U.S. patent application number 10/767412 was filed with the patent office on 2005-03-17 for expression library immunization.
Invention is credited to Barry, Michael A., Johnston, Stephen A., Lai, Wayne C..
Application Number | 20050058626 10/767412 |
Document ID | / |
Family ID | 23669392 |
Filed Date | 2005-03-17 |
United States Patent
Application |
20050058626 |
Kind Code |
A1 |
Johnston, Stephen A. ; et
al. |
March 17, 2005 |
Expression library immunization
Abstract
A general method for vaccinating against any pathogen is
presented. The method utilizes expression library immunization,
where an animal is inoculated with an expression library
constructed from fragmented genomic DNA of the pathogen. All
potential epitopes of the pathogen's proteins are encoded in its
DNA, and genetic immunization is used to directly introduce one or
more expression library clones to the immune system, producing an
immune response to the encoded protein. Inoculation of expression
libraries representing portions of the Mycoplasma pulmonis genome
was shown to protect mice from subsequent challenge by this natural
pathogen. Protection against Listeria was also obtained using the
method.
Inventors: |
Johnston, Stephen A.;
(Dallas, TX) ; Barry, Michael A.; (Carrollton,
TX) ; Lai, Wayne C.; (Richardson, TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
23669392 |
Appl. No.: |
10/767412 |
Filed: |
January 29, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10767412 |
Jan 29, 2004 |
|
|
|
09448330 |
Nov 22, 1999 |
|
|
|
09448330 |
Nov 22, 1999 |
|
|
|
09001157 |
Dec 30, 1997 |
|
|
|
5989553 |
|
|
|
|
09001157 |
Dec 30, 1997 |
|
|
|
08421155 |
Apr 7, 1995 |
|
|
|
5703057 |
|
|
|
|
Current U.S.
Class: |
424/93.2 |
Current CPC
Class: |
Y10S 530/868 20130101;
A61K 2039/51 20130101; A61K 39/00 20130101; C12N 15/87 20130101;
Y10S 530/825 20130101; A61K 48/00 20130101; A61P 37/04 20180101;
C07K 14/195 20130101; C07K 14/30 20130101; C07K 14/295 20130101;
Y10S 530/806 20130101; Y10S 530/826 20130101 |
Class at
Publication: |
424/093.2 |
International
Class: |
A61K 048/00 |
Claims
1-40. (Canceled)
41. A method of vaccinating a subject comprising: (a) obtaining a
nucleic acid encoding an antigen or an antigen that is encoded by
said nucleic acid, wherein the nucleic acid or antigen has been
determined to elicit an immune response by a method comprising the
steps of: i) obtaining a library comprising DNA or RNA sequences
from a pathogen; ii) introducing a plurality of members of said
library into an animal; and iii) selecting at least a first member
from the library that elicits an immune response to identify said
nucleic acid or antigen; and b) administering the nucleic acid or
antigen to a subject in a manner effective to vaccinate the subject
against the pathogen.
42. The method of claim 41, wherein the pathogen is a virus, yeast,
mold, algae or protozoa.
43. The method of claim 41, wherein the pathogen is a bacterial
cell.
44. The method of claim 43, wherein the bacterial cell is
identified as Mycoplasma pulmonis or Listeria monocytogenes.
45. The method of claim 41, wherein the library is prepared using a
bacterial host cell.
46. The method of claim 41, wherein the library is prepared using a
mammalian host cell.
47. The method of claim 45, wherein the bacterial cell is an E.
coli.
48. The method of claim 41, wherein the DNA or RNA is fragmented
physically or by restriction enzymes.
49. The method of claim 48, wherein fragments are about 100-1000
bp.
50. The method of claim 48, wherein the fragments are about 400
bp.
51. The method of claim 41, wherein the DNA or RNA is fused to a
mammalian gene.
52. The method of claim 5 1, wherein the mammalian gene encodes a
fusion protein.
53. The method of claim 52, wherein the fusion protein is ubiquitin
or human growth hormone.
54. The method of claim 41, wherein the library is about
10.times.10.sup.2 to about 1.times.10.sup.7 members.
55. The method of claim 41, wherein the library is about 10.sup.3
to about 10.sup.5 members.
56. The method of claim 41, wherein the library is about 10.sup.4
members.
57. The method of claim 41, wherein about 8 .mu.g to about 12 .mu.g
of DNA or RNA is introduced into the animal.
58. The method of claim 41, wherein about 10 .mu.g of DNA or RNA is
introduced into the animal.
59. The method of claim 58, wherein the DNA or RNA is introduced by
gene gun or injection.
60. The method of claim 41, wherein the expression library
comprises a vector that includes a promoter suitable for expression
in a mammalian cell.
61. The method of claim 60, wherein the vector includes a signal
sequence positioned upstream of the DNA or RNA.
62. The method of claim 41, wherein the library is a cloned
expression library.
63. The method of claim 41, wherein the DNA or RNA is synthesized
chemically.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The invention relates generally to methods for screening and
obtaining vaccines generated from administration of expression
libraries constructed from a pathogen genome. The method further
includes identification of one or more antigenic plasmids that will
elicit an immune response that is protective against pathogen
challenge subsequent to inducing an in vivo immunogenic response.
Also included in the invention are particular vaccine compositions
protective against Listeria and Mycoplasma.
[0003] 2. Description of Related Art
[0004] While vaccination is one of the most cost-effective medical
methods for saving lives, vaccines have not been developed for many
of the most serious human diseases, including respiratory syncytial
virus (RSV), pneumonia caused by Streptococcus pneumoniae, and
diarrhea caused by rotavirus and Shigella. As is evident with the
HIV epidemic, the increase in tuberculosis and the endemic spread
of malaria and other parasitic diseases, there is an increasing
need to develop effective vaccines, yet for many of these pathogens
daunting scientific problems have arisen. For example, the
influenza virus is notorious for antigenic drift so that new
vaccines are constantly being developed; research efforts continue
in attempts to identify effective vaccines for rabies (Xiang, et
al, 1994), herpes (Rouse, 1995); tuberculosis (Lowrie, et al,
1994); HIV (Coney, et al, 1994) as well as many other diseases of
importance in developed and undeveloped countries. Yet there exists
no relatively rapid, yet alone systematic, means of identifying an
effective vaccine, much less a reasonable assurance that, once
identified, the vaccine will be broadly responsive to pathogen
challenge.
[0005] Many currently used vaccines are composed of live/attenuated
pathogens (Ada, 1991) which when inoculated infect cells and elicit
a broad immune response in the host. While highly detailed
knowledge of the pathobiology is not necessary, at the very least
isolation and identification of the pathogen is required. Live
vaccines are often superior to antigen or subunit vaccines because
of their tendency to elicit a broad level protective response;
however, serious disadvantages in using such vaccines include the
risk of a vaccine-induced infection, problems with producing and
storing the vaccine, and failure to engender any immune response;
for example, where antigen presentation is limited. Perhaps the
most troubling aspect of using live vaccines is the propensity for
actually causing the disease against which protection is intended.
Past experience with some of the polio and measles vaccines has
demonstrated that this may be a serious risk.
[0006] An alternative to the use of live/attenuated pathogen
vaccines is to use antibodies to single proteins or to a limited
number of proteins associated only with the pathogen. Polyclonal or
monoclonal antibodies are readily produced with the aid of modern
hybridoma technology, although these techniques are relatively
expensive and time consuming. There is also no assurance that
antibodies produced in response to an antigen will provide
protection against the pathogen providing the antigen;
consequently, it may be necessary to test a large number of
antigens isolated from a pathogen. Ultimately, no single antigen
may prove effective as a vaccine because the ability of subunit or
killed vaccine preparations to elicit a broad immune response is
generally quite limited.
[0007] Certain disadvantages of conventional vaccines are overcome
by using what is called "genetic immunization" (Tang, 1992). This
technology involves inoculating simple, naked plasmid DNA encoding
a pathogen protein into the cells of the host. The pathogen's
antigens are produced intracellularly and, depending on the
attached targeting signals, can be directed toward major
histocompatibility complex (MHC) class I or II presentation (Ulmer,
et al, 1993; Wang, et al, 1993). Risk of infection is essentially
eliminated and the DNA can be delivered to cells not normally
infected by the pathogen. Compared to conventional vaccines, the
production of genetic vaccines is straightforward and DNA is
considerably more stable than proteinaceous or live/attenuated
vaccines. Genetic immunization (a.k.a. DNA, polynucleotide etc.
immunization) with specific genes has shown promise in several
model systems of pathogenic disease (Davis, et al, 1993; Conry, et
al, 1994; Xiang, et al, 1994), and a few natural systems (Cox, et
al, 1993; Fynan, et al, 1993). Use of DNA (or RNA) thus overcomes
some of the problems encountered when an animal is presented
directly with an antigen.
[0008] However, despite promising initial results with genetic
vaccination, there remains the more basic and unsolved problem of
identifying the particular gene or genes of the pathogen that will
express an immunogen capable of priming the immune system for rapid
and protective response to pathogen challenge. Certain non-viral
pathogens and some viruses have very large genomes; for example,
protozoa genomes contain up to about 10.sup.8 nucleotides, thus
posing an expensive and time-consuming analytical challenge to
identify or isolate effective immunogenic antigens. The solution to
this problem to date has been to extensively study the pathobiology
of the host-pathogen interaction to isolate the protein reacted to
by the host during infection. And even with identification of a
gene or subunit that elicits a protective immune response, there
may still be lacking strong protection because of lack of broad
response to the encoded polypeptide.
[0009] Significantly, the time and money to identify and develop a
vaccine would be greatly reduced if there were available simple,
systematic and rapid ways to identify vaccines for specific
pathogens without having first to determine at least the
fundamental biological properties of the pathogen. Even more
important would be vaccines that are broadly effective without any
danger of causing the disease against which it is intended to
protect.
SUMMARY OF THE INVENTION
[0010] The present invention addresses one or more of these and
other drawbacks inherent in the prior art by providing novel
methods of generating and identifying effective vaccines. The
vaccines stimulate a broad protective response in a manner similar
to that generated by live/attenuated vaccines without the inherent
disadvantage of potentially causing the disease associated with the
pathogen. The invention also includes novel antigenic polypeptides
encoded by DNA plasmid vaccines, kits that include antigenic
pathogen polypeptides, plasmid vaccines or antibodies generated
from the pathogen polypeptides.
[0011] The invention, in general terms, arises from the inventors'
success in developing a way to present to an animal a major number
of antigenic determinants encoded by the genome of any pathogen.
The DNA of the pathogen is fragmented, ligated into expression
vectors and cloned sub-libraries (sibs) of the expression library
are inoculated into an animal. Sib library is understood to be a
portion of a parental library that may or may not have overlapping
members with other sibs of the same library. "Sibbing" as used
herein is understood to mean the partitioning of a parental library
into sequential subsets. Challenge by the pathogen reveals which
animals are protected and consequently which portions of the sib
expression library have protective effect. Sibbing methods may then
be used to identify the individual or combinations of plasmids that
are responsible for the protection. It is then possible to prepare
vaccines from the plasmids, and to identify the polypeptides
encoded by the protective plasmid vectors. One may also use well
known methods to generate polyclonal or monoclonal antibodies to
identified immunogens and use these as vaccines.
[0012] The invention is particularly directed to methods of
vaccination. A cloned expression library is prepared from
fragmented genomic DNA of a pathogen, or may be prepared from cDNA
of pathogen RNA. One then introduces one or more of the library
clones into an animal so as to induce an immune response against
one or more of the antigens that are encoded by one or more of the
clones. Subsequently, one may isolate the particular clone or
clones responsible for producing an antigen that induces an immune
response, obtain the antibodies, if any, generated in response to
one or more of the clones, or formulate vaccine compositions from
the various libraries or sib libraries that induce an immune
response.
[0013] The inventors' method allows rapid screening for potential
vaccines. It also allows discovery of new vaccines that would not
be detected by conventional approaches. For such screening, one
first selects or identifies a particular pathogen to which a
protective vaccine is desired. For example, the method has been
applied to a mycoplasm, Mycoplasma pulmonis, and to a eubacterium,
Listeria monocytogenes. These pathogens are but two examples of the
wide range of pathogens that might be screened; the method is
equally adaptable to screen for vaccines for HIV, malaria,
mycoplasma, tuberculosis, respiratory syncytial virus, and
conjugated pneumoccus; all pathogens for which there are no
effective vaccines. One may also screen for alternative and
improved vaccines for diseases such as smallpox and polio. Nor is
the method limited necessarily to viruses and bacteria. Use of any
pathogen is contemplated, including protozoa, yeast, fungi, worms
or prions. It is only necessary to obtain genomic material e.g.,
DNA or RNA or, in the case of prions, because they are proteins, to
isolate or synthesize a DNA that encodes the prion.
[0014] After selecting the pathogen(s) to which a vaccine is
desired, one then obtains a genomic or cDNA (or RNA) sample which
is subsequently fragmented, for example by physical fragmentation
or, preferably, by enzymatic cleavage, i.e. use of restriction
endonucleases. Fragmentation methods are well known to those
skilled in the art and may be varied to obtain segments (by use of
different restriction endonucleases or combinations and digestion
times) differing in size and composition.
[0015] After fragmentation of the DNA, an expression library is
prepared. Preparation of such libraries is relatively
straightforward and can be performed by well known methods.
Standard cloning vectors such as Puc118 may be employed which have
an ampicillin selectable marker and, preferably ori and a CMV
promoter. Bacteria are then transformed with the vectors, for
example, E. coli or Salmonella or other suitable bacterial host.
Identified transformants are cultured by standard procedures and
the plasmid DNA isolated by such methods as chromatographic or
organic separation. A series of plasmids have been constructed
which allow cloning each library into a site which can direct the
foreign protein to MHCI or II. These plasmids are shown in FIG.
1.
[0016] For prions, a relatively rare class of pathogens, a
preferred method is to determine the amino acid sequence of the
protein and synthesize the encoding DNA, or, alternatively, isolate
encoding DNA from infected cells. The prion-encoding DNA is then
fragmented and used to prepare an expression library in a manner
analogous to that of RNA, cDNA or genomic DNA.
