U.S. patent application number 10/723164 was filed with the patent office on 2005-03-10 for methods of assessing crohn's disease patient phenotype by i2, ompc and asca serologic response.
Invention is credited to Fleshner, Phillip R., Mow, William S., Rotter, Jerome I., Targan, Stephan R., Vasiliauskas, Eric A., Yang, Huiying.
Application Number | 20050054021 10/723164 |
Document ID | / |
Family ID | 33131415 |
Filed Date | 2005-03-10 |
United States Patent
Application |
20050054021 |
Kind Code |
A1 |
Targan, Stephan R. ; et
al. |
March 10, 2005 |
Methods of assessing Crohn's disease patient phenotype by I2, OmpC
and ASCA serologic response
Abstract
The invention provides a method of diagnosing or predicting
susceptibility to a clinical subtype of Crohn's disease in a
subject having Crohn's disease by determining the presence or
absence of IgA anti-I2 antibodies in the subject, where the
presence of the IgA anti-I2 antibodies indicates that the subject
has a clinical subtype of Crohn's disease. In one embodiment, a
method of the invention is practiced by further determining the
presence or absence in the subject of a NOD2 variant,
anti-Saccharomyces cerevisiae antibodies (ASCA), IgA anti-OmpC
antibodies, or perinuclear anti-neutrophil cytoplasmic antibodies
(pANCA). The methods of the invention can be used to diagnose or
predict susceptibility to a clinical subtype of Crohn's disease,
for example, a fibrostenotic subtype, a subtype characterized by
the need for small bowel surgery, or a subtype characterized by the
absence of features of ulcerative colitis.
Inventors: |
Targan, Stephan R.; (Santa
Monica, CA) ; Vasiliauskas, Eric A.; (Manhattan
Beach, CA) ; Mow, William S.; (San Ramon, CA)
; Yang, Huiying; (Cerritos, CA) ; Fleshner,
Phillip R.; (Beverly Hills, CA) ; Rotter, Jerome
I.; (Los Angeles, CA) |
Correspondence
Address: |
Cathryn Campbell
McDERMOTT, WILL & EMERY
Suite 700
4370 La Jolla Village Drive
San Diego
CA
92122
US
|
Family ID: |
33131415 |
Appl. No.: |
10/723164 |
Filed: |
November 26, 2003 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10723164 |
Nov 26, 2003 |
|
|
|
10413501 |
Apr 11, 2003 |
|
|
|
Current U.S.
Class: |
435/7.92 |
Current CPC
Class: |
G01N 2800/065 20130101;
G01N 33/6893 20130101; G01N 2469/20 20130101; G01N 33/686 20130101;
C12Q 1/6883 20130101; C12Q 2600/156 20130101 |
Class at
Publication: |
435/007.92 |
International
Class: |
G01N 033/53; G01N
033/537; G01N 033/543 |
Goverment Interests
[0002] This invention was made with government support under grant
number DK 46763 awarded by the National Institutes of Health. The
United States Government has certain rights in this invention.
Claims
We claim:
1. A method of diagnosing or predicting susceptibility to a
fibrostenotic subtype of Crohn's disease in a subject having
Crohn's disease, comprising determining the presence or absence of
IgA anti-I2 antibodies in the subject, wherein the presence of said
IgA anti-I2 antibodies indicates that the subject has said
fibrostenotic subtype of Crohn's disease.
2. The method of claim 1, further comprising determining the
presence or absence in the subject of one or more fibrostenotic
markers selected from a NOD2 variant, anti-Saccharomyces cerevisiae
antibodies (ASCA), and anti-OmpC antibodies, wherein the presence
of said IgA anti-I2 antibodies or the presence of one of said one
or more fibrostenotic markers each independently indicates that the
subject has said fibrostenotic subtype of Crohn's disease.
3. The method of claim 2, wherein said one or more fibrostenotic
markers is a NOD2 variant.
4. The method of claim 3, wherein said NOD2 variant is selected
from R702W, G908R, and 1007fs.
5. The method of claim 2, wherein said one or more fibrostenotic
markers is ASCA.
6. The method of claim 2, wherein said one or more fibrostenotic
markers is IgA anti-OmpC antibodies.
7. The method of claim 2, wherein said one or more fibrostenotic
markers are a NOD2 variant and ASCA.
8. The method of claim 1, wherein determining the presence or
absence of IgA anti-I2 antibodies in the subject comprises the
steps of: (a) contacting a sample from the subject with an I2
antigen, or immunoreactive fragment thereof, under conditions
suitable to form a complex of I2 antigen, or immunoreactive
fragment thereof, and antibody against said I2 antigen; (b)
contacting said complex with a labeled secondary antibody; and (c)
detecting the presence or absence of said complex, wherein the
presence of said complex indicates the presence of said IgA anti-I2
antibodies in the subject.
9. The method of claim 1, further comprising determining the
presence or absence of a NOD2 variant in the subject, wherein the
presence of IgA anti-I2 antibodies and the presence of a NOD2
variant in the subject indicates that the subject has said
fibrostenotic subtype of Crohn's disease.
10. The method of claim 9, wherein the combined presence of said
IgA anti-I2 antibodies and said NOD2 variant in the subject is
associated with said fibrostenotic subtype of Crohn's disease with
an odds ratio of at least 6.
11. The method of claim 1, further comprising determining the
presence or absence of ASCA in the subject, wherein the presence of
said IgA anti-I2 antibodies and the presence of said ASCA in the
subject indicates that the subject has said fibrostenotic subtype
of Crohn's disease.
12. The method of claim 11, wherein the combined presence of said
IgA anti-I2 antibodies and said ASCA in the subject is associated
with said fibrostenotic subtype of Crohn's disease with an odds
ratio of at least 6.
13. The method of claim 9, further comprising determining the
presence or absence of said ASCA in the subject, wherein the
combined presence of IgA anti-I2 antibodies, said NOD2 variant, and
said ASCA in the subject indicates that the subject has said
fibrostenotic subtype of Crohn's disease.
14. The method of claim 13, wherein the combined presence of said
IgA anti-I2 antibodies, said NOD2 variant, and said ASCA in the
subject is associated with said fibrostenotic subtype of Crohn's
disease with an odds ratio of at least 9.
15. A method of diagnosing or predicting susceptibility to a
clinical subtype of Crohn's disease in a subject having Crohn's
disease, comprising determining the presence or absence of IgA
anti-I2 antibodies in the subject, wherein the presence of said IgA
anti-I2 antibodies indicates that the subject has a clinical
subtype of Crohn's disease.
16. The method of claim 15, wherein said clinical subtype of
Crohn's disease is a fibrostenotic subtype of Crohn's disease.
17. The method of claim 15, wherein said clinical subtype of
Crohn's disease is characterized by the need for small bowel
surgery.
18. The method of claim 15, wherein said clinical subtype of
Crohn's disease is characterized by the absence of features of
ulcerative colitis.
19. The method of claim 15, further comprising determining the
presence or absence in the subject of one or more markers selected
from a NOD2 variant, anti-Saccharomyces cerevisiae antibodies
(ASCA), IgA anti-OmpC antibodies, and perinuclear anti-neutrophil
cytoplasmic antibodies (pANCA).
20. The method of claim 19, wherein said one or more markers is a
NOD2 variant.
21. The method of claim 20, wherein said NOD2 variant is selected
from R702W, G908R, and 1007fs.
22. The method of claim 19, wherein said one or more markers is
ASCA.
23. The method of claim 19, wherein said one or more markers are a
NOD2 variant and ASCA.
24. The method of claim 15, wherein determining the presence or
absence of IgA anti-I2 antibodies in the subject comprises the
steps of: (a) contacting a sample from the subject with an I2
antigen, or immunoreactive fragment thereof, under conditions
suitable to form a complex of I2 antigen, or immunoreactive
fragment thereof, and antibody against said I2 antigen; (b)
contacting said complex with a labeled secondary antibody; and (c)
detecting the presence or absence of said complex, wherein the
presence of said complex indicates the presence of said IgA anti-I2
antibodies in the subject.
25. A method of determining a risk of having or developing a
clinical subtype of Crohn's disease characterized by fibrostenosis,
internal perforating disease or the need for small bowel surgery in
a subject having Crohn's disease, comprising determining the
presence or absence of three markers in the subject, said three
markers being IgA anti-I2 antibodies, anti-Saccharomyces cerevisiae
antibodies (ASCA), and IgA anti-OmpC antibodies, wherein the
presence of said three markers indicates a first risk of having or
developing said clinical subtype of Crohn's disease, the presence
of exactly two of said three markers indicates a second risk of
having or developing said clinical subtype of Crohn's disease, the
presence of exactly one of said three markers indicates a third
risk of having or developing said clinical subtype of Crohn's
disease, and the absence of said three markers indicates a fourth
risk of having or developing said clinical subtype of Crohn's
disease, and wherein said first risk is greater than said second
risk, said second risk is greater than said third risk, and said
third risk is greater than said fourth risk.
26. A method of determining a risk of having or developing a
clinical subtype of Crohn's disease characterized by the need for
small bowel surgery in a subject having Crohn's disease, comprising
determining the presence or absence of three markers in the
subject, said three markers being IgA anti-I2 antibodies,
anti-Saccharomyces cerevisiae antibodies (ASCA), and IgA anti-OmpC
antibodies, wherein the presence of said three markers indicates a
first risk of having or developing said clinical subtype of Crohn's
disease, the presence of exactly two of said three markers
indicates a second risk of having or developing said clinical
subtype of Crohn's disease, the presence of exactly one of said
three markers indicates a third risk of having or developing said
clinical subtype of Crohn's disease, and the absence of said three
markers indicates a fourth risk of having or developing said
clinical subtype of Crohn's disease, and wherein said first risk is
greater than said second risk, said second risk is greater than
said third risk, and said third risk is greater than said fourth
risk.
27. A method of determining a risk of having or developing a
clinical subtype of Crohn's disease in a subject having Crohn's
disease, said clinical subtype characterized by fibrostenosis or
the need for small bowel surgery, said method comprising
determining the presence and magnitude of IgA anti-I2 antibody
response in the subject, wherein a greater magnitude of IgA anti-I2
antibody response indicates a greater risk of having or developing
said clinical subtype characterized by fibrostenosis or the need
for small bowel surgery.
28. A method of determining a risk of having or developing a
clinical subtype of Crohn's disease characterized by fibrostenosis,
internal perforating disease or the need for small bowel surgery in
a subject having Crohn's disease, comprising determining the
presence and magnitude of IgA anti-OmpC antibody response in the
subject, wherein a greater magnitude of IgA anti-OmpC antibody
response indicates a greater risk of having or developing said
clinical subtype characterized by fibrostenosis, internal
perforating disease or the need for small bowel surgery.
29. A method of determining a risk of having or developing a
clinical subtype of Crohn's disease characterized by fibrostenosis,
internal perforating disease or the need for small bowel surgery in
a subject having Crohn's disease, comprising determining the
presence and magnitude of three markers in the subject, said three
markers being IgA anti-I2 antibodies, anti-Saccharomyces cerevisiae
antibodies (ASCA), and IgA anti-OmpC antibodies, wherein a greater
magnitude of said three markers combined indicates a greater risk
of having or developing said clinical subtype characterized by
fibrostenosis, internal perforating disease or the need for small
bowel surgery.
Description
[0001] This application is a continuation-in-part under CFR
1.53(b)(2) of prior application Ser. No. 10/413,501, filed Apr. 11,
2003.
BACKGROUND OF THE INVENTION
[0003] This invention relates generally to the fields of
diagnostics and autoimmune disease and, more specifically, to
serologic and genetic methods for diagnosing clinical subtypes of
Crohn's disease.
[0004] Inflammatory bowel disease (IBD) is the collective term used
to describe two gastrointestinal disorders of unknown etiology:
Crohn's disease (CD) and ulcerative colitis (UC). The course and
prognosis of IBD, which occurs world-wide and is reported to
afflict as many as two million people, varies widely. Onset of IBD
is predominantly in young adulthood with diarrhea, abdominal pain,
and fever the three most common presenting symptoms. The diarrhea
may range from mild to severe, and anemia and weight loss are
additional common signs of IBD. Of all patients with IBD, ten
percent to fifteen percent will require surgery over a ten year
period. In addition, patients with IBD are at increased risk for
the development of intestinal cancer. Reports of an increasing
occurrence of psychological problems, including anxiety and
depression, are perhaps not surprising symptoms of what is often a
debilitating disease that strikes people in the prime of life.
[0005] Unfortunately, the available therapies for inflammatory
bowel disease are few, and both diagnosis and treatment have been
hampered by a lack of knowledge regarding the etiology of the
disease. However, it is thought that a combination of genetic
factors, exogenous triggers and endogenous microflora can
contribute to the immune-mediated damage to the intestinal mucosa
seen in inflammatory bowel disease. In Crohn's disease, bacteria
have been implicated in initiation and progression of the disease:
the intestinal inflammation in Crohn's disease is notable for its
frequent responsiveness to antibiotics and susceptibility to
bacterial fecal flow. Common intestinal colonists and novel
pathogens have been implicated in Crohn's by direct detection or by
disease associated anti-microbial immune responses. Furthermore, in
many genetically susceptible animal models of chronic colitis,
lumenal micro-organisms are a necessary cofactor for disease;
animals housed in a germ-free environment do not develop
colitis.
[0006] It is increasingly apparent that Crohn's disease is a
classification representing a number of heterogeneous disease
subtypes that affect the gastrointestinal tract and produce similar
symptoms. Both environmental and genetic factors likely contribute
to the etiology of such disease subtypes. Patients with Crohn's
disease can be classified, for example, into subtypes based on the
presence of fibrostenotic disease, internal-perforating disease,
perianal fistulizing disease or ulcerative colitis-like disease
according to previously described criteria. The extensive and often
protracted clinical testing required to determine Crohn's disease
subtypes may delay optimal treatment and involves invasive
procedures such as endoscopy.
[0007] Identification of serologic and genetic markers which are
closely associated with a clinical subtype of Crohn's disease would
provide the basis for novel diagnostic tests and eliminate or
reduce the need for the battery of laboratory, radiological, and
endoscopic evaluations typically required to determine disease
subtype. The availability of methods for diagnosing clinical
subtypes of Crohn's disease would represent a major clinical
advance that would aid in the therapeutic management of Crohn's
disease and would further lay the groundwork for the design of
treatment modalities which are specific to a particular disease
subtype. Such methods can reduce costs associated with treatment of
unresponsive disease subtypes and eliminate the disappointment of
those needlessly undergoing ineffective therapy. In particular, a
reliable genetic test for the fibrostenotic subtype of Crohn's
disease would be highly prized as a non-invasive method for the
early diagnosis of this disease subtype and would also be useful
for predicting susceptibility to the fibrostenotic subtype of
Crohn's disease in asymptomatic individuals, making prophylactic
therapy possible. The present invention satisfies this need and
provides related advantages as well.
