U.S. patent application number 10/937372 was filed with the patent office on 2005-03-24 for immunogenic compositions for protection against chlamydial infection.
Invention is credited to Dunn, Pamela L., Murdin, Andrew D..
Application Number | 20050065106 10/937372 |
Document ID | / |
Family ID | 33298239 |
Filed Date | 2005-03-24 |
United States Patent
Application |
20050065106 |
Kind Code |
A1 |
Murdin, Andrew D. ; et
al. |
March 24, 2005 |
Immunogenic compositions for protection against Chlamydial
infection
Abstract
A protective immune response against Chlamydial infection is
achieved by in vivo administration of an immunogenic composition
comprising two vectors and a pharmaceutically-acceptable carrier
therefor. One of the vectors comprises a first nucleotide sequence
encoding a major outer membrane protein (MOMP) of a strain of
Chlamydia, preferably C. pneumoniae, and a promoter sequence
operatively coupled to the first nucleotide sequence for expression
of the MOMP in the host. The other of the vectors comprises a
second nucleotide sequence encoding a 76 kDa protein of a strain of
Chlamydia, preferably C. pneumoniae, and a promoter sequence
operatively coupled to the second nucleotide sequence for
expression of the 76 kDa protein in the host. The protection
efficiency which is achieved by the immunization procedure is
enhanced over that attained with the individual vectors alone.
Inventors: |
Murdin, Andrew D.;
(Newmarket, CA) ; Dunn, Pamela L.; (Mississauga,
CA) |
Correspondence
Address: |
SIM & MCBURNEY
330 UNIVERSITY AVENUE
6TH FLOOR
TORONTO
ON
M5G 1R7
CA
|
Family ID: |
33298239 |
Appl. No.: |
10/937372 |
Filed: |
September 10, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10937372 |
Sep 10, 2004 |
|
|
|
09391606 |
Sep 7, 1999 |
|
|
|
6811783 |
|
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
C07H 21/04 20130101;
A61K 2039/53 20130101; A61K 2039/543 20130101; A61K 39/118
20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Claims
What we claim is:
1. An immunogenic composition for in vivo administration to a host
for the generation in the host of a protective immune response
against Chlamydial infection, comprising: a first vector
comprising: a first nucleotide sequence encoding a major outer
membrane protein (MOMP) of a strain of Chlamydia and a first
promoter sequence operatively coupled to said first nucleotide
sequence for expression of said MOMP in the host; a second vector
comprising: a second nucleotide sequence encoding a 76 kDa protein
of a strain of Chlamydia and a second promoter sequence operatively
coupled to said second nucleotide sequence for expression of said
76 kDa protein in the host; and a pharmaceutically-acceptable
carrier therefor.
2. The immunogenic composition of claim 1 wherein the first
nucleotide sequence encodes a MOMP from Chlamydia pneumoniae.
3. The immunogenic composition of claim 1 wherein the first
nucleotide sequence encodes a MOMP from Chlamydia trachomatis.
4. The immunogenic composition of claim 2 wherein said first
nucleotide sequence has SEQ ID No: 12, 13 or 14.
5. The immunogenic composition of claim 2 wherein said first
nucleotide sequence encodes a MOMP having SEQ ID No: 15 or 16.
6. The immunogenic composition of claim 2 wherein the first
promoter is a cytomegalovirus promoter.
7. The immunogenic composition of claim 1 wherein the second
nucleotide sequence encodes a 76 kDa protein from Chlamydia
pneumoniae.
8. The immunogenic composition of claim 1 wherein the second
nucleotide sequence encodes a 76 kDa protein from Chlamydia
trachomatis.
9. The immunogenic composition of claim 7 wherein said second
nucleotide sequence has SEQ ID No: 1, 2, 3 or 4.
10. The immunogenic composition of claim 7 wherein said second
nucleotide sequence encodes a 76 kDa protein having a molecular
size of about 35 kDa and having SEQ ID No: 7.
11. The immunogenic composition of claim 7 wherein said second
nucleotide sequence encodes a 76 kDa protein having a molecular
size of about 60 kDa and having SEQ ID No: 8 or 9.
12. The immunogenic composition of claim 7 wherein said second
promoter is a cytomegalovirus promoter.
13. The immunogenic composition of claim 1 wherein said first
vector is a plasmid vector.
14. The immunogenic composition of claim 13 wherein said first
plasmid vector has the identifying characteristics of pCAMOMP as
seen in FIG. 4.
15. The immunogenic composition of claim 1 wherein said second
vector is a plasmid vector.
16. The immunogenic composition of claim 15 wherein said second
plasmid vector has the identifying characteristics of pCA76 kDa as
seen in FIG. 2.
17. The immunogenic composition of claim 1 wherein both said first
and second vectors are plasmid vectors.
18. The immunogenic composition of claim 17 wherein said first
plasmid vector is pCAMOMP and said second plasmid vector is pCA76
kDa.
19. The immunogenic composition of claim 1 wherein said first and
second vectors are present in amounts such that the individual
protective effect of each vector upon administration of the
composition to the host is not adversely affected by the other.
20. The immunogenic composition of claim 1 wherein said first and
second vectors are present in amounts such that an enhanced
protective effect is achieved in comparison to the individual
vectors alone.
21. A method of immunizing a host against disease caused by
infection with a strain of Chlamydia, which comprises administering
to said host an effective amount of an immunogenic composition of
claim 1.
22. The method of claim 21 wherein said immunogenic composition is
administered intranasally.
23. The method of claim 21 wherein said host is a human host.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to immunogenic compositions
for protection against disease caused by Chlamydia infection in
mammals, including humans.
BACKGROUND OF THE INVENTION
[0002] Chlamydiae are procaryotes. They exhibit morphologic and
structural similarities to gram negative bacteria, including a
trilaminar outer membrane, which contains lipopolysaccharide and
several membrane proteins Chlamydiae are differentiated from other
bacteria by their morphology and by a unique developmental cycle.
They are obligate intracellular parasites with a unique biphasic
life cycle consisting of a metabolically inactive but infectious
extracellular stage and a replicating but non-infectious
intracellular stage. The replicative stage of the life-cycle takes
place within a membrane-bound inclusion which sequesters the
bacteria away from the cytoplasm of the infected host cell.
[0003] Because chlamydiae are small and multiply only within
susceptible cells, they were long thought to be viruses. However,
they have many characteristics in common with other bacteria: (1)
they contain both DNA and RNA, (2) they divide by binary fission,
(3) their cell envelopes resemble those of other gram-negative
bacteria, (4) they contain ribosomes similar to those of other
bacteria, and (5) they are susceptible to various antibiotics.
Chlamydiae can be seen in the light microscope, and the genome is
about one-third the size of the Escherichia coli genome.
[0004] Many different strains of chlamydiae have been isolated from
birds, man and other mammals, and these strains can be
distinguished on the basis of host range, virulence, pathogenesis,
and antigenic composition. There is strong homology of DNA within
each species, but surprisingly little between species, suggesting
long-standing evolutionary separation.
[0005] C. trachomatis has a high degree of host specificity, being
almost completely limited to man, and causes ocular and
genitourinary infections of widely varying severity. In contrast,
C. psittaci strains are rare in man but are found in a wide range
of birds and also in wild, domestic, and laboratory mammals, where
they multiply in cells of many organs.
[0006] C. pneumoniae is a common human pathogen, originally
described as the TWAR strain of C. psittaci, but subsequently
recognized to be a new species. C. pneumoniae is antigenically,
genetically, and morphologically distinct from other Chlamydia
species (C. trachomatis, C. pecorum and C. psittaci). It shows 10%
or less DNA sequence homology with either of C. trachomatis or C.
psittaci and so far appears to consist of only a single strain,
TWAR.
[0007] C. pneumoniae is a common cause of community acquired
pneumonia, less frequent only than Streptococcus pneumoniae and
Mycoplasma pneumoniae (refs. 1 and 2--Throughout this application,
various references are referred to in parenthesis to more fully
describe the state of the art to which this invention pertains.
Full bibliographic information for each citation is found at the
end of the specification, immediately preceding the claims. The
disclosure of these references are hereby incorporated by reference
into the present disclosure). C. pneumoniae can also cause upper
respiratory tract symptoms and disease, including bronchitis and
sinusitis (refs. 1 to 4). The great majority of the adult
population (over 60%) has antibodies to C. pneumoniae (ref. 5),
indicating past infection which was unrecognized or
asymptomatic.
[0008] C. pneumoniae infection usually presents as an acute
respiratory disease (i.e., cough, sore throat, hoarseness, and
fever; abnormal chest sounds on auscultation). For most patients,
the cough persists for 2 to 6 weeks, and recovery is slow. In
approximately 10% of these cases, upper respiratory tract infection
is followed by bronchitis or pneumonia. Furthermore, during a C.
pneumoniae epidemic, subsequent co-infection with pneumococcus has
been noted in about half of these pneumonia patients, particularly
in the infirm and the elderly. As noted above, there is more and
more evidence that C. pneumoniae infection is also linked to
diseases other than respiratory infections.
[0009] The reservoir for the organism is presumably people. In
contrast to C. psittaci infections, there is no known bird or
animal reservoir. Transmission has not been clearly defined, but
may result from direct contact with secretions, from formites, or
from airborne spread. There is a long incubation period, which may
last for many months. Based on analysis of epidemics, C. pneumoniae
appears to spread slowly through a population (case-to-case
interval averaging 30 days) because infected persons are
inefficient transmitters of the organism. Susceptibility to C.
pneumoniae is universal. Reinfections occur during adulthood,
following the primary infection as a child. C. pneumoniae appears
to be an endemic disease throughout the world, noteworthy for
superimposed intervals of increased incidence (epidemics) that
persist for 2 to 3 years. C. trachomatis infection does not confer
cross-immunity to C. pneumoniae. Infections are easily treated with
oral antibiotics, tetracycline or erythromycin (2 g/d, for at least
10 to 14 d). A recently developed drug, azithromycin, is highly
effective as a single-dose therapy against chlamydial
infections.
[0010] In most instances, C. pneumoniae infection is mild and
without complications, and up to 90% of infections are subacute or
unrecognized. Among children in industrialized countries,
infections have been thought to be rare up to the age of 5 years,
although a recent study has reported that many children in this age
group show PCR evidence of infection despite being seronegative,
and estimates a prevalence of 17 to 19% in 2 to 4 years old (ref.
