U.S. patent application number 10/916548 was filed with the patent office on 2005-03-24 for glucopyranosyloxybenzylbenzene derivatives and medicinal compositions containing the same.
This patent application is currently assigned to KISSEI PHARMACEUTICAL CO., LTD.. Invention is credited to Fujikura, Hideki, Fushimi, Nobuhiko, Isaji, Masayuki, Nishimura, Toshihiro, Tatani, Kazuya.
Application Number | 20050065098 10/916548 |
Document ID | / |
Family ID | 18783054 |
Filed Date | 2005-03-24 |
United States Patent
Application |
20050065098 |
Kind Code |
A1 |
Fujikura, Hideki ; et
al. |
March 24, 2005 |
Glucopyranosyloxybenzylbenzene derivatives and medicinal
compositions containing the same
Abstract
The present invention relates to glucopyranosyloxy-benzylbenzene
derivatives represented by the general formula: 1 wherein P
represents a group forming a prodrug; and R represents a lower
alkyl group, a lower alkoxy group, a lower alkylthio group, a lower
alkoxy-substituted (lower alkyl) group, a lower alkoxy-substituted
(lower alkoxy) group or a lower alkoxy-substituted (lower
alkylthio) group, which have an improved oral absorption and can
exert an excellent inhibitory activity in human SGLT2 in vivo and
which are useful as agents for the prevention or treatment of a
disease associated with hyperglycemia such as diabetes, diabetic
complications or obesity, and pharmaceutical compositions
comprising the same.
Inventors: |
Fujikura, Hideki; (Nagano,
JP) ; Fushimi, Nobuhiko; (Nagano, JP) ;
Nishimura, Toshihiro; (Nagano, JP) ; Tatani,
Kazuya; (Nagano, JP) ; Isaji, Masayuki;
(Nagano, JP) |
Correspondence
Address: |
SUGHRUE MION, PLLC
2100 PENNSYLVANIA AVENUE, N.W.
SUITE 800
WASHINGTON
DC
20037
US
|
Assignee: |
KISSEI PHARMACEUTICAL CO.,
LTD.
|
Family ID: |
18783054 |
Appl. No.: |
10/916548 |
Filed: |
August 12, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10916548 |
Aug 12, 2004 |
|
|
|
10381846 |
Jul 29, 2003 |
|
|
|
10381846 |
Jul 29, 2003 |
|
|
|
PCT/JP01/08239 |
Mar 28, 2003 |
|
|
|
Current U.S.
Class: |
514/23 ;
536/119 |
Current CPC
Class: |
A61P 3/04 20180101; A61P
43/00 20180101; A61K 31/7034 20130101; A61P 3/10 20180101; A61P
3/00 20180101; C07H 15/203 20130101 |
Class at
Publication: |
514/023 ;
536/119 |
International
Class: |
A61K 031/70; C07H
013/02 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 29, 2000 |
JP |
301523/2000 |
Claims
1-2. (canceled).
3. A method as claimed in claim 14, wherein the
glucopyranosyloxybenzylben- zene derivative is represented by the
general formula: 8wherein R.sup.1 represents a lower alkyl group or
a lower alkoxy group; and P.sup.1 represents a lower acyl group, a
lower alkoxy-substituted (lower acyl) group, a lower
alkoxycarbonyl-substituted (lower acyl) group, a lower
alkoxycarbonyl group or a lower alkoxy-substituted (lower
alkoxycarbonyl) group.
4. A method as claimed in claim 14, wherein the
glucopyranosyloxybenzylben- zene derivative is represented by the
general formula: 9wherein R represents a lower alkyl group, a lower
alkoxy group, a lower alkylthio group, a lower alkoxy-substituted
(lower alkyl) group, a lower alkoxy-substituted (lower alkoxy)
group or a lower alkoxy-substituted (lower alkylthio) group; and
P.sup.2 represents a lower acyl group or a lower alkoxycarbonyl
group.
5. A method as claimed in claim 14, wherein the
glucopyranosyloxybenzylben- zene derivative is represented by the
general formula: 10wherein R.sup.1 represents a lower alkyl group
or a lower alkoxy group; and P.sup.2 represents a lower acyl group
or a lower alkoxycarbonyl group.
6. A method as claimed in claim 14, wherein the
glucopyranosyloxybenzylben- zene derivative is represented by the
formula: 11
7. A method as claimed in claim 14, wherein the
glucopyranosyloxybenzylben- zene derivative is represented by the
formula: 12
8-13. (canceled).
14. A method for the prevention of a disease associated with
hyperglycemia, which comprises administering to a patient in need
of the prevention of a disease associated with hyperglycemia a
therapeutically effective amount of a
glucopyranosyloxybenzylbenzene derivative represented by the
general formula: 13wherein R represents a lower alkyl group, a
lower alkoxy group, a lower alkylthio group, a lower
alkoxy-substituted (lower alkyl) group, a lower alkoxy-substituted
(lower alkoxy) group or a lower alkoxy-substituted (lower
alkylthio) group; and P.sup.1 represents a lower acyl group, a
lower alkoxy-substituted (lower acyl) group, a lower
alkoxycarbonyl-substituted (lower acyl) group, a lower
alkoxycarbonyl group or a lower alkoxy-substituted (lower
alkoxycarbonyl) group.
15. (canceled).
16. A method for providing a preventing effect on a disease
associated with hyperglycemia, which comprises administering to a
patient in need of the preventing effect a therapeutically
effective amount of a glucopyranosyloxybenzylbenzene derivative
represented by the general formula: 14wherein R represents a lower
alkyl group, a lower alkoxy group, a lower alkylthio group, a lower
alkoxy-substituted (lower alkyl) group, a lower alkoxy-substituted
(lower alkoxy) group or a lower alkoxy-substituted (lower
alkylthio) group; and P.sup.1 represents a lower acyl group, a
lower alkoxy-substituted (lower acyl) group, a lower
alkoxycarbonyl-substituted (lower acyl) group, a lower
alkoxycarbonyl group or a lower alkoxy-substituted (lower
alkoxycarbonyl) group.
17. A method as claimed in claim 16, wherein the
glucopyranosyloxybenzylbe- nzene derivative is represented by the
general formula: 15wherein R.sup.1 represents a lower alkyl group
or a lower alkoxy group; and P.sup.1 represents a lower acyl group,
a lower alkoxy-substituted (lower acyl) group, a lower
alkoxycarbonyl-substituted (lower acyl) group, a lower
alkoxycarbonyl group or a lower alkoxy-substituted (lower
alkoxycarbonyl) group.
18. A method as claimed in claim 16, wherein the
glucopyranosyloxybenzylbe- nzene derivative is represented by the
general formula: 16wherein R represents a lower alkyl group, a
lower alkoxy group, a lower alkylthio group, a lower
alkoxy-substituted (lower alkyl) group, a lower alkoxy-substituted
(lower alkoxy) group or a lower alkoxy-substituted (lower
alkylthio) group; and P.sup.2 represents a lower acyl group or a
lower alkoxycarbonyl group.
19. A method as claimed in claim 16, wherein the
glucopyranosyloxybenzylbe- nzene derivative is represented by the
general formula: 17wherein R.sup.1 represents a lower alkyl group
or a lower alkoxy group; and P.sup.2 represents a lower acyl group
or a lower alkoxycarbonyl group.
20. A method as claimed in claim 16, wherein the
glucopyranosyloxybenzylbe- nzene derivative is represented by the
formula: 18
21. A method as claimed in claim 16, wherein the
glucopyranosyloxybenzylbe- nzene derivative is represented by the
formula: 19
Description
TECHNICAL FIELD
[0001] The present invention relates to
glucopyranosyloxy-benzylbenzene derivatives which are useful as
medicaments and pharmaceutical compositions comprising the
same.
[0002] More particularly, the present invention relates to
glucopyranosyloxybenzylbenzene derivatives, which are useful as
agents for the prevention or treatment of a disease associated with
hyperglycemia such as diabetes, diabetic complications or obesity,
represented by the general formula: 2
[0003] wherein P represents a group forming a prodrug; and R
represents a lower alkyl group, a lower alkoxy group, a lower
alkylthio group, a lower alkoxy-substituted (lower alkyl) group, a
lower alkoxy-substituted (lower alkoxy) group or a lower
alkoxy-substituted (lower alkylthio) group, of which
glucopyranosyl-oxybenzylbenzene derivatives, which have an
inhibitory activity in human SGLT2, represented by the general
formula: 3
[0004] wherein R represents a lower alkyl group, a lower alkoxy
group, a lower alkylthio group, a lower alkoxy-substituted (lower
alkyl) group, a lower alkoxy-substituted (lower alkoxy) group or a
lower alkoxy-substituted (lower alkylthio) group, are active forms,
and relates to pharmaceutical compositions comprising the same.
BACKGROUND ART
[0005] Diabetes is one of lifestyle-related diseases with the
background of change of eating habit and lack of exercise. Hence,
diet and exercise therapies are performed in patients with
diabetes. Furthermore, when its sufficient control and continuous
performance are difficult, drug treatment is simultaneously
performed. At present, biguanides, sulfonylureas and agents for
reducing insulin resistance have been employed as antidiabetic
agents. However, biguanides and sulfonylureas show occasionally
adverse effects such as lactic acidosis and hypoglysemia,
respectively. In case of using agents for reducing insulin
resistance, adverse effects such as edema occasionally are
observed, and it is also concerned for advancing obesity.
