Modified small interfering RNA molecules and methods of use

Abstract

The present invention provides double-stranded RNA molecules that mediate RNA interference in target cells, preferably hepatic cells. The invention also provides double-stranded RNA molecules that are modified to be resistant to nuclease degradation, which inactivates a virus, and more specifically, hepatitis C virus (HCV). The invention also provides a method of using these modified RNA molecules to inactivate virus in mammalian cells and a method of making modified small interfering RNAs (siRNAs) using human Dicer.

Description

BACKGROUND OF THE INVENTION

[0001] The present invention relates to the field of nucleic acid detection and to the phenomenon of RNA silencing, or RNA interference (RNAi). RNA silencing constitutes a phenomenon wherein non-coding RNA molecules mediate specific gene suppression in an organism. In nature, the phenomenon protects an organism's genome from foreign, invading nucleic acids such as transposons, trangenes and viral genes.

[0002] The introduction of double-stranded RNA (dsRNA) into a cell triggers RNA silencing, which then degrades endogenous MRNA corresponding to the dsRNA. RNA silencing pathways involve a conversion of dsRNA into short interfering RNAs (siRNAs) that direct ribonucleases to homologous mRNA targets (Baulcombe et al., 2001). An enzyme called Dicer processes the dsRNA into siRNAs, which are 20-25 nucleotides long. The siRNAs then assemble into endoribonuclease-containing complexes known as RNA-induced silencing complexes (RISCs). Subsequently, the siRNAs guide the RISCs to complementary RNA molecules, where the RISCs cleave and destroy the target mRNA. Small amounts of dsRNA can silence a large amount of target mRNA due to an amplification component of RNA silencing (Fire et al., Nature, 391:806-811 (1998)).

[0003] The first evidence that dsRNA produces efficient gene silencing through RNAi came from studies on the nematode Caenorhabditis elegans (Fire et al., Nature, 391:806-811 (1998) and U.S. Pat. No. 6,506,559). Later studies in the fruit fly Drosophila melanogaster demonstrated that RNAi is a multi-step mechanism (Elbashir et al., Genes Dev., 15(2): 188-200 (2001)).

[0004] Although dsRNA can mediate gene-specific interference in mammalian cells (Wianny, F. and Zemicka-Goetz, M., Nature Cell Biol. 2:70-75 (2000) Svoboda, P. et al., Development 17:4147-4156 (2000)), the use of RNAi in mammalian somatic cells is often limited by a triggering of dsRNA-dependent protein kinase (PKR), which inactivates the translation factor eIF2a, causes a generalized suppression of protein synthesis and often times causes apoptosis (Gil, J. and Esteban, M., Apoptosis 5:107-114(2000)).

[0005] Recently, siRNA of approximately 21 or 22 base pairs in length, corresponding to targeted RNA or DNA sequences, were shown to disrupt the expression of the targeted sequences in mammalian cells (Elbashir, S. M., et al., Nature 411: 494-498 (2001)). However, it is not clear that all RNA or DNA sequences of a mammalian cell's genome are susceptible to siRNA. It is also uncertain that every mammalian cell type possesses the necessary machinery for effectuating gene-specific suppression using siRNA. Further, siRNA is of limited use for at least two reasons: (a) the transient nature of the suppression effect seen in cells where the siRNA has been administered, and (b) the necessity for chemical synthesis of siRNAs before their use (Tuschl, T., Nature Biotech., 20: 446-448 (2002)). Also, since siRNAs are unstable in vivo, their long-term effectiveness is limited.

[0006] An invention that addresses these challenges will improve the utility of RNAi for treating human disease at the level of nucleic acid activity. In particular, such an invention will make RNAi a more practical therapy for viral infections, such as infections with HCV. Current therapies for such viral infections are very limited, and tend to have poor response rates.

SUMMARY OF THE INVENTION

[0007] The present invention provides double-stranded RNA (dsRNA) molecules that mediate RNA interference in target cells. In particular, it provides small interfering RNAs (siRNAs) that inhibit viral replication in infected cells. Preferred dsRNA molecules of the invention correspond to hepatitis C virus (HCV) nucleic acids, and inhibit replication of HCV in hepatic cells.

[0008] In another aspect, the invention provides modified dsRNA, including siRNA, molecules that are protected against nuclease degradation, but are able to inhibit viral replication in mammalian cells.

[0009] The invention also provides methods of inhibiting viral replication in infected cells by administering dsRNA or siRNA molecules. Modified dsRNA and siRNA molecules are particularly useful in these methods, as they are nuclease resistant, yet retain the biological activity of being able to inhibit viral replication by targeting an RNA sequence in a virus.

[0010] The invention further provides a method of making modified siRNAs that target a viral RNA or DNA sequence. The method comprises preparing a dsRNA fragment that contains at least one modified ribonucleotide in at least one strand, and cleaving the dsRNA fragment with Dicer enzyme, resulting in more than one modified siRNA.

[0011] Other objects, features and advantages of the invention will become apparent from the following detailed description. The description and specific examples indicate preferred embodiments, but should not be considered limiting, as various modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description. Further, the examples demonstrate the principle of the invention, but cannot be expected to specifically illustrate all useful applications.

BRIEF DESCRIPTION OF THE DRAWINGS

[0012] FIG. 1 depicts the sequence and secondary structure of the 5' UTR from the HCV genome. It also provides specific sequences of siRNAs for inducing RNAi toward HCV in hepatic cells.

[0013] FIG. 2 provides sequences for several HCV-specific siRNAs that are useful for inducing RNAi toward HCV in hepatic cells. Each HCV-specific siRNA is identified by the designation provided in the first column.

[0014] FIG. 3 shows the nucleotide sequence of the SARS coronavirus.

[0015] FIG. 4 is a schematic representation of the open reading frames of the SARS coronavirus.

[0016] FIG. 5 depicts a subgenomic HCV replicon contained in the hepatoma cell line Huh 7, which was used to test the efficacy of siRNA in human liver cells.

[0017] FIG. 6 depicts the dose response of normalized luciferase activity in Huh-7 cells containing the subgenomic HCV replicon (5-2 line), that were administered different concentrations of siRNA5. Luciferase activity, which was measured at 1, 2 and 3 days post-transfection, fell with increasing doses of siRNA. The luciferase assay was performed using a Luciferase assay system available from Promega Corp. (Madison, Wis.), according to the manufacturer's instructions.

[0018] FIG. 7 depicts the sequence specificity of siRNA5 for inducing HCV-directed RNAi in Huh-7 liver cells.

[0019] FIG. 8 demonstrates that siRNA5 is not toxic to Huh-7 cells. ATPase levels were assayed using an ATPase assay kit available from Promega Corp. (Madison, Wis.), according to the manufacturer's instructions.

[0020] FIG. 9 depicts the effects of siRNA5 on HCV replication in 21-5 cells (Huh-7 cells containing full-length HCV), as measured by RNA assay. RNA levels were assayed using a TaqMan.TM. RNA kit (F. Hoffinan La-Roche, Switzerland), according to the manufacturer's instructions. Values are normalized.

[0021] FIG. 10 demonstrates that siRNA5 does not affect the viability of Huh 5-2 cells. Specifically, mRNA encoding GAPDH, an enzyme essential to glycolysis was measured in Huh 5-2 cells transfected with siRNA5 or GAPDH-specific siRNA. The graph demonstrates that siRNA5 did not affect RNA levels of GAPDH. GAPDH was measured using a TaqMan.TM. RNA kit (F. Hoffinan La-Roche, Switzerland), according to the manufacturer's instructions. Values are normalized.

[0022] FIG. 11 depicts a dose response of normalized luciferase activity in Huh 7 cells containing a subgenomic HCV replicon (5-2 line) that were administered different concentrations of 2'-fluoro-siRNA (2'-F-GL2), which targets the fruit fly luciferase gene. Luciferase activity, which was measured at 2 days post-transfection, fell with increasing doses of siRNA. The luciferase assay was performed using a Firefly Luciferase kit (Promega Corp., Madison, Wis.), according to the manufacturer's instructions.

[0023] FIG. 12 demonstrates an inhibition of luciferase activity in 5-2 cells using the siRNA Chol-GL2 in the absence of liposomes.

[0024] FIG. 13 depicts an autoradiograph of 5'-labeled siRNA duplexes separated by PAGE, and shows the stability of 2'-fluoro-modified siRNA (2'-F-GL2) incubated in human serum for up to 10 days. The siRNA duplexes were subjected to incubation with human serum and analysis by 20% PAGE. The composition of the lanes is as follows: Lanes 1, 11 and 21: .sup.32P-end labeled siRNA alone; Lanes 2-10, 12-20 and 22-25: siRNA incubated with human serum. Lanes 2 & 12, 1 min; Lanes 3 & 13, 5 min; Lanes 4 & 14, 15 min; Lanes 5 & 15,30 min; Lanes 6 & 16, 1 hr; Lanes 7 & 17,2 hr; Lanes 8 & 18,4 hr; Lanes 9 & 19, 8 hr; Lanes 10 & 20,24 hr; Lanes 22,24 hr; Lanes 23, 48 hr; Lanes 24, 120 hr; Lanes 25, 240 hr incubation, respectively.

[0025] FIG. 14 demonstrates the use of recombinant human dicer to convert fluorinated dsRNA into 2' F-siRNA. The composition of the lanes is as follows: Lane 1: size marker, .lambda..backslash.HindIII+.phi.X174.backsl- ash.HaeIII; Lane 2: ribo/ribo homoduplex RNA; Lane 3: ribo/2'-F heteroduplex RNA; Lane 4: 2'-F/ribo heteroduplex RNA; Lane 6: size marker, 10 bp DNA ladder; Lane 7: ribo/ribo homoduplex siRNA; Lane 8: ribo/2'-F heteroduplex siRNA; Lane 9: 2'-F/ribo heteroduplex siRNA; Lane 10: 2'-F/2'-F homoduplex siRNA.

[0026] FIG. 15 shows a dose response of normalized luciferase activity in Huh-7 cells containing the subgenomic HCV replicon (5-2 line) to HCV-specific siRNAs. Luciferase activity fell with increasing doses of each siRNA.

[0027] FIG. 16 shows that cholesterol shows a dose response of normalized luciferase activity in Huh-7 cells containing the subgenomic HCV replicon (5-2 line) to cholesterol-modified GL2 siRNA.

DETAILED DESCRIPTION OF THE INVENTION

[0028] The present invention provides dsRNA molecules that are about 10 to about 30 nucleotides long, and that mediate RNA interference in target cells. Preferably, the inventive molecules are chemically modified to confer increased stability against nuclease degradation, but retain the ability to bind to target nucleic acids.

[0029] As used herein, "RNA interference" (RNAi) refers to sequence-specific or gene specific suppression of gene expression (protein synthesis) that is mediated by siRNA, without generalized suppression of protein synthesis. While the invention is not limited to a particular theory or mode of action, RNAi may involve degradation of messenger RNA (mRNA) by an RNA-induced silencing complex (RISC), preventing translation of the transcribed MRNA. Alternatively, it may involve methylation of genomic DNA, which shunts transcription of a gene. The suppression of gene expression caused by RNAi may be transient or it may be more stable, even permanent. "Gene suppression", "targeted suppression", "sequence-specific suppression", "targeted RNAi" and "sequence-specific RNAi" are used interchangeably herein. Furthermore, sequence-specific suppression, as used herein, is determined by separately assaying levels of the protein targeted for suppression in cells containing the siRNA (experimental cells) and in cells not containing the identical siRNA (control cells), then comparing the two values. Experimental and control cells should be derived from the same source and same animal. Also, control and experimental cells used in determining the level or quantity of gene suppression should be assayed under similar, if not identical, conditions.

[0030] RNA is a polymer of ribonucleotides, each containing the sugar ribose in association with a phosphate group and a nitrogenous base (typically, adenine, guanine, cytosine, or uracil). Like its cousin, DNA, RNA can form complementary hydrogen bonds. Therefore, RNA may be double-stranded (dsRNA), single-stranded (ssRNA) or double-stranded with a single-stranded overhang. Common types of RNA include messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), micro RNA (miRNA) and small hairpin RNA (shRNA), each of which plays a specific role in biological cells. As used herein, the term "RNA" includes all of these.

[0031] "Small interfering RNA" (siRNA) refers to double-stranded RNA molecules from about 10 to about 30 nucleotides long that are named for their ability to specifically interfere with protein expression. Preferably, siRNA molecules are 12-28 nucleotides long, more preferably 15-25 nucleotides long, still more preferably 19-23 nucleotides long and most preferably 21-23 nucleotides long. Therefore, preferred siRNA molecules are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 28 or 29 nucleotides in length.

[0032] The length of one strand designates the length of an siRNA molecule. For instance, an siRNA that is described as 21 ribonucleotides long (a 21-mer) could comprise two opposite strands of RNA that anneal together for 19 contiguous base pairings. The two remaining ribonucleotides on each strand would form an "overhang." When an siRNA contains two strands of different lengths, the longer of the strands designates the length of the siRNA. For instance, a dsRNA containing one strand that is 21 nucleotides long and a second strand that is 20 nucleotides long, constitutes a 21-mer.

[0033] siRNAs that comprise an overhang are desirable. The overhang may be at the 5' or the 3' end of a strand. Preferably, it is at the 3' end of the RNA strand. The length of an overhang may vary, but preferably is about 1 to about 5 bases, and more preferably is about 2 nucleotides long. Preferably, the siRNA of the present invention will comprise a 3' overhang of about 2 to 4 bases. More preferably, the 3' overhang is 2 ribonucleotides long. Even more preferably, the 2 ribonucleotides comprising the 3' overhang are uridine (U).

[0034] siRNAs of the present invention are designed to interact with a target ribonucleotide sequence, meaning they complement a target sequence sufficiently to bind to the target sequence. Preferably the target ribonucleotide sequence derives from a disease producing agent or pathogen. More preferably, the target ribonucleotide sequence is in a virus genome of an RNA virus or a DNA virus. Even more preferably, the virus is selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus.

[0035] Hepatitis C virus (HCV) is a highly preferred virus target. FIG. 1 and FIG. 2 disclose the nucleic acid sequences for several HCV-specific siRNA molecules. Among those shown, siRNA5, siRNAC1, siRNAC2, siRNA5B1, siRNA5B2, and siRNA5B4 have shown particularly good activity, and therefore are highly preferred. siRNAs at least 80%, 90%, or 95%, identical to these highly preferred siRNAs also constitute part of the invention.

[0036] Another preferred virus target is the coronavirus, which is associated with upper respiratory infections in humans and recently has been linked with SARS (severe acute respiratory syndrome). Coronavirus has the largest known RNA virus genome, 32 kilobases long, and its genome is composed of positively stranded RNA. (See FIG. 5) Each coronavirus mRNA has a 5'-end leader sequence of 60 to 80 nucleotides that is identical to the 5'-UTR of genomic RNA approximately 200 nucleotides long. (See FIG. 6) These sequences are highly conserved, and therefore, provide an excellent source of target sequences for which siRNAs. See Fundamental Virology, 3.sup.rd Ed., Chapter 18, p. 541-560 (Eds. Fields, Knipe and Howley), Lippincott-Raven (1995). In one embodiment, the entire leader sequence (nucleotides 1-72) is targeted. In another embodiment, one or more sections of the leader sequence is targeted. In a preferred embodiment, nucleotides 64-72 (TAAACGAAC) of the leader sequence are targeted. siRNA targeted to the coronavirus may be modified or unmodified.