6). In developing countries, the seroprevalence of C. pneumoniae
antibodies among young children is elevated, and there are
suspicions that C. pneumoniae may be an important cause of acute
lower respiratory tract disease and mortality for infants and
children in tropical regions of the world.
[0011] From seroprevalence studies and studies of local epidemics,
the initial C. pneumoniae infection usually happens between the
ages of 5 and 20 years. In the USA, for example, there are
estimated to be 30,000 cases of childhood pneumonia each year
caused by C. pneumoniae. Infections may cluster among groups of
children or young adults (e.g., school pupils or military
conscripts).
[0012] C. pneumoniae causes 10 to 25% of community-acquired lower
respiratory tract infections (as reported from Sweden, Italy,
Finland, and the USA). During an epidemic, C. pneumonia infection
may account for 50 to 60% of the cases of pneumonia. During these
periods, also, more episodes of mixed infections with S. pneumoniae
have been reported.
[0013] Reinfection during adulthood is common; the clinical
presentation tends to be milder. Based on population seroprevalence
studies, there tends to be increased exposure with age, which is
particularly evident among men. Some investigators have speculated
that a persistent, asymptomatic C. pneumoniae infection state is
common.
[0014] In adults of middle age or older, C. pneumoniae infection
may progress to chronic bronchitis and sinusitis. A study in the
USA revealed that the incidence of pneumonia caused by C.
pneumoniae in persons younger than 60 years is 1 case per 1,000
persons per year; but in the elderly, the disease incidence rose
three-fold. C. pneumoniae infection rarely leads to
hospitalization, except in patients with an underlying illness.
[0015] Of considerable importance is the association of
atherosclerosis and C. pneumoniae infection. There are several
epidemiological studies showing a correlation of previous
infections with C. pneumoniae and heart attacks, coronary artery
and carotid artery disease (refs. 7 to 11). Moreover, the organisms
has been detected in atheromas and fatty streaks of the coronary,
carotid, peripheral arteries and aorta (refs. 12 to 16). Viable C.
pneumoniae has been recovered from the coronary and carotid artery.
(refs, 17, 18). Furthermore, it has been shown that C. pneumoniae
can induce changes of atherosclerosis in a rabbit model (ref. 19).
Taken together, these results indicate that it is highly probable
that C. pneumoniae can cause atherosclerosis in humans, though the
epidemiological importance of chlamydial atherosclerosis remains to
be demonstrated.
[0016] A number of recent studies have also indicated an
association between C. pneumoniae infection and asthma. Infection
has been linked to wheezing, asthmatic bronchitis, adult-onset
asthma and acute exacerbation of asthma in adults, and small-scale
studies have shown that prolonged antibiotic treatment was
effective at greatly reducing the severity of the disease in some
individuals (refs. 20 to 25).
[0017] In light of these results, a protective vaccine against
disease caused by C. pneumoniae infection would be of considerable
importance. There is not yet an effective vaccine for human C.
pneumoniae infection. Nevertheless, studies with C. trachomatis and
C. psittaci indicate that this is an attainable goal. For example,
mice which have recovered from a lung infection with C. trachomatis
are protected from infertility induced by a subsequent vaginal
challenge (ref. 26). Similarly, sheep immunized with inactivated C.
psittaci were protected from subsequent chlamydial-induced
abortions and stillbirths (ref. 27). Protection from chlamydial
infections has been associated with Th1 immune responses,
particularly the induction of INF.gamma.-producing CD4+ T cells
(ref. 28). The adoptive transfer of CD4+ cell lines or clones to
nude or SCID mice conferred protection from challenge or cleared
chronic disease (refs. 29, 30) and in vivo depletion of CD4+ T
cells exacerbated disease post-challenge (refs. 31, 32). However,
the presence of sufficiently high titres of neutralizing antibody
at mucosal surfaces can also exert a protective effect (ref.
33).
[0018] The extent of antigenic variation within the species C.
pneumoniae is not well characterized. Serovars of C. trachomatis
are defined on the basis of antigenic variation in major outer
membrane proteins (MOMP), but published C. pneumoniae MOMP gene
sequences show no variation between several diverse isolates of the
organism (refs. 34, 35, 36). Regions of the protein known to be
conserved in other chlamydial MOMPs are conserved in C. pneumoniae
(refs. 34, 35). One study has described a strain of C. pneumoniae
with a MOMP of greater that usual molecular weight, but the gene
for this has not been sequenced (ref. 1). Partial sequences of
outer membrane protein 2 from nine diverse isolates were also found
to be invariant (ref. 17). The genes for HSP60 and HSP70 show
little variation from other chlamydial species, as would be
expected. The gene encoding a 76 kDa antigen has been cloned from a
single strain of C. pneumoniae. It has no significant similarity
with other known chlamydial genes (ref. 4).
[0019] Many antigens recognized by immune sera to C. pneumoniae are
conserved across all chlamydiae, but 98kDa, 76 kDa and 54 kDa
proteins may be C. pneumoniae-specific (refs. 2, 4, 37).
Immunoblotting of isolates with sera from patients does show
variation of blotting patterns between isolates, indicating that
serotypes C. pneumoniae may exist (refs. 1, 17). However, the
results are potentially confounded by the infection status of the
patients, since immunoblot profiles of a patient's sera change with
time post-infection. An assessment of the number and relative
frequency of any serotypes, and the defining antigens, is not yet
possible.
[0020] Thus, a need remains for effective compositions for
preventing and treating Chlamydia infections.
SUMMARY OF THE INVENTION
[0021] The present invention provides a novel approach to
immunizing against Chlamydial infection based on nucleic acid
immunization. It has surprisingly been found that the
administration of a combination of nucleotide sequences encoding
two different chlamydial proteins provides an enhanced protection
efficacy.
[0022] Accordingly, in one aspect of the present invention, there
is provided an immunogenic composition for in vivo administration
to a host for the generation in the host of a protective immune
response against Chlamydial infection, comprising a first vector
comprising a first nucleotide sequence encoding a major outer
membrane protein (MOMP) of a strain of Chlamydia and a first
promoter sequence operatively coupled to said first nucleotide
sequence for expression of said MOMP in the host; a second vector
comprising a second nucleotide sequence encoding a 76 kDa protein
of a strain of Chlamydia and a second promoter sequence operatively
coupled to said second nucleotide sequence for expression of said
76 kDa protein in the host; and a pharmaceutically-acceptable
carrier therefor.
[0023] The first nucleotide sequence may encode a MOMP from any
strain of Chlamydia, preferably from C. pneumoniae but also
including C. trachomatis. The second nucleotide sequence encoding
the MOMP protein of C. pneumoniae may have SEQ ID No: 12, 13 or 14
or may encode a MOMP having a SEQ ID No: 15 or 16.
[0024] The first promoter which is employed may be a
cytomegalovirus promoter, although any other convenient promoter
may be employed.
[0025] The second nucleotide sequence may encode a 76 kDa protein
from any strain of Chlamydia, preferably from C. pneumoniae but
also including C. trachomatis. The second nucleotide sequence
encoding the 76 kDa protein of C. pneumoniae may have SEQ ID No: 1,
2, 3 or 4. The second nucleotide sequence may encode a 76 kDa
protein having a molecular size of about 35 kDa and having SEQ ID
No: 7 or may encode a 76 kDa protein having a molecular size of
about 60 kDa and having SEQ ID No: 8 or 9.
[0026] The second promoter which is employed may be a
cytomegalovirus promoter, although any other convenient promoter
may be employed.
[0027] The first vector preferably comprises a plasmid vector and
specifically may be pCAMOMP. Similarly the second vector preferably
comprises a plasmid vector and specifically may be pCA76 kDa. Most
preferably, both the first and second vectors are plasmid vectors
and specifically the combination of pCAMOMP and pCA76 kDa.
[0028] The two vectors are used in an immunogenic composition along
with any convenient pharmaceutically-acceptable carrier. As noted
above, the uses of the combination of two vectors produces an
enhanced protection efficacy in comparison to the individual
vectors alone. Accordingly, the first and second vectors preferably
are present in the immunogenic composition in amounts such that the
individual protective effect of each vector upon administration to
the composition to the host is not adversely affected by the
other.
[0029] The present invention, in a further aspect thereof, provides
a method of immunizing a host against disease caused by infection
with a strain of Chlamydia, which comprises administering to the
host, which may be a human host, an effective amount of an
immunogenic composition provided herein. The immunogenic
composition preferably is administered intranasally.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] The present invention will be further understood from the
following description with reference to the drawings, in which:
[0031] FIG. 1 shows the nucleotide sequence of C. pneumoniae 76 kDa
gene (SEQ ID No: 1--complete sequence; SEQ ID No: 2-5' encoding
region; SEQ ID No: 3-3' encoding region including Myc and His
encoding regions; SEQ ID No: 4-3' encoding region excluding Myc and
His encoding regions; SEQ ID No: 5--Myc encoding region; SEQ ID No:
6--His encoding region) and the deduced amino acid sequences of two
open reading frames of the 76 kDa protein (SEQ ID NO: 7--upstream
reading frame; SEQ ID No: 8--downstream reading frame including Myc
and His regions; SEQ ID No: 9--downstream reading frame excluding
Myc and His regions; SEQ ID No: 10--Myc region; SEQ ID No: 11--His
region);
[0032] FIG. 2 shows a scheme of construction of plasmid pCA76
kDa;
[0033] FIG. 3 shows the nucleotide sequence of the C. pneumoniae
MOMP gene (SEQ ID No: 12--complete sequence; SEQ ID No:
13--encoding sequence including Myc and His encoding regions; SEQ
ID No: 14--encoding sequence excluding Myc and His encoding
regions) and the deduced amino acid sequence of the MOMP protein
(SEQ ID No: 15--including Myc and His regions; SEQ ID No:
16--excluding Myc and His regions);
[0034] FIG. 4 shows a scheme of the construction of plasmid
pCAMOMP; and
[0035] FIG. 5 illustrates the protective efficacy against C.
pneumoniae lung challenge in Balb/c mice following DNA immunization
with pCAMOMP plus pCA76 kDa, in comparison to controls, wherein the
individual data points (open diamonds) are shown for each animal,
as well as the mean (solid squares) and standard deviation for each
group.
GENERAL DESCRIPTION OF INVENTION
[0036] As noted above, the present invention is directed to
protecting a host against chlamydial infection by administering to
the host an immunogenic composition containing two vectors,
preferably plasmid vectors, each of which contains nucleotide
sequence encoding a different protein of a strain of Chlamydia.
