U.S. patent application number 10/946914 was filed with the patent office on 2005-03-17 for antisense modulation of connective tissue growth factor expression.
This patent application is currently assigned to ISIS PHARMACEUTICALS, INC. Invention is credited to Gaarde, William, Guha, Mausumee, Monia, Brett P., Watt, Andrew T..
Application Number | 20050059629 10/946914 |
Document ID | / |
Family ID | 21719724 |
Filed Date | 2005-03-17 |
United States Patent
Application |
20050059629 |
Kind Code |
A1 |
Gaarde, William ; et
al. |
March 17, 2005 |
Antisense modulation of connective tissue growth factor
expression
Abstract
Antisense compounds, compositions and methods are provided for
modulating the expression of connective tissue growth factor. The
compositions comprise antisense compounds, particularly antisense
oligonucleotides, targeted to nucleic acids encoding connective
tissue growth factor. Methods of using these compounds for
modulation of connective tissue growth factor expression and for
treatment of diseases associated with expression of connective
tissue growth factor are provided.
Inventors: |
Gaarde, William; (Carlsbad,
CA) ; Watt, Andrew T.; (Oceanside, CA) ;
Monia, Brett P.; (Encinitas, CA) ; Guha,
Mausumee; (Trabuco Canyon, CA) |
Correspondence
Address: |
FENWICK & WEST LLP
801 CALIFORNIA STREET
MOUNTAIN VIEW
CA
94014
US
|
Assignee: |
ISIS PHARMACEUTICALS, INC
|
Family ID: |
21719724 |
Appl. No.: |
10/946914 |
Filed: |
September 21, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10946914 |
Sep 21, 2004 |
|
|
|
10006191 |
Dec 10, 2001 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/455 |
Current CPC
Class: |
C12N 2310/315 20130101;
C12N 2310/321 20130101; C12N 15/1136 20130101; C12N 2310/3341
20130101; C12N 2310/341 20130101; C12N 2310/346 20130101; C12N
2310/3525 20130101; C12N 2310/321 20130101; A61K 38/00 20130101;
Y02P 20/582 20151101 |
Class at
Publication: |
514/044 ;
435/455 |
International
Class: |
A61K 048/00; C12N
015/85 |
Claims
What is claimed is:
1. A method of preventing or delaying the onset of diabetic
nephropathy in an animal, said method comprising administering to
said animal an effective amount of a compound 8 to 50 nucleobases
in length targeted to a nucleic acid molecule encoding connective
tissue growth factor, wherein said compound specifically hybridizes
with said nucleic acid molecule encoding connective tissue growth
factor and inhibits the expression of connective tissue growth
factor.
2. The method of claim 1, wherein said nucleic acid molecule
encodes human connective tissue growth factor and has a nucleotide
sequence comprising SEQ ID NO: 3, 17, 18 or 19:
3. The method of claim 1, wherein said nucleic acid molecule
encodes mouse connective growth factor and has a nucleotide
sequence comprising SEQ ID NO: 10 or 98.
4. The method according to claim 1, wherein said compound is an
antisense oligonucleotide.
5. The method according to claim 4, wherein said antisense
oligonucleotide has a sequence comprising SEQ ID NO: 24, 25, 27,
28, 33, 34, 35, 36, 38, 39, 41, 45, 46, 47, 48, 50, 52, 58, 62, 63,
64, 68, 70, 72, 73, 81, 86, 88, 90, 91, 92, 95, 97, 30, 31, 32, 37,
40, 42, 103, 104, 106, 108, 110, 111, 116, 117, 120, 122, 124, 126,
127, 128, 130, 134, 135, 136, 138, 139, 140, 141, 142, 143, 144,
145, 146, 147, 151 or 153.
6. The method according to claim 4, wherein said antisense
oligonucleotide is a sequence of up to 30 nucleobases in length
comprising at least an 8 nucleobase portion of SEQ ID NO: 24, 25,
27, 28, 33, 34, 35, 36, 38, 39, 41, 45, 46, 47, 48, 50, 52, 58, 62,
63, 64, 68, 70, 72, 73, 81, 86, 88, 90, 91, 92, 95, 97, 30, 31, 32,
37, 40, 42, 103, 104, 106, 108, 110, 111, 116, 117, 120, 122, 124,
126, 127, 128, 130, 134, 135, 136, 138, 139, 140, 141, 142, 143,
144, 145, 146, 147, 151 or 153.
7. The method according to claim 4, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 48.
8. The method according to claim 4, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 45.
9. The method according to claim 4, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 28.
10. The method according to claim 4, wherein the antisense
oligonucleotide comprises at least one modified internucleoside
linkage.
11. The method according to claim 10, wherein the modified
internucleoside linkage is a phosphorothioate linkage.
12. The method according to claim 4, wherein the antisense
oligonucleotide comprises at least one modified sugar moiety.
13. The method according to claim 12, wherein the modified sugar
moiety is a 2'-O-methoxyethyl sugar moiety.
14. The method according to claim 4, wherein the antisense
oligonucleotide comprises at least one modified nucleobase.
15. The method according to claim 14, wherein the modified
nucleobase is a 5-methylcytosine.
16. The method according to claim 4, wherein the antisense
oligonucleotide is a chimeric oligonucleotide.
17. The method according to claim 1, wherein said compound is
administered as a composition comprising said compound and a
pharmaceutically acceptable carrier or diluent.
18. The method according to claim 17, wherein said composition
further comprises a colloidal dispersion system.
19. The method according to claim 1, wherein the animal is a
diabetic animal.
20. The method according to claim 19, wherein the diabetic animal
has type 1 diabetes.
21. The method according to claim 19, wherein the diabetic animal
has type 2 diabetes.
22. The method according to claim 1, wherein the animal is a human
or a rodent.
23. A method of treating or delaying the onset of type 1 or type 2
diabetes in an animal, said method comprising administering to said
animal an effective amount of a compound 8 to 50 nucleobases in
length targeted to a nucleic acid molecule encoding connective
tissue growth factor, wherein said compound specifically hybridizes
with said nucleic acid molecule encoding connective tissue growth
factor and inhibits the expression of connective tissue growth
factor.
24. The method according to claim 23, wherein said compound is an
antisense oligonucleotide.
25. The method according to claim 24, wherein said antisense
oligonucleotide has a sequence comprising SEQ ID NO: 24, 25, 27,
28, 33, 34, 35, 36, 38, 39, 41, 45, 46, 47, 48, 50, 52, 58, 62, 63,
64, 68, 70, 72, 73, 81, 86, 88, 90, 91, 92, 95, 97, 30, 31, 32, 37,
40, 42, 103, 104, 106, 108, 110, 111, 116, 117, 120, 122, 124, 126,
127, 128, 130, 134, 135, 136, 138, 139, 140, 141, 142, 143, 144,
145, 146, 147, 151 or 153.
26. The method according to claim 24, wherein said antisense
oligonucleotide is a sequence of up to 30 nucleobases in length
comprising at least an 8 nucleobase portion of SEQ ID NO: 24, 25,
27, 28, 33, 34, 35, 36, 38, 39, 41, 45, 46, 47, 48, 50, 52, 58, 62,
63, 64, 68, 70, 72, 73, 81, 86, 88, 90, 91, 92, 95, 97, 30, 31, 32,
37, 40, 42, 103, 104, 106, 108, 110, 111, 116, 117, 120, 122, 124,
126, 127, 128, 130, 134, 135, 136, 138, 139, 140, 141, 142, 143,
144, 145, 146, 147, 151 or 153.
27. The method according to claim 24, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 48.
28. The method according to claim 24, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 45.
29. The method according to claim 24, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 28.
30. The method according to claim 24, wherein the antisense
oligonucleotide comprises at least one modified internucleoside
linkage.
31. The method according to claim 30, wherein the modified
internucleoside linkage is a phosphorothioate linkage.
32. The method according to claim 24, wherein the antisense
oligonucleotide comprises at least one modified sugar moiety.
33. The method according to claim 32, wherein the modified sugar
moiety is a 2'-O-methoxyethyl sugar moiety.
34. The method according to claim 24, wherein the antisense
oligonucleotide comprises at least one modified nucleobase.
35. The method according to claim 34, wherein the modified
nucleobase is a 5-methylcytosine.
36. The method according to claim 24, wherein the antisense
oligonucleotide is a chimeric oligonucleotide.
37. The method according to claim 23, wherein said compound is
administered as a composition comprising said compound and a
pharmaceutically acceptable carrier or diluent.
38. The method according to claim 37, wherein said composition
further comprises a colloidal dispersion system.
39. The method according to claim 23, wherein the animal is a human
or a rodent.
40. A method of inhibiting the expression of connective tissue
growth factor in cells or tissues comprising contacting said cells
or tissues with a compound 8 to 50 nucleobases in length targeted
to a nucleic acid molecule encoding connective tissue growth
factor, wherein said compound specifically hybridizes with said
nucleic acid molecule encoding connective tissue growth factor and
inhibits the expression of connective tissue growth factor.
41. A method of treating an animal having a disease or condition
associated with connective tissue growth factor comprising
administering to said animal a therapeutically or prophylactically
effective amount of a compound 8 to 50 nucleobases in length
targeted to a nucleic acid molecule encoding connective tissue
growth factor, wherein said compound specifically hybridizes with
said nucleic acid molecule encoding connective tissue growth factor
and inhibits the expression of connective tissue growth factor.
42. The method of claim 41, wherein the disease or condition is a
hyperproliferative disorder.
43. The method of claim 42, wherein the hyperproliferative disorder
is cancer.
44. The method of claim 43, wherein the cancer is selected from the
group consisting of breast, prostate and renal cancer.
45. The method of claim 41 wherein the disease or condition is
selected from the group consisting of pulmonary fibrosis, renal
fibrosis, scleroderma, and atherosclerosis.
46. A method of inhibiting or preventing an increase in proteinuria
or albuminuria or both in a diabetic animal, said method comprising
administering to said diabetic animal an effective amount of a
compound 8 to 50 nucleobases in length targeted to a nucleic acid
molecule encoding connective tissue growth factor, wherein said
compound specifically hybridizes with said nucleic acid molecule
encoding connective tissue growth factor and inhibits the
expression of connective tissue growth factor.
47. The method according to claim 46, wherein said compound is an
antisense oligonucleotide.
48. The method according to claim 47, wherein said antisense
oligonucleotide has a sequence comprising SEQ ID NO: 24, 25, 27,
28, 33, 34, 35, 36, 38, 39, 41, 45, 46, 47, 48, 50, 52, 58, 62, 63,
64, 68, 70, 72, 73, 81, 86, 88, 90, 91, 92, 95, 97, 30, 31, 32, 37,
40, 42, 103, 104, 106, 108, 110, 111, 116, 117, 120, 122, 124, 126,
127, 128, 130, 134, 135, 136, 138, 139, 140, 141, 142, 143, 144,
145, 146, 147, 151 or 153.
49. The method according to claim 47, wherein said antisense
oligonucleotide is a sequence of up to 30 nucleobases in length
comprising at least an 8 nucleobase portion of SEQ ID NO: 24, 25,
27, 28, 33, 34, 35, 36, 38, 39, 41, 45, 46, 47, 48, 50, 52, 58, 62,
63, 64, 68, 70, 72, 73, 81, 86, 88, 90, 91, 92, 95, 97, 30, 31, 32,
37, 40, 42, 103, 104, 106, 108, 110, 111, 116, 117, 120, 122, 124,
126, 127, 128, 130, 134, 135, 136, 138, 139, 140, 141, 142, 143,
144, 145, 146, 147, 151 or 153.
50. The method according to claim 47, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 48.
51. The method according to claim 47, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 45.
52. The method according to claim 47, wherein said antisense
oligonucleotide has a sequence consisting of SEQ ID NO: 28.
53. The method according to claim 47, wherein the antisense
oligonucleotide comprises at least one modified internucleoside
linkage.
54. The method according to claim 53, wherein the modified
internucleoside linkage is a phosphorothioate linkage.
55. The method according to claim 47, wherein the antisense
oligonucleotide comprises at least one modified sugar moiety.
56. The method according to claim 55, wherein the modified sugar
moiety is a 2'-O-methoxyethyl sugar moiety.
57. The method according to claim 47, wherein the antisense
oligonucleotide comprises at least one modified nucleobase.
58. The method according to claim 57, wherein the modified
nucleobase is a 5-methylcytosine.
59. The method according to claim 47, wherein the antisense
oligonucleotide is a chimeric oligonucleotide.
60. The method according to claim 46, wherein said compound is
administered as a composition comprising said compound and a
pharmaceutically acceptable carrier or diluent.
61. The method according to claim 60, wherein said composition
further comprises a colloidal dispersion system.
62. The method according to claim 46, wherein the diabetic animal
has type 1 diabetes.
63. The method according to claim 46, wherein the diabetic animal
has type 2 diabetes.
64. The method according to claim 46, wherein the diabetic animal
is a human or a rodent.
65. The method according to claim 4, wherein said antisense
oligonucleotide comprises a first region consisting of at least 5
contiguous 2'-deoxy nucleosides flanked by second and third
regions, each of said second and third regions independently
consisting of at least one 2'-O-methoxyethyl nucleoside, and
wherein the internucleoside linkages of the first region are
phosphorothioate linkages and the internucleoside linkages of the
second and third regions are phosphodiester linkages.
66. The method according to claim 24, wherein said antisense
oligonucleotide comprises a first region consisting of at least 5
contiguous 2'-deoxy nucleosides flanked by second and third
regions, each of said second and third regions independently
consisting of at least one 2'-O-methoxyethyl nucleoside, and
wherein the internucleoside linkages of the first region are
phosphorothioate linkages and the internucleoside linkages of the
second and third regions are phosphodiester linkages.
67. The method according to claim 40, wherein said compound is an
antisense oligonucleotide, said antisense oligonucleotide
comprising a first region consisting of at least 5 contiguous
2'-deoxy nucleosides flanked by second and third regions, each of
said second and third regions independently consisting of at least
one 2'-O-methoxyethyl nucleoside, and wherein the internucleoside
linkages of the first region are phosphorothioate linkages and the
internucleoside linkages of the second and third regions are
phosphodiester linkages.
68. The method according to claim 41, wherein said compound is an
antisense oligonucleotide, said antisense oligonucleotide
comprising a first region consisting of at least 5 contiguous
2'-deoxy nucleosides flanked by second and third regions, each of
said second and third regions independently consisting of at least
one 2'-O-methoxyethyl nucleoside, and wherein the internucleoside
linkages of the first region are phosphorothioate linkages and the
internucleoside linkages of the second and third regions are
phosphodiester linkages.
69. The method according to claim 47, wherein said antisense
oligonucleotide comprises a first region consisting of at least 5
contiguous 2'-deoxy nucleosides flanked by second and third
regions, each of said second and third regions independently
consisting of at least one 2'-O-methoxyethyl nucleoside, and
wherein the internucleoside linkages of the first region are
phosphorothioate linkages and the internucleoside linkages of the
second and third regions are phosphodiester linkages.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 10/006,191, filed Dec. 10, 2001, which is
hereby incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention provides compositions and methods for
modulating the expression of connective tissue growth factor. In
particular, this invention relates to compounds, particularly
oligonucleotides, specifically hybridizable with nucleic acids
encoding connective tissue growth factor. Such compounds have been
shown to modulate the expression of connective tissue growth factor
in cells and in vivo.
BACKGROUND OF THE INVENTION
[0003] In the course of studies of platelet-derived growth factor
(PDGF) isoforms, a novel, cysteine-rich mitogenic peptide secreted
by human vascular endothelial cells and related to
the-v-src-induced immediate early gene product CEF-10 was
identified. An anti-PDGF antibody was used to screen a human
umbilical vein endothelial cell (HUVEC) expression library, and the
gene encoding this novel mitogen was named connective tissue growth
factor (CTGF). The connective tissue growth factor protein was
shown to stimulate DNA synthesis and promote chemotaxis of
fibroblasts (Bradham et al., J. Cell Biol., 1991, 114,
1285-1294).
[0004] Connective tissue growth factor (CTGF; also known as
ctgrofact, fibroblast inducible secreted protein, fisp-12, NOV2,
insulin-like growth factor-binding protein-related protein 2,
IGFBP-rP2, IGFBP-8, HBGF-0.8, Hcs24, and ecogenin) is a member of
the CCN (CTGF/CYR61/NOV) family of modular proteins, named for the
first family members identified, connective tissue growth factor,
cysteine-rich (CYR61), and nephroblastoma overexpressed (NOV), but
the family also includes the proteins ELM-1 (expressed in
low-metastatic cells), WISP-3 (Wnt-1-induced secreted protein), and
COP-1 (WISP-2). CCN proteins have been found to be secreted,
extracellular matrix-associated proteins that regulate cellular
processes such as adhesion, migration, mitogenesis,
differentiation, survival, angiogenesis, atherosclerosis,
chondrogenesis, wound healing, tumorigenesis, and vascular and
fibrotic diseases like scleroderma (Lau and Lam, Exp. Cell Res.,
1999, 248, 44-57).
[0005] In most cases, a single 2.4-kilobase connective tissue
growth factor transcript has been reported in expression studies,
although 3.5- and 7-kilobase transcripts have been reported in
glioblastoma cells. Connective tissue growth factor is expressed in
fibroblasts during normal differentiation processes that involve
extracellular matrix (ECM) production and remodeling, such as
embryogenesis and uterine decidualization following implantation.
Connective tissue growth factor is also frequently overexpressed in
fibrotic skin disorders such as systemic sclerosis, localized skin
sclerosis, keloids, scar tissue, eosinophilic fasciitis, nodular
fasciitis, and Dupuytren's contracture. Connective tissue growth
factor mRNA or protein levels are elevated in fibrotic lesions of
major organs and tissues including the liver, kidney, lung,
cardiovascular system, pancreas, bowel, eye, and gingiva. In
mammary, pancreatic and fibrohistiocytic tumors characterized by
significant connective tissue involvement, connective tissue growth
factor is overexpressed in the stromal compartment. In many cases,
connective tissue growth factor expression is linked spatially and
temporally to the profibrogenic cytokine transforming growth
factor-beta (TGF-.beta.) (Moussad and Brigstock, Mol. Genet.
Metab., 2000, 71, 276-292).
[0006] Connective tissue growth factor has been mapped to human
chromosomal region 6q23.1, proximal to the c-myb gene, and
chromosomal abnormalities involving this region have been
associated with human tumors, such as Wilms' tumor (Martinerie et
al., Oncogene, 1992, 7, 2529-2534).
[0007] Tumors with significant fibrotic and vascular components
exhibit increased connective tissue growth factor expression, and
connective tissue growth factor may be involved in the pathogenesis
of pediatric myofibroblastic tumors. Of 12 pediatric tumors
examined, all showed moderate to intense connective tissue growth
factor expression in tumor cells and/or endothelial cells of the
associated vasculature (Kasaragod et al., Pediatr. Dev. Pathol.,
2001, 4, 37-45).
[0008] Connective tissue growth factor mRNA is also specifically
upregulated in malignant human leukemic lymphoblasts from children
with acute lymphoblastic leukemia (ALL) (Vorwerk et al., Br. J.
Cancer, 2000, 83, 756-760), and both mRNA and protein levels are
upregulated by TGF-beta in Hs578T human breast cancer cells in a
dose-dependent manner, indicating that connective tissue growth
factor is an important neuroendocrine factor and a critical
downstream effector of TGF-beta (Yang et al., J. Clin. Endocrinol.
Metab., 1998, 83, 2593-2596).
[0009] Based on a region of amino acid homology to insulin-like
growth factor (IGF) binding proteins (IGFBPs), connective tissue
growth factor was hypothesized to regulate cell growth through IGF.
Recombinant human connective tissue growth factor was expressed in
a baculoviral system and demonstrated to bind to IGF in vitro with
low affinity, and thus, connective tissue growth factor was
identified as a member of the IGFBP superfamily, and was given the
name IGFBP-8 (Kim et al., Proc. Natl. Acad. Sci. U.S.A., 1997, 94,
12981-12986).
[0010] The role of connective tissue growth factor has been
investigated in a transgenic mouse. Transgenic mice overproducing
the connective tissue growth factor protein under control of the
collagen promoter could develop and their embryonic and neonatal
growth were normal, but they displayed dwarfism within a few months
of birth, bone density was decreased compared with normal mice,
male testes were much smaller than normal and fertility was
affected. These results indicate that the effects of overexpression
of connective tissue growth factor affects endochondral
ossification, and may also regulate embryonic development of the
testes (Nakanishi et al., Biochem. Biophys. Res. Commun., 2001,
281, 678-681).
[0011] In cultured 22-day fetal rat calvarial osteoblasts, cortisol
stimulates transcription of connective tissue growth factor in a
time- and dose-dependent manner, and cyclohexamide did not preclude
this effect, indicating that this upregulation was not protein
synthesis dependent. Glucocorticoids have complex effects on bone,
some due to direct regulation of specific genes expressed by
osteoblasts, and some indirect, mediated by locally produced growth
factors or their binding proteins. IGFs have important stimulatory
effects on bone formation, but glucocorticoids inhibit expression
of IGFs. Because connective tissue growth factor binds to IGF, its
increased expression could modulate the effect of cortisol on bone
(Pereira et al., Am. J. Physiol. Endocrinol. Metab., 2000, 279,
E570-576).
[0012] Connective tissue growth factor may be regulated not only at
the level of transcription, but also by proteolytic degradation,
but this varies with cell type. In large vessel bovine endothelial
cells, cyclic AMP (cAMP) was found to increase expression of intact
connective tissue growth factor protein by inhibiting degradation,
whereas TGF-beta stimulated neither mRNA nor protein levels. In
microvessel cells, TGF-beta stimulates an increase in connective
tissue growth factor mRNA and both TGF-beta and cAMP stimulated
proteolytic degradation, and these differences may have an effect
on angiogenesis and wound healing (Boes et al., Endocrinology,
1999, 140, 1575-1580).
[0013] Purified murine connective tissue growth factor promotes the
adhesion of primary human dermal microvascular endothelial cells
(HMVECs) and of platelets through integrin receptors
.alpha..sub.v.beta..sub.3 and .alpha..sub.IIb.beta..sub.3,
respectively, suggesting its involvement in cell adhesion
signaling, hemostasis and thrombosis (Babic et al., Mol. Cell
Biol., 1999, 19, 2958-2966; Jedsadayanmata et al., J. Biol. Chem.,
1999, 274, 24321-24327). Connective tissue growth factor also
stimulates migration of HMVECs in culture through an integrin
receptor .alpha..sub.v.beta..sub.3-dependent mechanism.
Furthermore, connective tissue growth factor can promote survival
of HMVECs plated onto laminin but deprived of growth factors, a
condition that otherwise induces apoptosis. In vivo, connective
tissue growth factor induces neovascularization in rat corneal
micropocket implants. Thus, connective tissue growth factor is an
angiogenic inducer, and may play a role in adhesion, migration, and
survival of endothelial cells during blood vessel growth, perhaps
by delivering an antiapoptotic signal via its interaction with
integrin .alpha..sub.v.beta..sub.3 (Babic et al., Mol. Cell Biol.,
1999, 19, 2958-2966).
[0014] In contrast, connective tissue growth factor may negatively
regulate growth of human prostate cells. Connective tissue growth
factor expression is upregulated during senescence of normal human
prostate epithelial cells (HPECs), and connective tissue growth
factor is responsive to growth regulators such as all-trans
retinoic acid (atRA), supporting a growth-regulatory role of
connective tissue growth factor in prostatic epithelium
(Lopez-Bermejo et al., Endocrinology, 2000, 141, 4072-4080).
[0015] Expansion of ECM with fibrosis occurs in many tissues as
part of the end-organ complications of diabetes (i.e. diabetic
nephropathy), and advanced glycosylation end products (AGE) are
implicated as one causitive factor in diabetic tissue fibrosis. In
addition to being a potent inducer of ECM synthesis and
angiogenesis, connective tissue growth factor is increased in
tissues from rodent models of diabetes. AGE treatment of primary
cultures of CRL-2097 and CRL-1474 nonfetal human dermal fibroblasts
resulted in an increase in steady state levels of connective tissue
growth factor mRNA as well as protein levels in conditioned medium
and cell-associated connective tissue growth factor, while other
IGFBP-related proteins were not upregulated by AGE. Thus, AGE
upregulates the profibrotic and proangiogenic protein connective
tissue growth factor, which may play a role in diabetic
complications (Twigg et al., Endocrinology, 2001, 142,
1760-1769).
[0016] Diabetic nephropathy is a syndrome occurring in people with
diabetes mellitus and characterized by albuminuria, hypertension,
and progressive renal insufficiency. Diabetic nephropathy is a
common complication in patients with either type 1 or type 2
diabetes mellitus and is recognized to cause severe morbidity and
mortality. Structural hallmarks of advanced diabetic nephropathy
are glomerulosclerosis and tubulointerstitial fibrosis leading to
kidney failure. Current therapies include ACE inhibitors and
angiotensin II receptor blockers, both of which are not justified
for blanket use among all newly diagnosed patients since only
30-40% will develop progressive renal disease and the long term
side effects of these drugs are unknown.
[0017] In addition to the need for safe and effective treatments
for diabetes is a need for a reliable method to accurately predict,
at early stages of disease, which diabetic patients will develop
nephropathy and progress to kidney failure. Persistent
microalbuminuria is regarded as a predictor of established vascular
damage and an indicator of incipient nephropathy. Studies of renal
biopsies from patients with type 1 diabetic nephropathy demonstrate
an increase in expression of CTGF in renal tissue exhibiting
microalbuminuria and nephropathy, relative to normal control
tissues (Adler et al., Kidney Int., 2001, 60, 2330-2336),
suggesting CTGF is not only a mediator of diabetic nephropathy, but
could be used as a marker for the development of disease (Riser et
al., Kidney Int., 2003, 64, 451-458).
[0018] In a murine lung fibrosis model, an increase in connective
tissue growth factor mRNA expression is also induced by bleomycin,
a known lung fibrogenic agent (Lasky et al., Am. J. Physiol., 1998,
275, L365-371), as well as in bronchoalveolar lavage cells from
patients with idiopathic pulmonary fibrosis and pulmonary
sarcoidosis, in comparison to healthy nonsmoking control subjects,
indicating that connective tissue growth factor is involved in the
fibroproliferative response to injury (Allen et al., Am. J. Respir.
Cell Mol. Biol., 1999, 21, 693-700). Similarly, in an experimental
model of proliferative glomerulonephritis, connective tissue growth
factor mRNA expression was strongly increased in extracapillary and
mesangial proliferative lesions and in areas of periglomerular
fibrosis. The early glomerular connective tissue growth factor
overexpression coincided with a striking upregulation of TGF-.beta.
proteins, and the kinetics of connective tissue growth factor
expression strongly suggest a role in glomerular repair, possibly
downstream of TGF-beta in this model of transient renal injury (Ito
et al., J. Am. Soc. Nephrol., 2001, 12, 472-484).
[0019] Disclosed and claimed in U.S. Pat. No. 5,876,730 is a
substantially pure or isolated polypeptide characterized as having
an amino acid sequence corresponding to the carboxy terminal amino
acids of a connective tissue growth factor (CTGF) protein, wherein
the polypeptide has an amino acid sequence beginning at amino acid
residue 247 or 248 from the N-terminus of connective tissue growth
factor, an isolated polynucleotide sequence encoding the connective
tissue growth factor polypeptide, a recombinant expression vector
which contains said polynucleotide, a host cell containing said
expression vector, and a pharmaceutical composition comprising a
therapeutically effective amount of connective tissue growth factor
polypeptide in a pharmaceutically acceptable carrier. Antisense
oligonucleotides are generally disclosed (Brigstock and Harding,
1999).