[0037] In one embodiment, the invention provides an siRNA molecule comprising a ribonucleotide sequence at least 80% identical to a ribonucleotide sequence from a target agent or virus. Preferably, the siRNA molecule is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the ribonucleotide sequence of the target agent or virus. The target can be the entire viral genome, a primary transcript, an open reading frame, or any portion of these. Most preferably, an siRNA will be 100% identical to the nucleotide sequence of a target agent or virus. However, siRNA molecules with insertions, deletions or single point mutations relative to a target may also be effective. Tools to assist siRNA design are readily available to the public. For example, a computer-based siRNA design tool is available on the internet at www.dharmacon.com.

[0038] By way of example, a polynucleotide having a nucleotide sequence at least 95% "identical" to a reference nucleotide sequence means that the polynucleotide's sequence may include up to five point mutations per 100 nucleotides of the reference nucleotide sequence, or 1 point mutation per 20 nucleotides. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

[0039] As a practical matter, whether any particular nucleic acid molecule is at least 90%, 95%, 96%, 97% 98%, 99% or 100% identical to the ribonucleotide sequence of a target agent or virus can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, Madison, Wis.). Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489 (1981)) to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference ribonucleotide sequence and that gaps in homology of up to 5% of the total number of ribonucleotides in the reference sequence are allowed.

[0040] The present invention also includes siRNA molecules that have been chemically modified to confer increased stability against nuclease degradation, but retain the ability to bind to target nucleic acids that may be present in cells. In the case where a target RNA is virus-specific, the modified siRNAs are able to bind to the virus specific RNAs or DNAs, thereby inactivating the virus.

[0041] A modified siRNA of the present invention comprises a modified ribonucleotide, and is resistant to enzymatic degradation, such as RNase degradation, yet retains the ability to inhibit viral replication in a cell containing the specific viral target RNA or DNA sequences. The siRNA may be modified at any position of the molecule so long as the modified siRNA binds to a target sequence and is resistant to enzymatic degradation. Modifications in the siRNA may be in the nucleotide base, i.e., the purine or the pyrimidine, the ribose or the phosphate. Preferably, the modification occurs at the 2' position of at least one ribose in an siRNA.

[0042] More specifically, the siRNA is modified in at least one pyrimidine, at least one purine or a combination thereof. However, generally all pyrimidines (cytosine or uracil), or all purines (adenosine or guanine) or a combination of all pyrimidines and all purines of the siRNA are modified. More preferably, the pyrimidines are modified, and these pyrimidines are cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof. Ribonucleotides on either one or both strands of the siRNA may be modified.

[0043] Ribonucleotides containing pyrimidine bases found in RNA (cytidine and uridine) can be chemically modified by adding any molecule that inhibits RNA degradation or breakdown of the base, the ribose or the phosphates. As previously noted, the 2' position of ribose is a preferred site for modification. 2' modified siRNAs have a longer serum half-life and are resistant to degradation, relative to unmodified siRNAs or single-stranded RNAs, such as antisense or ribozyme. 2'-modified pyrimidine ribonucleotides can be formed by a number of different methods known in the art.

[0044] A preferable chemical modification is the addition of a molecule from the halide chemical group to a ribonucleotide of siRNA. Within the halides, fluorine is a preferred molecule. Besides fluoro-, other chemical moieties such as methyl-, methoxyethyl- and propyl- may be added as modifications. The most preferred modification, though, is fluoro-modification, such as a 2'-fluoro-modification or a 2',2'-fluoro-modification.

[0045] Thus, in a preferred embodiment of the invention, siRNA is modified by the addition of a fluorine molecule to the 2' carbon of a pyrimidine ribonucleotide. The siRNA may be fluorinated completely or partially. For example, only the cytosine ribonucleotides may be fluorinated. Alternatively, only the uracil ribonucleotides may be fluorinated. In a preferred embodiment, both uracil and cytosine are fluorinated. Only one strand, either sense or antisense, of siRNA may to be fluorinated. Even partial 2' fluorination of siRNA gives protection against nucleolytic degradation. Importantly, 2' fluorinated siRNA is not toxic to cells, an unexpected result given that fluorine chemistry usually is toxic to living organisms.

[0046] In addition, modified siRNAs of the present invention may contain chemical modifications that inhibit viral RNA polymerases. For example, siRNAs may comprise one or more nucleosides that inhibit viral RNA-dependent RNA polymerases. Examples of such nucleosides and other chemical modifications exist in WO 02/057425, WO 02/057287, WO 02/18404, WO 02/100415, WO 02/32920, WO 01/90121, U.S. Pat. No. 6,063,628 and U.S. published application No. 2002/0019363.

[0047] siRNA can be prepared in a number of ways, such as by chemical synthesis, T7 polymerase transcription, or by treating long double stranded RNA (dsRNA) prepared by one of the two previous methods with Dicer enzyme. Dicer enzyme creates mixed populations of dsRNA from about 21 to about 23 base pairs in length from dsRNA that is about 500 base pairs to about 1000 base pairs in size. Unexpectedly, Dicer can effectively cleave modified strands of dsRNA, such as 2' fluoro-modified dsRNA. Before development of this method, it was previously thought that Dicer would not be able to cleave modified siRNA. The Dicer method of preparing siRNAs can be performed using a Dicer siRNA Generation Kit available from Gene Therapy Systems (San Diego, Calif.).

[0048] The invention particularly includes a method of making a modified siRNA that targets a nucleic acid sequence in a virus, comprising (a) preparing a modified-double stranded RNA (dsRNA) fragment containing at least one modified ribonucleotide in at least one strand, and (b) cleaving the modified-dsRNA fragments with recombinant human Dicer, resulting in more than one modified siRNA. The method may further comprise (c) isolating the modified siRNAs.

[0049] In the methods for making siRNA, a dsRNA fragment can be prepared by chemical synthesis or in vitro translation. In one embodiment, the modified siRNA is a 2' modified siRNA in which the modification is at the 2' position of at least one ribonucleotide of said siRNA. The modification is selected from the group consisting of fluoro-, methyl-, methoxyethyl and propyl-modification. Preferably the fluoro- modification is a 2'-fluoro-modification or a 2',2'-fluoro-modification. The pyrimidines, the purines or a combination thereof of the siRNA are modified. More preferably, the pyrimidines are modified, such as cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof. One or both strands of the siRNA may contain one or more modified ribonucleotide.

[0050] The invention further provides a method of inactivating a target agent or virus in a patient by administering to the patient a dsRNA in an effective amount to inactivate the targeted agent or virus. Preferably the dsRNA is modified as described above. RNA interference toward a targeted DNA segment in a cell can be achieved by administering a double-stranded RNA molecule to the cells, wherein the ribonucleotide sequence of the double-stranded RNA molecule corresponds to the ribonucleotide sequence of the targeted DNA segment. Preferably, the dsRNA used to induce targeted RNAI is siRNA.

[0051] As used herein "targeted DNA segment" is used to mean a DNA sequence encoding, in whole or in part, an mRNA for a targeted protein, including introns or exons, where suppression is desired. DNA segment can also mean a DNA sequence that normally regulates expression of the targeted protein, including but not limited to the promoter of the targeted protein. Furthermore, the DNA segment may or may not be a part of the cell's genome or it may be extrachromosomal, such as plasmid DNA.

[0052] The present invention is particularly directed to a method of inactivating a virus in a patient by administering to the patient an siRNA, preferably a modified siRNA, in an effective amount to inactivate the virus. The siRNA is preferably about 10 to about 30 ribonucleotides in length, more preferably 12-28 ribonucleotides, more preferably 15-25 ribonucleotides, even more preferably 19-23 ribonucleotides and most preferably 21-23 ribonucleotides.

[0053] Also, the method of inactivating a virus preferably utilizes an siRNA that is modified at the 2' position of at least one ribonucleotide of said siRNA. The siRNA may be modified with chemical groups selected from the group consisting of fluoro-, methyl-, methoxyethyl- and propyl-. Fluoro-modification is most preferred, and either a 2'-fluoro-modification or a 2',2'-fluoro-modification is useful in the method. The modification may be at a pyrimidine, a purine or a combination thereof of the siRNA. More preferably the pyrimidines are modified, such as cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof. In one embodiment, one strand of the siRNA contains at least one modified ribonucleotide, while in another embodiment, both strands of the siRNA contain at least one modified ribonucleotide.

[0054] siRNAs useful in treatment methods may also be modified by the attachment of at least one, but preferably more than one, receptor-binding ligand(s) to the siRNA. Such ligands are useful to direct delivery of siRNA to a target virus in a body system, organ, tissue or cells of a patient, such as the liver, gastrointestinal tract, respiratory tract, the cervix or the skin.

[0055] In preferred embodiments, receptor-binding ligands are attached to either a 5'-end or a 3'-end of an siRNA molecule. Receptor-binding ligands may be attached to one or more siRNA ends, including any combination of 5'- and 3'-ends. Thus, when receptor binding ligands are attached only to the ends of an siRNA molecule, anywhere between 1 and 4 such ligands may be attached.

[0056] The selection of an appropriate ligand for targeting siRNAs to viruses in particular body systems, organs, tissues or cells is considered to be within the ordinary skill of the art. For example, to target an siRNA to hepatocytes, cholesterol may be attached at one or more ends, including any combination of 5'- and 3'-ends, of an siRNA molecule. The resultant cholesterol-siRNA is delivered to hepatocytes in the liver, thereby providing a means to deliver siRNAs to this targeted location. Other ligands useful for targeting siRNAs to the liver include HBV surface antigen and low-density lipoprotein (LDL).

[0057] As another example, siRNA molecules that target Human Immunodeficiency virus type 1 (HIV-1) can be delivered to T lymphocytes where the target nucleic acids are located (Song, E. et al., J. of Virology, 77(13): 7174-7181 (2003)). This delivery can be accomplished by attaching, at the 3'-end or 5'-end of siRNA molecules, HIV-1 surface antigen capable of binding to the CD4 surface protein located on T-cells (Kilby, M. et al., New England J. of Medicine, 348(22): 2228-38 (2003)).

[0058] Similarly, siRNA molecules that target Influenza A virus can be delivered to epithelial cells of the respiratory tract where the target nucleic acids are located (Ge, Q. et al., Proc. Natl. Acad. of Sciences, 100(5): 2718-2723 (2002)). This delivery can be accomplished by attaching, at the 3'-end or 5'-end of siRNA molecules, the Influenza virus surface antigen, which is capable of binding to the sialic acid residues located on the surface of the epithelial cells (Ohuchi, M., et al., J. of Virology, 76(24): 12405-12413 (2002); Glick, G. et al., J. of Biol. Chem., 266 (35): 23660-23669 (1991)).

[0059] Also, siRNA molecules that target respiratory syncitial virus (RSV) can be delivered to epithelial cells of the respiratory tract where the target nucleic acids are located (Bitko, V. et al., BMC Microbiology, 1:34 (2001)). This delivery can be accomplished by attaching, at the 3'-end or 5'-end of siRNA molecules, RSV surface antigen (Malhotra, R. et al., Microbes and Infection, 5: 123-133 (2003)).

[0060] As still another example, siRNAs that target Human Papillomavirus (HPV) can be delivered to basal epithelial cells where the target nucleic acids are located (Hall, A. et al., J. of Virology, 77(10): 6066-6069 (2003)). This delivery can be accomplished by attaching, at the 3'-end or 5'-end of siRNA molecules, HPV surface antigen capable of binding to heparin sulfate proteoglycans located on the surface of basal epithelial cells (Bousarghin L. et al., J. of Virology, 77(6): 3846-3850 (2002)).

[0061] Further, siRNAs that target Poliovirus (PV) can be delivered to cells of the nervous system where the target nucleic acids are located (Gitlin, L. et al., Nature, 418: 430-434 (2002)). This delivery can be accomplished by attaching, at the 3'-end or 5'-end of siRNA molecules, PV surface antigen capable of binding to the CD155 receptor located on the surface of neurons (He, Y. et al., Proc. Natl. Acad. of Sciences, 97 (1): 79-84 (2000)).

[0062] As noted, the methods of treatment are intended to target disease-causing agents or pathogens, and more particularly viruses, which can be either RNA viruses or DNA viruses. Preferred viruses are selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus. More preferably the target virus is hepatitis C virus or a coronavirus.

[0063] In one aspect, the method utilizes an siRNA prepared by (a) identifying a target ribonucleotide sequence in a virus genome for designing a small interfering RNA (siRNA) and (b) producing a siRNA that has been modified to contain at least one modified ribonucleotide. Preferably, the siRNA comprises a double-stranded RNA molecule with a first strand ribonucleotide sequence corresponding to a ribonucleotide sequence corresponding to a target ribonucleotide sequence in the virus, and a second strand comprising a ribonucleotide sequence complementary to the target ribonucleotide sequence. The first and second strands should be separate complementary strands that hybridize to each other to form a double-stranded RNA molecule. Moreover, one or both of the strands should comprise at least one modified ribonucleotide.

[0064] In preferred embodiments of the invention, the siRNA targets a ribonucleotide sequence in the hepatitis C virus genome. The target ribonucleotide sequence comprises a conserved ribonucleotide sequence necessary for HCV replication, and the conserved ribonucleotide sequence is selected from the group consisting of 5'-untranslated region (5'-UTR), 3'-untranslated region (3'-UTR), core, and NS3 helicase. Highly preferred siRNA molecules comprise a sequence at least 80% identical to those of siRNA5, siRNAC1, siRNAC2, siRNA5B1, siRNA5B2, or siRNA5B4. The siRNAs may be unmodified, or modified as described above. Methods of inhibiting the replication of HCV in cells positive for HCV should not be toxic to the cells, or cause apoptosis in the treated cells. Preferably, the inhibition of HCV replication is specifically tailored to affect only HCV replication in the cells, such that normal growth, division or metabolism is not affected. Cells in which HCV has been shown to replicate include, but are not limited to hepatic cells, B cell lymphocytes and T cell lymphocytes. Preferably, a method of inhibiting the replication of HCV is performed in hepatic cells.

[0065] According to the invention, "hepatic cells" can be from any animal source. Further, the hepatic cells may be in cell culture, or part of a tissue, or an organ, in part or in whole. The phrase hepatic cells is meant to include any cell constituting a normal, abnormal or diseased liver cell. Examples of hepatic cells include, but are not limited to, Kupffer cells, hepatocytes and cells comprising a hepatocellular carcinoma. "Hepatic cells" is not meant to include cells that make up discrete structures within the liver, such as endothelial cells lining blood vessels. A tissue or organ containing the hepatic cells may be within a subject or may be biopsied or removed from the animal. Additionally, the tissue may be "fresh" in that the tissue would be recently removed from a subject, without any preservation steps between the excision and the methods of the current invention. Prior to application of the methods of the current invention, the tissue may also have been preserved by such standard tissue preparation techniques including, but not limited to, freezing, quick freezing, paraffin embedding and tissue fixation. Furthermore, the tissue may also be a xenograft or a syngraft on or in another host animal. As used herein, the terms animal and subject are used interchangeably.

[0066] According to the invention, "hepatitis C virus," or "HCV," takes its ordinary meaning in the art as of the date of invention. The hepatitis C virus is an RNA virus of the Flaviviridae family. For example as used herein, HCV includes, but is not limited to genotypes 1-11 (using the most common genotyping system), with these genotypes being broken down into sub-types, some of which include but are not limited to 1a, 1b, 1c, 2a, 2b, 2c, 3a, 3b, 4a, 4b, 4c, 4d, 4e, 5a, 6a, 7a, 7b, 8a, 8b, 9a, 10a and 11a. Further, isolates from individuals consist of closely related yet heterogeneous populations of viral genomes, sometimes referred to as quasispecies.