[0037] To illustrate the invention, a first plasmid vector was
constructed containing the MOMP gene from C. pneumoniae and a
second plasmid vector was constructed containing the 76 kDa protein
gene from C. pneumoniae. While the invention is illustrated by the
use of such plasmid vectors, other vectors containing such genes
may be employed for administration to the host for expression of
the encoded proteins in the host. Such other vectors may include
live viral vectors, such as adenoviruses, alphaviruses including
Semliki Forest virus and poxviruses including avipox and canary pox
viruses as well as bacterial vectors, such as Shigella, Salmonella,
Vibrio cholerae, Lactobacillus, Bacille Bili de Calmette-Gurin
(BCG) and Streptococcus.
[0038] One of the vectors employed herein contains a nucleic acid
molecule which codes for a Chlamydial protein known in the art as
the "76 kDa protein" (ref. 4). The latter terminology is utilized
herein to refer to the protein identified in the art. Research has
determined that the encoding nucleotide sequence for this protein
in fact encodes two opening reading frames, one encoding a protein
of approximately 35 kDa in length (SEQ ID No: 7) and the other
encoding a protein of approximately 60 kDa in length (SEQ ID No:
9).
[0039] It has been found that, if the complete nucleotide sequence
(SEQ ID No: 1) is incorporated into a suitable expression vector,
then only the 35 kDa protein is expressed. If, however, the
nucleotide sequence encoding the 60 kDa protein alone (SEQ ID No:
4) is incorporated into a suitable expression vector, then that
protein also can be expressed. Both proteins have been found to be
immunogenic and protective with the 35 kDa protein exhibiting a
stronger protective effect than the 60 kDa protein (U.S. Patent
Application No. 60/132,270 filed May 3, 1999; U.S. Patent
Application No. 60/141,276 filed Jun. 30, 1999, assigned to the
Assignee hereof and the disclosures of which are incorporated
herein by reference).
[0040] Any convenient plasmid vector may be used for the MOMP gene
and the 76 kDa protein gene, such as the pcDNA3.1 expression vector
(Invitrogen, San Diego, Calif., USA) containing the cytomegalovirus
promoter. Schemes for construction of the pCA76 kDa plasmid vector
of 8594 bp size and of the pCAMOMP plasmid vector of 7.6 kb in
size, which include downstream DNA sequences coding for Myc and His
tags, are shown in FIGS. 2 and 4 respectively and described in
detail below.
[0041] The respective plasmids are formulated into an immunogenic
composition in conjunction with a suitable
pharmaceutically-acceptable carrier for administration to a host,
such as a human host. The immunogenic composition may be
administered in any convenient manner to the host, such as
intramuscularly or intranasally, although other routes of
administration may be used, as discussed below. The data presented
herein and described in detail below demonstrates that DNA
immunization with both the C. pneumoniae MOMP and 76 kDa protein
genes elicits a strong protective immune response. The effect which
is obtained is achieved without the use of adjuvant or other
stimulation of immune response, such as cardiotoxin, although such
materials may be used, if desired, as discussed below. In addition,
the use of immunomodulation is not excluded from the scope of the
invention. For example, it may be desirable to coadminister DNA
that expresses immunoregulator cytokines (ref. 38).
[0042] As may be seen from the data below, by utilizing both the
MOMP gene and the 76 kDa protein gene, there is obtained a
protective immune response which is significantly greater than that
achieved using the individual genes alone. The coadministration of
the two genes does not result in any interference to the immune
response of the individual genes.
[0043] There has previously been described in WO 98/02546, assigned
to University of Manitoba and the disclosure of which is
incorporated herein by reference, the use of the MOMP gene for DNA
immunization. The improved results obtained herein using a
combination of the MOMP gene and the 76 kDa protein gene
demonstrate the use of multiple antigen genes from chlamydiae to
augment the level of protective immunity achieved by DNA
immunization. These results are more encouraging than those
obtained using recombinant MOMP protein or synthetic peptides as
the immunogen.
[0044] Nucleotide sequences, e.g., DNA molecules, can easily be
retrieved by polymerase chain reaction (PCR) amplification of
genomic bacterial DNA extracted by conventional methods. This
involves the use of synthetic oligonucleotide primers matching
upstream and downstream of the 5' and 3' ends of the encoding
domain. Suitable primers can be designed according to the
nucleotide sequence information provided. Typically, a primer can
consist of 10 to 40, preferably 15 to 25 nucleotides. It may be
also advantageous to select primers containing C and G nucleotides
in a proportion sufficient to ensure efficient hybridization; e.g.,
an amount of C and G nucleotides of at least 40%, preferably 50% of
the total nucleotide amount.
[0045] It is clearly apparent to one skilled in the art that the
various embodiments of the present invention have many applications
in the fields of vaccination and treatment of chlamydial infection.
A further non-limiting discussion of such uses is further presented
below.
[0046] 1. Vaccine Preparation and Use
[0047] Immunogenic compositions, suitable to be used as vaccines,
may be prepared from the MOMP gene and the 76 kDa protein gene and
vectors as disclosed herein. The vaccine elicits an immune response
in a subject which includes the production of anti-MOMP and anti-76
kDa protein antibodies. Immunogenic compositions, including
vaccines, containing the nucleic acid may be prepared as
injectables, in physiologically-acceptabl- e liquid solutions or
emulsions for polynucleotide administration.
[0048] The nucleic acid may be associated with liposomes, such as
lecithin liposomes or other liposomes known in the art, as a
nucleic acid liposome (for example, as described in WO 93/24640) or
the nucleic acid may be associated with an adjuvant, as described
in more detail below. Liposomes comprising cationic lipids interact
spontaneously and rapidly with polyanions, such as DNA and RNA,
resulting in liposome/nucleic acid complexes that capture up to
100% of the polynucleotide. In addition, the polycationic complexes
fuse with cell membranes, resulting in an intracellular delivery of
polynucleotide that bypasses the degradative enzymes of the
lysosomal compartment.
[0049] Published PCT application WO 94/27435 describes compositions
for genetic immunization comprising cationic lipids and
polynucleotides. Agents which assist in the cellular uptake of
nucleic acid, such as calcium ions, viral proteins and other
transfection facilitating agents, may advantageously be used.
[0050] Polynucleotide immunogenic preparations may also be
formulated as microcapsules, including biodegradable time-release
particles. Thus, U.S. Pat. No. 5,151,264 describes a particulate
carrier of a phospholipid/glycolipid/polysaccharide nature that has
been termed Bio Vecteurs Supra Moleculaires (BVSM). The particulate
carriers are intended to transport a variety of molecules having
biological activity in one of the layers thereof.
[0051] U.S. Pat. No. 5,075,109 describes encapsulation of the
antigens trinitrophenylated keyhole limpet hemocyanin and
staphylococcal enterotoxin B in 50:50 poly
(DL-lactideco-glycolide). Other polymers for encapsulation are
suggested, such as poly(glycolide), poly(DL-lactide-co-glycolide),
copolyoxalates, polycaprolactone, poly(lactide-co-caprolactone),
poly(esteramides), polyorthoesters and poly(8-hydroxybutyric acid),
and polyanhydrides.
[0052] Published PCT application WO 91/06282 describes a delivery
vehicle comprising a plurality of bioadhesive microspheres and
antigens. The microspheres being of starch, gelatin, dextran,
collagen or albumin. This delivery vehicle is particularly intended
for the uptake of vaccine across the nasal mucosa. The delivery
vehicle may additionally contain an absorption enhancer.
[0053] The vectors may be mixed with pharmaceutically acceptable
excipients which are compatible therewith. Such excipients may
include, water, saline, dextrose, glycerol, ethanol, and
combinations thereof. The immunogenic compositions and vaccines may
further contain auxiliary substances, such as wetting or
emulsifying agents, pH buffering agents, or adjuvants to enhance
the effectiveness thereof. Immunogenic compositions and vaccines
may be administered parenterally, by injection subcutaneously,
intravenously, intradermally, intraperitoneally or intramuscularly,
possibly following pretreatment of the injection site with a local
anesthetic.
[0054] Alternatively, the immunogenic compositions formed according
to the present invention, may be formulated and delivered in a
manner to evoke an immune response at mucosal surfaces. Thus, the
immunogenic composition may be administered to mucosal surfaces by,
for example, the ocular, pulminary, nasal or oral (intragastric)
routes. Alternatively, other modes of administration including
rectal, vaginal or urinary tract as well as suppositories may be
desirable. For suppositories, binders and carriers may include, for
example, polyalkylene glycols or triglycerides. Oral formulations
may include normally employed incipients, such as, for example,
pharmaceutical grades of saccharine, cellulose and magnesium
carbonate.
[0055] The immunogenic preparations and vaccines are administered
in a manner compatible with the dosage formulation, and in such
amount as is therapeutically effective, protective and immunogenic.
The quantity to be administered depends on the subject to be
treated, including, for example, the capacity of the individual's
immune system to synthesize the MOMP and 76 kDa proteins and
antibodies thereto, and if needed, to produce a cell- mediated
immune response. Precise amounts of active ingredient required to
be administered depend on the judgement of the practitioner.
However, suitable dosage ranges are readily determinable by one
skilled in the art and may be of the order of about 1 .mu.g to
about 1 mg of the vectors.
[0056] Suitable regimes for initial administration and booster
doses are also variable, but may include an initial administration
followed by subsequent administrations. The dosage may also depend
on the route of administration and will vary according to the size
of the host. A vaccine which protects against only one pathogen is
a monovalent vaccine. Vaccines which contain antigenic material of
several pathogens are combined vaccines and also belong to the
present invention. Such combined vaccines contain, for example,
material from various pathogens or from various strains of the same
pathogen, or from combinations of various pathogens.
[0057] Immunogenicity may be significantly improved if the vectors
are co-administered with adjuvants, commonly used as 0.05 to 0.1
percent solution in phosphate-buffered saline. Adjuvants enhance
the immunogenicity of an antigen but are not necessarily
immunogenic themselves. Adjuvants may act by retaining the antigen
locally near the site of administration to produce a depot effect
facilitating a slow, sustained release of antigen to cells of the
immune system. Adjuvants can also attract cells of the immune
system to an antigen depot and stimulate such cells to elicit
immune responses.
[0058] Immunostimulatory agents or adjuvants have been used for
many years to improve the host immune responses to, for example,
vaccines. Thus, adjuvants have been identified that enhance the
immune response to antigens. Some of these adjuvants are toxic,
however, and can cause undesirable side-effects, making them
unsuitable for use in humans and many animals. Indeed, only
aluminum hydroxide and aluminum phosphate (collectively commonly
referred to as alum) are routinely used as adjuvants in human and
veterinary vaccines.