[0020] Disclosed and claimed in U.S. Pat. Nos. 5,783,187;
5,585,270; 6,232,064; 6,150,101; 6,069,006 and PCT Publication WO
00/35936 are an isolated polynucleotide encoding the connective
tissue growth factor polypeptide, expression vectors, host cells
stably transformed or transfected with said vectors; an isolated
polynucleotide comprising 5' untranslated regulatory nucleotide
sequences isolated from upstream of connective tissue growth
factor, wherein said untranslated regulatory nucleotide sequences
comprises a transcriptional and translational initiation region and
wherein said sequence is a TGF-beta responsive element; an isolated
nucleic acid construct comprising a non-coding regulatory sequence
isolated upstream from a connective tissue growth factor (CTGF)
gene, wherein said non-coding regulatory sequence is operably
associated with a nucleic acid sequence which expresses a protein
of interest or antisense RNA, wherein said nucleic acid sequence is
heterologous to said non-coding sequence; and a fragment of
connective tissue growth factor (CTGF) polypeptide having the
ability to induce ECM synthesis, collagen synthesis and/or
myofibroblast differentiation, comprising an amino acid sequence
encoded by at least exon 2 or exon 3 of said polypeptide. Further
claimed is a method for identifying a composition which affects
TGF-beta-induced connective tissue growth factor expression, and a
method of diagnosing a pathological state in a subject suspected of
having a pathology selected from the group consisting of fibrotic
disease and atherosclerosis, the method comprising obtaining a
sample suspected of containing connective tissue growth factor,
whereby detecting a difference in the level of connective tissue
growth factor in the sample from the subject as compared to the
level of connective tissue growth factor in the normal standard
sample is diagnostic of a pathology characterized by a cell
proliferative disorder associated with connective tissue growth
factor in the subject. Further claimed is a method for ameliorating
a cell proliferative disorder associated with connective tissue
growth factor, comprising administering to a subject having said
disorder, at the site of the disorder, a composition comprising a
therapeutically effective amount of an antibody or fragment thereof
that binds to connective tissue growth factor, wherein said
antibody or fragment thereof does not bind to PDGF. Antisense
oligonucleotides are generally disclosed (Grotendorst, 2000;
Grotendorst and Bradham, 2001; Grotendorst and Bradham, 2000;
Grotendorst and Bradham, 1996; Grotendorst and Bradham, 1998;
Grotendorst and Bradham, 2000).
[0021] Disclosed and claimed in PCT Publication WO 99/66959 is a
device for promoting neuronal regeneration, comprising a gene
activated matrix comprising a biocompatible matrix and at least one
neuronal therapeutic encoding agent having an operably linked
promoter device, wherein the neuronal therapeutic encoding agent
encodes an inhibitor of neuronal cell growth, and wherein the
inhibitor of neuronal cell growth is selected from the group
consisting of NFB42, TGF-beta, connective tissue growth factor
(CTGF), and macrophage migration inhibitory factor (MIF), and
wherein the neuronal therapeutic encoding agent is selected from
the group consisting of a nucleic acid molecule, a vector, an
antisense nucleic acid molecule and a ribozyme (Baird et al.,
1999).
[0022] Disclosed and claimed in PCT Publication WO 00/27868 is a
substantially pure connective tissue growth factor polypeptide or
functional fragments thereof, an isolated polynucleotide sequence
encoding said polypeptide, said polynucleotide sequence wherein T
can also be U, a nucleic acid sequence complementary to said
polynucleotide sequence, and fragments of said sequences that are
at least 15 bases in length and that will hybridize to DNA which
encodes the amino acid sequence of the connective tissue growth
factor protein under moderate to highly stringent conditions.
Further claimed is an expression vector including said
polynucleotide, a host cell stably transformed with said vector, an
antibody that binds to said polypeptide, and a method for producing
said polypeptide. Further claimed is a method for inhibiting the
expression of connective tissue growth factor in a cell comprising
contacting the cell with a polynucleotide which binds to a target
nucleic acid in the cell, wherein the polynucleotide inhibits the
expression of connective tissue growth factor in the cell, wherein
the polynucleotide is an antisense polynucleotide, as well as a kit
for the detection of connective tissue growth factor expression
comprising a carrier means being compartmentalized to receive one
or more containers, comprising at least one container containing at
least one antisense oligonucleotide that binds to connective tissue
growth factor (Schmidt et al., 2000).
[0023] Disclosed and claimed in PCT Publication WO 00/13706 is a
method for treating or preventing fibrosis, the method comprising
administering to a subject in need an effective amount of an agent
that modulates, regulates or inhibits the expression or activity of
connective tissue growth factor or fragments thereof, and wherein
the agent is an antibody, an antisense oligonucleotide, or a small
molecule. The method is directed to treating kidney fibrosis and
associated renal disorders, in particular, complications associated
with diabetes and hypertension (Riser and Denichili, 2000).
[0024] Disclosed and claimed in PCT Publication WO 01/29217 is an
isolated nucleic acid molecule comprising a nucleic acid sequence
encoding a polypeptide comprising an amino acid sequence selected
from a group comprising NOV1, NOV2 (connective tissue growth
factor), and NOV3, a mature form or variant of an amino acid
sequence selected from said group, as well as a nucleic acid
molecule comprising a nucleic acid sequence encoding a polypeptide
comprising an amino acid sequence selected from said group as well
as mature and variant forms or fragments of said polypeptides, and
the complement of said nucleic acid molecule. Antisense
oligonucleotides are generally disclosed (Prayaga et al.,
2001).
[0025] There are currently no known therapeutic agents that
effectively inhibit the synthesis of connective tissue growth
factor and to date, but investigative strategies aimed at
modulating connective tissue growth factor function have involved
the use of sodium butyrate (NaB), function blocking antibodies and
antisense oligonucleotides.
[0026] NaB is a dietary micronutrient. Dietary factors are believed
to play an important role in both the development and prevention of
human cancers, including breast carcinoma. NaB is a major end
product of digestion of dietary starch and fiber, and is a potent
growth inhibitor that initiates cell differentiation of many cell
types in vitro. NaB exerts its biological effects, in part, as a
histone deacetylase inhibitor in mammary epithelial cells, induces
apoptotic cell death in Hs578T estrogen-non-responsive human breast
cancer cells, and can activate different genes involved in cell
cycle arrest depending on cell type. NaB specifically upregulates
the expression of connective tissue growth factor in a
dose-dependent manner, stimulating an increase in both mRNA and
protein levels in both cancerous and non-cancerous mammary cells
(Tsubaki et al., J. Endocrinol., 2001, 169, 97-110).
[0027] TGF-beta has the unique ability to stimulate growth of
normal fibroblasts in soft agar, a property of transformed cells.
Connective tissue growth factor cannot induce this
anchorage-independent growth normal rat kidney (NRK) fibroblasts,
but connective tissue growth factor synthesis and action are
essential for TGF-.beta.-induced anchorage-independence. Antibodies
to connective tissue growth factor specifically blocked
TGF-beta-induced anchorage-independent growth, and NRK fibroblasts
transformed with a construct expressing the connective tissue
growth factor gene in the antisense orientation were not responsive
to TGF-beta in the anchorage-independent growth assay (Kothapalli
et al., Cell Growth. Differ., 1997, 8, 61-68). These CTGF-antisense
expressing NRK cells were also used to show that
TGF-beta-stimulated collagen synthesis is mediated by connective
tissue growth factor, indicating that connective tissue growth
factor may be a useful target for antifibrotic therapies (Duncan et
al., Faseb J., 1999, 13, 1774-1786).
[0028] The 3'-untranslated region (UTR) of the human connective
tissue growth factor cDNA bears several consensus sequences for
regulatory elements. When the 3'-UTR was fused downstream of a
reporter gene, it was found to act as a strong cis-acting
repressive element, and the antisense 3'-UTR had a similar, but
stronger effect. (Kubota et al., FEBS Lett., 1999, 450, 84-88).
Comparison of the human and mouse connective tissue growth factor
3'-UTRs revealed a conserved small segment of 91 bases. This region
was amplified by RT-PCR from NIH3T3 mouse fibroblasts and used to
make a chimeric fusion construct for analysis of its repressive
effects. The mouse connective tissue growth factor 3'-UTR in either
the sense or the antisense orientation had a strong repressive
effect on transcription of the reporter gene, indicating an
orientation independence of this regulatory element (Kondo et al.,
Biochem. Biophys. Res. Commun., 2000, 278, 119-124).
[0029] A phosphorothioate antisense oligonucleotide, 16 nucleotides
in length and targeted to the translation initiation start site,
was used to inhibit expression of connective tissue growth factor
and suppress proliferation and migration of bovine aorta vascular
endothelial cells in culture (Shimo et al., J. Biochem. (Tokyo),
1998, 124, 130-140). This antisense oligonucleotide was also used
to show that connective tissue growth factor induces apoptosis in
MCF-7 human breast cancer cells and that TGF-beta-induced apoptosis
is mediated, in part, by connective tissue growth factor (Hishikawa
et al., J. Biol. Chem., 1999, 274, 37461-37466). The same antisense
oligonucleotide was also found to inhibit the TGF-beta-mediated
activation of caspase 3 and thus to inhibit induction of
TGF-beta-mediated apoptosis in human aortic smooth muscle cells
(HASC) (Hishikawa et al., Eur. J. Pharmacol., 1999, 385, 287-290).
This antisense oligonucleotide was also used to block connective
tissue growth factor expression and demonstrate that high blood
pressure upregulates expression of connective tissue growth factor
in mesangial cells, which in turn enhances ECM protein production
and induces apoptosis, contributing to the remodeling of mesangium
and ultimately glomerulosclerosis (Hishikawa et al., J. Biol.
Chem., 2001, 276, 16797-16803).
[0030] Consequently, there remains a long felt need for additional
agents capable of effectively inhibiting connective tissue growth
factor function.
[0031] Antisense technology is emerging as an effective means for
reducing the expression of specific gene products and may therefore
prove to be uniquely useful in a number of therapeutic, diagnostic,
and research applications for the modulation of connective tissue
growth factor expression.
[0032] The present invention provides compositions and methods for
modulating connective tissue growth factor expression in cells and
in vivo.
SUMMARY OF THE INVENTION
[0033] The present invention is directed to compounds, particularly
antisense oligonucleotides, which are targeted to a nucleic acid
encoding connective tissue growth factor, and which modulate the
expression of connective tissue growth factor. Pharmaceutical and
other compositions comprising the compounds of the invention are
also provided. Further provided are methods of modulating the
expression of connective tissue growth factor in cells or tissues,
comprising contacting said cells or tissues with one or more of the
antisense compounds or compositions of the invention. Further
provided are methods of treating an animal, particularly a human,
suspected of having or being prone to a disease or condition
associated with expression of connective tissue growth factor by
administering a therapeutically or prophylactically effective
amount of one or more of the antisense compounds or compositions of
the invention. Also provided are methods of preventing or delaying
the onset of diabetic nephropathy in animals, comprising
administering an effective amount of one or more of the compounds
or compositions of the invention. Methods of treating or delaying
the onset of type 1 or type 2 diabetes in animals, comprising
administering an effective amount of one or more of the compounds
or compositions of the invention, are provided. Further provided
are methods of inhibiting or preventing albuminuria and/or
proteinuria in a diabetic animal by administering one or more
compounds or compositions of the invention. Compounds and
compositions comprising antisense oligonucleotides with a first
region consisting of at least 5 contiguous 2'-deoxy nucleosides
flanked by second and third regions, each of said second and third
regions independently consisting of at least one 2'-O-methoxyethyl
nucleoside, and wherein the internucleoside linkages of the first
region are phosphorothioate linkages and the internucleoside
linkages of the second and third regions are phosphodiester
linkages, are also provided.
DETAILED DESCRIPTION OF THE INVENTION
[0034] The present invention employs oligomeric compounds,
particularly antisense oligonucleotides, for use in modulating the
function of nucleic acid molecules encoding connective tissue
growth factor, ultimately modulating the amount of connective
tissue growth factor produced. This is accomplished by providing
antisense compounds which specifically hybridize with one or more
nucleic acids encoding connective tissue growth factor. Oligomeric
compounds that modulate the expression of connective tissue growth
factor in cells or tissues are provided. It is shown herein that
the oligomeric compounds of the invention prevent or delay the
onset of type 1 and type diabetes in animal models of diabetes. The
oligomeric compounds of the invention also are shown herein to
prevent or delay the onset of diabetic nephropathy in diabetic
animals and to prevent an increase in proteinuria and/or
albuminuria in diabetic animals. These effects are achieved by
contacting cells or tissues with the oligomeric compounds of the
invention, or administering to an animal in need of treatment said
compounds such that connective tissue growth factor expression is
modulated, preferably inhibited.
[0035] The oligomeric compounds of the invention are chimeric
oligonucleotides ("gapmers") with a central "gap" region consisting
of 2'-deoxynucleotides, which is flanked on both sides by "wings"
composed of 2'-methoxyethyl (2'-MOE) nucleotides. In one
embodiment, the internucleoside (backbone) linkages of the chimeric
compounds are phosphorothioate (P.dbd.S) throughout the
oligonucleotide. In another embodiment, the chimeric compounds have
phosphorothioate linkages in the central gap and phosphodiester
linkages in the wings.
[0036] As used herein, the terms "target nucleic acid" and "nucleic
acid encoding connective tissue growth factor" encompass DNA
encoding connective tissue growth factor, RNA (including pre-mRNA
and mRNA) transcribed from such DNA, and also cDNA derived from
such RNA. The specific hybridization of an oligomeric compound with
its target nucleic acid interferes with the normal function of the
nucleic acid. This modulation of function of a target nucleic acid
by compounds which specifically hybridize to it is generally
referred to as "antisense". The functions of DNA to be interfered
with include replication and transcription. The functions of RNA to
be interfered with include all vital functions such as, for
example, translocation of the RNA to the site of protein
translation, translation of protein from the RNA, splicing of the
RNA to yield one or more mRNA species, and catalytic activity which
may be engaged in or facilitated by the RNA. The overall effect of
such interference with target nucleic acid function is modulation
of the expression of connective tissue growth factor. In the
context of the present invention, "modulation" means either an
increase (stimulation) or a decrease (inhibition) in the expression
of a gene. In the context of the present invention, inhibition is
the preferred form of modulation of gene expression and mRNA is a
preferred target.
[0037] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multistep
process. The process usually begins with the identification of a
nucleic acid sequence whose function is to be modulated. This may
be, for example, a cellular gene (or mRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious agent.
In the present invention, the target is a nucleic acid molecule
encoding connective tissue growth factor. The targeting process
also includes determination of a site or sites within this gene for
the antisense interaction to occur such that the desired effect,
e.g., detection or modulation of expression of the protein, will
result. Within the context of the present invention, a preferred
intragenic site is the region encompassing the translation
initiation or termination codon of the open reading frame (ORF) of
the gene. Since, as is known in the art, the translation initiation
codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in
the corresponding DNA molecule), the translation initiation codon
is also referred to as the "AUG codon," the "start codon" or the
"AUG start codon". A minority of genes have a translation
initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG,
and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
Thus, the terms "translation initiation codon" and "start codon"
can encompass many codon sequences, even though the initiator amino
acid in each instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of an mRNA molecule transcribed from a gene encoding
connective tissue growth factor, regardless of the sequence(s) of
such codons.
[0038] It is also known in the art that a translation termination
codon (or "stop codon") of a gene may have one of three sequences,
i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start
codon region" and "translation initiation codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation initiation codon. Similarly, the terms "stop
codon region" and "translation termination codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation termination codon.
[0039] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Other target regions
include the 5' untranslated region (5'UTR), known in the art to
refer to the portion of an mRNA in the 5' direction from the
translation initiation codon, and thus including nucleotides
between the 5' cap site and the translation initiation codon of an
mRNA or corresponding nucleotides on the gene, and the 3'
untranslated region (3'UTR), known in the art to refer to the
portion of an mRNA in the 3' direction from the translation
termination codon, and thus including nucleotides between the
translation termination codon and 3' end of an mRNA or
corresponding nucleotides on the gene. The 5' cap of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap. The
5' cap region may also be a preferred target region.
[0040] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. mRNA
splice sites, i.e., intron-exon junctions, may also be preferred
target regions, and are particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular mRNA splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred targets. It has also been found that
introns can also be effective, and therefore preferred, target
regions for antisense compounds targeted, for example, to DNA or
pre-mRNA.
[0041] It is also known in the art that alternative RNA transcripts
can be produced from the same genomic region of DNA. These
alternative transcripts are generally known as "variants". More
specifically, "pre-mRNA variants" are transcripts produced from the
same genomic DNA that differ from other transcripts produced from
the same genomic DNA in either their start or stop position and
contain both intronic and extronic regions. Upon excision of one or
more exon or intron regions or portions thereof during splicing,
pre-mRNA variants produce smaller "mRNA variants". Consequently,
mRNA variants are processed pre-mRNA variants and each unique
pre-mRNA variant must always produce a unique mRNA variant as a
result of splicing. These mRNA variants are also known as
"alternative splice variants". If no splicing of the pre-mRNA
variant occurs then the pre-mRNA variant is identical to the mRNA
variant.
[0042] It is also known in the art that variants can be produced
through the use of alternative signals to start or stop
transcription and that pre-mRNAs and mRNAs can possess more that
one start codon or stop codon. Variants that originate from a
pre-mRNA or mRNA that use alternative start codons are known as
"alternative start variants" of that pre-mRNA or mRNA. Those
transcripts that use an alternative stop codon are known as
"alternative stop variants" of that pre-mRNA or mRNA. One specific
type of alternative stop variant is the "polyA variant" in which
the multiple transcripts produced result from the alternative
selection of one of the "polyA stop signals" by the transcription
machinery, thereby producing transcripts that terminate at unique
polyA sites.
[0043] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0044] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. "Complementary," as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a DNA or RNA molecule, then the oligonucleotide and the DNA or
RNA are considered to be complementary to each other at that
position. The oligonucleotide and the DNA or RNA are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleotides which can hydrogen
bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity or precise pairing such that stable and
specific binding occurs between the oligonucleotide and the DNA or
RNA target. It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. An antisense
compound is specifically hybridizable when binding of the compound
to the target DNA or RNA molecule interferes with the normal
function of the target DNA or RNA to cause a loss of utility, and
there is a sufficient degree of complementarity to avoid
non-specific binding of the antisense compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, and in the case of in vitro assays, under
conditions in which the assays are performed.
[0045] Antisense and other compounds of the invention which
hybridize to the target and inhibit expression of the target are
identified through experimentation, and the sequences of these
compounds are hereinbelow identified as preferred embodiments of
the invention. The target sites to which these preferred sequences
are complementary are hereinbelow referred to as "active sites" and
are therefore preferred sites for targeting. Therefore another
embodiment of the invention encompasses compounds which hybridize
to these active sites.
[0046] The compounds of the present invention can be utilized for
diagnostics, therapeutics, prophylaxis and as research reagents and
kits. Furthermore, antisense oligonucleotides, which are able to
inhibit gene expression with exquisite specificity, are often used
by those of ordinary skill to elucidate the function of particular
genes or to distinguish between functions of various members of a
biological pathway.
[0047] The compounds of the present invention can also be applied
in the areas of drug discovery and target validation. The present
invention comprehends the use of the compounds and preferred target
segments identified herein in drug discovery efforts to elucidate
relationships that exist between CTGF and a disease state,
phenotype, or condition. These methods include detecting or
modulating CTGF comprising contacting a sample, tissue, cell, or
organism with the compounds of the present invention, measuring the
nucleic acid or protein level of CTGF and/or a related phenotypic
or chemical endpoint at some time after treatment, and optionally
comparing the measured value to a non-treated sample or sample
treated with a further compound of the invention. These methods can
also be performed in parallel or in combination with other
experiments to determine the function of unknown genes for the
process of target validation or to determine the validity of a
particular gene product as a target for treatment or prevention of
a particular disease, condition, or phenotype.
[0048] Antisense compounds are commonly used as research reagents
and diagnostics. For example, antisense oligonucleotides, which are
able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes. Antisense compounds are also used, for example,
to distinguish between functions of various members of a biological
pathway. Antisense modulation has, therefore, been harnessed for
research use.
[0049] For use in kits and diagnostics, the antisense compounds of
the present invention, either alone or in combination with other
antisense compounds or therapeutics, can be used as tools in
differential and/or combinatorial analyses to elucidate expression
patterns of a portion or the entire complement of genes expressed
within cells and tissues.
[0050] Expression patterns within cells or tissues treated with one
or more antisense compounds are compared to control cells or
tissues not treated with antisense compounds and the patterns
produced are analyzed for differential levels of gene expression as
they pertain, for example, to disease association, signaling
pathway, cellular localization, expression level, size, structure
or function of the genes examined. These analyses can be performed
on stimulated or unstimulated cells and in the presence or absence
of other compounds which affect expression patterns.
[0051] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett.,
2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE
(serial analysis of gene expression)(Madden, et al., Drug Discov.
Today, 2000, 5, 415-425), READS (restriction enzyme amplification
of digested cDNAs) (Prashar and Weissman, Methods Enzymol., 1999,
303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et
al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 1976-81), protein
arrays and proteomics (Celis, et al., FEBS Lett., 2000, 480, 2-16;
Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), expressed
sequence tag (EST) sequencing (Celis, et al., FEBS Lett., 2000,
480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57),
subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal.
Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41,
203-208), subtractive cloning, differential display (DD) (Jurecic
and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative
genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl.,
1998, 31, 286-96), FISH (fluorescent in situ hybridization)
techniques (Going and Gusterson, Eur. J. Cancer, 1999, 35,
1895-904) and mass spectrometry methods (reviewed in (To, Comb.
Chem. High Throughput Screen, 2000, 3, 235-41).
[0052] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotide drugs, including ribozymes, have been
safely and effectively administered to humans and numerous clinical
trials are presently underway. It is thus established that
oligonucleotides can be useful therapeutic modalities that can be
configured to be useful in treatment regimes for treatment of
cells, tissues and animals, especially humans.
[0053] For therapeutics, an animal, preferably a human, suspected
of having a disease or disorder which can be treated by modulating
the expression of CTGF is treated by administering one or more
antisense compounds in accordance with this invention. For example,
in one non-limiting embodiment, the methods comprise the step of
administering to the animal in need of treatment, a therapeutically
effective amount of a CTGF inhibitor. The CTGF inhibitors of the
present invention effectively inhibit the activity of the CTGF
target protein or inhibit the expression of the CTGF protein. In
one embodiment, the disease or disorder is diabetes, including type
1 and type 2 diabetes and complications arising therefrom.
[0054] The compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of a
compound to a suitable pharmaceutically acceptable diluent or
carrier. Use of the compounds and methods of the invention may also
be useful prophylactically.
[0055] In the context of this invention, the term "oligonucleotide"
refers to an oligomer or polymer of ribonucleic acid (RNA) or
deoxyribonucleic acid (DNA) or mimetics thereof. This term includes
oligonucleotides composed of naturally-occurring nucleobases,
sugars and covalent internucleoside (backbone) linkages as well as
oligonucleotides having non-naturally-occurring portions which
function similarly. Such modified or substituted oligonucleotides
are often preferred over native forms because of desirable
properties such as, for example, enhanced cellular uptake, enhanced
affinity for nucleic acid target and increased stability in the
presence of nucleases.
[0056] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics such as are described below. The antisense
compounds in accordance with this invention preferably comprise
from about 8 to about 50 nucleobases (i.e. from about 8 to about 50
linked nucleosides). Particularly preferred antisense compounds are
antisense oligonucleotides, even more preferably those comprising
from about 12 to about 30 nucleobases. Antisense compounds include
ribozymes, external guide sequence (EGS) oligonucleotides
(oligozymes), and other short catalytic RNAs or catalytic
oligonucleotides which hybridize to the target nucleic acid and
modulate its expression.
[0057] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn the respective ends of this
linear polymeric structure can be further joined to form a circular
structure, however, open linear structures are generally preferred.
Within the oligonucleotide structure, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0058] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0059] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriest- ers,
selenophosphates and boranophosphates having normal 3'-5' linkages,
2'-5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Preferred oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0060] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos.: 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are
commonly owned with this application, and each of which is herein
incorporated by reference.
[0061] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0062] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0063] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. : 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0064] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0065] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O--, S--, or N-alkyl;
O--, S--, or N-alkenyl; O--, S-- or N-alkynyl; or O-alkyl-O-alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or
unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10
alkenyl and alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.su- b.3)].sub.2, where n and
m are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes
2'-methoxyethoxy(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples hereinbelow.
[0066] A further prefered modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or
4' carbon atom of the sugar ring thereby forming a bicyclic sugar
moiety. The linkage is preferably a methylene (--CH.sub.2--).sub.n
group bridging the 2' oxygen atom and the 4' carbon atom wherein n
is 1 or 2. LNAs and preparation thereof are described in WO
98/39352 and WO 99/14226.
[0067] Other preferred modifications include
2'-methoxy(2'-O--CH.sub.3),
2'-aminopropoxy(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2),
2'-allyl(2'-CH.sub.2--CH.dbd.CH.sub.2),
2'-O-allyl(2'-O--CH.sub.2--CH.dbd- .CH.sub.2) and 2'-fluoro(2'-F).
The 2'-modification may be in the arabino (up) position or ribo
(down) position. A preferred 2'-arabino modification is 2'-F.
Similar modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos.: 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0068] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine,
5-propynyl(--C.ident.C--CH.sub.3)uracil and cytosine and other
alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil(pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazi- n-2(3H)-one),
phenothiazine cytidine(1H-pyrimido[5,4-b][1,4]benzothiazin-2-
(3H)-one), G-clamps such as a substituted phenoxazine cytidine
(e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine(2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine(H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
Modified nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in U.S. Pat. No.
3,687,808, those disclosed in The Concise Encyclopedia Of Polymer
Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John
Wiley & Sons, 1990, those disclosed by Englisch et al.,
Angewandte Chemie, International Edition, 1991, 30, 613, and those
disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC
Press, 1993. Certain of these nucleobases are particularly useful
for increasing the binding affinity of the oligomeric compounds of
the invention. These include 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0069] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.:
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which is
commonly owned with the instant application and also herein
incorporated by reference.
[0070] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. The
compounds of the invention can include conjugate groups covalently
bound to functional groups such as primary or secondary hydroxyl
groups. Conjugate groups of the invention include intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugates groups include cholesterols,
lipids, phospholipids, biotin, phenazine, folate, phenanthridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmacodynamic properties, in the
context of this invention, include groups that improve oligomer
uptake, enhance oligomer resistance to degradation, and/or
strengthen sequence-specific hybridization with RNA. Groups that
enhance the pharmacokinetic properties, in the context of this
invention, include groups that improve oligomer uptake,
distribution, metabolism or excretion. Representative conjugate
groups are disclosed in International Patent Application
PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which
is incorporated herein by reference. Conjugate moieties include but
are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86,
6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let.,
1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309;
Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a
thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20,
533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues
(Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et
al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol
or triethyl-ammonium 1,2-di-O-hexadecyl-rac-gly-
cero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995,
36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783),
a polyamine or a polyethylene glycol chain (Manoharan et al.,
Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane
acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36,
3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys.
Acta, 1995, 1264, 229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the
invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) which is incorporated herein by reference in its
entirety.
[0071] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos.: 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0072] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention also includes antisense compounds which are
chimeric compounds. "Chimeric" antisense compounds or "chimeras,"
in the context of this invention, are antisense compounds,
particularly oligonucleotides, which contain two or more chemically
distinct regions, each made up of at least one monomer unit, i.e.,
a nucleotide in the case of an oligonucleotide compound. These
oligonucleotides typically contain at least one region wherein the
oligonucleotide is modified so as to confer upon the
oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is
a cellular endonuclease which cleaves the RNA strand of an RNA:DNA
duplex. Activation of RNase H, therefore, results in cleavage of
the RNA target, thereby greatly enhancing the efficiency of
oligonucleotide inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter
oligonucleotides when chimeric oligonucleotides are used, compared
to phosphorothioate deoxyoligonucleotides hybridizing to the same
target region. Cleavage of the RNA target can be routinely detected
by gel electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0073] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos.: 5,013,830; 5,149,797;
5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350;
5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which
are commonly owned with the instant application, and each of which
is herein incorporated by reference in its entirety.
[0074] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0075] The antisense compounds of the invention are synthesized in
vitro and do not include antisense compositions of biological
origin, or genetic vector constructs designed to direct the in vivo
synthesis of antisense molecules. The compounds of the invention
may also be admixed, encapsulated, conjugated or otherwise
associated with other molecules, molecule structures or mixtures of
compounds, as for example, liposomes, receptor targeted molecules,
oral, rectal, topical or other formulations, for assisting in
uptake, distribution and/or absorption. Representative United
States patents that teach the preparation of such uptake,
distribution and/or absorption assisting formulations include, but
are not limited to, U.S. Pat. Nos.: 5,108,921; 5,354,844;
5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020;
5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804;
5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978;
5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152;
5,556,948; 5,580,575; and 5,595,756, each of which is herein
incorporated by reference.