[0017] An important aspect of the invention is the preparation of a
representative expression library from pathogen DNA. Mycoplasma
pulmonis is one example of a pathogen. MP has a genome size of
.about.1.times.10.sup.6 bp. Two of nine sib libraries provided
protective and were thus identified as candidates for effective
vaccine protection. Each sib library had .about.3.times.10.sup.3
members, of which only .about.500 should be expressing natural
open-reading frames. That two libraries protected indicated that
several plasmids or combinations of plasmids were vaccine
candidates. It appears likely that a minimal number of plasmids
will provide useful protection. Tests of two smaller MP libraries
of .about.70 members derived from MP2.3 showed little or no
protection, from which it was concluded that the protective
plasmid(s) are located in other sub-libraries of MP2.3. The
inventors have shown that the disclosed expression libraries can be
used directly as vaccines or partitioned in various ways to isolate
individual or combinations of plasmids that are protective. In this
way the ELI technology is a practical vaccine discovery approach,
even for protein subunit vaccines.
[0018] As mentioned, DNA is fragmented either physically or, for
example, by restriction enzymes, to produce relatively small
pieces, preferably on the order of 100 to 1,000 base pairs. For
smaller genomes, several hundred base pairs are preferable, for
example, 400 hundred base pairs; however, larger genomes, such as
found in Pseudomonas or E. coli might initially be fragmented into
somewhat larger sizes, for example, 30004000 bp. Except in the case
of extremely small genomes, a preferred method of practice is to
prepare sib libraries from the main expression library. For
example, a library including DNA mean fragment sizes of
approximately 400 bp are preferably sibbed into sublibraries
containing approximately 3000 transformants, i.e. approximately 21
sublibraries. A smaller number of sublibraries, or sib libraries,
is preferred for smaller genomes, such as mycoplasma, where a 3000
member library is achieved with approximately 9 sib libraries.
[0019] Of course it is technically feasible to apply ELI to any
pathogens with larger genomes. Genomes smaller than Mycoplasm and
Listeria, many of which have genomes up to 100-fold smaller than
Mycoplasm, are well-suited for application of the disclosed methods
of identifying and isolating immunogens. These pathogens include
HIV, known to have an exceptional number of variants and which is
therefore an excellent candidate for screening with the ELI.
[0020] Genetic immunization with the ELI expression library
reproduces the same antigens induced by a live/attenuated pathogen,
i.e., the entire genome. Additionally, and importantly, the method
is such as to allow presentation of new determinants that are
normally hidden by the biology of the pathogen. The new ELI method
combines the advantages of genetic immunization without the
necessity of discovering a single protective gene or foreknowledge
of the pathogen's biology.
[0021] Once expression libraries have been prepared for a given
pathogen and DNA plasmid libraries isolated, one will inoculate a
mammal with a DNA plasmid library. The library may be inoculated
into the animal in any one of several different methods that have
been shown effective for genetic immunization; for example, gene
gun or needle injection into muscle or skin or by oral
administration. The gene gun technique used for ELI is thought to
be approximately 1,000- to 10,000-fold more efficient than
injection of naked DNA (Fynan, et al. (1993)). Alternatively,
others e.g. Ulmer et al. (1993), have indicated the genetic
immunization by direct DNA injection may be performed with similar
efficiency as the gene gun. The inventors have found that gene
administration by either method produces qualitatively identical
immunization.
[0022] The inventors' method has broad application as a screening
method for identifying vaccines. Briefly, this involves preparing
an expression library from fragmented genomic nucleic acid,
isolating plasmid DNA and immunizing with at least a portion of the
library. A protective effect is indicated when an animal is
challenged with the pathogen from which the genomic material was
obtained.
[0023] The inventors have found that mammalian genes fused to the
pathogen DNA appears to facilitate expression in the mammalian
cell. In preferred embodiments, a mammalian gene such as that
encoding human growth hormone is fused with the DNA; however, other
genes would be suitable, including .alpha.-trypsin, ubiquitin or
signal sequences. The inventors have found that fusion of
nonmammalian pathogen sequences to mammalian genes increases the
amount of antigen available to the immune system. This may arise
because of increasing antigenic recognition or targeting to
components in the cell.
[0024] The inventors have found that the maximum expression by
genetic immunization (ELI) is obtained when about 2.5 .mu.g is
introduced per site of inoculation when gene gun inoculation is
used. Different amounts may be required if other methods of
introduction are employed. The inventors have also determined that
the lowest amount of DNA that produces an immune response is
between about 0.1 and 1 ng. (FIG. 2). This was shown by injecting
various amounts of human growth hormone DNA into mice and
monitoring antibody production. Antibody was detectable with 1 ng.
It was thus predicted that the maximum complexity represented by
inoculating 10 .mu.g (in four sites) of a library under these
conditions such that an immune response would be generated
comprising approximately 1.times.10.sup.4 clones (or
1/6.times.1.times.10.sup.4=1.5.times.10.sup.3 expressing clones).
This indicated that approximately 1.times.10.sup.4 clones could be
included in each sib library. An inoculation of approximately 10
.mu.g of DNA would introduce the equivalent of approximately
10.sup.9 bacterial genomes into the host in a highly immunogenic
form. This exceeds by several orders of magnitude the number of
genome equivalents generally necessary to produce infection in a
host. For example, mycoplasma can produce an infection when
inoculated at 10.sup.3 to 10.sup.6 organisms per animal. These
results were an important aspect of the invention because there was
a real question whether these predictions concerning the number of
plasmids that could be injected would actually be feasible. Had
large libraries not been shown to be protective, there would have
been little value to the disclosed methods.
[0025] Genetic immunization procedures are now well established and
well known in the art. One or more inocula of the library aliquots
may be employed for immunization. Likewise, vaccine compositions
may vary widely, to include for example various adjuvants.
[0026] ELI is expected to elicit response of both arms of the
immune system. Extracellular antigens are largely presented through
MHCII proteins and produce a humoral defense, i.e., circulating
antibodies against proteins of the pathogen. Intracellular
pathogens present proteins through a different pathway that goes
through the endoplasmic reticulum and onto MHCI proteins to elicit
the cellular arm of the immune system. For many pathogens, the
relative importance of the two arms in protection is not known and
the two systems may crossover in macrophages and through natural
immunity, e.g., natural killer cells. Use of appropriate vectors
may cause one or both of the immune responses to be favored.
[0027] The inventors have shown that ELI will produce a vaccine
without knowing what specific protein(s) is responsible for
eliciting protection. In this sense ELI mimics live/attenuated
vaccines. Another advantage over conventional vaccines is that
peptides may be presented to the immune system with ELI which are
normally hidden by the pathogen's biology or immune-avoidance
mechanisms. Unlike live/attenuated vaccines where the stoichiometry
of the pathogen's antigens is fixed, the composition of the library
can be modified at will to allow introduction of only the most
effective antigens at varied levels. By using ELI, the site of
inoculation can be controlled allowing cells not normally infected
to present antigens. In addition, use of other fusion proteins than
hGH should allow antigens to be targeted to specific presentation
pathways.
[0028] The effective protection against mycoplasm demonstrated by
the inventors indicated both humoral and cellular responses were
elicited. Previous work demonstrated that anti-mycoplasma
antibodies can protect mice against infection (Tayler, et al,
1981), yet passive transfer of antibody does not protect rats
(Davidson, et al, 1982). Immune spleen cells, however, can transfer
protection in syngeneic rats (Cassell, 1982; Lai, et al, 1991). It
has also been demonstrated in mice that augmented natural killer
cells or secreted interferon gamma-activated macrophages can kill
mycoplasma (Lai, et al, 1990). Given this uncertainty about the
relative contributions to resistance and the fact that both
responses were elicited with the library inoculations, the strong
protection does not appear to arise primarily from one or the other
immune arm. This aspect is very attractive, as it indicates a broad
protective response from ELI immunization.
[0029] ELI is expected to elicit immunity against any organisms
requiring either arm of the immune system because it activates both
humoral and cellular immune responses. The protection afforded is
therefore quite broad and is expected to provide superior
protection compared with single antigen or antigen-encoding
DNA.
[0030] The invention also contemplates that the disclosed DNA
libraries or the peptides encoded by identified protective DNA
plasmids will be useful in developing a wide range of vaccines and
will also be useful in certain methods of cancer treatment. Cancer
treatment methods, including vaccine development are another aspect
of the present invention. Additionally, a variety of in vitro and
in vivo assay protocols are facilitated as a result of the novel
compositions disclosed herein. In addition to generating an immune
response in an animal, and particularly in a human, the peptides
may also be used as immunogens to generate anti-peptide antibodies,
which themselves have many uses, not least of which is the
detection of pathogen related peptides, or peptide fragments
thereof, in diagnostic tests and kits based upon immunological
binding assays).
[0031] Therefore, one contemplated use for the pathogen peptides
concerns their use in methods for detecting the presence of a
pathogen within a sample. These methods include contacting a sample
suspected of containing a pathogen with a peptide or composition in
accordance with the present invention under conditions effective to
allow the peptide(s) to form a complex with pathogen-related
peptides contained in the sample. One then detects the presence of
the complex by detecting the presence of the peptide(s) within the
complex, e.g., by either originally using radiolabeled peptides or
by subsequently employing anti-peptide antibodies and standard
secondary antibody detection techniques.
[0032] The peptides, or multimers thereof, may be dispersed in any
one of the many pharmacologically-acceptable vehicles known in the
art and particularly exemplified herein. As such, the peptides may
be encapsulated within liposomes or incorporated in a biocompatible
coating designed for slow-release. The preparation and use of
appropriate therapeutic formulations will be known to those of
skill in the art in light of the present disclosure. The peptides
may also be used as part of a prophylactic regimen designed to
prevent, or protect against, disease pathogens, possible cancer
progression and/or metastasis and may thus be formulated as a
vaccine.
[0033] The present invention also provides methods for identifying
specific pathogen peptides, which methods comprise contacting the
cells suspected of containing such polypeptides with an
immunologically effective amount of a composition comprising one or
more specific anti-peptide antibodies disclosed herein.
[0034] In another aspect, the present invention contemplates a
diagnostic kit for screening samples suspected of containing
pathogen polypeptides, or cells producing such polypeptides. Said
kit can contain a peptide or antibody of the present invention. The
kit can contain reagents for detecting an interaction between an
agent and a peptide or antibody of the present invention. The
provided reagent can be radio-, fluorescently- or
enzymatically-labeled. The kit can contain a known radiolabeled
agent capable of binding or interacting with a peptide or antibody
of the present invention.
[0035] In another aspect, the present invention contemplates a
diagnostic kit for detecting mycoplasm or Listeria polypeptides.
The kit comprises reagents capable of detecting such peptides. The
provided reagent may also be radio-, enzymatically-, or
fluorescently-labeled. The kit can contain a radiolabeled peptide
capable of binding to or interacting with a mycoplasma or Listeria
polypeptide, or, preferably, may contain a radiolabeled antibody
capable of binding to or interacting with a peptide of the present
invention. The kit can contain a polynucleotide probe that encodes
a peptide of the present invention or any of their complements. The
kit can contain an antibody immunoreactive with a peptide of the
present invention.
[0036] The reagent of the kit can be provided as a liquid solution,
attached to a solid support or as a dried powder. Preferably, when
the reagent is provided in a liquid solution, the liquid solution
is an aqueous solution. When the reagent provided is attached to a
solid support, the solid support can be chromatograph media, a test
plate having a plurality of wells, or a microscope slide. When the
reagent provided is a dry powder, the powder can be reconstituted
by the addition of a suitable solvent, optionally provided.
[0037] In still further embodiments, the present invention concerns
immunodetection methods and associated kits. It is proposed that
the peptides of the present invention may be employed to detect
antibodies having reactivity therewith, or, alternatively,
antibodies prepared in accordance with the present invention, may
be employed to detect pathogen polypeptides. In general, these
methods will include first obtaining a sample suspected of
containing such a protein, peptide or antibody, contacting the
sample with an antibody or peptide in accordance with the present
invention, as the case may be, under conditions effective to allow
the formation of an immunocomplex, and then detecting the presence
of the immunocomplex.
[0038] In general, the detection of immunocomplex formation is
quite well known in the art and may be achieved through the
application of numerous approaches. For example, the present
invention contemplates the application of ELISA, RIA, immunoblot
(e.g., dot blot), indirect immunofluorescence techniques and the
like. Generally, immunocomplex formation will be detected through
the use of a label, such as a radiolabel or an enzyme tag (such as
alkaline phosphatase, horseradish peroxidase, or the like). Of
course, one may find additional advantages through the use of a
secondary binding ligand such as a second antibody or a
biotin/avidin ligand binding arrangement, as is known in the
art.
[0039] For diagnostic purposes, it is proposed that virtually any
sample suspected of comprising either the mycoplasma or Listeria or
antibody sought to be detected, as the case may be, may be
employed. Exemplary samples include clinical samples obtained from
a patient or animal such as blood or serum samples, ear swabs,
sputum samples, middle ear fluid or even perhaps urine samples may
be employed. Furthermore, it is contemplated that such embodiments
may have application to non-clinical samples, such as in the
titering of antigen or antibody samples, in the selection of
hybridomas, and the like.
[0040] In related embodiments, the present invention contemplates
the preparation of kits that may be employed to detect the presence
of pathogen peptides and/or antibodies in a sample. Generally
speaking, kits in accordance with the present invention will
include a suitable antigenic peptide, e.g. from mycoplasma or
Listeria, or an antibody directed against such a protein or
peptide, together with an immunodetection reagent and a means for
containing the antibody or antigen and reagent. The immunodetection
reagent will typically comprise a label associated with the
antibody or antigen, or associated with a secondary binding ligand.
Exemplary ligands might include a secondary antibody directed
against the first antibody or antigen or a biotin or avidin (or
streptavidin) ligand having an associated label. Of course, as
noted above, a number of exemplary labels are known in the art and
all such labels may be employed in connection with the present
invention.