[0059] A wide range of extrinsic adjuvants and other
immunomodulating material can provoke potent immune responses to
antigens. These include saponins complexed to membrane protein
antigens to produce immune stimulating complexes (ISCOMS), pluronic
polymers with mineral oil, killed mycobacteria in mineral oil,
Freund's complete adjuvant, bacterial products, such as muramyl
dipeptide (MDP) and lipopolysaccharide (LPS), as well as Quil A
derivatives and components thereof, QS 21, calcium phosphate,
calcium hydroxide, zinc hydroxide, an octodecyl ester of an amino
acid, ISCOPREP, DC-chol, DDBA and polyphosphazene. Advantageous
combinations of adjuvants are described in copending U.S. patent
applications Ser. No.: 08/261,194 filed Jun. 16, 1994 and Ser. No.
08/483,856 filed Jun. 7, 1995, assigned to the assignee hereof and
the disclosures of which are incorporated herein by reference
thereto (WO 95/34308).
[0060] In particular embodiments of the present invention, the
vectors may be delivered in conjunction with a targeting molecule
to target the vectors to selected cells including cells of the
immune system.
[0061] The vectors may be delivered to the host by a variety of
procedures, for example, Tang et al. (ref. 39) disclosed that
introduction of gold microprojectiles coated with DNA encoding
bovine growth hormone (BGH) into the skin of mice resulted in
production of anti-BGH antibodies in the mice, while Furth et al.
(ref. 40) showed that a jet injector could be used to transfect
skin, muscle, fat and mammary tissues of living animals. See also
U.S. Pat. Nos. 4,245,050 and 5,015,580 and WO 94/24263.
EXAMPLES
[0062] The above disclosure generally describes the present
invention. A more complete understanding can be obtained by
reference to the following specific examples. These examples are
described solely for purposes of illustration and are not intended
to limit the scope of the invention. Changes in form and
substitution of equivalents are contemplated as circumstances may
suggest or render expedient. Although specific terms have been
employed herein, such terms are intended in a descriptive sense and
not for purposes of limitation.
Example 1
[0063] This Example illustrates the preparation of a plasmid vector
pCA76 kDa containing the 76 kDa protein gene.
[0064] The 76 kDa protein gene was amplified from Chlamydia
pneumoniae (CM1) genomic DNA by polymerase chain reaction (PCR)
using a 5' primer (5' GCTCTAGACCGCCATGACAAAAAAACAT TATGCTTGGG 3')
(SEQ ID No: 9) and 3' primer (5' CGGGATCCATAGAACTTGCTGCAGCGGG 3')
(SEQ ID No: 10). The 5' primer contains a Xba I restriction site, a
ribsome binding site, an initiation codon and a sequence close to
the 5' end of the 76 kDa protein coding sequence. The 3' primer
includes the sequence encoding the C-terminal sequence of the 76
kDa protein and a Bam HI restriction site. The stop codon was
excluded and an additional nucleotide was inserted to obtain an
inframe C-terminal fusion with the Histidine tag. The presence of a
stop codon at nucleotide 828 of the amplified sequence means that
only a partial 76 kDa protein is expressed.
[0065] After amplification, the PCR fragment was using QIAquick.TM.
PRC purification kit (Qiagen) and then digested with Xba I and Bam
HI and cloned into the pCA-Myc-His eukaryotic expression vector as
described in Example 3 below (FIG. 2) with transcription under
control of the human CMV promoter.
Example 2
[0066] This Example illustrates the preparation of a plasmid vector
pCAMOMP containing the MOMP protein gene.
[0067] The MOMP protein gene was amplified from Chlamydia
pneumoniae (CM1) genomic DNA by polymerase chain reaction (PCR)
using a 5' primer (5' CCCGGATATCCCACCATGTTGCCTGTAGG GAACCCTTC 3')
(SEQ ID No: 11) and a 3' primer (5' GGGGTACCGGAATCTGAACTGACCAGATACG
3') (SEQ ID No: 12). The 5' primer contains a EcoRV restriction
site, a ribosome binding site, an initiation codon and a sequence
encoding the N-terminal sequence of the mature MOMP. The 3' primer
includes the sequence encoding the C-terminal sequence of the MOMP
and a Kpn I restriction site. The DNA sequence encoding the leader
peptide was excluded, the stop codon was excluded and an additional
nucleotide was inserted to obtain an in-frame C-terminal fusion
with the Histdine tag.
[0068] After amplification, the PCR fragment was purified using
QIAquick.TM. PCR purification kit (Qiagen) and then digested with
Eco RV and Kpn I and cloned into the pCA-Myc-His eukaryotic
expression vector described in Example 3 (FIG. 4) with
transcription under control of the human CMV promoter.
Example 3
[0069] This Example illustrates the preparation of the eukaryotic
expression vectors pCA76 kDa and pCAMOMP.
[0070] Plasmid pcDNA3.1 (-) (Invitrogen) was restricted with Spe I
and Bam HI to remove the CMV promoter and the remaining vector
fragment was isolated. The CMV promoter and intron A from plasmid
VR-1012 (Vical) was isolated on a Spe I/Bam HI fragment. The
fragments were ligated together to produce plasmid pCA/Myc-His, as
seen in FIG. 2.
[0071] The Xba I/Bam HI restricted PCR fragment containing the 76
kDa protein gene (Example 1) was ligated into the Xba I and Bam HI
restricted plasmid pCA/Myc-His to produce plasmid pCA76 kDa (FIG.
2).
[0072] The Eco RV/Kpn I restricted PCR fragment containing the MOMP
gene (Example 2) was ligated into Eco RV/Kpn I restricted
pCA/Myc-His to produce plasmid pCAMOMP (FIG. 4).
[0073] The resulting plasmids, pCA76 kDa and pCAMOMP, were
transferred by electroporation into E. coli XL-1 blue (Stratagene)
which was grown in LB broth containing 50 .mu.g/ml of
carbenicillin. The plasmids were isolated by Endo Free Plasmid Giga
Kit.TM. (Qiagen) large scale DNA purification system. DNA
concentration was determined by absorbance at 260 nm and the
plasmid was verified after gel electrophoresis and Ethidium bromide
staining and comparison to molecular weight standards. The 5' and
3' ends of the gene were verified by sequencing using a LiCor model
4000 L DNA sequencer and IRD-800 labelled primers.
Example 4
[0074] This Example illustrates the immunization of mice to achieve
protection against an intranasal challenge by C. pneumoniae.
[0075] It has been previously demonstrated that mice are
susceptible to intranasal infection with different isolates of C.
pneumoniae (ref. 41). Strain AR-39 (ref. 42) was used in Balb/c
mice as a challenge infection model to examine the capacity of
chlamydia gene products delivered as naked DNA to elicit a
protective response against a sublethal C. pneumoniae lung
infection. Protective immunity is defined as an accelerated
clearance of pulmonary infection.
[0076] Groups of 7 to 9 week old male Balb/c mice (5 to 9 per
group) were immunized intramuscularly (i.m.) and intranasally
(i.n.) with plasmids pCA76 kDa and pCAMOMP containing the coding
sequences of C. pneumoniae 76 kDa and MOMP, respectively, prepared
as described in Example 3. Saline or plasmid vectors containing
non-protective inserted chlamydial genes, namely pCAI116 and
pCAI178,were given to groups of control animals.
[0077] The constructs pCAI116 and pCAI178 are identical to pCA76
kDa and pCAMOMP except that the nucleotide sequence encoding the
partial 76 kDa protein or MOMP is replaced with a C. pneumoniae
nucleotide sequence encoding, respectively, a possible inclusion
membrane protein and a nucleoside 5'-diphosphate
phosphotransferase, respectively.
[0078] For i.m. immunization, alternate left and right quadriceps
were injected with 100 .mu.g of each DNA construct in 50 .mu.l of
PBS on three occasions at 0, 3, and 6 weeks. For i.n. immunization,
anaesthetized mice aspirated 50 .mu.l of PBS containing 50 .mu.g of
each DNA construct on three occasions at 0, 3, and 6 weeks. At week
8, immunized mice were inoculated i.n. with 5.times.10.sup.5 IFU of
C. pneumoniae, strain AR39, in 100 .mu.l of SPG buffer to test
their ability to limit the growth of a sublethal C. pneumoniae
challenge.
[0079] Lungs were taken from mice at day 9 post-challenge and
immediately homogenized in SPG buffer (7.5% sucrose, 5 mM
glutamate, 12.5 mM phosphate, pH 7.5). The homogenate was stored
frozen at -70.degree. C. until assay. Dilutions of the homogenate
were assayed for the presence of infectious chlamydia by
inoculation onto monolayers of susceptible cells. The inoculum was
centrifuged onto the cells at 3000 rpm for 1 hour, then the cells
were incubated for three days at 35.degree. C. in the presence of 1
.mu.g/ml cycloheximide. After incubation, the monolayers were fixed
with formalin and methanol, then immunoperoxidase stained for the
presence of Chlamydial inclusions using convalescent sera from
rabbits infected with C. pneumoniae and metal-enhanced DAB as a
peroxidase substrate.
[0080] FIG. 5 and Table 1 contain the results obtained and show
that mice immunized i.n. and i.m. with both pCA76 kDa and pCAMOMP
had chlamydial lung titers less than 6700 in 6 of 6 cases, whereas
the range of values for control mice with saline were 15,000 to
106,100 IFU/lung in 20 out of 23 cases (mean 49,000) and 12,600 to
80,600 IFU/lung in 11 out of 12 cases (mean 33,500 to 47,000) for
mice immunized with the vectors containing non-protective genes
(Table 1). The mice immunized with only the pCAMOMP alone showed
lung titres in the range of 5800 to 18,700 in 5 out of 6 cases
(mean 12,600) and mice immunized with pCA76 kDa alone showed
similar titres in the range of 6,300 to 18,200 in 5 out of 6 cases
(mean 7,400). The increased protection afforded by the combination
of the two constructs is surprising in light of other failures due
to antigen competition.