[0076] The antisense compounds of the invention encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to prodrugs and
pharmaceutically acceptable salts of the compounds of the
invention, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents.
[0077] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligonucleotides of the
invention are prepared as SATE
[(S-acetyl-2-thioethyl)phosphate]derivatives according to the
methods disclosed in WO 93/24510 to Gosselin et al., published Dec.
9, 1993 or in WO 94/26764 and U.S. Pat. No. 5,770,713 to Imbach et
al.
[0078] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the invention: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto.
[0079] Pharmaceutically acceptable base addition salts are formed
with metals or amines, such as alkali and alkaline earth metals or
organic amines. Examples of metals used as cations are sodium,
potassium, magnesium, calcium, and the like. Examples of suitable
amines are N,N'-dibenzylethylenediamine, chloroprocaine, choline,
diethanolamine, dicyclohexylamine, ethylenediamine,
N-methylglucamine, and procaine (see, for example, Berge et al.,
"Pharmaceutical Salts," J. of Pharma Sci., 1977, 66, 1-19). The
base addition salts of said acidic compounds are prepared by
contacting the free acid form with a sufficient amount of the
desired base to produce the salt in the conventional manner. The
free acid form may be regenerated by contacting the salt form with
an acid and isolating the free acid in the conventional manner. The
free acid forms differ from their respective salt forms somewhat in
certain physical properties such as solubility in polar solvents,
but otherwise the salts are equivalent to their respective free
acid for purposes of the present invention. As used herein, a
"pharmaceutical addition salt" includes a pharmaceutically
acceptable salt of an acid form of one of the components of the
compositions of the invention. These include organic or inorganic
acid salts of the amines. Preferred acid salts are the
hydrochlorides, acetates, salicylates, nitrates and phosphates.
Other suitable pharmaceutically acceptable salts are well known to
those skilled in the art and include basic salts of a variety of
inorganic and organic acids, such as, for example, with inorganic
acids, such as for example hydrochloric acid, hydrobromic acid,
sulfuric acid or phosphoric acid; with organic carboxylic,
sulfonic, sulfo or phospho acids or N-substituted sulfamic acids,
for example acetic acid, propionic acid, glycolic acid, succinic
acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric
acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic
acid, glucaric acid, glucuronic acid, citric acid, benzoic acid,
cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid,
nicotinic acid or isonicotinic acid; and with amino acids, such as
the 20 alpha-amino acids involved in the synthesis of proteins in
nature, for example glutamic acid or aspartic acid, and also with
phenylacetic acid, methanesulfonic acid, ethanesulfonic acid,
2-hydroxyethanesulfonic acid, ethane-1,2-disulfonic acid,
benzenesulfonic acid, 4-methylbenzenesulfonic acid,
naphthalene-2-sulfonic acid, naphthalene-1,5-disulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid
(with the formation of cyclamates), or with other acid organic
compounds, such as ascorbic acid. Pharmaceutically acceptable salts
of compounds may also be prepared with a pharmaceutically
acceptable cation. Suitable pharmaceutically acceptable cations are
well known to those skilled in the art and include alkaline,
alkaline earth, ammonium and quaternary ammonium cations.
Carbonates or hydrogen carbonates are also possible.
[0080] For oligonucleotides, preferred examples of pharmaceutically
acceptable salts include but are not limited to (a) salts formed
with cations such as sodium, potassium, ammonium, magnesium,
calcium, polyamines such as spermine and spermidine, etc.; (b) acid
addition salts formed with inorganic acids, for example
hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric
acid, nitric acid and the like; (c) salts formed with organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid,
succinic acid, maleic acid, fumaric acid, gluconic acid, citric
acid, malic acid, ascorbic acid, benzoic acid, tannic acid,
palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid,
naphthalenedisulfonic acid, polygalacturonic acid, and the like;
and (d) salts formed from elemental anions such as chlorine,
bromine, and iodine.
[0081] The antisense compounds of the present invention can be
utilized for diagnostics, therapeutics, prophylaxis and as research
reagents and kits. For therapeutics, an animal, preferably a human,
suspected of having a disease or disorder which can be treated by
modulating the expression of connective tissue growth factor is
treated by administering antisense compounds in accordance with
this invention. The compounds of the invention can be utilized in
pharmaceutical compositions by adding an effective amount of an
antisense compound to a suitable pharmaceutically acceptable
diluent or carrier. Use of the antisense compounds and methods of
the invention may also be useful prophylactically, e.g., to prevent
or delay infection, inflammation or tumor formation, for
example.
[0082] The antisense compounds of the invention are useful for
research and diagnostics, because these compounds hybridize to
nucleic acids encoding connective tissue growth factor, enabling
sandwich and other assays to easily be constructed to exploit this
fact. Hybridization of the antisense oligonucleotides of the
invention with a nucleic acid encoding connective tissue growth
factor can be detected by means known in the art. Such means may
include conjugation of an enzyme to the oligonucleotide,
radiolabelling of the oligonucleotide or any other suitable
detection means. Kits using such detection means for detecting the
level of connective tissue growth factor in a sample may also be
prepared.
[0083] The present invention also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the invention. The pharmaceutical compositions of the present
invention may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligonucleotides with at least one
2'-O-methoxyethyl modification are believed to be particularly
useful for oral administration.
[0084] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful. Preferred
topical formulations include those in which the oligonucleotides of
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Preferred lipids and liposomes
include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and
cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). Oligonucleotides of the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligonucleotides may be complexed to lipids, in
particular to cationic lipids. Preferred fatty acids and esters
include but are not limited arachidonic acid, oleic acid,
eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic
acid, palmitic acid, stearic acid, linoleic acid, linolenic acid,
dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-10 alkyl ester (e.g. isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed on May 20, 1999 which
is incorporated herein by reference in its entirety.
[0085] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Preferred oral formulations are those in which
oligonucleotides of the invention are administered in conjunction
with one or more penetration enhancers surfactants and chelators.
Preferred surfactants include fatty acids and/or esters or salts
thereof, bile acids and/or salts thereof. Prefered bile acids/salts
include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic
acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid,
glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic
acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusid- ate,
sodium glycodihydrofusidate. Prefered fatty acids include
arachidonic acid, undecanoic acid, oleic acid, lauric acid,
caprylic acid, capric acid, myristic acid, palmitic acid, stearic
acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a monoglyceride, a diglyceride or a pharmaceutically acceptable
salt thereof (e.g. sodium). Also prefered are combinations of
penetration enhancers, for example, fatty acids/salts in
combination with bile acids/salts. A particularly prefered
combination is the sodium salt of lauric acid, capric acid and
UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
Oligonucleotides of the invention may be delivered orally in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. Oligonucleotide complexing agents
include poly-amino acids; polyimines; polyacrylates;
polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates;
cationized gelatins, albumins, starches, acrylates,
polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates;
DEAE-derivatized polyimines, pollulans, celluloses and starches.
Particularly preferred complexing agents include chitosan,
N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine,
polyspermines, protamine, polyvinylpyridine,
polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g.
p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate),
poly(butylcyanoacrylate), poly(isobutylcyanoacrylate),
poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate,
DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for oligonucleotides
and their preparation are described in detail in U.S. applications
Ser. No. 08/886,829 (filed Jul. 1, 1997), Ser. No. 09/108,673
(filed Jul. 1, 1998), Ser. No. 09/256,515 (filed Feb. 23, 1999),
Ser. No. 09/082,624 (filed May 21, 1998) and Ser. No. 09/315,298
(filed May 20, 1999) each of which is incorporated herein by
reference in their entirety.
[0086] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0087] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0088] The pharmaceutical formulations of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0089] The compositions of the present invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0090] In one embodiment of the present invention the
pharmaceutical compositions may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product. The
preparation of such compositions and formulations is generally
known to those skilled in the pharmaceutical and formulation arts
and may be applied to the formulation of the compositions of the
present invention.
[0091] Emulsions
[0092] The compositions of the present invention may be prepared
and formulated as emulsions. Emulsions are typically heterogenous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter. (Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.
335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising of two immiscible liquid phases
intimately mixed and dispersed with each other. In general,
emulsions may be either water-in-oil (w/o) or of the oil-in-water
(o/w) variety. When an aqueous phase is finely divided into and
dispersed as minute droplets into a bulk oily phase the resulting
composition is called a water-in-oil (w/o) emulsion. Alternatively,
when an oily phase is finely divided into and dispersed as minute
droplets into a bulk aqueous phase the resulting composition is
called an oil-in-water (o/w) emulsion. Emulsions may contain
additional components in addition to the dispersed phases and the
active drug which may be present as a solution in either the
aqueous phase, oily phase or itself as a separate phase.
Pharmaceutical excipients such as emulsifiers, stabilizers, dyes,
and anti-oxidants may also be present in emulsions as needed.
Pharmaceutical emulsions may also be multiple emulsions that are
comprised of more than two phases such as, for example, in the case
of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w)
emulsions. Such complex formulations often provide certain
advantages that simple binary emulsions do not. Multiple emulsions
in which individual oil droplets of an o/w emulsion enclose small
water droplets constitute a w/o/w emulsion. Likewise a system of
oil droplets enclosed in globules of water stabilized in an oily
continuous provides an o/w/o emulsion.
[0093] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
may be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that may be incorporated into either
phase of the emulsion. Emulsifiers may broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0094] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (Rieger, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic
and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic nature of the surfactant has been termed the
hydrophile/lipophile balance (HLB) and is a valuable tool in
categorizing and selecting surfactants in the preparation of
formulations. Surfactants may be classified into different classes
based on the nature of the hydrophilic group: nonionic, anionic,
cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 285).
[0095] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0096] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0097] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0098] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that may
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used may be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0099] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery have been very widely used because of reasons of ease
of formulation, efficacy from an absorption and bioavailability
standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 199). Mineral-oil base laxatives,
oil-soluble vitamins and high fat nutritive preparations are among
the materials that have commonly been administered orally as o/w
emulsions.
[0100] In one embodiment of the present invention, the compositions
of oligonucleotides and nucleic acids are formulated as
microemulsions. A microemulsion may be defined as a system of
water, oil and amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically
microemulsions are systems that are prepared by first dispersing an
oil in an aqueous surfactant solution and then adding a sufficient
amount of a fourth component, generally an intermediate
chain-length alcohol to form a transparent system. Therefore,
microemulsions have also been described as thermodynamically
stable, isotropically clear dispersions of two immiscible liquids
that are stabilized by interfacial films of surface-active
molecules (Leung and Shah, in: Controlled Release of Drugs:
Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0101] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0102] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750),
decaglycerol decaoleate (DAO750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions may, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase may typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase may include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0103] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (Constantinides et al., Pharmaceutical Research, 1994, 11,
1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13,
205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (Constantinides
et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form
spontaneously when their components are brought together at ambient
temperature. This may be particularly advantageous when formulating
thermolabile drugs, peptides or oligonucleotides. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of oligonucleotides and nucleic acids from the
gastrointestinal tract, as well as improve the local cellular
uptake of oligonucleotides and nucleic acids within the
gastrointestinal tract, vagina, buccal cavity and other areas of
administration.
[0104] Microemulsions of the present invention may also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
oligonucleotides and nucleic acids of the present invention.
Penetration enhancers used in the microemulsions of the present
invention may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0105] Liposomes
[0106] There are many organized surfactant structures besides
microemulsions that have been studied and used for the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used in the
present invention, the term "liposome" means a vesicle composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0107] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0108] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0109] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0110] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes. As the merging of the liposome and cell progresses, the
liposomal contents are emptied into the cell where the active agent
may act.
[0111] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for topical administration, liposomes present
several advantages over other formulations. Such advantages include
reduced side-effects related to high systemic absorption of the
administered drug, increased accumulation of the administered drug
at the desired target, and the ability to administer a wide variety
of drugs, both hydrophilic and hydrophobic, into the skin.
[0112] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis.
[0113] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged DNA molecules to form a stable complex. The positively
charged DNA/liposome complex binds to the negatively charged cell
surface and is internalized in an endosome. Due to the acidic pH
within the endosome, the liposomes are ruptured, releasing their
contents into the cell cytoplasm (Wang et al., Biochem. Biophys.
Res. Commun., 1987, 147, 980-985).
[0114] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0115] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0116] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0117] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/po- lyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporin-A into different layers
of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).
[0118] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0119] Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphat- idylcholine are disclosed in WO
97/13499 (Lim et al.).
[0120] Many liposomes comprising lipids derivatized with one or
more hydrophilic polymers, and methods of preparation thereof, are
known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53,
2778) described liposomes comprising a nonionic detergent,
2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett.,
1984, 167, 79) noted that hydrophilic coating of polystyrene
particles with polymeric glycols results in significantly enhanced
blood half-lives. Synthetic phospholipids modified by the
attachment of carboxylic groups of polyalkylene glycols (e.g., PEG)
are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899).
Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments
demonstrating that liposomes comprising phosphatidylethanolamine
(PE) derivatized with PEG or PEG stearate have significant
increases in blood circulation half-lives. Blume et al. (Biochimica
et Biophysica Acta, 1990, 1029, 91) extended such observations to
other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from
the combination of distearoylphosphatidylethanolamine (DSPE) and
PEG. Liposomes having covalently bound PEG moieties on their
external surface are described in European Patent No. EP 0 445 131
B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20
mole percent of PE derivatized with PEG, and methods of use
thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556
and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and
European Patent No. EP 0 496 813 B1). Liposomes comprising a number
of other lipid-polymer conjugates are disclosed in WO 91/05545 and
U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073
(Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids
are described in WO 96/10391 (Choi et al.). U.S. Pat. No. 5,540,935
(Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.)
describe PEG-containing liposomes that can be further derivatized
with functional moieties on their surfaces.
[0121] A limited number of liposomes comprising nucleic acids are
known in the art. WO 96/40062 to Thierry et al. discloses methods
for encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an antisense RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes
comprising antisense oligonucleotides targeted to the raf gene.
[0122] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0123] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0124] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0125] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0126] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0127] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0128] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0129] Penetration Enhancers
[0130] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligonucleotides, to the skin of animals. Most
drugs are present in solution in both ionized and nonionized forms.
However, usually only lipid soluble or lipophilic drugs readily
cross cell membranes. It has been discovered that even
non-lipophilic drugs may cross cell membranes if the membrane to be
crossed is treated with a penetration enhancer. In addition to
aiding the diffusion of non-lipophilic drugs across cell membranes,
penetration enhancers also enhance the permeability of lipophilic
drugs.
[0131] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
p.92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail.
[0132] Surfactants: In connection with the present invention,
surfactants (or "surface-active agents") are chemical entities
which, when dissolved in an aqueous solution, reduce the surface
tension of the solution or the interfacial tension between the
aqueous solution and another liquid, with the result that
absorption of oligonucleotides through the mucosa is enhanced. In
addition to bile salts and fatty acids, these penetration enhancers
include, for example, sodium lauryl sulfate,
polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p.92); and perfluorochemical emulsions, such as FC-43.
Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0133] Fatty acids: Various fatty acids and their derivatives which
act as penetration enhancers include, for example, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol.,
1992, 44, 651-654).
[0134] Bile salts: The physiological role of bile includes the
facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural
bile salts, and their synthetic derivatives, act as penetration
enhancers. Thus the term "bile salts" includes any of the naturally
occurring components of bile as well as any of their synthetic
derivatives. The bile salts of the invention include, for example,
cholic acid (or its pharmaceutically acceptable sodium salt, sodium
cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic
acid (sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0135] Chelating Agents: Chelating agents, as used in connection
with the present invention, can be defined as compounds that remove
metallic ions from solution by forming complexes therewith, with
the result that absorption of oligonucleotides through the mucosa
is enhanced. With regards to their use as penetration enhancers in
the present invention, chelating agents have the added advantage of
also serving as DNase inhibitors, as most characterized DNA
nucleases require a divalent metal ion for catalysis and are thus
inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618,
315-339). Chelating agents of the invention include but are not
limited to disodium ethylenediaminetetraacetate (EDTA), citric
acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and
homovanilate), N-acyl derivatives of collagen, laureth-9 and
N-amino acyl derivatives of beta-diketones (enamines)(Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page
92; Muranishi, Critical Reviews in Therapeutic Drug Carrier
Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14,
43-51).
[0136] Non-chelating non-surfactants: As used herein, non-chelating
non-surfactant penetration enhancing compounds can be defined as
compounds that demonstrate insignificant activity as chelating
agents or as surfactants but that nonetheless enhance absorption of
oligonucleotides through the alimentary mucosa (Muranishi, Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This
class of penetration enhancers include, for example, unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives
(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991, page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0137] Agents that enhance uptake of oligonucleotides at the
cellular level may also be added to the pharmaceutical and other
compositions of the present invention. For example, cationic
lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188), cationic glycerol derivatives, and polycationic
molecules, such as polylysine (Lollo et al., PCT Application WO
97/30731), are also known to enhance the cellular uptake of
oligonucleotides.
[0138] Other agents may be utilized to enhance the penetration of
the administered nucleic acids, including glycols such as ethylene
glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and
terpenes such as limonene and menthone.
[0139] Carriers
[0140] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate oligonucleotide in hepatic tissue can be
reduced when it is coadministered with polyinosinic acid, dextran
sulfate, polycytidic acid or 4-acetamido-4'
isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., Antisense
Res. Dev., 1995, 5, 115-121; Takakura et al., Antisense & Nucl.
Acid Drug Dev., 1996, 6, 177-183).
[0141] Excipients
[0142] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
may be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc.).
[0143] Pharmaceutically acceptable organic or inorganic excipient
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0144] Formulations for topical administration of nucleic acids may
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0145] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
[0146] Other Components
[0147] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0148] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0149] Certain embodiments of the invention provide pharmaceutical
compositions containing (a) one or more antisense compounds and (b)
one or more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include but are not limited to daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin,
bleomycin, mafosfamide, ifosfamide, cytosine arabinoside,
bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone,
tamoxifen, dacarbazine, procarbazine, hexamethylmelamine,
pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil,
methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine,
5-azacytidine, hydroxyurea, deoxycoformycin,
4-hydroxyperoxycyclophosphor- amide, 5-fluorouracil (5-FU),
5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,
taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate,
irinotecan, topotecan, gemcitabine, teniposide, cisplatin and
diethylstilbestrol (DES). See, generally, The Merck Manual of
Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al.,
eds., Rahway, N.J. When used with the compounds of the invention,
such chemotherapeutic agents may be used individually (e.g., 5-FU
and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide
for a period of time followed by MTX and oligonucleotide), or in
combination with one or more other such chemotherapeutic agents
(e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and
oligonucleotide). Anti-inflammatory drugs, including but not
limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the invention. See, generally, The
Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al.,
eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively).
Other non-antisense chemotherapeutic agents are also within the
scope of this invention. Two or more combined compounds may be used
together or sequentially.
[0150] In another related embodiment, compositions of the invention
may contain one or more antisense compounds, particularly
oligonucleotides, targeted to a first nucleic acid and one or more
additional antisense compounds targeted to a second nucleic acid
target. Numerous examples of antisense compounds are known in the
art. Two or more combined compounds may be used together or
sequentially.
[0151] The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50s found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.0001 .mu.g to 100 g per kg of body weight, and may be
given once or more daily, weekly, monthly or yearly, or even once
every 2 to 20 years. Persons of ordinary skill in the art can
easily estimate repetition rates for dosing based on measured
residence times and concentrations of the drug in bodily fluids or
tissues. Following successful treatment, it may be desirable to
have the patient undergo maintenance therapy to prevent the
recurrence of the disease state, wherein the oligonucleotide is
administered in maintenance doses, ranging from 0.0001 .mu.g to 100
g per kg of body weight, once or more daily, to once every 20
years.
[0152] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the same.
EXAMPLES
Example 1
Nucleoside Phosphoramidites for Oligonucleotide Synthesis Deoxy and
2'-alkoxy amidites
[0153] 2'-Deoxy and 2'-methoxy beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial sources (e.g.
Chemgenes, Needham Mass. or Glen Research, Inc. Sterling Va.).
Other 2'-O-alkoxy substituted nucleoside amidites are prepared as
described in U.S. Pat. No. 5,506,351, herein incorporated by
reference. For oligonucleotides synthesized using 2'-alkoxy
amidites, the standard cycle for unmodified oligonucleotides was
utilized, except the wait step after pulse delivery of tetrazole
and base was increased to 360 seconds.
[0154] Oligonucleotides containing 5-methyl-2'-deoxycytidine
(5-Me-C) nucleotides were synthesized according to published
methods [Sanghvi, et. al., Nucleic Acids Research, 1993, 21,
3197-3203] using commercially available phosphoramidites (Glen
Research, Sterling Va. or ChemGenes, Needham Mass.).
2'-Fluoro amidites
2'-Fluorodeoxyadenosine amidites
[0155] 2'-fluoro oligonucleotides were synthesized as described
previously [Kawasaki, et. al., J. Med. Chem., 1993, 36, 831-841]
and U.S. Pat. No. 5,670,633, herein incorporated by reference.
Briefly, the protected nucleoside
N6-benzoyl-2'-deoxy-2'-fluoroadenosine was synthesized utilizing
commercially available 9-beta-D-arabinofuranosyladenine as starting
material and by modifying literature procedures whereby the
2'-alpha-fluoro atom is introduced by a S.sub.N2-displacement of a
2'-beta-trityl group. Thus
N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively
protected in moderate yield as the 3',5'-ditetrahydropyranyl (THP)
intermediate. Deprotection of the THP and N6-benzoyl groups was
accomplished using standard methodologies and standard methods were
used to obtain the 5'-dimethoxytrityl-(DMT) and
5'-DMT-3'-phosphoramidite intermediates.
2'-Fluorodeoxyguanosine
[0156] The synthesis of 2'-deoxy-2'-fluoroguanosine was
accomplished using tetraisopropyldisiloxanyl (TPDS) protected
9-beta-D-arabinofuranosylguani- ne as starting material, and
conversion to the intermediate
diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS
group was followed by protection of the hydroxyl group with THP to
give diisobutyryl di-THP protected arabinofuranosylguanine.
Selective O-deacylation and triflation was followed by treatment of
the crude product with fluoride, then deprotection of the THP
groups. Standard methodologies were used to obtain the 5'-DMT- and
5'-DMT-3'-phosphoramidi- tes.
2'-Fluorouridine
[0157] Synthesis of 2'-deoxy-2'-fluorouridine was accomplished by
the modification of a literature procedure in which
2,2'-anhydro-1-beta-D-ara- binofuranosyluracil was treated with 70%
hydrogen fluoride-pyridine. Standard procedures were used to obtain
the 5'-DMT and 5'-DMT-3'-phosphoramidites.
2'-Fluorodeoxycytidine
[0158] 2'-deoxy-2'-fluorocytidine was synthesized via amination of
2'-deoxy-2'-fluorouridine, followed by selective protection to give
N4-benzoyl-2'-deoxy-2'-fluorocytidine. Standard procedures were
used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites.
2'-O-(2-Methoxyethyl) modified amidites
[0159] 2'-O-Methoxyethyl-substituted nucleoside amidites are
prepared as follows, or alternatively, as per the methods of
Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
2,2'-Anhydro[1-(beta-D-arabinofuranosyl)-5-methyluridine]
[0160] 5-Methyluridine (ribosylthymine, commercially available
through Yamasa, Choshi, Japan) (72.0 g, 0.279 M),
diphenyl-carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g,
0.024 M) were added to DMF (300 mL). The mixture was heated to
reflux, with stirring, allowing the evolved carbon dioxide gas to
be released in a controlled manner. After 1 hour, the slightly
darkened solution was concentrated under reduced pressure. The
resulting syrup was poured into diethylether (2.5 L), with
stirring. The product formed a gum. The ether was decanted and the
residue was dissolved in a minimum amount of methanol (ca. 400 mL).
The solution was poured into fresh ether (2.5 L) to yield a stiff
gum. The ether was decanted and the gum was dried in a vacuum oven
(60.degree. C. at 1 mm Hg for 24 h) to give a solid that was
crushed to a light tan powder (57 g, 85% crude yield). The NMR
spectrum was consistent with the structure, contaminated with
phenol as its sodium salt (ca. 5%). The material was used as is for
further reactions (or it can be purified further by column
chromatography using a gradient of methanol in ethyl acetate
(10-25%) to give a white solid, mp 222-4.degree. C.).
2'-O-Methoxyethyl-5-methyluridine
[0161] 2,2'-Anhydro-5-methyluridine (195 g, 0.81 M),
tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol
(1.2 L) were added to a 2 L stainless steel pressure vessel and
placed in a pre-heated oil bath at 160.degree. C. After heating for
48 hours at 155-160.degree. C., the vessel was opened and the
solution evaporated to dryness and triturated with MeOH (200 mL).
The residue was suspended in hot acetone (1 L). The insoluble salts
were filtered, washed with acetone (150 mL) and the filtrate
evaporated. The residue (280 g) was dissolved in CH.sub.3CN (600
mL) and evaporated. A silica gel column (3 kg) was packed in
CH.sub.2Cl.sub.2/acetone/MeOH (20:5:3) containing 0.5% Et.sub.3NH.
The residue was dissolved in CH.sub.2Cl.sub.2 (250 mL) and adsorbed
onto silica (150 g) prior to loading onto the column. The product
was eluted with the packing solvent to give 160 g (63%) of product.
Additional material was obtained by reworking impure fractions.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0162] 2'-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was
co-evaporated with pyridine (250 mL) and the dried residue
dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the mixture stirred at
room temperature for one hour. A second aliquot of dimethoxytrityl
chloride (94.3 g, 0.278 M) was added and the reaction stirred for
an additional one hour. Methanol (170 mL) was then added to stop
the reaction. HPLC showed the presence of approximately 70%
product. The solvent was evaporated and triturated with CH.sub.3CN
(200 mL). The residue was dissolved in CHCl.sub.3 (1.5 L) and
extracted with 2.times.500 mL of saturated NaHCO.sub.3 and
2.times.500 mL of saturated NaCl. The organic phase was dried over
Na.sub.2SO.sub.4, filtered and evaporated. 275 g of residue was
obtained. The residue was purified on a 3.5 kg silica gel column,
packed and eluted with EtOAc/hexane/acetone (5:5:1) containing 0.5%
Et.sub.3NH. The pure fractions were evaporated to give 164 g of
product. Approximately 20 g additional was obtained from the impure
fractions to give a total yield of 183 g (57%).
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine
[0163] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methyluridine (106
g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from
562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38
mL, 0.258 M) were combined and stirred at room temperature for 24
hours. The reaction was monitored by TLC by first quenching the TLC
sample with the addition of MeOH. Upon completion of the reaction,
as judged by TLC, MeOH (50 mL) was added and the mixture evaporated
at 35.degree. C. The residue was dissolved in CHCl.sub.3 (800 mL)
and extracted with 2.times.200 mL of saturated sodium bicarbonate
and 2.times.200 mL of saturated NaCl. The water layers were back
extracted with 200 mL of CHCl.sub.3. The combined organics were
dried with sodium sulfate and evaporated to give 122 g of residue
(approx. 90% product). The residue was purified on a 3.5 kg silica
gel column and eluted using EtOAc/hexane(4:1). Pure product
fractions were evaporated to yield 96 g (84%). An additional 1.5 g
was recovered from later fractions.
3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleurid-
ine
[0164] A first solution was prepared by dissolving
3'-O-acetyl-2'-O-methox-
yethyl-5'-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in
CH.sub.3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M)
was added to a solution of triazole (90 g, 1.3 M) in CH.sub.3CN (1
L), cooled to -5.degree. C. and stirred for 0.5 h using an overhead
stirrer. POCl.sub.3 was added dropwise, over a 30 minute period, to
the stirred solution maintained at 0-10.degree. C., and the
resulting mixture stirred for an additional 2 hours. The first
solution was added dropwise, over a 45 minute period, to the latter
solution. The resulting reaction mixture was stored overnight in a
cold room. Salts were filtered from the reaction mixture and the
solution was evaporated. The residue was dissolved in EtOAc (1 L)
and the insoluble solids were removed by filtration. The filtrate
was washed with 1.times.300 mL of NaHCO.sub.3 and 2.times.300 mL of
saturated NaCl, dried over sodium sulfate and evaporated. The
residue was triturated with EtOAc to give the title compound.