SUMMARY OF THE INVENTION
[0008] The invention provides a method of diagnosing or predicting
susceptibility to a clinical subtype of Crohn's disease in a
subject having Crohn's disease by determining the presence or
absence of IgA anti-I2 antibodies in the subject, where the
presence of the IgA anti-I2 antibodies indicates that the subject
has a clinical subtype of Crohn's disease. In one embodiment, a
method of the invention is practiced by further determining the
presence or absence in the subject of a NOD2 variant,
anti-Saccharomyces cerevisiae antibodies (ASCA), IgA anti-OmpC
antibodies, or perinuclear anti-neutrophil cytoplasmic antibodies
(pANCA). The methods of the invention can be used to diagnose or
predict susceptibility to a clinical subtype of Crohn's disease,
for example, a fibrostenotic subtype, a subtype characterized by
the need for small bowel surgery, or a subtype characterized by the
absence of features of ulcerative colitis.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 shows an I2 nucleotide sequence (SEQ ID NO: 1) and
predicted amino acid sequence (SEQ ID NO: 2)
[0010] FIG. 2A shows an illustration of the NOD2 gene locus. The
location of selected NOD2 variants is indicated. FIG. 2B shows the
nucleotide sequence of the NOD2 gene surrounding the R702W NOD2
variant. The top strand is labeled as SEQ ID NO:3 and the bottom
strand is labeled as SEQ ID NO:4. Nucleotide sequences which can be
used as primers for PCR amplification are indicated. FIG. 2C shows
the nucleotide sequence of the NOD2 gene surrounding the G908R NOD2
variant. The top strand is labeled as SEQ ID NO:5 and the bottom
strand is labeled as SEQ ID NO:6. Nucleotide sequences which can be
used as primers for PCR amplification are indicated. FIG. 2D shows
the nucleotide sequence of the NOD2 gene surrounding the 1007fs
NOD2 variant. The top strand is labeled as SEQ ID NO:7 and the
bottom strand is labeled as SEQ ID NO:8. Nucleotide sequences which
can be used as primers for PCR amplification are indicated. In
FIGS. 2B, C and D, the position of a nucleotide sequence which can
be used as a probe in an allelic discrimination assay is boxed and
the position of the polymorphic site is underlined.
[0011] FIG. 3A shows the nucleotide sequence (SEQ ID NO:9) of an E.
coli outer membrane protein c (OmpC) precursor and FIG. 3B shows
the corresponding amino acid sequence (SEQ ID NO:10).
[0012] FIG. 4 shows scatter graphs of the level of patient serum
reactivity towards microbial and autoantigens in a Crohn's disease
cohort of 303 patients. (A) IgA anti-I2, (B) IgA anti-OmpC, (C) IgA
ASCA, (D) IgG ASCA and (E) ANCA. In each panel, the shaded zone at
the bottom indicates negative serum reactivity. Circles show I2-,
OmpC-, ASCA-, and pANCA-positive reactivity. In panel E, the open
circles in the left-side portion represent a perinuclear staining
pattern while the black circles shown in the right-side portion
represent ANCA-positive samples with a cytoplasmic indirect
immunofluorescent (IIF) staining pattern.
[0013] FIG. 5 is a Venn diagram showing the relationship between
microbial marker antibodies in the Crohn's disease cohort of 303
patients. Shown are the percentage of patients positive for a
single marker, the three combinations of two markers, and all three
markers.
[0014] FIG. 6 shows that no significant changes in serologic
response to microbial and autoantigens occurred over time.
Serologic responses were determined following small bowel surgery
(time 0) in 26 patients with at least one sequential follow up
analysis six months or more after the surgery. The dotted line
represents the demarcation between positive and negative
values.
[0015] FIG. 7 shows quartile analysis of the 303 Crohn's disease
patient cohort for three microbial antigens: I2, OmpC and ASCA. The
population was subdivided into four quartiles by I2 (top left),
OmpC (middle left), and ASCA (bottom left) binding levels. Values
for binding levels are in ELISA units. Quartile sums were
calculated by the addition of each individual's quartile values for
the three microbial antigens to give a quartile sum ranging from 3
to 12. Patients with the lowest level reactivity towards all three
antigens had a quartile sum score of 3 while patients with the
highest level antibody reactivity towards all three had a quartile
sum score of 12. The distribution of quartile sums for the 303
patient cohort is shown in the right panel.
[0016] FIG. 8 shows that the frequency of complicated small bowel
disease increases with antibody reactivity, as represented by the
quartile sum score against all three antigens (* denotes negative
ptrend). Those patients with the highest level antibody reactivity
towards all three microbial antigens have the highest association
with complicated small bowel disease phenotypes.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The present invention is directed to the exciting discovery
of serologic and genetic markers that are closely associated with
the fibrostenotic subtype of Crohn's disease. These markers can be
used to diagnose or predict susceptibility to the fibrostenotic
subtype of Crohn's disease in a subject having Crohn's disease.
[0018] As disclosed herein, ELISAs for IgA anti-I2 antibodies and
anti-Saccharomyces cerevisiae antibodies (ASCA) were performed
on258 Crohn's disease patients (Examples II and III, respectively).
In addition, genotyping was performed on these patients for three
Crohn's disease associated variants of the NOD2 gene, R702W, G908R,
and1007 fs, using the Taqman.RTM. MGB system as described in
Example IV.
[0019] The results disclosed herein demonstrate that IgA antibodies
to I2 were present in 56.5% of the Crohn's disease patients in the
study (see Example I). Patients expressing these IgA anti-I2
antibodies were significantly more likely to have a fibrostenotic
subtype of Crohn's disease than those not expressing IgA anti-I2
antibodies (71.4% vs. 43.3%, p<0.001) and significantly more
likely to require small bowel surgery (66.7% vs. 37.1%,
p<0.001). In addition, IgA anti-I2 antibody expression was
negatively associated with ulcerative colitis-like Crohn's disease
(20.6% vs. 41.24%, p<0.001). Quartile analyses revealed that
higher levels of IgA anti-I2 antibodies were more strongly
associated with the fibrostenotic subtype of Crohn's disease (p for
the trend <0.001) and small bowel involvement (p=0.023), and
inversely associated with ulcerative colitis-like Crohn's disease
(p=0.005) compared to lower levels of IgA anti-I2 antibodies. In
addition, as disclosed in Example I, conditional analysis performed
on NOD2 variants and ASCA indicated that IgA anti-I2 antibodies
were independently associated with the fibrostenotic subtype of
Crohn'disease (p=0.001 and p=0.005, respectively). Similarly, IgA
anti-I2 was independently associated with small bowel surgery when
conditioned on NOD2 variation (p=0.001) or ASCA (p=0.002). These
results indicate that the presence of IgA anti-I2 antibodies can be
used to diagnose or predict susceptibility to a clinical subtype of
Crohn's disease, such as the fibrostenotic subtype, in a subject
having Crohn's disease.
[0020] As further disclosed in Example I, patients with all three
markers, IgA anti-I2 antibodies, one of the three NOD2 variants,
and ASCA showed a greater risk of the fibrostenotic subtype of
Crohn's disease (82%, odds ratio=9.7, p<0.000001), compared with
patients with two markers (74%, odds ratio=6.0), one marker (48%,
odds ratio=1.9), or none of these markers (33%, odds
ratio=reference group). These results indicate that the presence of
IgA anti-I2 antibodies in combination with the presence of other
markers can be used to diagnose or predict susceptibility to a
fibrostenotic subtype Crohn's disease in a patient having Crohn's
disease.
[0021] The results disclosed herein in Example VII with a cohort of
303 Crohn's disease patients corroborate that anti-I2 reactivity is
significantly associated with fibrostenosis and small bowel surgery
in patients with Crohn's disease, and additionally show that
anti-I2 reactivity is significantly associated with the occurrence
of small bowel disease in these patients (Table 4). Furthermore,
anti-OmpC reactivity was associated with subtypes of Crohn's
disease characterized by fibrostenosis, internal perforating
disease, or the need for small bowel surgery (see Table 4).
Reactivity against both of these antigens was negatively associated
with ulcerative colitis-like disease in Crohn's patients.
[0022] As additionally disclosed herein, the relationship between
serum reactivity towards one, two, or three microbial antigens (I2,
oligomannan and OmpC) and clinical phenotype was analyzed
irrespective of pANCA and NOD2 status. Table 6 shows that CD
patients with all three associated markers were more likely to have
fibrostenotic disease, internal perforating disease and to require
small bowel surgery, as compared with CD patients having serum
reactivity with fewer of these markers (p for all .ltoreq.0.001).
These results indicate that Crohn's disease patients who have
antibody responses towards a greater number of the microbial
antigens I2, oligomannan and OmpC are at increased risk for
fibrostenosis, internal perforating disease, and the need for small
bowel surgery as compared with patients with a serologic response
towards a smaller number of these antigens.
[0023] The importance of quantitative antibody response against I2,
oligomannan, or OmpC to frequency of various Crohn's disease
clinical subtypes is further disclosed herein. Table 7A shows the
results of quartile analysis for anti-I2, ASCA and anti-OmpC for
each disease characteristic. As disclosed herein in Example VII,
there was an increasing percentage of Crohn's disease patients with
small bowel disease, fibrostenotic disease, internal perforating
disease, small bowel surgery, and a decreasing likelihood of
UC-like disease, as the magnitude of an antibody response toward a
microbial antigen increased. Thus, these results demonstrate that a
greater antibody response towards I2, OmpC, or oligomannan is
associated with increasing frequency of complicated small bowel
Crohn's disease.
[0024] Further disclosed herein in Example VII is an analysis of
the total level of antibody response towards all three microbial
antigens. Quartile sum analysis (sum of quartile scores for
anti-I2, ASCA and anti-OmpC) was performed in order to evaluate a
possible association between the level of combined immune response
towards I2, oligomannan and OmpC, and disease characteristics for
an individual Crohn's patient. As shown in FIG. 7, individual
serologic responses were broken down by quartiles and assigned
scores of 1 to 4 based on their designated quartile. Individual
quartile scores for each microbial antigen were added to obtain a
quartile sum score, ranging from 3 to 12, which represented the
cumulative quantitative immune response towards the three microbial
antigens. As revealed in FIG. 8, Crohn's disease patients with
greater quartile sum scores had an increasing likelihood of small
bowel disease, fibrostenotic disease, and internal perforating
disease, an increasing need for small bowel surgery, and a
decreasing frequency of UC-like disease. These results demonstrate
that the presence of multiple high-level antibody responses towards
the microbial antigens I2, oligomannan and OmpC is associated with
a higher frequency of complicated small bowel disease.
[0025] Based on these findings, the present invention provides a
method of diagnosing or predicting susceptibility to a clinical
subtype of Crohn's disease in a subject having Crohn's disease by
determining the presence or absence of IgA anti-I2 antibodies in
the subject, where the presence of the IgA anti-I2 antibodies
indicates that the subject has a clinical subtype of Crohn's
disease. The methods of the invention can be advantageous in that
they are noninvasive and can be conveniently practiced, for
example, with a blood sample from the subject. The methods of the
invention can be used to quickly, easily and reliably diagnose or
predict susceptibility to a clinical subtype of Crohn's disease,
for example, a fibrostenotic subtype, a subtype characterized by
the need for small bowel surgery, or a subtype characterized by the
absence of features of ulcerative colitis, as described herein. The
methods of the invention can also be advantageous in that they can
be useful for predicting how a subject will respond to a certain
therapy.
[0026] In one embodiment, a method of the invention is practiced by
determining the presence or absence of IgA anti-I2 antibodies in a
subject having Crohn's disease and further determining the presence
or absence in the subject of a NOD2 variant, anti-Saccharomyces
cerevisiae antibodies (ASCA), IgA anti-OmpC antibodies, or
perinuclear anti-neutrophil cytoplasmic antibodies (pANCA). Such a
NOD2 variant can be, for example, R702W, G908R, or 1007fs. In a
further embodiment, determining the presence or absence of IgA
anti-I2 antibodies in the subject is practiced by contacting a
sample from the subject with an I2 antigen, or immunoreactive
fragment thereof, under conditions suitable to form a complex of I2
antigen, or immunoreactive fragment thereof, and antibody against
the I2 antigen; contacting the complex with a labeled secondary
antibody; and detecting the presence or absence of the complex,
where the presence of the complex indicates the presence of the
anti-I2 antibodies in the subject.
[0027] The invention: also provides a method of diagnosing or
predicting susceptibility to a fibrostenotic subtype of Crohn's
disease by determining the presence or absence of IgA anti-I2
antibodies in a subject having Crohn's disease, where the presence
of IgA anti-I2 antibodies indicates that the subject has the
fibrostenotic subtype of Crohn's disease. In one embodiment, a
method of the invention is practiced by further determining the
presence or absence in the subject of one or more of the following
fibrostenotic markers: a NOD2 variant, anti-Saccharomyces
cerevisiae antibodies (ASCA), or IgA anti-OmpC antibodies. Such a
NOD2 variant can be, for example, R702W, G908R, or 1007fs NOD2
variant. In a further embodiment, a method of the invention is
practiced by determining the presence or absence of anti-I2
antibodies, a NOD2 variant and ASCA. In yet a further embodiment,
determining the presence or absence of IgA anti-I2 antibodies in
the subject is practiced by contacting a sample from the subject
with an I2 antigen, or immunoreactive fragment thereof, under
conditions suitable to form a complex of I2 antigen, or
immunoreactive fragment thereof, and antibody against the I2
antigen; contacting the complex with a labeled secondary antibody;
and detecting the presence or absence of the complex, where the
presence of the complex indicates the presence of the IgA anti-I2
antibodies in the subject.