1 TABLE 1 BACTERIAL LOAD (INCLUSION FORMING UNITS PER LUNG) IN THE
LUNGS OF BALB/C MICE IMMUNIZED WITH VARIOUS DNA IMMUNIZATION
CONSTRUCTS IMMUNIZING CONSTRUCT pCAMOMP + Saline pCAI116 pCAI178
pCAMOMP pCA76kDa pCA76kDa MOUSE Day 9 Day 9 Day 9 Day 9 Day 9 Day 9
1 1700 47700 80600 5800 18200 6600 2 36200 12600 31900 30200 6300
5300 3 106100 28600 30600 9900 13400 0 4 33500 17700 6500 18700 100
3300 5 70400 77300 53000 0 2400 5200 6 48700 17600 79500 11000 4000
2700 7 600 8 19800 9 29500 10 100000 11 15000 12 56600 13 60300 14
88800 15 30400 16 69300 17 47500 18 96500 19 30200 20 84800 21 3800
22 65900 23 33000 MEAN 49069.57 33583.33 47016.67 12600 7400 3850
SD 32120.48 24832.67 29524.32 10600.19 6981.40 2363.68
SUMMARY OF THE DISCLOSURE
[0081] In summary of this disclosure, the present invention
provides a novel immunization procedure for obtaining an enhanced
protective immune response to Chlamydial infection by employing DNA
immunization using nucleotide sequences encoding a MOMP and a 76
kDa protein of a strain of Chlamydia. Modifications are possible
within the scope of the invention.
REFERENCES
[0082] 1. Grayston et al. (1995), Journal of Infectious Diseases
168:1231
[0083] 2. Campos et al. (1995), Investigation of Ophthalmology and
Visual Science 36:1477
[0084] 3. Grayston et al (1990), Journal of Infectious Diseases
161:618
[0085] 4. Marrie (1993), Clinical Infectious Diseases. 18:501
[0086] 5. Wang et al (1986), Chlamydial infections. Cambridge
University Press, Cambridge. p. 329
[0087] 6. Norman et a I (1998), acta Paediatrica, 87:23-27
[0088] 7. Saikku et al.(1988), Lancet;ii:983
[0089] 8. Thom et al. (1992), JAMA 268:68
[0090] 9. Linnanmaki et al. (1993), Circulation 87:1030
[0091] 10. Saikku et al. (1992), Annals Internal Medicine
116:273
[0092] 11. Melnick et al(1993), American Journal of Medicine
95:499
[0093] 12. Shor et al. (1992), South African. Medical Journal
82:158
[0094] 13. Kuo et al. (1993), Journal of Infectious Diseases
167:841
[0095] 14. Kuo et al. (1993), Arteriosclerosis and Thrombosis
13:1500
[0096] 15. Campbell et al (1995), Journal of Infectious Diseases
172:585
[0097] 16. Chiu et al. Circulation, 1997 (In Press).
[0098] 17. Ramirez et al (1996) Annals of Internal Medicine
125:979
[0099] 18. Jackson et al. Abst. K121, p272, 36th ICAAC, 15-18 Sep.
1996, New Orleans.
[0100] 19. Fong et al (1997) Journal of Clinical Microbiolology
35:48
[0101] 20. Hahn D L, et al. Evidence for Chlamydia pneumoniae
infection in steroid-dependent asthma. Ann Allergy Asthma Immunol.
January 1998; 80(1): 45-49.
[0102] 21. Hahn D L, et al. Association of Chlamydia pneumoniae IgA
antibodies with recently symptomatic asthma. Epidemiol Infect.
December 1996; 117(3): 513-517.
[0103] 22. Bjornsson E, et al. Serology of chlamydia in relation to
asthma and bronchial hyperresponsiveness. Scand J Infect Dis. 1996;
28(1): 63-69.
[0104] 23. Hahn D L. Treatment of Chlamydia pneumoniae infection in
adult asthma: a before-after trial. J Fam Pract. October 1995;
41(4): 345-351.
[0105] 24. Allegra L, et al. Acute exacerbations of asthma in
adults: role of Chlamydia pneumoniae infection. Eur Respir J.
December 1994; 7(12): 2165-2168.
[0106] 25. Hahn D L, et al. Association of Chlamydia pneumoniae
(strain TWAR) infection with wheezing, asthmatic bronchitis, and
adult-onset asthma. JAMA. Jul. 10, 1991; 266(2): 225-230.
[0107] 26. Pal et al.(1996) Infection and Immunity.64:5341
[0108] 27. Jones et al. (1995) Vaccine 13:715
[0109] 28. Igietsemes et al. (1993) Immunology 5:317
[0110] 29. Igietseme et al (1993) Regional Immunology 5:317
[0111] 30. Magee et al (1993) Regional Immunology 5: 305
[0112] 31. Landers et al (1991) Infection & Immunity
59:3774
[0113] 32. Magee et al (1995) Infection & Immunity 63:516
[0114] 33. Cotter et al. (1995) Infection and Immunity63:4704
[0115] 34. Campbell et al (1990) Infection and Immunity 58:93
[0116] 35. McCafferty et al (1995) Infection and Immunity
63:2387-9.
[0117] 36. Knudsen et al (1996)Third Meeting of the European
Society for Chlamydia Research, Vienna
[0118] 37. Wiedmann-AI-Ahmad M, et al. Reactions of polyclonal and
neutralizing anti-p54 monoclonal antibodies with an isolated,
species-specific 54-kilodalton protein of Chlamydia pneumoniae.
Clin Diagn Lab Immunol. November 1997; 4(6): 700-704
[0119] 38. Xiang, 1995, Immunity 2: 129-35.
[0120] 39. Tang et al, Nature 1992; 356:152-154.
[0121] 40. Furth et al., Vaccine 1994,12:1503-1509.
[0122] 41. Yang et al, 1993, Infection & Immunity, vol. 61, pp
2037-40.
[0123] 42. Chi E. Y., Kuo C. C., Grayston J. T. 1987. Unique
ultrastructure in the elementary body of Chlamydia sp strain TWAR.
J. Bacteriol 169(8): 3757-63.
Sequence CWU 1
1
20 1 2545 DNA Chlamydia pneumoniae 1 ttgcggtgct gttaacggtg
gagggcagtg tagtctgagc agtactcgtt gctgccgcgc 60 gcgccaccag
acataatagc tgacagacta acagactgtt cctttccatg ggtcttttct 120
gcagtcaccg tcgtcgacac gtgtgatcag atatcgcggc cgctctagac cgccatgaca
180 aaaaaacatt atgcttgggt tgtagaaggg attctcaatc gtttgcctaa
acagtttttt 240 gtgaaatgta gtgttgtcga ctggaacaca ttcgttcctt
cagaaacctc cactacagaa 300 aaagctgcta caaacgctat gaaatacaaa
tactgtgttt ggcagtggct cgtcggaaag 360 catagtcagg ttccttggat
caatggacag aaaaagcctc tatatcttta tggagctttc 420 ttaatgaacc
ctttagcaaa ggctacgaag actacgttaa atggaaaaga aaacctagct 480
tggtttattg gaggaacttt agggggactc agaaaagctg gagactggtc tgccacagta
540 cgttatgagt atgtcgaagc cttgtcagtt ccagaaatag atgtttcagg
gattggccgt 600 ggtaatttat taaagttttg gttcgcccaa gcaattgctg
ctaactatga tcctaaagag 660 gctaatagtt ttacaaatta taaaggattt
tccgctctat atatgtatgg catcacagat 720 tctctatcat tcagagctta
tggggcttac tccaaaccag caaacgataa actcggcagt 780 gattttactt
tccgaaagtt tgatctaggt ataatttcag cgttttaagt caaattttaa 840
taaaatcttt aaaaacaggc tcgcattaat tattagtgag agcttttttt ttatttttta
900 taataaaact aaaagatttt tattattttt tgagttttta tggttaatcc
tattggtcca 960 ggtcctatag acgaaacaga acgcacacct cccgcagatc
tttctgctca aggattggag 1020 gcgagtgcag caaataagag tgcggaagct
caaagaatag caggtgcgga agctaagcct 1080 aaagaatcta agaccgattc
tgtagagcga tggagcatct tgcgttctgc agtgaatgct 1140 ctcatgagtc
tggcagataa gctgggtatt gcttctagta acagctcgtc ttctactagc 1200
agatctgcag acgtggactc aacgacagcg accgcaccta cgcctcctcc acccacgtct
1260 gatgattata agactcaagc gcaaacagct tacgatacta tctttacctc
aacatcacta 1320 gctgacatac aggctgcttt ggtgagcctc caggatgctg
tcactaatat aaaggataca 1380 gcggctactg atgaggaaac cgcaatcgct
gcggagtggg aaactaagaa tgccgatgca 1440 attaaagttg gcgcgcaaat
tacagaatta gcgaaatatg cttcggataa ccaagcgatt 1500 cttgactctt
taggtaaact gacttccttc gacctcttac agactgctct tctccaatct 1560
gtagcaaaca ataacaaagc agctgagctt cttaaagaga tgcaagataa cccagtagtc