2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0165] A solution of
3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5--
methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and
NH.sub.4OH (30 mL) was stirred at room temperature for 2 hours. The
dioxane solution was evaporated and the residue azeotroped with
MeOH (2.times.200 mL). The residue was dissolved in MeOH (300 mL)
and transferred to a 2 liter stainless steel pressure vessel. MeOH
(400 mL) saturated with NH.sub.3 gas was added and the vessel
heated to 100.degree. C. for 2 hours (TLC showed complete
conversion). The vessel contents were evaporated to dryness and the
residue was dissolved in EtOAc (500 mL) and washed once with
saturated NaCl (200 mL). The organics were dried over sodium
sulfate and the solvent was evaporated to give 85 g (95%) of the
title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
[0166] 2'-O-Methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85
g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride
(37.2 g, 0.165 M) was added with stirring. After stirring for 3
hours, TLC showed the reaction to be approximately 95% complete.
The solvent was evaporated and the residue azeotroped with MeOH
(200 mL). The residue was dissolved in CHCl.sub.3 (700 mL) and
extracted with saturated NaHCO.sub.3 (2.times.300 mL) and saturated
NaCl (2.times.300 mL), dried over MgSO.sub.4 and evaporated to give
a residue (96 g). The residue was chromatographed on a 1.5 kg
silica column using EtOAc/hexane (1:1) containing 0.5% Et.sub.3NH
as the eluting solvent. The pure product fractions were evaporated
to give 90 g (90%) of the title compound.
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine-3'-amid-
ite
[0167]
N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine
(74 g, 0.10 M) was dissolved in CH.sub.2Cl.sub.2 (1 L). Tetrazole
diisopropylamine (7.1 g) and
2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were
added with stirring, under a nitrogen atmosphere. The resulting
mixture was stirred for 20 hours at room temperature (TLC showed
the reaction to be 95% complete). The reaction mixture was
extracted with saturated NaHCO.sub.3 (1.times.300 mL) and saturated
NaCl (3.times.300 mL). The aqueous washes were back-extracted with
CH.sub.2Cl.sub.2 (300 mL), and the extracts were combined, dried
over MgSO.sub.4 and concentrated. The residue obtained was
chromatographed on a 1.5 kg silica column using EtOAc/hexane (3:1)
as the eluting solvent. The pure fractions were combined to give
90.6 g (87%) of the title compound.
2'-O-(Aminooxyethyl)nucleoside amidites and
2'-O-(dimethylaminooxyethyl)nu- cleoside amidites
2'-(Dimethylaminooxyethoxy)nucleoside amidites
[0168] 2'-(Dimethylaminooxyethoxy)nucleoside amidites [also known
in the art as 2'-O-(dimethylaminooxyethyl)nucleoside amidites] are
prepared as described in the following paragraphs. Adenosine,
cytidine and guanosine nucleoside amidites are prepared similarly
to the thymidine (5-methyluridine) except the exocyclic amines are
protected with a benzoyl moiety in the case of adenosine and
cytidine and with isobutyryl in the case of guanosine.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
[0169] O.sup.2-2'-anhydro-5-methyluridine (Pro. Bio. Sint., Varese,
Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013
eq, 0.0054 mmol) were dissolved in dry pyridine (500 ml) at ambient
temperature under an argon atmosphere and with mechanical stirring.
tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1 eq, 0.458
mmol) was added in one portion. The reaction was stirred for 16 h
at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicated a
complete reaction. The solution was concentrated under reduced
pressure to a thick oil. This was partitioned between
dichloromethane (1 L) and saturated sodium bicarbonate (2.times.1
L) and brine (1 L). The organic layer was dried over sodium sulfate
and concentrated under reduced pressure to a thick oil. The oil was
dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600
mL) and the solution was cooled to -10.degree. C. The resulting
crystalline product was collected by filtration, washed with ethyl
ether (3.times.200 mL) and dried (40.degree. C., 1 mm Hg, 24 h) to
149 g (74.8%) of white solid. TLC and NMR were consistent with pure
product.
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
[0170] In a 2 L stainless steel, unstirred pressure reactor was
added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the
fume hood and with manual stirring, ethylene glycol (350 mL,
excess) was added cautiously at first until the evolution of
hydrogen gas subsided.
5'-O-tert-Butyldiphenylsilyl-O.sup.2-2'-anhydro-5-methyluridine
(149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) were
added with manual stirring. The reactor was sealed and heated in an
oil bath until an internal temperature of 160.degree. C. was
reached and then maintained for 16 h (pressure <100 psig). The
reaction vessel was cooled to ambient and opened. TLC (Rf 0.67 for
desired product and Rf 0.82 for ara-T side product, ethyl acetate)
indicated about 70% conversion to the product. In order to avoid
additional side product formation, the reaction was stopped,
concentrated under reduced pressure (10 to 1 mm Hg) in a warm water
bath (40-100.degree. C.) with the more extreme conditions used to
remove the ethylene glycol. [Alternatively, once the low boiling
solvent is gone, the remaining solution can be partitioned between
ethyl acetate and water. The product will be in the organic phase.]
The residue was purified by column chromatography (2 kg silica gel,
ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate
fractions were combined, stripped and dried to product as a white
crisp foam (84 g, 50%), contaminated starting material (17.4 g) and
pure reusable starting material 20 g. The yield based on starting
material less pure recovered starting material was 58%. TLC and NMR
were consistent with 99% pure product.
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
[0171]
5'-O-tert-Butyldiphenylsilyl-2'-O-(2-hydroxyethyl)-5-methyluridine
(20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g,
44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was
then dried over P.sub.2O.sub.5 under high vacuum for two days at
40.degree. C. The reaction mixture was flushed with argon and dry
THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear
solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added
dropwise to the reaction mixture. The rate of addition is
maintained such that resulting deep red coloration is just
discharged before adding the next drop. After the addition was
complete, the reaction was stirred for 4 hrs. By that time TLC
showed the completion of the reaction (ethylacetate:hexane, 60:40).
The solvent was evaporated in vacuum. Residue obtained was placed
on a flash column and eluted with ethyl acetate:hexane (60:40), to
get
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridine
as white foam (21.819 g, 86%).
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methylurid-
ine
[0172]
2'-O-([2-phthalimidoxy)ethyl]-5'-t-butyldiphenylsilyl-5-methyluridi-
ne (3.1 g, 4.5 mmol) was dissolved in dry CH.sub.2Cl.sub.2 (4.5 mL)
and methylhydrazine (300 mL, 4.64 mmol) was added dropwise at
-10.degree. C. to 0.degree. C. After 1 h the mixture was filtered,
the filtrate was washed with ice cold CH.sub.2Cl.sub.2 and the
combined organic phase was washed with water, brine and dried over
anhydrous Na.sub.2SO.sub.4. The solution was concentrated to get
2'-O-(aminooxyethyl)thymidine, which was then dissolved in MeOH
(67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1
eq.) was added and the resulting mixture was strirred for 1 h.
Solvent was removed under vacuum; residue chromatographed to get
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-methyluri-
dine as white foam (1.95 g, 78%).
5'-O-tert-Butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methylurid-
ine
[0173]
5'-O-tert-butyldiphenylsilyl-2'-O-[(2-formadoximinooxy)ethyl]-5-met-
hyluridine (1.77 g, 3.12 mmol) was dissolved in a solution of 1 M
pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium
cyanoborohydride (0.39 g, 6.13 mmol) was added to this solution at
10.degree. C. under inert atmosphere. The reaction mixture was
stirred for 10 minutes at 10.degree. C. After that the reaction
vessel was removed from the ice bath and stirred at room
temperature for 2 h, the reaction monitored by TLC (5% MeOH in
CH.sub.2Cl.sub.2). Aqueous NaHCO.sub.3 solution (5%, 10 mL) was
added and extracted with ethyl acetate (2.times.20 mL). Ethyl
acetate phase was dried over anhydrous Na.sub.2SO.sub.4, evaporated
to dryness. Residue was dissolved in a solution of 1 M PPTS in MeOH
(30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) was added and
the reaction mixture was stirred at room temperature for 10
minutes. Reaction mixture cooled to 10.degree. C. in an ice bath,
sodium cyanoborohydride (0.39 g, 6.13 mmol) was added and reaction
mixture stirred at 10.degree. C. for 10 minutes. After 10 minutes,
the reaction mixture was removed from the ice bath and stirred at
room temperature for 2 hrs. To the reaction mixture 5% NaHCO.sub.3
(25 mL) solution was added and extracted with ethyl acetate
(2.times.25 mL). Ethyl acetate layer was dried over anhydrous
Na.sub.2SO.sub.4 and evaporated to dryness . The residue obtained
was purified by flash column chromatography and eluted with 5% MeOH
in CH.sub.2Cl.sub.2 to get
5'-O-tert-butyldiphenylsilyl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluri-
dine as a white foam (14.6 g, 80%).
2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0174] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) was
dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept
over KOH). This mixture of triethylamine-2HF was then added to
5'-O-tert-butyldiphenylsil-
yl-2'-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40 g, 2.4
mmol) and stirred at room temperature for 24 hrs. Reaction was
monitored by TLC (5% MeOH in CH.sub.2Cl.sub.2). Solvent was removed
under vacuum and the residue placed on a flash column and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 to get
2'-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg, 92.5%).
5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine
[0175] 2'-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17
mmol) was dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. It was then co-evaporated with anhydrous pyridine (20
mL). The residue obtained was dissolved in pyridine (11 mL) under
argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol),
4,4'-dimethoxytrityl chloride (880 mg, 2.60 mmol) was added to the
mixture and the reaction mixture was stirred at room temperature
until all of the starting material disappeared. Pyridine was
removed under vacuum and the residue chromatographed and eluted
with 10% MeOH in CH.sub.2Cl.sub.2 (containing a few drops of
pyridine) to get 5'-O-DMT-2'-O-(dimethylamino-oxyethyl)-5--
methyluridine (1.13 g, 80%).
5'-O-DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoet-
hyl)-N,N-diisopropylphosphoramidite]
[0176] 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine (1.08
g, 1.67 mmol) was co-evaporated with toluene (20 mL). To the
residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) was
added and dried over P.sub.2O.sub.5 under high vacuum overnight at
40.degree. C. Then the reaction mixture was dissolved in anhydrous
acetonitrile (8.4 mL) and
2-cyanoethyl-N,N,N.sup.1,N.sup.1-tetraisopropylphosphoramidite
(2.12 mL, 6.08 mmol) was added. The reaction mixture was stirred at
ambient temperature for 4 hrs under inert atmosphere. The progress
of the reaction was monitored by TLC (hexane:ethyl acetate 1:1).
The solvent was evaporated, then the residue was dissolved in ethyl
acetate (70 mL) and washed with 5% aqueous NaHCO.sub.3 (40 mL).
Ethyl acetate layer was dried over anhydrous Na.sub.2SO.sub.4 and
concentrated. Residue obtained was chromatographed (ethyl acetate
as eluent) to get 5'-O-DMT-2'-O-(2-N,N-dim-
ethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-N,N-diisopropylphos-
phoramidite] as a foam (1.04 g, 74.9%).
2'-(Aminooxyethoxy)nucleoside amidites
[0177] 2'-(Aminooxyethoxy)nucleoside amidites [also known in the
art as 2'-O-(aminooxyethyl)nucleoside amidites] are prepared as
described in the following paragraphs. Adenosine, cytidine and
thymidine nucleoside amidites are prepared similarly.
N2-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimeth-
oxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite]
[0178] The 2'-O-aminooxyethyl guanosine analog may be obtained by
selective 2'-O-alkylation of diaminopurine riboside. Multigram
quantities of diaminopurine riboside may be purchased from Schering
AG (Berlin) to provide 2'-O-(2-ethylacetyl)diaminopurine riboside
along with a minor amount of the 3'-O-isomer.
2'-O-(2-ethylacetyl)diaminopurine riboside may be resolved and
converted to 2'-O-(2-ethylacetyl)guanosine by treatment with
adenosine deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C.
J., WO 94/02501 A1 940203.) Standard protection procedures should
afford 2'-O-(2-ethylacetyl)-5'-O-(4,4'-dimethoxytrityl)guanosine
and
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-dime-
thoxytrityl)guanosine which may be reduced to provide
2-N-isobutyryl-6-O-diphenylcarbamoyl-2'-O-(2-hydroxyethyl)-5'-O-(4,4'-dim-
ethoxytrityl)guanosine. As before the hydroxyl group may be
displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the
protected nucleoside may phosphitylated as usual to yield
2-N-isobutyryl-6-O-diphen-
ylcarbamoyl-2'-O-([2-phthalmidoxy]ethyl)-5'-O-(4,4'-dimethoxytrityl)guanos-
ine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite].
2'-dimethylaminoethoxyethoxy(2'-DMAEOE)nucleoside amidites
[0179] 2'-dimethylaminoethoxyethoxy nucleoside amidites (also known
in the art as 2'-O-dimethylaminoethoxyethyl, i.e.,
2'-O--CH.sub.2--O--CH.sub.2--- N(CH.sub.2).sub.2, or 2'-DMAEOE
nucleoside amidites) are prepared as follows. Other nucleoside
amidites are prepared similarly.
2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine
[0180] 2[2-(Dimethylamino)ethoxy]ethanol (Aldrich, 6.66 g, 50 mmol)
is slowly added to a solution of borane in tetra-hydrofuran (1 M,
10 mL, 10 mmol) with stirring in a 100 mL bomb. Hydrogen gas
evolves as the solid dissolves.
O.sup.2--,2'-anhydro-5-methyluridine (1.2 g, 5 mmol), and sodium
bicarbonate (2.5 mg) are added and the bomb is sealed, placed in an
oil bath and heated to 155.degree. C. for 26 hours. The bomb is
cooled to room temperature and opened. The crude solution is
concentrated and the residue partitioned between water (200 mL) and
hexanes (200 mL). The excess phenol is extracted into the hexane
layer. The aqueous layer is extracted with ethyl acetate
(3.times.200 mL) and the combined organic layers are washed once
with water, dried over anhydrous sodium sulfate and concentrated.
The residue is columned on silica gel using methanol/methylene
chloride 1:20 (which has 2% triethylamine) as the eluent. As the
column fractions are concentrated a colorless solid forms which is
collected to give the title compound as a white solid.
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methyl
uridine
[0181] To 0.5 g (1.3 mmol) of
2'-O-[2(2-N,N-dimethylamino-ethoxy)ethyl)]-5- -methyl uridine in
anhydrous pyridine (8 mL), triethylamine (0.36 mL) and
dimethoxytrityl chloride (DMT-Cl, 0.87 g, 2 eq.) are added and
stirred for 1 hour. The reaction mixture is poured into water (200
mL) and extracted with CH.sub.2Cl.sub.2 (2.times.200 mL). The
combined CH.sub.2Cl.sub.2 layers are washed with saturated
NaHCO.sub.3 solution, followed by saturated NaCl solution and dried
over anhydrous sodium sulfate. Evaporation of the solvent followed
by silica gel chromatography using MeOH:CH.sub.2Cl.sub.2:Et.sub.3N
(20:1, v/v, with 1% triethylamine) gives the title compound.
5'-O-Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl
uridine-3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite
[0182] Diisopropylaminotetrazolide (0.6 g) and
2-cyanoethoxy-N,N-diisoprop- yl phosphoramidite (1.1 mL, 2 eq.) are
added to a solution of
5'-O-dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl)]-5-methylur-
idine (2.17 g, 3 mmol) dissolved in CH.sub.2Cl.sub.2 (20 mL) under
an atmosphere of argon. The reaction mixture is stirred overnight
and the solvent evaporated. The resulting residue is purified by
silica gel flash column chromatography with ethyl acetate as the
eluent to give the title compound.
Example 2
Oligonucleotide Synthesis
[0183] Unsubstituted and substituted phosphodiester (P.dbd.O)
oligonucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine.
[0184] Phosphorothioates (P.dbd.S) are synthesized as for the
phosphodiester oligonucleotides except the standard oxidation
bottle was replaced by 0.2 M solution of 3H-1,2-benzodithiole-3-one
1,1-dioxide in acetonitrile for the stepwise thiation of the
phosphite linkages. The thiation wait step was increased to 68 sec
and was followed by the capping step. After cleavage from the CPG
column and deblocking in concentrated ammonium hydroxide at
55.degree. C. (18 h), the oligonucleotides were purified by
precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl
solution.
[0185] Phosphinate oligonucleotides are prepared as described in
U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0186] Alkyl phosphonate oligonucleotides are prepared as described
in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0187] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are
prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050,
herein incorporated by reference.
[0188] Phosphoramidite oligonucleotides are prepared as described
in U.S. Pat. No., 5,256,775 or U.S. Pat. No. 5,366,878, herein
incorporated by reference.
[0189] Alkylphosphonothioate oligonucleotides are prepared as
described in published PCT applications PCT/US94/00902 and
PCT/US93/06976 (published as WO 94/17093 and WO 94/02499,
respectively), herein incorporated by reference.
[0190] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are
prepared as described in U.S. Pat. No. 5,476,925, herein
incorporated by reference.
[0191] Phosphotriester oligonucleotides are prepared as described
in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0192] Borano phosphate oligonucleotides are prepared as described
in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated
by reference.
Example 3
Oligonucleoside Synthesis
[0193] Methylenemethylimino linked oligonucleosides, also
identified as MMI linked oligonucleosides,
methylenedimethyl-hydrazo linked oligonucleosides, also identified
as MDH linked oligonucleosides, and methylenecarbonylamino linked
oligonucleosides, also identified as amide-3 linked
oligonucleosides, and methyleneaminocarbonyl linked
oligonucleosides, also identified as amide-4 linked
oligonucleosides, as well as mixed backbone compounds having, for
instance, alternating MMI and P.dbd.O or P.dbd.S linkages are
prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein
incorporated by reference.
[0194] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564,
herein incorporated by reference.
[0195] Ethylene oxide linked oligonucleosides are prepared as
described in U.S. Pat. No. 5,223,618, herein incorporated by
reference.
Example 4
PNA Synthesis
[0196] Peptide nucleic acids (PNAs) are prepared in accordance with
any of the various procedures referred to in Peptide Nucleic Acids
(PNA): Synthesis, Properties and Potential Applications, Bioorganic
& Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared
in accordance with U.S. Pat. Nos. 5,539,082, 5,700,922, and
5,719,262, herein incorporated by reference.
Example 5
Synthesis of Chimeric Oligonucleotides
[0197] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of
several different types. These include a first type wherein the
"gap" segment of linked nucleosides is positioned between 5'and 3'
"wing" segments of linked nucleosides and a second "open end" type
wherein the "gap" segment is located at either the 3' or the 5'
terminus of the oligomeric compound. Oligonucleotides of the first
type are also known in the art as "gapmers" or gapped
oligonucleotides. Oligonucleotides of the second type are also
known in the art as "hemimers" or "wingmers".
[2'-O-Me]-[2'-deoxy]-[2'-O-Me]Chimeric Phosphorothioate
Oligonucleotides
[0198] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate
and 2'-deoxy phosphorothioate oligonucleotide segments are
synthesized using an Applied Biosystems automated DNA synthesizer
Model 380B, as above. Oligonucleotides are synthesized using the
automated synthesizer and
2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA
portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for
5' and 3' wings. The standard synthesis cycle is modified by
increasing the wait step after the delivery of tetrazole and base
to 600 s repeated four times for RNA and twice for 2'-O-methyl. The
fully protected oligonucleotide is cleaved from the support and the
phosphate group is deprotected in 3:1 ammonia/ethanol at room
temperature overnight then lyophilized to dryness. Treatment in
methanolic ammonia for 24 hrs at room temperature is then done to
deprotect all bases and sample was again lyophilized to dryness.
The pellet is resuspended in 1M TBAF in THF for 24 hrs at room
temperature to deprotect the 2' positions. The reaction is then
quenched with 1M TEAA and the sample is then reduced to 1/2 volume
by rotovac before being desalted on a G25 size exclusion column.
The oligo recovered is then analyzed spectrophotometrically for
yield and for purity by capillary electrophoresis and by mass
spectrometry.
[2'-O-(2-Methoxyethyl)]-[2'-deoxy]-[2'-O-(Methoxyethyl)]Chimeric
Phosphorothioate Oligonucleotides
[0199]
[2'-O-(2-methoxyethyl)]-[2'-deoxy]-[-2'-O-(methoxyethyl)]chimeric
phosphorothioate oligonucleotides were prepared as per the
procedure above for the 2'-O-methyl chimeric oligonucleotide, with
the substitution of 2'-O-(methoxyethyl)amidites for the 2'-O-methyl
amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]-[2'-deoxy
Phosphorothioate]-[2'-O-(2- -Methoxyethyl)Phosphodiester]Chimeric
Oligonucleotides
[0200] [2'-O-(2-methoxyethyl phosphodiester]-[2'-deoxy
phosphorothioate]-[2'-O-(methoxyethyl)phosphodiester]chimeric
oligonucleotides are prepared as per the above procedure for the
2'-O-methyl chimeric oligonucleotide with the substitution of
2'-O-(methoxyethyl)amidites for the 2'-O-methyl amidites,
oxidization with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric
structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one
1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate
internucleotide linkages for the center gap.
[0201] Other chimeric oligonucleotides, chimeric oligonucleosides
and mixed chimeric oligonucleotides/oligonucleosides are
synthesized according to U.S. Pat. No. 5,623,065, herein
incorporated by reference.
Example 6
Oligonucleotide Isolation
[0202] After cleavage from the controlled pore glass column
(Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides or
oligonucleosides are purified by precipitation twice out of 0.5 M
NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were
analyzed by polyacrylamide gel electrophoresis on denaturing gels
and judged to be at least 85% full length material. The relative
amounts of phosphorothioate and phosphodiester linkages obtained in
synthesis were periodically checked by .sup.31P nuclear magnetic
resonance spectroscopy, and for some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem.
1991, 266, 18162-18171. Results obtained with HPLC-purified
material were similar to those obtained with non-HPLC purified
material.
Example 7
Oligonucleotide Synthesis--96 Well Plate Format
[0203] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of
assembling 96 sequences simultaneously in a standard 96 well
format. Phosphodiester internucleotide linkages were afforded by
oxidation with aqueous iodine. Phosphorothioate internucleotide
linkages were generated by sulfurization utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous
acetonitrile. Standard base-protected beta-cyanoethyldiisopropyl
phosphoramidites were purchased from commercial vendors (e.g.
PE-Applied Biosystems, Foster City, Calif., or Pharmacia,
Piscataway, N.J.). Non-standard nucleosides are synthesized as per
known literature or patented methods. They are utilized as base
protected beta-cyanoethyldiisopropyl phosphoramidites.
[0204] Oligonucleotides were cleaved from support and deprotected
with concentrated NH.sub.4OH at elevated temperature (55-60.degree.
C.) for 12-16 hours and the released product then dried in vacuo.
The dried product was then re-suspended in sterile water to afford
a master plate from which all analytical and test plate samples are
then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis--96 Well Plate Format
[0205] The concentration of oligonucleotide in each well was
assessed by dilution of samples and UV absorption spectroscopy. The
full-length integrity of the individual products was evaluated by
capillary electrophoresis (CE) in either the 96 well format
(Beckman P/ACE.TM. MDQ) or, for individually prepared samples, on a
commercial CE apparatus (e.g., Beckman P/ACE.TM. 5000, ABI 270).
Base and backbone composition was confirmed by mass analysis of the
compounds utilizing electrospray-mass spectroscopy. All assay test
plates were diluted from the master plate using single and
multi-channel robotic pipettors. Plates were judged to be
acceptable if at least 85% of the compounds on the plate were at
least 85% full length.
Example 9
Cell Culture and Oligonucleotide Treatment
[0206] The effect of antisense compounds on target nucleic acid
expression can be tested in any of a variety of cell types provided
that the target nucleic acid is present at measurable levels. This
can be routinely determined using, for example, PCR or Northern
blot analysis. The following 6 cell types are provided for
illustrative purposes, but other cell types can be routinely used,
provided that the target is expressed in the cell type chosen. This
can be readily determined by methods routine in the art, for
example Northern blot analysis, Ribonuclease protection assays, or
RT-PCR.
[0207] T-24 Cells:
[0208] The human transitional cell bladder carcinoma cell line T-24
was obtained from the American Type Culture Collection (ATCC)
(Manassas, Va.). T-24 cells were routinely cultured in complete
McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.)
supplemented with 10% fetal calf serum ((Invitrogen Corporation,
Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin
100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 7000 cells/well for use in
RT-PCR analysis.
[0209] For Northern blotting or other analysis, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0210] A549 Cells:
[0211] The human lung carcinoma cell line A549 was obtained from
the American Type Culture Collection (ATCC) (Manassas, Va.). A549
cells were routinely cultured in DMEM basal media (Invitrogen
Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf
serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100
units per mL, and streptomycin 100 micrograms per mL (Invitrogen
Corporation, Carlsbad, Calif.). Cells were routinely passaged by
trypsinization and dilution when they reached 90% confluence.
[0212] NHDF Cells:
[0213] Human neonatal dermal fibroblast (NHDF) were obtained from
the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely
maintained in Fibroblast Growth Medium (Clonetics Corporation,
Walkersville, Md.) supplemented as recommended by the supplier.
Cells were maintained for up to 10 passages as recommended by the
supplier.
[0214] HEK Cells:
[0215] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville, Md.). HEKs were routinely
maintained in Keratinocyte Growth Medium (Clonetics Corporation,
Walkersville, Md.) formulated as recommended by the supplier. Cells
were routinely maintained for up to 10 passages as recommended by
the supplier.
[0216] HuVEC Cells:
[0217] The human umbilical vein endothilial cell line HuVEC was
obtained from the American Type Culture Collection (Manassas, Va.).
HuVEC cells were routinely cultured in EBM (Clonetics Corporation
Walkersville, Md.) supplemented with SingleQuots supplements
(Clonetics Corporation, Walkersville, Md.). Cells were routinely
passaged by trypsinization and dilution when they reached 90%
confluence were maintained for up to 15 passages. Cells were seeded
into 96-well plates (Falcon-Primaria #3872) at a density of 10000
cells/well for use in RT-PCR analysis.
[0218] For Northern blotting or other analyses, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0219] b.END Cells:
[0220] The mouse brain endothelial cell line b.END was obtained
from Dr. Werner Risau at the Max Plank Instititute (Bad Nauheim,
Germany). b.END cells were routinely cultured in DMEM, high glucose
(Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10%
fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.).
Cells were routinely passaged by trypsinization and dilution when
they reached 90% confluence. Cells were seeded into 96-well plates
(Falcon-Primaria #3872) at a density of 3000 cells/well for use in
RT-PCR analysis.
[0221] For Northern blotting or other analyses, cells may be seeded
onto 100 mm or other standard tissue culture plates and treated
similarly, using appropriate volumes of medium and
oligonucleotide.
[0222] Treatment with Antisense Compounds:
[0223] When cells reached 70% confluency, they were treated with
oligonucleotide. For cells grown in 96-well plates, wells were
washed once with 100 .mu.L OPTI-ME.TM.-1 reduced-serum medium
(Invitrogen Corporation, Carlsbad, Calif.) and then treated with
130 .mu.L of OPTI-MEM.TM.-1 containing 3.75 .mu.g/mL LIPOFECTIN.TM.
(Invitrogen Corporation, Carlsbad, Calif.) and the desired
concentration of oligonucleotide. After 4-7 hours of treatment, the
medium was replaced with fresh medium. Cells were harvested 16-24
hours after oligonucleotide treatment.
[0224] The concentration of oligonucleotide used varies from cell
line to cell line. To determine the optimal oligonucleotide
concentration for a particular cell line, the cells are treated
with a positive control oligonucleotide at a range of
concentrations. For human cells the positive control
oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1,
a 2'-O-methoxyethyl gapmer (2'-O-methoxyethyls shown in bold) with
a phosphorothioate backbone which is targeted to human H-ras. For
mouse or rat cells the positive control oligonucleotide is ISIS
15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl
gapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate
backbone which is targeted to both mouse and rat c-raf. The
concentration of positive control oligonucleotide that results in
80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS
15770) mRNA is then utilized as the screening concentration for new
oligonucleotides in subsequent experiments for that cell line. If
80% inhibition is not achieved, the lowest concentration of
positive control oligonucleotide that results in 60% inhibition of
H-ras or c-raf mRNA is then utilized as the oligonucleotide
screening concentration in subsequent experiments for that cell
line. If 60% inhibition is not achieved, that particular cell line
is deemed as unsuitable for oligonucleotide transfection
experiments.