[0067] Pestivirus is yet another target of the present invention. As used herein, "pestivirus" takes its ordinary meaning in the art as of the date of invention. The pestivirus belongs to the family Flaviviridae. Pestivirus is widespread throughout the Australian cattle population. It is believed that about 70% of herds are actively infected with pestivirus. Infection of susceptible animals can cause a variety of diseases--some not apparent until well after the initial spread of the virus into a herd. Pestivirus is a genus of viruses that includes hog cholera virus, bovine viral diarrhea virus (BVDV) and border disease virus (BDV) or hairy-shaker disease virus.

[0068] siRNA may be administered to a patient by intravenous injection, subcutaneous injection, oral delivery, liposome delivery or intranasal delivery. The siRNA may then accumulate in a target body system, organ, tissue or cell type of the patient.

[0069] The present invention also provides a method of inhibiting the replication of a virus in mammalian cells, comprising transfecting cells harboring the virus with a vector that directs the expression of virus-specific siRNA. In one embodiment, the invention provides a method of inhibiting the replication of hepatitis C virus (HCV) in cells positive for HCV, comprising transfecting HCV-positive cells with a vector that directs the expression of an HCV-specific siRNA. The cells may be evaluated to determine if a marker in the cells has been inhibited by the siRNA.

[0070] Thus, the invention also provides vectors and host cells comprising a nucleic acid segment encoding the described siRNAs.

[0071] Vectors of the present invention may be employed for producing siRNAs by recombinant techniques. Thus, for example, a DNA segment encoding an siRNA may be included in any one of a variety of expression vectors for expressing any DNA sequence. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in a desired host.

[0072] The appropriate DNA segment may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

[0073] The DNA segment in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct siRNA synthesis. Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous Sarcoma Virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I promoter. Preferably the promoters of the present invention are from the type III class of RNA polymerase III promoters. More preferably, the promoters are selected from the group consisting of the U6 and H1 promoters. The U6 and H1 promoters are both members of the type III class of RNA polymerase III promoters. The promoters of the present invention may also be inducible, in that expression may be turned "on" or "off." For example, a tetracycline-regulatable system employing the U6 promoter may be used to control the production of siRNA. The expression vector may or may not contain a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

[0074] In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline or ampicillin resistance.

[0075] Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

[0076] In one embodiment, the invention provides a vector, wherein the DNA segment encoding the sense strand of the RNA polynucleotide is operably linked to a first promoter and where the DNA segment encoding the antisense (opposite) strand of the RNA polynucleotide molecule of is operably linked to a second promoter. In other words, each strand of the RNA polynucleotide is independently expressed. Furthermore, the promoter driving expression of each strand can be identical or each one may be different from the other promoter.

[0077] In another embodiment, the vector of the current invention may comprise opposing promoters. For example, the vector may comprise two U6 promoters on either side of the DNA segment encoding the sense strand of the RNA polynucleotide and placed in opposing orientations, with or without a transcription terminator placed between the two opposing promoters. The U6 opposing promoter construct is similar to the T7 opposing promoter construct as described in Wang, Z. et al., J. Biol. Chem. 275: 40174-40179 (2000). See Miyagishi, M. and Taira, K., Nature Biotech. 20: 497-500 (2002).

[0078] In another embodiment, the DNA segments encoding both strands of the RNA polynucleotide are under the control of a single promoter. In one embodiment, the DNA segments encoding each strand are arranged on the vector with a "loop" region interspersed between the two DNA segments, where transcription f the DNA segments and loop region creates one RNA transcript. The single transcript will, in turn, anneal to itself creating a "hairpin" RNA structure capable of inducing RNAi. The "loop" of the hairpin structure is preferably from about 4 to about 6 nucleotides in length. More preferably, the loop is 4 nucleotides in length.

[0079] The vector containing the appropriate DNA sequence as described herein, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the siRNA. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. (1989), the disclosure of which is hereby incorporated by reference.

[0080] Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, cloning vectors or expression vectors. The vectors may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells may be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

[0081] In a further embodiment, the present invention relates to host cells containing the above-described constructs. A host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell may be a prokaryotic cell, such as a bacterial cell. Preferably, host cells are mammalian cells. More preferably, host cells are hepatic cells. Introduction of a construct into host cells can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., et al., Basic Methods in Molecular Biology (1986)).

[0082] The term patient, as used herein, refers to an animal, preferably a mammal. More preferably the patient can be a primate, including non-human and humans. The terms subject and patient are used interchangeably herein.

[0083] The treatments envisioned by the current invention can be used for subjects with a pre-existing viral infection, or for subjects pre-disposed to an infection. Additionally, the methods of the current invention can be used to correct or compensate for cellular or physiological abnormalities involved in conferring susceptibility to viral infections in patients, and/or to alleviate symptoms of a viral infections in patients, or as a preventative measure in patients.

[0084] The method of treating a patient having a viral infection involves administration of compositions to the subjects. As used herein, composition can mean a pure compound, agent or substance or a mixture of two or more compounds, agents or substances. As used herein, the term agent, substance or compound is intended to mean a protein, nucleic acid, carbohydrate, lipid, polymer or a small molecule, such as a drug.

[0085] In one embodiment of the current invention, the composition administered to the subject is a pharmaceutical composition. Further, the pharmaceutical composition can be administered orally, nasally, parenterally, intrasystemically, intraperitoneally, topically (as by drops or transdermal patch), bucally, or as an oral or nasal spray. Intranasal delivery of a virus that causes upper respiratory diseases, such as the coronavirus or the metapneumovirus, would be a particularly advantageous delivery mode. The term "parenteral," as used herein, refers to modes of administration that include intravenous, intramuscular, intraperitoneal, intrastemal, subcutaneous and intraarticular injection and infusion. The pharmaceutical compositions as contemplated by the current invention may also include a pharmaceutically acceptable carrier.

[0086] "Pharmaceutically acceptable carrier" includes, but is not limited to, a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type, such as liposomes.

[0087] A pharmaceutical composition of the present invention for parenteral injection can comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0088] The compositions of the present invention can also contain adjuvants such as, but not limited to, preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorb acid, and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

[0089] In some cases, to prolong the effect of the drugs, it is desirable to slow the absorption from subcutaneous or intramuscular injection. This can be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, can depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

[0090] Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.

[0091] The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.

[0092] Solid dosage forms for oral administration include, but are not limited to, capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compounds are mixed with at least one item pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, acetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form can also comprise buffering agents.

[0093] Solid compositions of a similar type can also be employed as fillers in soft and hard filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.

[0094] The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They can optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes.

[0095] The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0096] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms can contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

[0097] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0098] Suspensions, in addition to the active compounds, can contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.

[0099] Alternatively, the composition can be pressurized and contain a compressed gas, such as nitrogen or a liquefied gas propellant. The liquefied propellant medium and indeed the total composition is preferably such that the active ingredients do not dissolve therein to any substantial extent. The pressurized composition can also contain a surface active agent. The surface active agent can be a liquid or solid non-ionic surface active agent or can be a solid anionic surface active agent. It is preferred to use the solid anionic surface active agent in the form of a sodium salt.

[0100] The compositions of the present invention can also be administered in the form of liposomes. As is known in the art, liposomes are generally derived from phospholipids or other lipid substances. Liposomes are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any non- toxic, physiologically acceptable and metabolizable lipid capable of forming liposomes can be used. The present compositions in liposome form can contain, in addition to the compounds of the invention, stabilizers, preservatives, excipients, and the like. The preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods to form liposomes are known in the art (see, for example, Prescott, Ed., Meth. Cell Biol. 14:33 et seq (1976)).

[0101] One of ordinary skill in the art will appreciate that effective amounts of the agents of the invention can be determined empirically and can be employed in pure form or, where such forms exist, in pharmaceutically acceptable salt, ester or prodrug form. A "therapeutically effective" amount of the inventive compositions can be determined by prevention or amelioration of adverse conditions or symptoms of diseases, injuries or disorders being treated. The agents can be administered to a subject, in need of treatment of viral infection, as pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the agents or composition of the present invention will be decided by the attending physician within the scope of sound medical judgement. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors: the type and degree of the cellular or physiological response to be achieved; activity of the specific agent or composition employed; the specific agents or composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the agent; the duration of the treatment; drugs used in combination or coincidental with the specific agent; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the agents at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosages until the desired effect is achieved.

[0102] Dosing also can be arranged in a patient specific manner to provide a predetermined concentration of the agents in the blood, as determined by techniques accepted and routine in the art. Thus patient dosaging can be adjusted to achieve regular on-going blood levels, as measured by HPLC, on the order of from 50 to 1000 ng/ml.

[0103] It will be readily apparent to one of ordinary skill in the relevant arts that other suitable modifications and adaptations to the methods and applications described herein can be made without departing from the scope of the invention or any embodiment thereof.

EXAMPLES

[0104] The examples demonstrate that siRNA, including modified siRNA, can effectively inhibit viral replication in mammalian cells. Moreover, the examples show that the inventive siRNAs promote HCV RNA degradation in human liver cells and establish that hepatocytes possess the necessary functional components of modified siRNA-induced silencing. The examples also demonstrate that siRNA technology can be used as a therapy to inhibit HCV replication in host cells. The inventors, by submitting the following examples, do not intend to limit the scope of the claimed invention.

EXAMPLE 1

[0105] To test whether siRNA directed to the HCV genome confers intracellular immunity against this human pathogen, a recently developed HCV cell culture systems in human hepatoma cell line, Huh-7, was used. One of the cell lines, 5-2, harbors autonomously replicating subgenomic HCV RNA (Bartenschlager, J. Virol, 2001). The subgenomic replicon carries firefly luciferase gene, allowing a reporter function assay as a measure of HCV RNA replication (FIG. 5). Owing to cell culture adaptive mutations introduced into the genome (Bart), these 5-2 cells replicate HCV RNA at levels of up to 5.times.10.sup.4 virus particles/cell.

[0106] Using T7 transcription, several 21-bp siRNA duplexes against different regions of the 5'-UTR of the HCV genome were made (FIG. 5). Briefly, 2 oligo double-stranded DNA molecules comprising the T7 promoter and the 5' UTR of HCV being oriented in either the sense direction or the antisense direction were generated. Each oligo DNA was then transcribed in vitro to produce (+) and (-) RNA and then treated with DNAase I to remove the DNA template. The two RNA strands were allowed to anneal at 37.degree. C. overnight, generating dsRNA. After treating the dsRNA with RNAase T1 to remove unreacted ssRNA species, the dsRNA was purified for transfection.

[0107] Several other siRNA duplexes were designed, including GL2 and GL3, that were directed against the fruit fly and sea pansy luciferase genes, respectively. Using standard transfection techniques, the siRNAs were transfected into the 5-2 cells and luciferase activity was measured to determine the effect of the siRNAs on HCV replication. Luciferase activity was measured 48 hours after transfection. In cells where siRNA5 was transfected, there was reduced luciferase activity of up to 85%, in a dose responsive manner (FIG. 6). The inhibition of luciferase activity was not seen in cells that were transfected with irrelevant siRNA (SIN). The sequence of SIN was taken from sindbis virus transcription promoter (FIG. 1).

EXAMPLE 2

[0108] The sequence specificity of the siRNA5 response was further tested using additional siRNA duplexes, GL2 and GL3. FIG. 1 shows that GL2 and GL3 differ from each other by 3-nucleotides. Luciferase activity was reduced by 90% in cells transfected with siRNA5 or GL2, but no significant reduction was seen in cells transfected with GL3 (FIG. 7). The luciferase assay was performed using a Luciferase assay system available from Promega Corp. (Madison, Wis.), according to the manufacturer's instructions.

EXAMPLE 3

[0109] Whether or not siRNA5 was toxic to transfected cells also was tested. Toxicity was by measured using an ATPase activity assay. FIG. 8 shows that the siRNA5-induced reduction in HCV replication, as seen in FIG. 6, was not due to cellular toxicity which is attributed to non sequence-specific RNAi. ATPase levels were assayed using an ATPase assay kit from Promega (Madison, Wis.) according to the manufacturer's instructions.

EXAMPLE 4

[0110] The full-length HCV replicon may possess the ability to adapt and suppress RNAI, thus replicating in spite of the presence of siRNA, as documented in Li, H, Science 296:1319-1321 (2002). To determine the effects of siRNA5 on replication of full-length HCV RNA in Huh-7 cells, from the 21-5 cell line, harboring the selectable full-length HCV replicon, were treated with siRNA5. Levels of HCV RNA were measured by quantitative PCR using TaqMan.TM. (F. Hoffinan La-Roche, Switzerland). The results as seen in FIG. 9 show that siRNA-directed silencing reduced steady-state viral RNA production, even in the setting of an adapted HCV mutant, where RNA replication was very high. Results from both subgenomic and full-length HCV replicons suggest that none of the HCV proteins can suppress RNA interference.

EXAMPLE 5

[0111] Whether or not siRNA5 was toxic to transfected cells also was tested. Specifically, MRNA encoding GAPDH, an enzyme essential in glycolysis, was measured in Huh 5-2 cells transfected with siRNA5, or siRNA specific towards the GAPDH sequence. FIG. 10 demonstrates that siRNA5 did not affect RNA levels of GAPDH. GAPDH was measured using a TaqMan.TM. RNA kit (F. Hoffinan La-Roche, Switzerland) according to the manufacturer's instructions.

EXAMPLE 6

[0112] To test the effectiveness of siRNA5 on inhibiting the ability of HCV to replicate in an infected liver, potions of HCV-infected human liver are xenografted onto transgenic severe combined immunodeficient (SCID) mice according to methods well known to the skilled artisan.

[0113] Briefly, once the HCV-infected liver has supplanted the mouse liver, liposome-encapsulated siRNA5, or control liposomes are administered by intravenous injection to the mice through the tail vein, or another accessible vein. The mice are dosed one time a day for 3-10 days.

[0114] At the end of the dosing regimen the mice are sacrificed and blood collected and the livers removed. The liver is divided into portions such that a portion is frozen using liquid nitrogen, a portion is fixed for paraffin embedding, and a portion is fixed for sectioning onto slides.

[0115] Using the appropriate allotment, HCV RNA is quantified using the TaqMan.TM. RNA assay kit previously utilized herein to determine the levels of HCV RNA in the liver cells. Further, anti-HCV antibody titers can be measured in the collected blood samples, along with serum ALT levels.

EXAMPLE 7

[0116] To test the effectiveness of siRNA5 on inhibiting the ability of HCV to infect a healthy liver, potions of normal human liver are xenografted onto transgenic severe combined immunodeficient (SCID) mice according to methods well known to the skilled artisan.

[0117] Briefly, once the healthy liver has supplanted the mouse liver, liposome-encapsulated siRNA5, or control liposomes are administered by intravenous injection to the mice through the tail vein, or another accessible vein. The mice are dosed one time a day for 3-10 days. After the pre-dosing regimen, active HCV is then injected intravenously, or via hepatic injection, into the mice.

[0118] At about 6, 12, 18, 24 hours, and periodically up to about 5 days after the mice are infected with HCV, the mice are sacrificed and blood collected and the livers removed. The liver is divided into portions such that a portion is frozen using liquid nitrogen, a portion is fixed for paraffin embedding, and a portion is fixed for sectioning onto slides.