1620 ccagggaaaa cgcctgcaat tgctcaatct ttagttgatc agacagatgc
tacagcgaca 1680 cagatagaga aagatggaaa tgcgattggg gatgcatatt
ttgcaggaca gaacgctagt 1740 ggagctgtag aaaatgctaa atctaataac
agtataagca acatagattc agctaaagca 1800 gcaatcgcta ctgctaagac
acaaatagct gaagctcaga aaaagttccc cgactctcca 1860 attcttcaag
aagcggaaca aatggtaata caggctgaga aagatcttaa aaatatcaaa 1920
cctgcagatg gttctgatgt tccaaatcca ggaactacag ttggaggctc caagcaacaa
1980 ggaagtagta ttggtagtat tcgtgtttcc atgctgttag atgatgctga
aaatgagacc 2040 gcttccattt tgatgtctgg gtttcgtcag atgattcaca
tgttcaatac ggaaaatcct 2100 gattctcaag ctgcccaaca ggagctcgca
gcacaagcta gagcagcgaa agccgctgga 2160 gatgacagtg ctgctgcagc
gctggcagat gctcagaaag ctttagaagc ggctctaggt 2220 aaagctgggc
aacaacaggg catactcaat gctttgggac agatcgcttc tgctgctgtt 2280
gtgagcgcag gagtcctccc gctgcagcaa gttctatgga tccgagctcg gtaccaagct
2340 tacgtagaac aaaaactcat ctcagaagag gatctgaata gcgccgtcga
ccatcatcat 2400 catcatcatt gagtttaaac ggtctccagc ttaagtttaa
accgctgatc agcctcgact 2460 gtgccttcta gttgccagcc atctgttgtt
tgcccctccc ccgtgccttc cttgaccctg 2520 gaaggtgcca ctcccactgt ccttt
2545 2 651 DNA Chlamydia pneumoniae 2 atgacaaaaa aacattatgc
ttgggttgta gaagggattc tcaatcgttt gcctaaacag 60 ttttttgtga
aatgtagtgt tgtcgactgg aacacattcg ttccttcaga aacctccact 120
acagaaaaag ctgctacaaa cgctatgaaa tacaaatact gtgtttggca gtggctcgtc
180 ggaaagcata gtcaggttcc ttggatcaat ggacagaaaa agcctctata
tctttatgga 240 gctttcttaa tgaacccttt agcaaaggct acgaagacta
cgttaaatgg aaaagaaaac 300 ctagcttggt ttattggagg aactttaggg
ggactcagaa aagctggaga ctggtctgcc 360 acagtacgtt atgagtatgt
cgaagccttg tcagttccag aaatagatgt ttcagggatt 420 ggccgtggta
atttattaaa gttttggttc gcccaagcaa ttgctgctaa ctatgatcct 480
aaagaggcta atagttttac aaattataaa ggattttccg ctctatatat gtatggcatc
540 acagattctc tatcattcag agcttatggg gcttactcca aaccagcaaa
cgataaactc 600 ggcagtgatt ttactttccg aaagtttgat ctaggtataa
tttcagcgtt t 651 3 1470 DNA Chlamydia pneumoniae 3 atggttaatc
ctattggtcc aggtcctata gacgaaacag aacgcacacc tcccgcagat 60
ctttctgctc aaggattgga ggcgagtgca gcaaataaga gtgcggaagc tcaaagaata
120 gcaggtgcgg aagctaagcc taaagaatct aagaccgatt ctgtagagcg
atggagcatc 180 ttgcgttctg cagtgaatgc tctcatgagt ctggcagata
agctgggtat tgcttctagt 240 aacagctcgt cttctactag cagatctgca
gacgtggact caacgacagc gaccgcacct 300 acgcctcctc cacccacgtc
tgatgattat aagactcaag cgcaaacagc ttacgatact 360 atctttacct
caacatcact agctgacata caggctgctt tggtgagcct ccaggatgct 420
gtcactaata taaaggatac agcggctact gatgaggaaa ccgcaatcgc tgcggagtgg
480 gaaactaaga atgccgatgc aattaaagtt ggcgcgcaaa ttacagaatt
agcgaaatat 540 gcttcggata accaagcgat tcttgactct ttaggtaaac
tgacttcctt cgacctctta 600 cagactgctc ttctccaatc tgtagcaaac
aataacaaag cagctgagct tcttaaagag 660 atgcaagata acccagtagt
cccagggaaa acgcctgcaa ttgctcaatc tttagttgat 720 cagacagatg
ctacagcgac acagatagag aaagatggaa atgcgattgg ggatgcatat 780
tttgcaggac agaacgctag tggagctgta gaaaatgcta aatctaataa cagtataagc
840 aacatagatt cagctaaagc agcaatcgct actgctaaga cacaaatagc
tgaagctcag 900 aaaaagttcc ccgactctcc aattcttcaa gaagcggaac
aaatggtaat acaggctgag 960 aaagatctta aaaatatcaa acctgcagat
ggttctgatg ttccaaatcc aggaactaca 1020 gttggaggct ccaagcaaca
aggaagtagt attggtagta ttcgtgtttc catgctgtta 1080 gatgatgctg
aaaatgagac cgcttccatt ttgatgtctg ggtttcgtca gatgattcac 1140
atgttcaata cggaaaatcc tgattctcaa gctgcccaac aggagctcgc agcacaagct
1200 agagcagcga aagccgctgg agatgacagt gctgctgcag cgctggcaga
tgctcagaaa 1260 gctttagaag cggctctagg taaagctggg caacaacagg
gcatactcaa tgctttggga 1320 cagatcgctt ctgctgctgt tgtgagcgca
ggagtcctcc cgctgcagca agttctatgg 1380 atccgagctc ggtaccaagc
ttacgtagaa caaaaactca tctcagaaga ggatctgaat 1440 agcgccgtcg
accatcatca tcatcatcat 1470 4 1389 DNA Chlamydia pneumoniae 4
atggttaatc ctattggtcc aggtcctata gacgaaacag aacgcacacc tcccgcagat
60 ctttctgctc aaggattgga ggcgagtgca gcaaataaga gtgcggaagc
tcaaagaata 120 gcaggtgcgg aagctaagcc taaagaatct aagaccgatt
ctgtagagcg atggagcatc 180 ttgcgttctg cagtgaatgc tctcatgagt
ctggcagata agctgggtat tgcttctagt 240 aacagctcgt cttctactag
cagatctgca gacgtggact caacgacagc gaccgcacct 300 acgcctcctc
cacccacgtc tgatgattat aagactcaag cgcaaacagc ttacgatact 360
atctttacct caacatcact agctgacata caggctgctt tggtgagcct ccaggatgct
420 gtcactaata taaaggatac agcggctact gatgaggaaa ccgcaatcgc
tgcggagtgg 480 gaaactaaga atgccgatgc aattaaagtt ggcgcgcaaa
ttacagaatt agcgaaatat 540 gcttcggata accaagcgat tcttgactct
ttaggtaaac tgacttcctt cgacctctta 600 cagactgctc ttctccaatc
tgtagcaaac aataacaaag cagctgagct tcttaaagag 660 atgcaagata
acccagtagt cccagggaaa acgcctgcaa ttgctcaatc tttagttgat 720
cagacagatg ctacagcgac acagatagag aaagatggaa atgcgattgg ggatgcatat
780 tttgcaggac agaacgctag tggagctgta gaaaatgcta aatctaataa
cagtataagc 840 aacatagatt cagctaaagc agcaatcgct actgctaaga
cacaaatagc tgaagctcag 900 aaaaagttcc ccgactctcc aattcttcaa
gaagcggaac aaatggtaat acaggctgag 960 aaagatctta aaaatatcaa
acctgcagat ggttctgatg ttccaaatcc aggaactaca 1020 gttggaggct
ccaagcaaca aggaagtagt attggtagta ttcgtgtttc catgctgtta 1080
gatgatgctg aaaatgagac cgcttccatt ttgatgtctg ggtttcgtca gatgattcac
1140 atgttcaata cggaaaatcc tgattctcaa gctgcccaac aggagctcgc
agcacaagct 1200 agagcagcga aagccgctgg agatgacagt gctgctgcag
cgctggcaga tgctcagaaa 1260 gctttagaag cggctctagg taaagctggg
caacaacagg gcatactcaa tgctttggga 1320 cagatcgctt ctgctgctgt
tgtgagcgca ggagtcctcc cgctgcagca agttctatgg 1380 atccgagct 1389 5
63 DNA Chlamydia pneumoniae 5 cggtaccaag cttacgtaga acaaaaactc
atctcagaag aggatctgaa tagcgccgtc 60 gac 63 6 18 DNA Chlamydia
pneumoniae 6 catcatcatc atcatcat 18 7 217 PRT Chlamydia pneumoniae
7 Met Thr Lys Lys His Tyr Ala Trp Val Val Glu Gly Ile Leu Asn Arg 1
5 10 15 Leu Pro Lys Gln Phe Phe Val Lys Cys Ser Val Val Asp Trp Asn
Thr 20 25 30 Phe Val Pro Ser Glu Thr Ser Thr Thr Glu Lys Ala Ala
Thr Asn Ala 35 40 45 Met Lys Tyr Lys Tyr Cys Val Trp Gln Trp Leu
Val Gly Lys His Ser 50 55 60 Gln Val Pro Trp Ile Asn Gly Gln Lys
Lys Pro Leu Tyr Leu Tyr Gly 65 70 75 80 Ala Phe Leu Met Asn Pro Leu
Ala Lys Ala Thr Lys Thr Thr Leu Asn 85 90 95 Gly Lys Glu Asn Leu
Ala Trp Phe Ile Gly Gly Thr Leu Gly Gly Leu 100 105 110 Arg Lys Ala
Gly Asp Trp Ser Ala Thr Val Arg Tyr Glu Tyr Val Glu 115 120 125 Ala
Leu Ser Val Pro Glu Ile Asp Val Ser Gly Ile Gly Arg Gly Asn 130 135
140 Leu Leu Lys Phe Trp Phe Ala Gln Ala Ile Ala Ala Asn Tyr Asp Pro
145 150 155 160 Lys Glu Ala Asn Ser Phe Thr Asn Tyr Lys Gly Phe Ser
Ala Leu Tyr 165 170 175 Met Tyr Gly Ile Thr Asp Ser Leu Ser Phe Arg
Ala Tyr Gly Ala Tyr 180 185 190 Ser Lys Pro Ala Asn Asp Lys Leu Gly
Ser Asp Phe Thr Phe Arg Lys 195 200 205 Phe Asp Leu Gly Ile Ile Ser
Ala Phe 210 215 8 490 PRT Chlamydia pneumoniae 8 Met Val Asn Pro
Ile Gly Pro Gly Pro Ile Asp Glu Thr Glu Arg Thr 1 5 10 15 Pro Pro