[0041] The container means will generally include a vial into which
the antibody, antigen or detection reagent may be placed, and
preferably suitably aliquotted. The kits of the present invention
will also typically include a means for containing the antibody,
antigen, and reagent containers in close confinement for commercial
sale. Such containers may include injection or blow-molded plastic
containers into which the desired vials are retained.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] FIG. 1. Examples of ELI vectors to direct antigens for
different MHC class presentation. Secreted antigens are expected to
favor MHC class presentation and antibody production. Cytoplasmic
or proteasomal-directed antigens should favor MHC class I
presentation and. CD8+ cytotoxic T lymphocyte activation.
[0043] FIG. 2. hGH antibodies produced by genetic immunization with
varied amounts of CMV-GH plasmid. 5-6 week old female Balb/C mice
were inoculated every two weeks in 2 shots with the gene gun using
the indicated amounts of CMV-GH plasmid. Each inoculum under 1
.mu.g was balanced to 1 .mu.g with CMV-LUC, a luciferase expression
plasmid. Inoculations indicates samples of sera collected 10 days
after the indicated CMV-GH inoculation. The entire set of sera
along with pre-immune sera was tested by .beta.-galactosidase
ELISA. Anti-hGH Antibodies (betagal lumens) represents the ELISA
lumens produced by each sample minus the pre-immune background. The
black and striped bars for each different amount of CMV-GH
represents an individual mouse tested.
[0044] FIG. 3. Vectors used for expression library immunization
(ELI). CMV-GH-F1&3 was derived from CMV-GH in which the
cytomegalovirus promoter drives expression of the genomic human
growth hormone (hGH) gene. CMV-GH-F1&3 differs from the hGH
sequence by substitution of a BamHI site 3' to the BglII site such
that restriction fragments having GATC 5' overhangs (i.e. MboI
fragments) can be inserted into BamHI or BglII in two different
coding frames. TAA stop codons were inserted in all three coding
frames 3' to both insertion sites to stop translation of any
inserts lacking their own stop codons. CMV-GH-F2 was constructed
similarly by knocking out the BglII site in hGH and inserting a
BamHI in frame 2.
[0045] FIG. 4A. MP titers from the lungs of ELI-immunized,
MP-challenged mice. 5-6 week old Balb/C female mice were immunized
4 times with 10 .mu.g of MP1.1 and MP2.3 on day 1 and with 5 .mu.g
on day 8, 21, and 52 and challenged with the indicated number of MP
(MP Inoculum) 12 days later (Lai et al, 1991). CMV-GH and listeria
library mice were immunized on a similar schedule and challenged at
the same time. The listeria library mice consists of a 3000
transformant library constructed into CMV-GH-F2 using MboI-digested
Listeria monocytogenes genomic DNA. The mice were sacrificed 14
days after challenge and lung lavage and lung sectioning was
performed. MP Titers from the lungs of ELI-immunized, MP-challenged
mice. MP CFUs from Lung represents the total number of MP from each
group of mice as calculated from counting MP grown on plates from
serial dilutions of lung lavages from the mice.
[0046] FIG. 4B. Histopathology of ELI immunized, MP-challenged
mice. Lung sections from mice immunized with the indicated plasmids
were stained and the degree of histopathologic lesions induced by
MP infection was assessed and scored with a histopathology index.
An index of 1.0 represents the maximal number of lesions observed
in infected mice. An index of 0 indicates normal morphology. Each
bar represents the mean from 2 to 4 mice. Error bars represent the
standard deviation for each group.
[0047] FIG. 5. MP titers from the lungs of mice 30 days after the
start of immunization. 5-6 week old male Balb/C mice were immunized
with 6 .mu.g of CMV-GH-F2 or MP2.3 on day 1 and 3 .mu.g on day 15,
and 22. The mice were challenged with the indicated MP inoculum on
day 30 and lung lavages were performed on day 44. MP CFUs from Lung
represents the total number of MP from each group of mice as
calculated from counting MP grown on plates from serial dilutions
of lung lavages from the mice. Each bar represents the mean for 3
mice. Error bars represent the standard deviation for each
group.
[0048] FIG. 6. Cartoon of generic ELI protocol for isolation of
vaccine plasmids for any pathogen.
[0049] FIG. 7. Listeria monocytogenes titers from the spleens of
ELI-immunized, Listeria monocytogenes-infected mice. 5-6 week old
BalbC female mice were immunized 3 times with 10 .mu.g of Listeria
library 1.1 or combined Lis lib 2.1+2.2. Lis Lib are libraries
created by ligation of Listeria monocytogenes genomic Mbol
fragments cloned into CMV-GHF1&3 and CMV-GHF-2 as for MP.
control (unimmunized) and EKI-immunized mice were challenged with
10.sup.5 listeria by i.v. injection and listeria CFUs were counted
from spleen homogenates 3 days later.
[0050] FIG. 8. Cartoon showing scheme for sibbing procedure for
several independent protective plasmids.
[0051] FIG. 9. Cartoon showing scheme for sibbing procedure to
determine cooperative effects or additive threshold effects.
[0052] FIG. 10. Cartoon of the methodology of ELI against Mycopasma
pulmonis (MP). Libraries MP1.1 and MP2.3 consist of two different
3000 transformant sibs created by insertion of MP MboI fragments
into frame 1 of CMV-GH-F1&3 and frame 2 of CMV-GH-F2,
respectively. Balb/C mice were immunized as indicated using either
MP1.1 or MP2.3 by gene gun delivery and the mice were subsequently
challenged with MP and their resistance was assessed by titering MP
from the lungs and by histochemical staining of lung sections as
described in (Lai, et al, 1991). A set of mice with lower MP titers
or histopathology indicated that one or more plasmids in the
library confer resistance to MP by genetic immunization.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0053] The invention includes a novel expression library
immunization (ELI) method applicable to virtually any pathogen and
that requires no knowledge of the biological properties of the
pathogen. The method operates on the assumption, generally accepted
by those skilled in the art, that all the potential antigenic
determinants of any pathogen are encoded in its genome. The
inventors have now devised methods of identifying vaccines using a
genomic expression library representing all of the antigenic
determinants (except for those resulting from modification of the
protein) of a pathogen. The method has the advantages of "gene
immunization" by eliminating potential for infection while also
providing for the first time a general and effective method of
immunizing and identifying a vaccine without having to characterize
the pathogen against which the vaccine is desired.
[0054] The preparation of an expression library is performed using
the techniques and methods familiar to the molecular biologist. The
pathogen's genome, whether bacterial, yeast, mold, fungal, algal,
protozoan, viral, may or may not be known and may even have been
cloned. Thus one obtains DNA (or cDNA), representing substantially
the entire genome of the pathogen. The DNA is broken up, by
physical fragmentation or restriction endonuclease, into segments
of some length so as to provide a library of about 10.sup.-1 (x
genome size) members. Of course for cloned DNA in YACs, a
sufficient library may be available. In cases, as for certain
viruses, where the genome is RNA, the RNA may be used to prepare a
DNA library. Alternatively, mRNA may be used to generate libraries;
for example from human or animal tumor cells.
[0055] The in vivo effectiveness of the novel immunization has been
demonstrated with genomes differing in size by approximately
four-fold. The inventors have demonstrated ELI protection against
Mycoplasma pulmonis with a genome of 1.times.10.sup.6 bp and have
also shown protection against Listeria monocytogenes, a pathogen
whose genome is approximately 4.times.10.sup.6 bp. These pathogens
represent two different classes of pathogens, Mollicutes and
Gram-positive bacilli respectively and serve to demonstrate the
broad applicability of the method.
[0056] One expects the disclosed techniques and methods to apply
not only to the Listeria and Mycoplasma genera but also to the
broader classes of pathogens including Mollicutes and Gram-positive
bacilli. Numerous species comprise the genera of these classes,
including the unusual asporogenous aerobic bacilli represented by
Rothia, kurthia and Oerskovia. Most pathogens have genomes the same
or smaller size than Listeria or Mycoplasma and the method will
also apply to larger genomes and will be suitable for developing
and identifying vaccines from broad categories of human and
non-human pathogens, shown in Table 1.
1 TABLE 1 viruses genome of .about.10.sup.3 to 10.sup.5 bp
mycoplasma genome of .about.10.sup.6 bp bacteria genome of .about.2
.times. 10.sup.6 to 9 .times. 10.sup.6 bp Fungi genome of .about.2
.times. 10.sup.7 bp Algae genome of .about.5 .times. 10.sup.7 bp
Protozoa genome of .about.5 .times. 10.sup.7 bp Molds genome of
.about.5 .times. 10.sup.7 bp to 9 .times. 10.sup.7 bp cDNA library
(any .about.10.sup.3 to 10.sup.6 bp pathogen or cancer)
mitochondrial genome .about.10.sup.4 to 10.sup.5 bp
[0057] 1. Other Methods of Inoculation
[0058] Introducing an expression library into a subject may be
performed in several ways; including by gene gun. The gene gun
technique used for ELI is thought to be .about.1000 to 10,000-fold
more efficient than injection of naked DNA (Fynan, et al (1993).
Others, e.g. Ulmer, et al (1993) have indicated that genetic
immunization by direct DNA injection may be performed with similar
efficiency as the gene gun. The inventors have found that gene
administration by either method produces qualitatively identical
immunization. The expression library may also be introduced by
methods other than genetic immunization. The bacteria bearing the
library can be directly inoculated into the host or the library and
put into an infectious agent, such as adenovirus. Once the
protecting pathogen gene(s) has been isolated the actual vaccine
can be by genetic immunization.
[0059] Of course, in light of the new technology on DNA
vaccination, it will be understood that virtually all such
vaccination regimens will be appropriate for use with DNA vectors
and constructs, as described by Ulmer et al. (1993), Tang et al.
(1992), Cox et al. (1993), Fynan et al. (1993), Wang et al. (1993)
and Whitton et al. (1993), each incorporated herein by reference.
In addition to parenteral routes of DNA inoculation, including
intramuscular and intravenous injections, mucosal vaccination is
also contemplated, as may be achieved by administering drops of DNA
compositions to the nares or trachea. It is particularly
contemplated that a gene-gun could be used to deliver an
effectively immunizing amount of DNA to the epidermis (Fynan et
al., 1993).
[0060] 2. ELISAs
[0061] ELISAs may be used in conjunction with the invention. In an
ELISA assay, proteins or peptides incorporating pathogen antigen
sequences are immobilized onto a selected surface, preferably a
surface exhibiting a protein affinity such as the wells of a
polystyrene microtiter plate. After washing to remove incompletely
adsorbed material, it is desirable to bind or coat the assay plate
wells with a nonspecific protein that is known to be antigenically
neutral with regard to the test antisera such as bovine serum
albumin (BSA), casein or solutions of milk powder. This allows for
blocking of nonspecific adsorption sites on the immobilizing
surface and thus reduces the background caused by nonspecific
binding of antisera onto the surface.
[0062] After binding of antigenic material to the well, coating
with a non-reactive material to reduce background, and washing to
remove unbound material, the immobilizing surface is contacted with
the antisera or clinical or biological extract to be tested in a
manner conducive to immune complex (antigen/antibody) formation.
Such conditions preferably include diluting the antisera with
diluents such as BSA, bovine gamma globulin (BGG) and phosphate
buffered saline (PBS)/Tween.RTM.. These added agents also tend to
assist in the reduction of nonspecific background. The layered
antisera is then allowed to incubate for from 2 to 4 hours, at
temperatures preferably on the order of about 25.degree. to about
27.degree. C. Following incubation, the antisera-contacted surface
is washed so as to remove non-immunocomplexed material. A preferred
washing procedure includes washing with a solution such as
PBS/Tween, or borate buffer.
[0063] Following formation of specific immunocomplexes between the
test sample and the bound antigen, and subsequent washing, the
occurrence and even amount of immunocomplex formation may be
determined by subjecting same to a second antibody having
specificity for the first. To provide a detecting means, the second
antibody will preferably have an associated enzyme that will
generate a color development upon incubating with an appropriate
chromogenic substrate. Thus, for example, one will desire to
contact and incubate the antisera-bound surface with a urease or
peroxidase-conjugated anti-human IgG for a period of time and under
conditions which favor the development of immunocomplex formation
(e.g., incubation for 2 hours at room temperature in a
PBS-containing solution such as PBS-Tween.RTM.).
[0064] After incubation with the second enzyme-tagged antibody, and
subsequent to washing to remove unbound material, the amount of
label is quantified by incubation with a chromogenic substrate such
as urea and bromocresol purple or
2,2'-azino-di-(3-ethyl-benzthiazoline-6-sulfonic acid [ABTS] and
H.sub.2O.sub.2, in the case of peroxidase as the enzyme label.
Quantification is then achieved by measuring the degree of color
generation, e.g., using a visible spectra spectrophotometer.
[0065] 3. Epitopic Core Sequences
[0066] The present invention is also directed to protein or peptide
compositions, free from total cells and other peptides, which
comprise a purified protein or peptide which incorporates an
epitope that is immunologically cross-reactive with one or more
pathogen antibodies, for example those polypeptides that comprise
the epitopic regions of mycoplasma or Listeria genome.
[0067] As used herein, the term "incorporating an epitope(s) that
is immunologically cross-reactive with one or more pathogen
antibodies" is intended to refer to a peptide or protein antigen
which includes a primary, secondary or tertiary structure similar
to an epitope located within any of a number of pathogen
polypeptides encoded by the pathogen DNA or RNA. The level of
similarity will generally be to such a degree that monoclonal or
polyclonal antibodies directed against the such polypeptides will
also bind to, react with, or otherwise recognize, the
cross-reactive peptide or protein antigen. Various immunoassay
methods may be employed in conjunction with such antibodies, such
as, for example, Western blotting, ELISA, RIA, and the like, all of
which are known to those of skill in the art.
[0068] The identification of pathogen epitopes, and/or their
functional equivalents, suitable for use in vaccines is part of the
present invention. Once isolated and identified, one may readily
obtain functional equivalents. For example, one may employ the
methods of Hopp, as taught in U.S. Pat. No. 4,554,101, incorporated
herein by reference, which teaches the identification and
preparation of epitopes from amino acid sequences on the basis of
hydrophilicity. The methods described in several other papers, and
software programs based thereon, can also be used to identify
epitopic core sequences (see, for example, Jameson and Wolf, 1988;
Wolf et al., 1988; U.S. Pat. No. 4,554,101). The amino acid
sequence of these "epitopic core sequences" may then be readily
incorporated into peptides, either through the application of
peptide synthesis or recombinant technology.