Example 10
Analysis of Oligonucleotide Inhibition of Connective Yissue Growth
Factor Expression
[0225] Antisense modulation of connective tissue growth factor
expression can be assayed in a variety of ways known in the art.
For example, connective tissue growth factor mRNA levels can be
quantitated by, e.g., Northern blot analysis, competitive
polymerase chain reaction (PCR), or real-time PCR (RT-PCR).
Real-time quantitative PCR is presently preferred. RNA analysis can
be performed on total cellular RNA or poly(A)+ mRNA. The preferred
method of RNA analysis of the present invention is the use of total
cellular RNA as described in other examples herein. Methods of RNA
isolation are taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9
and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993. Northern blot
analysis is routine in the art and is taught in, for example,
Ausubel, F. M. et al., Current Protocols in Molecular Biology,
Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996.
Real-time quantitative (PCR) can be conveniently accomplished using
the commercially available ABI PRISM.TM. 7700 Sequence Detection
System, available from PE-Applied Biosystems, Foster City, Calif.
and used according to manufacturer's instructions.
[0226] Protein levels of connective tissue growth factor can be
quantitated in a variety of ways well known in the art, such as
immunoprecipitation, Western blot analysis (immunoblotting), ELISA
or fluorescence-activated cell sorting (FACS). Antibodies directed
to connective tissue growth factor can be identified and obtained
from a variety of sources, such as the MSRS catalog of antibodies
(Aerie Corporation, Birmingham, Mich.), or can be prepared via
conventional antibody generation methods. Methods for preparation
of polyclonal antisera are taught in, for example, Ausubel, F. M.
et al., Current Protocols in Molecular Biology, Volume 2, pp.
11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of
monoclonal antibodies is taught in, for example, Ausubel, F. M. et
al., Current Protocols in Molecular Biology, Volume 2, pp.
11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.
[0227] Immunoprecipitation methods are standard in the art and can
be found at, for example, Ausubel, F. M. et al., Current Protocols
in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley
& Sons, Inc., 1998. Western blot (immunoblot) analysis is
standard in the art and can be found at, for example, Ausubel, F.
M. et al., Current Protocols in Molecular Biology, Volume 2, pp.
10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked
immunosorbent assays (ELISA) are standard in the art and can be
found at, for example, Ausubel, F. M. et al., Current Protocols in
Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley &
Sons, Inc., 1991.
Example 11
Poly(A)+ mRNA Isolation
[0228] Poly(A)+ mRNA was isolated according to Miura et al., Clin.
Chem., 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA
isolation are taught in, for example, Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1-4.5.3,
John Wiley & Sons, Inc., 1993. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 60 .mu.L lysis buffer (10
mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM
vanadyl-ribonucleoside complex) was added to each well, the plate
was gently agitated and then incubated at room temperature for five
minutes. 55 .mu.L of lysate was transferred to Oligo d(T) coated
96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated
for 60 minutes at room temperature, washed 3 times with 200 .mu.L
of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl).
After the final wash, the plate was blotted on paper towels to
remove excess wash buffer and then air-dried for 5 minutes. 60
.mu.L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to
70.degree. C. was added to each well, the plate was incubated on a
90.degree. C. hot plate for 5 minutes, and the eluate was then
transferred to a fresh 96-well plate.
[0229] Cells grown on 100 mm or other standard plates may be
treated similarly, using appropriate volumes of all solutions.
Example 12
Total RNA Isolation
[0230] Total RNA was isolated using an RNEASY 96.TM. kit and
buffers purchased from Qiagen Inc. (Valencia, Calif.) following the
manufacturer's recommended procedures. Briefly, for cells grown on
96-well plates, growth medium was removed from the cells and each
well was washed with 200 .mu.L cold PBS. 150 .mu.L Buffer RLT was
added to each well and the plate vigorously agitated for 20
seconds. 150 .mu.L of 70% ethanol was then added to each well and
the contents mixed by pipetting three times up and down. The
samples were then transferred to the RNEASY .sub.96.TM. well plate
attached to a QIAVAC.TM. manifold fitted with a waste collection
tray and attached to a vacuum source. Vacuum was applied for 1
minute. 500 .mu.L of Buffer RW1 was added to each well of the
RNEASY 96.TM. plate and incubated for 15 minutes and the vacuum was
again applied for 1 minute. An additional 500 .mu.L of Buffer RW1
was added to each well of the RNEASY 96.TM. plate and the vacuum
was applied for 2 minutes. 1 mL of Buffer RPE was then added to
each well of the RNEASY .sub.96.TM. plate and the vacuum applied
for a period of 90 seconds. The Buffer RPE wash was then repeated
and the vacuum was applied for an additional 3 minutes. The plate
was then removed from the QIAVAC.TM. manifold and blotted dry on
paper towels. The plate was then re-attached to the QIAVAC.TM.
manifold fitted with a collection tube rack containing 1.2 mL
collection tubes. RNA was then eluted by pipetting 170 .mu.L water
into each well, incubating 1 minute, and then applying the vacuum
for 3 minutes.
[0231] The repetitive pipetting and elution steps may be automated
using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.).
Essentially, after lysing of the cells on the culture plate, the
plate is transferred to the robot deck where the pipetting, DNase
treatment and elution steps are carried out.
Example 13
Real-Time Quantitative PCR Analysis of Connective Tissue Growth
Factor mRNA Levels
[0232] Quantitation of connective tissue growth factor mRNA levels
was determined by real-time quantitative PCR using the ABI
PRISM.TM. 7700 Sequence Detection System (PE-Applied Biosystems,
Foster City, Calif.) according to manufacturer's instructions. This
is a closed-tube, non-gel-based, fluorescence detection system
which allows high-throughput quantitation of polymerase chain
reaction (PCR) products in real-time. As opposed to standard PCR,
in which amplification products are quantitated after the PCR is
completed, products in real-time quantitative PCR are quantitated
as they accumulate. This is accomplished by including in the PCR
reaction an oligonucleotide probe that anneals specifically between
the forward and reverse PCR primers, and contains two fluorescent
dyes. A reporter dye (e.g., FAM, obtained from either Operon
Technologies Inc., Alameda, Calif. or Integrated DNA Technologies
Inc., Coralville, Iowa) is attached to the 5' end of the probe and
a quencher dye (e.g., TAMRA, obtained from either Operon
Technologies Inc., Alameda, Calif. or Integrated DNA Technologies
Inc., Coralville, Iowa) is attached to the 3' end of the probe.
When the probe and dyes are intact, reporter dye emission is
quenched by the proximity of the 3' quencher dye. During
amplification, annealing of the probe to the target sequence
creates a substrate that can be cleaved by the 5'-exonuclease
activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase
releases the reporter dye from the remainder of the probe (and
hence from the quencher moiety) and a sequence-specific fluorescent
signal is generated. With each cycle, additional reporter dye
molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular intervals by laser
optics built into the ABI PRISM.TM. 7700 Sequence Detection System.
In each assay, a series of parallel reactions containing serial
dilutions of mRNA from untreated control samples generates a
standard curve that is used to quantitate the percent inhibition
after antisense oligonucleotide treatment of test samples.
[0233] Prior to quantitative PCR analysis, primer-probe sets
specific to the target gene being measured are evaluated for their
ability to be "multiplexed" with a GAPDH amplification reaction. In
multiplexing, both the target gene and the internal standard gene
GAPDH are amplified concurrently in a single sample. In this
analysis, MRNA isolated from untreated cells is serially diluted.
Each dilution is amplified in the presence of primer-probe sets
specific for GAPDH only, target gene only ("single-plexing"), or
both (multiplexing). Following PCR amplification, standard curves
of GAPDH and target mRNA signal as a function of dilution are
generated from both the single-plexed and multiplexed samples. If
both the slope and correlation coefficient of the GAPDH and target
signals generated from the multiplexed samples fall within 10% of
their corresponding values generated from the single-plexed
samples, the primer-probe set specific for that target is deemed
multiplexable. Other methods of PCR are also known in the art.
[0234] PCR reagents were obtained from Invitrogen, Carlsbad, Calif.
RT-PCR reactions were carried out by adding 20 .mu.L PCR cocktail
(2.5.times.PCR buffer (--MgCl2), 6.6 mM MgCl2, 375 .mu.M each of
dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and
reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25
Units PLATINUM.RTM. Taq, 5 Units MuLV reverse transcriptase, and
2.5.times.ROX dye) to 96 well plates containing 30 .mu.L total RNA
solution. The RT reaction was carried out by incubation for 30
minutes at 48.degree. C. Following a 10 minute incubation at
95.degree. C. to activate the PLATINUM.RTM. Taq, 40 cycles of a
two-step PCR protocol were carried out: 95.degree. C. for 15
seconds (denaturation) followed by 60.degree. C. for 1.5 minutes
(annealing/extension).
[0235] Gene target quantities obtained by real time RT-PCR are
normalized using either the expression level of GAPDH, a gene whose
expression is constant, or by quantifying total RNA using
RiboGreen.TM. (Molecular Probes, Inc. Eugene, Oreg.). GAPDH
expression is quantified by real time RT-PCR, by being run
simultaneously with the target, multiplexing, or separately. Total
RNA is quantified using RiboGreen.TM. RNA quantification reagent
from Molecular Probes. Methods of RNA quantification by
RiboGreen.TM. are taught in Jones, L. J., et al, Analytical
Biochemistry, 1998, 265, 368-374.
[0236] In this assay, 170 .mu.L of RiboGreen.TM. working reagent
(RiboGreen.TM. reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA,
pH 7.5) is pipetted into a 96-well plate containing 30 .mu.L
purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE
Applied Biosystems) with excitation at 480 nm and emission at 520
nm.
[0237] Probes and primers to human connective tissue growth factor
were designed to hybridize to a human connective tissue growth
factor sequence, using published sequence information (GenBank
accession number M92934.1, incorporated herein as SEQ ID NO:3). For
human connective tissue growth factor the PCR primers were:
[0238] forward primer: ACAAGGGCCTCTTCTGTGACTT (SEQ ID NO: 4)
[0239] reverse primer: GGTACACCGTACCACCGAAGAT (SEQ ID NO: 5) and
the
[0240] PCR probe was: FAM-TGTGCACCGCCAAAGATGGTGCT-TAMRA
[0241] (SEQ ID NO: 6) where FAM (PE-Applied Biosystems, Foster
City, Calif.) is the fluorescent reporter dye) and TAMRA
(PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.
For human GAPDH the PCR primers were:
[0242] forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO:7)
[0243] reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO:8) and
the
[0244] PCR probe was: 5' JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID
NO: 9) where JOE (PE-Applied Biosystems, Foster City, Calif.) is
the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems,
Foster City, Calif.) is the quencher dye.
[0245] Probes and primers to mouse connective tissue growth factor
were designed to hybridize to a mouse connective tissue growth
factor sequence, using published sequence information (GenBank
accession number BC006783.1, incorporated herein as SEQ ID NO:10).
For mouse connective tissue growth factor the PCR primers were:
[0246] forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO:11)
[0247] reverse primer: GCCCCCCACCCCAAA (SEQ ID NO: 12) and the
PCR
[0248] probe was: FAM-TCATAATCAAAGAAGCAGCAAGCACTTCCTG-TAMRA
[0249] (SEQ ID NO: 13) where FAM (PE-Applied Biosystems, Foster
City, Calif.) is the fluorescent reporter dye) and TAMRA
(PE-Applied Biosystems, Foster City, Calif.) is the quencher dye.
For mouse GAPDH the PCR primers were:
[0250] forward primer: GGCAAATTCAACGGCACAGT (SEQ ID NO:14)
[0251] reverse primer: GGGTCTCGCTCCTGGAAGAT (SEQ ID NO:15) and
the
[0252] PCR probe was: 5' JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3'
(SEQ ID NO: 16) where JOE (PE-Applied Biosystems, Foster City,
Calif.) is the fluorescent reporter dye) and TAMRA (PE-Applied
Biosystems, Foster City, Calif.) is the quencher dye.
Example 14
Northern Blot Analysis of Connective Tissue Growth Factor mRNA
Levels
[0253] Eighteen hours after antisense treatment, cell monolayers
were washed twice with cold PBS and lysed in 1 mL RNAZOL.TM.
(TEL-TEST "B" Inc., Friendswood, Tex.). Total RNA was prepared
following manufacturer's recommended protocols. Twenty micrograms
of total RNA was fractionated by electrophoresis through 1.2%
agarose gels containing 1.1% formaldehyde using a MOPS buffer
system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the
gel to HYBOND.TM.-N+ nylon membranes (Amersham Pharmacia Biotech,
Piscataway, N.J.) by overnight capillary transfer using a
Northern/Southern Transfer buffer system (TEL-TEST "B" Inc.,
Friendswood, Tex.). RNA transfer was confirmed by UV visualization.
Membranes were fixed by UV cross-linking using a STRATALINKER.TM.
UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then
probed using QUICKHYB.TM. hybridization solution (Stratagene, La
Jolla, Calif.) using manufacturer's recommendations for stringent
conditions.
[0254] To detect human connective tissue growth factor, a human
connective tissue growth factor specific probe was prepared by PCR
using the forward primer ACAAGGGCCTCTTCTGTGACTT (SEQ ID NO: 4) and
the reverse primer GGTACACCGTACCACCGAAGAT (SEQ ID NO: 5). To
normalize for variations in loading and transfer efficiency
membranes were stripped and probed for human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech,
Palo Alto, Calif.).
[0255] To detect mouse connective tissue growth factor, a mouse
connective tissue growth factor specific probe was prepared by PCR
using the forward primer GCTCAGGGTAAGGTCCGATTC (SEQ ID NO: 11) and
the reverse primer GCCCCCCACCCCAAA (SEQ ID NO: 12). To normalize
for variations in loading and transfer efficiency membranes were
stripped and probed for mouse glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0256] Hybridized membranes were visualized and quantitated using a
PHOSPHORIMAGER.TM. and IMAGEQUANT.TM. Software V3.3 (Molecular
Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels
in untreated controls.
Example 15
Antisense Inhibition of Human Connective Tissue Growth Factor
Expression by Chimeric Phosphorothioate Oligonucleotides Having
2'-MOE Wings and a Deoxy Gap
[0257] In accordance with the present invention, a series of
oligonucleotides were designed to target different regions of the
human connective tissue growth factor RNA, using published
sequences (GenBank accession number M92934.1, incorporated herein
as SEQ ID NO: 3, GenBank accession number X8947.1, incorporated
herein as SEQ ID NO: 17, GenBank accession number
XM.sub.13037055.1, incorporated herein as SEQ ID NO: 18, and
GenBank accession number XM.sub.13037056.1, incorporated herein as
SEQ ID NO: 19). The oligonucleotides are shown in Table 1. "Target
site" indicates the first (5'-most) nucleotide number on the
particular target sequence to which the oligonucleotide binds. All
compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20
nucleotides in length, composed of a central "gap" region
consisting of ten 2'-deoxynucleotides, which is flanked on both
sides (5' and 3' directions) by five-nucleotide "wings". The wings
are composed of 2'-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All cytidine residues are
5-methylcytidines. The compounds were analyzed for their effect on
human connective tissue growth factor mRNA levels by quantitative
real-time PCR as described in other examples herein. Data are
averages from two experiments. If present, "N.D." indicates "no
data".
1TABLE 1 Inhibition of human connective tissue growth factor mRNA
levels by chimeric phosphorothioate oligonucleotides having 2'-MOE
wings and a deoxy gap TARGET TARGET % SEQ ISIS # REGION SEQ ID NO
SITE SEQUENCE INHIB ID NO 100880 Coding 3 707 gcagttggctctaatcatag
0 20 100883 Coding 3 828 tgaccatgcacaggcggctc 12 21 100885 Coding 3
917 ctcaaacttgataggcttgg 18 22 100886 Coding 3 956
tttagctcggtatgtcttca 0 23 100888 Coding 3 1028 cttgaactccaccggcaggg
28 24 100889 Coding 3 1076 ggtcttgatgaacatcatgt 40 25 100890 Coding
3 1098 gacagttgtaatggcaggca 23 26 100891 Coding 3 1147
ccgtacatcttcctgtagta 31 27 124173 Coding 18 304
ccagctgcttggcgcagacg 80 28 124183 Coding 18 718
tctggaccaggcagttggct 12 29 124184 Coding 18 723
tgtggtctggaccaggcagt 1 30 124185 Coding 18 728 cactctgtggtctggaccag
16 31 124188 Coding 18 882 gatgcactttttgcccttct 0 32 124189 Coding
18 927 gccagaaagctcaaacttga 77 33 124190 Coding 18 932
gtgcagccagaaagctcaaa 37 34 124196 Coding 18 1079
caggtcttgatgaacatcat 33 35 124197 Coding 18 1084
aggcacaggtcttgatgaac 53 36 124198 Coding 18 1089
atggcaggcacaggtcttga 9 37 124199 Coding 18 1098
acagttgtaatggcaggcac 72 38 124212 3'UTR 18 1707
ccacaagctgtccagtctaa 66 39 124213 3'UTR 18 1712
acttgccacaagctgtccag 1 40 124215 3'UTR 18 1815 ttaacttagataactgtaca
79 41 124216 3'UTR 18 1820 ttaaattaacttagataact 0 42 124230 3'UTR
19 2098 ttaataaaggccatttgttc 0 43 124234 3'UTR 19 2198
cactctcaacaaataaactg 14 44 124235 3'UTR 19 2203
ggtcacactctcaacaaata 87 45 124236 3'UTR 19 2208
cttttggtcacactctcaac 35 46 124237 3'UTR 19 2213
tgtaacttttggtcacactc 35 47 124238 3'UTR 19 2218
aaacatgtaacttttggtca 89 48 124239 3'UTR 19 2242
ctttattttcaactagaaag 0 49 144294 Coding 18 303 cagctgcttggcgcagacgc
30 50 144305 Coding 18 622 ccttgggctcgtcacacacc 0 51 144311 Coding
18 725 tctgtggtctggaccaggca 49 52 144314 Coding 18 929
cagccagaaagctcaaactt 0 53 144315 Coding 18 935 ctggtgcagccagaaagctc
0 54 144319 Coding 18 1080 acaggtcttgatgaacatca 0 55 144320 Coding
18 1086 gcaggcacaggtcttgatga 0 56 144321 Coding 18 1091
taatggcaggcacaggtctt 0 57 144323 Coding 18 1156
ccatgtctccgtacatcttc 28 58 144336 3'UTR 18 1711
cttgccacaagctgtccagt 1 59 144337 3'UTR 18 1740 aaaaatctggcttgttacag
0 60 144338 3'UTR 18 1822 ctttaaattaacttagataa 0 61 144345 3'UTR 19
2206 tttggtcacactctcaacaa 38 62 144346 3'UTR 19 2212
gtaacttttggtcacactct 36 63 144347 3'UTR 19 2219
caaacatgtaacttttggtc 24 64 144348 3'UTR 19 2243
actttattttcaactagaaa 0 65 144802 Start 3 120 cggcggtcatggttggcact 0
66 Codon 144803 Start 3 130 cccatactggcggcggtcat 0 67 Codon 144804
Coding 17 284 ccgtccagcacgaggctcac 49 68 144805 Coding 17 367
agaggcccttgtgcgggtcg 0 69 144806 Coding 17 383 gagccgaagtcacagaagag
68 70 144807 Coding 17 473 aaggactctccgctgcggta 0 71 144808 Coding
3 487 cacgtgcactggtacttgca 45 72 144809 Coding 17 611
tcgcagcatttcccgggcag 79 73 144810 Coding 17 615
ctcctcgcagcatttcccgg 7 74 144811 Coding 17 633 gggctcgtcacacacccact
17 75 144812 Coding 17 699 gtctgggccaaacgtgtctt 0 76 144813 Coding
3 698 tctaatcatagttgggtctg 6 77 144814 Coding 17 729
gaccaggcagttggctctaa 0 78 144815 Coding 17 819 ctctagcctgcaggaggcgt
0 79 144816 Coding 17 875 atgttctcttccaggtcagc 0 80 144817 Coding
17 915 ggagattttgggagtacgga 51 81 144818 Coding 17 926
ttgataggcttggagatttt 1 82 144820 Coding 17 979 cacagaatttagctcggtat
0 83 144822 Coding 3 981 ggccgtcggtacatactcca 0 84 144824 Coding 17
1037 tccaccggcagggtggtggt 16 85 144826 Coding 17 1051
cagggcacttgaactccacc 41 86 144828 Coding 17 1055
ccgtcagggcacttgaactc 0 87 144830 Coding 17 1115
ggacagttgtaatggcaggc 39 88 144833 Coding 17 1149
gtagtacagcgattcaaaga 13 89 144835 Stop 3 1167 tctggcttcatgccatgtct
37 90 Codon 144837 Stop 3 1177 tctctcactctctggcttca 25 91 Codon
144839 3'UTR 3 1229 tacggaaaaatgagatgtga 41 92 144841 3'UTR 3 1261
atttaaataacttgtgctac 0 93 144843 3'UTR 3 1358 ttcttcaaaccagtgtctgg
0 94 144845 3'UTR 3 1537 cagtgagcacgctaaaattt 72 95 144847 3'UTR 3
1621 gttctgacttaaggaacaac 0 96 144849 3'UTR 3 1697
gctgtccagtctaatcgaca 52 97
[0258] As shown in Table 1, SEQ ID NOs 24, 25, 27, 28, 33, 34, 35,
36, 38, 39, 41, 45, 46, 47, 48, 50, 52, 58, 62, 63, 64, 68, 70, 72,
73, 81, 86, 88, 90, 91, 92, 95 and 97 demonstrated at least 24%
inhibition of human connective tissue growth factor expression in
this assay and are therefore preferred. The target sites to which
these preferred sequences are complementary are herein referred to
as "active sites" and are therefore preferred sites for targeting
by compounds of the present invention.
Example 16
Antisense Inhibition of Mouse Connective Tissue Growth Factor
Expression by Chimeric Phosphorothioate Oligonucleotides Having
2'-MOE Wings and a Deoxy Gap
[0259] In accordance with the present invention, a second series of
oligonucleotides were designed to target different regions of the
mouse connective tissue growth factor RNA, using published
sequences (GenBank accession number BC006783.1, incorporated herein
as SEQ ID NO: 10, and GenBank accession number M80263.1,
incorporated herein as SEQ ID NO: 98). The oligonucleotides are
shown in Table 2. "Target site" indicates the first (5'-most)
nucleotide number on the particular target sequence to which the
oligonucleotide binds. All compounds in Table 2 are chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings". The wings are composed of 2'-methoxyethyl
(2'-MOE)nucleotides. The internucleoside (backbone) linkages are
phosphorothioate (P.dbd.S) throughout the oligonucleotide. All
cytidine residues are 5-methylcytidines. The compounds were
analyzed for their effect on mouse connective tissue growth factor
mRNA levels by quantitative real-time PCR as described in other
examples herein. Data are averages from two experiments. If
present, "N.D." indicates "no data".
2TABLE 2 Inhibition of mouse connective tissue growth factor mRNA
levels by chimeric phosphorothioate oligonucleotides having 2'-MOE
wings and a deoxy gap TARGET TARGET % SEQ ISIS # REGION SEQ ID NO
SITE SEQUENCE INHIB ID NO 100891 Coding 10 1220
ccgtacatcttcctgtagta 78 27 124173 Coding 98 374
ccagctgcttggcgcagacg 15 28 124183 Coding 98 788
tctggaccaggcagttggct 23 29 124184 Coding 98 793
tgtggtctggaccaggcagt 24 30 124185 Coding 98 798
cactctgtggtctggaccag 41 31 124188 Coding 98 952
gatgcactttttgcccttct 25 32 124189 Coding 98 997
gccagaaagctcaaacttga 79 33 124190 Coding 98 1002
gtgcagccagaaagctcaaa 72 34 124196 Coding 98 1149
caggtcttgatgaacatcat 12 35 124197 Coding 98 1154
aggcacaggtcttgatgaac 0 36 124198 Coding 98 1159
atggcaggcacaggtcttga 32 37 124199 Coding 98 1168
acagttgtaatggcaggcac 37 38 124212 3'UTR 98 1774
ccacaagctgtccagtctaa 80 39 124213 3'UTR 98 1779
acttgccacaagctgtccag 52 40 124215 3'UTR 98 1874
ttaacttagataactgtaca 54 41 124216 3'UTR 98 1879
ttaaattaacttagataact 24 42 124230 3'UTR 98 2131
ttaataaaggccatttgttc 3 43 124234 3'UTR 98 2235 cactctcaacaaataaactg
18 44 124235 3'UTR 98 2240 ggtcacactctcaacaaata 16 45 124236 3'UTR
98 2245 cttttggtcacactctcaac 0 46 124237 3'UTR 98 2250
tgtaacttttggtcacactc 57 47 124238 3'UTR 98 2255
aaacatgtaacttttggtca 36 48 124239 3'UTR 98 2278
ctttattttcaactagaaag 0 49 100884 Coding 10 949 actttttgcccttcttaatg
14 99 124165 5'UTR 98 88 gacgctccaggcggtggcgt 0 100 124166 5'UTR 98
93 gtctggacgctccaggcggt 0 101 124167 5'UTR 98 131
cggctggagcctggattcgg 23 102 124168 5'UTR 98 139
gagaggcgcggctggagcct 43 103 124169 5'UTR 98 177
acgcggtaggaggatgcaca 24 104 124170 Start 98 195
gaggcgagcatgatcgggac 0 105 Codon 124171 Coding 98 364
ggcgcagacgcggcagcagc 68 106 124172 Coding 98 369
tgcttggcgcagacgcggca 0 107 124174 Coding 98 418
gcccttgtgtgggtcgcagg 42 108 124175 Coding 98 431
aatcgcagaagaggcccttg 1 109 124176 Coding 98 507
accgacccaccgaagacaca 45 110 124177 Coding 98 550
ttggtatttgcagctgcttt 34 111 124178 Coding 98 583
cacgcagcccacggccccat 0 112 124179 Coding 98 605
gcacgtccatgctgcatagg 18 113 124180 Coding 98 650
gcagcttgacccttctcggg 20 114 124181 Coding 98 705
actgctgtgcggtccttggg 12 115 124182 Coding 98 741
gtgtcttccagtcggtaggc 60 116 124186 Coding 98 861
aaggtattgtcattggtaac 37 117 124187 Coding 98 884
ggctctgcttctccagtctg 5 118 124191 Coding 98 1013
tcttcacactggtgcagcca 0 119 124192 Coding 98 1049
cgtctgtgcacaccccgcag 31 120 124193 Coding 10 1068
cggtgtgcagcagcggccgt 5 121 124194 Coding 98 1092
tccactggcagagtggtggt 47 122 124195 Coding 98 1135
catcatattctttttcatga 1 123 124200 Coding 98 1183
gtcattgtccccaggacagt 33 124 124201 Stop 98 1239
tcctggctttacgccatgtc 13 125 Codon 124202 3'UTR 98 1293
aaatgagatgcaactcagtt 28 126 124203 3'UTR 98 1487
tcagtgtgcgttctggcact 38 127 124204 3'UTR 98 1504
gttccaggagactcacctca 54 128 124205 3'UTR 98 1512
tctccactgttccaggagac 1 129 124206 3'UTR 98 1522
tctcctggcatctccactgt 38 130 124207 3'UTR 98 1528
tttctttctcctggcatctc 0 131 124208 3'UTR 98 1594
tccccggttacactccaaaa 0 132 124209 3'UTR 98 1625
aggtctgtctgcaagcatgc 0 133 124210 3'UTR 98 1645
tgctcagctctcgctagagc 45 134 124211 3'UTR 98 1730
agtgtcactggaatcagaat 47 135 124214 3'UTR 98 1856
caaatatatatatatatata 42 136 124217 3'UTR 98 1902
acttaaaacaaaaacaaatg 0 137 124218 3'UTR 98 1927
gctatcagtttaaaatccca 42 138 124219 3'UTR 98 1957
gtgtcctacctatggtgttt 48 139 124220 3'UTR 98 1978
tttgaatcacagataagctt 48 140 124221 3'UTR 98 1993
cagtatctcctttgttttga 34 141 124222 3'UTR 98 2003
attcccactgcagtatctcc 44 142 124223 3'UTR 98 2012
caggtcacaattcccactgc 30 143 124224 3'UTR 98 2028
ctgacagagagtcactcagg 40 144 124225 3'UTR 98 2058
gctttatcacctgcacagca 74 145 124226 3'UTR 98 2064
tacatagctttatcacctgc 56 146 124227 3'UTR 98 2071
cttccaatacatagctttat 66 147 124228 3'UTR 98 2076
tctgacttccaatacatagc 18 148 124229 3'UTR 98 2119
atttgttcaccaacagggat 0 149 124231 3'UTR 98 2152
ttaccctgagccagccattt 14 150 124232 3'UTR 98 2188
aagaagcagcaagcacttcc 40 151 124233 3'UTR 98 2200
cagtcataatcaaagaagca 1 152 124240 3'UTR 98 2283
atatactttattttcaacta 51 153
[0260] As shown in Table 2, SEQ ID NOs 27, 30, 31, 32, 33, 34, 37,
38, 39, 40, 41, 42, 47, 48, 103, 104, 106, 108, 110, 111, 116, 117,
120, 122, 124, 126, 127, 128, 130, 134, 135, 136, 138, 139, 140,
141, 142, 143, 144, 145, 146, 147, 151 and 153 demonstrated at
least 24% inhibition of mouse connective tissue growth factor
expression in this experiment and are therefore preferred. The
target sites to which these preferred sequences are complementary
are herein referred to as "active sites" and are therefore
preferred sites for targeting by compounds of the present
invention.