[0119] Using the appropriate allotment, HCV RNA is quantified using the TaqMan.TM. RNA assay kit previously utilized herein to determine the levels of HCV RNA in the liver cells. Further, anti-HCV antibody titers can be measured in the collected blood samples, along with serum ALT levels.

EXAMPLE 8

[0120] Modified siRNA can be prepared by chemical synthesis. In one embodiment, each C and U within a siRNA duplex, e.g. GL2, can be substituted with 2'-F-U and 2' F-C. To produce siRNA with 3'-end overhangs comprising 2'-F-U and 2' F-C, a universal support can be used. By selectively cleaving the oligo from the support, a practitioner can ensure that residues of the overhangs comprise modified nucleotides. Alternatively, the nucleotides comprising the 3'-end overhang can be unmodified dTdT.

[0121] 2'-F RNA oligonucleotides can be synthesized on an Applied Biosystems 8909 or 8905 DNA/RNA synthesizer using the standard 1 .mu.mol beta-cyanoethyl phosphoramidite RNA chemistry protocol. The RNA phosphoramidite monomers and columns of Pac-A, 2'-F-Ac-C, iPr-Pac-G, 2'-F-U, and U-RNA CPG can be obtained from Glen Research (Sterling, VA). (See catalog nos. 10-3000-05, 10-3415-02, 10-3021-05, 10-3430-02, and 20-3430-41E, respectively.) Glen Research's Sulfurizing Reagent (catalog no. 40-4036-10) can be used as an oxidant to obtain a single phosphorothioate backbone between the 3' CPG and a subsequent base. To attain the coupling, the oxidizing step of the standard RNA 1 .mu.mol protocol can be replaced with the standard thioate 1 .mu.mol protocol. Cholesteryl-TEG phosphoramidite (Glen Research, catalog no. 10-1975-90) and cholestryl-TEG CPG (Glen Research, catalog no. 20-2975-41E) can be incorporated onto the 5' or 3' ends of one or more of the oliogoribonucleotides. After synthesis, the 2'-F RNA's are cleaved and deprotected with 1:1 ammonium hydroxide/methylamine, and the silyl groups are removed with triethylamine trihydrofluoride using standard protocols. See e.g. http://www.glenres.com/productfiles/technical/tb_rnadeprotection- .pdf. The oligoribonucleotides are then desalted on Sephadex G25 columns (Pharmacia NAP 25, catalog no. 17-08252-02) with sterilized water and purified using standard gel electrophoresis protocols. Modified siRNAs also can be obtained from commercial vendors such as Dharmacon (Lafayette, Col.).

[0122] Alternatively, modified siRNA can be prepared by transcription using the Durascribe.TM. T7 Transcription Kit purchased from Epicentre Technologies (Madison, Wis.).

[0123] The modified siRNAs (dsRNAs) made by these methods contain phosphodiester linked oligonucleotides. Standard methods for making modified single-stranded RNAs, such as antisense molecules, are useful for making modified siRNAs, as modified single-stranded RNAs can be annealed together to form double stranded RNAs. Such standard methods include, but are not limited to, those described in Chiang et al., J. Biol. Chem. 266, 18162-18171 (1991); Baker et al., J. Biol. Chem. 272, 11994-12000 (1997); Kawasaki et al., J. Med. Chem. 36, 831-841 (1993); Monia et al., J. Biol. Chem. 268, 14514-14522 (1993).

EXAMPLE 9

[0124] To test whether siRNA directed to the HCV genome confers intracellular immunity against this human pathogen, a recently developed HCV cell culture systems in human hepatoma cell line, Huh-7, was used. One of the cell lines, 5-2, harbors autonomously replicating subgenomic HCV RNA (Bartenschlager, J. Virol, 2001). The subgenomic replicon carries firefly luciferase gene, allowing a reporter function assay as a measure of HCV RNA replication. Owing to cell culture adaptive mutations introduced into the genome, 5-2 cells replicate HCV RNA at levels of up to 5.times.10.sup.4 virus particles/cell.

[0125] Using T7 transcription, several 21-bp siRNA duplexes against different regions of the 5'-UTR of the HCV genome were made. Briefly, two oligo double-stranded DNA molecules comprising the T7 promoter and the 5' UTR of HCV being oriented in either the sense direction or the antisense direction were generated. Each oligo DNA was then transcribed in vitro to produce (+) and (-) RNA and then treated with DNAase I to remove the DNA template. The two RNA strands were allowed to anneal at 37.degree. C. overnight, generating dsRNA. After treating the dsRNA with RNAase T1 to remove the unreacted ssRNA species, the dsRNA was purified for transfection.

[0126] Two exemplary modified siRNAs are provided below:

1 Chol-GL2 Chol-CGUACGCGGAAUACUUCGAUU UUGCAUGCGCCUUAUGAAGCU GL2 CGUACGCGGAAUACUUCGAUU UUGCAUGCGCCUUAUGAAGCU

[0127] Each C and U within siRNA GL2, directed against the fruit fly luciferase gene, was substituted with 2'-F-U and 2.degree. F-C. The modified siRNAs were transfected into the 5-2 cells using standard liposome transfection techniques. Specifically, the modified siRNAs were incubated for 4 hrs at 37.degree. C. in a 250 .mu.l cell suspension containing 0.5 .mu.l of Oligofectamine (Invitrogen, Carlsbad, Calif.), for 20 hrs in 375 .mu.l serum containing culture medium, and for 24 hrs at 37.degree. C. in fresh medium without the liposome-siRNA complex. Luciferase activity was measured 48 hours after transfection to determine the effect of the modified siRNAs on HCV replication.

[0128] FIG. 11 shows that GL2 reduced the luciferase activity at increasing concentrations. Luciferase activity was reduced by 90% in cells transfected with 2'-F-GL2, but no significant reduction was seen in mocked transfected cells or with a control (2'-F-GFP=green fluorescent protein). The luciferase assay was carried out using a Luciferase assay system available from Promega Corp. (Madison, Wis.), according to the manufacturer's instructions.

[0129] The siRNA Chol-GL2 comprises a cholesteryl group on one of the 5' ends. 5-2 cells were incubated with various concentrations of Chol-GL2 in the absence of liposomes. Cells were harvested 48 hours after incubation and assayed for luciferase activity. FIG. 12 shows that Chol-GL2 inhibited luciferase gene activity in a dose-dependent manner. InvA refers to chol-GL2 in inverted sequence.

EXAMPLE 10

[0130] To test the stability of 2' chemically modified siRNA compared to unmodified siRNA (siRNA), the following experiment is performed. Four nanograms of siRNA are added to a 20 .mu.L volume of 80% human serum from a healthy donor. This mixture is incubated at 37.degree. C. for various times ranging from 1 minute up to 10 days. The results are depicted in lanes 2-10 of FIG. 13. The same process is performed for 2' fluorine modified siRNA (2'-F siRNA) as well and the results are shown in lanes 12-20 and 22-25 of FIG. 3. When the incubation process is finished, the mixtures are placed on ice and then immediately separated by PAGE along with a .sup.32P-siRNA control (See Lanes 1, 11 and 21 of FIG. 13). The data show that the 2'-modified siRNA is stable over a period of 10 days as compared to unmodified siRNA.

EXAMPLE 11

[0131] To demonstrate the production of modified siRNA from long dsRNA, five micrograms of 1000 bp-long fluorinated dsRNAs (FIG. 14, panel (A)) were incubated overnight with 15 units of human Dicer at 37.degree. C. The resulting diced-siRNAs were purified using a Sephadex G-25 column and electrophoresed on 20% PAGE (FIG. 14, panel (B)). FIG. 4 shows that recombinant human dicer effectively converts fluorinated-dsRNA into 2'F-siRNA.

EXAMPLE 12

[0132] To further test whether siRNAs directed to the HCV genome confer intracellular immunity against this human pathogen, the assay described in Example 1 was employed to test siRNAC 1, siRNAC2, siRNA5B 1, siRNA5B2, and siRNA5B4, each of which is shown in FIG. 2. Each siRNA was tested at concentrations of 1 nM, 10 nM and 100 nM. As shown in FIG. 15, each of the siRNAs significantly inhibited luciferase activity in a dose-dependent manner. SiRNAC2 exhibited particular effectiveness.

EXAMPLE 13

[0133] As a follow-up to the experiments reported in Example 9, assays were performed to demonstrate that the cholesterol modification, and not the fluoro modification directed siRNA molecules to Huh-7 liver cells. Huh-7 cells were incubated with various concentrations of two kinds of Chol-GL2 siRNAs: one having a 2'-fluoro modification and the other lacking such a modification. The results, shown in FIG. 16 demonstrate that the deliver of cholesterol-modified siRNA molecules to liver cells is due to the cholesterol, and not other modifications.

