNA Artificial Sequence altered MSP sequence; preferably, a bacterium, virus, or parasite 1 gcc gtc act ccc tcc gtc atc gat aac atc ctg tcc aag atc gag aac 48 Ala Val Thr Pro Ser Val Ile Asp Asn Ile Leu Ser Lys Ile Glu Asn 1 5 10 15 gag tac gag gtg ctg tac ctg aag ccg ctg gca ggg gtc tac cgg agc 96 Glu Tyr Glu Val Leu Tyr Leu Lys Pro Leu Ala Gly Val Tyr Arg Ser 20 25 30 ctg aag aag cag ctg gag aac aac gtg atg acc ttc aac gtg aac gtg 144 Leu Lys Lys Gln Leu Glu Asn Asn Val Met Thr Phe Asn Val Asn Val 35 40 45 aag gat atc ctg aac agc cgg ttc aac aag cgg gag aac ttc aag aac 192 Lys Asp Ile Leu Asn Ser Arg Phe Asn Lys Arg Glu Asn Phe Lys Asn 50 55 60 gtg ctg gag agc gat ctg atc ccc tac aag gat ctg acc agc agc aac 240 Val Leu Glu Ser Asp Leu Ile Pro Tyr Lys Asp Leu Thr Ser Ser Asn 65 70 75 80 tac gtg gtc aag gat ccc tac aag ttc ctg aac aag gag aag aga gat 288 Tyr Val Val Lys Asp Pro Tyr Lys Phe Leu Asn Lys Glu Lys Arg Asp 85 90 95 aag ttc ctg agc agt tac aac tac atc aag gat agc att gat acc gat 336 Lys Phe Leu Ser Ser Tyr Asn Tyr Ile Lys Asp Ser Ile Asp Thr Asp 100 105 110 atc aac ttc gcc aac gat gtc ctg gga tac tac aag atc ctg tcc gag 384 Ile Asn Phe Ala Asn Asp Val Leu Gly Tyr Tyr Lys Ile Leu Ser Glu 115 120 125 aag tac aag agc gat ctg gat tca atc aag aag tac atc aac gat aag 432 Lys Tyr Lys Ser Asp Leu Asp Ser Ile Lys Lys Tyr Ile Asn Asp Lys 130 135 140 cag gga gag aac gag aag tac ctg ccc ttc ctg aac aac atc gag acc 480 Gln Gly Glu Asn Glu Lys Tyr Leu Pro Phe Leu Asn Asn Ile Glu Thr 145 150 155 160 ctg tac aag acc gtc aac gat aag att gat ctg ttc gtg atc cac ctg 528 Leu Tyr Lys Thr Val Asn Asp Lys Ile Asp Leu Phe Val Ile His Leu 165 170 175 gag gcc aag gtc ctg aac tac aca tat gag aag agc aac gtg gag gtc 576 Glu Ala Lys Val Leu Asn Tyr Thr Tyr Glu Lys Ser Asn Val Glu Val 180 185 190 aag atc aag gag ctg aat tac ctg aag acc atc cag gat aag ctg gcc 624 Lys Ile Lys Glu Leu Asn Tyr Leu Lys Thr Ile Gln Asp Lys Leu Ala 195 200 205 gat ttc aag aag aac aac aac ttc gtc ggg atc gcc gat ctg agc acc 672 Asp Phe Lys Lys Asn Asn Asn Phe Val Gly Ile Ala Asp Leu Ser Thr 210 215 220 gat tac aac cac aac aac ctg ctg acc aag ttc ctg agc acc ggt atg 720 Asp Tyr Asn His Asn Asn Leu Leu Thr Lys Phe Leu Ser Thr Gly Met 225 230 235 240 gtc ttc gaa aac ctg gcc aag acc gtc ctg agc aac ctg ctg gat ggg 768 Val Phe Glu Asn Leu Ala Lys Thr Val Leu Ser Asn Leu Leu Asp Gly 245 250 255 aac ctg cag ggg atg ctg aac atc agc cag cac cag tgt gtg aag aag 816 Asn Leu Gln Gly Met Leu Asn Ile Ser Gln His Gln Cys Val Lys Lys 260 265 270 cag tgt ccc cag aac agc ggg tgt ttc aga cac ctg gat gag aga gag 864 Gln Cys Pro Gln Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu 275 280 