[0028] In one embodiment, a method of the invention is practiced by
determining the presence or absence in the subject of IgA anti-I2
antibodies and further determining the presence or absence of a
NOD2 variant, where the presence of IgA anti-I2 antibodies and the
presence of a NOD2 variant in the subject indicates that the
subject has the fibrostenotic subtype of Crohn's disease. In a
related embodiment, the combined presence of the IgA anti-I2
antibodies and the NOD2 variant in the subject is associated with
the fibrostenotic subtype of Crohn's disease with an odds ratio of
at least 6. In another embodiment, the invention is practiced by
determining the presence or absence of IgA anti-I2 antibodies and
further determining the presence or absence of ASCA in the subject,
where the presence of the IgA anti-I2 antibodies and the presence
of ASCA in the subject indicates that the subject has the
fibrostenotic subtype of Crohn's disease. In a related embodiment,
the combined presence of the anti-I2 antibodies and ASCA in the
subject is associated with the fibrostenotic subtype of Crohn's
disease with an odds ratio of at least 6. In a further embodiment,
the invention is practiced by determining the presence or absence
of IgA anti-I2 antibodies and further determining the presence or
absence of a NOD2 variant and ASCA in the subject, where the
combined presence of IgA anti-I2 antibodies, the NOD2 variant, and
ASCA in the subject indicates that the subject has the
fibrostenotic subtype of Crohn's disease. In a related embodiment,
the combined presence of the anti-I2 antibodies, the NOD2 variant,
and ASCA in the subject is associated with the fibrostenotic
subtype of Crohn's disease with an odds ratio of at least 9.
[0029] The present invention also provides a method of determining
a risk of having or developing a clinical subtype of Crohn's
disease characterized by fibrostenosis, internal perforating
disease or the need for small bowel surgery in a subject having
Crohn's disease by determining the presence or absence of three
markers in the subject, the three markers being IgA anti-I2, ASCA
and IgA anti-OmpC antibodies, where the presence of the three
markers indicates a first risk of having or developing the clinical
subtype of Crohn's disease, the presence of exactly two of the
three markers indicates a second risk of having or developing the
clinical subtype of Crohn's disease, the presence of exactly one of
the three markers indicates a third risk of having or developing
the clinical subtype of Crohn's disease, and the absence of the
three markers indicates a fourth risk of having or developing the
clinical subtype of Crohn's disease, and where the first risk is
greater than the second risk, the second risk is greater than the
third risk, and the third risk is greater than the fourth risk.
[0030] Further provided herein is a method of determining a risk of
having or developing a clinical subtype of Crohn's disease
characterized by the need for small bowel surgery in a subject
having Crohn's disease by determining the presence or absence of
three markers in the subject, the three markers being IgA anti-I2
antibodies, ASCA and IgA anti-OmpC antibodies, where the presence
of the three markers indicates a first risk of having or developing
the clinical subtype of Crohn's disease, the presence of exactly
two of the three markers indicates a second risk of having or
developing the clinical subtype of Crohn's disease, the presence of
exactly one of the three markers indicates a third risk of having
or developing the clinical subtype of Crohn's disease, and the
absence of the three markers indicates a fourth risk of having or
developing the clinical subtype of Crohn's disease, and where the
first risk is greater than the second risk, the second risk is
greater than the third risk, and the third risk is greater than the
fourth risk.
[0031] The present invention additionally provides a method of
determining a risk of having or developing a clinical subtype of
Crohn's disease characterized by fibrostenosis or the need for
small bowel surgery in a subject having Crohn's disease by
determining the presence and magnitude of IgA anti-I2 antibody
response in the subject, where a greater magnitude of IgA anti-I2
antibody response indicates a greater risk of having or developing
the clinical subtype characterized by fibrostenosis or the need for
small bowel surgery.
[0032] Further provided herein is a method of determining a risk of
having or developing a clinical subtype of Crohn's disease
characterized by fibrostenosis, internal perforating disease or the
need for small bowel surgery in a subject having Crohn's disease by
determining the presence and magnitude of IgA anti-OmpC antibody
response in the subject, where a greater magnitude of IgA anti-OmpC
antibody response indicates a greater risk of having or developing
the clinical subtype characterized by fibrostenosis, internal
perforating disease or the need for small bowel surgery.
[0033] The invention additionally provides a method of determining
a risk of having or developing a clinical subtype of Crohn's
disease characterized by fibrostenosis, internal perforating
disease or the need for small bowel surgery in a subject having
Crohn's disease by determining the presence and magnitude of three
markers in the subject, the three markers being IgA anti-I2
antibodies, anti-Saccharomyces cerevisiae antibodies (ASCA), and
IgA anti-OmpC antibodies, where a greater magnitude of the three
markers combined indicates a greater risk of having or developing
the clinical subtype characterized by fibrostenosis, internal
perforating disease or the need for small bowel surgery.
[0034] The methods of the invention relate to the diagnosis and
treatment of Crohn's disease (regional enteritis), which is a
disease of chronic inflammation that can involve any part of the
gastrointestinal tract. Commonly the distal portion of the small
intestine (ileum) and cecum are affected. In other cases, the
disease is confined to the small intestine, colon or anorectal
region. Crohn's disease occasionally involves the duodenum and
stomach, and more rarely the esophagus and oral cavity.
[0035] The variable clinical manifestations of Crohn's disease are,
in part, a result of the varying anatomic localization of the
disease. The most frequent symptoms of Crohn's disease are
abdominal pain, diarrhea and recurrent fever. Crohn's disease is
commonly associated with intestinal obstruction or fistula, which
is an abnormal passage, for example, between diseased loops of
bowel. Crohn's disease also may include complications such as
inflammation of the eye, joints and skin; liver disease; kidney
stones or amyloidosis. In addition, Crohn's disease is associated
with an increased risk of intestinal cancer.
[0036] Several features are characteristic of the pathology of
Crohn's disease. The inflammation associated with Crohn's disease,
known as transmural inflammation, involves all layers of the bowel
wall. Thickening and edema, for example, typically also appear
throughout the bowel wall, with fibrosis also present in
long-standing disease. The inflammation characteristic of Crohn's
disease also is discontinuous in that segments of inflamed tissue,
known as "skip lesions," are separated by apparently normal
intestine. Furthermore, linear ulcerations, edema, and inflammation
of the intervening tissue lead to a "cobblestone" appearance of the
intestinal mucosa, which is distinctive of Crohn's disease.
[0037] A hallmark of Crohn's disease is the presence of discrete
aggregations of inflammatory cells, known as granulomas, which are
generally found in the submucosa. Some Crohn's disease cases
display the typical discrete granulomas, while others show a
diffuse granulomatous reaction or nonspecific transmural
inflammation. As a result, the presence of discrete granulomas is
indicative of Crohn's disease, although the absence of granulomas
also is consistent with the disease. Thus, transmural or
discontinuous inflammation, rather than the presence of granulomas,
is a preferred diagnostic indicator of Crohn's disease (Rubin and
Farber, Pathology (Second Edition) Philadelphia: J.B. Lippincott
Company (1994)).
[0038] In contrast to ulcerative colitis, which is characterized by
a continuous inflammation of the colon that usually is more severe
distally than proximally, Crohn's disease is a patchy disease with
frequent sparing of the rectum. Furthermore, the inflammation in
Crohn's disease is distinct from the superficial inflammation seen
in ulcerative colitis, which is usually limited to the mucosal
layer and characterized by an acute inflammatory infiltrate with
neutrophils and crypt abscesses. Instead, Crohn's disease affects
the entire thickness of the bowel wall with granulomas often,
although not always, present. Furthermore, involvement of the
terminal ileum, a cobblestone-like appearance, discrete ulcers or
fistulas suggest Crohn's disease.
[0039] The methods of the invention are practiced in a subject
having Crohn's disease. As used herein, the term "subject" means
any animal, such as a human or other mammal, capable of having
Crohn's disease. A subject having Crohn's disease can have one or
more symptoms of Crohn's disease or can be asymptomatic, having
been previously diagnosed as having Crohn's disease by one or more
well established criteria. The methods of the invention can be
useful, for example, for diagnosing a subtype of Crohn's disease in
a subject with one or more symptoms of Crohn's disease. In one
embodiment, the methods of the invention are used to determine the
presence or absence of the fibrostenotic subtype of Crohn's disease
in a subject known to have Crohn's disease. One skilled in the art
understands that the methods of the invention also can be practiced
in an individual not yet diagnosed as having Crohn's disease, for
example, an individual at risk for having Crohn's disease. Such an
individual can be, for example, genetically related to a subject
with Crohn's disease or can belong to a population that is known to
be at increased risk for having Crohn's disease such as the
Ashkenazi Jewish population.
[0040] Several of the methods of the invention are practiced by
determining the presence or absence of IgA anti-I2 antibodies in a
subject having Crohn's disease. As used herein, the term "IgA
anti-I2 antibodies" means IgA antibodies that selectively bind to
an I2 antigen, as well as fragments of antibodies that retain a
selective binding activity for an I2 antigen of at least about
1.times.105 M-1. Antibodies that selectively bind an I2 antigen
bind with substantially higher affinity to that antigen than to an
unrelated antigen. One skilled in the art understands that other
isotypes of anti-I2 antibodies, such as IgG, IgM, IgE, and IgD
anti-I2 antibodies, also can be useful in the methods of the
invention.
[0041] An I2 antigen is a polypeptide having substantially the same
amino acid sequence as the microbial I2 polypeptide (SEQ ID NO: 2)
shown in FIG. 1. The naturally occurring microbial I2 antigen SEQ
ID NO: 2 is a polypeptide of 100 amino acids sharing some
similarity to bacterial transcriptional regulators, with the
greatest similarity in the amino-terminal 30 amino acids. The
naturally occurring I2 SEQ ID NO:2 shares weak homology with the
predicted protein 4 from C. pasteurianum; Rv3557c from
Mycobacterium tuberculosis; and a transcriptional regulator from
Aquifex aeolicus.
[0042] The I2 antigen (SEQ ID NO:2) was originally identified by
overexpression of the encoding nucleic acid sequence in colonic
microbes harbored in inflamed lesions in Crohn's disease patients
(Sutton et al., Gastroenterology 119:23-31 (2000)). ELISA analysis
showed frequent IgA serum seroreactivity to a recombinant I2
antigen in patients with Crohn's disease but infrequent
seroreactivity in patients with ulcerative colitis, other
inflammatory enteric disease, or normal individuals (Sutton et al.,
supra, 2000). The I2 antigen is also known to induce a
proliferative and IL-10 response by CD4(+) T cells in unimmunized
mice (Dalwadi et al., Immunity 15:149-158 (2001)). The I2 response
is dependent on MHC classII-mediated recognition and does not
require antigen processing. Furthermore, activation is observed for
the TCR-Vbeta5 subpopulation of cells, indicating that the I2
antigen is a T cell superantigen (Dalwadi et al., supra, 2001). A
microbial homologue of I2, PA2885, has been identified in the
Pseudomonas aeruginosa genome (Wei et al., Infect. Immun.
70:6567-6575 (2002)). Furthermore, genomic cloning identified a
locus containing the full-length I2 gene (pfiT) in P. aeruginosa
(Wei et al., supra, 2002).
[0043] An I2 antigen can be the naturally occurring I2 antigen SEQ
ID NO: 2 or a related polypeptide having substantial amino acid
sequence similarity to this sequence. Such related polypeptides
generally exhibit greater sequence similarity to the I2 antigen SEQ
ID NO: 2 than to related sequences such as the predicted protein 4
from C. pasteurianum and include isotype variants or homologs of
the amino acid sequence shown in FIG. 1. As used herein, the term
I2 antigen generally describes polypeptides having an amino acid
sequence with greater than about 60% identity, greater than about
70% identity, greater than about 80% identity, and can be a
polypeptide having greater than about 90%, 95%, 97%, or 99% amino
acid sequence identity with SEQ ID NO: 2, said amino acid identity
determined with CLUSTALW using the BLOSUM 62 matrix with default
parameters. The C.pasteurianum protein4 has about 21% amino acid
identity with the I2 antigen SEQ ID NO: 2 and, therefore, is not an
I2 antigen as defined herein.
[0044] As disclosed above, the invention provides a method of
diagnosing or predicting susceptibility to a clinical subtype of
Crohn's disease in a subject having Crohn's disease by determining
the presence or absence of IgA anti-I2 antibodies in the subject,
where the presence of the IgA anti-I2 antibodies indicates that the
subject has a clinical subtype of Crohn's disease. In one
embodiment, the clinical subtype of Crohn's disease is a
fibrostenotic subtype of Crohn's disease. In another embodiment,
the clinical subtype of Crohn's disease is characterized by the
need for small bowel surgery. In a further embodiment, the clinical
subtype of Crohn's disease is characterized by the absence of
features of ulcerative colitis.
[0045] Crohn's disease represents a number of heterogeneous disease
subtypes that affect the gastrointestinal tract and may produce
similar symptoms. As used herein in reference to Crohn's disease,
the term "clinical subtype" means a classification of Crohn's
disease defined by a set of clinical criteria that distinguish one
classification of Crohn's disease from another. As non-limiting
examples, subjects with Crohn's disease can be classified as having
fibrostenotic disease, internal-perforating disease, perianal
fistulizing disease, ulcerative colitis (UC)-like disease, the need
for small bowel surgery or the absence of features of ulcerative
colitis. Subjects with Crohn's disease further can be classified as
having complicated Crohn's disease, which is a clinical subtype
characterized by one or more of the following complications:
fibrostenosis, internal perforating disease and the need for small
bowel surgery. Criteria relating to these subtypes have been
described, for example, in Gasche et al., Inflammatory Bowel
Diseases 6:8-15 (2000); Vasiliauskas et al., Gut 47:487-496 (2000);
Vasiliauskas et al., Gastroenterology 110:1810-1819 (1996); and
Greenstein et al., Gut 29:588-592 (1988).
[0046] The "fibrostenotic subtype" of Crohn's disease is a
classification of Crohn's disease characterized by one or more
accepted characteristics of fibrostenosing disease. Such
characteristics of fibrostenosing disease include, for example,
documented persistent intestinal obstruction or an intestinal
resection for an intestinal obstruction. The fibrostenotic subtype
of Crohn's disease can be accompanied by other symptoms such as
perforations, abscesses or fistulae, and further can be
characterized by persistent symptoms of intestinal blockage such as
nausea, vomiting, abdominal distention and inability to eat solid
food. Intestinal X-rays of patients with the fibrostenotic subtype
of Crohn's disease can show, for example, distention of the bowel
before the point of blockage.
[0047] The requirement for small bowel surgery in a subject with
the fibrostenotic subtype of Crohn's disease can indicate a more
aggressive form of this subtype. As shown in Example I, patients
expressing IgA ant-I2 antibodies were significantly more likely to
have the fibrostenotic subtype of Crohn's disease and significantly
more likely to require small bowel surgery than those not
expressing IgA anti-I2 antibodies. In addition, the amplitude or
level of IgA anti-I2 antibodies in a subject can be correlated with
the likelihood of having a particular clinical subtype of Crohn's
disease. As shown in Example I, quartile analyses revealed that
higher levels of IgA anti-I2 antibodies were more strongly
associated with the fibrostenotic subtype of Crohn's disease and
small bowel involvement and were negatively associated with
ulcerative colitis-like Crohn's disease than were lower levels.