Sequence CWU 1

1

67 1 21 RNA Hepatitis C virus 1 guacugccug auagggugcu u 21 2 21 RNA Hepatitis C virus 2 gcacccuauc aggcaguacu u 21 3 21 RNA Hepatitis C virus 3 cguacgcgga auacuucgau u 21 4 21 RNA Hepatitis C virus 4 ucgaaguauu ccgcguacgu u 21 5 21 RNA Hepatitis C virus 5 cguacgcgga auacuucgau u 21 6 21 RNA Hepatitis C virus 6 ucgaaguauu ccgcguacgu u 21 7 21 RNA Hepatitis C virus 7 aucucuacgg ugguccuaau u 21 8 21 RNA Hepatitis C virus 8 uuaggaccac cguagagauu u 21 9 383 RNA Hepatitis C virus 9 gccagccccc gauugggggc gacacuccac cauagaucac uccccuguga ggaacuacug 60 ucuucacgca gaaagcgucu agccauggcg uuaguaugag ugucgugcag ccuccaggac 120 ccccccuccc gggagagcca uaguggucug cggaaccggu gaguacaccg gaauugccag 180 gacgaccggg uccuuucuug gaucaacccg cucaaugccu ggagauuugg gcgugccccc 240 gcgagacugc uagccgagua guguuggguc gcgaaaggcc uugugguacu gccugauagg 300 gugcuugcga gugccccggg aggucucgua gaccgugcac caugagcacg aauccuaaac 360 cucaaagaaa aaccaaacgu aac 383 10 23 RNA Hepatitis C virus 10 cccugugagg aacuacuguc uuc 23 11 23 RNA Hepatitis C virus 11 uacugucuuc acgcagaaag cgu 23 12 23 RNA Hepatitis C virus 12 cgagacugcu agccgaguag ugu 23 13 23 RNA Hepatitis C virus 13 gaauccuaaa ccucaaagaa aaa 23 14 23 RNA Hepatitis C virus 14 ggucagaucg ucgguggagu uua 23 15 23 RNA Hepatitis C virus 15 gguaagguca ucgauacccu cac 23 16 23 RNA Hepatitis C virus 16 acggcgugaa cuaugcaaca ggg 23 17 23 RNA Hepatitis C virus 17 ccgguugcuc cuuuucuauc uuc 23 18 23 RNA Hepatitis C virus 18 gcucuucaua cggauuccaa uac 23 19 23 RNA Hepatitis C virus 19 cauacggauu ccaauacucu ccu 23 20 23 RNA Hepatitis C virus 20 uuugacucaa cggucacuga gaa 23 21 23 RNA Hepatitis C virus 21 ccuucacgga ggcuaugacu aga 23 22 23 RNA Hepatitis C virus 22 auacgacuug gaguugauaa cau 23 23 23 RNA Hepatitis C virus 23 auuccuggcu aggcaacauc auc 23 24 23 RNA Hepatitis C virus 24 uuguggcaag uaccucuuca acu 23 25 23 RNA Hepatitis C virus 25 auguggugcc uacuccuacu uuc 23 26 23 RNA Hepatitis C virus 26 cuuugguggc uccaucuuag ccc 23 27 23 RNA Hepatitis C virus 27 gucacggcua gcugugaaag guc 23 28 23 RNA Hepatitis C virus 28 agccgcuuga cugcagagag ugc 23 29 21 RNA Hepatitis C virus 29 cugugaggaa cuacugucuu c 21 30 21 RNA Hepatitis C virus 30 agacaguagu uccucacagg g 21 31 21 RNA Hepatitis C virus 31 cugucuucac gcagaaagcg u 21 32 21 RNA Hepatitis C virus 32 gcuuucugcg ugaagacagu a 21 33 21 RNA Hepatitis C virus 33 agacugcuag ccgaguagug u 21 34 21 RNA Hepatitis C virus 34 acuacucggc uagcagucuc g 21 35 21 RNA Hepatitis C virus 35 auccuaaacc ucaaagaaaa a 21 36 21 RNA Hepatitis C virus 36 uuucuuugag guuuaggauu c 21 37 21 RNA Hepatitis C virus 37 ucagaucguc gguggaguuu a 21 38 21 RNA Hepatitis C virus 38 aacuccaccg acgaucugac c 21 39 21 RNA Hepatitis C virus 39 uaaggucauc gauacccuca c 21 40 21 RNA Hepatitis C virus 40 gaggguaucg augaccuuac c 21 41 21 RNA Hepatitis C virus 41 ggcgugaacu augcaacagg g 21 42 21 RNA Hepatitis C virus 42 cuguugcaua guucacgccg u 21 43 21 RNA Hepatitis C virus 43 gguugcuccu uuucuaucuu c 21 44 21 RNA Hepatitis C virus 44 agauagaaaa ggagcaaccg g 21 45 21 RNA Hepatitis C virus 45 ucuucauacg gauuccaaua c 21 46 21 RNA Hepatitis C virus 46 auuggaaucc guaugaagag c 21 47 21 RNA Hepatitis C virus 47 uacggauucc aauacucucc u 21 48 21 RNA Hepatitis C virus 48 gagaguauug gaauccguau g 21 49 21 RNA Hepatitis C virus 49 ugacucaacg gucacugaga a 21 50 21 RNA Hepatitis C virus 50 cucagugacc guugagucaa a 21 51 21 RNA Hepatitis C virus 51 uucacggagg cuaugacuag a 21 52 21 RNA Hepatitis C virus 52 uagucauagc cuccgugaag g 21 53 21 RNA Hepatitis C virus 53 acgacuugga guugauaaca u 21 54 21 RNA Hepatitis C virus 54 guuaucaacu ccaagucgua u 21 55 21 RNA Hepatitis C virus 55 uccuggcuag gcaacaucau c 21 56 21 RNA Hepatitis C virus 56 ugauguugcc uagccaggaa u 21 57 21 RNA Hepatitis C virus 57 guggcaagua ccucuucaac u 21 58 21 RNA Hepatitis C virus 58 uugaagaggu acuugccaca a 21 59 21 RNA Hepatitis C virus 59 guggugccua cuccuacuuu c 21 60 21 RNA Hepatitis C virus 60 aaguaggagu aggcaccaca u 21 61 21 RNA Hepatitis C virus 61 uugguggcuc caucuuagcc c 21 62 21 RNA Hepatitis C virus 62 gcuaagaugg agccaccaaa g 21 63 21 RNA Hepatitis C virus 63 cacggcuagc ugugaaaggu c 21 64 21 RNA Hepatitis C virus 64 ccuuucacag cuagccguga c 21 65 21 RNA Hepatitis C virus 65 ccgcuugacu gcagagagug c 21 66 21 RNA Hepatitis C virus 66 acucucugca gucaagcggc u 21 67 29751 DNA Severe acute respiratory syndrome virus 67 ttattaggtt tttacctacc caggaaaagc caaccaacct cgatctcttg tagatctgtt 60 ctctaaacga actttaaaat ctgtgtagct gtcgctcggc tgcatgccta gtgcacctac 120 gcagtataaa caataataaa ttttactgtc gttgacaaga aacgagtaac tcgtccctct 180 tctgcagact gcttacggtt tcgtccgtgt tgcagtcgat catcagcata cctaggtttc 240 gtccgggtgt gaccgaaagg taagatggag agccttgttc ttggtgtcaa cgagaaaaca 300 cacgtccaac tcagtttgcc tgtccttcag gttagagacg tgctagtgcg tggcttcggg 360 gactctgtgg aagaggccct atcggaggca cgtgaacacc tcaaaaatgg cacttgtggt 420 ctagtagagc tggaaaaagg cgtactgccc cagcttgaac agccctatgt gttcattaaa 480 cgttctgatg ccttaagcac caatcacggc cacaaggtcg ttgagctggt tgcagaaatg 540 gacggcattc agtacggtcg tagcggtata acactgggag tactcgtgcc acatgtgggc 600 gaaaccccaa ttgcataccg caatgttctt cttcgtaaga acggtaataa gggagccggt 660 ggtcatagct atggcatcga tctaaagtct tatgacttag gtgacgagct tggcactgat 720 cccattgaag attatgaaca aaactggaac actaagcatg gcagtggtgc actccgtgaa 780 ctcactcgtg agctcaatgg aggtgcagtc actcgctatg tcgacaacaa tttctgtggc 840 ccagatgggt accctcttga ttgcatcaaa gattttctcg cacgcgcggg caagtcaatg 900 tgcactcttt ccgaacaact tgattacatc gagtcgaaga gaggtgtcta ctgctgccgt 960 gaccatgagc atgaaattgc ctggttcact gagcgctctg ataagagcta cgagcaccag 1020 acacccttcg aaattaagag tgccaagaaa tttgacactt tcaaagggga atgcccaaag 1080 tttgtgtttc ctcttaactc aaaagtcaaa gtcattcaac cacgtgttga aaagaaaaag 1140 actgagggtt tcatggggcg tatacgctct gtgtaccctg ttgcatctcc acaggagtgt 1200 aacaatatgc acttgtctac cttgatgaaa tgtaatcatt gcgatgaagt ttcatggcag 1260 acgtgcgact ttctgaaagc cacttgtgaa cattgtggca ctgaaaattt agttattgaa 1320 ggacctacta catgtgggta cctacctact aatgctgtag tgaaaatgcc atgtcctgcc 1380 tgtcaagacc cagagattgg acctgagcat agtgttgcag attatcacaa ccactcaaac 1440 attgaaactc gactccgcaa gggaggtagg actagatgtt ttggaggctg tgtgtttgcc 1500 tatgttggct gctataataa gcgtgcctac tgggttcctc gtgctagtgc tgatattggc 1560 tcaggccata ctggcattac tggtgacaat gtggagacct tgaatgagga tctccttgag 1620 atactgagtc gtgaacgtgt taacattaac attgttggcg attttcattt gaatgaagag 1680 gttgccatca ttttggcatc tttctctgct tctacaagtg cctttattga cactataaag 1740 agtcttgatt acaagtcttt caaaaccatt gttgagtcct gcggtaacta taaagttacc 1800 aagggaaagc ccgtaaaagg tgcttggaac attggacaac agagatcagt tttaacacca 1860 ctgtgtggtt ttccctcaca ggctgctggt gttatcagat caatttttgc gcgcacactt 1920 gatgcagcaa accactcaat tcctgatttg caaagagcag ctgtcaccat acttgatggt 1980 atttctgaac agtcattacg tcttgtcgac gccatggttt atacttcaga cctgctcacc 2040 aacagtgtca ttattatggc atatgtaact ggtggtcttg tacaacagac ttctcagtgg 2100 ttgtctaatc ttttgggcac tactgttgaa aaactcaggc ctatctttga atggattgag 2160 gcgaaactta gtgcaggagt tgaatttctc aaggatgctt gggagattct caaatttctc 2220 attacaggtg tttttgacat cgtcaagggt caaatacagg ttgcttcaga taacatcaag 2280 gattgtgtaa aatgcttcat tgatgttgtt aacaaggcac tcgaaatgtg cattgatcaa 2340 gtcactatcg ctggcgcaaa gttgcgatca ctcaacttag gtgaagtctt catcgctcaa 2400 agcaagggac tttaccgtca gtgtatacgt ggcaaggagc agctgcaact actcatgcct 2460 cttaaggcac caaaagaagt aacctttctt gaaggtgatt cacatgacac agtacttacc 2520 tctgaggagg ttgttctcaa gaacggtgaa ctcgaagcac tcgagacgcc cgttgatagc 2580 ttcacaaatg gagctatcgt cggcacacca gtctgtgtaa atggcctcat gctcttagag 2640 attaaggaca aagaacaata ctgcgcattg tctcctggtt tactggctac aaacaatgtc 2700 tttcgcttaa aagggggtgc accaattaaa ggtgtaacct ttggagaaga tactgtttgg 2760 gaagttcaag gttacaagaa tgtgagaatc acatttgagc ttgatgaacg tgttgacaaa 2820 gtgcttaatg aaaagtgctc tgtctacact gttgaatccg gtaccgaagt tactgagttt 2880 gcatgtgttg tagcagaggc tgttgtgaag actttacaac cagtttctga tctccttacc 2940 aacatgggta ttgatcttga tgagtggagt gtagctacat tctacttatt tgatgatgct 3000 ggtgaagaaa acttttcatc acgtatgtat tgttcctttt accctccaga tgaggaagaa 3060 gaggacgatg cagagtgtga ggaagaagaa attgatgaaa cctgtgaaca tgagtacggt 3120 acagaggatg attatcaagg tctccctctg gaatttggtg cctcagctga aacagttcga 3180 gttgaggaag aagaagagga agactggctg gatgatacta ctgagcaatc agagattgag 3240 ccagaaccag aacctacacc tgaagaacca gttaatcagt ttactggtta tttaaaactt 3300 actgacaatg ttgccattaa atgtgttgac atcgttaagg aggcacaaag tgctaatcct 3360 atggtgattg taaatgctgc taacatacac ctgaaacatg gtggtggtgt agcaggtgca 3420 ctcaacaagg caaccaatgg tgccatgcaa aaggagagtg atgattacat taagctaaat 3480 ggccctctta cagtaggagg gtcttgtttg ctttctggac ataatcttgc taagaagtgt 3540 ctgcatgttg ttggacctaa cctaaatgca ggtgaggaca tccagcttct taaggcagca 3600 tatgaaaatt tcaattcaca ggacatctta cttgcaccat tgttgtcagc aggcatattt 3660 ggtgctaaac cacttcagtc tttacaagtg tgcgtgcaga cggttcgtac acaggtttat 3720 attgcagtca atgacaaagc tctttatgag caggttgtca tggattatct tgataacctg 3780 aagcctagag tggaagcacc taaacaagag gagccaccaa acacagaaga ttccaaaact 3840 gaggagaaat ctgtcgtaca gaagcctgtc gatgtgaagc caaaaattaa ggcctgcatt 3900 gatgaggtta ccacaacact ggaagaaact aagtttctta ccaataagtt actcttgttt 3960 gctgatatca atggtaagct ttaccatgat tctcagaaca tgcttagagg tgaagatatg 4020 tctttccttg agaaggatgc accttacatg gtaggtgatg ttatcactag tggtgatatc 4080 acttgtgttg taataccctc caaaaaggct ggtggcacta ctgagatgct ctcaagagct 4140 ttgaagaaag tgccagttga tgagtatata accacgtacc ctggacaagg atgtgctggt 4200 tatacacttg aggaagctaa gactgctctt aagaaatgca aatctgcatt ttatgtacta 4260 ccttcagaag cacctaatgc taaggaagag attctaggaa ctgtatcctg gaatttgaga 4320 gaaatgcttg ctcatgctga agagacaaga aaattaatgc ctatatgcat ggatgttaga 4380 gccataatgg caaccatcca acgtaagtat aaaggaatta aaattcaaga gggcatcgtt 4440 gactatggtg tccgattctt cttttatact agtaaagagc ctgtagcttc tattattacg 4500 aagctgaact ctctaaatga gccgcttgtc acaatgccaa ttggttatgt gacacatggt 4560 tttaatcttg aagaggctgc gcgctgtatg cgttctctta aagctcctgc cgtagtgtca 4620 gtatcatcac cagatgctgt tactacatat aatggatacc tcacttcgtc atcaaagaca 4680 tctgaggagc actttgtaga aacagtttct ttggctggct cttacagaga ttggtcctat 4740 tcaggacagc gtacagagtt aggtgttgaa tttcttaagc gtggtgacaa aattgtgtac 4800 cacactctgg agagccccgt cgagtttcat cttgacggtg aggttctttc acttgacaaa 4860 ctaaagagtc tcttatccct gcgggaggtt aagactataa aagtgttcac aactgtggac 4920 aacactaatc tccacacaca gcttgtggat atgtctatga catatggaca gcagtttggt 4980 ccaacatact tggatggtgc tgatgttaca aaaattaaac ctcatgtaaa tcatgagggt 5040 aagactttct ttgtactacc tagtgatgac acactacgta gtgaagcttt cgagtactac 5100 catactcttg atgagagttt tcttggtagg tacatgtctg ctttaaacca cacaaagaaa 5160 tggaaatttc ctcaagttgg tggtttaact tcaattaaat gggctgataa caattgttat 5220 ttgtctagtg ttttattagc acttcaacag cttgaagtca aattcaatgc accagcactt 5280 caagaggctt attatagagc ccgtgctggt gatgctgcta acttttgtgc actcatactc 5340 gcttacagta ataaaactgt tggcgagctt ggtgatgtca gagaaactat gacccatctt 5400 ctacagcatg ctaatttgga atctgcaaag cgagttctta atgtggtgtg taaacattgt 5460 ggtcagaaaa ctactacctt aacgggtgta gaagctgtga tgtatatggg tactctatct 5520 tatgataatc ttaagacagg tgtttccatt ccatgtgtgt gtggtcgtga tgctacacaa 5580 tatctagtac aacaagagtc ttcttttgtt atgatgtctg caccacctgc tgagtataaa 5640 ttacagcaag gtacattctt atgtgcgaat gagtacactg gtaactatca gtgtggtcat 5700 tacactcata taactgctaa ggagaccctc tatcgtattg acggagctca ccttacaaag 5760 atgtcagagt acaaaggacc agtgactgat gttttctaca aggaaacatc ttacactaca 5820 accatcaagc ctgtgtcgta taaactcgat ggagttactt acacagagat tgaaccaaaa 5880 ttggatgggt attataaaaa ggataatgct tactatacag agcagcctat agaccttgta 5940 ccaactcaac cattaccaaa tgcgagtttt gataatttca aactcacatg ttctaacaca 6000 aaatttgctg atgatttaaa tcaaatgaca ggcttcacaa agccagcttc acgagagcta 6060 tctgtcacat tcttcccaga cttgaatggc gatgtagtgg ctattgacta tagacactat 6120 tcagcgagtt tcaagaaagg tgctaaatta ctgcataagc caattgtttg gcacattaac 6180 caggctacaa ccaagacaac gttcaaacca aacacttggt gtttacgttg tctttggagt 6240 acaaagccag tagatacttc aaattcattt gaagttctgg cagtagaaga cacacaagga 6300 atggacaatc ttgcttgtga aagtcaacaa cccacctctg aagaagtagt ggaaaatcct 6360 accatacaga aggaagtcat agagtgtgac gtgaaaacta ccgaagttgt aggcaatgtc 6420 atacttaaac catcagatga aggtgttaaa gtaacacaag agttaggtca tgaggatctt 6480 atggctgctt atgtggaaaa cacaagcatt accattaaga aacctaatga gctttcacta 6540 gccttaggtt taaaaacaat tgccactcat ggtattgctg caattaatag tgttccttgg 6600 agtaaaattt tggcttatgt caaaccattc ttaggacaag cagcaattac aacatcaaat 6660 tgcgctaaga gattagcaca acgtgtgttt aacaattata tgccttatgt gtttacatta 6720 ttgttccaat tgtgtacttt tactaaaagt accaattcta gaattagagc ttcactacct 6780 acaactattg ctaaaaatag tgttaagagt gttgctaaat tatgtttgga tgccggcatt 6840 aattatgtga agtcacccaa attttctaaa ttgttcacaa tcgctatgtg gctattgttg 6900 ttaagtattt gcttaggttc tctaatctgt gtaactgctg cttttggtgt actcttatct 6960 aattttggtg ctccttctta ttgtaatggc gttagagaat tgtatcttaa ttcgtctaac 7020 gttactacta tggatttctg tgaaggttct tttccttgca gcatttgttt aagtggatta 7080 gactcccttg attcttatcc agctcttgaa accattcagg tgacgatttc atcgtacaag 7140 ctagacttga caattttagg tctggccgct gagtgggttt tggcatatat gttgttcaca 7200 aaattctttt atttattagg tctttcagct ataatgcagg tgttctttgg ctattttgct 7260 agtcatttca tcagcaattc ttggctcatg tggtttatca ttagtattgt acaaatggca 7320 cccgtttctg caatggttag gatgtacatc ttctttgctt ctttctacta catatggaag 7380 agctatgttc atatcatgga tggttgcacc tcttcgactt gcatgatgtg ctataagcgc 7440 aatcgtgcca cacgcgttga gtgtacaact attgttaatg gcatgaagag atctttctat 7500 gtctatgcaa atggaggccg tggcttctgc aagactcaca attggaattg tctcaattgt 7560 gacacatttt gcactggtag tacattcatt agtgatgaag ttgctcgtga tttgtcactc 7620 cagtttaaaa gaccaatcaa ccctactgac cagtcatcgt atattgttga tagtgttgct 7680 gtgaaaaatg gcgcgcttca cctctacttt gacaaggctg gtcaaaagac ctatgagaga 7740 catccgctct cccattttgt caatttagac aatttgagag ctaacaacac taaaggttca 7800 ctgcctatta atgtcatagt ttttgatggc aagtccaaat gcgacgagtc tgcttctaag 7860 tctgcttctg tgtactacag tcagctgatg tgccaaccta ttctgttgct tgaccaagct 7920 cttgtatcag acgttggaga tagtactgaa gtttccgtta agatgtttga tgcttatgtc 7980 gacacctttt cagcaacttt tagtgttcct atggaaaaac ttaaggcact tgttgctaca 8040 gctcacagcg agttagcaaa gggtgtagct ttagatggtg tcctttctac attcgtgtca 8100 gctgcccgac aaggtgttgt tgataccgat gttgacacaa aggatgttat tgaatgtctc 8160 aaactttcac atcactctga cttagaagtg acaggtgaca gttgtaacaa tttcatgctc 8220 acctataata aggttgaaaa catgacgccc agagatcttg gcgcatgtat tgactgtaat 8280 gcaaggcata tcaatgccca agtagcaaaa agtcacaatg tttcactcat ctggaatgta 8340 aaagactaca tgtctttatc tgaacagctg cgtaaacaaa ttcgtagtgc tgccaagaag 8400 aacaacatac cttttagact aacttgtgct acaactagac aggttgtcaa tgtcataact 8460 actaaaatct cactcaaggg tggtaagatt gttagtactt gttttaaact tatgcttaag 8520 gccacattat tgtgcgttct tgctgcattg gtttgttata tcgttatgcc agtacataca 8580 ttgtcaatcc atgatggtta cacaaatgaa atcattggtt acaaagccat tcaggatggt 8640 gtcactcgtg acatcatttc tactgatgat tgttttgcaa ataaacatgc tggttttgac 8700 gcatggttta gccagcgtgg tggttcatac aaaaatgaca aaagctgccc tgtagtagct