[0069] Preferred peptides for use in accordance with the present
invention will depend on the particular peptides identified from
sib library immunization, as disclosed herein. Relatively short
peptides, such as those prepared from 8 to 30 or so amino acids may
provide advantages in certain circumstances, for example, in the
preparation of some vaccines or in immunologic detection assays.
Exemplary advantages include the ease of preparation and
purification, the relatively low cost and improved reproducibility
of production, and advantageous biodistribution.
[0070] It is proposed that particular advantages of the present
invention may be realized through the preparation of synthetic
peptides which include modified and/or extended
epitopic/immunogenic core sequences which result in a "universal"
epitopic peptide directed to pathogen-specific peptide sequences.
These epitopic core sequences are identified herein in particular
aspects as hydrophilic regions of the pathogen antigens. It is
proposed that these regions represent those which are most likely
to promote T-cell or B-cell stimulation or humoral response, and,
hence, elicit specific antibody production.
[0071] An epitopic core sequence, as used herein, is a relatively
short stretch of amino acids that is "complementary" to, and
therefore will bind, antigen binding sites on transferrin-binding
protein antibodies. Additionally or alternatively, an epitopic core
sequence is one that will elicit antibodies that are cross-reactive
with antibodies directed against the peptide compositions of the
present invention. It will be understood that in the context of the
present disclosure, the term "complementary" refers to amino acids
or peptides that exhibit an attractive force towards each other.
Thus, certain epitope core sequences of the present invention may
be operationally defined in terms of their ability to compete with
or perhaps displace the binding of the desired protein antigen with
the corresponding protein-directed antisera.
[0072] In general, the size of the polypeptide antigen is not
believed to be particularly crucial, so long as it is at least
large enough to carry the identified core sequence or sequences.
The smallest useful core sequence anticipated by the present
disclosure would generally be on the order of about 8 amino acids
in length, with sequences on the order of up to several tens of
amino acids, depending on the size of the DNA found to in the
protective plasmid identified by using the expression library
immunization method. Thus, this size will generally correspond to
the smallest peptide antigens prepared in accordance with the
invention. However, the size of the antigen may be relatively
large, for example up to several hundred or more where desired, so
long as it contains a basic epitopic core sequence.
[0073] The identification of epitopic core sequences is known to
those of skill in the art, for example, as described in U.S. Pat.
No. 4,554,101, incorporated herein by reference, which teaches the
identification and preparation of epitopes from amino acid
sequences on the basis of hydrophilicity. Moreover, numerous
computer programs are available for use in predicting antigenic
portions of proteins (see e.g., Jameson & Wolf, 1988; Wolf et
al., 1988). Computerized peptide sequence analysis programs (e.g.,
DNAStar Software, DNAStar, Inc., Madison, Wis.) may also be useful
in designing synthetic peptides in accordance with the present
disclosure.
[0074] Syntheses of epitopic sequences, or peptides which include
an antigenic epitope within their sequence, are readily achieved
using conventional synthetic techniques such as the solid phase
method (e.g., through the use of commercially available peptide
synthesizer such as an Applied Biosystems Model 430A Peptide
Synthesizer). Peptide antigens synthesized in this manner may then
be aliquotted in predetermined amounts and stored in conventional
manners, such as in aqueous solutions or, even more preferably, in
a powder or lyophilized state pending use.
[0075] In general, due to the relative stability of peptides, they
may be readily stored in aqueous solutions for fairly long periods
of time if desired, e.g., up to six months or more, in virtually
any aqueous solution without appreciable degradation or loss of
antigenic activity. However, where extended aqueous storage is
contemplated it will generally be desirable to include agents
including buffers such as Tris or phosphate buffers to maintain a
pH of about 7.0 to about 7.5. Moreover, it may be desirable to
include agents which will inhibit microbial growth, such as sodium
azide or Merthiolate. For extended storage in an aqueous state it
will be desirable to store the solutions at 4.degree. C., or more
preferably, frozen. Of course, where the peptides are stored in a
lyophilized or powdered state, they may be stored virtually
indefinitely, e.g., in metered aliquots that may be rehydrated with
a predetermined amount of water (preferably distilled) or buffer
prior to use.
[0076] 4. Immunoprecipitation
[0077] The antibodies of the present invention are particularly
useful for the isolation of antigens by immunoprecipitation.
Immunoprecipitation involves the separation of the target antigen
component from a complex mixture, and is used to discriminate or
isolate minute amounts of protein. For the isolation of membrane
proteins cells must be solubilized into detergent micelles.
Nonionic salts are preferred, since other agents such as bile
salts, precipitate at acid pH or in the presence of bivalent
cations.
[0078] In an alternative embodiment the antibodies of the present
invention are useful for the close juxtaposition of two antigens.
This is particularly useful for increasing the localized
concentration of antigens, e.g. enzyme-substrate pairs.
[0079] 5. Western Blots
[0080] The compositions of the present invention may find use in
immunoblot or western blot analysis. The anti-peptide antibodies
may be used as high-affinity primary reagents for the
identification of proteins immobilized onto a solid support matrix,
such as nitrocellulose, nylon or combinations thereof. In
conjunction with immunoprecipitation, followed by gel
electrophoresis, these may be used as a single step reagent for use
in detecting antigens against which secondary reagents used in the
detection of the antigen cause an adverse background. This is
especially useful when the antigens studied are immunoglobulins
(precluding the use of immunoglobulins binding bacterial cell wall
components), the antigens studied cross-react with the detecting
agent, or they migrate at the same relative molecular weight as a
cross-reacting signal.
[0081] Immunologically-based detection methods for use in
conjunction with Western blotting include enzymatically-,
radiolabel-, or fluorescently-tagged secondary antibodies against
the peptide moiety are considered to be of particular use in this
regard.
[0082] 6. Vaccines
[0083] The present invention contemplates vaccines for use in both
active and passive immunization embodiments. Immunogenic
compositions, proposed to be suitable for use as a vaccine, may be
prepared most readily directly from immunogenic pathogen sib
expression libraries in the manner disclosed herein. Preferably the
antigenic material is extensively dialyzed to remove undesired
small molecular weight molecules and/or lyophilized for more ready
formulation into a desired vehicle. Vaccines may be polypeptide or
DNA compositions. DNA compositions are preferably cloned sib
expression libraries, obtained from the fragmented genome of a
pathogen.
[0084] The inventors have demonstrated that one may generate an
immune response in an animal by administering to the animal, or
human subject, a pharmaceutically acceptable composition comprising
an immunologically effective amount of a cloned expression nucleic
acid library. The stimulation of specific antibodies and CTL
(cytotoxic T lymphocyte) responses upon administering to an animal
a nucleic molecule is now well known in the art, as evidenced by
articles such as Tang et al. (1992); Cox et al. (1993;) Fynan et
al. (1993); Ulmer et al. (1993); Wang et al. (1993) and Whitton et
al. (1993); each incorporated herein by reference.
[0085] This technology, often referred to as genetic immunization,
is particularly suitable to protect against bacterial infections
and is expected to be equally protective against viral infections.
Indeed, immunization with DNA has been successfully employed to
protect animals from challenge with influenza A (Ulmer et al.,
1993). Therefore, the use of the expression library compositions of
the present invention employing techniques similar to those
described by Ulmer et al. (1993, incorporated herein by reference),
is considered to be particularly useful as a vaccination
regimen.
[0086] The expression library DNA segments can be used in virtually
any form, including naked DNA and plasmid DNA, and may be
administered to the animal in a variety of ways, including
parenteral, mucosal and gene-gun inoculations, as described, for
example, by Fynan et al. (1993) and Tang et al (1992).
[0087] The inventors have used expression plasmids for
immunization; however, it is contemplated that the DNA segments
themselves as immunizing agents to vaccinate against infection and
disease. The technology for using DNA segments as vaccines has
recently been developed and is generally termed "Genetic
Immunization" or "DNA Vaccination" (Cohen, 1993). It is now known
that cells can take up naked DNA and express the peptides encoded
on their surface, thus stimulating an effective immune response,
which includes the generation of cytotoxic T lymphocytes (killer T
cells).
[0088] The utilization of this technology, and variations thereof,
such as those described by Tang et al. (1992), Ulmer et al. (1993);
Cox et al. (1993), Fynan et al. (1993), Wang et al. (1993) and
Whitton et al. (1993), each incorporated herein by reference, is
particularly suitable as it has already been shown to be successful
against a form of influenza virus, the type of pathogen also
targeted by the present invention. It is contemplated that
virtually any type of vector, including naked DNA in the form of a
plasmid, could be employed to generate an immune response in
conjunction with a wide variety of immunization protocols,
including parenteral, mucosal and gene-gun inoculations (Tang et
al, 1992; Fynan et al., 1993).
[0089] The preparation of vaccines which contain peptide sequences,
determined from the DNA of plasmids identified as protective
against pathogen challenge, as active ingredients is generally well
understood in the art, as exemplified by U.S. Pat. Nos. 4,608,251;
4,601,903; 4,599,231; 4,599,230; 4,596,792; and 4,578,770, all
incorporated herein by reference. Typically, such vaccines are
prepared as injectables, either as liquid solutions or suspensions
or solid forms suitable for solution in, or suspension in, liquid
prior to injection. The preparation may also be emulsified. The
active immunogenic ingredient is often mixed with excipients which
are pharmaceutically acceptable and compatible with the active
ingredient. Suitable excipients are, for example, water, saline,
dextrose, glycerol, ethanol, or the like and combinations thereof.
In addition, if desired, the vaccine may contain minor amounts of
auxiliary substances such as wetting or emulsifying agents, pH
buffering agents, or adjuvants which enhance the effectiveness of
the vaccines.
[0090] Vaccines may be conventionally administered parenterally, by
injection, for example, either subcutaneously or intramuscularly.
Additional formulations which are suitable for other modes of
administration include suppositories and, in some cases, oral
formulations. For suppositories, traditional binders and carriers
may include, for example, polyalkalene glycols or triglycerides:
such suppositories may be formed from mixtures containing the
active ingredient in the range of about 0.5% to about 10%,
preferably about 1 to about 2%. Oral formulations include such
normally employed excipients as, for example, pharmaceutical grades
of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate and the like. These
compositions take the form of solutions, suspensions, tablets,
pills, capsules, sustained release formulations or powders and
contain about 10 to about 95% of active ingredient, preferably
about 25 to about 70%.
[0091] The pathogen peptides of the present invention may be
formulated into the vaccine as neutral or salt forms.
Pharmaceutically-acceptable salts, include the acid addition salts
(formed with the free amino groups of the peptide) and those which
are formed with inorganic acids such as, for example, hydrochloric
or phosphoric acids, or such organic acids as acetic, oxalic,
tartaric, mandelic, and the like. Salts formed with the free
carboxyl groups may also be derived from inorganic bases such as,
for example, sodium, potassium, ammonium, calcium, or ferric
hydroxides, and such organic bases as isopropylamine,
trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the
like.
[0092] The vaccines are administered in a manner compatible with
the dosage formulation, and in such amount as will be
therapeutically effective and immunogenic. The quantity to be
administered depends on the subject to be treated, including, e.g.,
the capacity of the individual's immune system to synthesize
antibodies, and the degree of protection desired. Precise amounts
of active ingredient required to be administered depend on the
judgment of the practitioner. However, suitable dosage ranges are
of the order of several hundred micrograms active ingredient per
vaccination. Suitable regimes for initial administration and
booster shots are also variable, but are typified by an initial
administration followed by subsequent inoculations or other
administrations.
[0093] The manner of application may be varied widely. Any of the
conventional methods for administration of a vaccine are
applicable. These are believed to include gene gun inoculation of
the DNA encoding the antigen peptide(s), phage transfection of the
DNA, oral application on a solid physiologically acceptable base or
in a physiologically acceptable dispersion, parenterally, by
injection or the like. The dosage of the vaccine will depend on the
route of administration and will vary according to the size of the
host.
[0094] Various methods of achieving adjuvant effect for the vaccine
includes use of agents such as aluminum hydroxide or phosphate
(alum), commonly used as about 0.05 to about 0.1% solution in
phosphate buffered saline, admixture with synthetic polymers of
sugars (Carbopol.RTM.) used as an about 0.25% solution, aggregation
of the protein in the vaccine by heat treatment with temperatures
ranging between about 700 to about 101.degree. C. for a 30-second
to 2-minute period, respectively. Aggregation by reactivating with
pepsin treated (Fab) antibodies to albumin, mixture with bacterial
cells such as C. parvum or endotoxins or lipopolysaccharide
components of Gram-negative bacteria, emulsion in physiologically
acceptable oil vehicles such as mannide mono-oleate (Aracel A) or
emulsion with a 20% solution of a perfluorocarbon (Fluosol-DA.RTM.)
used as a block substitute may also be employed.
[0095] In many instances, it will be desirable to have multiple
administrations of the vaccine, usually not exceeding six
vaccinations, more usually not exceeding four vaccinations and
preferably one or more, usually at least about three vaccinations.
The vaccinations will normally be at from two to twelve week
intervals, more usually from three to five week intervals. Periodic
boosters at intervals of 1-5 years, usually three years, will be
desirable to maintain protective levels of the antibodies. The
course of the immunization may be followed by assays for antibodies
for the supernatant antigens. The assays may be performed by
labeling with conventional labels, such as radionuclides, enzymes,
fluorescents, and the like. These techniques are well known and may
be found in a wide variety of patents, such as U.S. Pat. Nos.
3,791,932; 4,174,384 and 3,949,064, as illustrative of these types
of assays.
[0096] 7. DNA Segments Encoding Novel Peptides
[0097] The present invention also concerns DNA segments, that can
be isolated from virtually any non-mammalian pathogen source, that
are free from total genomic DNA and that encode the novel peptides
disclosed herein. DNA segments encoding these peptide species may
prove to encode proteins, polypeptides, subunits, functional
domains, and the like of pathogen or other non-related gene
products. In addition these DNA segments may be synthesized
entirely in vitro using methods that are well-known to those of
skill in the art.