Therefore, in order to solve these problems, it has been desired to
develop antidiabetic agents having a new mechanism.
[0006] In recent years, development of new type antidiabetic agents
has been progressing, which promote urinary glucose excretion and
lower blood glucose level by preventing excess glucose reabsorption
at the kidney (J. Clin. Invest., Vol.79, pp.1510-1515 (1987)). In
addition, it is reported that SGLT2 (Na.sup.+/glucose cotransporter
2) is present in the S1 segment of the kidney's proximal tubule and
participates mainly in reabsorption of glucose filtrated through
glomerular (J. Clin. Invest., Vol.93, pp.397-404 (1994)).
Accordingly, inhibiting a human SGLT2 activity prevents
reabsorption of excess glucose at the kidney, subsequently promotes
excreting excess glucose though the urine, and normalizes blood
glucose level. Therefore, fast development of antidiabetic agents
which have a potent inhibitory activity in human SGLT2 and have a
new mechanism has been desired. Furthermore, since such agents
promote the excretion of excess glucose though the urine and
consequently the glucose accumulation in the body is decreased,
they are also expected to have a preventing effect on obesity.
DISCLOSURE OF THE INVENTION
[0007] The present inventors have studied earnestly to find
compounds having an inhibitory activity in human SGLT2. As a
result, it was found that compounds represented by the above
general formula (I) are converted in vivo into their active forms,
glucopyranosyloxybenzylbenzene derivatives represented by the above
general formula (II), and show an excellent inhibitory activity in
human SGLT2 as mentioned below, thereby forming the basis of the
present invention.
[0008] The present invention is to provide the following
glucopyranosyloxybenzylbenzene derivatives which exert an
inhibitory activity in human SGLT2 in vivo and show an excellent
hypoglycemic effect by excreting excess glucose in the urine
through preventing the reabsorption of glucose at the kidney, and
pharmaceutical compositions comprising the same.
[0009] This is, the present invention relates to a
glucopyranosyloxybenzyl- benzene derivative represented by the
general formula: 4
[0010] wherein P represents a group forming a prodrug; and R
represents a lower alkyl group, a lower alkoxy group, a lower
alkylthio group, a lower alkoxy-substituted (lower alkyl) group, a
lower alkoxy-substituted (lower alkoxy) group or a lower
alkoxy-substituted (lower alkylthio) group.
[0011] The present invention relates to a pharmaceutical
composition comprising as an active ingredient a
glucopyranosyloxybenzylbenzene derivative represented by the above
general formula (I).
[0012] The present invention relates to a human SGLT2 inhibitor
comprising as an active ingredient a glucopyranosyloxybenzylbenzene
derivative represented by the above general formula (I).
[0013] The present invention relates to an agent for the prevention
or treatment of a disease associated with hyperglycemia, which
comprises as an active ingredient a glucopyranosyloxybenzylbenzene
derivative represented by the above general formula (I).
[0014] The present invention relates to a method for the prevention
or treatment of a disease associated with hyperglycemia, which
comprises administering a therapeutically effective amount of a
glucopyranosyloxybenzylbenzene derivative represented by the above
general formula (I).
[0015] The present invention relates to a use of a
glucopyranosyloxybenzyl- benzene derivative represented by the
above general formula (I) for the manufacture of a pharmaceutical
composition for the prevention or treatment of a disease associated
with hyperglycemia.
[0016] In the present invention, the term "prodrug" means a
compound which is converted into a glucopyranosyloxybenzylbenzene
derivative represented by the above general formula (II) as an
active form thereof in vivo. As examples of groups forming
prodrugs, a hydroxy-protective group used generally as a prodrug,
such as a lower acyl group, a lower alkoxy-substituted (lower acyl)
group, a lower alkoxycarbonyl-substituted (lower acyl) group, a
lower alkoxycarbonyl group and a lower alkoxy-substituted (lower
alkoxycarbonyl) group, are illustrated.
[0017] Also, in the present invention, the term "lower alkyl group"
means a straight-chained or branched alkyl group having 1 to 6
carbon atoms such as a methyl group, an ethyl group, a propyl
group, an isopropyl group, a butyl group, an isobutyl group, a
sec-butyl group, a tert-butyl group, a pentyl group, an isopentyl
group, a neopentyl group, a tert-pentyl group, a hexyl group or the
like; the term "lower alkoxy group" means a straight-chained or
branched alkoxy group having 1 to 6 carbon atoms such as a methoxy
group, an ethoxy group, a propoxy group, an isopropoxy group, a
butoxy group, an isobutoxy group, a sec-butoxy group, a tert-butoxy
group, a pentyloxy group, an isopentyloxy group, a neopentyloxy
group, a tert-pentyloxy group, a hexyloxy group or the like; and
the term "lower alkylthio group" means a straight-chained or
branched alkylthio group having 1 to 6 carbon atoms such as a
methylthio group, an ethylthio group, a propylthio group, an
isopropylthio group, a butylthio group, an isobutylthio group, a
sec-butylthio group, a tert-butylthio group, a pentylthio group, an
isopentylthio group, a neopentylthio group, a tert-pentylthio
group, a hexylthio group or the like. The term "lower
alkoxy-substituted (lower alkyl) group means the above lower alkyl
group substituted by the above lower alkoxy group; the term "lower
alkoxy-substituted (lower alkoxy) group means the above lower
alkoxy group substituted by the above lower alkoxy group; and the
term "lower alkoxy-substituted (lower alkylthio) group means the
above lower alkylthio group substituted by the above lower alkoxy
group. The term "lower acyl group" means a straight-chained,
branched or cyclic acyl group having 2 to 7 carbon atoms such as an
acetyl group, a propionyl group, a butyryl group, an isobutyryl
group, a pivaloyl group, a hexanoyl group and a cyclohexylcarbonyl
group; and the term "lower alkoxy-substituted (lower acyl) group
means the above lower acyl group substituted by the above lower
alkoxy group. The term "lower alkoxycarbonyl group" means a
straight-chained, branched or cyclic alkoxycarbonyl group having 2
to 7 carbon atoms such as a methoxycarbonyl group, an
ethoxycarbonyl group, an isopropyloxycarbonyl group, an
isobutyloxycarbonyl group and a cyclohexyloxycarbonyl group; the
term "lower alkoxycarbonyl-substituted (lower acyl) group means the
above lower acyl group substituted by the above lower
alkoxycarbonyl group such as a 3-(ethoxycarbonyl)propionyl group;
and the term "lower alkoxy-substituted (lower alkoxycarbonyl) group
means the above lower alkoxycarbonyl group substituted by the above
alkoxy group such as a 2-methoxyethoxycarbonyl group.
[0018] In the substituent R, a lower alkyl group and a lower alkoxy
group are preferable, a straight-chained or branched alkyl group
having 1 to 4 carbon atoms and a straight-chained or branched
alkoxy group having 1 to 3 carbon atoms are more preferable, and an
ethyl group and a methoxy group are most preferable. In the
substituent P, a lower acyl group and a lower alkoxycarbonyl group
are preferable. As the lower acyl group, a straight-chained or
branched acyl group having 4 to 6 carbon atoms is preferable, and a
butyryl group and a hexanoyl group are more preferable. As the
lower alkoxycarbonyl group, a straight-chained or branched
alkoxycarbonyl group having 2 to 5 carbon atoms is preferable, and
a methoxycarbonyl group and an ethoxycarbonyl group are more
preferable.
[0019] The compounds of the present invention can be prepared by
introducing a hydroxy-protective group being capable of using
commonly in prodrugs into the hydroxy group of a
glucopyranosyloxybenzylbenzene derivative represented by the above
general formula (II) in the usual way. For example, the compounds
represented by the above general formula (I) of the present
invention can be prepared using a glucopyranosyloxybenzylbenzene
derivative represented by the above general formula (II) according
to the following procedure: 5
[0020] wherein X represents a leaving group such as a bromine atom
and a chlorine atom; and R and P have the same meanings as defined
above.
[0021] A prodrug represented by the above general formula (I) can
be prepared by protecting the hydroxy group of a
glucopyranosyloxybenzylbenz- ene derivative represented by the
above general formula (II) with a reagent for protecting
represented by the above general formula (III) in the presence of a
base such as pyridine, triethylamine, N,N-diisopropylethylamine,
picoline, lutidine, collidine, quinuclidine,
1,2,2,6,6-pentamethylpiperidine or 1,4-diazabicyclo[2.2.2]octane in
an inert solvent or without any solvent. As the solvent used,
dichloromethane, acetonitrile, ethyl acetate, diisopropyl ether,
chloroform, tetrahydrofuran, 1,2-dimethoxyethane, 1,4-dioxane,
acetone, tert-butanol, a mixed solvent thereof and the like can be
illustrated. The reaction temperature is usually from -40.degree.