285 gag tgt aag tgt ctg ctg aac tac aag cag gaa ggt gat aag tgt gtg 912 Glu Cys Lys Cys Leu Leu Asn Tyr Lys Gln Glu Gly Asp Lys Cys Val 290 295 300 gaa aac ccc aat cct act tgt aac gag aac aat ggt gga tgt gat gcc 960 Glu Asn Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala 305 310 315 320 gat gcc aag tgt acc gag gag gat tca ggg agc aac ggg aag aag atc 1008 Asp Ala Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys Ile 325 330 335 acc tgt gag tgt acc aag cct gat tct tat cca ctg ttc gat ggt atc 1056 Thr Cys Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly Ile 340 345 350 ttc tgt agt 1065 Phe Cys Ser 355 2 1088 DNA Plasmodium falciparum CDS (1)...(1083) 2 gca gta act cct tcc gta att gat aac ata ctt tct aaa att gaa aat 48 Ala Val Thr Pro Ser Val Ile Asp Asn Ile Leu Ser Lys Ile Glu Asn 1 5 10 15 gaa tat gag gtt tta tat tta aaa cct tta gca ggt gtt tat aga agt 96 Glu Tyr Glu Val Leu Tyr Leu Lys Pro Leu Ala Gly Val Tyr Arg Ser 20 25 30 tta aaa aaa caa tta gaa aat aac gtt atg aca ttt aat gtt aat gtt 144 Leu Lys Lys Gln Leu Glu Asn Asn Val Met Thr Phe Asn Val Asn Val 35 40 45 aag gat att tta aat tca cga ttt aat aaa cgt gaa aat ttc aaa aat 192 Lys Asp Ile Leu Asn Ser Arg Phe Asn Lys Arg Glu Asn Phe Lys Asn 50 55 60 gtt tta gaa tca gat tta att cca tat aaa gat tta aca tca agt aat 240 Val Leu Glu Ser Asp Leu Ile Pro Tyr Lys Asp Leu Thr Ser Ser Asn 65 70 75 80 tat gtt gtc aaa gat cca tat aaa ttt ctt aat aaa gaa aaa aga gat 288 Tyr Val Val Lys Asp Pro Tyr Lys Phe Leu Asn Lys Glu Lys Arg Asp 85 90 95 aaa ttc tta agc agt tat aat tat att aag gat tca ata gat acg gat 336 Lys Phe Leu Ser Ser Tyr Asn Tyr Ile Lys Asp Ser Ile Asp Thr Asp 100 105 110 ata aat ttt gca aat gat gtt ctt gga tat tat aaa ata tta tcc gaa 384 Ile Asn Phe Ala Asn Asp Val Leu Gly Tyr Tyr Lys Ile Leu Ser Glu 115 120 125 aaa tat aaa tca gat tta gat tca att aaa aaa tat atc aac gac aaa 432 Lys Tyr Lys Ser Asp Leu Asp Ser Ile Lys Lys Tyr Ile Asn Asp Lys 130 135 140 caa ggt gaa aat gag aaa tac ctt ccc ttt tta aac aat att gag acc 480 Gln Gly Glu Asn Glu Lys Tyr Leu Pro Phe Leu Asn Asn Ile Glu Thr 145 150 155 160 tta tat aaa aca gtt aat gat aaa att gat tta ttt gta att cat tta 528 Leu Tyr Lys Thr Val Asn Asp Lys Ile Asp Leu Phe Val Ile His Leu 165 170 175 gaa gca aaa gtt cta aat tat aca tat gag aaa tca aac gta gaa gtt 576 Glu Ala Lys Val Leu Asn Tyr Thr Tyr Glu Lys Ser Asn Val Glu Val 180 185 190 aaa ata aaa gaa ctt aat tac tta aaa aca att caa gac aaa ttg gca 624 Lys Ile Lys Glu Leu Asn Tyr Leu Lys Thr Ile Gln Asp Lys Leu Ala 195 200 205 gat ttt aaa aaa aat aac aat ttc gtt gga att gct gat tta tca aca 672 Asp Phe Lys Lys Asn Asn Asn Phe Val Gly Ile Ala Asp Leu Ser Thr 210 215 