8760 gctatcatta caagagagat tggtttcata gtgcctggct taccgggtac tgtgctgaga 8820 gcaatcaatg gtgacttctt gcattttcta cctcgtgttt ttagtgctgt tggcaacatt 8880 tgctacacac cttccaaact cattgagtat agtgattttg ctacctctgc ttgcgttctt 8940 gctgctgagt gtacaatttt taaggatgct atgggcaaac ctgtgccata ttgttatgac 9000 actaatttgc tagagggttc tatttcttat agtgagcttc gtccagacac tcgttatgtg 9060 cttatggatg gttccatcat acagtttcct aacacttacc tggagggttc tgttagagta 9120 gtaacaactt ttgatgctga gtactgtaga catggtacat gcgaaaggtc agaagtaggt 9180 atttgcctat ctaccagtgg tagatgggtt cttaataatg agcattacag agctctatca 9240 ggagttttct gtggtgttga tgcgatgaat ctcatagcta acatctttac tcctcttgtg 9300 caacctgtgg gtgctttaga tgtgtctgct tcagtagtgg ctggtggtat tattgccata 9360 ttggtgactt gtgctgccta ctactttatg aaattcagac gtgtttttgg tgagtacaac 9420 catgttgttg ctgctaatgc acttttgttt ttgatgtctt tcactatact ctgtctggta 9480 ccagcttaca gctttctgcc gggagtctac tcagtctttt acttgtactt gacattctat 9540 ttcaccaatg atgtttcatt cttggctcac cttcaatggt ttgccatgtt ttctcctatt 9600 gtgccttttt ggataacagc aatctatgta ttctgtattt ctctgaagca ctgccattgg 9660 ttctttaaca actatcttag gaaaagagtc atgtttaatg gagttacatt tagtaccttc 9720 gaggaggctg ctttgtgtac ctttttgctc aacaaggaaa tgtacctaaa attgcgtagc 9780 gagacactgt tgccacttac acagtataac aggtatcttg ctctatataa caagtacaag 9840 tatttcagtg gagccttaga tactaccagc tatcgtgaag cagcttgctg ccacttagca 9900 aaggctctaa atgactttag caactcaggt gctgatgttc tctaccaacc accacagaca 9960 tcaatcactt ctgctgttct gcagagtggt tttaggaaaa tggcattccc gtcaggcaaa 10020 gttgaagggt gcatggtaca agtaacctgt ggaactacaa ctcttaatgg attgtggttg 10080 gatgacacag tatactgtcc aagacatgtc atttgcacag cagaagacat gcttaatcct 10140 aactatgaag atctgctcat tcgcaaatcc aaccatagct ttcttgttca ggctggcaat 10200 gttcaacttc gtgttattgg ccattctatg caaaattgtc tgcttaggct taaagttgat 10260 acttctaacc ctaagacacc caagtataaa tttgtccgta tccaacctgg tcaaacattt 10320 tcagttctag catgctacaa tggttcacca tctggtgttt atcagtgtgc catgagacct 10380 aatcatacca ttaaaggttc tttccttaat ggatcatgtg gtagtgttgg ttttaacatt 10440 gattatgatt gcgtgtcttt ctgctatatg catcatatgg agcttccaac aggagtacac 10500 gctggtactg acttagaagg taaattctat ggtccatttg ttgacagaca aactgcacag 10560 gctgcaggta cagacacaac cataacatta aatgttttgg catggctgta tgctgctgtt 10620 atcaatggtg ataggtggtt tcttaataga ttcaccacta ctttgaatga ctttaacctt 10680 gtggcaatga agtacaacta tgaacctttg acacaagatc atgttgacat attgggacct 10740 ctttctgctc aaacaggaat tgccgtctta gatatgtgtg ctgctttgaa agagctgctg 10800 cagaatggta tgaatggtcg tactatcctt ggtagcacta ttttagaaga tgagtttaca 10860 ccatttgatg ttgttagaca atgctctggt gttaccttcc aaggtaagtt caagaaaatt 10920 gttaagggca ctcatcattg gatgctttta actttcttga catcactatt gattcttgtt 10980 caaagtacac agtggtcact gtttttcttt gtttacgaga atgctttctt gccatttact 11040 cttggtatta tggcaattgc tgcatgtgct atgctgcttg ttaagcataa gcacgcattc 11100 ttgtgcttgt ttctgttacc ttctcttgca acagttgctt actttaatat ggtctacatg 11160 cctgctagct gggtgatgcg tatcatgaca tggcttgaat tggctgacac tagcttgtct 11220 ggttataggc ttaaggattg tgttatgtat gcttcagctt tagttttgct tattctcatg 11280 acagctcgca ctgtttatga tgatgctgct agacgtgttt ggacactgat gaatgtcatt 11340 acacttgttt acaaagtcta ctatggtaat gctttagatc aagctatttc catgtgggcc 11400 ttagttattt ctgtaacctc taactattct ggtgtcgtta cgactatcat gtttttagct 11460 agagctatag tgtttgtgtg tgttgagtat tacccattgt tatttattac tggcaacacc 11520 ttacagtgta tcatgcttgt ttattgtttc ttaggctatt gttgctgctg ctactttggc 11580 cttttctgtt tactcaaccg ttacttcagg cttactcttg gtgtttatga ctacttggtc 11640 tctacacaag aatttaggta tatgaactcc caggggcttt tgcctcctaa gagtagtatt 11700 gatgctttca agcttaacat taagttgttg ggtattggag gtaaaccatg tatcaaggtt 11760 gctactgtac agtctaaaat gtctgacgta aagtgcacat ctgtggtact gctctcggtt 11820 cttcaacaac ttagagtaga gtcatcttct aaattgtggg cacaatgtgt acaactccac 11880 aatgatattc ttcttgcaaa agacacaact gaagctttcg agaagatggt ttctcttttg 11940 tctgttttgc tatccatgca gggtgctgta gacattaata ggttgtgcga ggaaatgctc 12000 gataaccgtg ctactcttca ggctattgct tcagaattta gttctttacc atcatatgcc 12060 gcttatgcca ctgcccagga ggcctatgag caggctgtag ctaatggtga ttctgaagtc 12120 gttctcaaaa agttaaagaa atctttgaat gtggctaaat ctgagtttga ccgtgatgct 12180 gccatgcaac gcaagttgga aaagatggca gatcaggcta tgacccaaat gtacaaacag 12240 gcaagatctg aggacaagag ggcaaaagta actagtgcta tgcaaacaat gctcttcact 12300 atgcttagga agcttgataa tgatgcactt aacaacatta tcaacaatgc gcgtgatggt 12360 tgtgttccac tcaacatcat accattgact acagcagcca aactcatggt tgttgtccct 12420 gattatggta cctacaagaa cacttgtgat ggtaacacct ttacatatgc atctgcactc 12480 tgggaaatcc agcaagttgt tgatgcggat agcaagattg ttcaacttag tgaaattaac 12540 atggacaatt caccaaattt ggcttggcct cttattgtta cagctctaag agccaactca 12600 gctgttaaac tacagaataa tgaactgagt ccagtagcac tacgacagat gtcctgtgcg 12660 gctggtacca cacaaacagc ttgtactgat gacaatgcac ttgcctacta taacaattcg 12720 aagggaggta ggtttgtgct ggcattacta tcagaccacc aagatctcaa atgggctaga 12780 ttccctaaga gtgatggtac aggtacaatt tacacagaac tggaaccacc ttgtaggttt 12840 gttacagaca caccaaaagg gcctaaagtg aaatacttgt acttcatcaa aggcttaaac 12900 aacctaaata gaggtatggt gctgggcagt ttagctgcta cagtacgtct tcaggctgga 12960 aatgctacag aagtacctgc caattcaact gtgctttcct tctgtgcttt tgcagtagac 13020 cctgctaaag catataagga ttacctagca agtggaggac aaccaatcac caactgtgtg 13080 aagatgttgt gtacacacac tggtacagga caggcaatta ctgtaacacc agaagctaac 13140 atggaccaag agtcctttgg tggtgcttca tgttgtctgt attgtagatg ccacattgac 13200 catccaaatc ctaaaggatt ctgtgacttg aaaggtaagt acgtccaaat acctaccact 13260 tgtgctaatg acccagtggg ttttacactt agaaacacag tctgtaccgt ctgcggaatg 13320 tggaaaggtt atggctgtag ttgtgaccaa ctccgcgaac ccttgatgca gtctgcggat 13380 gcatcaacgt ttttaaacgg gtttgcggtg taagtgcagc ccgtcttaca ccgtgcggca 13440 caggcactag tactgatgtc gtctacaggg cttttgatat ttacaacgaa aaagttgctg 13500 gttttgcaaa gttcctaaaa actaattgct gtcgcttcca ggagaaggat gaggaaggca 13560 atttattaga ctcttacttt gtagttaaga ggcatactat gtctaactac caacatgaag 13620 agactattta taacttggtt aaagattgtc cagcggttgc tgtccatgac tttttcaagt 13680 ttagagtaga tggtgacatg gtaccacata tatcacgtca gcgtctaact aaatacacaa 13740 tggctgattt agtctatgct ctacgtcatt ttgatgaggg taattgtgat acattaaaag 13800 aaatactcgt cacatacaat tgctgtgatg atgattattt caataagaag gattggtatg 13860 acttcgtaga gaatcctgac atcttacgcg tatatgctaa cttaggtgag cgtgtacgcc 13920 aatcattatt aaagactgta caattctgcg atgctatgcg tgatgcaggc attgtaggcg 13980 tactgacatt agataatcag gatcttaatg ggaactggta cgatttcggt gatttcgtac 14040 aagtagcacc aggctgcgga gttcctattg tggattcata ttactcattg ctgatgccca 14100 tcctcacttt gactagggca ttggctgctg agtcccatat ggatgctgat ctcgcaaaac 14160 cacttattaa gtgggatttg ctgaaatatg attttacgga agagagactt tgtctcttcg 14220 accgttattt taaatattgg gaccagacat accatcccaa ttgtattaac tgtttggatg 14280 ataggtgtat ccttcattgt gcaaacttta atgtgttatt ttctactgtg tttccaccta 14340 caagttttgg accactagta agaaaaatat ttgtagatgg tgttcctttt gttgtttcaa 14400 ctggatacca ttttcgtgag ttaggagtcg tacataatca ggatgtaaac ttacatagct 14460 cgcgtctcag tttcaaggaa cttttagtgt atgctgctga tccagctatg catgcagctt 14520 ctggcaattt attgctagat aaacgcacta catgcttttc agtagctgca ctaacaaaca 14580 atgttgcttt tcaaactgtc aaacccggta attttaataa agacttttat gactttgctg 14640 tgtctaaagg tttctttaag gaaggaagtt ctgttgaact aaaacacttc ttctttgctc 14700 aggatggcaa cgctgctatc agtgattatg actattatcg ttataatctg ccaacaatgt 14760 gtgatatcag acaactccta ttcgtagttg aagttgttga taaatacttt gattgttacg 14820 atggtggctg tattaatgcc aaccaagtaa tcgttaacaa tctggataaa tcagctggtt 14880 tcccatttaa taaatggggt aaggctagac tttattatga ctcaatgagt tatgaggatc 14940 aagatgcact tttcgcgtat actaagcgta atgtcatccc tactataact caaatgaatc 15000 ttaagtatgc cattagtgca aagaatagag ctcgcaccgt agctggtgtc tctatctgta 15060 gtactatgac aaatagacag tttcatcaga aattattgaa gtcaatagcc gccactagag 15120 gagctactgt ggtaattgga acaagcaagt tttacggtgg ctggcataat atgttaaaaa 15180 ctgtttacag tgatgtagaa actccacacc ttatgggttg ggattatcca aaatgtgaca 15240 gagccatgcc taacatgctt aggataatgg cctctcttgt tcttgctcgc aaacataaca 15300 cttgctgtaa cttatcacac cgtttctaca ggttagctaa cgagtgtgcg caagtattaa 15360 gtgagatggt catgtgtggc ggctcactat atgttaaacc aggtggaaca tcatccggtg 15420 atgctacaac tgcttatgct aatagtgtct ttaacatttg tcaagctgtt acagccaatg 15480 taaatgcact tctttcaact gatggtaata agatagctga caagtatgtc cgcaatctac 15540 aacacaggct ctatgagtgt ctctatagaa atagggatgt tgatcatgaa ttcgtggatg 15600 agttttacgc ttacctgcgt aaacatttct ccatgatgat tctttctgat gatgccgttg 15660 tgtgctataa cagtaactat gcggctcaag gtttagtagc tagcattaag aactttaagg 15720 cagttcttta ttatcaaaat aatgtgttca tgtctgaggc aaaatgttgg actgagactg 15780 accttactaa aggacctcac gaattttgct cacagcatac aatgctagtt aaacaaggag 15840 atgattacgt gtacctgcct tacccagatc catcaagaat attaggcgca ggctgttttg 15900 tcgatgatat tgtcaaaaca gatggtacac ttatgattga aaggttcgtg tcactggcta 15960 ttgatgctta cccacttaca aaacatccta atcaggagta tgctgatgtc tttcacttgt 16020 atttacaata cattagaaag ttacatgatg agcttactgg ccacatgttg gacatgtatt 16080 ccgtaatgct aactaatgat aacacctcac ggtactggga acctgagttt tatgaggcta 16140 tgtacacacc acatacagtc ttgcaggctg taggtgcttg tgtattgtgc aattcacaga 16200 cttcacttcg ttgcggtgcc tgtattagga gaccattcct atgttgcaag tgctgctatg 16260 accatgtcat ttcaacatca cacaaattag tgttgtctgt taatccctat gtttgcaatg 16320 ccccaggttg tgatgtcact gatgtgacac aactgtatct aggaggtatg agctattatt 16380 gcaagtcaca taagcctccc attagttttc cattatgtgc taatggtcag gtttttggtt 16440 tatacaaaaa cacatgtgta ggcagtgaca atgtcactga cttcaatgcg atagcaacat 16500 gtgattggac taatgctggc gattacatac ttgccaacac ttgtactgag agactcaagc 16560 ttttcgcagc agaaacgctc aaagccactg aggaaacatt taagctgtca tatggtattg 16620 ccactgtacg cgaagtactc tctgacagag aattgcatct ttcatgggag gttggaaaac 16680 ctagaccacc attgaacaga aactatgtct ttactggtta ccgtgtaact aaaaatagta 16740 aagtacagat tggagagtac acctttgaaa aaggtgacta tggtgatgct gttgtgtaca 16800 gaggtactac gacatacaag ttgaatgttg gtgattactt tgtgttgaca tctcacactg 16860 taatgccact tagtgcacct actctagtgc cacaagagca ctatgtgaga attactggct 16920 tgtacccaac actcaacatc tcagatgagt tttctagcaa tgttgcaaat tatcaaaagg 16980 tcggcatgca aaagtactct acactccaag gaccacctgg tactggtaag agtcattttg 17040 ccatcggact tgctctctat tacccatctg ctcgcatagt gtatacggca tgctctcatg 17100 cagctgttga tgccctatgt gaaaaggcat taaaatattt gcccatagat aaatgtagta 17160 gaatcatacc tgcgcgtgcg cgcgtagagt gttttgataa attcaaagtg aattcaacac 17220 tagaacagta tgttttctgc actgtaaatg cattgccaga aacaactgct gacattgtag 17280 tctttgatga aatctctatg gctactaatt atgacttgag tgttgtcaat gctagacttc 17340 gtgcaaaaca ctacgtctat attggcgatc ctgctcaatt accagccccc cgcacattgc 17400 tgactaaagg cacactagaa ccagaatatt ttaattcagt gtgcagactt atgaaaacaa 17460 taggtccaga catgttcctt ggaacttgtc gccgttgtcc tgctgaaatt gttgacactg 17520 tgagtgcttt agtttatgac aataagctaa aagcacacaa ggataagtca gctcaatgct 17580 tcaaaatgtt ctacaaaggt gttattacac atgatgtttc atctgcaatc aacagacctc 17640 aaataggcgt tgtaagagaa tttcttacac gcaatcctgc ttggagaaaa gctgttttta 17700 tctcacctta taattcacag aacgctgtag cttcaaaaat cttaggattg cctacgcaga 17760 ctgttgattc atcacagggt tctgaatatg actatgtcat attcacacaa actactgaaa 17820 cagcacactc ttgtaatgtc aaccgcttca atgtggctat cacaagggca aaaattggca 17880 ttttgtgcat aatgtctgat agagatcttt atgacaaact gcaatttaca agtctagaaa 17940 taccacgtcg caatgtggct acattacaag cagaaaatgt aactggactt tttaaggact 18000 gtagtaagat cattactggt cttcatccta cacaggcacc tacacacctc agcgttgata 18060 taaagttcaa gactgaagga ttatgtgttg acataccagg cataccaaag gacatgacct 18120 accgtagact catctctatg atgggtttca aaatgaatta ccaagtcaat ggttacccta 18180 atatgtttat cacccgcgaa gaagctattc gtcacgttcg tgcgtggatt ggctttgatg 18240 tagagggctg tcatgcaact agagatgctg tgggtactaa cctacctctc cagctaggat 18300 tttctacagg tgttaactta gtagctgtac cgactggtta tgttgacact gaaaataaca 18360 cagaattcac cagagttaat gcaaaacctc caccaggtga ccagtttaaa catcttatac 18420 cactcatgta taaaggcttg ccctggaatg tagtgcgtat taagatagta caaatgctca 18480 gtgatacact gaaaggattg tcagacagag tcgtgttcgt cctttgggcg catggctttg 18540 agcttacatc aatgaagtac tttgtcaaga ttggacctga aagaacgtgt tgtctgtgtg 18600 acaaacgtgc aacttgcttt tctacttcat cagatactta tgcctgctgg aatcattctg 18660 tgggttttga ctatgtctat aacccattta tgattgatgt tcagcagtgg ggctttacgg 18720 gtaaccttca gagtaaccat gaccaacatt gccaggtaca tggaaatgca catgtggcta 18780 gttgtgatgc tatcatgact agatgtttag cagtccatga gtgctttgtt aagcgcgttg 18840 attggtctgt tgaataccct attataggag atgaactgag ggttaattct gcttgcagaa 18900 aagtacaaca catggttgtg aagtctgcat tgcttgctga taagtttcca gttcttcatg 18960 acattggaaa tccaaaggct atcaagtgtg tgcctcaggc tgaagtagaa tggaagttct 19020 acgatgctca gccatgtagt gacaaagctt acaaaataga ggaactcttc tattcttatg 19080 ctacacatca cgataaattc actgatggtg tttgtttgtt ttggaattgt aacgttgatc 19140 gttacccagc caatgcaatt gtgtgtaggt ttgacacaag agtcttgtca aacttgaact 19200 taccaggctg tgatggtggt agtttgtatg tgaataagca tgcattccac actccagctt 19260 tcgataaaag tgcatttact aatttaaagc aattgccttt cttttactat tctgatagtc 19320 cttgtgagtc tcatggcaaa caagtagtgt cggatattga ttatgttcca ctcaaatctg 19380 ctacgtgtat tacacgatgc aatttaggtg gtgctgtttg cagacaccat gcaaatgagt 19440 accgacagta cttggatgca tataatatga tgatttctgc tggatttagc ctatggattt 19500 acaaacaatt tgatacttat aacctgtgga atacatttac caggttacag agtttagaaa 19560 atgtggctta taatgttgtt aataaaggac actttgatgg acacgccggc gaagcacctg 19620 tttccatcat taataatgct gtttacacaa aggtagatgg tattgatgtg gagatctttg 19680 aaaataagac aacacttcct gttaatgttg catttgagct ttgggctaag cgtaacatta 19740 aaccagtgcc agagattaag atactcaata atttgggtgt tgatatcgct gctaatactg 19800 taatctggga ctacaaaaga gaagccccag cacatgtatc tacaataggt gtctgcacaa 19860 tgactgacat tgccaagaaa cctactgaga gtgcttgttc ttcacttact gtcttgtttg 19920 atggtagagt ggaaggacag gtagaccttt ttagaaacgc ccgtaatggt gttttaataa 19980 cagaaggttc agtcaaaggt ctaacacctt caaagggacc agcacaagct agcgtcaatg 20040 gagtcacatt aattggagaa tcagtaaaaa cacagtttaa ctactttaag aaagtagacg 20100 gcattattca acagttgcct gaaacctact ttactcagag cagagactta gaggatttta 20160 agcccagatc acaaatggaa actgactttc tcgagctcgc tatggatgaa ttcatacagc 20220 gatataagct cgagggctat gccttcgaac acatcgttta tggagatttc agtcatggac 20280 aacttggcgg tcttcattta atgataggct tagccaagcg ctcacaagat tcaccactta 20340 aattagagga ttttatccct atggacagca cagtgaaaaa ttacttcata acagatgcgc 20400 aaacaggttc atcaaaatgt gtgtgttctg tgattgatct tttacttgat gactttgtcg 20460 agataataaa gtcacaagat ttgtcagtga tttcaaaagt ggtcaaggtt acaattgact 20520 atgctgaaat ttcattcatg ctttggtgta aggatggaca tgttgaaacc ttctacccaa 20580 aactacaagc aagtcgagcg tggcaaccag gtgttgcgat gcctaacttg tacaagatgc 20640 aaagaatgct tcttgaaaag tgtgaccttc agaattatgg tgaaaatgct gttataccaa 20700 aaggaataat gatgaatgtc gcaaagtata ctcaactgtg tcaatactta aatacactta 20760 ctttagctgt accctacaac atgagagtta ttcactttgg tgctggctct gataaaggag 20820 ttgcaccagg tacagctgtg ctcagacaat ggttgccaac tggcacacta cttgtcgatt 20880 cagatcttaa tgacttcgtc tccgacgcat attctacttt aattggagac tgtgcaacag 20940 tacatacggc taataaatgg gaccttatta ttagcgatat gtatgaccct aggaccaaac 21000 atgtgacaaa agagaatgac tctaaagaag ggtttttcac ttatctgtgt ggatttataa 21060 agcaaaaact agccctgggt ggttctatag ctgtaaagat aacagagcat tcttggaatg 21120 ctgaccttta caagcttatg ggccatttct catggtggac agcttttgtt acaaatgtaa 21180 atgcatcatc atcggaagca tttttaattg gggctaacta tcttggcaag ccgaaggaac 21240 aaattgatgg ctataccatg catgctaact acattttctg gaggaacaca aatcctatcc 21300 agttgtcttc ctattcactc tttgacatga gcaaatttcc tcttaaatta agaggaactg 21360 ctgtaatgtc tcttaaggag aatcaaatca atgatatgat ttattctctt ctggaaaaag 21420 gtaggcttat cattagagaa aacaacagag ttgtggtttc aagtgatatt cttgttaaca 21480 actaaacgaa catgtttatt ttcttattat ttcttactct cactagtggt agtgaccttg 21540 accggtgcac cacttttgat gatgttcaag ctcctaatta cactcaacat acttcatcta 21600 tgaggggggt ttactatcct gatgaaattt ttagatcaga cactctttat ttaactcagg 21660 atttatttct tccattttat tctaatgtta cagggtttca tactattaat catacgtttg 21720 gcaaccctgt catacctttt aaggatggta tttattttgc tgccacagag aaatcaaatg 21780 ttgtccgtgg ttgggttttt ggttctacca tgaacaacaa gtcacagtcg gtgattatta 21840 ttaacaattc tactaatgtt gttatacgag catgtaactt tgaattgtgt gacaaccctt 21900 tctttgctgt ttctaaaccc atgggtacac agacacatac tatgatattc gataatgcat 21960 ttaattgcac tttcgagtac atatctgatg ccttttcgct tgatgtttca gaaaagtcag 22020 gtaattttaa acacttacga gagtttgtgt ttaaaaataa agatgggttt ctctatgttt 22080 ataagggcta tcaacctata gatgtagttc gtgatctacc ttctggtttt aacactttga 22140 aacctatttt taagttgcct cttggtatta acattacaaa ttttagagcc attcttacag 22200 ccttttcacc tgctcaagac atttggggca cgtcagctgc agcctatttt gttggctatt 22260 taaagccaac tacatttatg ctcaagtatg atgaaaatgg tacaatcaca gatgctgttg 22320 attgttctca aaatccactt gctgaactca aatgctctgt taagagcttt gagattgaca 22380 aaggaattta ccagacctct aatttcaggg ttgttccctc aggagatgtt gtgagattcc 22440 ctaatattac aaacttgtgt ccttttggag aggtttttaa tgctactaaa ttcccttctg 22500 tctatgcatg ggagagaaaa aaaatttcta attgtgttgc tgattactct gtgctctaca 22560 actcaacatt tttttcaacc tttaagtgct atggcgtttc tgccactaag ttgaatgatc 22620 tttgcttctc caatgtctat gcagattctt ttgtagtcaa gggagatgat gtaagacaaa 22680 tagcgccagg acaaactggt gttattgctg attataatta taaattgcca gatgatttca 22740 tgggttgtgt ccttgcttgg aatactagga acattgatgc tacttcaact ggtaattata 22800 attataaata taggtatctt agacatggca agcttaggcc ctttgagaga gacatatcta 22860 atgtgccttt ctcccctgat ggcaaacctt gcaccccacc tgctcttaat tgttattggc 22920 cattaaatga ttatggtttt tacaccacta ctggcattgg ctaccaacct tacagagttg 22980 tagtactttc ttttgaactt ttaaatgcac cggccacggt ttgtggacca aaattatcca 23040 ctgaccttat taagaaccag tgtgtcaatt ttaattttaa tggactcact ggtactggtg 23100 tgttaactcc ttcttcaaag agatttcaac catttcaaca atttggccgt gatgtttctg 23160 atttcactga ttccgttcga gatcctaaaa catctgaaat attagacatt tcaccttgcg 23220 cttttggggg tgtaagtgta attacacctg gaacaaatgc ttcatctgaa gttgctgttc 23280 tatatcaaga tgttaactgc actgatgttt ctacagcaat tcatgcagat caactcacac 23340 cagcttggcg catatattct actggaaaca atgtattcca gactcaagca ggctgtctta 23400 taggagctga gcatgtcgac acttcttatg agtgcgacat tcctattgga gctggcattt 23460 gtgctagtta ccatacagtt tctttattac gtagtactag ccaaaaatct attgtggctt 23520 atactatgtc tttaggtgct gatagttcaa ttgcttactc taataacacc attgctatac 23580 ctactaactt ttcaattagc attactacag aagtaatgcc tgtttctatg gctaaaacct 23640 ccgtagattg taatatgtac atctgcggag attctactga atgtgctaat ttgcttctcc 23700 aatatggtag cttttgcaca caactaaatc gtgcactctc aggtattgct gctgaacagg 23760 atcgcaacac acgtgaagtg ttcgctcaag tcaaacaaat gtacaaaacc ccaactttga