C. to reflux temperature, and the reaction time is usually from 30
minutes to 2 days, varying based on a used starting material,
solvent and reaction temperature.
[0022] For example, the compounds represented by the above general
formula (II) of the present invention which are used as starting
materials in the aforementioned production process can be prepared
according to the following procedure: 6
[0023] wherein M represents a hydroxy-protective group; X.sup.1
represents a leaving group such as a trichloroacetoimidoyloxy
group, an acetoxy group, a bromine atom or a fluorine atom; one of
Y and Z represents MgBr, MgCl, MgI or a lithium atom, while the
other represents a formyl group; and R has the same meaning as
defined above.
[0024] Process 1
[0025] A compound represented by the above general formula (VI) can
be prepared by condensing a benzaldehyde derivative represented by
the above general formula (IV) with a Grignard reagent or a lithium
reagent represented by the above general formula (V), or by
condensing a Grignard reagent or a lithium reagent represented by
the above general formula (IV) with a benzaldehyde derivative
represented by the above general formula (V) in an inert solvent.
As the solvent used, tetrahydrofuran, diethyl ether, a mixed
solvent thereof and the like can be illustrated. The reaction
temperature is usually from -78.degree. C. to reflux temperature,
and the reaction time is usually from 10 minutes to 1 day, varying
based on a used starting material, solvent and reaction
temperature.
[0026] Process 2
[0027] A compound represented by the above general formula (VII)
can be prepared by subjecting a compound represented by the above
general formula (VI) to oxidation using a Dess-Martin reagent in an
inert solvent. As the solvent used, dichloromethane, chloroform,
acetonitrile, a mixed solvent thereof and the like can be
illustrated. The reaction temperature is usually from 0.degree. C.
to reflux temperature, and the reaction time is usually from 1 hour
to 1 day, varying based on a used starting material, solvent and
reaction temperature.
[0028] Process 3
[0029] A compound represented by the above general formula (VIII)
can be prepared by subjecting a compound represented by the above
general formula (VI) to catalytic hydrogenation using a palladium
catalyst such as palladium-carbon powder in the presence or absence
of an acid such as hydrochloric acid in an inert solvent, and
removing a protective group in the usual way as occasion demands.
As the solvent used in the catalytic hydrogenation, methanol,
ethanol, tetrahydrofuran, ethylacetate, acetic acid, isopropanol, a
mixed solvent thereof and the like can be illustrated. The reaction
temperature is usually from room temperature to reflux temperature,
and the reaction time is usually from 30 minutes to 1 day, varying
based on a used starting material, solvent and reaction
temperature. The compound of the above general formula (VIII) can
be converted into a salt thereof such as a sodium salt or a
potassium salt in the usual way.
[0030] Process 4
[0031] A compound represented by the above general formula (VIII)
can be prepared by removing the protective group M of a compound
represented by the above general formula (VII) in the usual way,
condensing the resulting compound with methyl chloroformate in the
presence of a base such as triethylamine, diisopropylethylamine or
4-(N,N-dimethylamino)pyri- dine in an inert solvent and subjecting
the resulting carbonate compound to reduction using a reducing
agent such as sodium borohydride. As the solvent used in the
condensing reaction, tetrahydrofuran, dichloromethane,
acetonitrile, ethyl acetate, diethyl ether, a mixed solvent thereof
and the like can be illustrated. The reaction temperature is
usually from 0.degree. C. to reflux temperature, and the reaction
time is usually from 30 minutes to 1 day, varying based on a used
starting material, solvent and reaction temperature. As the solvent
used in the reducing reaction, a mixed solvent with tetrahydrofuran
and water, and the like can be illustrated. The reaction
temperature is usually from 0.degree. C. to reflux temperature, and
the reaction time is usually from 1 hour to 1 day, varying based on
a used starting material, solvent and reaction temperature. The
compound of the above general formula (VIII) can be converted into
a salt thereof such as a sodium salt or a potassium salt in the
usual way.
[0032] Process 5
[0033] A glucoside represented by the above general formula (X) can
be prepared by subjecting a benzylphenol derivative represented by
the above general formula (VIII) or a salt thereof to glycosidation
using a glycosyl-donor represented by the above general formula
(IX) such as
2,3,4,6-tetra-O-acetyl-1-O-trichloroacetoimidoyl-.alpha.-D-glucopyranose,
1,2,3,4,6-penta-O-acetyl-.beta.-D-glucopyranose,
2,3,4,6-tetra-O-acetyl-.- alpha.-D-glucopyranosyl bromide and
2,3,4,6-tetra-O-acetyl-.beta.-D-glucop- yranosyl fluoride in the
presence of an activating reagent such as boron trifluoride diethyl
ether complex, silver trifluoromethanesulfonate, tin(IV) chloride
or trimethylsilyl trifluoromethanesulfonate in an inert solvent. As
the solvent used, dichloromethane, toluene, acetonitrile,
nitromethane, ethyl acetate, diethyl ether, chloroform, a mixed
solvent thereof and the like can be illustrated. The reaction
temperature is usually from -30.degree. C. to reflux temperature,
and the reaction time is usually from 10 minutes to 1 day, varying
based on a used starting meterial, solvent and reaction
temperature.
[0034] Process 6
[0035] A glucopyranosyloxybenzylbenzene derivative represented by
the above general formula (II) can be prepared by subjecting a
glucoside represented by the above general formula (X) to alkaline
hydrolysis to remove the hydroxy-protective groups. As the solvent
used, water, methanol, ethanol, tetrahydrofuran, a mixed solvent
thereof and the like can be illustrated, and as alkaline materials,
sodium hydroxide, sodium methoxide, sodium ethoxide or the like can
be used. The treatment temperature is usually from 0.degree. C. to
reflux temperature, and the treatment time is usually from 30
minutes to 6 hours, varying based on a used starting material,
solvent and treatment temperature.
[0036] The compounds of the present invention obtained by the above
production process can be isolated and purified by conventional
separation means such as fractional recrystallization, purification
using chromatography, solvent extraction and solid phase
extraction.
[0037] The prodrugs represented by the above general formula (I) of
the present invention include their hydrates and their solvates
with pharmaceutically acceptable solvents such as ethanol.
[0038] The prodrug represented by the above general formula (I) of
the present invention is converted into a
glucopyranosyloxybenzylbenzene derivative represented by the above
general formula (II) as an active form thereof in vivo and can
exert an excellent inhibitory activity in human SGLT2. In addition,
the prodrugs represented by the above general formula (I) of the
present invention have an improved oral absorption, and
pharmaceutical compositions comprising as the active ingredient the
prodrug have a highly usefulness as oral formulations. Therefore,
the prodrugs of the present invention are extremely useful as
agents for the prevention or treatment of a disease associated with
hyperglycemia such as diabetes, diabetic complications, obesity or
the like.
[0039] When the pharmaceutical compositions of the present
invention are employed in the practical treatment, various dosage
forms are used depending on their uses. As examples of the dosage
forms, powders, granules, fine granules, dry sirups, tablets,
capsules, injections, solutions, ointments, suppositories,
poultices and the like are illustrated, which are orally or
parenterally administered.
[0040] These pharmaceutical compositions can be prepared by
admixing with or by diluting and dissolving with an appropriate
pharmaceutical additive such as excipients, disintegrators,
binders, lubricants, diluents, buffers, isotonicities, antiseptics,
moistening agents, emulsifiers, dispersing agents, stabilizing
agents, dissolving aids and the like, and formulating the mixture
in accordance with pharmaceutically conventional methods depending
on their dosage forms.
[0041] When the pharmaceutical compositions of the present
invention are employed in the practical treatment, the dosage of a
compound of the present invention as the active ingredient is
appropriately decided depending on the age, sex, body weight and
degrees of symptoms and treatment of each patient, which is
approximately within the range of from 0.1 to 1,000 mg per day per
adult human in case of oral administration and approximately within
the range of from 0.01 to 300 mg per day per adult human in case of
parenteral administration, and the daily dose can be divided into
one to several doses per day and administered suitably.
EXAMPLES
[0042] The present invention is further illustrated in more detail
by way of the following Reference Examples, Examples and Test
Examples. However, the present invention is not limited
thereto.
Reference Example 1
[0043] 2-(4-Isobutylbenzyl)phenol
[0044] A Grignard reagent was prepared from
2-benzyloxy-1-bromobenzene (0.20 g), magnesium (0.026 g), a
catalytic amount of iodine and tetrahydrofuran (1 mL) in the usual
manner. The obtained Grignard reagent was added to a solution of
4-isobutylbenzaldehyde (0.16 g) in tetrahydrofuran (2 mL), and the
mixture was stirred at room temperature for 30 minutes. The
reaction mixture was purified by column chromatography on
aminopropyl silica gel (eluent: tetrahydrofuran) to give a
diphenylmethanol compound (0.23 g). The obtained diphenylmethanol
compound was dissolved in ethanol (3 mL) and concentrated
hydrochloric acid (0.1 mL). To the solution was added a catalytic
amount of 10% palladium-carbon powder, and the mixture was stirred
under a hydrogen atmosphere at room temperature overnight. The
catalyst was removed by filtration, and the filtrate was
concentrated under reduced pressure. The residue was purified by
column chromatography on silica gel (eluent:
dichloromethane/hexane=1/1) to give 2-(4-isobutylbenzyl)phenol
(0.10 g).