220 gat tat aac cat aat aac tta ttg aca aag ttc ctt agt aca ggt atg 720 Asp Tyr Asn His Asn Asn Leu Leu Thr Lys Phe Leu Ser Thr Gly Met 225 230 235 240 gtt ttt gaa aat ctt gct aaa acc gtt tta tct aat tta ctt gat gga 768 Val Phe Glu Asn Leu Ala Lys Thr Val Leu Ser Asn Leu Leu Asp Gly 245 250 255 aac ttg caa ggt atg tta aac att tca caa cac caa tgc gta aaa aaa 816 Asn Leu Gln Gly Met Leu Asn Ile Ser Gln His Gln Cys Val Lys Lys 260 265 270 caa tgt cca caa aat tct gga tgt ttc aga cat tta gat gaa aga gaa 864 Gln Cys Pro Gln Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu 275 280 285 gaa tgt aaa tgt tta tta aat tac aaa caa gaa ggt gat aaa tgt gtt 912 Glu Cys Lys Cys Leu Leu Asn Tyr Lys Gln Glu Gly Asp Lys Cys Val 290 295 300 gaa aat cca aat cct act tgt aac gaa aat aat ggt gga tgt gat gca 960 Glu Asn Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala 305 310 315 320 gat gcc aaa tgt acc gaa gaa gat tca ggt agc aac gga aag aaa atc 1008 Asp Ala Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys Ile 325 330 335 aca tgt gaa tgt act aaa cct gat tct tat cca ctt ttc gat ggt att 1056 Thr Cys Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly Ile 340 345 350 ttc tgc agt cac cac cac cac cac cac taact 1088 Phe Cys Ser His His His His His His 355 360 3 88 DNA Artificial Sequence synthetically generated oligonucleotide 3 tcgacgagag ccatgaaggt cctcatcctt gcctgtctgg tggctctggc cattgcaaga 60 gagcaggaag aactcaatgt agtcggta 88 4 88 DNA Artificial Sequence synthetically generated oligonucleotide 4 gatctaccga ctacattgag ttcttcctgc tctcttgcaa tggccagagc caccagacag 60 gcaaggatga ggaccttcat ggctctcg 88 5 60 DNA Artificial Sequence oligonucleotide for PCR 5 taactcgagc gaaccatgaa ggtcctcatc cttgcctgtc tggtggctct ggccattgca 60 6 48 DNA Artificial Sequence oligonucleotide for PCR 6 aattctcgag ttagtggtgg tggtggtggt gactgcagaa ataccatc 48 7 31 DNA Artificial Sequence oligonucleotide for PCR 7 aatagatctg cagtaactcc ttccgtaatt g 31 8 1142 DNA Artificial Sequence altered MSP sequence; preferably, a bacterium, virus, or parasite 8 atg aag gtc ctc ata att gcc tgt ctg gtg gct ctg gcc att gca gcc 48 Met Lys Val Leu Ile Ile Ala Cys Leu Val Ala Leu Ala Ile Ala Ala 1 5 10 15 gtc act ccc tcc gtc atc gat aac atc ctg tcc aag atc gag aac gag 96 Val Thr Pro Ser Val Ile Asp Asn Ile Leu Ser Lys Ile Glu Asn Glu 20 25 30 tac gag gtg ctg tac ctg aag ccc ctg gca gga gtc tac agg agc ctg 144 Tyr Glu Val Leu Tyr Leu Lys Pro Leu Ala Gly Val Tyr Arg Ser Leu 35 40 45 aag aag cag ctg gag aac aac gtg atg acc ttc aac gtg aac gtg aag 192 Lys Lys Gln Leu Glu Asn Asn Val Met Thr Phe Asn Val Asn Val Lys 50 55 60 gat atc ctg aac agc agg ttc aac aag agg gag aac ttc aag aac gtg 240 