23820 aatattttgg tggttttaat ttttcacaaa tattacctga ccctctaaag ccaactaaga 23880 ggtcttttat tgaggacttg ctctttaata aggtgacact cgctgatgct ggcttcatga 23940 agcaatatgg cgaatgccta ggtgatatta atgctagaga tctcatttgt gcgcagaagt 24000 tcaatggact tacagtgttg ccacctctgc tcactgatga tatgattgct gcctacactg 24060 ctgctctagt tagtggtact gccactgctg gatggacatt tggtgctggc gctgctcttc 24120 aaataccttt tgctatgcaa atggcatata ggttcaatgg cattggagtt acccaaaatg 24180 ttctctatga gaaccaaaaa caaatcgcca accaatttaa caaggcgatt agtcaaattc 24240 aagaatcact tacaacaaca tcaactgcat tgggcaagct gcaagacgtt gttaaccaga 24300 atgctcaagc attaaacaca cttgttaaac aacttagctc taattttggt gcaatttcaa 24360 gtgtgctaaa tgatatcctt tcgcgacttg ataaagtcga ggcggaggta caaattgaca 24420 ggttaattac aggcagactt caaagccttc aaacctatgt aacacaacaa ctaatcaggg 24480 ctgctgaaat cagggcttct gctaatcttg ctgctactaa aatgtctgag tgtgttcttg 24540 gacaatcaaa aagagttgac ttttgtggaa agggctacca ccttatgtcc ttcccacaag 24600 cagccccgca tggtgttgtc ttcctacatg tcacgtatgt gccatcccag gagaggaact 24660 tcaccacagc gccagcaatt tgtcatgaag gcaaagcata cttccctcgt gaaggtgttt 24720 ttgtgtttaa tggcacttct tggtttatta cacagaggaa cttcttttct ccacaaataa 24780 ttactacaga caatacattt gtctcaggaa attgtgatgt cgttattggc atcattaaca 24840 acacagttta tgatcctctg caacctgagc ttgactcatt caaagaagag ctggacaagt 24900 acttcaaaaa tcatacatca ccagatgttg atcttggcga catttcaggc attaacgctt 24960 ctgtcgtcaa cattcaaaaa gaaattgacc gcctcaatga ggtcgctaaa aatttaaatg 25020 aatcactcat tgaccttcaa gaattgggaa aatatgagca atatattaaa tggccttggt 25080 atgtttggct cggcttcatt gctggactaa ttgccatcgt catggttaca atcttgcttt 25140 gttgcatgac tagttgttgc agttgcctca agggtgcatg ctcttgtggt tcttgctgca 25200 agtttgatga ggatgactct gagccagttc tcaagggtgt caaattacat tacacataaa 25260 cgaacttatg gatttgttta tgagattttt tactcttgga tcaattactg cacagccagt 25320 aaaaattgac aatgcttctc ctgcaagtac tgttcatgct acagcaacga taccgctaca 25380 agcctcactc cctttcggat ggcttgttat tggcgttgca tttcttgctg tttttcagag 25440 cgctaccaaa ataattgcgc tcaataaaag atggcagcta gccctttata agggcttcca 25500 gttcatttgc aatttactgc tgctatttgt taccatctat tcacatcttt tgcttgtcgc 25560 tgcaggtatg gaggcgcaat ttttgtacct ctatgccttg atatattttc tacaatgcat 25620 caacgcatgt agaattatta tgagatgttg gctttgttgg aagtgcaaat ccaagaaccc 25680 attactttat gatgccaact actttgtttg ctggcacaca cataactatg actactgtat 25740 accatataac agtgtcacag atacaattgt cgttactgaa ggtgacggca tttcaacacc 25800 aaaactcaaa gaagactacc aaattggtgg ttattctgag gataggcact caggtgttaa 25860 agactatgtc gttgtacatg gctatttcac cgaagtttac taccagcttg agtctacaca 25920 aattactaca gacactggta ttgaaaatgc tacattcttc atctttaaca agcttgttaa 25980 agacccaccg aatgtgcaaa tacacacaat cgacggctct tcaggagttg ctaatccagc 26040 aatggatcca atttatgatg agccgacgac gactactagc gtgcctttgt aagcacaaga 26100 aagtgagtac gaacttatgt actcattcgt ttcggaagaa acaggtacgt taatagttaa 26160 tagcgtactt ctttttcttg ctttcgtggt attcttgcta gtcacactag ccatccttac 26220 tgcgcttcga ttgtgtgcgt actgctgcaa tattgttaac gtgagtttag taaaaccaac 26280 ggtttacgtc tactcgcgtg ttaaaaatct gaactcttct gaaggagttc ctgatcttct 26340 ggtctaaacg aactaactat tattattatt ctgtttggaa ctttaacatt gcttatcatg 26400 gcagacaacg gtactattac cgttgaggag cttaaacaac tcctggaaca atggaaccta 26460 gtaataggtt tcctattcct agcctggatt atgttactac aatttgccta ttctaatcgg 26520 aacaggtttt tgtacataat aaagcttgtt ttcctctggc tcttgtggcc agtaacactt 26580 gcttgttttg tgcttgctgc tgtctacaga attaattggg tgactggcgg gattgcgatt 26640 gcaatggctt gtattgtagg cttgatgtgg cttagctact tcgttgcttc cttcaggctg 26700 tttgctcgta cccgctcaat gtggtcattc aacccagaaa caaacattct tctcaatgtg 26760 cctctccggg ggacaattgt gaccagaccg ctcatggaaa gtgaacttgt cattggtgct 26820 gtgatcattc gtggtcactt gcgaatggcc ggacactccc tagggcgctg tgacattaag 26880 gacctgccaa aagagatcac tgtggctaca tcacgaacgc tttcttatta caaattagga 26940 gcgtcgcagc gtgtaggcac tgattcaggt tttgctgcat acaaccgcta ccgtattgga 27000 aactataaat taaatacaga ccacgccggt agcaacgaca atattgcttt gctagtacag 27060 taagtgacaa cagatgtttc atcttgttga cttccaggtt acaatagcag agatattgat 27120 tatcattatg aggactttca ggattgctat ttggaatctt gacgttataa taagttcaat 27180 agtgagacaa ttatttaagc ctctaactaa gaagaattat tcggagttag atgatgaaga 27240 acctatggag ttagattatc cataaaacga acatgaaaat tattctcttc ctgacattga 27300 ttgtatttac atcttgcgag ctatatcact atcaggagtg tgttagaggt acgactgtac 27360 tactaaaaga accttgccca tcaggaacat acgagggcaa ttcaccattt caccctcttg 27420 ctgacaataa atttgcacta acttgcacta gcacacactt tgcttttgct tgtgctgacg 27480 gtactcgaca tacctatcag ctgcgtgcaa gatcagtttc accaaaactt ttcatcagac 27540 aagaggaggt tcaacaagag ctctactcgc cactttttct cattgttgct gctctagtat 27600 ttttaatact ttgcttcacc attaagagaa agacagaatg aatgagctca ctttaattga 27660 cttctatttg tgctttttag cctttctgct attccttgtt ttaataatgc ttattatatt 27720 ttggttttca ctcgaaatcc aggatctaga agaaccttgt accaaagtct aaacgaacat 27780 gaaacttctc attgttttga cttgtatttc tctatgcagt tgcatatgca ctgtagtaca 27840 gcgctgtgca tctaataaac ctcatgtgct tgaagatcct tgtaaggtac aacactaggg 27900 gtaatactta tagcactgct tggctttgtg ctctaggaaa ggttttacct tttcatagat 27960 ggcacactat ggttcaaaca tgcacaccta atgttactat caactgtcaa gatccagctg 28020 gtggtgcgct tatagctagg tgttggtacc ttcatgaagg tcaccaaact gctgcattta 28080 gagacgtact tgttgtttta aataaacgaa caaattaaaa tgtctgataa tggaccccaa 28140 tcaaaccaac gtagtgcccc ccgcattaca tttggtggac ccacagattc aactgacaat 28200 aaccagaatg gaggacgcaa tggggcaagg ccaaaacagc gccgacccca aggtttaccc 28260 aataatactg cgtcttggtt cacagctctc actcagcatg gcaaggagga acttagattc 28320 cctcgaggcc agggcgttcc aatcaacacc aatagtggtc cagatgacca aattggctac 28380 taccgaagag ctacccgacg agttcgtggt ggtgacggca aaatgaaaga gctcagcccc 28440 agatggtact tctattacct aggaactggc ccagaagctt cacttcccta cggcgctaac 28500 aaagaaggca tcgtatgggt tgcaactgag ggagccttga atacacccaa agaccacatt 28560 ggcacccgca atcctaataa caatgctgcc accgtgctac aacttcctca aggaacaaca 28620 ttgccaaaag gcttctacgc agagggaagc agaggcggca gtcaagcctc ttctcgctcc 28680 tcatcacgta gtcgcggtaa ttcaagaaat tcaactcctg gcagcagtag gggaaattct 28740 cctgctcgaa tggctagcgg aggtggtgaa actgccctcg cgctattgct gctagacaga 28800 ttgaaccagc ttgagagcaa agtttctggt aaaggccaac aacaacaagg ccaaactgtc 28860 actaagaaat ctgctgctga ggcatctaaa aagcctcgcc aaaaacgtac tgccacaaaa 28920 cagtacaacg tcactcaagc atttgggaga cgtggtccag aacaaaccca aggaaatttc 28980 ggggaccaag acctaatcag acaaggaact gattacaaac attggccgca aattgcacaa 29040 tttgctccaa gtgcctctgc attctttgga atgtcacgca ttggcatgga agtcacacct 29100 tcgggaacat ggctgactta tcatggagcc attaaattgg atgacaaaga tccacaattc 29160 aaagacaacg tcatactgct gaacaagcac attgacgcat acaaaacatt cccaccaaca 29220 gagcctaaaa aggacaaaaa gaaaaagact gatgaagctc agcctttgcc gcagagacaa 29280 aagaagcagc ccactgtgac tcttcttcct gcggctgaca tggatgattt ctccagacaa 29340 cttcaaaatt ccatgagtgg agcttctgct gattcaactc aggcataaac actcatgatg 29400 accacacaag gcagatgggc tatgtaaacg ttttcgcaat tccgtttacg atacatagtc 29460 tactcttgtg cagaatgaat tctcgtaact aaacagcaca agtaggttta gttaacttta 29520 atctcacata gcaatcttta atcaatgtgt aacattaggg aggacttgaa agagccacca 29580 cattttcatc gaggccacgc ggagtacgat cgagggtaca gtgaataatg ctagggagag 29640 ctgcctatat ggaagagccc taatgtgtaa aattaatttt agtagtgcta tccccatgtg 29700 attttaatag cttcttagga gaatgacaaa aaaaaaaaaa aaaaaaaaaa a 29751