[0045] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0046] 0.89 (6H, d, J=6.6 Hz), 1.75-1.90 (1H, m), 2.43 (2H, d,
J=7.2 Hz), 3.97 (2H, s), 4.66 (1H, s), 6.75-6.85 (1H, m), 6.85-6.95
(1H, m), 7.00-7.20 (6H, m)
Reference Example 2
[0047] 2-(4-Isopropoxybenzyl)phenol
[0048] The title compound was prepared in a similar manner to that
described in Reference Example 1 using 4-isopropoxybenzaldehyde
instead of 4-isobutylbenzaldehyde.
[0049] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0050] 1.31 (6H, d, J=6.1 Hz), 3.93 (2H, s), 4.50 (1H, heptet,
J=6.1 Hz), 4.72 (1H, s), 6.75-6.85 (3H, m), 6.85-6.95 (1H, m),
7.05-7.20 (4H, m)
Reference Example 3
[0051] 2-(4-Ethoxybenzyl)phenol
[0052] A Grignard reagent was prepared from 1-bromo-4-ethoxybenzene
(1.5 g), magnesium (0.19 g), a catalytic amount of iodine and
tetrahydrofuran (2 mL) in the usual manner. To the obtained
Grignard reagent solution was added dropwise a solution of
2-benzyloxybenzaldehyde (1.1 g) in tetrahydrofuran (15 mL), and the
mixture was stirred at room temperature for 30 minutes. To the
reaction mixture were added a saturated aqueous ammonium chloride
solution (10 mL) and water (20 mL), and the mixture was extracted
with ethyl acetate (100 mL). The extract was washed with water (20
mL) and brine (20 mL), and dried over anhydrous sodium sulfate.
Thereafter, the solvent was removed under reduced pressure. The
residue was purified by column chromatography on silica gel
(eluent: hexane/ethyl acetate=5/1) to give a diphenylmethanol
compound (1.7 g). The obtained diphenylmethanol compound (1.7 g)
was dissolved in ethanol (25 mL). To the solution were added
concentrated hydrochloric acid (0.42 mL) and a catalytic amount of
10% palladium-carbon powder, and the mixture was stirred under a
hydrogen atmosphere at room temperature for 18 hours. The catalyst
was removed by filtration, and the filtrate was concentrated under
reduced pressure. To the residue was added ethyl acetate (100 mL),
and the mixture was washed with a saturated aqueous sodium hydrogen
carbonate solution (30 mL) and brine (30 mL). The organic layer was
dried over anhydrous sodium sulfate, and the solvent was removed
under reduced pressure. The residue was purified by column
chromatography on silica gel (eluent: hexane/ethyl acetate=8/1) to
give 2-(4-ethoxybenzyl)phenol (0.85 g).
[0053] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0054] 1.39 (3H, t, J=7.1 Hz), 3.93 (2H, s), 4.00 (2H, q, J=7.1
Hz), 4.72 (1H, s), 6.75-6.85 (3H, m), 6.85-6.95 (1H, m), 7.05-7.20
(4H, m)
Reference Example 4
[0055] 2-(4-Ethylthiobenzyl)phenol
[0056] A Grignard reagent was prepared from
1-bromo-4-ethylthiobenzene (1.1 g), magnesium (0.12 g), a catalytic
amount of iodine and tetrahydrofuran (5 mL) in the usual manner. To
the obtained Grignard reagent solution was added a solution of
2-(methoxymethoxy)benzaldehyde (0.56 g) in tetrahydrofuran (12 mL),
and the mixture was stirred at 65.degree. C. for 10 minutes. After
cooling to ambient temperature, a saturated aqueous ammonium
chloride solution (5 mL) and water (20 mL) were added to the
reaction mixture, and the mixture was extracted with ethyl acetate
(80 mL). The extract was washed with water (20 mL) and brine (20
mL), dried over anhydrous sodium sulfate, then the solvent was
removed under reduced pressure. The residue was purified by column
chromatography on silica gel (eluent:hexane/ethyl acetate=4/1) to
give a diphenylmethanol compound (0.91 g). The obtained
diphenylmethanol compound (0.90 g) was dissolved in dichloromethane
(15 mL). To the solution was added a Dess-Martin reagent
(1,1,1-tris(acetyloxy)-1,1-dihyd- ro-1,2-benziodoxol-3-(1H)-one)
(1.5 g), and the mixture was stirred at 25.degree. C. for 26 hours.
To the reaction mixture were added diethyl ether (75 mL) and 1
mol/L aqueous sodium hydroxide solution (30 mL), the mixture was
stirred vigorously, and the organic layer was separated. The
organic layer was washed with 1 mol/L aqueous sodium hydroxide
solution (30 mL), water (30 mL, 3 times) and brine (30 mL), dried
over anhydrous sodium sulfate, and the solvent was removed under
reduced pressure. The residue was purified by column chromatography
on silica gel (eluent: hexane/ethyl acetate=15/1-9/1) to afford a
ketone compound (0.82 g). A mixture of the obtained ketone compound
(0.81 g), p-toluenesulfonic acid monohydrate (0.10 g) and methanol
(14 mL) was stirred at 60.degree. C. for 4 hours. After cooling to
ambient temperature, the reaction mixture was concentrated under
reduced pressure. The residue was purified by column chromatography
on silica gel (eluent: hexane/ethyl acetate=15/1) to give a
deprotected compound (0.69 g). The obtained deprotected compound
(0.68 g) was dissolved in tetrahydrofuran (11 mL), triethylamine
(0.41 mL) and methyl chloroformate (0.22 mL) were added to the
solution, and the mixture was stirred at 25.degree. C. for 1 hour.
Furthermore, triethylamine (0.1 mL) and methyl chloroformate (0.061
mL) were added to the reaction mixture, and the mixture was stirred
for 30 minutes. The reaction mixture was filtered, and the filtrate
was concentrated under reduced pressure. The residue was dissolved
in tetrahydrofuran (14 mL) and water (7 mL), sodium borohydride
(0.40 g) was added to the solution, and the mixture was stirred at
25.degree. C. for 7 hours. To the reaction mixture was added
dropwise 1 mol/L hydrochloric acid (15 mL), and the mixture was
extracted with ethyl acetate (75 mL). The extract was washed with
water (20 mL), a saturated aqueous sodium hydrogen carbonate
solution (20 mL) and brine (20 mL), dried over anhydrous sodium
sulfate, and the solvent was removed under reduced pressure. The
residue was purified by column chromatography on silica gel
(eluent: hexane/ethyl acetate=8/1) to give
2-(4-ethylthiobenzyl)phenol (0.62 g).
[0057] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0058] 1.29 (3H, t, J=7.3 Hz), 2.90 (2H, q, J=7.3 Hz), 3.96 (2H,
s), 4.62 (1H, s), 6.75-6.80 (1H, m), 6.85-6.95 (1H, m), 7.05-7.20
(4H, m), 7.20-7.30 (2H, m)
Reference Example 5
[0059] 2-(4-Methoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyra- noside
[0060] To a solution of 2-(4-methoxybenzyl)phenol (46 mg) and
2,3,4,6-tetra-O-acetyl-1-O-trichloroacetoimdoyl-.alpha.-D-glucopy
ranose (0.13 g) in dichloromethane (2 mL) was added boron
trifluoride diethyl ether complex (0.033 mL), and the mixture was
stirred at room temperature for 1 hour. The reaction mixture was
purified by column chromatography on aminopropyl silica gel
(eluent: dichloromethane) to give 2-(4-methoxybenzyl)phenyl
2,3,4,6-terta-O-acetyl-.beta.-D-glucopyranoside (0.11 g).
[0061] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0062] 1.91 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.08 (3H, s), 3.77
(3H, s), 3.80-3.95 (3H, m), 4.17 (1H, dd, J=2.5, 12.2 Hz), 4.29
(1H, dd, J=5.5, 12.2 Hz), 5.11 (1H, d, J=7.5 Hz), 5.10-5.25 (1H,
m), 5.25-5.40 (2H, m), 6.75-6.85 (2H, m), 6.95-7.10 (5H, m),
7.10-7.25 (1H, m)
Reference Example 6
[0063] 2-(4-Methylbenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyran- oside
[0064] The title compound was prepared in a similar manner to that
described in Reference Example 5 using 2-(4-methylbenzyl)-phenol
instead of 2-(4-methoxybenzyl)phenol.
[0065] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0066] 1.89 (3H, s), 2.03 (3H, s), 2.05 (3H, s), 2.07 (3H, s), 2.30
(3H, s), 3.80-3.95 (3H, m), 4.17 (1H, dd, J=2.5, 12.3 Hz), 4.28
(1H, dd, J=5.5, 12.3 Hz), 5.11 (1H, d, J=7.5 Hz), 5.10-5.25 (1H,
m), 5.25-5.40 (2H, m), 6.90-7.20 (8H, m)
Reference Example 7
[0067] 2-(4-Ethylbenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyrano- side
[0068] The title compound was prepared in a similar manner to that
described in Reference Example 5 using 2-(4-ethylbenzyl)-phenol
instead of 2-(4-methoxybenzyl)phenol.