Asp Ile Leu Asn Ser Arg Phe Asn Lys Arg Glu Asn Phe Lys Asn Val 65 70 75 80 ctg gag agc gat ctg atc ccc tac aag gat ctg acc agc agc aac tac 288 Leu Glu Ser Asp Leu Ile Pro Tyr Lys Asp Leu Thr Ser Ser Asn Tyr 85 90 95 gtg gtc aaa gat ccc tac aag ttc ctg aac aag gag aag aga gat aag 336 Val Val Lys Asp Pro Tyr Lys Phe Leu Asn Lys Glu Lys Arg Asp Lys 100 105 110 ttc ctg agc agt tac aat tac atc aag gat agc att gac acc gat atc 384 Phe Leu Ser Ser Tyr Asn Tyr Ile Lys Asp Ser Ile Asp Thr Asp Ile 115 120 125 aac ttc gcc aac gat gtc ctg gga tac tac aag atc ctg tcc gag aag 432 Asn Phe Ala Asn Asp Val Leu Gly Tyr Tyr Lys Ile Leu Ser Glu Lys 130 135 140 tac aag agc gat ctg gat agc atc aag aag tac atc aac gat aag cag 480 Tyr Lys Ser Asp Leu Asp Ser Ile Lys Lys Tyr Ile Asn Asp Lys Gln 145 150 155 160 gga gag aac gag aag tac ctg ccc ttc ctg aac aac atc gag acc ctg 528 Gly Glu Asn Glu Lys Tyr Leu Pro Phe Leu Asn Asn Ile Glu Thr Leu 165 170 175 tac aag acc gtc aac gat aag att gat ctg ttc gtg atc cac ctg gag 576 Tyr Lys Thr Val Asn Asp Lys Ile Asp Leu Phe Val Ile His Leu Glu 180 185 190 gcc aag gtc ctg cag tac aca tat gag aag agc aac gtg gag gtc aag 624 Ala Lys Val Leu Gln Tyr Thr Tyr Glu Lys Ser Asn Val Glu Val Lys 195 200 205 atc aag gag ctg aat tac ctg aag acc atc cag gat aag ctg gcc gat 672 Ile Lys Glu Leu Asn Tyr Leu Lys Thr Ile Gln Asp Lys Leu Ala Asp 210 215 220 ttc aag aag aac aac aac ttc gtc gga atc gcc gat ctg agc acc gat 720 Phe Lys Lys Asn Asn Asn Phe Val Gly Ile Ala Asp Leu Ser Thr Asp 225 230 235 240 tac aac cac aac aac ctg ctg acc aag ttc ctg agc acc gga atg gtc 768 Tyr Asn His Asn Asn Leu Leu Thr Lys Phe Leu Ser Thr Gly Met Val 245 250 255 ttc gaa aac ctg gcc aag acc gtc ctg agc aac ctg ctg gat gga aac 816 Phe Glu Asn Leu Ala Lys Thr Val Leu Ser Asn Leu Leu Asp Gly Asn 260 265 270 ctg cag gga atg ctg cag atc agc cag cac cag tgt gtg aag aag cag 864 Leu Gln Gly Met Leu Gln Ile Ser Gln His Gln Cys Val Lys Lys Gln 275 280 285 tgt ccc cag aac agc gga tgc ttc aga cac ctg gat gag agg gag gag 912 Cys Pro Gln Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu Glu 290 295 300 tgc aag tgc ctg ctg aac tac aag cag gaa gga gat aag tgt gtg gaa 960 Cys Lys Cys Leu Leu Asn Tyr Lys Gln Glu Gly Asp Lys Cys Val Glu 305 310 315 320 aac ccc aat cct act tgt aac gag aac aat gga gga tgc gat gcc gat 1008 Asn Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala Asp 325 330 335 gcc aag tgt acc gag gag gat tca gga agc aac gga aag aag atc acc 1056 Ala Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys Ile Thr 340 345 350 tgc gag tgt acc aag cct gat tct tat cca ctg ttc gat ggt att ttc 1104 Cys Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly Ile