[0098] As used herein, the term "DNA segment" refers to a DNA
molecule that has been isolated free of total genomic DNA of a
particular species. Therefore, a DNA segment encoding a pathogen
peptide refers to a DNA segment that contains these peptide coding
sequences yet is isolated away from, or purified free from, total
genomic DNA of the species from which the DNA segment is obtained.
Included within the term "DNA segment", are DNA segments and
smaller fragments of such segments, and also recombinant vectors,
including, for example, plasmids, cosmids, phagemids, phage,
viruses, and the like.
[0099] Similarly, a DNA segment comprising an isolated or purified
pathogen peptide-encoding gene refers to a DNA segment which may
include in addition to peptide encoding sequences, certain other
elements such as, regulatory sequences, isolated substantially away
from other naturally occurring genes or protein-encoding sequences.
In this respect, the term "gene" is used for simplicity to refer to
a functional protein-, polypeptide- or peptide-encoding unit. As
will be understood by those in the art, this functional term
includes both genomic sequences, cDNA sequences and smaller
engineered gene segments that express, or may be adapted to
express, proteins, polypeptides or peptides.
[0100] "Isolated substantially away from other coding sequences"
means that the gene of interest, in this case, a gene encoding
pathogen epitopes of polypeptides forms the significant part of the
coding region of the DNA segment, and that the DNA segment does not
contain large portions of naturally occurring coding DNA, such as
large chromosomal fragments or other functional genes or cDNA
coding regions. Of course, this refers to the DNA segment as
originally isolated, and does not exclude genes or coding regions
later added to the segment by the hand of man.
[0101] In particular embodiments, the invention concerns isolated
DNA segments and recombinant vectors incorporating DNA sequences
that encode pathogen antigenic species that includes within its
amino acid sequence an amino acid sequence that essentially include
one or more amino acid sequences of epitopic regions of the
pathogen polypeptide.
[0102] It will also be understood that amino acid and nucleic acid
sequences may include additional residues, such as additional N- or
C-terminal amino acids or 5' or 3' sequences, and yet still be
essentially as set forth in one of the sequences disclosed herein,
so long as the sequence meets the criteria set forth above,
including the maintenance of biological protein activity where
protein expression is concerned. The addition of terminal sequences
particularly applies to nucleic acid sequences that may, for
example, include various non-coding sequences flanking either of
the 5' or 3' portions of the coding region or may include various
internal sequences, i.e., introns, which are known to occur within
genes.
[0103] The nucleic acid segments of the present invention,
regardless of the length of the coding sequence itself, may be
combined with other DNA sequences, such as promoters,
polyadenylation signals, additional restriction enzyme sites,
multiple cloning sites, other coding segments, and the like, such
that their overall length may vary considerably. It is therefore
contemplated that a nucleic acid fragment of almost any length may
be employed, with the total length preferably being limited by the
ease of preparation and use in the intended recombinant DNA
protocol. For example, nucleic acid fragments may be prepared that
include a short contiguous stretch encoding any of the immunogenic
polypeptide sequences identified by the methods herein disclosed,
or that are identical to or complementary to DNA sequences which
encode any of these peptides.
[0104] It will be readily understood that "intermediate lengths",
in these contexts, means any length between the quoted ranges, such
as 14, 15, 16, 17, 18, 19, 20, etc.; 21, 22, 23, etc.; 30, 31, 32,
etc.; 50, 51, 52, 53, etc.; 100, 101, 102, 103, etc.; 150, 151,
152, 153, etc.; including all integers through the 200-500;
500-1,000; 1,000-2,000; 2,000-3,000; 3,000-5,000; and up to and
including sequences of about 10,000 nucleotides and the like.
[0105] It will also be understood that this invention is not
limited to the particular nucleic acid sequences which encode
peptides of Mycoplasma or Listeria or only to pathogen DNA encoding
only epitopic regions. Recombinant vectors and isolated DNA
segments may therefore variously include the peptide-coding regions
themselves, coding regions bearing selected alterations or
modifications in the basic coding region, or they may encode larger
polypeptides that nevertheless include these peptide-coding regions
or may encode biologically functional equivalent proteins or
peptides that have variant amino acids sequences.
[0106] The DNA segments of the present invention encompass
biologically-functional equivalent peptides. Such sequences may
arise as a consequence of codon redundancy and functional
equivalency that are known to occur naturally within nucleic acid
sequences and the proteins thus encoded. Alternatively,
functionally-equivalent proteins or peptides may be created via the
application of recombinant DNA technology, in which changes in the
protein structure may be engineered, based on considerations of the
properties of the amino acids being exchanged. Changes designed by
man may be introduced through the application of site-directed
mutagenesis techniques, e.g., to introduce improvements to the
antigenicity of the protein or to test mutants in order to examine
activity at the molecular level.
[0107] If desired, one may also prepare fusion proteins and
peptides, e.g., where the peptide-coding regions are aligned within
the same expression unit with other proteins or peptides having
desired functions, such as for purification or immunodetection
purposes (e.g., proteins that may be purified by affinity
chromatography and enzyme label coding regions, respectively).
[0108] Recombinant vectors form further aspects of the present
invention. Particularly useful vectors are contemplated to be those
vectors in which the coding portion of the DNA segment, whether
encoding a full-length protein or smaller peptide, is positioned
under the control of a promoter. The promoter may be in the form of
the promoter that is naturally associated with a gene encoding
peptides of the present invention, as may be obtained by isolating
the 5' non-coding sequences located upstream of the coding segment
or exon, for example, using recombinant cloning and/or PCR.TM.
technology, in connection with the compositions disclosed
herein.
[0109] In other embodiments, it is contemplated that certain
advantages will be gained by positioning the coding DNA segment
under the control of a recombinant, or heterologous, promoter. As
used herein, a recombinant or heterologous promoter is intended to
refer to a promoter that is not normally associated with a DNA
segment encoding a pathogen peptide in its natural environment.
Such promoters may include promoters normally associated with other
genes, and/or promoters isolated from any bacterial, viral,
eukaryotic, or mammalian cell. Naturally, it will be important to
employ a promoter that effectively directs the expression of the
DNA segment in the cell type, organism, or animal, chosen for
expression. The use of promoter and cell type combinations for
protein expression is generally known to those of skill in the art
of molecular biology, for example, see Sambrook et al., 1989. The
promoters employed may be constitutive, or inducible, and can be
used under the appropriate conditions to direct high level
expression of the introduced DNA segment. An appropriate promoter
for use in high-level expression is the cytomegalovirus promoter
(Pharmacia LKB Biotechnology), although one is not limited to use
of this promoter.
[0110] In connection with expression embodiments to prepare
recombinant proteins and peptides, it is contemplated that longer
DNA segments will most often be used, with DNA segments encoding
the entire peptide sequence being most preferred. However, it will
be appreciated that the use of shorter DNA segments to direct the
expression of pathogen epitopic core regions, such as may be used
to generate anti-peptide antibodies, also falls within the scope of
the invention. DNA segments that encode peptide antigens from about
8 to about 50 amino acids in length, from about 8 to about 30 amino
acids in length, or even from about 8 to about 20 amino acids in
length are contemplated to be particularly useful.
[0111] In addition to their use in directing the expression of the
pathogen peptides of the present invention, the nucleic acid
sequences contemplated herein also have a variety of other uses.
For example, they also have utility as probes or primers in nucleic
acid hybridization embodiments. As such, it is contemplated that
nucleic acid segments that comprise a sequence region that consists
of at least a 14 nucleotide long contiguous sequence that has the
same sequence as, or is complementary to, a 14 nucleotide long
contiguous DNA segment will find particular utility. Longer
contiguous identical or complementary sequences, e.g., those of
about 20, 30, 40, 50, 100, 200, 500, 1000 (including all
intermediate lengths) and even up to full length sequences will
also be of use in certain embodiments.
[0112] The ability of such nucleic acid probes to specifically
hybridize to peptide-encoding sequences will enable them to be of
use in detecting the presence of complementary sequences in a given
sample. However, other uses are envisioned, including the use of
the sequence information for the preparation of mutant species
primers, or primers for use in preparing other genetic
constructions.
[0113] Nucleic acid molecules having sequence regions consisting of
contiguous nucleotide stretches of 10-14, 15-20, 30, 50, or even of
100-200 nucleotides or so, identical or complementary to DNA
sequences of any of the DNAs disclosed, are contemplated as
hybridization probes for use in, e.g., Southern and Northern
blotting. Smaller fragments will generally find use in
hybridization embodiments, wherein the length of the contiguous
complementary region may be varied, such as between about 10-14 and
about 100 nucleotides, but larger contiguous complementarity
stretches may be used, according to the length complementary
sequences one wishes to detect.
[0114] The use of a hybridization probe of about 10-14 nucleotides
in length allows the formation of a duplex molecule that is both
stable and selective. Molecules having contiguous complementary
sequences over stretches greater than 10 bases in length are
generally preferred, though, in order to increase stability and
selectivity of the hybrid, and thereby improve the quality and
degree of specific hybrid molecules obtained. One will generally
prefer to design nucleic acid molecules having gene-complementary
stretches of 15 to 20 contiguous nucleotides, or even longer where
desired.
[0115] Of course, fragments may also be obtained by other
techniques such as, e.g., by mechanical shearing or by restriction
enzyme digestion. Small nucleic acid segments or fragments may be
readily prepared by, for example, directly synthesizing the
fragment by chemical means, as is commonly practiced using an
automated oligonucleotide synthesizer. Also, fragments may be
obtained by application of nucleic acid reproduction technology,
such as the PCR.TM. technology of U.S. Pat. Nos. 4,683,195 and
4,683,202 (each incorporated herein by reference), by introducing
selected sequences into recombinant vectors for recombinant
production, and by other recombinant DNA techniques generally known
to those of skill in the art of molecular biology.
[0116] Accordingly, the nucleotide sequences of the invention may
be used for their ability to selectively form duplex molecules with
complementary stretches of DNA fragments. Depending on the
application envisioned, one will desire to employ varying
conditions of hybridization to achieve varying degrees of
selectivity of probe towards target sequence. For applications
requiring high selectivity, one will typically desire to employ
relatively stringent conditions to form the hybrids, e.g., one will
select relatively low salt and/or high temperature conditions, such
as provided by about 0.02 M to about 0.15 M NaCl at temperatures of
50.degree. C. to 70.degree. C. Such selective conditions tolerate
little, if any, mismatch between the probe and the template or
target strand. Detection of DNA segments via hybridization is
well-known to those of skill in the art, and the teachings of U.S.
Pat. Nos. 4,965,188 and 5,176,995 (each incorporated herein by
reference) are exemplary of the methods of hybridization analyses.
Teachings such as those found in the texts of Maloy et al., 1993;
Segal 1976; Prokop, 1991; and Kuby, 1991, are particularly
relevant.
[0117] Of course, for some applications, for example, where one
desires to prepare mutants employing a mutant primer strand
hybridized to an underlying template or where one seeks to isolate
pathogen peptide-encoding sequences from related species,
functional equivalents, or the like, less stringent hybridization
conditions will typically be needed in order to allow formation of
the heteroduplex. In these circumstances, one may desire to employ
conditions such as about 0.15 M to about 0.9 M salt, at
temperatures ranging from about 20.degree. C. to about 55.degree.
C. Cross-hybridizing species can thereby be readily identified as
positively hybridizing signals with respect to control
hybridizations. In any case, it is generally appreciated that
conditions can be rendered more stringent by the addition of
increasing amounts of formamide, which serves to destabilize the
hybrid duplex in the same manner as increased temperature. Thus,
hybridization conditions can be readily manipulated, and thus will
generally be a method of choice depending on the desired
results.
[0118] In certain embodiments, it will be advantageous to employ
nucleic acid sequences of the present invention in combination with
an appropriate means, such as a label, for determining
hybridization. A wide variety of appropriate indicator means are
known in the art, including fluorescent, radioactive, enzymatic or
other ligands, such as avidin/biotin, which are capable of giving a
detectable signal. In preferred embodiments, one will likely desire
to employ a fluorescent label or an enzyme tag, such as urease,
alkaline phosphatase or peroxidase, instead of radioactive or other
environmental undesirable reagents. In the case of enzyme tags,
colorimetric indicator substrates are known that can be employed to
provide a means visible to the human eye or spectrophotometrically,
to identify specific hybridization with complementary nucleic
acid-containing samples.
[0119] In general, it is envisioned that the hybridization probes
described herein will be useful both as reagents in solution
hybridization as well as in embodiments employing a solid phase. In
embodiments involving a solid phase, the test DNA (or RNA) is
adsorbed or otherwise affixed to a selected matrix or surface. This
fixed, single-stranded nucleic acid is then subjected to specific
hybridization with selected probes under desired conditions. The
selected conditions will depend on the particular circumstances
based on the particular criteria required (depending, for example,
on the G+C content, type of target nucleic acid, source of nucleic
acid, size of hybridization probe, etc.). Following washing of the
hybridized surface so as to remove nonspecifically bound probe
molecules, specific hybridization is detected, or even quantitated,
by means of the label.
[0120] 8. Biological Functional Equivalents
[0121] Modification and changes may be made in the structure of the
peptides of the present invention and DNA segments which encode
them and still obtain a functional molecule that encodes a protein
or peptide with desirable characteristics. The following is a
discussion based upon changing the amino acids of a protein to
create an equivalent, or even an improved, second-generation
molecule. The amino acid changes may be achieved by changing the
codons of the DNA sequence, according to the following codon
table:
2TABLE 1 Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine
Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic acid Glu E GAA
GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K
AAA AAG Leucine Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG
Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutamine
Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S
AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val
V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU
[0122] For example, certain amino acids may be substituted for
other amino acids in a protein structure without appreciable loss
of interactive binding capacity with structures such as, for
example, antigen-binding regions of antibodies or binding sites on
substrate molecules. Since it is the interactive capacity and
nature of a protein that defines that protein's biological
functional activity, certain amino acid sequence substitutions can
be made in a protein sequence, and, of course, its underlying DNA
coding sequence, and nevertheless obtain a protein with like
properties. It is thus contemplated by the inventors that various
changes may be made in the peptide sequences of the disclosed
compositions, or corresponding DNA sequences which encode said
peptides without appreciable loss of their biological utility or
activity.