[0069] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0070] 1.20 (3H, t, J=7.6 Hz), 1.87 (3H, s), 2.03 (3H, s), 2.05
(3H, s), 2.08 (3H, s), 2.60 (2H, q, J=7.6 Hz), 3.80-4.00 (3H, m),
4.18 (1H, dd, J=2.3, 12.2 Hz), 4.28 (1H, dd, J=5.4, 12.2 Hz), 5.11
(1H, d, J=7.5 Hz), 5.10-5.25 (1H, m), 5.25-5.40 (2H, m), 6.90-7.25
(8H, m)
Reference Example 8
[0071] 2-(4-Isobutylbenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyr- anoside
[0072] The title compound was prepared in a similar manner to that
described in Reference Example 5 using 2-(4-isobutylbenzyl)phenol
instead of 2-(4-methoxybenzyl)phenol.
[0073] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0074] 0.88 (6H, d, J=6.6 Hz), 1.75-1.90 (1H, m), 1.87 (3H, s),
2.03 (3H, s), 2.05 (3H, s), 2.08 (3H, s), 2.42 (2H, d, J=7.2 Hz),
3.80-3.95 (3H, m), 4.18 (1H, dd, J=2.4, 12.3 Hz), 4.29 (1H, dd,
J=5.5, 12.3 Hz), 5.11 (1H, d, J=7.6 Hz), 5.10-5.25 (1H, m),
5.25-5.40 (2H, m), 6.90-7.25 (8H, m)
Reference Example 9
[0075] 2-(4-Ethoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyran- oside
[0076] The title compound was prepared in a similar manner to that
described in Reference Example 5 using 2-(4-ethoxybenzyl)phenol
instead of 2-(4-methoxybenzyl)phenol.
[0077] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0078] 1.39 (3H, t, J=7.0 Hz), 1.91 (3H, s), 2.03 (3H, s), 2.05
(3H, s), 2.07 (3H, s), 3.80-3.95 (3H, m), 3.99 (2H, q, J=7.0 Hz),
4.18 (1H, dd, J=2.5, 12.3 Hz), 4.28 (1H, dd, J=5.6, 12.3 Hz), 5.10
(1H, d, J=7.7 Hz), 5.15-5.25 (1H, m), 5.25-5.40 (2H, m), 6.75-6.85
(2H, m), 6.95-7.10 (5H, m), 7.10-7.20 (1H, m)
Reference Example 10
[0079] 2-(4-Isopropoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucop- yranoside
[0080] The title compound was prepared in a similar manner to that
described in Reference Example 5 using 2-(4-isopropoxybenzyl)phenol
instead of 2-(4-methoxybenzyl)phenol.
[0081] .sup.1H-NMR (CDCl.sub.3) .delta. ppm:
[0082] 1.30 (6H, d, J=6.0 Hz), 1.90 (3H, s), 2.03 (3H, s), 2.05
(3H, s), 2.08 (3H, s), 3.80-3.90 (3H, m), 4.18 (1H, dd, J=2.3, 12.3
Hz), 4.28 (1H, dd, J=5.5, 12.3 Hz), 4.48 (1H, heptet, J=6.0 Hz),
5.10 (1H, d, J=7.7 Hz), 5.10-5.25 (1H, m), 5.25-5.40 (2H, m),
6.70-6.85 (2H, m), 6.90-7.10 (5H, m), 7.10-7.20 (1H, m)
Reference Example 11
[0083] 2-(4-Methoxybenzyl)phenyl .beta.-D-glucopyranoside
[0084] Sodium methoxide (28% methanol solution; 0.12 mL) was added
to a solution of 2-(4-methoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glu- copyranoside (0.11 g) in
methanol (4 mL), and the mixture was stirred at room temperature
for 30 minutes. The solvent was removed under reduced pressure. The
residue was purified by column chromatography on silica gel
(eluent: dichloromethane/methanol=10/1) to give
2-(4-methoxybenzyl)-pheny- l .beta.-D-glucopyranoside (65 mg).
[0085] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0086] 3.35-3.55 (4H, m), 3.69 (1H, dd, J=5.1, 12.1 Hz), 3.73 (3H,
s), 3.80-4.00 (2H, m), 4.03 (1H, d, J=15.1 Hz), 4.91 (1H, d, J=7.4
Hz), 6.75-6.85 (2H,m), 6.85-6.95 (1H, m), 6.95-7.10 (1H, m),
7.10-7.20 (4H, m)
Reference Example 12
[0087] 2-(4-Methylbenzyl)phenyl .beta.-D-glucopyranoside
[0088] The title compound was prepared in a similar manner to that
described in Reference Example 11 using 2-(4-methylbenzyl)-phenyl
2,3,4,6-tetra-0-acetyl-.beta.-D-glucopyranoside instead of
2-(4-methoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside- .
[0089] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0090] 2.27 (3H, s), 3.35-3.55 (4H, m), 3.69 (1H, dd, J=5.2, 12.0
Hz), 3.80-3.90 (1H, m), 3.94 (1H, d, J=15.0 Hz), 4.05 (1H, d,
J=15.0 Hz), 4.85-4.95 (1H, m), 6.85-6.95 (1H, m), 6.95-7.20 (7H,
m)
Reference Example 13
[0091] 2-(4-Ethylbenzyl)phenyl .beta.-D-glucopyranoside
[0092] The title compound was prepared in a similar manner to that
described in Reference Example 11 using 2-(4-ethylbenzyl)-phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside instead of
2-(4-methoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside- .
[0093] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0094] 1.15-1.25 (3H, m), 2.50-2.65 (2H, m), 3.35-3.55 (4H, m),
3.65-3.75 (1H,m), 3.80-4.00 (2H, m), 4.06 (1H, d, J=14.9 Hz),
4.85-5.00 (1H, m), 6.85-7.00 (1H, m), 7.00-7.20 (7H, m)
Reference Example 14
[0095] 2-(4-Isobutylbenzyl)phenyl .beta.-D-glucopyranoside
[0096] The title compound was prepared in a similar manner to that
described in Reference Example 11 using 2-(4-isobutylbenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside instead of
2-(4-methoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside- .
[0097] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0098] 0.80-0.95 (6H, m), 1.70-1.90 (1H, m), 2.41 (2H, d, J=7.1
Hz), 3.30-3.55 (4H, m), 3.60-3.75 (1H, m), 3.80-3.95 (1H, m), 3.95
(1H, d, J=15.0 Hz), 4.06 (1H, d, J=15.0 Hz), 4.85-4.95 (1H, m),
6.80-7.20 (8H, m)
Reference Example 15
[0099] 2-(4-Ethoxybenzyl)phenyl .beta.-D-glucopyranoside
[0100] The title compound was prepared in a similar manner to that
described in Reference Example 11 using 2-(4-ethoxylbenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside instead of
2-(4-methoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside- .
[0101] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0102] 1.35 (3H, t, J=6.8 Hz), 3.35-3.55 (4H, m), 3.60-3.75 (1H,
m), 3.80-4.10 (5H, m), 4.90 (1H, d, J=7.1 Hz), 6.70-6.85 (2H, m),
6.85-6.95 (1H, m), 7.00-7.20 (5H, m)
Reference Example 16
[0103] 2-(4-Isopropoxybenzy)phenyl .beta.-D-Glucopyranoside
[0104] The title compound was prepared in a similar manner to that
described in Reference Example 11 using
2-(4-isopropoxylbenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside instead of
2-(4-methoxybenzyl)phenyl
2,3,4,6-tetra-O-acetyl-.beta.-D-glucopyranoside- .
[0105] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0106] 1.27 (6H, d, J=6.0 Hz), 3.35-3.55 (4H, m), 3.69 (1H, dd,
J=5.4, 12.1 Hz), 3.88 (1H, dd, J=2.0, 12.1 Hz), 3.91 (1H, d, J=15.0
Hz), 4.02 (1H, d, J=15.0 Hz), 4.51 (1H, heptet, J=6.0 Hz), 4.91
(1H, d, J=7.7 Hz), 6.70-6.85 (2H,m), 6.85-6.95 (1H, m), 7.00-7.10
(1H, m), 7.10-7.20 (4H, m)
Reference Example 17
[0107] 2-(4-Ethylthiobenzyl)phenyl .beta.-D-glucopyranoside
[0108] To a solution of 2-(4-ethylthiobenzyl)phenol (0. 51 g) and
1,2,3,4,6-penta-O-acetyl-.beta.-D-glucopyranose (2.4 g) in toluene
(6.3 mL) and dichloromethane (2.7 mL) was added boron trifluoride
diethyl ether complex (0.78 mL), and the mixture was stirred at
room temperature for 9 hours. To the reaction mixture were added
ethyl acetate (70 mL) and a saturated aqueous sodium hydrogen
carbonate solution (25 mL), and the organic layer was separated.