Furthermore, the greater the number of fibrostenotic markers that a
subject possesses, the greater chance that the subject will have an
aggressive form of the fibrostenotic subtype of Crohn's disease
requiring small bowel surgery (see Example I). For example, a
subject with two or more markers can have a more severe form of the
fibrostenotic subtype than a patient with one marker.
[0048] Additional subtypes of Crohn's disease also are known in the
art and can be identified using defined clinical criteria. For
example, internal perforating disease is a clinical subtype of
Crohn's disease defined by current or previous evidence of
entero-enteric or entero-vesicular fistulae, intra-abdominal
abscesses, or small bowel perforation. Perianal perforating disease
is a clinical subtype of Crohn's disease defined by current or
previous evidence of either perianal fistulae or abscesses or
rectovaginal fistula. The UC-like clinical subtype of Crohn's
disease can be defined by current or previous evidence of
left-sided colonic involvement, symptoms of bleeding or urgency,
and crypt abscesses on colonic biopsies. Disease location can be
classified based on one or more endoscopic, radiologic or
pathologic studies.
[0049] One skilled in the art understands that overlap can exist
between clinical subtypes of Crohn's disease and that a subject
having Crohn's disease can have more than one clinical subtype of
Crohn's disease. For example, a subject having Crohn's disease can
have the fibrostenotic subtype of Crohn's disease and can also meet
clinical criteria for a clinical subtype characterized by the need
for small bowel surgery or the internal perforating disease
subtype. Similarly, the markers described herein can be associated
with more than one clinical subtype. For example, IgA anti-OmpC
antibodies can be associated with the fibrostenotic subtype, need
for small bowel surgery, and internal perforating disease subtypes,
and can be independently associated with the internal perforating
disease subtype. Also, for example, ASCA can be independently
associated with the fibrostenotic subtype, a clinical subtype
characterized by the need for small bowel surgery, and the internal
perforating disease subtype.
[0050] The invention further provides a method of diagnosing or
predicting suspectibility to a clinical subtype of Crohn's disease
in a subject having Crohn's disease by contacting a sample from the
subject with an I2 antigen, or immunoreactive fragment thereof,
under conditions suitable to form a complex of I2 antigen, or
immunoreactive fragment thereof, and antibody against the I2
antigen; contacting the complex with a labeled secondary antibody;
and detecting the presence or absence of the complex, where the
presence of the complex indicates the presence of the IgA anti-I2
antibodies in the subject, thereby indicating that the subject has
a clinical subtype of Crohn's disease.
[0051] The invention additionally provides a method of diagnosing
or predicting suspectibility to a fibrostenotic subtype of Crohn's
disease in a subject having Crohn's disease by contacting a sample
from the subject with an I2 antigen, or immunoreactive fragment
thereof, under conditions suitable to form a complex of I2 antigen,
or immunoreactive fragment thereof, and antibody against the I2
antigen; contacting the complex with a labeled secondary antibody;
and detecting the presence or absence of the complex, where the
presence of the complex indicates the presence of the IgA anti-I2
antibodies in the subject, thereby indicating that the subject has
the fibrostenotic subtype of Crohn's disease.
[0052] A sample useful in the methods of the invention can be
obtained from any biological fluid having antibodies such as, for
example, whole blood, plasma, saliva, or other bodily fluid or
tissue, such as serum. It is understood that a sample to be assayed
according to the methods of the invention can be a fresh or
preserved sample obtained from a subject to be diagnosed.
[0053] As used herein, the term "complex" is synonymous with
"immune complex" and means an aggregate of two or more molecules
that results from specific binding between an antigen, such as a
protein or peptide, and an antibody. In a method of the invention,
a complex is formed, for example, by specific binding of an
antibody and an I2 antigen or immunoreaction fragment thereof.
[0054] As used herein, the term "I2 antigen" means a polypeptide
which is immunoreactive with IgA anti-I2 antibodies that
immunoreact with SEQ ID NO:2. For example, the amino acid sequence
SEQ ID NO:2 can be an I2 antigen. An immunoreactive fragment of the
I2 antigen also can be used in the methods of the invention. As
used herein, the term "immunoreactive fragment" means a portion of
a full-length I2 antigen that retains the ability to form a
specific complex with IgA anti-I2 antibodies.
[0055] An I2 antigen, or immunoreactive fragment thereof, useful in
the invention can be produced or synthesized using methods well
known in the art. Such methods include recombinant DNA methods and
chemical synthesis methods for production of a peptide. Recombinant
methods for producing a polypeptide antigen through expression of a
nucleic acid sequence encoding the polypeptide in a suitable host
cell are well known in the art and are described, for example, in
Ausubel et al., supra,1999.
[0056] An I2 antigen, or immunoreactive fragment thereof, useful in
the invention also can be produced by chemical synthesis, for
example, by the solid phase peptide synthesis method of Merrifield
et al., J. Am. Chem. Soc. 85:2149 (1964). Standard solution methods
well known in the art also can be used to synthesize an I2 antigen,
or immunoreactive fragment thereof (see, for example, Bodanszky,
Principles of Peptide Synthesis, Springer-Verlag, Berlin (1984) and
Bodanszky, Peptide Chemistry, Springer-Verlag, Berlin (1993)). A
newly synthesized polypeptide antigen or immunogenic fragment
thereof can be purified, for example, by high performance liquid
chromatography (HPLC), and can be characterized using, for example,
mass spectrometry or amino acid sequence analysis.
[0057] It is understood that limited modifications can be made to
an I2 antigen without destroying its ability to bind to IgA anti-I2
antibodies. Similarly, limited modifications can be made to an
immunoreactive fragment of an I2 antigen without destroying its
immunoreactivity. A modification of an antigen disclosed herein
that does not destroy its reactivity with IgA antibodies in the
sera of patients having Crohn's disease is within the definition of
an I2 antigen. Similarly, a modification of an immunoreactive
fragment of an I2 antigen disclosed herein that does not destroy
its ability to form a complex with IgA antibodies in the sera of a
patient having Crohn's disease is within the definition of an
immunoreactive fragment. A modification can be, for example, an
addition, deletion, or substitution of amino acid residues;
substitution of a compound that mimics amino acid structure or
function; or addition of chemical moieties such as amino or acetyl
groups. The activity of a modified I2 antigen or a modified
immunoreactive fragment of an I2 antigen can be assayed, for
example, using one of the assays for immunoreactivity disclosed
herein.
[0058] A useful modification, for example, is one that confers
increased stability. Incorporation of one or more D-amino acids is
a modification useful in increasing stability of an I2 antigen or
immunoreactive fragment thereof. Similarly, deletion or
substitution of lysine can increase stability by protecting against
degradation. For example, such a substitution can increase
stability of an I2 antigen or an immunoreactive fragment thereof,
provided that the substitution does not significantly impair
immunoreactive activity.
[0059] In the methods of the invention, a complex can be detected
with a labeled secondary antibody, for example, that has
specificity for a class determining portion of an anti-I2 antibody.
Such a secondary antibody can be, without limitation, an anti-IgA
secondary antibody, an anti-IgG secondary antibody, or a
combination of anti-IgA and anti-IgG secondary antibodies.
[0060] As used herein, the term "secondary antibody" means an
antibody or combination of antibodies, which binds an antibody that
specifically binds an I2 antigen, or an immunoreactive fragment
thereof. One skilled in the art understands that, preferably, a
secondary antibody does not compete with the I2 antigen for binding
to the primary antibody. A secondary antibody can bind any epitope
of an anti-I2 antibody. A particularly useful secondary antibody is
an anti-IgA or anti-IgG antibody having specificity for the class
determining portion of the primary antibody.
[0061] It is understood that a useful secondary antibody is
specific for the species from which the sample was obtained. For
example, if human serum is the sample to be assayed, mouse
anti-human IgA or IgG can be a useful secondary antibody. A
combination of different antibodies, which can be useful in the
methods of the invention, also is encompassed within the meaning of
the term secondary antibody, provided that at least one antibody of
the combination reacts with an antibody that specifically binds an
I2 antigen.
[0062] The term class determining portion, when used in reference
to a secondary antibody, means the heavy chain constant-region
sequence of an antibody that determines the isotype, such as IgA,
IgD, IgE, IgG or IgM. Thus, a secondary antibody that has
specificity for the class determining portion of an IgA molecule,
for example, binds IgA in preference to other antibody
isotypes.
[0063] A secondary antibody useful in the invention can be obtained
commercially or by techniques well known in the art. Such an
antibody can be a polyclonal or a monoclonal antibody. For example,
IgA reactive polyclonal antibodies can be prepared using IgA or Fc
fragments of IgA as an immunogen to stimulate the production of
antibodies in the antisera of an animal such as a rabbit, goat,
sheep or rodent, as described in Harlow and Lane, Antibodies: A
Laboratory Manual New York: Cold Spring Harbor Laboratory (1988).
Monoclonal secondary antibodies, which are a population of antibody
molecules that contain only one species of idiotope capable of
binding a particular antigen epitope also can be produced by
routine methods (see, for example, Harlow and Lane, supra, 1988) or
obtained commercially.
[0064] The term "labeled secondary antibody" means a secondary
antibody, as defined above, that can be detected or measured by
analytical methods. Thus, the term labeled secondary antibody
includes an antibody labeled directly or indirectly with a
detectable marker that can be detected or measured and used in a
convenient assay such as an enzyme-linked immunosorbent assay
(ELISA), fluorescent assay, radioimmunoassay, radial
immunodiffusion assay or Western blotting assay. A secondary
antibody can be labeled, for example, with an enzyme, radioisotope,
fluorochrome or chemiluminescent marker. In addition, a secondary
antibody can be rendered detectable using a biotin-avidin linkage
such that a detectable marker is associated with the secondary
antibody. Labeling of the secondary antibody, however, should not
impair binding of the secondary antibody to the I2 antigen. If
desired, a multiple antibody system can be used as discussed above.
In such a system, at least one of the antibodies is capable of
binding the primary anti-I2 antibody and at least one of the
antibodies can be readily detected or measured by analytical
methods.
[0065] A secondary antibody can be rendered detectable by labeling
with an enzyme such as horseradish peroxidase (HRP), alkaline
phosphatase (AP), .beta.-galactosidase or urease, for example. A
horseradish-peroxidase detection system can be used, for example,
with the chromogenic substrate tetramethylbenzidine (TMB), which
yields a soluble product in the presence of hydrogen peroxide that
is detectable by measuring absorbance at 450 nm. An alkaline
phosphatase detection system can be used with the chromogenic
substrate p-nitrophenyl phosphate, for example, which yields a
soluble product readily detectable by measuring absorbance at 405
nm. Similarly, a .beta.-galactosidase detection system can be used
with the chromogenic substrate
o-nitrophenyl-.beta.-D-galactopyranoside (ONPG), which yields a
soluble product detectable by measuring absorbance at 410 nm, or a
urease detection system can be used with a substrate such as
urea-bromocresol purple (Sigma Immunochemicals, St. Louis, Mo.). A
secondary antibody can be linked to an enzyme by methods well known
in the art (Harlow and Lane, supra, 1988) or can be obtained from a
number of commercial sources. For example, goat F(ab')2 anti-human
IgA-alkaline phosphatase is a useful detectable secondary antibody
that can be purchased from Jackson Immuno-Research (West Grove,
Pa.).
[0066] A secondary antibody also can be rendered detectable by
labeling with a fluorochrome. Such a fluorochrome emits light of
ultraviolet or visible wavelength after excitation by light or
another energy source. DAPI, fluorescein, Hoechst 33258,
R-phycocyanin, B-phycoerythrin, R-phycoerythrin, rhodamine, Texas
red or lissamine are, without limitation, fluorochromes that can be
linked to a secondary antibody and used to detect the presence or
absence of a complex in a method of the invention. Methods of
conjugating and using these and other suitable fluorochromes are
described, for example, in Van Vunakis and Langone, Methods in
Enzymology, Volume 74, Part C (1991). A secondary antibody linked
to a fluorochrome also can be obtained from commercial sources. For
example, goat F(ab')2 anti-human IgA-FITC is available from Tago
Immunologicals (Burlingame, Calif.).
[0067] A secondary antibody also can be labeled with a
chemiluminescent marker. Such a chemiluminescent secondary antibody
is convenient for sensitive, non-radioactive detection of a complex
containing an I2 antigen and can be obtained commercially from
various sources such as Amersham Lifesciences, Inc. (Arlington
Heights, Ill.).
[0068] A secondary antibody further can be rendered detectable by
labeling with a radioisotope. For example, an iodine-125 labeled
secondary antibody is a useful detectable secondary antibody (see,
for example, Harlow and Lane, supra, 1988).
[0069] A signal from a detectable secondary antibody can be
analyzed, for example, using a spectrophotometer to detect color
from a chromogenic substrate; a fluorometer to detect fluorescence
in the presence of light of a certain wavelength; or a radiation
counter to detect radiation, such as a gamma counter for detection
of iodine-125. For detection of an enzyme-linked secondary
antibody, for example, a quantitative analysis can be made using a
spectrophotometer such as an EMAX Microplate Reader (Molecular
Devices; Menlo Park, Calif.) in accordance with the manufacturer's
instructions. If desired, the assays of the invention can be
automated or performed robotically, and the signal from multiple
samples can be detected simultaneously.
[0070] The assays of the present invention can be forward, reverse
or simultaneous as described in U.S. Pat. No. 4,376,110, issued
Mar. 8, 1983, to David et al. In the forward assay, each reagent is
sequentially contacted with an I2 antigen of the invention. If
desired, separation of bound from unbound reagent can be performed
before the addition of the next reagent. In a reverse assay, all
reagents are pre-mixed prior to contacting with I2 antigen. A
modified reverse assay is described in U.S. Pat. No. 4,778,751
issued Oct. 18, 1988, to El Shami et al. In a simultaneous assay,
all reagents are separately but contemporaneously contacted with an
I2 antigen of the invention. A reagent is any component useful in
performing the assays of the present invention, for example, the
sample, I2 antigen, detectable secondary antibody, washing buffer
or other solutions.
[0071] Separation steps for the various assay formats described
herein, including the removal of unbound secondary antibody from
the complex, can be performed by methods known in the art (Harlow
and Lane, supra, 1988). For example, washing with a suitable buffer
can be followed by filtration, aspiration or magnetic separation.