[0123] In making such changes, the hydropathic index of amino acids
may be considered. The importance of the hydropathic amino acid
index in conferring interactive biologic function on a protein is
generally understood in the art (Kyte and Doolittle, 1982,
incorporate herein by reference). It is accepted that the relative
hydropathic character of the amino acid contributes to the
secondary structure of the resultant protein, which in turn defines
the interaction of the protein with other molecules, for example,
enzymes, substrates, receptors, DNA, antibodies, antigens, and the
like.
[0124] Each amino acid has been assigned a hydropathic index on the
basis of their hydrophobicity and charge characteristics (Kyte and
Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine
(-4.5).
[0125] It is known in the art that certain amino acids may be
substituted by other amino acids having a similar hydropathic index
or score and still result in a protein with similar biological
activity, i.e., still obtain a biological functionally equivalent
protein. In making such changes, the substitution of amino acids
whose hydropathic indices are within .+-.2 is preferred, those
which are within .+-.1 are particularly preferred, and those within
.+-.0.5 are even more particularly preferred.
[0126] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity. U.S. Pat. No. 4,554,101, incorporated herein by
reference, states that the greatest local average hydrophilicity of
a protein, as governed by the hydrophilicity of its adjacent amino
acids, correlates with a biological property of the protein.
[0127] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (+3.0); aspartate (+3.0.+-.1); glutamate
(+3.0.+-.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5.+-.1); alanine (-0.5);
histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine
(-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryptophan (-3.4).
[0128] It is understood that an amino acid can be substituted for
another having a similar hydrophilicity value and still obtain a
biologically equivalent, and in particular, an immunologically
equivalent protein. In such changes, the substitution of amino
acids whose hydrophilicity values are within .+-.2 is preferred,
those which are within .+-.1 are particularly preferred, and those
within .+-.0.5 are even more particularly preferred.
[0129] As outlined above, amino acid substitutions are generally
therefore based on the relative similarity of the amino acid
side-chain substituents, for example, their hydrophobicity,
hydrophilicity, charge, size, and the like. Exemplary substitutions
which take various of the foregoing characteristics into
consideration are well known to those of skill in the art and
include: arginine and lysine; glutamate and aspartate; serine and
threonine; glutamine and asparagine; and valine, leucine and
isoleucine.
[0130] 9. Site-Specific Mutagenesis
[0131] Site-specific mutagenesis is a technique useful in the
preparation of individual peptides, or biologically functional
equivalent proteins or peptides, through specific mutagenesis of
the underlying DNA. The technique further provides a ready ability
to prepare and test sequence variants, for example, incorporating
one or more of the foregoing considerations, by introducing one or
more nucleotide sequence changes into the DNA. Site-specific
mutagenesis allows the production of mutants through the use of
specific oligonucleotide sequences which encode the DNA sequence of
the desired mutation, as well as a sufficient number of adjacent
nucleotides, to provide a primer sequence of sufficient size and
sequence complexity to form a stable duplex on both sides of the
deletion junction being traversed. Typically, a primer of about 17
to 25 nucleotides in length is preferred, with about 5 to 10
residues on both sides of the junction of the sequence being
altered.
[0132] In general, the technique of site-specific mutagenesis is
well known in the art, as exemplified by various publications. As
will be appreciated, the technique typically employs a phage vector
which exists in both a single stranded and double stranded form.
Typical vectors useful in site-directed mutagenesis include vectors
such as the M13 phage. These phage are readily commercially
available and their use is generally well known to those skilled in
the art. Double stranded plasmids are also routinely employed in
site directed mutagenesis which eliminates the step of transferring
the gene of interest from a plasmid to a phage.
[0133] In general, site-directed mutagenesis in accordance herewith
is performed by first obtaining a single-stranded vector or melting
apart of two strands of a double stranded vector which includes
within its sequence a DNA sequence which encodes the desired
peptide. An oligonucleotide primer bearing the desired mutated
sequence is prepared, generally synthetically. This primer is then
annealed with the single-stranded vector, and subjected to DNA
polymerizing enzymes such as E. coli polymerase I Klenow fragment,
in order to complete the synthesis of the mutation-bearing strand.
Thus, a heteroduplex is formed wherein one strand encodes the
original non-mutated sequence and the second strand bears the
desired mutation. This heteroduplex vector is then used to
transform appropriate cells, such as E. coli cells, and clones are
selected which include recombinant vectors bearing the mutated
sequence arrangement.
[0134] The preparation of sequence variants of the selected peptide
encoding DNA segments using site-directed mutagenesis is provided
as a means of producing potentially useful species and is not meant
to be limiting as there are other ways in which sequence variants
of peptides and the DNA sequences encoding them may be obtained.
For example, recombinant vectors encoding the desired peptide
sequence may be treated with mutagenic agents, such as
hydroxylamine, to obtain sequence variants.
[0135] 10. Monoclonal Antibody Generation
[0136] Means for preparing and characterizing antibodies are well
known in the art (See, e.g., Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory, 1988; incorporated herein by
reference).
[0137] The methods for generating monoclonal antibodies (mAbs)
generally begin along the same lines as those for preparing
polyclonal antibodies. Briefly, a polyclonal antibody is prepared
by immunizing an animal with an immunogenic composition in
accordance with the present invention and collecting antisera from
that immunized animal. A wide range of animal species can be used
for the production of antisera. Typically the animal used for
production of anti-antisera is a rabbit, a mouse, a rat, a hamster,
a guinea pig or a goat. Because of the relatively large blood
volume of rabbits, a rabbit is a preferred choice for production of
polyclonal antibodies.
[0138] As is well known in the art, a given composition may vary in
its immunogenicity. It is often necessary therefore to boost the
host immune system, as may be achieved by coupling a peptide or
polypeptide immunogen to a carrier. Exemplary and preferred
carriers are keyhole limpet hemocyanin (KLH) and bovine serum
albumin (BSA). Other albumins such as ovalbumin, mouse serum
albumin or rabbit serum albumin can also be used as carriers. Means
for conjugating a polypeptide to a carrier protein are well known
in the art and include glutaraldehyde, m-maleimidobencoyl-N-hy-
droxysuccinimide ester, carbodiimide and bis-biazotized
benzidine.
[0139] As is also well known in the art, the immunogenicity of a
particular immunogen composition can be enhanced by the use of
non-specific stimulators of the immune response, known as
adjuvants. Exemplary and preferred adjuvants include complete
Freund's adjuvant (a non-specific stimulator of the immune response
containing killed Mycobacterium tuberculosis), incomplete Freund's
adjuvants and aluminum hydroxide adjuvant.
[0140] The amount of immunogen composition used in the production
of polyclonal antibodies varies upon the nature of the immunogen as
well as the animal used for immunization. A variety of routes can
be used to administer the immunogen (subcutaneous, intramuscular,
intradermal, intravenous and intraperitoneal). The production of
polyclonal antibodies may be monitored by sampling blood of the
immunized animal at various points following immunization. A
second, booster, injection may also be given. The process of
boosting and titering is repeated until a suitable titer is
achieved. When a desired level of immunogenicity is obtained, the
immunized animal can be bled and the serum isolated and stored,
and/or the animal can be used to generate mAbs.
[0141] mAbs may be readily prepared through use of well-known
techniques, such as those exemplified in U.S. Pat. No. 4,196,265,
incorporated herein by reference. Typically, this technique
involves immunizing a suitable animal with a selected immunogen
composition, e.g., a purified or partially purified epitopic
protein, polypeptide or peptide. The immunizing composition is
administered in a manner effective to stimulate antibody producing
cells. Rodents such as mice and rats are preferred animals,
however, the use of rabbit, sheep frog cells is also possible. The
use of rats may provide certain advantages (Goding, 1986, pp.
60-61), but mice are preferred, with the BALB/c mouse being most
preferred as this is most routinely used and generally gives a
higher percentage of stable fusions.
[0142] Following immunization, somatic cells with the potential for
producing antibodies, specifically B lymphocytes (B cells), are
selected for use in the mAb generating protocol. These cells may be
obtained from biopsied spleens, tonsils or lymph nodes, or from a
peripheral blood sample. Spleen cells and peripheral blood cells
are preferred, the former because they are a rich source of
antibody-producing cells that are in the dividing plasmablast
stage, and the latter because peripheral blood is easily
accessible. Often, a panel of animals will have been immunized and
the spleen of animal with the highest antibody titer will be
removed and the spleen lymphocytes obtained by homogenizing the
spleen with a syringe. Typically, a spleen from an immunized mouse
contains approximately 5.times.10.sup.7 to 2.times.10.sup.8
lymphocytes.
[0143] The antibody-producing B lymphocytes from the immunized
animal are then fused with cells of an immortal myeloma cell,
generally one of the same species as the animal that was immunized.
Myeloma cell lines suited for use in hybridoma-producing fusion
procedures preferably are non-antibody-producing, have high fusion
efficiency, and enzyme deficiencies that render then incapable of
growing in certain selective media which support the growth of only
the desired fused cells (hybridomas).
[0144] Any one of a number of myeloma cells may be used, as are
known to those of skill in the art (Goding, pp. 65-66, 1986;
Campbell, pp. 75-83, 1984). For example, where the immunized animal
is a mouse, one may use P3-X63/Ag8, X63-Ag8.653, NS1/1.Ag 4 1,
Sp210-Ag14, FO, NSO/U, MPC-11, MPC11-X45-GTG 1.7 and S194/5XX0 Bul;
for rats, one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and
U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in
connection with human cell fusions.
[0145] One preferred murine myeloma cell is the NS-1 myeloma cell
line (also termed P3-NS-1-Ag4-1), which is readily available from
the NIGMS Human Genetic Mutant Cell Repository by requesting cell
line repository number GM3573. Another mouse myeloma cell line that
may be used is the 8-azaguanine-resistant mouse murine myeloma
SP2/0 non-producer cell line.
[0146] Methods for generating hybrids of antibody-producing spleen
or lymph node cells and myeloma cells usually comprise mixing
somatic cells with myeloma cells in a 2:1 ratio, though the ratio
may vary from about 20:1 to about 1:1, respectively, in the
presence of an agent or agents (chemical or electrical) that
promote the fusion of cell membranes. Fusion methods using Sendai
virus have been described by Kohler and Milstein (1975; 1976), and
those using polyethylene glycol (PEG), such as 37% (v/v) PEG, by
Gefter et al., (1977). The use of electrically induced fusion
methods is also appropriate (Goding pp. 71-74, 1986).
[0147] Fusion procedures usually produce viable hybrids at low
frequencies, about 1.times.10.sup.-6 to 1.times.10.sup.-8. However,
this does not pose a problem, as the viable, fused hybrids are
differentiated from the parental, unfused cells (particularly the
unfused myeloma cells that would normally continue to divide
indefinitely) by culturing in a selective medium. The selective
medium is generally one that contains an agent that blocks the de
novo synthesis of nucleotides in the tissue culture media.
Exemplary and preferred agents are aminopterin, methotrexate, and
azaserine. Aminopterin and methotrexate block de novo synthesis of
both purines and pyrimidines, whereas azaserine blocks only purine
synthesis. Where aminopterin or methotrexate is used, the media is
supplemented with hypoxanthine and thymidine as a source of
nucleotides (HAT medium). Where azaserine is used, the media is
supplemented with hypoxanthine.
[0148] The preferred selection medium is HAT. Only cells capable of
operating nucleotide salvage pathways are able to survive in HAT
medium. The myeloma cells are defective in key enzymes of the
salvage pathway, e.g., hypoxanthine phosphoribosyl transferase
(HPRT), and they cannot survive. The B-cells can operate this
pathway, but they have a limited life span in culture and generally
die within about two weeks. Therefore, the only cells that can
survive in the selective media are those hybrids formed from
myeloma and Bells.
[0149] This culturing provides a population of hybridomas from
which specific hybridomas are selected. Typically, selection of
hybridomas is performed by culturing the cells by single-clone
dilution in microtiter plates, followed by testing the individual
clonal supernatants (after about two to three weeks) for the
desired reactivity. The assay should be sensitive, simple and
rapid, such as radioimmunoassays, enzyme immunoassays, cytotoxicity
assays, plaque assays, dot immuno-binding assays, and the like.
[0150] The selected hybridomas would then be serially diluted and
cloned into individual antibody-producing cell lines, which clones
can then be propagated indefinitely to provide mAbs. The cell lines
may be exploited for mAb production in two basic ways. A sample of
the hybridoma can be injected (often into the peritoneal cavity)
into a histocompatible animal of the type that was used to provide
the somatic and myeloma cells for the original fusion. The injected
animal develops tumors secreting the specific monoclonal antibody
produced by the fused cell hybrid. The body fluids of the animal,
such as serum or ascites fluid, can then be tapped to provide mAbs
in high concentration. The individual cell lines could also be
cultured in vitro, where the mAbs are naturally secreted into the
culture medium from which they can be readily obtained in high
concentrations. mAbs produced by either means may be further
purified, if desired, using filtration, centrifugation and various
chromatographic methods such as HPLC or affinity
chromatography.
[0151] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventors to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
[0152] Materials and Methods
[0153] Vector Constructs. CMV-GH was constructed by insertion of
the genomic hGH sequence from CMV-GH-ori (Barry, et al, 1994) as a
BamHI fragment into the BglII site of CMV5, a derivative of CMV1
(Andersson, et al, 1989)]. CMV-GH-F1&3 was constructed by
knocking out the BamHI in CMV-GH and inserting the annealed,
kinased oligonucleotides, GATCTTGGATCCTAAGTAAGTA (SEQ ID NO: 1) and
AGCTTACTTACTTAGGATCCAA (SEQ ID NO:2), into BglII-HindIII-digested
CMV-GH. CMV-GH-F2 was constructed similarly by inserting the
oligos, GATCGGATCCTAAGTAAGTA (SEQ ID NO:3) and AGCTTACTTACTTAGGATCC
(SEQ ID NO:4) in BglII-HindIII-digested CMV-GH. Mycoplasma pulmonis
strain CT was grown in Chalquest media for isolation of genomic
DNA. Listeria monocytogenes was grown in LB. Genomic DNA was
isolated from each as described Ausubel, 1992. Each genomic DNA was
partially digested with MboI to an approximate mean fragment size
of 0.5 kilobase pairs. CMV-GH-F1&3 and CMV-GH-F2 were digested
with BamHI or BglII and dephosphorylated with shrimp alkaline
phosphatase. Each vector was ligated with a 5-fold excess of
genomic Mbol fragments and electroporated into TG1 bacteria.