Phe 355 360 365 tgc agt cac cac cac cac cac cac taa ctc gag gat cc 1142 Cys Ser His His His His His His * Leu Glu Asp 370 375 9 355 PRT Artificial Sequence altered MSP sequence; preferably, a bacterium, virus, or parasite 9 Ala Val Thr Pro Ser Val Ile Asp Asn Ile Leu Ser Lys Ile Glu Asn 1 5 10 15 Glu Tyr Glu Val Leu Tyr Leu Lys Pro Leu Ala Gly Val Tyr Arg Ser 20 25 30 Leu Lys Lys Gln Leu Glu Asn Asn Val Met Thr Phe Asn Val Asn Val 35 40 45 Lys Asp Ile Leu Asn Ser Arg Phe Asn Lys Arg Glu Asn Phe Lys Asn 50 55 60 Val Leu Glu Ser Asp Leu Ile Pro Tyr Lys Asp Leu Thr Ser Ser Asn 65 70 75 80 Tyr Val Val Lys Asp Pro Tyr Lys Phe Leu Asn Lys Glu Lys Arg Asp 85 90 95 Lys Phe Leu Ser Ser Tyr Asn Tyr Ile Lys Asp Ser Ile Asp Thr Asp 100 105 110 Ile Asn Phe Ala Asn Asp Val Leu Gly Tyr Tyr Lys Ile Leu Ser Glu 115 120 125 Lys Tyr Lys Ser Asp Leu Asp Ser Ile Lys Lys Tyr Ile Asn Asp Lys 130 135 140 Gln Gly Glu Asn Glu Lys Tyr Leu Pro Phe Leu Asn Asn Ile Glu Thr 145 150 155 160 Leu Tyr Lys Thr Val Asn Asp Lys Ile Asp Leu Phe Val Ile His Leu 165 170 175 Glu Ala Lys Val Leu Asn Tyr Thr Tyr Glu Lys Ser Asn Val Glu Val 180 185 190 Lys Ile Lys Glu Leu Asn Tyr Leu Lys Thr Ile Gln Asp Lys Leu Ala 195 200 205 Asp Phe Lys Lys Asn Asn Asn Phe Val Gly Ile Ala Asp Leu Ser Thr 210 215 220 Asp Tyr Asn His Asn Asn Leu Leu Thr Lys Phe Leu Ser Thr Gly Met 225 230 235 240 Val Phe Glu Asn Leu Ala Lys Thr Val Leu Ser Asn Leu Leu Asp Gly 245 250 255 Asn Leu Gln Gly Met Leu Asn Ile Ser Gln His Gln Cys Val Lys Lys 260 265 270 Gln Cys Pro Gln Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu 275 280 285 Glu Cys Lys Cys Leu Leu Asn Tyr Lys Gln Glu Gly Asp Lys Cys Val 290 295 300 Glu Asn Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala 305 310 315 320 Asp Ala Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys Ile 325 330 335 Thr Cys Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly Ile 340 345 350 Phe Cys Ser 355 10 361 PRT Plasmodium falciparum 10 Ala Val Thr Pro Ser Val Ile Asp Asn Ile Leu Ser Lys Ile Glu Asn 1 5 10 15 Glu Tyr Glu Val Leu Tyr Leu Lys Pro Leu Ala Gly Val Tyr Arg Ser 20 25 30 Leu Lys Lys Gln Leu Glu Asn Asn Val Met Thr Phe Asn Val Asn Val 35 40 45 Lys Asp Ile Leu Asn Ser Arg Phe Asn Lys Arg Glu Asn Phe Lys Asn 50 55 60 Val Leu Glu Ser Asp Leu Ile Pro Tyr Lys Asp Leu Thr Ser Ser Asn 65 70 75 80 Tyr Val Val Lys Asp Pro Tyr Lys Phe Leu Asn Lys Glu Lys Arg Asp 85 90 95 Lys Phe Leu Ser Ser Tyr Asn Tyr Ile Lys Asp Ser Ile Asp Thr Asp 100 105 110 Ile Asn Phe Ala Asn Asp Val Leu Gly Tyr Tyr Lys Ile Leu Ser Glu 115 120 125 Lys Tyr Lys Ser Asp Leu Asp Ser Ile Lys Lys Tyr Ile Asn Asp Lys 130 135 140 Gln Gly Glu Asn Glu Lys Tyr Leu Pro Phe Leu Asn