If the I2 antigen or an immunoreactive fragment thereof is
immobilized on a particulate support, such as on microparticles,
the particulate material can be centrifuged, if desired, followed
by removal of wash liquid. If the I2 antigen or an immunoreactive
fragment thereof is immobilized on a membrane, filter or well, a
vacuum or liquid absorbing apparatus can be applied to the opposite
side of the membrane, filter or well to draw the wash liquid away
from the complex.
[0072] Antibody based methods can also be useful for determining
the presence or absence of IgA anti-I2 antibodies,
anti-Saccharomyces cerevisiae antibodies or other antibodies such
as IgA anti-OmpC antibodies, and perinuclear anti-neutrophil
cytoplasmic antibodies. Such methods rely on anti-idiotypic
antibodies specific to the anti-I2 or other antibody of interest.
An anti-idiotypic antibody contains an internal image of the
antigen used to create the antibody of interest. Therefore, an
anti-idiotypic antibody can bind to an anti-I2 antibody or other
marker antibody of interest. Methods of making, selecting and using
anti-idiotype antibodies are well known in the art. See, for
example, Eichmann, et al., CRC Critical Reviews in Immunology
7:193-227 (1987).
[0073] A method of the invention for diagnosing or predicting
susceptibility to a clinical subtype of Crohn's disease in a
subject having Crohn's disease by determining the presence or
absence of IgA anti-I2 antibodies in the subject can optionally
include the additional step of determining the presence or absence
in the subject of a NOD2 variant, anti-Saccharomyces cerevisiae
antibodies, IgA anti-OmpC antibodies, or perinuclear
anti-neutrophil cytoplasmic antibodies (pANCA).
[0074] As used herein, the term "marker" means a serological,
genetic or other biochemical factor, the presence of which
correlates with a clinical subtype of Crohn's disease. Markers for
clinical subtypes of Crohn's disease include, without limitation,
IgA anti-I2 antibodies, NOD2 variants, anti-Saccharomyces
cerevisiae antibodies, IgA anti-OmpC antibodies, and perinuclear
anti-neutrophil cytoplasmic antibodies. As used herein, the term
"fibrostenotic marker" means a serological, genetic or other
biochemical factor, the presence of which correlates with the
fibrostenotic subtype of Crohn's disease. Non-limiting examples of
fibrostenotic markers useful in the invention include IgA anti-I2
antibodies; NOD2 variants such as R702W, G908R and 1007fs;
anti-Saccharomyces cerevisiae antibodies; anti-OmpC antibodies;
antibodies to other bacterial responsive antigens, and markers
associated with other types of fibrostenotic disease such as
fibrostenosis of the liver. As shown in Example I, the greater the
number of fibrostenotic markers that a subject possesses, the
greater the chance that the subject will have an aggressive form of
the fibrostenotic subtype of Crohn's disease requiring small bowel
surgery.
[0075] Several methods of the invention involve determining the
presence and magnitude of one or more markers such as IgA anti-I2
antibodies, ASCA and IgA anti-OmpC antibodies. One technique for
quantifying the magnitude of an antibody response is "quartile
analysis," in which each patient response is defined as in the
first quartile (0-25%); second quartile (25-50%); third quartile
(50-75%) or fourth quartile (75-100%) in relation to a reference
database of Crohn's disease patients. Such a fixed database
generally should include a large spectrum of Crohn's disease
patients and can be, for example, the 303 patient database
described herein. From such a database, quartile cut-offs are
established, for example, as described herein and shown in FIG. 7.
One skilled in the art further understands that quartile cut-offs
or other cut-offs further can be established using another large
Crohn's disease patient database such as, for example, quartile
cut-offs determined from sera from 500 known Crohn's disease
patients with mild to severe disease from a subspecialty practice
such as a gastroenterology practice or an exclusively inflammatory
bowel disease (IBD) practice in an academic or private setting.
[0076] A NOD2 variant is a fibrostenotic marker useful in the
methods of the invention. As used herein, the term "NOD2 variant"
means a nucleotide sequence of a NOD2 gene containing one or more
changes as compared to the wild-type NOD2 gene or an amino acid
sequence of a NOD2 polypeptide containing one or more changes as
compared to the wild-type NOD2 polypeptide sequence. NOD2, also
known as CARD15, has been localized to the IBD1 locus on chromosome
16 and identified by positional-cloning (Hugot et al., Nature
411:599-603 (2001)) as well as a positional candidate gene strategy
(Ogura et al., Nature 411:603-606 (2001), Hampe et al., Lancet
357:1925-1928 (2001)). The IBD1 locus has a high multipoint linkage
score (MLS) for inflammatory bowel disease (MLS=5.7 at marker
D16S411 in 16q12). See Cho et al., Inflamm. Bowel Dis. 3:186-190
(1997), Akolkar et al., Am. J. Gastroenterol. 96:1127-1132 (2001),
Ohmen et al., Hum. Mol. Genet. 5:1679-1683 (1996), Parkes et al.,
Lancet 348:1588 (1996), Cavanaugh et al., Ann. Hum. Gent. (1998),
Brant et al., Gastroenterology 115:1056-1061 (1998), Curran et al.,
Gastroenterology 115:1066-1071 (1998), Hampe et al., Am. J. Hum.
Genet. 64:808-816 (1999), and Annese et al., Eur. J. Hum. Genet.
7:567-573 (1999).
[0077] The sequence of the human NOD2 gene can be found in GenBank
as accession number NM.sub.--022162. In addition, the complete
sequence of human chromosome 16 clone RP11-327F22, which includes
NOD2, can be found in GenBank as accession number AC007728.
Furthermore, the sequence of NOD2 from other species can be found
in the GenBank database. A schematic of the NOD2 locus is shown in
FIG. 2A.
[0078] The NOD2 protein contains amino-terminal caspase recruitment
domains (CARDs), which can activate NF-kappa B (NF-kB), and several
carboxy-terminal leucine-rich repeat domains (Ogura et al, J. Biol.
Chem. 276:4812-4818 (2001)). NOD2 has structural homology with the
apoptosis regulator Apaf-1/CED-4 and a class of plant disease
resistant gene products (Ogura et al., supra, 2001). Similar to
plant disease resistant gene products, NOD2 has an amino-terminal
effector domain, a nucleotide-binding domain and leucine rich
repeats (LRRs). Wild-type NOD2 activates nuclear factor NF-kappa B,
making it responsive to bacterial lipopolysaccharides (LPS; Ogura
et al., supra, 2001; Inohara et al., J. Biol. Chem. 276:2551-2554
(2001). NOD2 can function as an intercellular receptor for LPS,
with the leucine rich repeats required for responsiveness. Three
single nucleotide polymorphisms in the coding region of NOD2 have
been previously described. These three SNPs, designated R702W,
G908R and 1007fs, are located in the carboxy-terminal region of the
NOD2 gene (Hugot et al., supra, 2001).
[0079] In one embodiment, a NOD2 variant is located in a coding
region of the NOD2 locus, for example, within a region encoding
several leucine-rich repeats in the carboxy-terminal portion of the
NOD2 polypeptide. Such NOD2 variants located in the leucine-rich
repeat region of NOD2 include, without limitation, R702W and G908R.
A NOD2 variant useful in the invention also can encode a NOD2
polypeptide with reduced ability to activate NF-kappa B as compared
to NF-kappa B activation by a wild-type NOD2 polypeptide. As an
example, the NOD2 variant 1007fs results in a truncated NOD2
polypeptide which has reduced ability to induce NF-kappa B in
response to LPS stimulation (Ogura et al., Nature 411:603-606
(2001)).
[0080] A NOD2 variant useful in the invention can be, for example,
R702W, G908R, or 1007fs. R702W, G908R, and 1007fs are located
within the coding region of NOD2 as shown in FIG. 2A. In one
embodiment, a method of the invention is practiced with the R702W
NOD2 variant. As used herein, the term "R702W" means a single
nucleotide polymorphism within exon 4 in the NOD2 gene, which
occurs within a triplet encoding amino acid 702 of the NOD2
protein. The wild-type NOD2 allele contains a cytosine (c) residue
at position 138,991 of the AC007728 sequence, which occurs within a
triplet encoding an arginine at amino acid702. The R702W NOD2
variant contains a thymine (t) residue at position 138,991 of the
AC007728 sequence, resulting in an arginine (R) to tryptophan (W)
substitution at amino acid 702 of the NOD2 protein. Accordingly,
this NOD2 variant is denoted "R702W" or "702W" and can also be
denoted "R675W" based on the earlier numbering system of Hugot et
al., supra, 2001. In addition, the R702W variant is also known as
the SNP8 allele or a "2" allele at SNP 8. The NCBI SNP ID number
for R702W or SNP 8 is rs2066844. As disclosed herein and described
further below, the presence of the R702W NOD2 variant and other
NOD2 variants can be conveniently detected, for example, by allelic
discrimination assays or sequence analysis. Primers and probes
specific for the R702W NOD2 variant can be found in Tables 1 and 2
in ExampleIV and in FIG. 2B.
[0081] A method of the invention also can be practiced with the
G908R NOD2 variant. As used herein, the term "G908R" means a single
nucleotide polymorphism within exon 8 in the NOD2 gene, which
occurs within a triplet encoding amino acid 908 of the NOD2 protein
(see FIG. 2C). Amino acid 908 is located within the leucine rich
repeat region of the NOD2 gene. The wild-type NOD2 allele contains
a guanine (g) residue at position 128,377 of the AC007728 sequence,
which occurs within a triplet encoding glycine at amino acid 908.
The G908R NOD2 variant contains a cytosine (c) residue at position
128,377 of the AC007728 sequence, resulting in a glycine (G) to
arginine (R) substitution at amino acid 908 of the NOD2 protein.
Accordingly, this NOD2 variant is denoted "G908R" or "908R" and can
also be denoted "G881R" based on the earlier numbering system of
Hugot et al., supra, 2001. In addition, the G908R variant is also
known as the SNP 12 allele or a "2" allele at SNP12. The NCBI SNP
ID number for G908R SNP12 is rs2066845. Primers and probes specific
for the G908R NOD2 variant can be found in Tables 1 and 2 in
Example IV and in FIG. 2C.
[0082] A method of the invention also can be practiced with the
1007fs NOD2 variant. This variant is an insertion of a single
nucleotide that results in a frame shift in the tenth leucine-rich
repeat of the NOD2 protein and is followed by a premature stop
codon. The resulting truncation of the NOD2 protein appears to
prevent activation of NF-kappaB in response to bacterial
lipopolysaccharides (Ogura et al., supra, 2001). As used herein,
the term "1007fs" means a single nucleotide polymorphism within
exon 11 in the NOD2 gene, which occurs in a triplet encoding amino
acid 1007 of the NOD2 protein. The 1007fs variant contains a
cytosine which has been added at position 121,139 of the AC007728
sequence, resulting in a frame shift mutation at amino acid 1007.
Accordingly, this NOD2 variant is denoted "1007fs" and can also be
denoted "3020insC," or "980fs" based on the earlier numbering
system of Hugot et al., supra, 2001. In addition, the 1007fs NOD2
variant is also known as the SNP 13 allele or a "2" allele at SNP
13. The NCBI SNP ID number for 1007fs or SNP 13 is rs2066847.
Primers and probes specific for the 1007fs NOD2 variant can be
found in Tables 1 and 2 in Example IV and in FIG. 2D.
[0083] One skilled in the art recognizes that a particular NOD2
variant or other polymorphic allele can be conveniently defined,
for example, in comparison to a Centre d'Etude du Polymorphisme
Humain (CEPH) reference individual such as the individual
designated 1347-02 (Dib et al., Nature 380:152-154 (1996)), using
commercially available reference DNA obtained, for example, from PE
Biosystems (Foster City, Calif.). In addition, specific information
on SNPs can be obtained from the dbSNP of the National Center for
Biotechnology Information (NCBI).
[0084] A NOD2 variant also can be located in a non-coding region of
the NOD2 locus. Non-coding regions include, for example, intron
sequences as well as 5' and 3' untranslated sequences. A
non-limiting example of a NOD2 variant located in a non-coding
region of the NOD2 gene is the JW1 variant, which is described in
Sugimura et al., Am. J. Hum. Genet. 72:509-518 (2003). It is
understood that the methods of the invention can be practiced with
JW1 or other NOD2 variants located in a non-coding region of the
NOD2 locus, such as an intron or promoter region of the NOD2 locus.
It is further understood that the methods of the invention can
involve determining the presence of one, two, three, four or more
NOD2 variants, including, but not limited to, the R702W, G908R,
1007fs, JW1 and other coding and non-coding region variants.
[0085] A variety of means can be useful for determining the
presence or absence of a NOD2 variant in a method of the invention.
Since a NOD2 variant can be a nucleotide sequence of a NOD2 gene
containing one or more changes as compared to the wild-type NOD2
gene or an amino acid sequence of an NOD2 polypeptide containing
one or more changes as compared to the wild-type NOD2 polypeptide
sequence, genetic, serological and other biochemical methods can be
useful. As an example, enzymatic amplification of nucleic acid from
a subject can be conveniently used to obtain nucleic acid for
subsequent genetic analysis. The presence or absence of a NOD2
variant also can be determined directly from the individual's
nucleic acid without enzymatic amplification. Analysis of nucleic
acid from a subject, whether amplified or not, can be performed
using any of various techniques, including, without limitation,
polymerase chain reaction based analysis, sequence analysis and
electrophoretic analysis. Techniques can be used alone or in
combination.
[0086] The presence or absence of a NOD2 variant or another genetic
marker can involve amplification of an individual's nucleic acid by
the polymerase chain reaction. The nucleic acid to be amplified can
be a single- or double-stranded DNA or RNA molecule, including, for
example, genomic DNA, cDNA and mRNA. Use of the polymerase chain
reaction for amplification of nucleic acids is well known in the
art (see, for example, Mullis et al. (Eds.), The Polymerase Chain
Reaction, Birkhuser, Boston, (1994)). Polymerase chain reaction
amplification for determining the presence of a NOD2 variant or
other genetic marker can be performed, if desired, using one or
more fluorescently labeled primers, or using one or more labeled or
unlabeled primers that contain a DNA minor grove binder, as in the
Taqman.RTM. assay described below.