The organic layer was washed with brine (25 mL), dried over
anhydrous sodium sulfate, and the solvent was removed under reduced
pressure. The residue was dissolved in methanol (10.5 mL), sodium
methoxide (28% methanol solution; 0.08 mL) was added to the
solution, and the mixture was stirred at 25.degree. C. for 18
hours. To the reaction mixture were added ethyl acetate (75 mL) and
water (20 mL), and the organic layer was separated. The organic
layer was washed with brine (20 mL), dried over anhydrous sodium
sulfate, and the solvent was removed under reduced pressure. The
residue was purified by column chromatography on silica gel
(eluent: dichloromethane/methanol=10/1). The solvent was removed
under reduced pressure, diethyl ether was added to the residue, and
the resulting precipitates were collected by filtration. The
obtained colorless solid was washed with diethyl ether and dried
under reduced pressure to give 2-(4-ethylthiobenzyl)phenyl
.beta.-D-glucopyranoside (0.51 g).
[0109] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0110] 1.24 (3H, t, J=7.3 Hz), 2.88 (2H, q, J=7.3 Hz), 3.35-3.55
(4H, m), 3.69 (1H, dd, J=5.0, 12.2 Hz), 3.88 (1H, dd, J=2.0, 12.2
Hz), 3.95 (1H, d, J=15.1 Hz), 4.08 (1H, d, J=15.1 Hz), 4.91 (1H, d,
J=7.3 Hz), 6.85-7.00 (1H, m), 7.00-7.10 (1H, m), 7.10-7.30 (6H,
m)
Example 1
[0111] 2-(4-Methoxybenzyl)phenyl
6-O-ethoxycarbonyl-.beta.-D-glucopyranosi- de
[0112] To a solution of 2-(4-methoxybenzyl)phenyl
.beta.-D-glucopyranoside (0.075 g) in 2,4,6-trimethylpyridine (2
mL) was added ethyl chloroformate (0.04 mL) at room temperature.
After the mixture was stirred at room temperature for 16 hours, a
saturated aqueous citric acid solution was added to the reaction
mixture, and the mixture was extracted with ethyl acetate. The
extract was washed with water and dried over anhydrous magnesium
sulfate, and the solvent was removed under reduced pressure. The
residue was purified by preparative thin layer chromatography on
silica gel (eluent: dichloromethane/methanol=10/1) to give
amorphous 2-(4-methoxybenzyl)phenyl
6-O-ethoxycarbonyl-.beta.-D-glucopyranoside (0.032 g).
[0113] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0114] 1.23 (3H, t, J=7.1 Hz), 3.30-3.65 (4H, m), 3.74 (3H, s),
3.93 (1H, d, J=15.1 Hz), 4.02 (1H, d, J=15.1 Hz), 4.05-4.20 (2H,
m), 4.29 (1H, dd, J=6.4,11.7 Hz), 4.45 (1H, dd, J=2.2, 11.7 Hz),
4.89 (1H, d, J=7.4 Hz), 6.75-6.85(2H, m), 6.85-7.05 (2H, m),
7.05-7.2 (4H, m)
Example 2
[0115] 2-(4-Methoxybenzyl)phenyl
6-O-methoxycarbonyl-.beta.-D-glucopyranos- ide
[0116] The title compound was prepared in a similar manner to that
described in Example 1 using methyl chloroformate instead of ethyl
chloroformate.
[0117] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0118] 3.30-3.65 (4H, m), 3.71 (3H, s), 3.74 (3H, s), 3.93 (1H, d,
J=15.1 Hz), 4.01 (1H, d, J=15.1 Hz), 4.30 (1H, dd, J=6.4, 11.7 Hz),
4.45 (1H, dd, J=2.1, 11.7 Hz), 4.89 (1H, d, J=7.4 Hz), 6.75-6.85
(2H, m), 6.85-7.05 (2H, m), 7.05-7.20 (4H, m)
Example 3
[0119] 2-(4-Methoxybenzyl)phenyl
6-O-[2-(methoxy)ethyloxycarbonyl]-.beta.-- D-glucopyranoside
[0120] The title compound was prepared in a similar manner to that
described in Example 1 using 2-(methoxy)ethyl chloroformate instead
of ethyl chloroformate.
[0121] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0122] 3.30-3.65 (9H, m), 3.74 (3H, s), 3.92 (1H, d, J=15.1 Hz),
4.02 (1H, d, J=15.1 Hz), 4.10-4.25 (2H, m), 4.30 (1H, dd, J=6.3,
11.7), 4.47 (1H, dd, J=2.1, 11.7 Hz), 4.89 (1H, d, J=7.4 Hz),
6.70-6.85 (2H, m), 6.85-7.05 (2H, m), 7.05-7.20 (4H, m)
Example 4
[0123] 2-(4-Methoxybenzyl)phenyl
6-O-hexanoyl-.beta.-D-glucopyranoside
[0124] To a solution of 2-(4-methoxybenzyl)phenyl
.beta.-D-glucopyranoside (0.10 g) in 2,4,6-trimethylpyridine (2 mL)
was added. hexanoyl chloride (0.072 g) at 0.degree. C., and the
mixture was stirred for 3 hours. To the reaction mixture was added
10% aqueous citric acid solution, and the mixture was extracted
with ethyl acetate. The organic layer was washed with 10% aqueous
citric acid solution and brine. The organic layer was dried over
anhydrous magnesium sulfate, and the solvent was removed under
reduced pressure. The residue was purified by preparative thin
layer chromatography on silica gel (eluent:
dichloromethane/methanol=10/1) to give 2-(4-methoxybenzyl)phenyl
6-O-hexanoyl-.beta.-D-glucopyranoside (0.030 g).
[0125] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0126] 0.80-0.95 (3H, m), 1.20-1.35 (4H, m), 1.50-1.65 (2H, m),
2.25-2.35 (2H,m), 3.30-3.65 (4H, m), 3.74 (3H, s), 3.93 (1H, d,
J=15.1 Hz), 4.01 (1H, d, J=15.1 Hz), 4.22 (1H, dd, J=6.7, 11.8 Hz),
4.42 (1H, dd, J=2.2, 11.8 Hz), 4.85-4.95 (1H, m), 6.75-6.85 (2H,
m), 6.85-7.05 (2H, m), 7.05-7.20 (4H, m)
Example 5
[0127] 2-(4-Methoxybenzyl)phenyl
6-O-propionyl-.beta.-D-glucopyranoside
[0128] The title compound was prepared in a similar manner to that
described in Example 4 using propionyl chloride instead of hexanoyl
chloride.
[0129] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0130] 1.08 (3H, t, J=7.6 Hz), 2.25-2.40 (2H, m), 3.30-3.55 (3H,
m), 3.55-3.65 (1H, m), 3.74 (3H, s), 3.93 (1H, d, J=15.1 Hz), 4.01
(1H, d, J=15.1 Hz), 4.23 (1H, dd, J=6.7, 11.8 Hz), 4.40 (1H, dd,
J=2.1, 11.8 Hz), 4.85-4.95 (1H, m), 6.75-6.85 (2H, m), 6.85-7.05
(2H, m), 7.05-7.20 (4H, m)
Example 6
[0131] 2-(4-Methoxybenzyl)phenyl
6-O-butyryl-.beta.-D-glucopyranoside
[0132] The title compound was prepared in a similar manner to that
described in Example 4 using butyryl chloride instead of hexanoyl
chloride.
[0133] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0134] 0.90 (3H, t, J=7.4 Hz), 1.50-1.70 (2H, m), 2.20-2.35 (2H,
m), 3.30-3.65 (4H, m), 3.74 (3H, s), 3.93 (1H, d, J=15.1 Hz), 4.01
(1H, d, J=15.1 Hz), 4.22 (1H, dd, J=6.7, 11.8 Hz), 4.42 (1H, dd,
J=2.2, 11.8 Hz), 4.85-4.95 (1H, m), 6.75-6.85 (2H, m), 6.85-7.05
(2H, m), 7.05-7.20 (4H, m)
Example 7
[0135] 2-(4-Methoxybenzyl)phenyl
6-O-acetyl-.beta.-D-glucopyranoside
[0136] The title compound was prepared in a similar manner to that
described in Example 4 using acetyl chloride instead of hexanoyl
chloride.
[0137] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0138] 2.02 (3H, s), 3.30-3.65 (4H, m), 3.74 (3H, s), 3.93 (1H, d,
J=15.1 Hz), 4.01 (1H, d, J=15.1 Hz), 4.24 (1H, dd, J=6.5, 11.9 Hz),
4.38 (1H, dd, J=2.2, 11.9 Hz), 4.85-4.95 (1H, m), 6.75-6.85 (2H,
m), 6.85-7.05 (2H, m), 7.05-7.20 (4H, m)
Example 8
[0139] 2-(4-Methoxybenzyl)phenyl
6-O-isobutyryl-.beta.-D-glucopyranoside
[0140] The title compound was prepared in a similar manner to that
described in Example 4 using isobutyryl chloride instead of
hexanoyl chloride.