Ala Asp Leu Ser Ala Gln Gly Leu Glu Ala Ser Ala Ala Asn 20 25 30
Lys Ser Ala Glu Ala Gln Arg Ile Ala Gly Ala Glu Ala Lys Pro Lys 35
40 45 Glu Ser Lys Thr Asp Ser Val Glu Arg Trp Ser Ile Leu Arg Ser
Ala 50 55 60 Val Asn Ala Leu Met Ser Leu Ala Asp Lys Leu Gly Ile
Ala Ser Ser 65 70 75 80 Asn Ser Ser Ser Ser Thr Ser Arg Ser Ala Asp
Val Asp Ser Thr Thr 85 90 95 Ala Thr Ala Pro Thr Pro Pro Pro Pro
Thr Ser Asp Asp Tyr Lys Thr 100 105 110 Gln Ala Gln Thr Ala Tyr Asp
Thr Ile Phe Thr Ser Thr Ser Leu Ala 115 120 125 Asp Ile Gln Ala Ala
Leu Val Ser Leu Gln Asp Ala Val Thr Asn Ile 130 135 140 Lys Asp Thr
Ala Ala Thr Asp Glu Glu Thr Ala Ile Ala Ala Glu Trp 145 150 155 160
Glu Thr Lys Asn Ala Asp Ala Ile Lys Val Gly Ala Gln Ile Thr Glu 165
170 175 Leu Ala Lys Tyr Ala Ser Asp Asn Gln Ala Ile Leu Asp Ser Leu
Gly 180 185 190 Lys Leu Thr Ser Phe Asp Leu Leu Gln Thr Ala Leu Leu
Gln Ser Val 195 200 205 Ala Asn Asn Asn Lys Ala Ala Glu Leu Leu Lys
Glu Met Gln Asp Asn 210 215 220 Pro Val Val Pro Gly Lys Thr Pro Ala
Ile Ala Gln Ser Leu Val Asp 225 230 235 240 Gln Thr Asp Ala Thr Ala
Thr Gln Ile Glu Lys Asp Gly Asn Ala Ile 245 250 255 Gly Asp Ala Tyr
Phe Ala Gly Gln Asn Ala Ser Gly Ala Val Glu Asn 260 265 270 Ala Lys
Ser Asn Asn Ser Ile Ser Asn Ile Asp Ser Ala Lys Ala Ala 275 280 285
Ile Ala Thr Ala Lys Thr Gln Ile Ala Glu Ala Gln Lys Lys Phe Pro 290
295 300 Asp Ser Pro Ile Leu Gln Glu Ala Glu Gln Met Val Ile Gln Ala
Glu 305 310 315 320 Lys Asp Leu Lys Asn Ile Lys Pro Ala Asp Gly Ser
Asp Val Pro Asn 325 330 335 Pro Gly Thr Thr Val Gly Gly Ser Lys Gln
Gln Gly Ser Ser Ile Gly 340 345 350 Ser Ile Arg Val Ser Met Leu Leu
Asp Asp Ala Glu Asn Glu Thr Ala 355 360 365 Ser Ile Leu Met Ser Gly
Phe Arg Gln Met Ile His Met Phe Asn Thr 370 375 380 Glu Asn Pro Asp
Ser Gln Ala Ala Gln Gln Glu Leu Ala Ala Gln Ala 385 390 395 400 Arg
Ala Ala Lys Ala Ala Gly Asp Asp Ser Ala Ala Ala Ala Leu Ala 405 410
415 Asp Ala Gln Lys Ala Leu Glu Ala Ala Leu Gly Lys Ala Gly Gln Gln
420 425 430 Gln Gly Ile Leu Asn Ala Leu Gly Gln Ile Ala Ser Ala Ala
Val Val 435 440 445 Ser Ala Gly Val Leu Pro Leu Gln Gln Val Leu Trp
Ile Arg Ala Arg 450 455 460 Tyr Gln Ala Tyr Val Glu Gln Lys Leu Ile
Ser Glu Glu Asp Leu Asn 465 470 475 480 Ser Ala Val Asp His His His
His His His 485 490 9 463 PRT Chlamydia pneumoniae 9 Met Val Asn
Pro Ile Gly Pro Gly Pro Ile Asp Glu Thr Glu Arg Thr 1 5 10 15 Pro
Pro Ala Asp Leu Ser Ala Gln Gly Leu Glu Ala Ser Ala Ala Asn 20 25
30 Lys Ser Ala Glu Ala Gln Arg Ile Ala Gly Ala Glu Ala Lys Pro Lys
35 40 45 Glu Ser Lys Thr Asp Ser Val Glu Arg Trp Ser Ile Leu Arg
Ser Ala 50 55 60 Val Asn Ala Leu Met Ser Leu Ala Asp Lys Leu Gly
Ile Ala Ser Ser 65 70 75 80 Asn Ser Ser Ser Ser Thr Ser Arg Ser Ala
Asp Val Asp Ser Thr Thr 85 90 95 Ala Thr Ala Pro Thr Pro Pro Pro
Pro Thr Ser Asp Asp Tyr Lys Thr 100 105 110 Gln Ala Gln Thr Ala Tyr
Asp Thr Ile Phe Thr Ser Thr Ser Leu Ala 115 120 125 Asp Ile Gln Ala
Ala Leu Val Ser Leu Gln Asp Ala Val Thr Asn Ile 130 135 140 Lys Asp
Thr Ala Ala Thr Asp Glu Glu Thr Ala Ile Ala Ala Glu Trp 145 150 155
160 Glu Thr Lys Asn Ala Asp Ala Ile Lys Val Gly Ala Gln Ile Thr Glu
165 170 175 Leu Ala Lys Tyr Ala Ser Asp Asn Gln Ala Ile Leu Asp Ser
Leu Gly 180 185 190 Lys Leu Thr Ser Phe Asp Leu Leu Gln Thr Ala Leu
Leu Gln Ser Val 195 200 205 Ala Asn Asn Asn Lys Ala Ala Glu Leu Leu
Lys Glu Met Gln Asp Asn 210 215 220 Pro Val Val Pro Gly Lys Thr Pro
Ala Ile Ala Gln Ser Leu Val Asp 225 230 235 240 Gln Thr Asp Ala Thr
Ala Thr Gln Ile Glu Lys Asp Gly Asn Ala Ile 245 250 255 Gly Asp Ala
Tyr Phe Ala Gly Gln Asn Ala Ser Gly Ala Val Glu Asn 260 265 270 Ala
Lys Ser Asn Asn Ser Ile Ser Asn Ile Asp Ser Ala Lys Ala Ala 275 280
285 Ile Ala Thr Ala Lys Thr Gln Ile Ala Glu Ala Gln Lys Lys Phe Pro
290 295 300 Asp Ser Pro Ile Leu Gln Glu Ala Glu Gln Met Val Ile Gln
Ala Glu 305 310 315 320 Lys Asp Leu Lys Asn Ile Lys Pro Ala Asp Gly
Ser Asp Val Pro Asn 325 330 335 Pro Gly Thr Thr Val Gly Gly Ser Lys
Gln Gln Gly Ser Ser Ile Gly 340 345 350 Ser Ile Arg Val Ser Met Leu
Leu Asp Asp Ala Glu Asn Glu Thr Ala 355 360 365 Ser Ile Leu Met Ser
Gly Phe Arg Gln Met Ile His Met Phe Asn Thr 370 375 380 Glu Asn Pro
Asp Ser Gln Ala Ala Gln Gln Glu Leu Ala Ala Gln Ala 385 390 395 400
Arg Ala Ala Lys Ala Ala Gly Asp Asp Ser Ala Ala Ala Ala Leu Ala 405
410 415 Asp Ala Gln Lys Ala Leu Glu Ala Ala Leu Gly Lys Ala Gly Gln
Gln 420 425 430 Gln Gly Ile Leu Asn Ala Leu Gly Gln Ile Ala Ser Ala
Ala Val Val 435 440 445 Ser Ala Gly Val Leu Pro Leu Gln Gln Val Leu
Trp Ile Arg Ala 450 455 460 10 21 PRT Chlamydia pneumoniae 10 Arg
Tyr Gln Ala Tyr Val Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10
15 Asn Ser Ala Val Asp 20 11 6 PRT Chlamydia pneumoniae 11 His His
His His His His 1 5 12 1426 DNA Chlamydia pneumoniae 12 tgagcagtac
tcgttgctgc cgcgcgcgcc accagacata atagctgaca gactaacaga 60
ctgttccttt ccatgggtct tttctgcagt caccgtcgtc gacacgtgtg atcagatatc
120 ccaccatgtt gcctgtaggg aacccttctg atccaagctt attaattgat
ggtacaatat 180 gggaaggtgc tgcaggagat ccttgcgatc cttgcgctac
ttggtgcgac gctattagct 240 tacgtgctgg attttacgga gactatgttt
tcgaccgtat cttaaaagta gatgcaccta 300 aaacattttc tatgggagcc
aagcctactg gatccgctgc tgcaaactat actactgccg 360 tagatagacc
taacccggcc tacaataagc atttacacga tgcagagtgg ttcactaatg 420
caggcttcat tgccttaaac atttgggatc gctttgatgt tttctgtact ttaggagctt
480 ctaatggtta cattagagga aactctacag cgttcaatct cgttggttta
ttcggagtta 540 aaggtactac tgtaaatgca aatgaactac caaacgtttc
tttaagtaac ggagttgttg 600 aactttacac agacacctct ttctcttgga
gcgtaggcgc tcgtggagcc ttatgggaat 660 gcggttgtgc aactttggga
gctgaattcc aatatgcaca gtccaaacct aaagttgaag 720 aacttaatgt
gatctgtaac gtatcgcaat tctctgtaaa caaacccaag ggctataaag 780
gcgttgcttt ccccttgcca acagacgctg gcgtagcaac agctactgga acaaagtctg
840 cgaccatcaa ttatcatgaa tggcaagtag gagcctctct atcttacaga
ctaaactctt 900 tagtgccata cattggagta caatggtctc gagcaacttt
tgatgctgat aacatccgca 960 ttgctcagcc aaaactacct acagctgttt
taaacttaac
tgcatggaac ccttctttac 1020 taggaaatgc cacagcattg tctactactg
attcgttctc agacttcatg caaattgttt 1080 cctgtcagat caacaagttt
aaatctagaa aagcttgtgg agttactgta ggagctactt 1140 tagttgatgc
tgataaatgg tcacttactg cagaagctcg tttaattaac gagagagctg 1200
ctcacgtatc tggtcagttc agattccggt accaagctta cgtagaacaa aaactcatct
1260 cagaagagga tctgaatagc gccgtcgacc atcatcatca tcatcattga
gtttaaacgg 1320 tctccagctt aagtttaaac cgctgatcag cctcgactgt
gccttctagt tgccagccat 1380 ctgttgtttg cccctccccc gtgccttcct
tgaccctgga aggtgc 1426 13 1301 DNA Chlamydia pneumoniae 13
atgttgcctg tagggaaccc ttctgatcca agcttattaa ttgatggtac aatatgggaa
60 ggtgctgcag gagatccttg cgatccttgc gctacttggt gcgacgctat
tagcttacgt 120 gctggatttt acggagacta tgttttcgac cgtatcttaa
aagtagatgc acctaaaaca 180 ttttctatgg gagccaagcc tactggatcc