[0087] Any of a variety of different primers can be used to amplify
an individual's nucleic acid by the polymerase chain reaction in
order to determine the presence or absence of a NOD2 variant or
other genetic marker in a method of the invention. For example, the
PCR primers listed in Table 1 (SEQ ID NOS:11-16) can be used to
amplify specific regions of the NOD2 locus. As non-limiting
examples, the region surrounding R702W can be amplified using SEQ
ID NO: 11 and 12; G908R can be amplified using SEQ ID NOS: 13 and
14, and the region surrounding 1007fs can be amplified using SEQ ID
NOS: 15 and 16. As understood by one skilled in the art, additional
primers for PCR analysis can be designed based on the sequence
flanking the NOD2 or other region of interest. Such primers
generally contain about 12 to 30 nucleotides of a sequence upstream
or downstream of the region of interest and are generally designed
to have sufficient guanine and cytosine content to attain a high
melting temperature which allows for a stable annealing step in the
amplification reaction. Several computer programs, such as Primer
Select, are available to aid in the design of PCR primers.
[0088] A Taqman.RTM. allelic discrimination assay available from
Applied Biosystems can be useful for determining the presence or
absence of a NOD2 variant or other genetic marker in a method of
the invention. In a Taqman.RTM. allelic discrimination assay, a
specific, fluorescent, dye-labeled probe for each allele is
constructed. Each probe contains a different fluorescent reporter
dye such as FAM or VICTM to differentiate the amplification of each
allele. In addition, each probe has a quencher dye at one end which
reduces fluorescence by fluorescence resonance energy transfer
(FRET). During PCR, each probe anneals specifically to
complementary sequences in the nucleic acid from the individual.
The 5' nuclease activity of Taq polymerase is used to cleave only
probe that specifically hybridizes to the allele. Cleavage
separates the reporter dye from the quencher dye, resulting in
increased fluorescence by the reporter dye. Thus, the fluorescence
signal generated by PCR amplification indicates which alleles are
present in the sample. Mismatches between a probe and allele reduce
the efficiency of both probe hybridization and cleavage by Taq
polymerase, resulting in little to no fluorescent signal. It is
understood that improved specificity in allelic discrimination
assays can be achieved by conjugating a DNA minor grove binder
(MGB) group to a DNA probe as described, for example, in Kutyavin
et al., Nucleic Acids Research 28:655-661 (2000). Minor grove
binders include, but are not limited to, compounds such as
dihydrocyclopyrroloindole tripeptide (DPI3).
[0089] Sequence analysis also can be useful for determining the
presence or absence of a NOD2 variant or other genetic marker in a
method of the invention. A NOD2 variant can be detected by sequence
analysis using primers disclosed herein, for example, the PCR
primers listed in Table 1 (SEQ ID NOS:11-16). As understood by one
skilled in the art, additional primers for sequence analysis can be
designed based on the sequence flanking the NOD2 region of
interest. As a non-limiting example, a sequence primer can contain
about 15 to 30 nucleotides of a sequence about 40 to 400 base pairs
upstream or downstream of the region of interest. Such sequencing
primers are generally designed to have sufficient guanine and
cytosine content to attain a high melting temperature which allows
for a stable annealing step in the sequencing reaction.
[0090] Sequence analysis refers to any manual or automated process
by which the order of nucleotides in the nucleic acid is
determined. As an example, sequence analysis can be used to
determine the nucleotide sequence of a sample of DNA. The term
sequence analysis encompasses, without limitation, chemical and
enzymatic methods such as dideoxy enzymatic methods including, for
example, Maxam-Gilbert and Sanger sequencing as well as variations
thereof. The term sequence analysis further encompasses, but is not
limited to, capillary array DNA sequencing, which relies on
capillary electrophoresis and laser-induced fluorescence detection
and can be performed using instruments such as the MegaBACE 1000 or
ABI3700. As additional non-limiting examples, the term sequence
analysis encompasses thermal cycle sequencing (Sears et al.,
Biotechniques 13:626-633 (1992)); solid-phase sequencing (Zimmerman
et al., Methods Mol. Cell Biol. 3:39-42 (1992); and sequencing with
mass spectrometry such as matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry MALDI-TOF MS
(Fu et al., Nature Biotech. 16:381-384 (1998)). The term sequence
analysis also includes, yet is not limited to, sequencing by
hybridization (SBH), which relies on an array of all possible short
oligonucleotides to identify a segment of sequences present in an
unknown DNA (Chee et al., Science 274:610-614 (1996); Drmanac et
al., Science 260:1649-1652 (1993); and Drmanac et al., Nature
Biotech. 16:54-58 (1998)). One skilled in the art understands that
these and additional variations are encompassed by the term
sequence analysis as defined herein. See, in general, Ausubel et
al., supra, Chapter 7 and supplement 47.
[0091] Genetic methods for determining the presence or absence of a
NOD2 variant or other genetic marker utilize a subject's biological
matter from which nucleic acid can be prepared. As non-limiting
examples, a subject's biological matter can be whole blood, plasma,
saliva, cheek swab, or other bodily fluid or tissue that contains
nucleic acid. In one embodiment, detecting the presence or absence
of a NOD2 variant or other genetic marker is practiced with whole
blood, which can be obtained readily by non-invasive means and used
to prepare genomic DNA, for example, for enzymatic amplification or
automated sequencing. In another embodiment, detecting the presence
or absence of a NOD2 variant or other genetic marker is practiced
with tissue obtained from an individual such as tissue obtained
during surgery or biopsy procedures.
[0092] Electrophoretic analysis also can be useful in the methods
of the invention. Elecrophoretic analysis, as used herein in
reference to one or more nucleic acids such as amplified fragments,
means a process whereby charged molecules are moved through a
stationary medium under the influence of an electric field.
Electrophoretic migration separates nucleic acids primarily on the
basis of their charge, which is in proportion to their size, with
smaller molecules migrating more quickly. The term electrophoretic
analysis includes, without limitation, analysis using slab gel
electrophoresis, such as agarose or polyacrylamide gel
electrophoresis, or capillary electrophoresis. Capillary
electrophoretic analysis generally occurs inside a small-diameter
(50-100 m) quartz capillary in the presence of high
(kilovolt-level) separating voltages with separation times of a few
minutes. Using capillary electrophoretic analysis, nucleic acids
are conveniently detected by UV absorption or fluorescent labeling,
and single-base resolution can be obtained on fragments up to
several hundred base pairs. Such methods of electrophoretic
analysis, and variations thereof, are well known in the art, as
described, for example, in Ausubel et al., Current Protocols in
Molecular Biology Chapter 2 (Supplement 45) John Wiley & Sons,
Inc. New York (1999).
[0093] Restriction fragment length polymorphism (RFLP) analysis
also can be useful for determining the presence or absence of a
NOD2 variant or other genetic marker in a method of the invention
(Jarcho et al. in Dracopoli et al., Current Protocols in Human
Genetics pages 2.7.1-2.7.5, John Wiley & Sons, New York; Innis
et al.,(Ed.), PCR Protocols, San Diego: Academic Press, Inc.
(1990)). As used herein, restriction fragment length polymorphism
analysis is any method for distinguishing genetic polymorphisms
using a restriction enzyme, which is an endonuclease that catalyzes
the degradation of nucleic acid and recognizes a specific base
sequence, generally a palindrome or inverted repeat. One skilled in
the art understands that the use of RFLP analysis depends upon an
enzyme that can differentiate two alleles at a polymorphic
site.
[0094] Allele-specific oligonucleotide hybridization also can be
used to detect the presence or absence of a NOD2 variant or other
genetic marker. Allele-specific oligonucleotide hybridization is
based on the use of a labeled oligonucleotide probe having a
sequence perfectly complementary, for example, to the sequence
encompassing a NOD2 variant. Under appropriate conditions, the
allele-specific probe hybridizes to a nucleic acid containing the
NOD2 variant but does not hybridize to the one or more other
alleles, which have one or more nucleotide mismatches as compared
to the probe. If desired, a second allele-specific oligonucleotide
probe that matches an alternate allele also can be used. Similarly,
the technique of allele-specific oligonucleotide amplification can
be used to selectively amplify, for example, a NOD2 variant by
using an allele-specific oligonucleotide primer that is perfectly
complementary to the nucleotide sequence of the NOD2 variant but
which has one or more mismatches as compared to other alleles
(Mullis et al., supra, 1994). One skilled in the art understands
that the one or more nucleotide mismatches that distinguish between
the NOD2 variant and one or more other alleles are often located in
the center of an allele-specific oligonucleotide primer to be used
in allele-specific oligonucleotide hybridization. In contrast, an
allele-specific oligonucleotide primer to be used in PCR
amplification generally contains the one or more nucleotide
mismatches that distinguish between the subtype-associated and
other alleles at the 3' end of the primer.
[0095] A heteroduplex mobility assay (HMA) is another well known
assay that can be used to detect the presence or absence of a NOD2
variant or other genetic marker in a method of the invention. HMA
is useful for detecting the presence of a polymorphic sequence
since a DNA duplex carrying a mismatch has reduced mobility in a
polyacrylamide gel compared to the mobility of a perfectly
base-paired duplex (Delwart et al., Science 262:1257-1261 (1993);
White et al., Genomics 12:301-306 (1992)).
[0096] The technique of single strand conformational polymorphism
(SSCP) also can be used to detect the presence or absence of a NOD2
variant or other genetic marker in a method of the invention (see
Hayashi, Methods Applic. 1:34-38 (1991)). This technique is used to
detect mutations based on differences in the secondary structure of
single-strand DNA that produce an altered electrophoretic mobility
upon non-denaturing gel electrophoresis. Polymorphic fragments are
detected by comparison of the electrophoretic pattern of the test
fragment to corresponding standard fragments containing known
alleles.
[0097] Denaturing gradient gel electrophoresis (DGGE) also can be
used to detect a NOD2 variant or other genetic marker in a method
of the invention. In DGGE, double-stranded DNA is electrophoresed
in a gel containing an increasing concentration of denaturant;
double-stranded fragments made up of mismatched alleles have
segments that melt more rapidly, causing such fragments to migrate
differently as compared to perfectly complementary sequences
(Sheffield et al., "Identifying DNA Polymorphisms by Denaturing
Gradient Gel Electrophoresis" in Innis et al., supra, 1990).
[0098] Other molecular methods useful for determining the presence
or absence of a NOD2 variant or other genetic marker are known in
the art and useful in the methods of the invention. Other
well-known approaches for determining the presence or absence of a
NOD2 variant include, without limitation, automated sequencing and
RNAase mismatch techniques (Winter et al., Proc. Natl. Acad. Sci.
82:7575-7579 (1985)). Furthermore, one skilled in the art
understands that, where the presence or absence of multiple NOD2
variants is to be determined, individual NOD2 variants can be
detected by the same or any combination of molecular methods. See,
in general, Birren et al. (Eds.) Genome Analysis: A Laboratory
Manual Volume 1 (Analyzing DNA) New York, Cold Spring Harbor
Laboratory Press (1997). In addition, one skilled in the art
understands that multiple NOD2 variants or other genetic markers
can be detected in individual reactions or in a single reaction (a
"multiplex" assay). In view of the above, one skilled in the art
realizes that the methods of the invention for diagnosing or
predicting susceptibility to a clinical subtype of Crohn's disease,
such as the fibrostenotic subtype, can be practiced using one or
any combination of the well known assays described above or known
in the art.
[0099] Antibody based methods also can be useful for determining
the presence or absence of a NOD2 variant in a method of the
invention. As an example, an antibody that is specifically reactive
with a NOD2 variant polypeptide or fragment thereof can be used to
detect the presence or absence of that NOD2 variant in an
individual. Such an antibody can be, for example, specifically
reactive with the truncated version of NOD2 generated by the 1007fs
NOD2 variant but not reactive with full-length or wild type
NOD2.
[0100] Antibodies useful in the methods of the invention include,
without limitation, monoclonal and polyclonal antibodies, single
chain antibodies, chimeric antibodies, bifunctional or bispecific
antibodies, humanized antibodies, human antibodies, and
complementary determining region (CDR)-grafted antibodies,
including compounds which include CDR or antigen-binding sequences,
which differentially bind to a polypeptide or fragment encoded by a
NOD2 variant but not to other non-variant sequences. Antibody
fragments, including Fab, Fab', F(ab')2, and Fv, also can be useful
in the methods of the invention as can plastic antibodies or
molecularly imprinted polymers (MIPs; Haupt and Mosbauch, Trends in
Biotech. 16:468-475 (1998)). Screening assays to determine
differential binding specificity of an antibody are well known in
the art (see Harlow et al. (Eds), Antibodies: A Laboratory Manual;
Cold Spring Harbor Laboratory; Cold Spring Harbor, N.Y.
(1988)).
[0101] Antibodies useful in a method of the invention can be
produced using any method well known in the art, using a
polypeptide, or immunogenic fragment thereof, encoded by a NOD2
variant. Immunogenic polypeptides or fragments can be isolated, for
example, from natural sources or recombinant host cells, or can be
chemically synthesized. Methods for synthesizing such peptides are
known in the art as described, for example, in Merrifield, J. Amer.
Chem. Soc. 85:2149-2154 (1963), and Krstenansky et al., FEBS Lett.
211:10 (1987).
[0102] Antibodies that differentially bind to NOD2 variants of the
invention can be labeled with a detectable label and used to detect
the presence, absence or amount of the encoded polypeptide in vivo,
in vitro, or in situ. A moiety, such as a fluorescent molecule, can
be linked to an antibody for use in a method of the invention
using, for example, carbodiimide conjugation (Bauminger and
Wilchek, Meth. Enzymol. 70:151-159 (1980)).
[0103] In a method of the invention, antibodies that differentially
bind to a NOD2 variant can be used in immunoassays to determine the
presence or absence of a NOD2 variant in a subject having Crohn's
disease. Immunoassays include, without limitation,
radioimmunoassays, enzyme-linked immunosorbent assays (ELISAs) and
immunoassays with fluorescently labeled antibodies, which are well
known in the art. Antibodies can also be used to detect the
presence or absence of a NOD2 variant or other fibrostenotic marker
in a cell or tissue using immunohistochemistry or other in situ
assays. Furthermore, cells containing a polypeptide of interest
either on the surface of the cell or internally can be detected by
an antibody using assays such as fluorescence activated cell
sorting (FACS). One skilled in the art understands that these and
other routine assays can be useful for determining the presence or
absence of a NOD2 variant according to a method of the
invention.
[0104] Antibodies can be used to detect the presence or absence of
a polypeptide of interest, such as IgA anti-I2 antibodies, an NOD2
variant, anti-Saccharomyces cerevisiae antibodies, IgA anti-OmpC
antibodies, and perinuclear anti-neutrophil cytoplasmic antibodies,
for example, directly from a blood sample. One skilled in the art
understands that when the presence or absence of multiple markers
is determined, the same or a different sample can be used.