Example 17
Western Blot Analysis of Connective Tissue Growth Factor Protein
Levels
[0261] Western blot analysis (immunoblot analysis) is carried out
using standard methods. Cells are harvested 16-20 h after
oligonucleotide treatment, washed once with PBS, suspended in
Laemmli buffer (100 .mu.l/well), boiled for 5 minutes and loaded on
a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and
transferred to membrane for western blotting. Appropriate primary
antibody directed to connective tissue growth factor is used, with
a radiolabelled or fluorescently labeled secondary antibody
directed against the primary antibody species. Bands are visualized
using a PHOSPHORIMAGER.TM. (Molecular Dynamics, Sunnyvale
Calif.).
Example 18
Antisense Inhibition of Connective Tissue Growth Factor in a Murine
Model of Type 1 Diabetes
[0262] The Animal Models of Diabetic Complications Consortium
(AMDCC) has developed protocols for the induction of diabetes in a
number of animal models. The streptozotocin (STZ) induced diabetic
model has been approved by the AMDCC as an appropriate model system
for studies of diabetic nephropathy associated with type 1
diabetes. In accordance with the present invention, oligomeric
compounds of the present invention were tested in the STZ-induced
model of type 1 diabetes.
[0263] C57/BL6 mice received intraperitoneal injections of STZ
daily for five days at a dose of 50 mg/kg. Blood chemistry was
monitored on days 9, 10 and 11 and urine chemistry was monitored on
days 13 and 14. Starting on day 14, diabetic mice were given
subcutaneous injections of antisense oligonucleotide ISIS 124212
(SEQ ID NO: 39) twice a week for four months (days 14-134) at a
dose of 20 mg/kg. Blood and urine chemistries were again monitored
at days 104, 134 and 136. Non-diabetic (no induction with STZ) and
saline-injected animals served as controls.
[0264] ISIS 124212 (SEQ ID NO: 39) is a chimeric oligonucleotide
("gapmer") 20 nucleotides in length, composed of a central "gap"
region consisting of ten 2'-deoxynucleotides, which is flanked on
both sides (5' and 3' directions) by five-nucleotide "wings". The
wings are composed of 2'-methoxyethyl (2'-MOE) nucleotides. The
internucleoside (backbone) linkages are phosphorothioate (P.dbd.S)
throughout the oligonucleotide. All cytidine residues are
5-methylcytidines.
[0265] Following four months of oligonucleotide treatment, mice
were sacrificed and mRNA expression levels of CTGF were determined
in four different treatment groups: non-diabetic mice injected with
saline, non-diabetic mice treated with antisense oligonucleotide,
STZ-induced diabetic mice injected with saline and STZ-induced
diabetic mice treated with antisense oligonucleotide.
[0266] CTGF target mRNA levels were determined by semiquantitative
RT-PCR according to standard procedures. PCR results were
normalized to the ubiquitously expressed mouse 18S gene. Probes and
primers to mouse CTGF were designed to hybridize to mouse CTGF
sequence using published sequence information.
[0267] STZ-induced diabetic mice injected with saline exhibited a
significant increase in CTGF expression relative to non-diabetic
mice. However, when STZ-induced diabetic mice were treated with
ISIS 124212, CTGF expression was significantly decreased. The level
of CTGF in diabetic mice treated with ISIS 124212 also was lower
than CTGF levels in non-diabetic mice with and without
oligonucleotide treatment.
[0268] Distribution of CTGF antisense oligonucleotide in the kidney
(outer cortex) of control and STZ-induced mice was assessed by 2E1
staining. Kidney samples were procured, fixed in 10%
neutral-buffered formalin and processed for staining with
anti-oligonucleotide IgG1 antibody 2E1-B5 (Berkeley Antibody
Company, Berkeley, Calif.). 2E1-B5 antibody was recognized using an
isospecific anti-IgG2 horseradish peroxidase-conjugated secondary
antibody (Zymed, San Francisco, Calif.) and immunostaining was
developed with 3,3'-diaminobenzidene (DAKO, Carpenteria, Calif.).
The results demonstrated that ISIS 124212 exhibited a similar
pattern of distribution in the outer cortex of STZ-induced and
non-induced mice.
[0269] Mice were further evaluated for blood glucose levels (Table
3) and body weight (Table 4). Measurements of blood glucose were
taken at week 8 and week 16 and body weight was determined at week
0 and week 16.
3TABLE 3 Average blood glucose levels in mg/dl (.+-.S.D.) of
STZ-induced diabetic mice treated with CTGF antisense
oligonucleotide Diabetic Status Treatment Week 8 Week 16 Control
Saline 127.8 .+-. 11.7 128.4 .+-. 18.0 Control ISIS 124212 108.2
.+-. 21.3 141.2 .+-. 19.4 STZ-induced Saline 470.5 .+-. 85.6 516.8
.+-. 97.4 STZ-induced ISIS 124212 381.3 .+-. 137.5 474.1 .+-.
148.2
[0270]
4TABLE 4 Average body weight in grams (.+-.S.D.) of STZ-induced
diabetic mice treated with CTGF antisense oligonucleotide Diabetic
Status Treatment Week 8 Week 16 Control Saline 24.6 .+-. 1.7 30.2
.+-. 1.8 Control ISIS 124212 29.0 .+-. 1.0 32.2 .+-. 1.1
STZ-induced Saline 22.2 .+-. 1.1 25.8 .+-. 1.8 STZ-induced ISIS
124212 23.1 .+-. 2.6 26.2 .+-. 2.3
[0271] As is expected for diabetic mice, STZ-induction
significantly increased blood glucose levels. Treatment with ISIS
124212 in diabetic mice resulted in slightly lower average blood
glucose levels; however, the reduction was not significant. Body
weight was unaffected by both STZ-induction and antisense
treatment. Since CTGF is activated downstream of high glucose
levels, CTGF was not expected to alter blood glucose levels or body
weight in this model.
[0272] These results validate the use of CTGF antisense
oligonucleotides for the reduction of CTGF mRNA expression in a
mouse model of type 1 diabetes.
Example 19
Inhibition of the Development of Diabetic Nephropathy by Treatment
with CTGF Antisense Oligonucleotides
[0273] To evaluate whether antisense inhibition of CTGF alters the
development of diabetic nephropathy, a series of experiments were
performed to assess signs of the disease as well as quantitate
CTGF-regulated genes and proteins involved in the development of
diabetic nephropathy. For each experiment, four different treatment
groups were used: non-diabetic mice injected with saline,
non-diabetic mice treated with antisense oligonucleotide,
STZ-induced diabetic mice injected with saline and STZ-induced
diabetic mice treated with antisense oligonucleotide.
[0274] Toxic effects of compounds administered in vivo can be
assessed by measuring the levels of enzymes and proteins associated
with disease or injury of the liver or kidney. In accordance with
the present invention, levels of albumin and urine protein were
measured in STZ-induced diabetic mice and control mice treated with
the compounds of the invention. Serum was analyzed by LabCorp
Testing Facility (San Diego, Calif.). Levels of albumin and urine
protein were normalized to urine creatinine.
5TABLE 5 Average levels of albumin and urine protein in STZ-induced
diabetic mice treated with CTGF antisense oligonucleotide (values
normalized to urine creatinine) Albumin Urine protein Diabetic
Status Treatment (.mu.g) (mg/24 h) Control Saline 13 27 Control
ISIS 124212 25 27 STZ-induced Saline 42 58 STZ-induced ISIS 124212
17 30
[0275] The results demonstrate that treatment of STZ-induced
diabetic mice with ISIS 124212 significantly decreases levels of
albumin and urine protein relative to saline-injected diabetic
mice.
[0276] Another marker of diabetic nephropathy is expansion of the
mesangial matrix. STZ-induced diabetic mice and control mice
treated with CTGF antisense oligonucleotide were evaluated for
mesangial matrix expansion using Periodic Acid Schiff (PAS)
staining according to standard procedures. Samples were evaluated
by image analyses software. STZ-induced diabetic mice treated with
ISIS 124212 exhibited less mesangial matrix expansion than saline
control mice, indicating that CTGF antisense treatment inhibits the
development of diabetic nephropathy.
[0277] CTGF has been shown to mediate TGF-beta stimulation of
collagen synthesis and anchorage-independent growth of fibroblasts,
suggesting that CTGF is a potential target for inhibiting fibrosis.
Therefore, CTGF antisense oligonucleotides were evaluated for their
ability to inhibit expression of TGF-beta in STZ-induced diabetic
mice.
[0278] TGF-beta-1 target mRNA levels were determined by
quantitative real-time PCR as described by other examples herein.
PCR results were normalized to the ubiquitously expressed mouse 18S
gene. Probes and primers to mouse TGF-beta-1 were designed to
hybridize to mouse TGF-beta-1 sequence using published sequence
information. For mouse TGF-beta-1, the PCR primers were:
6 Forward primer: AAACGGAAGCGCACTGAA (SEQ ID NO: 154) Reverse
primer: GGGACTGGCGAGCCTTAGTT (SEQ ID NO: 155)
[0279] The PCR probe was: FAM-CCATCCGTGGCCAGATCCTGT-TAMRA (SEQ ID
NO: 156), where FAM is the fluorescent dye and TAMRA is the
quencher dye.
[0280] STZ-induced diabetic mice injected with saline exhibited a
significant increase in TGF-beta-1 expression relative to
non-diabetic mice. However, when STZ-induced diabetic mice were
treated with ISIS 124212, TGF-beta-1 expression was significantly
decreased, indicating that CTGF antisense treatment effectively
reduces expression of downstream targets.
[0281] The effect of CTGF antisense oligonucleotide on a second
downstream target, the fibronectin gene, also was determined by
PCR. Fibronectin target mRNA levels were determined by quantitative
real-time PCR as described by other examples herein. PCR results
were normalized to the ubiquitously expressed mouse 18S gene.
Probes and primers to mouse fibronectin were designed to hybridize
to mouse fibronectin sequence using published sequence information.
For mouse fibronectin, the PCR primers were:
7 Forward primer: CCGTCCATCGAGCTGACC (SEQ ID NO: 157) Reverse
primer: TGCAACGTCTTCATTCTTC (SEQ ID NO: 158)
[0282] The PCR probe was: FAM-ACCTCTTGGTGCGCTACTCACC-TAMRA (SEQ ID
NO: 159), where FAM is the fluorescent dye and TAMRA is the
quencher dye.
[0283] STZ-induced diabetic mice injected with saline exhibited a
significant increase in fibronectin gene expression relative to
non-diabetic mice. However, when STZ-induced diabetic mice were
treated with ISIS 124212, fibronectin expression was significantly
decreased.
[0284] Fibronectin gene expression is activated by the
transcription factor CREB. The phosphorylated form of CREB (p-CREB)
represents the active form of the transcription factor. To
determine whether CTGF antisense treatment of STZ-induced diabetic
mice results in a reduction in p-CREB, western blots for CREB and
p-CREB were performed on kidney samples as described in other
examples herein. CREB and p-CREB specific antibodies (Cell
Signaling Technology, Beverly, Mass.) were used at a concentration
of 1:1000. STZ-induced diabetic mice exhibited significant levels
of p-CREB; however, treatment with ISIS 124212 nearly eliminated
p-CREB. Little to no p-CREB is detected in non-diabetic mice.
Levels of CREB were similar under each condition. These results
suggest that CTGF modulates fibronectin gene expression by altering
the activation state of CREB.
[0285] High glucose levels are known to activate the MAPK pathway.
To determine whether CTGF antisense inhibition alters activation of
this pathway, western blots for p38 and phosphorylated p38 (p-p38)
were performed on kidney samples. Western blots were performed as
described in other examples herein using p38 and p-p38-specific
antibodies (Cell Signaling Technology) at a concentration of
1:1000. Relative to non-diabetic mice, STZ-induced diabetic mice
exhibit increased levels of p-p38. Treatment of diabetic mice with
ISIS 124212 moderately reduced the levels of activated p-p38.
Levels of p38 were similar under each condition.
[0286] Together, these results indicate that CTGF antisense
inhibition is an effective means of reducing the physical signs of
diabetic nephropathy as well as reducing the expression of genes
involved in the development of diabetic nephropathy associated with
type 1 diabetes.
Example 20
Antisense Inhibition of Connective Tissue Growth Factor in a Murine
Model of Type 2 Diabetes
[0287] The Animal Models of Diabetic Complications Consortium
(AMDCC) has developed protocols for the induction of diabetes in a
number of animal models. The genetic C57BLKS/J
Lep.sup.db/Lep.sup.db model has been approved by the AMDCC as an
appropriate model system for studies of diabetic nephropathy
associated with type 2 diabetes.
[0288] Leptin is a hormone produced by fat that regulates appetite.
Deficiencies in this hormone in both humans and non-human animals
lead to obesity. Lep.sup.db/Lep.sup.db mice have a mutation in the
leptin receptor gene which results in obesity and hyperglycemia. As
such, these mice are a useful model for the investigation of
obesity and diabetes and treatments designed to treat these
conditions. In accordance with the present invention, oligomeric
compounds of the present invention were tested in the
Lep.sup.db/Lep.sup.db model of type 2 diabetes.
[0289] Full phosphorothioate compound ISIS 124212 (SEQ ID NO: 39)
and mixed backbone compound 334157 (SEQ ID NO: 160) were tested for
their capacity to inhibit CTGF expression in vivo. Three month old
C57BLKS/J Lep.sup.db/Lep.sup.db and age-matched control C57BLKS/J
mice were treated twice a week for six weeks with control
oligonucleotide ISIS 141923 (SEQ ID NO: 161), or CTGF antisense
oligonucleotides ISIS 124212 or ISIS 334157. Oligonucleotides were
delivered subcutaneously at a dose of 10 mg/kg or 25 mg/kg.
Saline-injected animals served as controls. Blood and urine
chemistries were analyzed prior to treatment, at three weeks, and
post-treatment. After the treatment period, mice are sacrificed and
CTGF mRNA levels were evaluated in the kidney. RNA isolation and
target mRNA expression level quantitation by quantitative PCR are
performed as described in other examples herein. For mouse CTGF,
the PCR primers were:
8 Forward primer: GCTCAGGGTAAGGTCCGATTC (SEQ ID NO: 162) Reverse
primer: GCCCCCCACCCCAAA (SEQ ID NO: 163)
[0290] The PCR probe was: FAM-TCATAATCAAAGAAGCAGCAAGCACTTCC-TAMRA
(SEQ ID NO: 164), where FAM is the fluorescent dye and TAMRA is the
quencher dye.
9TABLE 6 Antisense inhibition of CTGF mRNA in Lep.sup.db/Lep.sup.db
kidney (shown as percent of saline-injected control mice) Percent
expression of CTGF mRNA after treatment with oligonucleotide at the
concentrations shown: Oligonucleotide Saline 10 mg/kg 25 mg/kg
141923 100 -- 82 124212 100 110 71 334157 100 83 53
[0291] ISIS 124212, ISIS 334517 and ISIS 141923 are chimeric
oligonucleotides ("gapmers") 20 nucleotides in length, composed of
a central "gap" region consisting of ten 2'-deoxynucleotides, which
is flanked on both sides (5' and 3' directions) by five-nucleotide
"wings". The wings are composed of 2'-methoxyethyl (2'-MOE)
nucleotides. ISIS 124212 and ISIS 141923 have phosphorothioate
(P.dbd.S) internucleoside (backbone) linkages throughout the
oligonucleotide. ISIS 334517 has a mixed backbone with
phosphorothioate linkages in the central gap region and
phosphodiester linkages in the wings. All cytidine residues in each
oligonucleotide are 5-methylcytidines. Treatment with ISIS 334157
resulted in a significant decrease in CTGF expression at a dose of
25 mg/kg. ISIS 124212 also inhibited expression CTGF at the same
dose.
[0292] Prior to antisense oligonucleotide treatment, expression of
CTGF in Lep.sup.db/Lep.sup.db kidney was assessed in 4.5 month old
mice. CTGF was found to be expressed in the proximal tubular
epithelial cells and in the glomeruli.
[0293] To assess distribution of CTGF antisense oligonucleotides in
Lep.sup.db/Lep.sup.db kidney, 2E1 staining was performed as
described in other examples herein. The results demonstrated that
ISIS 124212 and ISIS 334157 exhibit a similar pattern of
distribution in the inner and outer cortex.
[0294] To evaluate whether antisense inhibition of CTGF alters the
development of diabetic nephropathy, levels of collagen 1A and
collagen IV (.alpha.2) were determined. Collagen 1A and collagen IV
target mRNA levels were determined by quantitative real-time PCR as
described by other examples herein.
[0295] Probes and primers to mouse collagen 1A and collagen IV were
designed to hybridize to mouse collagen 1A and collagen IV
sequences using published sequence information. For mouse collagen
1A, the PCR primers were:
10 Forward primer: TGGATTCCCGTTCGAGTACG (SEQ ID NO: 165) Reverse
primer: TCAGCTGGATAGCGACATCG (SEQ ID NO: 166)
[0296] The PCR probe was: FAM-AAGCGAGGGCTCCGACCCGA-TAMRA (SEQ ID
NO: 167)
[0297] FAM is the fluorescent dye and TAMRA is the quencher
dye.
[0298] For mouse collagen IV, the PCR primers were:
11 Forward primer: AGACCAACAAGCAAGTGAGTGC (SEQ ID NO: 168) Reverse
primer: CTAGCATGTGAGCCACATTCATCC (SEQ ID NO: 169)
[0299] The PCR probe was: FAM-CTGCTGAGGGCACGCTGAGCT-TAMRA (SEQ ID
NO: 170)
[0300] FAM is the fluorescent dye and TAMRA is the quencher
dye.
12TABLE 7 Inhibition of collagen 1A mRNA expression in
Lep.sup.db/Lep.sup.db mice treated with CTGF antisense
oligonucleotide (shown as percent of saline-injected control mice)
Percent expression of collagen 1A mRNA after treatment with CTGF
antisense oligonucleotide at the concentrations shown:
Oligonucleotide Saline 10 mg/kg 25 mg/kg 141923 100 -- 145 124212
100 60 65 334157 100 78 75
[0301]
13TABLE 8 Inhibition of collagen IV mRNA expression in
Lep.sup.db/Lep.sup.db mice treated with CTGF antisense
oligonucleotide (shown as percent of saline-injected control mice)
Percent expression of collagen IV mRNA after treatment with CTGF
antisense oligonucleotide at the concentrations shown:
Oligonucleotide Saline 10 mg/kg 25 mg/kg 141923 100 -- 72 124212
100 50 40 334157 100 37 24
[0302] Treatment with either ISIS 124212 or ISIS 334157 led to a
significant reduction in mRNA expression of both collagen 1A and
collagen IV in Lep.sup.db/Lep.sup.db mice, relative to both
saline-injected control mice and mice treated with control
oligonucleotide. These results indicate that treatment with CTGF
antisense oligonucleotides inhibits development of nephropathy
associated with type 2 diabetes.
[0303] Toxic effects of compounds administered in vivo can be
assessed by measuring the levels of enzymes and proteins associated
with disease or injury of the liver or kidney. Elevations in the
levels of the serum transaminases aspartate aminotransferase (AST)
and alanine aminotransferase (ALT) are often indicators of liver
disease or injury. To assess the physiological effects resulting
from inhibition of target mRNA, the Lep.sup.db/Lep.sup.db mice were
further evaluated at the end of the treatment period for AST and
ALT. Serum was analyzed by LabCorp Testing Facility (San Diego,
Calif.). The levels of AST and ALT were within normal ranges and
were not significantly changed relative to saline-treated animals,
demonstrating that the mixed backbone and full phosphorothioate
antisense compounds of the invention do not significantly affect
hepatic function.
[0304] These results illustrate that both full phosphorothioate
backbone and mixed backbone compounds inhibit expression of CTGF in
vivo without toxicity. In addition, the compounds of the invention
inhibit the development of diabetic nephropathy in diabetic
animals.