Claims

What is claimed is:

1. A method for inactivating a virus in a patient comprising administering to said patient a modified siRNA in an effective amount to inactivate said virus.

2. The method of claim 1, wherein said modified siRNA is a 2' modified siRNA.

3. The method of claim 2, wherein the modification is at the 2' position of at least one ribonucleotide of said siRNA.

4. The method of claim 3, wherein said modification is selected from the group consisting of fluoro-, methyl-, methoxyethyl- and propyl-modification.

5. The method of claim 4, wherein said fluoro-modification is a 2'-fluoro-modification or a 2',2'-fluoro-modification.

6. The method of claim 5, wherein pyrimidines of said siRNA are modified, and said pyrimidines are cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof.

7. The method of claim 1, wherein both strands of said siRNA contain at least one modified nucleotide.

8. The method of claim 1, wherein said virus is selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus.

9. The method of claim 8, wherein said virus is hepatitis C virus.

10. The method of claim 8, wherein said siRNA is prepared by (a) identifying a target nucleotide sequence in an HCV genome for designing a small interfering RNA (siRNA); and (b) producing an siRNA that has been modified to contain at least one modified nucleotide.

11. The method of claim 8, wherein said siRNA is prepared by (a) identifying a target nucleotide sequence in a virus genome for designing a small interfering RNA (siRNA); and (b) producing an siRNA that has been modified to contain at least one modified nucleotide.

12. The method of claim 10, wherein said target nucleotide sequence is selected from the group consisting of 5'-untranslated region (5'-UTR), 3'-untranslated region (3'-UTR), core, and NS3 helicase.

13. The method of claim 12, wherein said siRNA is siRNA5, siRNAC1, siRNAC2, siRNA5B1, siRNA5B2 or siRNA5B4.

14. An siRNA comprising a modified ribonucleotide, wherein said siRNA is resistant to RNase and retains the ability to inhibit viral replication.

15. The siRNA of claim 14, wherein said modified siRNA is a 2' modified siRNA.

16. The siRNA of claim 15, wherein the modification is at the 2' position of at least one ribonucleotide of said siRNA.

17. The siRNA of claim 14, wherein the modification is selected from the group consisting of fluoro-, methyl-, methoxyethyl- and propyl-modification.

18. The siRNA of claim 17, wherein said fluoro-modification is a 2'-fluoro-medication or a 2',2'-fluoro-modification.

19. The method of claim 18, wherein pyrimidines of said siRNA are modified, and said pyrimidines are cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof.

20. The siRNA of claim 14, wherein both strands of the siRNA contains modified nucleotides.

21. The siRNA of claim 14, wherein said siRNA interacts with a target nucleotide sequence in a virus genome.

22. The siRNA of claim 21, wherein said virus is selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus.

23. The siRNA of claim 22, wherein said virus is hepatitis C virus (HCV).

24. A method of making a modified siRNA that targets a nucleic acid sequence in a virus comprising: (a) preparing a modified-double stranded RNA (dsRNA) fragment containing at least one modified ribonucleotide in at least one strand that spans the genome of a target agent; and (b) cleaving said modified-dsRNA fragments with recombinant human Dicer resulting in more than one modified siRNA.

25. The method of claim 24, further comprising: (c) isolating said modified siRNAs.

26. The method of claim 24, wherein said target agent is a virus.

27. The method of claim 26, wherein said virus is selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus.

28. A method for inactivating a virus in a patient comprising administering to said patient a modified siRNA consisting of about 10 to about 30 ribonucleotides in an effective amount to inactivate said virus.

29. The method of claim 28, wherein said modified siRNA consists of about 19 to about 23 ribonucleotides.

30. The method of claim 28, wherein said modified siRNA is a 2' modified siRNA.

31. The method of claim 30, wherein the modification is at the 2' position of at least one ribonucleotide of said siRNA.

32. The method of claim 31, wherein said modification is selected from the group consisting of fluoro-, methyl-, methoxyethyl- and propyl-modification.

33. The method of claim 32, wherein said fluoro-modification is a 2'-fluoro-modification or a 2',2'-fluoro-modification.

34. The method of claim 28, wherein pyrimidines of said siRNA are modified and said pyrimidines are cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof.

35. The method of claim 28, wherein both strands of said siRNA contain modified nucleotides.

36. The method of claim 28, wherein said virus is selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus.

37. The method of claim 36, wherein said virus is hepatitis C virus (HCV).

38. The method of claim 37, wherein said siRNA is prepared by (a) identifying a target nucleotide sequence in a HCV genome for designing a small interfering RNA (siRNA); and (b) producing an siRNA that has been modified to contain at least one modified nucleotide.

39. The method of claim 36, wherein said siRNA is prepared by (a) identifying a target nucleotide sequence in a virus genome for designing a small interfering RNA (siRNA); and (b) producing an siRNA that has been modified to contain at least one modified nucleotide.

40. The method of claim 38, wherein said target nucleotide sequence comprises a conserved nucleotide sequence necessary for HCV replication.

41. The method of claim 40, wherein said conserved nucleotide sequence is selected from the group consisting of 5'-untranslated region (5'-UTR), 3'-untranslated region (3'-UTR), core, and NS3 helicase.

42. The method of claim 41, wherein said siRNA is siRNA5, siRNAC1, siRNAC2, siRNA5B1, siRNA5B2 or siRNA5B4.

43. A double-stranded RNA molecule of from about 10 to about 30 nucleotides that inhibits replication of hepatitis C virus (HCV).

44. The double-stranded RNA molecule of claim 43 comprising a nucleotide sequence at least 80% identical to the nucleotide sequence of siRNA5, siRNAC1, siRNAC2, siRNA5B1, siRNA5B2 or siRNA5B4.

45. A method of inducing targeted RNA interference toward HCV in hepatic cells, comprising administering the double-stranded RNA molecule of claim 43 to hepatic cells, wherein the nucleotide sequence of said double-stranded RNA molecule corresponds to an HCV nucleotide sequence.

46. A method of inhibiting replication of hepatitis C virus (HCV), comprising administering the RNA polynucleotide molecule of claim 44 to cells infected with HCV.

47. A vector comprising a DNA segment encoding the RNA molecule of claim 43.

48. The vector of claim 47, wherein the sense strand of said double-stranded RNA molecule is operably linked to a first promoter and wherein the antisense strand of said double-stranded RNA molecule of is operably linked to a second promoter.

49. The vector of claim 48, wherein said first and second promoters are selected from the group consisting of U6 and H1.

50. The vector of claim 48 wherein said first and second promoters are the same.

51. The vector of claim 47, wherein the sense and antisense strands of said RNA molecule are under the control of a single promoter.

52. The vector of claim 51, wherein said single promoter is selected from the group consisting of U6 and H1.

53. A host cell comprising the vector of claim 47.

54. A method of inhibiting replication of hepatitis C virus (HCV) in cells carrying HCV, comprising transfecting said cells with the vector of claim 47.

55. A method of treating hepatitis C in a subject in need thereof, comprising administering a composition comprising the RNA molecule of claim 43 to said subject.

56. A method of treating hepatitis C in a subject in need thereof, comprising administering the vector of claim 47 to said subject.

57. A modified siRNA molecule, comprising a double-stranded RNA molecule of from about 10 to about 30 nucleotides in length, which mediates RNA interference toward a target agent or virus, and which is linked to at least one receptor-binding ligand.

58. The modified siRNA molecule of claim 57, wherein said receptor-binding ligand is attached to a 5'-end or 3'-end of said siRNA molecule.

59. The modified siRNA molecule of claim 58, wherein said receptor binding ligand is attached to multiple ends of said siRNA molecule.

60. The modified siRNA molecule of claim 57, wherein said receptor-binding ligand is selected from the group consisting of a cholesterol, an HBV surface antigen, low-density lipoprotein, an HIV-1 surface antigen, an influenza virus surface antigen, an RSV surface antigen, an HPV surface antigen and a polio virus surface antigen.

61. The modified siRNA molecule of claim 60, wherein said receptor-binding ligand is cholesterol.

62. The modified siRNA molecule of claim 57, further comprising a modification at the 2' position of at least one ribonucleotide, which modification at the 2' position of at least one ribonucleotide renders said siRNA resistant to degradation.

63. The modified siRNA molecule of claim 62, wherein said modification at the 2' position of at least one ribonucleotide is a 2'-fluoro-modification or a 2',2'-fluoro-modification.

64. A method of inducing targeted RNA interference in a patient, comprising administering to said patient an effective amount of the siRNA of claim 57.

65. A method of inducing targeted RNA interference in a patient, comprising administering to said patient an effective amount of the siRNA of claim 61.

66. A method of inducing targeted RNA interference in a patient, comprising administering to said patient an effective amount of the siRNA of claim 63.