Asn Ile Glu Thr 145 150 155 160 Leu Tyr Lys Thr Val Asn Asp Lys Ile Asp Leu Phe Val Ile His Leu 165 170 175 Glu Ala Lys Val Leu Asn Tyr Thr Tyr Glu Lys Ser Asn Val Glu Val 180 185 190 Lys Ile Lys Glu Leu Asn Tyr Leu Lys Thr Ile Gln Asp Lys Leu Ala 195 200 205 Asp Phe Lys Lys Asn Asn Asn Phe Val Gly Ile Ala Asp Leu Ser Thr 210 215 220 Asp Tyr Asn His Asn Asn Leu Leu Thr Lys Phe Leu Ser Thr Gly Met 225 230 235 240 Val Phe Glu Asn Leu Ala Lys Thr Val Leu Ser Asn Leu Leu Asp Gly 245 250 255 Asn Leu Gln Gly Met Leu Asn Ile Ser Gln His Gln Cys Val Lys Lys 260 265 270 Gln Cys Pro Gln Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu 275 280 285 Glu Cys Lys Cys Leu Leu Asn Tyr Lys Gln Glu Gly Asp Lys Cys Val 290 295 300 Glu Asn Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala 305 310 315 320 Asp Ala Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys Ile 325 330 335 Thr Cys Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly Ile 340 345 350 Phe Cys Ser His His His His His His 355 360 11 379 PRT Artificial Sequence altered MSP sequence; preferably, a bacterium, virus, or parasite 11 Met Lys Val Leu Ile Ile Ala Cys Leu Val Ala Leu Ala Ile Ala Ala 1 5 10 15 Val Thr Pro Ser Val Ile Asp Asn Ile Leu Ser Lys Ile Glu Asn Glu 20 25 30 Tyr Glu Val Leu Tyr Leu Lys Pro Leu Ala Gly Val Tyr Arg Ser Leu 35 40 45 Lys Lys Gln Leu Glu Asn Asn Val Met Thr Phe Asn Val Asn Val Lys 50 55 60 Asp Ile Leu Asn Ser Arg Phe Asn Lys Arg Glu Asn Phe Lys Asn Val 65 70 75 80 Leu Glu Ser Asp Leu Ile Pro Tyr Lys Asp Leu Thr Ser Ser Asn Tyr 85 90 95 Val Val Lys Asp Pro Tyr Lys Phe Leu Asn Lys Glu Lys Arg Asp Lys 100 105 110 Phe Leu Ser Ser Tyr Asn Tyr Ile Lys Asp Ser Ile Asp Thr Asp Ile 115 120 125 Asn Phe Ala Asn Asp Val Leu Gly Tyr Tyr Lys Ile Leu Ser Glu Lys 130 135 140 Tyr Lys Ser Asp Leu Asp Ser Ile Lys Lys Tyr Ile Asn Asp Lys Gln 145 150 155 160 Gly Glu Asn Glu Lys Tyr Leu Pro Phe Leu Asn Asn Ile Glu Thr Leu 165 170 175 Tyr Lys Thr Val Asn Asp Lys Ile Asp Leu Phe Val Ile His Leu Glu 180 185 190 Ala Lys Val Leu Gln Tyr Thr Tyr Glu Lys Ser Asn Val Glu Val Lys 195 200 205 Ile Lys Glu Leu Asn Tyr Leu Lys Thr Ile Gln Asp Lys Leu Ala Asp 210 215 220 Phe Lys Lys Asn Asn Asn Phe Val Gly Ile Ala Asp Leu Ser Thr Asp 225 230 235 240 Tyr Asn His Asn Asn Leu Leu Thr Lys Phe Leu Ser Thr Gly Met Val 245 250 255 Phe Glu Asn Leu Ala Lys Thr Val Leu Ser Asn Leu Leu Asp Gly Asn 260 265 270 Leu Gln Gly Met Leu Gln Ile Ser Gln His Gln Cys Val Lys Lys Gln 275 280 285 Cys Pro Gln Asn Ser Gly Cys Phe Arg His Leu Asp Glu Arg Glu Glu 290 295 300 Cys Lys Cys Leu Leu Asn Tyr Lys Gln Glu Gly Asp Lys Cys Val Glu 305 310 315 320 Asn Pro Asn Pro Thr Cys Asn Glu Asn Asn Gly Gly Cys Asp Ala Asp 325 330 335 Ala Lys Cys Thr Glu Glu Asp Ser Gly Ser Asn Gly Lys Lys Ile Thr 340 345 350 Cys Glu Cys Thr Lys Pro Asp Ser Tyr Pro Leu Phe Asp Gly Ile Phe 355 360 365 Cys Ser His His His His His His Leu Glu Asp 370 375 12 82 DNA Artificial Sequence synthetically generated oligonucleotide 12 ggccgctcga cgccaccatg aaggtcctca taattgcctg tctggtggct ctggccattg 60 cagccgtcac tccctccgtc at 82 13 80 DNA Artificial Sequence synthetically generated oligonucleotide 13 cgatgacgga gggagtgacg gctgcaatgg ccagagccac cagacaggca attatgagga 60 ccttcatggt ggcgtcgagc 80 14 27 DNA Artificial Sequence oligonucleotide for PCR 14 gattgacaag taatacgctg tttcctc 27 15 17 DNA Artificial Sequence oligonucleotide for PCR 15 ggattcaata gatacgg 17 16 21 DNA Artificial Sequence oligonucleotide for PCR 16 cagggaatgc tgcagatcag c 21 17 49 DNA Artificial Sequence oligonucleotide for PCR 17 aattctcgag ttagtggtgg tggtggtggt gatcgcagaa aataccatg 49 18 24 DNA Artificial Sequence oligonucleotide for PCR 18 ctccttgttc aggaacttgt aggg 24 19 21 DNA Artificial Sequence oligonucleotide for PCR 19 gtcctgcagt acacatatga g 21