[0141] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0142] 1.11 (3H, d, J=7.0 Hz), 1.12 (3H, d, J=7.0 Hz), 2.45-2.60
(1H, m), 3.30-3.65 (4H, m), 3.74 (3H, s), 3.93 (1H, d, J=15.1 Hz),
4.00 (1H, d, J=15.1 Hz), 4.19 (1H, dd, J=6.9, 11.8 Hz), 4.43 (1H,
dd, J=2.1, 11.8 Hz), 4.85-4.95(1H, m), 6.75-6.85 (2H, m), 6.85-7.05
(2H, m), 7.05-7.20 (4H, m)
Example 9
[0143] 2-(4-Methoxybenzyl)phenyl
6-O-ethylsuccinyl-.beta.-D-glucopyranosid- e
[0144] The title compound was prepared in a similar manner to that
described in Example 4 using ethylsuccinyl chloride instead of
hexanoyl chloride.
[0145] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0146] 1.19 (3H, t, J=7.1 Hz), 2.50-2.70 (4H, m), 3.30-3.65 (4H,
m), 3.74 (3H, s), 3.93 (1H, d, J=15.1 Hz), 4.02 (1H, d, J=15.1 Hz),
4.08 (2H, q, J=7.1 Hz), 4.22 (1H, dd, J=6.7, 11.8 Hz), 4.44 (1H,
dd, J=2.1, 11.8 Hz), 4.85-4.95(1H, m), 6.75-7.25 (8H, m)
Example 10
[0147] 2-(4-Methoxybenzyl)phenyl
6-O-isopropyloxycarbonyl-.beta.-D-glucopy- ranoside
[0148] To a solution of isopropanol (0.12 g) in
2,4,6-trimethylpyridine (2 mL) was added triphosgene (0.022 g) at
0.degree. C., and the mixture was stirred for 1 hour. Thereafter,
2-(4-methoxybenzyl)phenyl .beta.-D-glucopyranoside (0.075 g) was
added to the reaction mixture, and the mixture was stirred at room
temperature overnight. To the reaction mixture was added 10%
aqueous citric acid solution, and the mixture was extracted with
ethyl acetate. The organic layer was washed with 10% aqueous citric
acid solution and water, and dried over magnesium sulfate, and the
solvent was removed under reduced pressure. The residue was
purified by preparative thin layer chromatography on silica gel
(eluent: dichloromethane/methanol=10/1) to give
2-(4-methoxybenzyl)-phenyl
6-O-isopropyloxycarbonyl-.beta.-D-glucopyranoside (0.024 g).
[0149] .sup.1H-NMR (CD.sub.3OD) .delta. ppm:
[0150] 1.21 (3H, d, J=6.3 Hz), 1.23 (3H, d, J=6.3 Hz), 3.30-3.65
(4H, m), 3.74 (3H, s), 3.93 (1H, d, J=15.1 Hz), 4.02 (1H, d, J=15.1
Hz), 4.28 (1H, dd, J=6.4, 11.7 Hz), 4.43 (1H, dd, J=2.2, 11.7 Hz),
4.70-4.85 (1H, m), 4.85-4.95(1H, m), 6.75-7.20 (8H, m)
Examples 1-22
[0151] The compounds in the following Table 1 were prepared in a
similar manner to that described in Example 1 or 2 using a compound
obtained in Reference Examples 12-17.
1TABLE 1 7 Example R P 11 Methyl Ethoxycarbonyl 12 Methyl
Methoxycarbonyl 13 Ethyl Ethoxycarbonyl 14 Ethyl Methoxycarbonyl 15
Isobutyl Ethoxycarbonyl 16 Isobutyl Methoxycarbonyl 17 Ethoxy
Ethoxycarbonyl 18 Ethoxy Methoxycarbonyl 19 Isopropyl
Ethoxycarbonyl 20 Isopropyl Methoxycarbonyl 21 Ethylthio
Ethoxycarbonyl 22 Ethylthio Methoxycarbonyl
Test Example 1
[0152] Assay for Inhibitory Effect on Human SGLT2 Activity
[0153] 1) Construction of the Plasmid Vector Expressing Human
SGLT2
[0154] Preparation of the cDNA library for PCR amplification was
performed by reverse transcription of a total RNA deprived from
human kidney (Ori gene) with oligo dT as the primer, using
SUPERSCRIPT Preamplification System (Gibco-BRL: LIFE TECHNOLOGIES).
The DNA fragment coding for human SGLT2 was amplified by the Pfu
DNA Polymerase (Stratagene)-used PCR reaction, in which the human
kidney cDNA library described above was used as the template and
the following oligo nucleotides 0702F and 0712R, presented as
Sequence Numbers 1 and 2 respectively, were used as the primers.
The amplified DNA fragment was ligated into pCR-Blunt (Invitrogen),
a vector for cloning, according to standard method of the kit. The
competent cell, Escherichia coli HB101 (Toyobo), was transformed
according to usual method and then selection of the transformants
was performed on the LB agar medium containing 50 .mu.g/mL of
kanamycin. After the plasmid DNA was extracted and purified from
the one of the transformants, amplifying of the DNA fragment coding
for human SGLT2 was performed by the Pfu DNA Polymerase
(Stratagene)-used PCR reaction, in which the following oligo
nucleotides 0714F and 0715R, presented as Sequence Numbers 3 and 4
respectively, were used as the primers. The amplified DNA fragment
was digested with restriction enzymes, Xho I and Hind III, and then
purified with Wizard Purification System (Promega). This purified
DNA fragment was inserted at the corresponding multi-cloning sites
of pcDNA3.1 (-) Myc/His-B (Invitrogen), a vector for expressing of
fusion protein. The competent cell, Escherichia coli HB101
(Toyobo), was transformed After the gene transfer, the cells were
harvested by centrifugation and resuspended with OPTI-MEM I medium
(1 mL/cuvette). To each well in 96-wells plate, 125 .mu.L of this
cell suspension was added. After overnight culture at 37.degree. C.
under 5% CO.sub.2, 125 .mu.L of DMEM medium which is containing 10%
of fetal bovine serum (Sanko Jyunyaku), 100 units/mL sodium
penicillin G (Gibco-BRL: LIFE TECHNOLOGIES) and 100 .mu.g/mL
streptomycin sulfate (Gibco-BRL: LIFE TECHNOLOGIES) was added to
each well. After a culture until the following day, these cells
were used for the measurement of the inhibitory activity against
the uptake of methyl-.alpha.-D-glucopyranosid- e.
[0155] 3) Measurement of the Inhibitory Activity Against the Uptake
of Methyl-.alpha.-D-glucopyranoside
[0156] After a test compound was dissolved in dimethyl sulfoxide
and diluted with the uptake buffer (a pH 7.4 buffer containing 140
mM sodium chloride, 2 mM potassium chloride, 1 mM calcium chloride,
1 mM magnesium chloride, 5 mM methyl-.alpha.-D-glucopyranoside, 10
mM 2-[4-(2-hydroxyethyl)-1-piperazinyl]ethane sulfonic acid and 5
mM tris (hydroxymethyl) aminomethane), each diluent was used as
test sample for measurement of the inhibitory activity. After
removal of the medium of the COS-7 cells expressing transiently
human SGLT2, to each well 200 .mu.L of the pretreatment buffer (a
pH 7.4 buffer containing 140 mM choline chloride, 2 mM potassium
chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 10 mM
2-[4-(2-hydroxyethyl)-1piperazinyl]-ethane sulfonic acid and 5 mM
tris(hydroxymethyl)aminomethane) according to usual method and then
selection of the transformant was performed on the LB agar medium
containing 100 .mu.g/mL of ampicillin. After the plasmid DNA was
extracted and purified from this transformant, the base sequence of
the DNA fragment inserted at the multi-cloning sites of pcDNA3.1
(-) Myc/His-B was analyzed. This clone had a single base
substitution (ATC which codes for the isoleucine-433 was
substituted by GTC) compared with the human SGLT2 reported by Wells
et al (Am. J. Physiol., Vol. 263, pp. 459-465 (1992)).
Sequentially, a clone in which valine is substituted for the
isoleucine-433 was obtained. This plasmid vector expressing human
SGLT2 in which the peptide presented as Sequence Number 5 is fused
to the carboxyl terminal alanine residue was designated KL29.
2 Sequence Number 1 ATGGAGGAGCACACAGAGGC Sequence Number 2
GGCATAGAAGCCCCAGAGGA Sequence Number 3
AACCTCGAGATGGAGGAGCACACAGAGGC Sequence Number 4
AACAAGCTTGGCATAGAAGCCCCAGAGGA Sequence Number 5
KLGPEQKLISEEDLNSAVDHHHHHH
[0157] 2) Preparation of the Cells Expressing Transiently Human
SGLT2
[0158] KL29, the plasmid coding human SGLT2, was trnasfected into
COS-7 cells (RIKEN CELL BANK RCB0539) by electroporation.