Transformant number was estimated by plating serial dilutions onto
YT-ampicillin plates and approximately 3000 transformants were
grown overnight in LB-ampicillin and frozen. 5 ml of this overnight
grow up was used to inoculate a 500 ml LB-amp culture from which
plasmid DNA was prepared using Qiagen plasmid purification
columns.
[0154] Animals. Mice were treated in accordance with institutional
guidelines. Prior to immunization, the mice were anesthetized with
0.5 ml of avertin i.p. and their ears depilated with Nair.TM.. Up
to 2.5 .mu.g of plasmid DNA was loaded on 0.5 mg of 1-3 .mu.m gold
microparticles for each inoculum. The total amount of DNA to be
delivered was delivered in 4 inoculums into both sides of both ears
using the hand-held biolistic gene gun described in Sanford, et al,
1991.
[0155] Measurement of Delayed-type Hypersensitivity (DTH). DTH was
evaluated by injecting PBS into the right rear footpad and PBS
containing 50 .mu.g sonicated MP cell protein into the left rear
footpad. A dial gauge caliper was used to measure the change in
footpad thickness induced 24 h after injection. Three readings were
measured and averaged.
[0156] Macrophage Migration Inhibition (MMI). MMI was evaluated by
filling a glass capillary tube with 100 .mu.l of spleen cell
suspension (1.times.10.sup.8 cells/ml) from each mouse and placing
it horizontally in a well of a 24 well plate immersed in RPMI media
in the absence or presence of 50 g/ml sonicated MP protein. After
24 h, the area of cell migration out of the tube was measured by
digital imaging. The area of migrated cells from control animal was
averaged. Less migration was indicative of release of MIF from
T-cells previously activated against MP antigens by immunization.
Release of MIF in this assay results in reduced area of migrated
cells from the capillary.
EXAMPLE 1
[0157] This example illustrates that a diverse library of plasmids
can be inoculated and still produce an immune response to each
encoded antigen. Theoretically a library including all the genome
could be inoculated, exposing the host to all the pathogen's
proteins. However, inoculation with 1 .mu.g of a library of 10,000,
for example, would result in delivery of only 0.1 ng of each
individual plasmid. This demonstration was important for addressing
the feasibility of ELI. Previous work had shown that inoculation of
1 .mu.g of DNA encoding hGH produced only approximately 0.1 ng of
protein. Typical procedures for immunization utilize 10-100 .mu.g
of protein.
[0158] Determination of Amount Required for Immune Response
[0159] Mice were inoculated with various amounts of DNA encoding
human growth hormone (hGH) and tested for antibodies against hGH
(FIG. 2). Considering the need for efficiency, the gene gun was
used rather than needle injection into muscle or dermis, since the
gene gun appears to require less DNA for a given response (Fynan et
al. 1993).
[0160] Mouse sera was recovered by tail vein bleed 10 days after
gene inoculation. hGH antibodies were measured by a modified ELISA
protocol which makes use of the highly sensitive, wide range,
luminescent .beta.-galactosidase assay (Galactolight.TM.-Tropix)
able to detect fg to ng of .beta.-galactosidase activity.
[0161] 100 ng of hGH protein in 100 .mu.l PBS (137 mM NaCl, 2.7 mM
KCl, 8.2 mM Na.sub.2HPO.sub.4, 1.5 mM KH.sub.2PO.sub.4, pH 7.4) was
coated into each well of a 96 well plate ELISA plate for 2 h at
room temp. The wells were blocked by the addition of 300 .mu.l of
5% dried milk in TBST (150 mM NaCl, 10 mM Tris, pH 8, 0.1% Tween)
for 1 h. The wells were washed 3 times with TBST and 200 .mu.l of a
{fraction (1/250)} dilution of mouse sera was added for 2 h at room
temp. This solution was removed, the wells were washed 6 times with
TBST and 200 .mu.l of a {fraction (1/1000)} dilution of goat
anti-mouse IgG-.beta.-galactosidase conjugate in TBST was added for
1 h. The wells were washed 5 times in TBST and once with PBS. 200
.mu.l of complete Galacto-light reaction buffer ({fraction (1/100)}
dilution of galacton concentrate in reaction buffer) was added to
each well and incubated for 30 to 60 min at room temp. This
solution was then transferred to luminometer cuvettes, 300 .mu.l of
Galactolight accelerator was added and luminescence was measured 5
sec later by integration for 10 sec on a Berthold BIOLUMAT 9500C
luminometer. Relative antibody titers are expressed in
b-galactosidase lumens (FIG. 2).
[0162] Surprisingly, antibodies were detectable following
inoculation of as little as 1 ng of hGH DNA, consistent with
previous reports (Eisenbraun, et al, 1993). This indicated that
libraries of at least 10.sup.3-10.sup.4 members were possible with
1 .mu.g of DNA.
EXAMPLE 2
[0163] Expression library immunization in mice was tested using the
pathogen Mycoplasma pulmonis (MP), a wall-less bacteria. MP has a
relatively small genome of .about.10.sup.6 base pairs (Neimark and
Lange, 1990). MP is an extracellular pathogen that colonizes the
lungs and other tissues (Lindsey, et al, 1978). This bacterium was
considered to pose a challenge for creating a representative
library because it has an unusual codon usage (i.e. the tryptophan
codon of MP is a stop in mammalian cells (Yamao, et al,. 1985) so
that it appeared problematical that wider range expression of a
library would be possible in mammalian cells. Additionally, MP is
an endogenous pathogen in rodents (Cassell, 1982), often causing
losses in animal supply colonies, and any effective vaccine
discovered would be a potential benefit to those maintaining large
rodent colonies.
[0164] Mycoplasm vaccination with a Mycoplasm Sib Library
[0165] A library was constructed by inserting partially digested MP
DNA into the last exon of the hGH gene under control of the CMV
promoter. The hGH gene contains a signal sequence allowing MP
antigens to be secreted as fusion proteins. Since the fragments of
MP DNA inserted randomly, only 1/6 of the ones corresponding to
open reading frames would be expected to be in-frame. To include
all possible antigens, MP fragments were fused into 3 different
frames of hGH sequence and with stop codons in 3 frames at the 3'
end (FIG. 3). Nine independent (sib) libraries were constructed,
each with .about.3000 members. Over 95% of the plasmids bore
inserts with a median size of .about.400 bp.
[0166] Two of these sib libraries (MP1.1L and MP2.3) were
inoculated separately into the skin of the ear of mice, with 10
.mu.g introduced in a total of four inoculation sites. These
inoculations contained .about.1 .mu.g of MP DNA, representing the
equivalent of .about.1.times.10.sup.9 MP genomes--10.sup.6-fold
more than introduced in a normal-MP infection. As negative
controls, a plasmid encoding hGH alone or a comparable hGH fusion
library with DNA from Listeria monocytogenes were inoculated in the
same fashion. Sixty days after the first inoculation, and ten days
after the last inoculation the mice were challenged by intranasal
introduction of MP. Two weeks later, the mice were tested for MP
infection. All of the control mice (non-inoculated and inoculated
with hGH or Listeria DNA) had 10.sup.5 to 10.sup.7 mycoplasma in
lung lavages even after the lowest (10.sup.3) challenge. Lung
sections from these mice showed significant lesions in the lung at
the lowest challenge (FIGS. 4A and 4B).
[0167] In remarkable contrast, the mice inoculated with either the
MP1.1 or MP2.3 library had no culturable mycoplasma even at the
highest challenge and showed no evidence of lung lesions (FIG.
5).
[0168] Anti-mycoplasma immune responses were characterized by
several assays (Table 1). Mice vaccinated with libraries MP1.1 and
MP2.3 demonstrated strong delayed-type hypersensitivity (DTH) to MP
proteins, while there was little or no response in the control
animals. Histological examination demonstrated massive mononuclear
cell infiltration in the MP library-injected mice but not in
control mice (data not shown). These DTH responses indicate that
T-cells have been activated against mycoplasma antigens by
inoculation of the MP libraries. Similarly, T-cells from mice
immunized with MP1.1 or MP2.3 were primed to mycoplasma antigens
and released migration inhibition factor (MIF) in macrophage
migration inhibition tests. Mice were immunized as described in
FIG. 6. Anti-hGH and anti-MP antibodies were measured by ELISA from
sera taken 10 days after the second inoculation. 2 mice from each
group were tested for DTH and MMI 12 days after the last
immunization. Control refers to un-immunized mice. Results are
shown in Table 1.
3TABLE 1 Immune Responses Induced by ELI Libraries. Anti-hGH
Anti-MP MP-specific MP-specific Antibodies.sup.1 Antibodies.sup.2
DTH (mm).sup.3 MMI (%).sup.4 Control - - 2.3 .+-. 0.4 0 MP 1.1 + +
16.4 .+-. 0.4 71.8 MP 2.3 + + 19.8 .+-. 0.3 73.3 .sup.1Antibody
levels against hGH protein. (-) designates no antibodies, (+)
indicates levels detectable only at dilutions of 1/250.
.sup.2Antibody levels against whole mycoplasma antigens. (-)
designates no antibodies, (+) indicates levels detectable only at
dilutions of 1/50. .sup.3MP-specific delayed-type hypersensitivity.
Measurements indicate the change in footpad thickness induced by
injection of MP antigens in PBS relative to that of PBS alone (20).
Net footpad thickness (.times.100 mm) = [(post-MP injection minus
pre-MP injection) minus post-PBS injection]. .sup.4MP-specific
macrophage migration inhibition. Percent inhibition was calculated
from the formula: (A - B)/A .times. 100, where A = the area of
macrophage migration in media and B = the area of macrophage
migration in media containing MP antigen (21).
[0169] Sera from MP1.1 and MP2.3 mice showed relatively low titers
of antibodies against hGH and mycoplasma proteins (Table 1). Though
all library members encode hGH and inoculation of hGH alone induced
strong antibody titers, the fusion proteins may be restricted in
their ability to be secreted and produce a humoral response. A
similar low titer of hGH antibodies was observed with a Listeria
library.
[0170] In another experiment, mice were immunized three times in a
30 day rather than 60 day regime to determine how rapidly
protection could be initiated. This shortened protocol elicited
substantial protection with the control mice having 10.sup.4 more
culturable pathogen at a given initial inoculum. However, unlike in
the first experiment the protection was not as complete. This
difference may arise because of the longer period of immune
response before the challenge.
EXAMPLE 3
[0171] A Listeria ELI library was created in the same manner as
that for mycoplasma.
[0172] Expression Library Immunization with Listeria. Genomic DNA
from Listeria monocytogenes was isolated and partially digested to
an approximate mean fragment size of 0.4 kilobase pairs. These
fragments were ligated into the human growth hormone sequence to
generate a library which was sibbed into 21 sub-libraries of
approximately 3000 transformants each. A larger set of sibs was
constructed since the genome size of Listeria is approximately 4
times that of Mycoplasma.
[0173] A total of 10 .mu.g of the indicated 3000 transformant
sib(s) or parent plasmid was loaded on 0.5 mg of 1-3 .mu.m gold
microparticles and delivered into the ears of anesthetized 5-6 week
old female Balb/C mice using a hand-held biolistic gene gun
(Sanford et al. (1991)). The gene gun was used to maximize the
efficiency of immunization. Mice were immunized 3 times over 60
days and challenged 7 days after final immunization with
approximately 1.times.10.sup.5 listeria monocytogenes by
intravenous injection into the tail vein. Three days later, the
mice were sacrificed and listeria recovered from their spleens and
counted.
[0174] Results are shown in FIG. 7. Inoculation with two of the sib
libraries provided substantial protection on challenge with
Listeria monocytogenes compared with controls.
EXAMPLE 4
[0175] The in vivo methods for identifying and developing
expression library vaccines as described in Examples 2 and 3 are
equally applicable to testing and sibbing of libraries ex vivo.
This example illustrates an ex vivo method of identifying a
vaccine.
[0176] Ex vivo Identification of Sib Library Vaccines
[0177] Cells or sera from an animal immunized with a sib are tested
for reaction against mammalian cells transfected with the same or
another sib. To test for cellular responses, transfected cells are
plated in 96 well plates a single or multiple clones per well.
Cells from the blood, spleen, lymph nodes, or other sites are added
to the wells and either CTL activity, proliferation, or cytokine
secretion measured. A well in which a positive reaction occurs will
indicate that the antigen gene transfected into the cell elicited
the particular immune response which was assayed.
[0178] This approach allows particular modes of immune responses to
be screened to avoid known deleterious immune events such as
autoimmune damage in Chaga's disease (Parham, (1994). A similar
approach is used with bacterial, viral, yeast, or other cellular
carriers in the absence or presence of antigen presenting cells
such as macrophages. Antibodies from sera or other sites could be
tested against purified ELI antigens (e.g. glutathione fusions) or
cellular extracts from the above carriers in an antibody capture
ELISA. For those antigens that are secreted or located on the
surface of the carrier, antibodies from the immunized mouse can
capture these antigens in ELISA. Although most screening will
preferably be performed using cells or antibodies from
ELI-immunized animals, similar ex vivo screening may be performed
using reagents from animals infected with the legitimate
pathogen.
EXAMPLE 5
[0179] The inventors expect that MP genomic fragments may be cloned
into the a fragment of .beta.-galactosidase such that mycoplasma
antigens will be synthesized inside the E. coli. Engulfment of the
bacteria will result in presentation of the mycoplasma antigen and
immunization.