Claims

1-26. (Cancelled)

27. A method for producing a parasite protein or fragment thereof in milk of a non-human transgenic mammal, comprising: providing said non-human transgenic mammal whose genome comprises a modified nucleic acid sequence encoding said parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said modified nucleic acid sequence has been modified by replacing one or more AT-containing codons of the nucleic acid sequence of said parasite protein or fragment thereof as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as derived from said parasite; and allowing said non-human transgenic mammal to express said parasite protein or fragment thereof in its milk, to thereby produce said parasite protein or fragment thereof.

28. The method of claim 27, wherein all of the codons of the naturally occurring nucleic acid sequence have been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.

29. The method of claim 27, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level of at least 0.5 mg/ml.

30. The method of claim 27, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level which is between 1.0 mg/ml and 2.0 mg/ml.

31. The method of claim 27, wherein said parasite protein or fragment thereof as expressed in said non-human transgenic mammal can be detectably expressed in the milk of said transgenic non-human mammal.

32. The method of claim 27, wherein all non-preferred codons are replaced with a codon or codons preferred by a mammalian cell for the purposes of expression.

33. The parasite protein or fragment thereof as produced by the method of claim 27.

34. The method of claim 27 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.

35. The method of claim 27 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.

36. The method of claim 27 wherein said promoter is selected from a group of promoters consisting of: a) beta-casein; b) bovine lactoglobulin; c) whey acid promoter; d) alpha-ovalbumin; and e) caprine casein.

37. The method of claim 27 wherein said non-human transgenic mammal is selected from a group of mammals consisting of: a) caprine; b) bovine; c) porcine; d) rodent; and e) ovine.

38. The method of claim 27 wherein said modified nucleic acid sequence is modified to provide for the expression of a modified amino acid sequence such at least one glycosylation site on said parasite protein or protein fragment thereof produced by said non-human transgenic mammal is eliminated.

39. A method for producing a parasite protein or fragment thereof in the milk of a non-human transgenic mammal, comprising: providing said non-human transgenic mammal whose genome comprises a modified nucleic acid sequence encoding said parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said nucleic acid sequence of said parasite protein or fragment thereof has been modified by replacing at least a portion of an AUUUA mRNA instability motif in a coding sequence of said parasite protein or fragment thereof as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof while encoding an amino acid which is the same as the replaced portion of said AUUUA mRNA instability motif; allowing said non-human transgenic mammal to express said parasite protein or fragment thereof in its milk, to thereby produce said parasite protein or fragment thereof, and wherein the naturally occurring nucleic acid sequence encoding said parasite protein or fragment thereof contains at least one AUUUA instability motif; and,

40. The method of claim 39, wherein each of said AUUUA mRNA instability motifs present in the naturally occurring nucleic acid have been replaced by a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof.

41. The method of claim 39, wherein said modified nucleic acid sequence further comprises at least one additional codon other than a first codon replaced to lower AT content or a nucleic acid sequence modification made to eliminate said AUUUA mRNA instability motif which has been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.

42. The method of claim 39 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.

43. The method of claim 39 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.

44. The method of claim 39 wherein said promoter is selected from a group of promoters consisting of: a) beta-casein; b) bovine lactoglobulin; c) whey acid promoter; d) alpha-ovalbumin; and e) caprine casein.

45. The method of claim 39 wherein said non-human transgenic mammal is selected from a group of mammals consisting of: a) caprine; b) bovine; c) porcine; d) rodent; and e) ovine.

46. A method for producing a parasite protein or fragment thereof in the milk of a non-human transgenic mammal, comprising: providing a non-human transgenic mammal whose genome comprises a modified nucleic acid sequence encoding said parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said modified nucleic acid sequence has been modified by: a) replacing at least a portion of an AUUUA mRNA instability motif in the coding sequence of said parasite protein or fragment thereof as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof while encoding the same amino acid as the replaced portion of said AUUUA mRNA instability motif; b) replacing one or more AT-containing codons of said modified nucleic acid sequence as it naturally occurs in said parasite with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same amino acid as the replaced codon; c) allowing said non-human transgenic mammal to express said parasite protein or fragment thereof in its milk, to thereby produce said parasite protein or fragment thereof and wherein the naturally occurring nucleic acid sequence encoding said parasite protein or fragment thereof contains at least one AUUUA instability motif; and,

47. The method of claim 46, wherein each of said AUUUA mRNA instability motifs present in the naturally occurring nucleic acid have been replaced by a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof.

48. The method of claim 46, wherein said modified nucleic acid sequence further comprises at least one additional codon other than a first codon replaced to lower AT content or a nucleic acid sequence modification made to eliminate said AUUUA mRNA instability motif which has been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.

49. The method of claim 46, wherein all of the codons of the naturally occurring nucleic acid sequence have been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.