Sequence CWU 1
1
170 1 20 DNA Artificial Sequence Antisense Oligonucleotide 1
tccgtcatcg ctcctcaggg 20 2 20 DNA Artificial Sequence Antisense
Oligonucleotide 2 atgcattctg cccccaagga 20 3 2075 DNA Homo sapiens
CDS (130)...(1179) 3 cccggccgac agccccgaga cgacagcccg gcgcgtcccg
gtccccacct ccgaccaccg 60 ccagcgctcc aggccccgcg ctccccgctc
gccgccaccg cgccctccgc tccgcccgca 120 gtgccaacc atg acc gcc gcc agt
atg ggc ccc gtc cgc gtc gcc ttc gtg 171 Met Thr Ala Ala Ser Met Gly
Pro Val Arg Val Ala Phe Val 1 5 10 gtc ctc ctc gcc ctc tgc agc cgg
ccg gcc gtc ggc cag aac tgc agc 219 Val Leu Leu Ala Leu Cys Ser Arg
Pro Ala Val Gly Gln Asn Cys Ser 15 20 25 30 ggg ccg tgc cgg tgc ccg
gac gag ccg gcg ccg cgc tgc ccg gcg ggc 267 Gly Pro Cys Arg Cys Pro
Asp Glu Pro Ala Pro Arg Cys Pro Ala Gly 35 40 45 gtg agc ctc gtg
ctg gac ggc tgc ggc tgc tgc cgc gtc tgc gcc aag 315 Val Ser Leu Val
Leu Asp Gly Cys Gly Cys Cys Arg Val Cys Ala Lys 50 55 60 cag ctg
ggc gag ctg tgc acc gag cgc gac ccc tgc gac ccg cac aag 363 Gln Leu
Gly Glu Leu Cys Thr Glu Arg Asp Pro Cys Asp Pro His Lys 65 70 75
ggc ctc ttc tgt gac ttc ggc tcc ccg gcc aac cgc aag atc ggc gtg 411
Gly Leu Phe Cys Asp Phe Gly Ser Pro Ala Asn Arg Lys Ile Gly Val 80
85 90 tgc acc gcc aaa gat ggt gct ccc tgc atc ttc ggt ggt acg gtg
tac 459 Cys Thr Ala Lys Asp Gly Ala Pro Cys Ile Phe Gly Gly Thr Val
Tyr 95 100 105 110 cgc agc gga gag tcc ttc cag agc agc tgc aag tac
cag tgc acg tgc 507 Arg Ser Gly Glu Ser Phe Gln Ser Ser Cys Lys Tyr
Gln Cys Thr Cys 115 120 125 ctg gac ggg gcg gtg ggc tgc atg ccc ctg
tgc agc atg gac gtt cgt 555 Leu Asp Gly Ala Val Gly Cys Met Pro Leu
Cys Ser Met Asp Val Arg 130 135 140 ctg ccc agc cct gac tgc ccc ttc
ccg agg agg gtc aag ctg ccc ggg 603 Leu Pro Ser Pro Asp Cys Pro Phe
Pro Arg Arg Val Lys Leu Pro Gly 145 150 155 aaa tgc tgc gag gag tgg
gtg tgt gac gag ccc aag gac caa acc gtg 651 Lys Cys Cys Glu Glu Trp
Val Cys Asp Glu Pro Lys Asp Gln Thr Val 160 165 170 gtt ggg cct gcc
ctc gcg gct tac cga ctg gaa gac acg ttt ggc cca 699 Val Gly Pro Ala
Leu Ala Ala Tyr Arg Leu Glu Asp Thr Phe Gly Pro 175 180 185 190 gac
cca act atg att aga gcc aac tgc ctg gtc cag acc aca gag tgg 747 Asp
Pro Thr Met Ile Arg Ala Asn Cys Leu Val Gln Thr Thr Glu Trp 195 200
205 agc gcc tgt tcc aag acc tgt ggg atg ggc atc tcc acc cgg gtt acc
795 Ser Ala Cys Ser Lys Thr Cys Gly Met Gly Ile Ser Thr Arg Val Thr
210 215 220 aat gac aac gcc tcc tgc agg cta gag aag cag agc cgc ctg
tgc atg 843 Asn Asp Asn Ala Ser Cys Arg Leu Glu Lys Gln Ser Arg Leu
Cys Met 225 230 235 gtc agg cct tgc gaa gct gac ctg gaa gag aac att
aag aag ggc aaa 891 Val Arg Pro Cys Glu Ala Asp Leu Glu Glu Asn Ile
Lys Lys Gly Lys 240 245 250 aag tgc atc cgt act ccc aaa atc tcc aag
cct atc aag ttt gag ctt 939 Lys Cys Ile Arg Thr Pro Lys Ile Ser Lys
Pro Ile Lys Phe Glu Leu 255 260 265 270 tct ggc tgc acc agc atg aag
aca tac cga gct aaa ttc tgt gga gta 987 Ser Gly Cys Thr Ser Met Lys
Thr Tyr Arg Ala Lys Phe Cys Gly Val 275 280 285 tgt acc gac ggc cga
tgc tgc acc ccc cac aga acc acc acc ctg ccg 1035 Cys Thr Asp Gly
Arg Cys Cys Thr Pro His Arg Thr Thr Thr Leu Pro 290 295 300 gtg gag
ttc aag tgc cct gac ggc gag gtc atg aag aag aac atg atg 1083 Val
Glu Phe Lys Cys Pro Asp Gly Glu Val Met Lys Lys Asn Met Met 305 310
315 ttc atc aag acc tgt gcc tgc cat tac aac tgt ccc gga gac aat gac
1131 Phe Ile Lys Thr Cys Ala Cys His Tyr Asn Cys Pro Gly Asp Asn
Asp 320 325 330 atc ttt gaa tcg ctg tac tac agg aag atg tac gga gac
atg gca tga 1179 Ile Phe Glu Ser Leu Tyr Tyr Arg Lys Met Tyr Gly
Asp Met Ala * 335 340 345 agccagagag tgagagacat taactcatta
gactggaact tgaactgatt cacatctcat 1239 ttttccgtaa aaatgatttc
agtagcacaa gttatttaaa tctgtttttc taactggggg 1299 aaaagattcc
cacccaattc aaaacattgt gccatgtcaa acaaatagtc tatcttcccc 1359
agacactggt ttgaagaatg ttaagacttg acagtggaac tacattagta cacagcacca
1419 gaatgtatat taaggtgtgg ctttaggagc agtgggaggg taccggcccg
gttagtatca 1479 tcagatcgac tcttatacga gtaatatgcc tgctatttga
agtgtaattg agaaggaaaa 1539 ttttagcgtg ctcactgacc tgcctgtagc
cccagtgaca gctaggatgt gcattctcca 1599 gccatcaaga gactgagtca
agttgttcct taagtcagaa cagcagactc agctctgaca 1659 ttctgattcg
aatgacactg ttcaggaatc ggaatcctgt cgattagact ggacagcttg 1719
tggcaagtga atttgcctgt aacaagccag attttttaaa atttatattg taaatattgt
1779 gtgtgtgtgt gtgtgtgtat atatatatat atatgtacag ttatctaagt
taatttaaag 1839 ttgtttgtgc ctttttattt ttgtttttaa tgctttgata
tttcaatgtt agcctcaatt 1899 tctgaacacc ataggtagaa tgtaaagctt
gtctgatcgt tcaaagcatg aaatggatac 1959 ttatatggaa attctgctca
gatagaatga cagtccgtca aaacagattg tttgcaaagg 2019 ggaggcatca
gtgtcttggc aggctgattt ctaggtagga aatgtggtag ctcacg 2075 4 22 DNA
Artificial Sequence PCR Primer 4 acaagggcct cttctgtgac tt 22 5 22
DNA Artificial Sequence PCR Primer 5 ggtacaccgt accaccgaag at 22 6
23 DNA Artificial Sequence PCR Probe 6 tgtgcaccgc caaagatggt gct 23
7 19 DNA Artificial Sequence PCR Primer 7 gaaggtgaag gtcggagtc 19 8
20 DNA Artificial Sequence PCR Primer 8 gaagatggtg atgggatttc 20 9
20 DNA Artificial Sequence PCR Probe 9 caagcttccc gttctcagcc 20 10
2334 DNA Mus musculus CDS (206)...(1252) 10 gaagactcag ccagatccac
tccagctccg accccaggag accgacctcc tccagacggc 60 agcagcccca
gcccagccga caaccccaga cgccaccgcc tggagcgtcc agacaccaac 120
ctccgcccct gtccgaatcc aggctccggc cgcgcctctc gtcgcctctg caccctgctg
180 tgcatcctcc taccgcgtcc cgatc atg ctc gcc tcc gtc gca ggt ccc atc
232 Met Leu Ala Ser Val Ala Gly Pro Ile 1 5 agc ctc gcc ttg gtg ctc
ctc gcc ctc tgc acc cgg cct gct acg ggc 280 Ser Leu Ala Leu Val Leu
Leu Ala Leu Cys Thr Arg Pro Ala Thr Gly 10 15 20 25 cag gac tgc agc
gcg caa tgt cag tgc gca gcc gaa gca gcg ccg cac 328 Gln Asp Cys Ser
Ala Gln Cys Gln Cys Ala Ala Glu Ala Ala Pro His 30 35 40 tgc ccc
gcc ggc gtg agc ctg gtg ctg gac ggc tgc ggc tgc tgc cgc 376 Cys Pro
Ala Gly Val Ser Leu Val Leu Asp Gly Cys Gly Cys Cys Arg 45 50 55
gtc tgc gcc aag cag ctg gga gaa ctg tgt acg gag cgt gac ccc tgc 424
Val Cys Ala Lys Gln Leu Gly Glu Leu Cys Thr Glu Arg Asp Pro Cys 60
65 70 gac cca cac aag ggc ctc ttc tgc gat ttc ggc tcc ccc gcc aac
cgc 472 Asp Pro His Lys Gly Leu Phe Cys Asp Phe Gly Ser Pro Ala Asn
Arg 75 80 85 aag atc gga gtg tgc act gcc aaa gat ggt gca ccc tgt
gtc ttc ggt 520 Lys Ile Gly Val Cys Thr Ala Lys Asp Gly Ala Pro Cys
Val Phe Gly 90 95 100 105 ggg tcg gtg tac cgc agc ggt gag tcc ttc
caa agc agc tgc aaa tac 568 Gly Ser Val Tyr Arg Ser Gly Glu Ser Phe
Gln Ser Ser Cys Lys Tyr 110 115 120 caa tgc act tgc ctg gat ggg gcc
gtg ggc tgc gtg ccc ctg tgc agc 616 Gln Cys Thr Cys Leu Asp Gly Ala
Val Gly Cys Val Pro Leu Cys Ser 125 130 135 atg gac gtg cgc ctg ccc
agc cct gac tgc ccc ttc ccg aga agg gtc 664 Met Asp Val Arg Leu Pro
Ser Pro Asp Cys Pro Phe Pro Arg Arg Val 140 145 150 aag ctg cct ggg
aaa tgc tgc gag gag tgg gtg tgt gac gag ccc aag 712 Lys Leu Pro Gly
Lys Cys Cys Glu Glu Trp Val Cys Asp Glu Pro Lys 155 160 165 gac cgc
aca gca gtt ggc cct gcc cta gct gcc tac cga ctg gaa gac 760 Asp Arg
Thr Ala Val Gly Pro Ala Leu Ala Ala Tyr Arg Leu Glu Asp 170 175 180
185 aca ttt ggc cca gac cca act atg atg cga gcc aac tgc ctg gtc cag
808 Thr Phe Gly Pro Asp Pro Thr Met Met Arg Ala Asn Cys Leu Val Gln
190 195 200 acc aca gag tgg agc gcc tgt tct aag acc tgt ggg atg ggc
atc tcc 856 Thr Thr Glu Trp Ser Ala Cys Ser Lys Thr Cys Gly Met Gly
Ile Ser 205 210 215 acc cga gtt acc aat gac aat acc ttc tgc aga ctt
gag aag cag agt 904 Thr Arg Val Thr Asn Asp Asn Thr Phe Cys Arg Leu
Glu Lys Gln Ser 220 225 230 cgc ctc tgc atg gtc agg ccc tgc gaa gct
gac ctg gag gaa aac att 952 Arg Leu Cys Met Val Arg Pro Cys Glu Ala
Asp Leu Glu Glu Asn Ile 235 240 245 aag aag ggc aaa aag tgc atc cgg
aca cct aaa atc gcc aag cct gtc 1000 Lys Lys Gly Lys Lys Cys Ile
Arg Thr Pro Lys Ile Ala Lys Pro Val 250 255 260 265 aag ttt gag ctt
tct ggc tgc acc agt gtg aag aca tac agg gct aag 1048 Lys Phe Glu
Leu Ser Gly Cys Thr Ser Val Lys Thr Tyr Arg Ala Lys 270 275 280 ttc
tgc ggg gtg tgc aca gac ggc cgc tgc tgc aca ccg cac aga acc 1096
Phe Cys Gly Val Cys Thr Asp Gly Arg Cys Cys Thr Pro His Arg Thr 285
290 295 acc act ctg cca gtg gag ttc aaa tgc ccc gat ggc gag atc atg
aaa 1144 Thr Thr Leu Pro Val Glu Phe Lys Cys Pro Asp Gly Glu Ile
Met Lys 300 305 310 aag aat atg atg ttc atc aag acc tgt gcc tgc cat
tac aac tgt cct 1192 Lys Asn Met Met Phe Ile Lys Thr Cys Ala Cys
His Tyr Asn Cys Pro 315 320 325 ggg gac aat gac atc ttt gag tcc ctg
tac tac agg aag atg tac gga 1240 Gly Asp Asn Asp Ile Phe Glu Ser
Leu Tyr Tyr Arg Lys Met Tyr Gly 330 335 340 345 gac atg gcg taa
agccaggaag taagggacac gaactcatta gactataact 1292 Asp Met Ala *
tgaactgagt tgcatctcat tttcttctgt aaaaacaatt acagtagcac attaatttaa
1352 atctgtgttt ttaactaccg tgggaggaac tatcccacca aagtgagaac
gttatgtcat 1412 ggccatacaa gtagtctgtc aacctcagac actggtttcg
agacagttta cacttgacag 1472 ttgttcatta gcgcacagtg ccagaacgca
cactgaggtg agtctcctgg aacagtggag 1532 atgccaggag aaagaaagac
aggtactagc tgaggttatt ttaaaagcag cagtgtgcct 1592 actttttgga
gtgtaaccgg ggagggcaat tatagcatgc ttgcagacag acctgctcta 1652
gcgagagctg agcatgtgtc ctccactaga tgaggctgag tccagctgtt ctttaagaac
1712 agcagtttca gctctgacca ttctgattcc agtgacactt gtcaggagtc
agagccttgt 1772 ctgttagact ggacagcttg tggcaagtaa gtttgcctgt
aacaagccag atttttattg 1832 atattgtaaa tattgtggat atatatatat
atatatttgt acagttatct aagttaattt 1892 aaagtcattt gtttttgttt
taagtgcttt tgggatttta aactgatagc ctcaaactcc 1952 aaacaccata
ggtaggacac gaagcttatc tgtgattcaa aacaaaggag atactgcagt 2012
gggaattgtg acctgagtga ctctctgtca gaacaaatgc tgtgcaggtg ataaagctat
2072 gtattggaag tcagatttct agtaggaaat gtggtcaaat ccctgttggt
gaacaaatgg 2132 cctttattaa gaaatggctg gctcagggta aggtccgatt
cctaccagga agtgcttgct 2192 gcttctttga ttatgactgg tttggggtgg
ggggcagttt atttgttgag agtgtgacca 2252 aaagttacat gtttgcacct
ttctagttga aaataaagta tatatatatt ttttatatga 2312 aaaaaaaaaa
aaaaaaaaaa aa 2334 11 21 DNA Artificial Sequence PCR Primer 11
gctcagggta aggtccgatt c 21 12 15 DNA Artificial Sequence PCR Primer
12 gccccccacc ccaaa 15 13 31 DNA Artificial Sequence PCR Probe 13
tcataatcaa agaagcagca agcacttcct g 31 14 20 DNA Artificial Sequence
PCR Primer 14 ggcaaattca acggcacagt 20 15 20 DNA Artificial
Sequence PCR Primer 15 gggtctcgct cctggaagat 20 16 27 DNA
Artificial Sequence PCR Probe 16 aaggccgaga atgggaagct tgtcatc 27
17 2312 DNA Homo sapiens CDS (146)...(1195) 17 tccagtgacg
gagccgcccg gccgacagcc ccgagacgac agcccggcgc gtcccggtcc 60
ccacctccga ccaccgccag cgctccaggc cccgcgctcc ccgctcgccg ccaccgcgcc
120 ctccgctccg cccgcagtgc caacc atg acc gcc gcc agt atg ggc ccc gtc
172 Met Thr Ala Ala Ser Met Gly Pro Val 1 5 cgc gtc gcc ttc gtg gtc
ctc ctc gcc ctc tgc agc cgg ccg gcc gtc 220 Arg Val Ala Phe Val Val
Leu Leu Ala Leu Cys Ser Arg Pro Ala Val 10 15 20 25 ggc cag aac tgc
agc ggg ccg tgc cgg tgc ccg gac gag ccg gcg ccg 268 Gly Gln Asn Cys
Ser Gly Pro Cys Arg Cys Pro Asp Glu Pro Ala Pro 30 35 40 cgc tgc
ccg gcg ggc gtg agc ctc gtg ctg gac ggc tgc ggc tgc tgc 316 Arg Cys
Pro Ala Gly Val Ser Leu Val Leu Asp Gly Cys Gly Cys Cys 45 50 55
cgc gtc tgc gcc aag cag ctg ggc gag ctg tgc acc gag cgc gac ccc 364
Arg Val Cys Ala Lys Gln Leu Gly Glu Leu Cys Thr Glu Arg Asp Pro 60
65 70 tgc gac ccg cac aag ggc ctc ttc tgt gac ttc ggc tcc ccg gcc
aac 412 Cys Asp Pro His Lys Gly Leu Phe Cys Asp Phe Gly Ser Pro Ala
Asn 75 80 85 cgc aag atc ggc gtg tgc acc gcc aaa gat ggt gct ccc
tgc atc ttc 460 Arg Lys Ile Gly Val Cys Thr Ala Lys Asp Gly Ala Pro
Cys Ile Phe 90 95 100 105 ggt ggt acg gtg tac cgc agc gga gag tcc
ttc cag agc agc tgc aag 508 Gly Gly Thr Val Tyr Arg Ser Gly Glu Ser
Phe Gln Ser Ser Cys Lys 110 115 120 tac cag tgc acg tgc ctg gac ggg
gcg gtg ggc tgc atg ccc ctg tgc 556 Tyr Gln Cys Thr Cys Leu Asp Gly
Ala Val Gly Cys Met Pro Leu Cys 125 130 135 agc atg gac gtt cgt ctg
ccc agc cct gac tgc ccc ttc ccg agg agg 604 Ser Met Asp Val Arg Leu
Pro Ser Pro Asp Cys Pro Phe Pro Arg Arg 140 145 150 gtc aag ctg ccc
ggg aaa tgc tgc gag gag tgg gtg tgt gac gag ccc 652 Val Lys Leu Pro
Gly Lys Cys Cys Glu Glu Trp Val Cys Asp Glu Pro 155 160 165 aag gac
caa acc gtg gtt ggg cct gcc ctc gcg gct tac cga ctg gaa 700 Lys Asp
Gln Thr Val Val Gly Pro Ala Leu Ala Ala Tyr Arg Leu Glu 170 175 180
185 gac acg ttt ggc cca gac cca act atg att aga gcc aac tgc ctg gtc
748 Asp Thr Phe Gly Pro Asp Pro Thr Met Ile Arg Ala Asn Cys Leu Val
190 195 200 cag acc aca gag tgg agc gcc tgt tcc aag acc tgt ggg atg
ggc atc 796 Gln Thr Thr Glu Trp Ser Ala Cys Ser Lys Thr Cys Gly Met
Gly Ile 205 210 215 tcc acc cgg gtt acc aat gac aac gcc tcc tgc agg
cta gag aag cag 844 Ser Thr Arg Val Thr Asn Asp Asn Ala Ser Cys Arg
Leu Glu Lys Gln 220 225 230 agc cgc ctg tgc atg gtc agg cct tgc gaa
gct gac ctg gaa gag aac 892 Ser Arg Leu Cys Met Val Arg Pro Cys Glu
Ala Asp Leu Glu Glu Asn 235 240 245 att aag aag ggc aaa aag tgc atc
cgt act ccc aaa atc tcc aag cct 940 Ile Lys Lys Gly Lys Lys Cys Ile
Arg Thr Pro Lys Ile Ser Lys Pro 250 255 260 265 atc aag ttt gag ctt
tct ggc tgc acc agc atg aag aca tac cga gct 988 Ile Lys Phe Glu Leu
Ser Gly Cys Thr Ser Met Lys Thr Tyr Arg Ala 270 275 280 aaa ttc tgt
gga gta tgt acc gac ggc cga tgc tgc acc ccc cac aga 1036 Lys Phe
Cys Gly Val Cys Thr Asp Gly Arg Cys Cys Thr Pro His Arg 285 290 295
acc acc acc ctg ccg gtg gag ttc aag tgc cct gac ggc gag gtc atg
1084 Thr Thr Thr Leu Pro Val Glu Phe Lys Cys Pro Asp Gly Glu Val
Met 300 305 310 aag aag aac atg atg ttc atc aag acc tgt gcc tgc cat
tac aac tgt 1132 Lys Lys Asn Met Met Phe Ile Lys Thr Cys Ala Cys
His Tyr Asn Cys 315 320 325 ccc gga gac aat gac atc ttt gaa tcg ctg
tac tac agg aag atg tac 1180 Pro Gly Asp Asn Asp Ile Phe Glu Ser
Leu Tyr Tyr Arg Lys Met Tyr 330 335 340 345 gga gac atg gca tga
agccagagag tgagagacat taactcatta gactggaact 1235 Gly Asp Met Ala *
tgaactgatt cacatctcat ttttccgtaa aaatgatttc agtagcacaa gttatttaaa
1295 tctgtttttc taactggggg aaaagattcc cacccaattc aaaacattgt
gccatgtcaa 1355 acaaatagtc tatcttcccc agacactggt ttgaagaatg
ttaagacttg acagtggaac 1415 tacattagta cacagcacca gaatgtatat
taaggtgtgg ctttaggagc agtgggaggg 1475 taccagcaga aaggttagta
tcatcagata gctcttatac gagtaatatg cctgctattt 1535 gaagtgtaat
tgagaaggaa aattttagcg tgctcactga cctgcctgta gccccagtga 1595
cagctaggat gtgcattctc cagccatcaa gagactgagt caagttgttc cttaagtcag
1655 aacagcagac tcagctctga cattctgatt cgaatgacac tgttcaggaa
tcggaatcct 1715 gtcgattaga ctggacagct tgtggcaagt gaatttcctg
taacaagcca gattttttaa 1775 aatttatatt gtaaatattg tgtgtgtgtg
tgtgtgtgta tatatatata tatatgtaca 1835 gttatctaag ttaatttaaa
gttgtttgtg cctttttatt tttgttttta atgctttgat 1895 atttcaatgt
tagcctcaat ttctgaacac cataggtaga atgtaaagct tgtctgatcg 1955
ttcaaagcat gaaatggata cttatatgga aattctctca gatagaatga cagtccgtca
2015 aaacagattg tttgcaaagg ggaggcatca gtgtccttgg caggctgatt
tctaggtagg 2075 aaatgtggta gctcacgctc acttttaatg aacaaatggc
ctttattaaa aactgagtga 2135 ctctatatag ctgatcagtt ttttcacctg
gaagcatttg tttctacttt gatatgactg 2195 tttttcggac agtttatttg
ttgagagtgt gaccaaaagt tacatgtttg cacctttcta 2255 gttgaaaata
aagtatattt tttctaaaaa aaaaaaaaaa cgacagcaac ggaattc 2312 18 2078
DNA Homo sapiens CDS (131)...(1180) 18 cccggccgac agccccgaga
cgacagcccg gcgcgtcccg gtccccacct ccgaccaccg 60 ccagcgctcc
aggccccgcc gctccccgct cgccgccacc gcgccctccg ctccgcccgc 120
agtgccaacc atg acc gcc gcc agt atg ggc ccc gtc cgc gtc gcc ttc 169
Met Thr Ala Ala Ser Met Gly Pro Val Arg Val Ala Phe 1 5 10 gtg gtc
ctc ctc gcc ctc tgc agc cgg ccg gcc gtc ggc cag aac tgc 217 Val Val
Leu Leu Ala Leu Cys Ser Arg Pro Ala Val Gly Gln Asn Cys 15 20 25
agc ggg ccg tgc cgg tgc ccg gac gag ccg gcg ccg cgc tgc ccg gcg 265
Ser Gly Pro Cys Arg Cys Pro Asp Glu Pro Ala Pro Arg Cys Pro Ala 30
35 40 45 ggc gtg agc ctc gtg ctg gac ggc tgc ggc tgc tgc cgc gtc
tgc gcc 313 Gly Val Ser Leu Val Leu Asp Gly Cys Gly Cys Cys Arg Val
Cys Ala 50 55 60 aag cag ctg ggc gag ctg tgc acc gag cgc gac cca
tgc gac ccg cac 361 Lys Gln Leu Gly Glu Leu Cys Thr Glu Arg Asp Pro
Cys Asp Pro His 65 70 75 aag ggc cta ttc tgt cac ttc ggc tcc ccg
gcc aac cgc aag atc ggc 409 Lys Gly Leu Phe Cys His Phe Gly Ser Pro
Ala Asn Arg Lys Ile Gly 80 85 90 gtg tgc acc gcc aaa gat ggt gct
ccc tgc atc ttc ggt ggt acg gtg 457 Val Cys Thr Ala Lys Asp Gly Ala
Pro Cys Ile Phe Gly Gly Thr Val 95 100 105 tac cgc agc gga gag tcc
ttc cag agc agc tgc aag tac cag tgc acg 505 Tyr Arg Ser Gly Glu Ser
Phe Gln Ser Ser Cys Lys Tyr Gln Cys Thr 110 115 120 125 tgc ctg gac
ggg gcg gtg ggc tgc atg ccc ctg tgc agc atg gac gtt 553 Cys Leu Asp
Gly Ala Val Gly Cys Met Pro Leu Cys Ser Met Asp Val 130 135 140 cgt
ctg ccc agc cct gac tgc ccc ttc ccg agg agg gtc aag ctg ccc 601 Arg
Leu Pro Ser Pro Asp Cys Pro Phe Pro Arg Arg Val Lys Leu Pro 145 150
155 ggg aaa tgc tgc gag gag tgg gtg tgt gac gag ccc aag gac caa acc
649 Gly Lys Cys Cys Glu Glu Trp Val Cys Asp Glu Pro Lys Asp Gln Thr
160 165 170 gtg gtt ggg cct gcc ctc gcg gct tac cga ctg gaa gac acg
ttt ggc 697 Val Val Gly Pro Ala Leu Ala Ala Tyr Arg Leu Glu Asp Thr
Phe Gly 175 180 185 cca gac cca act atg att aga gcc aac tgc ctg gtc
cag acc aca gag 745 Pro Asp Pro Thr Met Ile Arg Ala Asn Cys Leu Val
Gln Thr Thr Glu 190 195 200 205 tgg agc gcc tgt tcc aag acc tgt ggg
atg ggc atc tcc acc cgg gtt 793 Trp Ser Ala Cys Ser Lys Thr Cys Gly
Met Gly Ile Ser Thr Arg Val 210 215 220 acc aat gac aac gcc tcc tgc
agg cta gag aag cag agc cgc ctg tgc 841 Thr Asn Asp Asn Ala Ser Cys
Arg Leu Glu Lys Gln Ser Arg Leu Cys 225 230 235 atg gtc agg cct tgc
gaa gct gac ctg gaa gag aac att aag aag ggc 889 Met Val Arg Pro Cys
Glu Ala Asp Leu Glu Glu Asn Ile Lys Lys Gly 240 245 250 aaa aag tgc
atc cgt act ccc aaa atc tcc aag cct atc aag ttt gag 937 Lys Lys Cys
Ile Arg Thr Pro Lys Ile Ser Lys Pro Ile Lys Phe Glu 255 260 265 ctt
tct ggc tgc acc agc atg aag aca tac cga gct aaa ttc tgt gga 985 Leu
Ser Gly Cys Thr Ser Met Lys Thr Tyr Arg Ala Lys Phe Cys Gly 270 275
280 285 gta tgt acc gac ggc cga tgc tgc acc ccc cac aga acc acc acc
ctg 1033 Val Cys Thr Asp Gly Arg Cys Cys Thr Pro His Arg Thr Thr
Thr Leu 290 295 300 ccg gtg gag ttc aag tgc cct gac ggc gag gtc atg
aag aag aac atg 1081 Pro Val Glu Phe Lys Cys Pro Asp Gly Glu Val
Met Lys Lys Asn Met 305 310 315 atg ttc atc aag acc tgt gcc tgc cat
tac aac tgt ccc gga gac aat 1129 Met Phe Ile Lys Thr Cys Ala Cys
His Tyr Asn Cys Pro Gly Asp Asn 320 325 330 gac atc ttt gaa tcg ctg
tac tac agg aag atg tac gga gac atg gca 1177 Asp Ile Phe Glu Ser
Leu Tyr Tyr Arg Lys Met Tyr Gly Asp Met Ala 335 340 345 tga
agccagagag tgagagacat taactcatta gactggaact tgaactgatt 1230
cacatctcat ttttccgtaa aaatgatttc agtagcacaa gttatttaaa tctgtttttc
1290 taactggggg aaaagattcc cacccaattc aaaacattgt gccatgtcaa
acaaatagtc 1350 tatcaacccc agacactggt ttgaagaatg ttaagacttg
acagtggaac tacattagta 1410 cacagcacca gaatgtatat taaggtgtgg
ctttaggagc agtgggaggg taccagcaga 1470 aaggttagta tcatcagata
gcatcttata cgagtaatat gcctgctatt tgaagtgtaa 1530 ttgagaagga
aaattttagc gtgctcactg acctgcctgt agccccagtg acagctagga 1590
tgtgcattct ccagccatca agagactgag tcaagttgtt ccttaagtca gaacagcaga
1650 ctcagctctg acattctgat tcgaatgaca ctgttcagga atcggaatcc
tgtcgattag 1710 actggacagc ttgtggcaag tgaatttgcc tgtaacaagc
cagatttttt aaaatttata 1770 ttgtaaatat tgtgtgtgtg tgtgtgtgtg
tatatatata tatatgtaca gttatctaag 1830 ttaatttaaa gttgtttgtg
cctttttatt tttgttttta atgctttgat atttcaatgt 1890 tagcctcaat
ttctgaacac cataggtaga atgtaaagct tgtctgatcg ttcaaagcat 1950
gaaatggata cttatatgga aattctgctc agatagaatg acagtccgtc aaaacagatt
2010 gtttgcaaag gggaggcatc agtgtccttg gcaggctgat ttctaggtag
gaaatgtggt 2070 agcctcac 2078 19 2280 DNA Homo sapiens CDS
(143)...(1192) 19 gacggcagcc gccccggccg acagccccga gacgacagcc
cggcgcgtcc cggtccccac 60 ctccgaccac cgccagcgct ccaggccccg
ccgctccccg ctcgccgcca ccgcgccctc 120 cgctccgccc gcagtgccaa cc atg
acc gcc gcc agt atg ggc ccc gtc cgc 172 Met Thr Ala Ala Ser Met Gly
Pro Val Arg 1 5 10 gtc gcc ttc gtg gtc ctc ctc gcc ctc tgc agc cgg
ccg gcc gtc ggc 220 Val Ala Phe Val Val Leu Leu Ala Leu Cys Ser Arg
Pro Ala Val Gly 15 20 25 cag aac tgc agc ggg ccg tgc cgg tgc ccg
gac gag ccg gcg ccg cgc 268 Gln Asn Cys Ser Gly Pro Cys Arg Cys Pro
Asp Glu Pro Ala Pro Arg 30 35 40 tgc ccg gcg ggc gtg agc ctc gtg
ctg gac ggc tgc ggc tgc tgc cgc 316 Cys Pro Ala Gly Val Ser Leu Val
Leu Asp Gly Cys Gly Cys Cys Arg 45 50 55 gtc tgc gcc aag cag ctg
ggc gag ctg tgc acc gag cgc gac cca tgc 364 Val Cys Ala Lys Gln Leu
Gly Glu Leu Cys Thr Glu Arg Asp Pro Cys 60 65 70 gac ccg cac aag
ggc cta ttc tgt cac ttc ggc tcc ccg gcc aac cgc 412 Asp Pro His Lys
Gly Leu Phe Cys His Phe Gly Ser Pro Ala Asn Arg 75 80 85 90 aag atc
ggc gtg tgc acc gcc aaa gat ggt gct ccc tgc atc ttc ggt 460 Lys Ile
Gly Val Cys Thr Ala Lys Asp Gly Ala Pro Cys Ile Phe Gly 95 100 105
ggt acg gtg tac cgc agc gga gag tcc ttc cag agc agc tgc aag tac 508
Gly Thr Val Tyr Arg Ser Gly Glu Ser Phe Gln Ser Ser Cys Lys Tyr 110