[0180] A similar library may be constructed where the mycoplasma
antigens are secreted from the E. coli into the gut where they will
activate IgA immunity which extends from the gastrointestinal tract
into the lungs and nasal passages. These bacterial libraries will
be introduced in other locations such as the peritoneum or
sub-cutaneously to elicit immunity in other locations. The
bacterial libraries can be introduced in osmotic pumps to avoid
infection or as killed preparations.
[0181] An alternate bacterial host for the libraries is Listeria
monocytogenes, since this bacterium invades macrophages and elicits
MHC class I-restricted antigen presentation (Schafer, et al,
1992).
[0182] Antigen libraries can also be built onto the coat proteins
of bacteriophages. For example, antigens can be added to the plll
and pVIII proteins of bacteriophage fdTET. An advantage of
bacteriophage libraries is that they are expected to have no
pathologic effect on the organism unlike living vectors.
[0183] Finally, ELI antigens can be created in vitro in E. coli
expression systems by fusion to glutathione S-transferase or
another fusion protein and inoculated into animals as a soluble
protein bolus to elicit antibody responses.
[0184] Alternately, the library proteins can be introduced on
agarose, paramagnetic, iron, or latex beads which can elicit
cytotoxic T lymphocyte activity following phagocytosis of the beads
by macrophages (Kovacsovics-Bankowski, et al, 1993).
EXAMPLE 6
[0185] In addition to inoculation of DNA into animals, it is
expected that ELI can be performed using pathogen libraries
transfected into syngeneic animal cells and the cells subsequently
introduced into the animal. Once in the animal, the transfected
cells can present library antigens to elicit immune responses.
Library antigens may also be cloned into mammalian viruses such as
adenovirus or vaccinia and inoculated into animals or cells rather
than naked DNA.
[0186] Other approaches include expressing library antigens in E.
coli or other bacteria (e.g. listeria), yeast, bacteriophages, or
other cellular vehicles which can be introduced into the animal to
elicit an immune response. Others have demonstrated that E. coli
expressing a single mycoplasma antigen fused to
.beta.-galactosidase introduced into the gut of mice elicits
immunity to mycoplasma (Lai, et al, 1994),
[0187] A variety of approaches are contemplated for the isolation
of individual vaccine genes using ELI. The success of each depends
on the number and degree of cooperative effects between antigen
genes. Two types of protective genes are expected to be detected in
the practice of the disclosed method in the course of sibbing a
library. As an example, a finite set of antigen gene fragments that
are independently protective may be found for a particular
pathogen. For these types of genes, a sequential sibbing protocol
can be used in which a positive sib is divided into smaller sibs to
be tested in the target organism for protection (FIG. 8).
Reiterative sibbing and testing for protection will eventually
isolate individual protective genes from the library. As the
proportion of protective gene fragment increases in sequential
sibs, protection should increase to some maximal amount. For
example, in a 3000 transformant sib, only 3 ng of a single
independent protective clone is delivered to an animal in 10 .mu.g
of sib DNA. After sibbing to a 100 transformant library now 100 ng
of the positive clone would be delivered in a 10 .mu.g immunization
resulting in as much as a 33-fold increase in protection (up to a
certain level). It is expected that these types of genes will have
additive protective effects when combined with other genes of this
class.
[0188] There may also be antigen genes that require the presence of
one or more other antigen genes to confer resistance. In this
situation, sequential sibbing will eventually result in near total
loss of protection in all sibs at a certain level of division. To
isolate these cooperative gene, a positive sib is divided into
overlapping halves (FIG. 9) and tested in animals for protection.
If only one half sib conferred resistance, this indicates that two
or more cooperative genes are located in the two quarters and that
loss of either totally abrogates protection. A positive half sib is
then broken in alternate patterns to isolate a smaller sib
containing the protective plasmids. This process is reiterated
until the minimal set of genes is isolated.
[0189] Both approaches may be tested in parallel since both classes
(and others) may be observed. Computer controlled sibbing is
expected to facilitate this process since individual DNA isolates
can be created at the beginning of the sibbing process and
algorithms can be created to combine clones in either approach.
EXAMPLE 7
[0190] The expression library is constructed to represent at least
a substantial portion of the pathogens genome. Bacterial pathogens
have genomes of approximately 3.times.10.sup.6 base pairs. If each
fragment is about 1.times.10.sup.3 bp, a genome equivalent would be
approximately 1.8.times.10.sup.4 clones considering only {fraction
(1/16)} would be in frame. To capture all possible coding
sequences, the fragments are ligated into vectors that place them
into each of three forward coding frames, thereby generating a set
of three master libraries. Three genome equivalents for each master
library would be 5.4.times.10.sup.4 clones. The master genomic
expression library is maintained as a collection of sib libraries,
each containing {fraction (1/10)} to {fraction (1/20)} of the
total. The size of the sib library is dictated by certain
considerations, including the lowest amount of DNA that can be
inoculated and still produce an immune response.
[0191] Mycoplasm protection has been achieved with two different
libraries of 3000 transformants (MP1.1 and MP2.3) containing an
unknown number of protective antigen gene fragments. These sibs
differ in that mycoplasma fragments were cloned into two different
coding frames of human growth hormone. It thus appears unlikely
that the same antigen fragment is conferring protection in both
libraries, indicating that there are minimally 2 independent
protective genes or an unknown number of cooperative protective
genes in 6000 total transformants. Since only 1/6 of clones should
express a real mycoplasma protein fragment, a minimal estimate is
{fraction (1/500)} expressing clones are protective. To estimate
the maximal number of protective independent clones, 2 sibs were
created from MP2.3 in which each contained 69 transformants
(MP2.3.01 and MP2.3.02) and approximately 11 mycoplasma
antigen-expressing clones each. Inoculation of these sibs into mice
resulted in little or no protection. This suggests that the maximum
number of independent protective clones is less than {fraction
(1/22)} expressing clones. From this it is estimated that there are
approximately 10 to 200 independent protective antigen genes and an
unknown number of cooperative genes in the total mycoplasma library
of 27,000 transformants. A complete sibbed mycoplasma library
sibbed to completion will allow an accurate estimate for this
organism. FIG. 10 is a cartoon summarizing in general the
immunization protocol.
[0192] For viral pathogens, sibbing will be proportionally
simplified since their genomes are 10 to 1000-fold smaller than
mycoplasma.
[0193] The results of the present work indicate that different
organisms and different types of libraries (i.e. different fusion
proteins, different delivery systems) will yield a wide numerical
range of protective genes.
[0194] All of the compositions and methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the methods and compositions and in
the steps or in the sequence of steps of the methods described
herein without departing from the concept, spirit and scope of the
invention. More particularly, it will be apparent that the methods
and concepts have a very wide range of application to virtually all
categories of human and non-human pathogens and while demonstrated
with two pathogens could be applied to any foreign DNA, including
cancer. All such similar applications and substitutes apparent to
those skilled in the art in view of the present disclosure and
known techniques are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
[0195] The following references as well as those cited in the
specification are incorporated in pertinent part by reference
herein for reasons cited in the text.
[0196] References
[0197] Ada, G., Mol. Immunol. 28, 225 (1991).
[0198] Andersson, S., Davis, D. N., Dhlback, H., Jurnvall, H. and
Russell, D. W. J. Biol. Chem. 264, 8222 (1989).
[0199] Ausubel, F. M. et al. Eds. Short Protocols in Molecular
Biology, Greene Publishing Associates and John Wiley & Sons,
New York, ed. 2, pp. 2-10 to 2-12 (1992).
[0200] Barry, M. A., Barry, M. E. and Johnston, S. A. Biotechniques
16, 616 (1994).
[0201] Campbell, "Monoclonal Antibody Technology, Laboratory
Techniques in Biochemistry and Molecular Biology," Vol. 13, Burden
and Von Knippenberg, Eds. pp. 75-83, Elsevier, Amsterdam, 1984.
[0202] Cassell, G. H. Rev. Inf. Dis. 4, 518 (1982).
[0203] Cohen, "Naked DNA Points Way to Vaccines," Science,
259:1691-1692, 1993.
[0204] Coney, L., Wang, B., Ugen, K. E., Boyer, J., McCallus, D. et
al., Vaccine 12, 1545 (1994).
[0205] Conry, R. M., et al., Cancer Res. 54, 1164 (1994).
[0206] Cox, G. J. M., Zamb, T. J. and Babiuk, L. A. J. Virol.
67(9):5664-5667, 1993.
[0207] Davidson, M. K., Brown, M. B., Schoeb, T. R., Cassell, G. H.
and Lindsey, J. R. Rev. Infect. Dis. 4, S243 (1982).
[0208] Davis, H. L., Michel, M. L., Whalen, R. G. Hum. Mol. Gen. 2,
1847 (1993).
[0209] Eisenbraun, M. D., Fuller, D. H., Haynes, J. R. DNA Cell
Biol. 9, 791 (1993).
[0210] Fynan, E. F., Webster, R. G., Fuller, D. H., Haynes, J. R.
and Santoro, J. C. et al., Proc. Natl. Acad. Sci. USA 90, 11478
(1993).
[0211] Gefter et al., Somatic Cell Genet. 3:231-236, 1977.
[0212] Goding, "Monoclonal Antibodies: Principles and Practice,"
pp. 60-74. 2nd Edition, Academic Press, Orlando, Fla., 1986.
[0213] Jameson & Wolf, Compu. Appl. Biosci., 4(1):181-6,
1988.
[0214] Kohler and Milstein, Eur. J. Immunol. 6:511-519, 1976.
[0215] Kohler and Milstein, Nature 256:495-497, 1975.
[0216] Kovacsovics-Bankowski, M. et al. Efficient major
histocompatibility complex class I presentation of exogenous
antigen upon phagocytosis by macrophages. Proc. Natl. Acad. Sci.
90, 4942-4946 (1993).
[0217] Lai, W. C., Bennett, M., Lu, Y. S. and Pakes, S. P. Infect.
Immun. 59, 346 (1991).
[0218] Lai, W. C. et al., J. Infect. Dis. 161 1269 (1990). W. C.
Lai and M. Bennett, in Molecular and Diagnostic Procedures in
Mycoplasmology, S. Raziu and J. G. Tully, Eds. (Academic Press,
Orlando, Fla., 1995 in press), vol 1, chap. 8.
[0219] Lai, W. C. et al. Protection of mice against experimental
murine mycoplasmosis by a Mycoplasma pulmonis immunogen in
lysogenized Escherichia coli. Vaccine 12, 291-298 (1994).
[0220] Lindsey, J. R., Cassell, G. H. and Baker, H. J. in Pathology
of laboratory animals, K. Benirschke, F. M. Garner, T. C. Jones,
Eds. (Springer Verlag Inc., New York, 1978), p. 1482.
[0221] Lowrie, D. B., Tascon, R. E., Colston, M. J. and Silva, C.
L., Towards a DNA vaccine against tuberculosis. Vaccine 12,
1537-1540 (1994).
[0222] Maloy, S. R., "Experimental Techniques in Bacterial
Genetics" Jones and Bartlett Publishers, Boston, Mass., 1990.
[0223] Maloy et al., "Microbial Genetics" 2nd Edition. Jones and
Barlett Publishers, Boston, Mass., 1994.
[0224] Neimark, H. C. and Lange, C. S. Nucleic Acids Res. 18, S443
(1990).
[0225] Parham, P. Defence cuts begin to bite. Nature 356, 291-292
(1994).
[0226] Prokop, A., and Bajpai, R. K. "Recombinant DNA Technology I"
Ann. N. Y. Acad. Sci. vol. 646, 1991.
[0227] Rouse, B. T., Generic vaccines against herpes simplex virus.
Gene therapy & nucleic acid vaccine strategies held Feb. 16-17,
1995, Bethesda, Md.
[0228] Sambrook, J. et al., "Molecular Cloning: A Laboratory
Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.,
1989.
[0229] J. C. Sanford, et al. Technique, 3, 3 (1991).
[0230] Schafer, R. et al. Induction of a cellular immune response
to a foreign antigen by a recombinant Listeria monocytogenes
vaccine. J. Immunol. 149, 53-59 (1992).
[0231] Segal, I. H., "Biochemical Calculations" 2nd Edition. John
Wiley & Sons, New York, 1976.
[0232] Tang, D., DeVit, M. and Johnston, S. A. Nature, 356:152-154,
1992.
[0233] Tayler, G. and Tayler-Robinson, D. Immunology 30, 611
(1976). G. Tayler and C. J. Howard, Immunology 43, 519 (1981).
[0234] Ulmer, J. B., Donnelly, J. J., Parker, S. E., Rhodes, G. H.
and Felgner, P. L. "Heterologous Protection Against Influenza by
Injection of DNA Encoding a Viral Protein," Science, 259:1745-1749,
1993.
[0235] Wang, B. et al., Proc. Natl. Acad. Sci. USA, 90:4156-4160,
1993.
[0236] Whitton et al., J. Virol. 67:(1)348-352,1993.
[0237] Wolf et al., Compu. Appl. Biosci., 4(1):187-91 1988.
[0238] Xiang, Z. Q. et al., Virology 199, 132 (1994). A. Katsumi,
N. Emi, A. Abe, Y. Hasegawa,
[0239] Ito, M. et al., Hum. Gene Ther. 5, 1335 (1994).
[0240] Yamao, F., Muto, A., Kawauch, Y., Iwami, M. and Iwagami, S.
et al., Proc. Natl. Acad. Sci. USA 82, 2306 (1985).
Sequence CWU 1
1
8 1 21 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 1 gatcttggat cctaagtagt a 21 2 22 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 2
agcttactta cttaggatcc aa 22 3 20 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Primer 3 gatcggatcc
taagtaagta 20 4 20 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Primer 4 agcttactta cttaggatcc 20 5
32 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 5 actgggcaga tcttggatcc taagtaagta ag 32 6 8 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
Peptide 6 Thr Gly Gln Ile Leu Asp Pro Lys 1 5 7 30 DNA Artificial
Sequence Description of Artificial Sequence Synthetic Primer 7
actgggcaga tcggatccta agtaagtaag 30 8 6 PRT Artificial Sequence
Description of Artificial Sequence Synthetic Peptide 8 Thr Gly Gln
Ile Leu Asp 1 5
* * * * *