50. The method of claim 46, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level of at least 0.5 mg/ml.

51. The method of claim 46, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level which is between 1.0 mg/ml and 2.0 mg/ml.

52. The method of claim 46, wherein said parasite protein or fragment thereof as expressed in said non-human transgenic mammal can be detectably expressed in the milk of said transgenic non-human mammal.

53. The method of claim 46, wherein all non-preferred codons are replaced with a codon or codons preferred by a mammalian cell for the purposes of expression.

54. The parasite protein or fragment thereof as produced by the method of claim 46.

55. The method of claim 46 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.

56. The method of claim 46 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.

57. The method of claim 46 wherein said promoter is selected from a group of promoters consisting of: a) beta-casein; b) bovine lactoglobulin; c) whey acid promoter; d) alpha-ovalbumin; and e) caprine casein.

58. The method of claim 46 wherein said non-human transgenic mammal is selected from a group of mammals consisting of: a) caprine; b) bovine; c) porcine; d) rodent; and e) ovine.

59. The method of claim 46 wherein said modified nucleic acid sequence is modified to provide for the expression of a modified amino acid sequence such at least one glycosylation site on said parasite protein or protein fragment thereof produced by said non-human transgenic mammal is eliminated.

60. A transgenic non-human mammal whose germline comprises a modified nucleic acid sequence encoding a parasite protein or fragment thereof operably linked to a promoter which directs expression in a mammary gland, wherein said modified nucleic acid sequence has been modified by replacing at least a portion of an AUUUA mRNA instability motif in a coding sequence as it naturally occurs in a parasite with a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof while encoding the same amino acid as the replaced portion of said AUUUA mRNA instability motif and by replacing one or more AT-containing codons of the nucleic acid sequence of said parasite protein or fragment thereof as it naturally occurs in the parasite with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same amino acid as the replaced codon, wherein said non-human transgenic mammal expresses said parasite protein or fragment thereof in its milk and wherein the naturally occurring nucleic acid sequence encoding said parasite protein or fragment thereof contains at least one AUUUA instability motif; and,

61. The mammal of claim 60, wherein each of said AUUUA mRNA instability motifs present in the naturally occurring nucleic acid have been replaced by a codon or codons preferred by a mammalian cell for the purposes of expression so as to remove said AUUUA mRNA instability motif or prevent said AUUUA mRNA instability motif from destabilizing mRNAs encoding said parasite protein or fragment thereof.

62. The mammal of claim 60, wherein said modified nucleic acid sequence further comprises at least one additional codon other than a first codon replaced to lower AT content or a nucleic acid sequence modification made to eliminate said AUUUA mRNA instability motif which has been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.

63. The mammal of claim 60, wherein all of the codons of the naturally occurring nucleic acid sequence have been replaced with a codon or codons preferred by a mammalian cell for the purposes of expression and encoding the same parasite protein or fragment thereof as found in the naturally occurring nucleic acid sequence.

64. The mammal of claim 60, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level of at least 0.5 mg/ml.

65. The mammal of claim 60, wherein said parasite protein or fragment thereof is expressed in the milk of said non-human transgenic mammal at a level which is between 1.0 mg/ml and 2.0 mg/ml.

66. The mammal of claim 60, wherein said parasite protein or fragment thereof as expressed in said non-human transgenic mammal can be detectably expressed in the milk of said transgenic non-human mammal.

67. The mammal of claim 60, wherein all non-preferred codons are replaced with a codon or codons preferred by a mammalian cell for the purposes of expression.

68. The parasite protein or fragment thereof as produced by the mammal of claim 60.

69. The mammal of claim 60 wherein said parasite protein or fragment thereof is a protein, polypeptide or peptide derived from the Plasmodium falciparum protein MSP-1.

70. The mammal of claim 60 wherein said mammalian cell for the purposes of expression is a mammary epithelial cell.

71. The mammal of claim 60 wherein said promoter is selected from a group of promoters consisting of: a) beta-casein; b) bovine lactoglobulin; c) whey acid promoter; d) alpha-ovalbumin; and e) caprine casein.

72. The mammal of claim 60 wherein said non-human transgenic mammal is selected from a group of mammals consisting of: a) caprine; b) bovine; c) porcine; d) rodent; and e) ovine.

73. The mammal of claim 60 wherein said modified nucleic acid sequence is modified to provide for the expression of a modified amino acid sequence such at least one glycosylation site on said parasite protein or protein fragment thereof produced by said non-human transgenic mammal is eliminated.