[0105] As disclosed above, the invention provides a method of
diagnosing or predicting susceptibility to a clinical subtype of
Crohn's disease in a subject having Crohn's disease by determining
the presence or absence of IgA anti-I2 antibodies in the subject
and optionally determining the presence or absence in the subject
of anti-Saccharomyces cerevisiae antibodies (ASCA).
[0106] Anti-Saccharomyces cerevisiae antibodies (ASCA) are a
fibrostenotic marker useful in the invention. As disclosed herein,
the presence of ASCA can be used to diagnose or predict
susceptibility to a fibrostenotic subtype of Crohn's disease in a
subject having Crohn's disease (see Example I). The presence of
ASCA can be determined by well known methods such as by reactivity
with purified yeast cell wall phosphopeptidomannan (PPM), which can
be prepared, for example, from ATCC strain #38926. Methods for
determining the presence of ASCA are exemplified herein in Example
III. As used herein, "ASCA" means antibody reactivity against S.
cerevisiae that is greater than the reactivity observed with
control (normal subject) sera analyzed under the same
conditions.
[0107] Anti-Saccharomyces cerevisiae antibodies (ASCA) are
characteristically elevated in patients having Crohn's disease
although the nature of the S. cerevisiae antigen supporting the
specific antibody response in Crohn's disease is unknown (Sendid et
al., Clin. Diag. Lab. Immunol., 3:219-226 (1996)). These antibodies
may represent a response against yeasts present in common food or
drink or a response against yeasts that colonize the
gastrointestinal tract. Studies with periodate oxidation have shown
that the epitopes recognized by ASCA in Crohn's disease patient
sera contain polysaccharides. Oligomannosidic epitopes are shared
by a variety of organisms including different yeast strains and
genera, filamentous fungi, viruses, bacteria and human
glycoproteins. Thus, the mannose-induced antibody responses in
Crohn's disease may represent a response against a pathogenic yeast
organism or may represent a response against a cross-reactive
oligomannosidic epitope present, for example, on a human
glycoprotein autoantigen. Regardless of the nature of the antigen,
elevated levels of serum ASCA are a differential marker for Crohn's
disease, with only low levels of ASCA reported in UC patients
(Sendid et al., supra, 1996). Using multiple regression analysis,
higher ASCA levels in subjects with Crohn's disease were shown to
be independently associated with early age of disease onset as well
as both fibrostenosing and internal penetrating disease behaviors
(Vasiliauskas et al., Gut 47:487-497 (2000)).
[0108] The presence or absence of ASCA can be determined using an
antigen specific for ASCA, which is any antigen or mixture of
antigens that is bound specifically by ASCA. Although ASCA
antibodies were initially characterized by their ability to bind S.
cerevisiae, those of skill in the art will understand that an
antigen specific for ASCA can be obtained from S. cerevisiae, or
can be obtained from a variety of other sources so long as the
antigen is capable of binding specifically to ASCA antibodies.
Accordingly, exemplary sources of an antigen specific for ASCA
contemplated for use in the methods of the invention include whole
killed yeast cells, such as from the genera Saccharomyces and
Candida, yeast cell wall phosphopeptidomannan (PPM),
oligomannosides, neoglycolipids, anti-ASCA idiotypic antibodies,
and the like. As described above, different species and strains of
yeast, including Saccharomyces, can be used as an antigen specific
for ASCA in the methods provided herein. For example, S. cerevisiae
strain Su1, Su2, CBS 1315 or BM 156, or Candida albicans strain
VW32, can be used as an antigen specific for ASCA in the methods of
the invention.
[0109] Preparations of yeast cell wall mannans, or
phosphopeptidomannans (PPM), are also contemplated herein as
antigens specific for ASCA. These water soluble surface antigens
can be prepared by appropriate extraction techniques, including
autoclaving as described in ExampleIII or can be obtained
commercially (see Lindberg et al., Gut 33:909-913 (1992)). The acid
stable fraction of yeast cell wall PPM also can be useful in the
methods of the invention (Sendid et al., supra, 1996). An exemplary
PPM for use in diagnosing clinical subtypes of Crohn's disease is
derived from S. cerevisiae strain ATCC #38926.
[0110] Purified oligosaccharide antigens, such as oligomannosides
specific for ASCA, also are contemplated for use in determining the
presence or absence of ASCA in the methods of the invention.
Purified oligomannoside antigens can be converted, if desired, into
neoglycolipids as described in Faille et al., Eur. J. Microbiol.
Infect. Dis. 11:438-446 (1992). One skilled in the art understands
that the reactivity of such an oligomannoside antigen with ASCA can
be optimized by varying the mannosyl chain length (Frosh et al.,
Proc. Natl. Acad. Sci. USA 82:1194-1198 (1985)); the anomeric
configuration (Fukazawa et al., In E. Kurstak (ed.), Immunology of
Fungal Disease, Marcel Dekker Inc., New York, pp. 37-62 (1989);
Nishikawa et al, Microbiol. Immunol. 34:825-840 (1990); Poulain et
al., Eur. J. Clin. Microbiol. 23:46-52 (1993); Shibata et al.,
Arch. Biochem. Biophys. 243:338-348 (1985); and Trinel et al.,
Infect. Immun. 60:3845-3851 (1992)); or the position of the linkage
(Kikuchi et al., Planta 190:525-535 (1993)).
[0111] An oligomannoside antigen specific for ASCA can include the
mannotetraose Man(13)Man(12)Man(12)Man, and can be purified from
PMM as described in Faille et al., supra, 1992. An exemplary
neoglycolipid for use in the methods of the invention can be
constructed by releasing the oligomannoside from its respective PPM
and subsequently coupling the released oligomannoside to
4-hexadecylaniline or the like. These and other antigens specific
for ASCA can be used in determining the presence or absence of ASCA
in the methods of the invention.
[0112] IgA anti-OmpC antibodies are another marker useful for
determining a clinical subtype of Crohn's disease in a method of
the invention. IgA anti-OmpC antibodies are associated with the
fibrostenotic subtype, need for small bowel surgery, and internal
perforating disease subtype, and can be independently associated
with the internal perforating disease subtype. Provided herein is a
method of diagnosing or predicting susceptibility to a clinical
subtype of Crohn's disease in a subject having Crohn's disease by
determining the presence or absence of IgA anti-OmpC antibodies in
the subject, where the presence of IgA anti-OmpC antibodies
indicates that the subject has a clinical subtype of Crohn's
disease. In one embodiment, the clinical subtype of Crohn's disease
is the fibrostenotic subtype. In another embodiment, the clinical
subtype of Crohn's disease is the internal perforating disease
subtype.
[0113] The presence of IgA anti-OmpC antibodies in a subject can
indicate that the subject has a fibrostenotic subtype of Crohn's
disease. In some cases, the presence of IgA anti-OmpC antibodies
can correlate with the presence of ASCA. In some embodiments, the
presence of IgA anti-OmpC antibodies and ASCA are determined, while
in other embodiments the presence of IgA anti-OmpC antibodies can
be used as a surrogate marker for the presence of ASCA.
[0114] The outer-membrane protein C (OmpC) is a porin, a class of
transmembrane proteins that are found in the outer membranes of
bacteria, including gram-negative enteric bacteria such as E. coli.
The porins in the outer membrane of an E. coli cell provide
channels for passage of disaccharides, phosphate and similar
molecules. Porins can be trimers of identical subunits arranged to
form a barrel-shaped structure with a pore at the center (Lodish et
al., Molecular Cell Biology, Chapter 14 (1995)).
[0115] OmpC is one of the major porin proteins found in the outer
membranes of bacteria such as E. coli. An OmpC antigen can be
prepared, for example, from an encoding nucleic acid sequence such
as that available as GenBank accession K00541 or as shown in FIG.
3A by methods well known in the art (see, for example, Ausubel et
al., Current Protocols in Molecular Biology John Wiley & Sons,
Inc. New York (1999)). OmpC is similar in structure and function to
outer-membrane protein F ("OmpF"). Both assemble as trimers in the
outer membrane to form aqueous channels that allow the passive
diffusion of small, hydrophilic molecules across the hydrophobic
barrier. However, OmpC pores have a diameter of 1.1 nm, while OmpF
pores have a diameter of 1.2 nm. This difference results in a
slower rate of diffusion through the OmpC pores than through the
OmpF pores.
[0116] Porin expression can be influenced by environmental
conditions, including osmolarity, temperature, growth phase and
toxin concentration. For example, in the intestine, where both
nutrient and toxic molecule concentrations are relatively high,
OmpC, with a smaller pore diameter, is the predominant porin (Pratt
et al., Mol. Micro., 20:911-917 (1996)).
[0117] The methods of the invention relate to determining the
presence or absence of IgA anti-OmpC antibodies in a subject having
Crohn's disease. As used herein, the term "IgA anti-OmpC
antibodies" means IgA reactivity against an OmpC antigen that is
greater than two standard deviations above the mean IgA anti-OmpC
reactivity of control (normal) sera analyzed under the same
conditions. Detection of IgA anti-OmpC antibodies using an ELISA is
described herein in Example V.
[0118] Another marker useful in the invention is perinuclear
anti-neutrophil cytoplasmic antibodies (pANCA). Previous studies
have shown pANCA reactivity in a small portion of patients with
Crohn's disease, although these antibodies are elevated more
frequently in patients with ulcerative colitis. The reported
prevalence in Crohn's disease varies from 0 to 43%, with most
studies reporting that 10 to 30% of Crohn's disease patients
express PANCA (see, for example, Saxon et al., J. Allergy Clin.
Immunol. 86:202-210 (1990); Cambridge et al., Gut 33:668-674
(1992); Pool et al., Gut 3446-50 (1993); and Brokroelofs et al.,
Dig. Dis. Sci. 39:545-549 (1994). In subjects with Crohn's disease,
serum pANCA expression characterizes a UC-like clinical phenotype
of the disease (Vasiliauskas et al., Gastroenterology 110:1810-1819
(1996)).
[0119] A method of the invention involves determining the presence
or absence of I2 antibodies and optionally determining in a subtype
having Crohn's disease, the presence or absence of PANCA in the
subject, for example, by reactivity with fixed neutrophil. As used
herein, the term "perinuclear anti-neutrophil cytoplasmic antibody"
is synonymous with "PANCA" and refers to an antibody that reacts
specifically with a neutrophil to give perinuclear to nuclear
staining or cytoplasmic staining with perinuclear highlighting. A
method for determining the presence of pANCA in a subject is
exemplified herein in Example VI.
[0120] In one embodiment, the invention provides a method of
diagnosing or predicting susceptibility to a fibrostenotic subtype
of Crohn's disease in a subject having Crohn's disease by
determining the presence or absence of IgA anti-I2 antibodies in
the subject, and further determining the presence or absence in the
subject of one or more fibrostenotic markers such as a NOD2
variant, anti-Saccharomyces cerevisiae antibodies (ASCA), or
anti-OmpC antibodies, where the presence of IgA anti-I2 antibodies
or the presence of one of the fibrostenotic markers each
independently indicates that the subject has the fibrostenotic
subtype of Crohn's disease.
[0121] The term "independently" means that the presence of IgA
anti-I2 antibodies alone or the presence of one of the
fibrostenotic markers alone is sufficient to indicate that the
subject has the fibrostenotic subtype of Crohn's disease. As shown
in Example I, the presence of IgA anti-I2 antibodies alone
indicated that a subject was more likely to have a fibrostenotic
subtype of Crohn's disease than those not expressing IgA anti-I2
antibodies (71.4% vs. 43.3%, p<0.001) and significantly more
likely to require small bowel surgery (66.7% vs. 37.1%,
p<0.001). In addition, as shown in Example I, conditional
analysis performed on NOD2 variants and ASCA indicated that IgA
anti-I2 antibodies were independently associated with the
fibrostenotic subtype (p=0.001 and p=0.005 respectively).
Similarly, IgA anti-I2 antibodies were independently associated
with small bowel surgery when conditioned on NOD2 variation
(p=0.001) or ASCA (p=0.002) (see Example I).
[0122] As disclosed herein in Example I, combinations of markers
can be diagnostic for a subtype of Crohn's disease. For example,
the invention provides a method of diagnosing or predicting
susceptibility to a fibrostenotic subtype of Crohn's disease in a
subject having Crohn's disease by determining the presence or
absence of IgA anti-I2 antibodies in the subject, and further
determining the presence or absence of a NOD2 variant in the
subject, where the combined presence of IgA anti-I2 antibodies and
a NOD2 variant in the subject indicates that the subject has the
fibrostenotic subtype of Crohn's disease. In one embodiment, the
combined presence of the IgA anti-I2 antibodies and the NOD2
variant in the subject is associated with the fibrostenotic subtype
of Crohn's disease with an odds ratio of at least 6.
[0123] The strength of an association between one or more markers
and a clinical subtype of Crohn's disease can be characterized by a
particular odds ratio such as an odds ratio of at least 6. Such an
odds ratio can be, for example, at least 6.5, 7.0, 8.0, 9.0 or
greater. For example, subjects with three markers such as IgA
anti-I2 antibodies, NOD2 variation, and ASCA showed the greatest
risk of the fibrostenotic subtype of Crohn's disease (82%, odds
Ratio=9.7, p<0.000001) compared with subjects with two markers
(74%, odds Ratio=6.0), one marker (48%, odds Ratio=1.9), or none of
these markers (33%, odds Ratio=reference group) (see Example I).
Methods for determining an odds ratio are well known in the art
(see, for example, Schlesselman et al., Case Control Studies:
Design, Conduct and Analysis Oxford University Press, New York
(1982)).
[0124] In one embodiment, a marker or markers is associated with a
clinical subtype of Crohn's disease with a p value of equal to or
less than 0.05. In other embodiments, a marker is associated with a
clinical subtype of Crohn's disease with a p value of equal to or
less than 0.001. As used herein, the term "p value" is synonymous
with "probability value." As is well known in the art, the expected
p value for the association between a random marker and a subtype
is 1.00. A p value of less than about 0.05 indicates that the
marker and a subtype do not appear together by chance but are
influenced by positive factors. Generally, the statistical
threshold for significance of linkage has been set at a level where
false positives would occur once in twenty (p=0.05). In particular
embodiments, a marker is associated with a clinical subtype of
Crohn's disease, such as the fibrostenotic subtype with a p value
of equal to or less than 0.05, 0.04, 0.03, 0.02, 0.01, 0.009,
0.008, 0.007, 0.006, 0.005, 0.004, 0.003, 0.002 or 0.001, or with a
p value of less than 0.000001, 0.00001, 0.00095, 0.0009, 0.00085,
0.0008 or 0.0005. It is recognized that, in some cases, p values
may need to be corrected, for example, to account for factors such
as sample size (number of families), genetic heterogeneity,
clinical heterogeneity, or analytical approach (parametric or
nonparametric method).