gctgctgcaa actatactac tgccgtagat 240 agacctaacc cggcctacaa
taagcattta cacgatgcag agtggttcac taatgcaggc 300 ttcattgcct
taaacatttg ggatcgcttt gatgttttct gtactttagg agcttctaat 360
ggttacatta gaggaaactc tacagcgttc aatctcgttg gtttattcgg agttaaaggt
420 actactgtaa atgcaaatga actaccaaac gtttctttaa gtaacggagt
tgttgaactt 480 tacacagaca cctctttctc ttggagcgta ggcgctcgtg
gagccttatg ggaatgcggt 540 tgtgcaactt tgggagctga attccaatat
gcacagtcca aacctaaagt tgaagaactt 600 aatgtgatct gtaacgtatc
gcaattctct gtaaacaaac ccaagggcta taaaggcgtt 660 gctttcccct
tgccaacaga cgctggcgta gcaacagcta ctggaacaaa gtctgcgacc 720
atcaattatc atgaatggca agtaggagcc tctctatctt acagactaaa ctctttagtg
780 ccatacattg gagtacaatg gtctcgagca acttttgatg ctgataacat
ccgcattgct 840 cagccaaaac tacctacagc tgttttaaac ttaactgcat
ggaacccttc tttactagga 900 aatgccacag cattgtctac tactgattcg
ttctcagact tcatgcaaat tgtttcctgt 960 cagatcaaca agtttaaatc
tagaaaagct tgtggagtta ctgtaggagc tactttagtt 1020 gatgctgata
aatggtcact tactgcagaa gctcgtttaa ttaacgagag agctgctcac 1080
gtatctggtc agttcagatt ccggtaccaa gcttacgtag aacaaaaact catctcagaa
1140 gaggatctga atagcgccgt cgaccatcat catcatcatc attgagttta
aacggtctcc 1200 agcttaagtt taaaccgctg atcagcctcg actgtgcctt
ctagttgcca gccatctgtt 1260 gtttgcccct cccccgtgcc ttccttgacc
ctggaaggtg c 1301 14 1101 DNA Chlamydia pneumoniae 14 atgttgcctg
tagggaaccc ttctgatcca agcttattaa ttgatggtac aatatgggaa 60
ggtgctgcag gagatccttg cgatccttgc gctacttggt gcgacgctat tagcttacgt
120 gctggatttt acggagacta tgttttcgac cgtatcttaa aagtagatgc
acctaaaaca 180 ttttctatgg gagccaagcc tactggatcc gctgctgcaa
actatactac tgccgtagat 240 agacctaacc cggcctacaa taagcattta
cacgatgcag agtggttcac taatgcaggc 300 ttcattgcct taaacatttg
ggatcgcttt gatgttttct gtactttagg agcttctaat 360 ggttacatta
gaggaaactc tacagcgttc aatctcgttg gtttattcgg agttaaaggt 420
actactgtaa atgcaaatga actaccaaac gtttctttaa gtaacggagt tgttgaactt
480 tacacagaca cctctttctc ttggagcgta ggcgctcgtg gagccttatg
ggaatgcggt 540 tgtgcaactt tgggagctga attccaatat gcacagtcca
aacctaaagt tgaagaactt 600 aatgtgatct gtaacgtatc gcaattctct
gtaaacaaac ccaagggcta taaaggcgtt 660 gctttcccct tgccaacaga
cgctggcgta gcaacagcta ctggaacaaa gtctgcgacc 720 atcaattatc
atgaatggca agtaggagcc tctctatctt acagactaaa ctctttagtg 780
ccatacattg gagtacaatg gtctcgagca acttttgatg ctgataacat ccgcattgct
840 cagccaaaac tacctacagc tgttttaaac ttaactgcat ggaacccttc
tttactagga 900 aatgccacag cattgtctac tactgattcg ttctcagact
tcatgcaaat tgtttcctgt 960 cagatcaaca agtttaaatc tagaaaagct
tgtggagtta ctgtaggagc tactttagtt 1020 gatgctgata aatggtcact
tactgcagaa gctcgtttaa ttaacgagag agctgctcac 1080 gtatctggtc
agttcagatt c 1101 15 394 PRT Chlamydia pneumoniae 15 Met Leu Pro
Val Gly Asn Pro Ser Asp Pro Ser Leu Leu Ile Asp Gly 1 5 10 15 Thr
Ile Trp Glu Gly Ala Ala Gly Asp Pro Cys Asp Pro Cys Ala Thr 20 25
30 Trp Cys Asp Ala Ile Ser Leu Arg Ala Gly Phe Tyr Gly Asp Tyr Val
35 40 45 Phe Asp Arg Ile Leu Lys Val Asp Ala Pro Lys Thr Phe Ser
Met Gly 50 55 60 Ala Lys Pro Thr Gly Ser Ala Ala Ala Asn Tyr Thr
Thr Ala Val Asp 65 70 75 80 Arg Pro Asn Pro Ala Tyr Asn Lys His Leu
His Asp Ala Glu Trp Phe 85 90 95 Thr Asn Ala Gly Phe Ile Ala Leu
Asn Ile Trp Asp Arg Phe Asp Val 100 105 110 Phe Cys Thr Leu Gly Ala
Ser Asn Gly Tyr Ile Arg Gly Asn Ser Thr 115 120 125 Ala Phe Asn Leu
Val Gly Leu Phe Gly Val Lys Gly Thr Thr Val Asn 130 135 140 Ala Asn
Glu Leu Pro Asn Val Ser Leu Ser Asn Gly Val Val Glu Leu 145 150 155
160 Tyr Thr Asp Thr Ser Phe Ser Trp Ser Val Gly Ala Arg Gly Ala Leu
165 170 175 Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala Glu Phe Gln Tyr
Ala Gln 180 185 190 Ser Lys Pro Lys Val Glu Glu Leu Asn Val Ile Cys
Asn Val Ser Gln 195 200 205 Phe Ser Val Asn Lys Pro Lys Gly Tyr Lys
Gly Val Ala Phe Pro Leu 210 215 220 Pro Thr Asp Ala Gly Val Ala Thr
Ala Thr Gly Thr Lys Ser Ala Thr 225 230 235 240 Ile Asn Tyr His Glu
Trp Gln Val Gly Ala Ser Leu Ser Tyr Arg Leu 245 250 255 Asn Ser Leu
Val Pro Tyr Ile Gly Val Gln Trp Ser Arg Ala Thr Phe 260 265 270 Asp
Ala Asp Asn Ile Arg Ile Ala Gln Pro Lys Leu Pro Thr Ala Val 275 280
285 Leu Asn Leu Thr Ala Trp Asn Pro Ser Leu Leu Gly Asn Ala Thr Ala
290 295 300 Leu Ser Thr Thr Asp Ser Phe Ser Asp Phe Met Gln Ile Val
Ser Cys 305 310 315 320 Gln Ile Asn Lys Phe Lys Ser Arg Lys Ala Cys
Gly Val Thr Val Gly 325 330 335 Ala Thr Leu Val Asp Ala Asp Lys Trp
Ser Leu Thr Ala Glu Ala Arg 340 345 350 Leu Ile Asn Glu Arg Ala Ala
His Val Ser Gly Gln Phe Arg Phe Arg 355 360 365 Tyr Gln Ala Tyr Val
Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn 370 375 380 Ser Ala Val
Asp His His His His His His 385 390 16 367 PRT Chlamydia pneumoniae
16 Met Leu Pro Val Gly Asn Pro Ser Asp Pro Ser Leu Leu Ile Asp Gly
1 5 10 15 Thr Ile Trp Glu Gly Ala Ala Gly Asp Pro Cys Asp Pro Cys
Ala Thr 20 25 30 Trp Cys Asp Ala Ile Ser Leu Arg Ala Gly Phe Tyr
Gly Asp Tyr Val 35 40 45 Phe Asp Arg Ile Leu Lys Val Asp Ala Pro
Lys Thr Phe Ser Met Gly 50 55 60 Ala Lys Pro Thr Gly Ser Ala Ala
Ala Asn Tyr Thr Thr Ala Val Asp 65 70 75 80 Arg Pro Asn Pro Ala Tyr
Asn Lys His Leu His Asp Ala Glu Trp Phe 85 90 95 Thr Asn Ala Gly
Phe Ile Ala Leu Asn Ile Trp Asp Arg Phe Asp Val 100 105 110 Phe Cys
Thr Leu Gly Ala Ser Asn Gly Tyr Ile Arg Gly Asn Ser Thr 115 120 125
Ala Phe Asn Leu Val Gly Leu Phe Gly Val Lys Gly Thr Thr Val Asn 130
135 140 Ala Asn Glu Leu Pro Asn Val Ser Leu Ser Asn Gly Val Val Glu
Leu 145 150 155 160 Tyr Thr Asp Thr Ser Phe Ser Trp Ser Val Gly Ala
Arg Gly Ala Leu 165 170 175 Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala
Glu Phe Gln Tyr Ala Gln 180 185 190 Ser Lys Pro Lys Val Glu Glu Leu
Asn Val Ile Cys Asn Val Ser Gln 195 200 205 Phe Ser Val Asn Lys Pro
Lys Gly Tyr Lys Gly Val Ala Phe Pro Leu 210 215 220 Pro Thr Asp Ala
Gly Val Ala Thr Ala Thr Gly Thr Lys Ser Ala Thr 225 230 235 240 Ile
Asn Tyr His Glu Trp Gln Val Gly Ala Ser Leu Ser Tyr Arg Leu 245 250
255 Asn Ser Leu Val Pro Tyr Ile Gly Val Gln Trp Ser Arg Ala Thr Phe
260 265 270 Asp Ala Asp Asn Ile Arg Ile Ala Gln Pro Lys Leu Pro Thr
Ala Val 275 280 285 Leu Asn Leu Thr Ala Trp Asn Pro Ser Leu Leu Gly
Asn Ala Thr Ala 290 295 300 Leu Ser Thr Thr Asp Ser Phe Ser Asp Phe
Met Gln Ile Val Ser Cys 305 310 315 320 Gln Ile Asn Lys Phe Lys Ser
Arg Lys Ala Cys Gly Val Thr Val Gly 325 330 335 Ala Thr Leu Val Asp
Ala Asp Lys Trp Ser Leu Thr Ala Glu Ala Arg 340 345 350 Leu Ile Asn
Glu Arg Ala Ala His Val Ser Gly Gln Phe Arg Phe 355 360 365 17 38
DNA Chlamydia pneumoniae 17 gctctagacc gccatgacaa aaaaacatta
tgcttggg 38 18 28 DNA Chlamydia pneumoniae 18 cgggatccat agaacttgct
gcagcggg 28 19 38 DNA Chlamydia pneumoniae 19 cccggatatc ccaccatgtt
gcctgtaggg aacccttc 38 20 31 DNA Chlamydia pneumoniae 20 ggggtaccgg
aatctgaact gaccagatac g 31
* * * * *