Electroporation was performed with GENE PULSER II (Bio-Rad
Laboratories) under the condition: 0.290 kV, 975 .mu.F,
2.times.10.sup.6 cells of COS-7 cell and 20 .mu.g of KL29 in 500
.mu.L of OPTI-MEM I medium (Gibco-BRL: LIFE TECHNOLOGIES) in the
0.4 cm type cuvette. was added, and the cells were incubated at
37.degree. C. for 10 minutes. After the pretreatment buffer was
removed, 200 .mu.L of the same buffer was added again, and the
cells were incubated at 37.degree. C. for 10 minutes. The buffer
for measurement was prepared by adding of 7 .mu.L of
methyl-.alpha.-D-(U-14C)glucopyranoside (Amersham Pharmacia
Biotech) to 525 .mu.L of the prepared test sample. For the control,
the buffer for measurement without test compound was prepared. For
estimate of the basal uptake in the absence of test compound and
sodium, the buffer for measurement of the basal uptake, which
contains 140 mM choline chloride in place of sodium chloride, was
prepared similarly. After the pretreatment buffer was removed, 75
.mu.L of the buffer for measurement was added to each well, and the
cells were incubated at 37.degree. C. for 2 hours. After the buffer
for measurement was removed, 200 .mu.L of the washing buffer (a pH
7.4 buffer containing 140 mM choline chloride, 2 mM potassium
chloride, 1 mM calcium chloride, 1 mM magnesium chloride, 10 mM
methyl-.alpha.-D-glucopyranoside, 1 mM
2-[4-(2-hydroxyethyl)-1-piperazinyl]ethane sulfonic acid and 5 mM
tris(hydroxymethyl)aminomethane) was added to each well and
immediately removed. After two additional washing, the cells were
solubilized by addition of 75 .mu.L of 0.2 N sodium hydroxide to
each well. After the cell lysates were transferred to the PicoPlate
(Packard) and 150 .mu.L of MicroScint-40 (Packard) was added, the
radioactivity was measured with microplate scintillation counter
TopCount (Packard). The difference in uptake was obtained as 100%
value by subtracting the radioactivity in the basal uptake from
that in control and then the concentrations at which 50% of uptake
was inhibited (IC.sub.50 Value) were calculated from the
concentration-inhibition curve by least square method. The results
are shown in the following Table 2.
3 TABLE 2 Test compound IC.sub.50 value (nM) Reference Example 11
350 Reference Example 12 450 Reference Example 13 140 Reference
Example 14 500 Reference Example 15 330 Reference Example 16 370
Reference Example 17 110
Test Example 2
[0159] Assay for Oral Absorbability
[0160] 1) Preparation of the Samples for Measurement of the Drug
Concentration After Intravenous Injection to the Tail Vein
[0161] As experimental animal, overnight fasted SD rats (CLEA
JAPAN, INC., male, 5 weeks of age, 140-170 g) were used. Sixty mg
of a test compound was suspended or dissolved in 1.8 mL of ethanol
and then dissolved by adding 7.2 mL of polyethylene glycol 400 and
9 mL of saline to prepare a 3.3 mg/mL solution. The body weights of
rats were measured and then the solution of the test compound was
intravenously injected to the tail vein of unanesthetized rats at
the dose of 3 mL/kg (10 mg/kg). The intravenous injection to the
tail was performed with 26 G injection needle and 1 mL syringe. The
sampling times for collection of blood were 2, 5, 10, 20, 30, 60
and 120 minutes after the intravenous injection to the tail vein.
The blood was centrifuged and the plasma was used as the sample for
measurement of the drug concentration in blood.
[0162] 2) Preparation of the Samples for Measurement of the Drug
Concentration After Oral Administration
[0163] As experimental animal, overnight fasted SD rats (CLEA
JAPAN, INC., male, 5 weeks of age, 140-170 g) were used. A test
compound was suspended or dissolved in 0.5% sodium
carboxymethylcellulose solution at the concentration of 1 mg/mL of
active form. After the body weights of rats were measured, the
liquid containing the test compound described above was orally
administered at the dose of 10 mL/kg (10 mg/kg as active form). The
oral administration was performed with gastric tube for rat and 2.5
mL syringe. The sampling times for collection of blood were 15, 30,
60, 120 and 240 minutes after the oral administration. The blood
was centrifuged and the plasma was used as the sample for
measurement of the drug concentration in blood.
[0164] 3) Measurement of Drug Concentration
[0165] To 0.1 mL of the plasma obtained in 1) and 2) described
above, 1 .mu.g of 2-(4-ethoxybenzyl)phenyl .beta.-D-glucopyranoside
described in Reference Example 15 was added as internal standard
and then deproteinization was performed by adding 1 mL of methanol.
After centrifugation, the methanol phase was evaporated to dryness
under a stream of nitrogen. The residue was dissolved in 300 .mu.L
of the mobile phase and a 30 .mu.L aliquot of the solution was
injected into HPLC. The drug concentration in plasma was analysed
by HPLC method under the condition as follows.
[0166] Column : Inertsil ODS-2 (4.6.times.250 mm)
[0167] Mobile Phase: Acetonitrile/10 mM Phosphate buffer (pH
3.0)=25:75(v/v)
[0168] Column Temperature: 50.degree. C.
[0169] Flow Rate: 1.0 mL/minute
[0170] Wavelength for Measurement: UV 232 nm
[0171] After addition of 1 .mu.g of 2-(4-ethoxybenzyl)phenyl
.beta.-D-glucopyranoside described in Reference Example 15 as
internal standard and each concentration (1.0, 0.5, 0.2, 0.1, 0.05
and 0.02 .mu.g) of 2-(4-methoxybenzyl)phenyl
.beta.-D-glucopyranoside described in Reference Example 11 to 0.1
mL of the blank plasma, similar operating described above was
performed and then the standard curve was prepared.
[0172] Each area under the plasma concentration-time curve by
intravenous injection to the tail vein and oral administration of
test compound was estimated with WinNonlin Standard made by
Pharsight Corporation from the plasma concentrations at each time
obtained from HPLC and then the bioavailability (%) was calculated
by the formula as follows. The results are shown in the following
Table 3. 1 Bioavailability ( % ) = Area under the Plasma
Concentration - Time Curve by Oral Administration Area under the
Plasma Concentration - Time Curve by Intravenous Injection to the
Tail Vein .times. 100
4 TABLE 3 Test compound Bioavailability (%) Example 1 46 Example 4
61 Reference Example 11 15
Test Example 3
[0173] Assay for the Facilitatory Effect on Urinary Glucose
Excretion
[0174] As experimental animal, non-fasted SD rats (SLC. Inc., male,
8 weeks of age, 270-320 g) were used. A test compound was suspended
in 0.5% carboxymethyl solution and 0.3, 1 and 3 mg/mL suspension
were prepared. After the body weights of rats were measured, the
test suspension was orally administered at the dose of 10 mL/kg (3,
10 and 30 mg/kg). For the control, just only 0.5% sodium
carboxymethylcellulose solution was orally administered at the dose
of 10 mL/kg. The oral administration was performed with gastric
tube for rat and 2.5 mL syringe. The head count in one group was 5
or 6. Collection of urine was performed in metabolic cage after the
oral administration was finished. The sampling time for collection
of urine was 24 hours after the oral administration. After
collection of urine was finished, the urine volume was recorded and
the urinary glucose concentration was measured. The glucose
concentration was measured with a kit for laboratory test: Glucose
B-Test WAKO (Wako Pure Chemical Industries, Ltd.). The amount of
urinary glucose excretion in 24 hours per 200 g of body weight was
calculated from urine volume, urinary glucose concentration and
body weight. The results are shown in the following Table 4.
5 TABLE 4 Amount of Urinary Glucose Dose Excretion Test compound
(mg/kg) (mg/24 hours .multidot. 200 g body weight) Example 1 3 52
10 239 30 513
Test Example 4
[0175] Acute Toxicity Test
[0176] Four weeks old male ICR mice (CLEA JAPAN, INC. 22-28 g, 5
animals in each group) were fasted for 4 hours, and 60 mg/mL of a
suspension of a test compound in 0.5% carboxymethylcellulose
solution was orally administered at the dose of 10 mL/kg(600
mg/kg). No death was observed until 24 hours after the
administration as shown in the following Table 5.
6 TABLE 5 Test compound Death number Example 1 0/5
[0177] Industrial Applicability
[0178] The glucopyranosyloxybenzylbenzene derivatives represented
by the above general formula (I) of the present invention have an
improved oral absorption and can exert an excellent inhibitory
activity in human SGLT2 by converting into
glucopyranosyloxybenzylbenzene derivatives represented by the above
general formula (II) as active forms thereof in vivo after oral
administration. The present invention can provide agents for the
prevention or treatment of a disease associated with hyperglycemia
such as diabetes, diabetic complications, obesity or the like,
which are also suitable as oral formulations.
Sequence CWU 1
1
5 1 20 DNA Artificial Sequence PCR primer 1 atggaggagc acacagaggc
20 2 20 DNA Artificial Sequence PCR primer 2 ggcatagaag ccccagagga
20 3 29 DNA Artificial Sequence PCR primer 3 aacctcgaga tggaggagca
cacagaggc 29 4 29 DNA Artificial Sequence PCR primer 4 aacaagcttg
gcatagaagc cccagagga 29 5 25 PRT Artificial Sequence carboxy
terminus of fusion protein 5 Lys Leu Gly Pro Glu Gln Lys Leu Ile
Ser Glu Glu Asp Leu Asn Ser 1 5 10 15 Ala Val Asp His His His His
His His 20 25
* * * * *