115 120 cag tgc acg tgc ctg gac ggg gcg gtg ggc tgc atg ccc ctg tgc
agc 556 Gln Cys Thr Cys Leu Asp Gly Ala Val Gly Cys Met Pro Leu Cys
Ser 125 130 135 atg gac gtt cgt ctg ccc agc cct gac tgc ccc ttc ccg
agg agg gtc 604 Met Asp Val Arg Leu Pro Ser Pro Asp Cys Pro Phe Pro
Arg Arg Val 140 145 150 aag ctg ccc ggg aaa tgc tgc gag gag tgg gtg
tgt gac gag ccc aag 652 Lys Leu Pro Gly Lys Cys Cys Glu Glu Trp Val
Cys Asp Glu Pro Lys 155 160 165 170 gac caa acc gtg gtt ggg cct gcc
ctc gcg gct tac cga ctg gaa gac 700 Asp Gln Thr Val Val Gly Pro Ala
Leu Ala Ala Tyr Arg Leu Glu Asp 175 180 185 acg ttt ggc cca gac cca
act atg att aga gcc aac tgc ctg gtc cag 748 Thr Phe Gly Pro Asp Pro
Thr Met Ile Arg Ala Asn Cys Leu Val Gln 190 195 200 acc aca gag tgg
agc gcc tgt tcc aag acc tgt ggg atg ggc atc tcc 796 Thr Thr Glu Trp
Ser Ala Cys Ser Lys Thr Cys Gly Met Gly Ile Ser 205 210 215 acc cgg
gtt acc aat gac aac gcc tcc tgc agg cta gag aag cag agc 844 Thr Arg
Val Thr Asn Asp Asn Ala Ser Cys Arg Leu Glu Lys Gln Ser 220 225 230
cgc ctg tgc atg gtc agg cct tgc gaa gct gac ctg gaa gag aac att 892
Arg Leu Cys Met Val Arg Pro Cys Glu Ala Asp Leu Glu Glu Asn Ile 235
240 245 250 aag aag ggc aaa aag tgc atc cgt act ccc aaa atc tcc aag
cct atc 940 Lys Lys Gly Lys Lys Cys Ile Arg Thr Pro Lys Ile Ser Lys
Pro Ile 255 260 265 aag ttt gag ctt tct ggc tgc acc agc atg aag aca
tac cga gct aaa 988 Lys Phe Glu Leu Ser Gly Cys Thr Ser Met Lys Thr
Tyr Arg Ala Lys 270 275 280 ttc tgt gga gta tgt acc gac ggc cga tgc
tgc acc ccc cac aga acc 1036 Phe Cys Gly Val Cys Thr Asp Gly Arg
Cys Cys Thr Pro His Arg Thr 285 290 295 acc acc ctg ccg gtg gag ttc
aag tgc cct gac ggc gag gtc atg aag 1084 Thr Thr Leu Pro Val Glu
Phe Lys Cys Pro Asp Gly Glu Val Met Lys 300 305 310 aag aac atg atg
ttc atc aag acc tgt gcc tgc cat tac aac tgt ccc 1132 Lys Asn Met
Met Phe Ile Lys Thr Cys Ala Cys His Tyr Asn Cys Pro 315 320 325 330
gga gac aat gac atc ttt gaa tcg ctg tac tac agg aag atg tac gga
1180 Gly Asp Asn Asp Ile Phe Glu Ser Leu Tyr Tyr Arg Lys Met Tyr
Gly 335 340 345 gac atg gca tga agccagagag tgagagacat taactcatta
gactggaact 1232 Asp Met Ala * tgaactgatt cacatctcat ttttccgtaa
aaatgatttc agtagcacaa gttatttaaa 1292 tctgtttttc taactggggg
aaaagattcc cacccaattc aaaacattgt gccatgtcaa 1352 acaaatagtc
tatcaacccc agacactggt ttgaagaatg ttaagacttg acagtggaac 1412
tacattagta cacagcacca gaatgtatat taaggtgtgg ctttaggagc agtgggaggg
1472 taccagcaga aaggttagta tcatcagata gcatcttata cgagtaatat
gcctgctatt 1532 tgaagtgtaa ttgagaagga aaattttagc gtgctcactg
acctgcctgt agccccagtg 1592 acagctagga tgtgcattct ccagccatca
agagactgag tcaagttgtt ccttaagtca 1652 gaacagcaga ctcagctctg
acattctgat tcgaatgaca ctgttcagga atcggaatcc 1712 tgtcgattag
actggacagc ttgtggcaag tgaatttgcc tgtaacaagc cagatttttt 1772
aaaatttata ttgtaaatat tgtgtgtgtg tgtgtgtgtg tatatatata tatatgtaca
1832 gttatctaag ttaatttaaa gttgtttgtg cctttttatt tttgttttta
atgctttgat 1892 atttcaatgt tagcctcaat ttctgaacac cataggtaga
atgtaaagct tgtctgatcg 1952 ttcaaagcat gaaatggata cttatatgga
aattctgctc agatagaatg acagtccgtc 2012 aaaacagatt gtttgcaaag
gggaggcatc agtgtccttg gcaggctgat ttctaggtag 2072 gaaatgtggt
agcctcactt ttaatgaaca aatggccttt attaaaaact gagtgactct 2132
atatagctga tcagtttttt cacctggaag catttgtttc tactttgata tgactgtttt
2192 tcggacagtt tatttgttga gagtgtgacc aaaagttaca tgtttgcacc
tttctagttg 2252 aaaataaagt gtatattttt tctataaa 2280 20 20 DNA
Artificial Sequence Antisense Oligonucleotide 20 gcagttggct
ctaatcatag 20 21 20 DNA Artificial Sequence Antisense
Oligonucleotide 21 tgaccatgca caggcggctc 20 22 20 DNA Artificial
Sequence Antisense Oligonucleotide 22 ctcaaacttg ataggcttgg 20 23
20 DNA Artificial Sequence Antisense Oligonucleotide 23 tttagctcgg
tatgtcttca 20 24 20 DNA Artificial Sequence Antisense
Oligonucleotide 24 cttgaactcc accggcaggg 20 25 20 DNA Artificial
Sequence Antisense Oligonucleotide 25 ggtcttgatg aacatcatgt 20 26
20 DNA Artificial Sequence Antisense Oligonucleotide 26 gacagttgta
atggcaggca 20 27 20 DNA Artificial Sequence Antisense
Oligonucleotide 27 ccgtacatct tcctgtagta 20 28 20 DNA Artificial
Sequence Antisense Oligonucleotide 28 ccagctgctt ggcgcagacg 20 29
20 DNA Artificial Sequence Antisense Oligonucleotide 29 tctggaccag
gcagttggct 20 30 20 DNA Artificial Sequence Antisense
Oligonucleotide 30 tgtggtctgg accaggcagt 20 31 20 DNA Artificial
Sequence Antisense Oligonucleotide 31 cactctgtgg tctggaccag 20 32
20 DNA Artificial Sequence Antisense Oligonucleotide 32 gatgcacttt
ttgcccttct 20 33 20 DNA Artificial Sequence Antisense
Oligonucleotide 33 gccagaaagc tcaaacttga 20 34 20 DNA Artificial
Sequence Antisense Oligonucleotide 34 gtgcagccag aaagctcaaa 20 35
20 DNA Artificial Sequence Antisense Oligonucleotide 35 caggtcttga
tgaacatcat 20 36 20 DNA Artificial Sequence Antisense
Oligonucleotide 36 aggcacaggt cttgatgaac 20 37 20 DNA Artificial
Sequence Antisense Oligonucleotide 37 atggcaggca caggtcttga 20 38
20 DNA Artificial Sequence Antisense Oligonucleotide 38 acagttgtaa
tggcaggcac 20 39 20 DNA Artificial Sequence Antisense
Oligonucleotide 39 ccacaagctg tccagtctaa 20 40 20 DNA Artificial
Sequence Antisense Oligonucleotide 40 acttgccaca agctgtccag 20 41
20 DNA Artificial Sequence Antisense Oligonucleotide 41 ttaacttaga
taactgtaca 20 42 20 DNA Artificial Sequence Antisense
Oligonucleotide 42 ttaaattaac ttagataact 20 43 20 DNA Artificial
Sequence Antisense Oligonucleotide 43 ttaataaagg ccatttgttc 20 44
20 DNA Artificial Sequence Antisense Oligonucleotide 44 cactctcaac
aaataaactg 20 45 20 DNA Artificial Sequence Antisense
Oligonucleotide 45 ggtcacactc tcaacaaata 20 46 20 DNA Artificial
Sequence Antisense Oligonucleotide 46 cttttggtca cactctcaac 20 47
20 DNA Artificial Sequence Antisense Oligonucleotide 47 tgtaactttt
ggtcacactc 20 48 20 DNA Artificial Sequence Antisense
Oligonucleotide 48 aaacatgtaa cttttggtca 20 49 20 DNA Artificial
Sequence Antisense Oligonucleotide 49 ctttattttc aactagaaag 20 50
20 DNA Artificial Sequence Antisense Oligonucleotide 50 cagctgcttg
gcgcagacgc 20 51 20 DNA Artificial Sequence Antisense
Oligonucleotide 51 ccttgggctc gtcacacacc 20 52 20 DNA Artificial
Sequence Antisense Oligonucleotide 52 tctgtggtct ggaccaggca 20 53
20 DNA Artificial Sequence Antisense Oligonucleotide 53 cagccagaaa
gctcaaactt 20 54 20 DNA Artificial Sequence Antisense
Oligonucleotide 54 ctggtgcagc cagaaagctc 20 55 20 DNA Artificial
Sequence Antisense Oligonucleotide 55 acaggtcttg atgaacatca 20 56
20 DNA Artificial Sequence Antisense Oligonucleotide 56 gcaggcacag
gtcttgatga 20 57 20 DNA Artificial Sequence Antisense
Oligonucleotide 57 taatggcagg cacaggtctt 20 58 20 DNA Artificial
Sequence Antisense Oligonucleotide 58 ccatgtctcc gtacatcttc 20 59
20 DNA Artificial Sequence Antisense Oligonucleotide 59 cttgccacaa
gctgtccagt 20 60 20 DNA Artificial Sequence Antisense
Oligonucleotide 60 aaaaatctgg cttgttacag 20 61 20 DNA Artificial
Sequence Antisense Oligonucleotide 61 ctttaaatta acttagataa 20 62
20 DNA Artificial Sequence Antisense Oligonucleotide 62 tttggtcaca
ctctcaacaa
20 63 20 DNA Artificial Sequence Antisense Oligonucleotide 63
gtaacttttg gtcacactct 20 64 20 DNA Artificial Sequence Antisense
Oligonucleotide 64 caaacatgta acttttggtc 20 65 20 DNA Artificial
Sequence Antisense Oligonucleotide 65 actttatttt caactagaaa 20 66
20 DNA Artificial Sequence Antisense Oligonucleotide 66 cggcggtcat
ggttggcact 20 67 20 DNA Artificial Sequence Antisense
Oligonucleotide 67 cccatactgg cggcggtcat 20 68 20 DNA Artificial
Sequence Antisense Oligonucleotide 68 ccgtccagca cgaggctcac 20 69
20 DNA Artificial Sequence Antisense Oligonucleotide 69 agaggccctt
gtgcgggtcg 20 70 20 DNA Artificial Sequence Antisense
Oligonucleotide 70 gagccgaagt cacagaagag 20 71 20 DNA Artificial
Sequence Antisense Oligonucleotide 71 aaggactctc cgctgcggta 20 72
20 DNA Artificial Sequence Antisense Oligonucleotide 72 cacgtgcact
ggtacttgca 20 73 20 DNA Artificial Sequence Antisense
Oligonucleotide 73 tcgcagcatt tcccgggcag 20 74 20 DNA Artificial
Sequence Antisense Oligonucleotide 74 ctcctcgcag catttcccgg 20 75
20 DNA Artificial Sequence Antisense Oligonucleotide 75 gggctcgtca
cacacccact 20 76 20 DNA Artificial Sequence Antisense
Oligonucleotide 76 gtctgggcca aacgtgtctt 20 77 20 DNA Artificial
Sequence Antisense Oligonucleotide 77 tctaatcata gttgggtctg 20 78
20 DNA Artificial Sequence Antisense Oligonucleotide 78 gaccaggcag
ttggctctaa 20 79 20 DNA Artificial Sequence Antisense
Oligonucleotide 79 ctctagcctg caggaggcgt 20 80 20 DNA Artificial
Sequence Antisense Oligonucleotide 80 atgttctctt ccaggtcagc 20 81
20 DNA Artificial Sequence Antisense Oligonucleotide 81 ggagattttg
ggagtacgga 20 82 20 DNA Artificial Sequence Antisense
Oligonucleotide 82 ttgataggct tggagatttt 20 83 20 DNA Artificial
Sequence Antisense Oligonucleotide 83 cacagaattt agctcggtat 20 84
20 DNA Artificial Sequence Antisense Oligonucleotide 84 ggccgtcggt
acatactcca 20 85 20 DNA Artificial Sequence Antisense
Oligonucleotide 85 tccaccggca gggtggtggt 20 86 20 DNA Artificial
Sequence Antisense Oligonucleotide 86 cagggcactt gaactccacc 20 87
20 DNA Artificial Sequence Antisense Oligonucleotide 87 ccgtcagggc
acttgaactc 20 88 20 DNA Artificial Sequence Antisense
Oligonucleotide 88 ggacagttgt aatggcaggc 20 89 20 DNA Artificial
Sequence Antisense Oligonucleotide 89 gtagtacagc gattcaaaga 20 90
20 DNA Artificial Sequence Antisense Oligonucleotide 90 tctggcttca
tgccatgtct 20 91 20 DNA Artificial Sequence Antisense
Oligonucleotide 91 tctctcactc tctggcttca 20 92 20 DNA Artificial
Sequence Antisense Oligonucleotide 92 tacggaaaaa tgagatgtga 20 93
20 DNA Artificial Sequence Antisense Oligonucleotide 93 atttaaataa
cttgtgctac 20 94 20 DNA Artificial Sequence Antisense
Oligonucleotide 94 ttcttcaaac cagtgtctgg 20 95 20 DNA Artificial
Sequence Antisense Oligonucleotide 95 cagtgagcac gctaaaattt 20 96
20 DNA Artificial Sequence Antisense Oligonucleotide 96 gttctgactt
aaggaacaac 20 97 20 DNA Artificial Sequence Antisense
Oligonucleotide 97 gctgtccagt ctaatcgaca 20 98 2330 DNA Mus
musculus CDS (204)...(1250) 98 agactcagcc agatccactc cagctccgac
cccaggagac cgacctcctc cagacggcag 60 cagccccagc ccagccgaca
accccagacg ccaccgcctg gagcgtccag acaccaacct 120 ccgcccctgt
ccgaatccag gctccagccg cgcctctcgt cgcctctgca ccctgctgtg 180
catcctccta ccgcgtcccg atc atg ctc gcc tcc gtc gca ggt ccc atc agc
233 Met Leu Ala Ser Val Ala Gly Pro Ile Ser 1 5 10 ctc gcc ttg gtg
ctc ctc gcc ctc tgc acc cgg cct gct acg ggc cag 281 Leu Ala Leu Val
Leu Leu Ala Leu Cys Thr Arg Pro Ala Thr Gly Gln 15 20 25 gac tgc
agc gcg caa tgt cag tgc gca gcc gaa gca gcg ccg cac tgc 329 Asp Cys
Ser Ala Gln Cys Gln Cys Ala Ala Glu Ala Ala Pro His Cys 30 35 40
ccc gcc ggc gtg agc ctg gtg ctg gac ggc tgc ggc tgc tgc cgc gtc 377
Pro Ala Gly Val Ser Leu Val Leu Asp Gly Cys Gly Cys Cys Arg Val 45
50 55 tgc gcc aag cag ctg gga gaa ctg tgt acg gag cgt gac ccc tgc
gac 425 Cys Ala Lys Gln Leu Gly Glu Leu Cys Thr Glu Arg Asp Pro Cys
Asp 60 65 70 cca cac aag ggc ctc ttc tgc gat ttc ggc tcc ccc gcc
aac cgc aag 473 Pro His Lys Gly Leu Phe Cys Asp Phe Gly Ser Pro Ala
Asn Arg Lys 75 80 85 90 att gga gtg tgc act gcc aaa gat ggt gca ccc
tgt gtc ttc ggt ggg 521 Ile Gly Val Cys Thr Ala Lys Asp Gly Ala Pro
Cys Val Phe Gly Gly 95 100 105 tcg gtg tac cgc agc ggt gag tcc ttc
caa agc agc tgc aaa tac caa 569 Ser Val Tyr Arg Ser Gly Glu Ser Phe
Gln Ser Ser Cys Lys Tyr Gln 110 115 120 tgc act tgc ctg gat ggg gcc
gtg ggc tgc gtg ccc cta tgc agc atg 617 Cys Thr Cys Leu Asp Gly Ala
Val Gly Cys Val Pro Leu Cys Ser Met 125 130 135 gac gtg cgc ctg ccc
agc cct gac tgc ccc ttc ccg aga agg gtc aag 665 Asp Val Arg Leu Pro
Ser Pro Asp Cys Pro Phe Pro Arg Arg Val Lys 140 145 150 ctg cct ggg
aaa tgc tgc gag gag tgg gtg tgt gac gag ccc aag gac 713 Leu Pro Gly
Lys Cys Cys Glu Glu Trp Val Cys Asp Glu Pro Lys Asp 155 160 165 170
cgc aca gca gtt ggc cct gcc cta gct gcc tac cga ctg gaa gac aca 761
Arg Thr Ala Val Gly Pro Ala Leu Ala Ala Tyr Arg Leu Glu Asp Thr 175
180 185 ttt ggc cca gac cca act atg atg cga gcc aac tgc ctg gtc cag
acc 809 Phe Gly Pro Asp Pro Thr Met Met Arg Ala Asn Cys Leu Val Gln
Thr 190 195 200 aca gag tgg agc gcc tgt tct aag acc tgt gga atg ggc
atc tcc acc 857 Thr Glu Trp Ser Ala Cys Ser Lys Thr Cys Gly Met Gly
Ile Ser Thr 205 210 215 cga gtt acc aat gac aat acc ttc tgc aga ctg
gag aag cag agc cgc 905 Arg Val Thr Asn Asp Asn Thr Phe Cys Arg Leu
Glu Lys Gln Ser Arg 220 225 230 ctc tgc atg gtc agg ccc tgc gaa gct
gac ctg gag gaa aac att aag 953 Leu Cys Met Val Arg Pro Cys Glu Ala
Asp Leu Glu Glu Asn Ile Lys 235 240 245 250 aag ggc aaa aag tgc atc
cgg aca cct aaa atc gcc aag cct gtc aag 1001 Lys Gly Lys Lys Cys
Ile Arg Thr Pro Lys Ile Ala Lys Pro Val Lys 255 260 265 ttt gag ctt
tct ggc tgc acc agt gtg aag aca tac agg gct aag ttc 1049 Phe Glu
Leu Ser Gly Cys Thr Ser Val Lys Thr Tyr Arg Ala Lys Phe 270 275 280
tgc ggg gtg tgc aca gac ggc cgc tgc tgc aca ccg cac aga acc acc
1097 Cys Gly Val Cys Thr Asp Gly Arg Cys Cys Thr Pro His Arg Thr
Thr 285 290 295 act ctg cca gtg gag ttc aaa tgc ccc gat ggc gag atc
atg aaa aag 1145 Thr Leu Pro Val Glu Phe Lys Cys Pro Asp Gly Glu
Ile Met Lys Lys 300 305 310 aat atg atg ttc atc aag acc tgt gcc tgc
cat tac aac tgt cct ggg 1193 Asn Met Met Phe Ile Lys Thr Cys Ala
Cys His Tyr Asn Cys Pro Gly 315 320 325 330 gac aat gac atc ttt gag
tcc ctg tac tac agg aag atg tac gga gac 1241 Asp Asn Asp Ile Phe
Glu Ser Leu Tyr Tyr Arg Lys Met Tyr Gly Asp 335 340 345 atg gcg taa
agccaggaag taagggacac gaactcatta gactataact 1290 Met Ala *
tgaactgagt tgcatctcat tttcttctgt aaaaacaatt acagtagcac attaatttaa
1350 atctgtgttt ttaactaccg tgggaggaac tatcccacca aagtgagaac
gttatgtcat 1410 ggccatacaa gtagtctgtc aacctcagac actggtttcg
agacagttta cacttgacag 1470 ttgttcatta gcgcacagtg ccagaacgca
cactgaggtg agtctcctgg aacagtggag 1530 atgccaggag aaagaaagac
aggtactagc tgaggttatt ttaaaagcag cagtgtgcct 1590 actttttgga
gtgtaaccgg ggagggaaat tatagcatgc ttgcagacag acctgctcta 1650
gcgagagctg agcatgtgtc ctccactaga tgaggctgag tccagctgtt ctttaagaac
1710 agcagtttca gctctgacca ttctgattcc agtgacactt gtcaggagtc
agagccttgt 1770 ctgttagact ggacagcttg tggcaagtaa gtttgcctgt
aacaagccag atttttattg 1830 atattgtaaa tattgtggat atatatatat
atatatatat atttgtacag ttatctaagt 1890 taatttaaag tcatttgttt
ttgttttaag tgcttttggg attttaaact gatagcctca 1950 aactccaaac
accataggta ggacacgaag cttatctgtg attcaaaaca aaggagatac 2010
tgcagtggga attgtgacct gagtgactct ctgtcagaac aaacaaatgc tgtgcaggtg
2070 ataaagctat gtattggaag tcagatttct agtaggaaat gtggtcaaat
ccctgttggt 2130 gaacaaatgg cctttattaa gaaatggctg gctcagggta
aggtccgatt cctaccagga 2190 agtgcttgct gcttctttga ttatgactgg
tttggggtgg ggggcagttt atttgttgag 2250 agtgtgacca aaagttacat
gtttgcactt tctagttgaa aataaagtat atatatattt 2310 ttatatgaaa
aaaaaaaaaa 2330 99 20 DNA Artificial Sequence Antisense
Oligonucleotide 99 actttttgcc cttcttaatg 20 100 20 DNA Artificial
Sequence Antisense Oligonucleotide 100 gacgctccag gcggtggcgt 20 101
20 DNA Artificial Sequence Antisense Oligonucleotide 101 gtctggacgc
tccaggcggt 20 102 20 DNA Artificial Sequence Antisense
Oligonucleotide 102 cggctggagc ctggattcgg 20 103 20 DNA Artificial
Sequence Antisense Oligonucleotide 103 gagaggcgcg gctggagcct 20 104
20 DNA Artificial Sequence Antisense Oligonucleotide 104 acgcggtagg
aggatgcaca 20 105 20 DNA Artificial Sequence Antisense
Oligonucleotide 105 gaggcgagca tgatcgggac 20 106 20 DNA Artificial
Sequence Antisense Oligonucleotide 106 ggcgcagacg cggcagcagc 20 107
20 DNA Artificial Sequence Antisense Oligonucleotide 107 tgcttggcgc
agacgcggca 20 108 20 DNA Artificial Sequence Antisense
Oligonucleotide 108 gcccttgtgt gggtcgcagg 20 109 20 DNA Artificial
Sequence Antisense Oligonucleotide 109 aatcgcagaa gaggcccttg 20 110
20 DNA Artificial Sequence Antisense Oligonucleotide 110 accgacccac
cgaagacaca 20 111 20 DNA Artificial Sequence Antisense
Oligonucleotide 111 ttggtatttg cagctgcttt 20 112 20 DNA Artificial
Sequence Antisense Oligonucleotide 112 cacgcagccc acggccccat 20 113
20 DNA Artificial Sequence Antisense Oligonucleotide 113 gcacgtccat
gctgcatagg 20 114 20 DNA Artificial Sequence Antisense
Oligonucleotide 114 gcagcttgac ccttctcggg 20 115 20 DNA Artificial
Sequence Antisense Oligonucleotide 115 actgctgtgc ggtccttggg 20 116
20 DNA Artificial Sequence Antisense Oligonucleotide 116 gtgtcttcca
gtcggtaggc 20 117 20 DNA Artificial Sequence Antisense
Oligonucleotide 117 aaggtattgt cattggtaac 20 118 20 DNA Artificial
Sequence Antisense Oligonucleotide 118 ggctctgctt ctccagtctg 20 119
20 DNA Artificial Sequence Antisense Oligonucleotide 119 tcttcacact
ggtgcagcca 20 120 20 DNA Artificial Sequence Antisense
Oligonucleotide 120 cgtctgtgca caccccgcag 20 121 20 DNA Artificial
Sequence Antisense Oligonucleotide 121 cggtgtgcag cagcggccgt 20 122
20 DNA Artificial Sequence Antisense Oligonucleotide 122 tccactggca
gagtggtggt 20 123 20 DNA Artificial Sequence Antisense
Oligonucleotide 123 catcatattc tttttcatga 20 124 20 DNA Artificial
Sequence Antisense Oligonucleotide 124 gtcattgtcc ccaggacagt 20 125
20 DNA Artificial Sequence Antisense Oligonucleotide 125 tcctggcttt
acgccatgtc 20 126 20 DNA Artificial Sequence Antisense
Oligonucleotide 126 aaatgagatg caactcagtt 20 127 20 DNA Artificial
Sequence Antisense Oligonucleotide 127 tcagtgtgcg ttctggcact 20 128
20 DNA Artificial Sequence Antisense Oligonucleotide 128 gttccaggag
actcacctca 20 129 20 DNA Artificial Sequence Antisense
Oligonucleotide 129 tctccactgt tccaggagac 20 130 20 DNA Artificial
Sequence Antisense Oligonucleotide 130 tctcctggca tctccactgt 20 131
20 DNA Artificial Sequence Antisense Oligonucleotide 131 tttctttctc
ctggcatctc 20 132 20 DNA Artificial Sequence Antisense
Oligonucleotide 132 tccccggtta cactccaaaa 20 133 20 DNA Artificial
Sequence Antisense Oligonucleotide 133 aggtctgtct gcaagcatgc 20 134
20 DNA Artificial Sequence Antisense Oligonucleotide 134 tgctcagctc
tcgctagagc 20 135 20 DNA Artificial Sequence Antisense
Oligonucleotide 135 agtgtcactg gaatcagaat 20 136 20 DNA Artificial
Sequence Antisense Oligonucleotide 136 caaatatata tatatatata 20 137
20 DNA Artificial Sequence Antisense Oligonucleotide 137 acttaaaaca
aaaacaaatg 20 138 20 DNA Artificial Sequence Antisense
Oligonucleotide 138 gctatcagtt taaaatccca 20 139 20 DNA Artificial
Sequence Antisense Oligonucleotide 139 gtgtcctacc tatggtgttt 20 140
20 DNA Artificial Sequence Antisense Oligonucleotide 140 tttgaatcac
agataagctt 20 141 20 DNA Artificial Sequence Antisense
Oligonucleotide 141 cagtatctcc tttgttttga 20 142 20 DNA Artificial
Sequence Antisense Oligonucleotide 142 attcccactg cagtatctcc 20 143
20 DNA Artificial Sequence Antisense Oligonucleotide 143 caggtcacaa
ttcccactgc 20 144 20 DNA Artificial Sequence Antisense
Oligonucleotide 144 ctgacagaga gtcactcagg 20 145 20 DNA Artificial
Sequence Antisense Oligonucleotide 145 gctttatcac ctgcacagca 20 146
20 DNA Artificial Sequence Antisense Oligonucleotide 146 tacatagctt
tatcacctgc 20 147 20 DNA Artificial Sequence Antisense
Oligonucleotide 147 cttccaatac atagctttat 20 148 20 DNA Artificial
Sequence Antisense Oligonucleotide 148 tctgacttcc aatacatagc
20 149 20 DNA Artificial Sequence Antisense Oligonucleotide 149
atttgttcac caacagggat 20 150 20 DNA Artificial Sequence Antisense
Oligonucleotide 150 ttaccctgag ccagccattt 20 151 20 DNA Artificial
Sequence Antisense Oligonucleotide 151 aagaagcagc aagcacttcc 20 152
20 DNA Artificial Sequence Antisense Oligonucleotide 152 cagtcataat
caaagaagca 20 153 20 DNA Artificial Sequence Antisense
Oligonucleotide 153 atatacttta ttttcaacta 20 154 18 DNA Artificial
Sequence PCR Primer 154 aaacggaagc gcactgaa 18 155 20 DNA
Artificial Sequence PCR Primer 155 gggactggcg agccttagtt 20 156 21
DNA Artificial Sequence PCR Probe 156 ccatccgtgg ccagatcctg t 21
157 18 DNA Artificial Sequence PCR Primer 157 ccgtccatcg agctgacc
18 158 19 DNA Artificial Sequence PCR Primer 158 tgcaacgtct
tcattcttc 19 159 22 DNA Artificial Sequence PCR Probe 159
acctcttggt gcgctactca cc 22 160 20 DNA Artificial Sequence
Antisense Compound 160 ccacaagctg tccagtctaa 20 161 20 DNA
Artificial Sequence Antisense Compound 161 ccttccctga aggttcctcc 20
162 21 DNA Artificial Sequence PCR Primer 162 gctcagggta aggtccgatt
c 21 163 15 DNA Artificial Sequence PCR Primer 163 gccccccacc ccaaa
15 164 29 DNA Artificial Sequence PCR Probe 164 tcataatcaa
agaagcagca agcacttcc 29 165 20 DNA Artificial Sequence PCR Primer
165 tggattcccg ttcgagtacg 20 166 20 DNA Artificial Sequence PCR
Primer 166 tcagctggat agcgacatcg 20 167 20 DNA Artificial Sequence
PCR Probe 167 aagcgagggc tccgacccga 20 168 22 DNA Artificial
Sequence PCR Primer 168 agaccaacaa gcaagtgagt gc 22 169 24 DNA
Artificial Sequence PCR Primer 169 ctagcatgtg agccacattc atcc 24
170 21 DNA Artificial Sequence PCR Probe 170 ctgctgaggg cacgctgagc
t 21
* * * * *