[0125] In addition to IgA anti-I2 antibodies and a NOD2 variant,
other combinations of markers can be diagnostic of a particular
clinical subtype of Crohn's disease. For example, the invention
provides a method of diagnosing or predicting susceptibility to a
fibrostenotic subtype of Crohn's disease in a subject having
Crohn's disease by determining the presence or absence of IgA
anti-I2 antibodies in the subject and further determining the
presence or absence of ASCA in the subject, where the combined
presence of anti-I2 antibodies and ASCA in the subject indicates
that the subject has the fibrostenotic subtype of Crohn's disease.
In one embodiment, the combined presence of the IgA anti-I2
antibodies and the ASCA in the subject is associated with the
fibrostenotic subtype of Crohn's disease with an odds ratio of at
least 6. In another embodiment, the combined presence of IgA
anti-I2 antibodies, a NOD2 variant, and ASCA in the subject
indicates that the subject has the fibrostenotic subtype of Crohn's
disease. In a related embodiment, the combined presence of the IgA
anti-I2 antibodies, a NOD2 variant, and the ASCA in the subject is
associated with the fibrostenotic subtype of Crohn's disease with
an odds ratio of at least 9.
[0126] The methods of the invention optionally include generating a
report indicating the presence or absence in a subject of one or
more markers associated with a clinical subtype of Crohn's disease
as disclosed herein. The methods of the invention also optionally
include generating a report indicating the presence or absence in a
subject of a clinical subtype of Crohn's disease, for example, the
fibrostenotic subtype, or the risk that a subject has of having or
developing a particular subtype of Crohn's disease. A report can be
in a variety of forms, including, but not limited to, paper
reports, oral reports and electronic reports. For example, a report
can be printed on paper, or a report can be an electronic report
that is not printed but is transmitted over an electronic medium
such as electronic mail or a computer diskette.
[0127] The invention also provides a method of predicting a
response to therapy in a subject having Crohn's disease by
determining the presence or absence in the subject of one or more
markers associated with a clinical subtype of Crohn's disease,
diagnosing the subject in which the one or more markers are present
as having a particular subtype of Crohn's disease, and predicting a
response to a therapy based on the diagnosis. The invention also
provides a method of optimizing therapy in a subject having Crohn's
disease by determining the presence or absence in the subject of
one or more markers associated with a clinical subtype of Crohn's
disease, diagnosing the subject in which the one or more markers
are present as having a particular clinical subtype of Crohn's
disease, and treating the subject having a particular clinical
subtype of Crohn's disease based on the diagnosis. As an example,
treatment for the fibrostenotic subtype of Crohn's disease
currently includes surgical removal of the affected, strictured
part of the bowel.
[0128] It is understood that modifications which do not
substantially affect the activity of the various embodiments of
this invention are also included within the definition of the
invention provided herein. Accordingly, the following examples are
intended to illustrate but not limit the present invention.
EXAMPLE I
Antibodies Against the Bacterial Sequence I2 are a Marker of the
Fibrostenotic Subtype of Crohn's Disease
[0129] This example shows that antibodies against the Crohn's
disease-associated bacterial sequence I2 are an independent marker
of the fibrostenotic subtype of Crohn's disease.
[0130] Clinical, serologic and genetic data were examined for 258
Crohn's disease patients under an Institutional Review Board (IRB)
approved protocol. Briefly, a diagnosis of Crohn's disease in the
patients was defined by the presence of a combination of
established features from at least two of the following categories:
1) clinical--perforating or fistulizing disease, obstructive
symptoms secondary to small bowel stenosis or stricture; 2)
endoscopic--deep linear or serpiginous ulcerations, discrete ulcers
in normal-appearing mucosa, cobblestoning, or discontinuous or
asymmetric inflammation; 3) radiographic--segmental disease (skip
lesions), small bowel or colon strictures, stenosis, or fistula,
and; 4) histopathologic--submucosal or transmural inflammation,
multiple granulomas, marked focal cryptitis or focal chronic
inflammatory infiltration within and between biopsies, or skip
lesions including rectal sparing in the absence of local therapy.
Patients with primary sclerosing cholangitis and autoimmune
hepatitis and those with chronically increased transaminase or
alkaline phosphatase levels were excluded to avoid confusion with
non-inflammatory bowel disease ANCA.
[0131] ELISAs were performed for IgA anti-I2 antibodies and
anti-Saccharomyces cerevisiae antibodies (ASCA) as described in
Examples II and III. Genotyping was performed for three Crohn's
disease associated variants of the NOD2 gene, R702W, G908R, and
1007fs using the Taqman MGB system as described in Example IV.
[0132] Analysis of ELISA and genotyping data indicated that IgA
antibodies to I2 were present in 56.5% of the Crohn's disease
patients in the study. Patients expressing IgA anti-I2 antibodies
were significantly more likely to have a fibrostenotic subtype of
Crohn's disease than those not expressing IgA anti-I2 antibodies
(71.4% vs. 43.3%, p<0.001) and significantly more likely to
require small bowel surgery (66.7% vs. 37.1%, p<0.001). In
addition, IgA anti-I2 antibodies expression was negatively
associated with ulcerative colitis-like Crohn's disease (20.6% vs.
41.24%, p<0.001). Quartile analyses revealed that higher levels
of IgA anti-I2 antibodies were more strongly associated with the
fibrostenotic subtype of Crohn's disease (p for the
trend<0.001), small bowel involvement (p=0.023), and inversely
associated with ulcerative colitis-like Crohn's disease
(p=0.005).
[0133] Conditional analysis performed on NOD2 variants and ASCA
indicated that IgA anti-I2 antibodies were independently associated
with the fibrostenotic subtype (p=0.001 and p=0.005, respectively).
Similarly, IgA anti-I2 antibodies was independently associated with
small bowel surgery when conditioned on NOD2 variation (p=0.001) or
ASCA (p=0.002).
[0134] Patients with all three markers, IgA anti-I2 antibodies,
NOD2 variation, and ASCA showed the greatest risk of the
fibrostenotic subtype of Crohn's disease (82%, Odds Ratio=9.7,
p<0.000001), compared with patients with two (74%, Odds
Ratio=6.0), one (48%, Odds Ratio=1.9), or none of these markers
(33%, Odds Ratio=reference group).
EXAMPLE II
ELISA for IgA anti-I2 Antibodies
[0135] This example shows demonstrates that the presence of IgA
anti-I2 antibodies in patient sera can be determined using an ELISA
microplate assay.
[0136] A. GST-12 Fusion Protein
[0137] The full-length I2 encoding nucleic acid sequence (SEQ ID
NO: 1) was cloned into the GST expression vector pGEX. After
expression in E. coli, the protein was purified on a GST column. A
GST control protein was also expressed and purified. The purified
protein was shown to be of the expected molecular weight by silver
staining, and had anti-GST reactivity upon western analysis. The
full-length I2 encoding nucleic acid sequence (SEQ ID NO:1) has
also been cloned into a Hex-His6 expression vector, expressed in E.
coli, and the resulting protein purified.
[0138] B. ELISA Analysis A
[0139] Human IgA antibodies that bind the I2 polypeptide (SEQ ID
NO: 2) were detected by direct ELISA assays essentially as follows.
Plates (Greiner, USA Scientific, Ocala, Fla.) were coated overnight
at 4.degree. C. with 100 .mu.l/well GST control polypeptide or
GST-I2 fusion polypeptide (5 .mu.g/ml in borate buffered saline,
pH8.5). After three washes in 0.05% Tween 20 in phosphate buffered
saline (PBS), the plates were blocked with 150 .mu.l/well of 0.5%
bovine serum albumin in PBS, pH7.4 (BSA-PBS) for 30 minutes at room
temperature. The blocking solution was then replaced with 100
.mu.l/well of Crohn's disease or normal control serum, diluted
1:100. The plates were then incubated for 2 hours at room
temperature and washed as before. Alkaline phosphatase conjugated
goat anti-human IgA (.alpha.-chain specific), or IgG (.gamma. chain
specific) (Jackson ImmunoResearch, West Grove, Pa.) was added to
the plates at a dilution of 1:1000 in BSA-PBS. The plates were
incubated for 2 hours at room temperature before washing three
times with 0.05% Tween 20/PBS followed by another three washes with
Tris buffered normal saline, pH 7.5. Substrate solution (1.5 mg/ml
disodium p-nitrophenol phosphate (Aresco; Solon, Ohio) in 2.5 mM
MgCl2, 0.01 M Tris, pH 8.6) was added at 100 .mu.l/well, and color
allowed to develop for one hour. The plates were then analyzed at
405 nm. Nonspecific binding of sera to the control GST protein
(typically <0.1) were subtracted from raw values of I2 binding
to obtain I2-specific absorbances.
[0140] I2 positive reactivity was defined as reactivity greater
than two standard deviations above the mean reactivity obtained
with control (normal) sera analyzed at the same time as the test
samples.
EXAMPLE III
ELISA for anti-Saccharomyces Cerevisiae Antibodies (ASCA)
[0141] This example demonstrates that the presence of
anti-Saccharomyces cerevisiae antibodies in patient sera can be
determined using an ELISA microplate assay.
[0142] A. Preparation of Yeast Cell Wall Mannan
[0143] Yeast cell wall mannan was prepared as follows and as
described in Faille et al., Eur. J. Clin. Microbiol. Infect. Dis.
11:438-446 (1992) and in Kocourek and Ballou et al., J. Bacteriol.
100:1175-1181 (1969). A lyophilized pellet of yeast Saccharomyces
uvarum was obtained from the American Type Culture Collection
(#38926). Yeast were reconstituted in 10 ml 2.times.YT medium,
prepared according to Sambrook et al., Molecular Cloning Cold
Spring Harbor Laboratory Press (1989). S. uvarum were grown for two
to three days at 30.degree. C. The terminal S. uvarum culture was
inoculated on a 2.times.YT agar plate and subsequently grown for
two to three days at 30.degree. C. A single colony was used to
inoculate 500 ml 2.times.YT media, and grown for two to three days
at 30.degree. C. Fermentation media (pH 4.5) was prepared by adding
20 gm glucose, 2 gm bacto-yeast extract, 0.25 gm MgSO4 and 2.0 ml
28% H3PO4 per liter distilled water. The 500 ml culture was used to
inoculate 50 liters of fermentation media, and the culture
fermented for three to four days at 37.degree. C.
[0144] S. uvarum mannan extract was prepared by adding 50 ml 0.02 M
citrate buffer (5.88 gm/l sodium citrate; pH7.0.+-.0.1) to each 100
grams of cell paste. The cell/citrate mixture was autoclaved at
125.degree. C. for ninety minutes and allowed to cool. After
centrifuging at 5000 rpm for 10 minutes, the supernatant was
removed and retained. The cells were then washed with 75 ml 0.02 M
citrate buffer and the cell/citrate mixture again autoclaved at
125.degree. C. for ninety minutes. The cell/citrate mixture was
centrifuged at 5000 rpm for 10 minutes, and the supernatant
retained.
[0145] In order to precipitate copper/mannan complexes, an equal
volume of Fehling's Solution was added to the combined supernatants
while stirring. The complete Fehling's solution was prepared by
mixing Fehling's Solution A with Fehling's SolutionB in a 1:1 ratio
just prior to use. The copper complexes were allowed to settle, and
the liquid decanted gently from the precipitate. The copper/mannan
precipitate complexes were then dissolved in 6-8 ml 3N HCl per 100
grams yeast paste.
[0146] The resulting solution was poured with vigorous stirring
into 100 ml of 8:1 methanol: acetic acid, and the precipitate
allowed to settle for several hours. The supernatant was decanted
and discarded; then the wash procedure was repeated until the
supernatant was colorless, approximately two to three times. The
precipitate was collected on a scintered glass funnel, washed with
methanol and air dried overnight. On some occasions, the
precipitate was collected by centrifugation at 5000 rpm for 10
minutes before washing with methanol and air drying overnight. The
dried mannan powder was dissolved in distilled waster, using
approximately 5 ml water per gram of dry mannan powder. The final
concentration of S. uvarum cell wall mannan was approximately 30
.mu.g/ml.
[0147] B. Preparation of S. uvarum Mannan ELISA Plates
[0148] S. uvarum cell mannan ELISA plates were saturated with
antigen as follows. Purified S. uvarum mannan prepared as described
above was diluted to a concentration of 100 .mu.g/ml with phosphate
buffered saline/0.2% sodium azide (PBS-N3). Using a multi-channel
pipettor, 100 .mu.l of 100 .mu.g/ml S. uvarum mannan was added per
well of a Costar 96-well hi-binding plate (catalogue number 3590;
Costar Corp., Cambridge, Mass.). The antigen was allowed to coat
the plate at 4.degree. C. for a minimum of 12 hours. Each lot of
plates was compared to a previous lot before use. Plates were
stored at 2-8.degree. C. for up to one month.
[0149] C. Analysis of Patient sera
[0150] Patient sera were analyzed in duplicate for anti-IgG or
anti-IgA reactivity. Microtiter plates saturated with antigen as
described above were incubated with phosphate buffered saline/0.05%
Tween-20 for 45 minutes at room temperature to inhibit nonspecific
antibody binding. Patient sera were subsequently added at a
dilution of 1:80 and incubated for 1 hour at room temperature.
Wells were washed three times with PBS/0.05% Tween-20. Then a
1:1000 dilution of alkaline phosphatase-conjugated goat anti-human
F(ab') fragment-specific IgG (Pierce, Rockford, Ill.) or alpha
chain-specific IgA (Jackson Immunoresearch Labs,Inc., West Grove,
Pa.) was added, and the microtiter plates incubated for 1 hour at
room temperature. After washing, a solution of p-nitrophenol
phosphate in diethanolamine substrate buffer was added, and color
development allowed to proceed for 10 minutes. Absorbance at 405 nm
with a reference wavelength of 650 nm was analyzed using an
automated EMAX plate reader (Molecular Devices, Menlo Park,
Calif.).
[0151] Standard binding of pooled sera from patients with an
established diagnosis of Crohn's disease was used as a standard
reference for binding and set to be 100 ELISA units. Results with
test patient sera were expressed as a percentage of the standard
binding of the reference Crohn's disease sera. Sera showing ASCA
reactivity (IgG, IgA, or both) exceeding the reference range were
termed ASCA positive.
EXAMPLE IV
Genotyping for Three Crohn's Disease Associated Variants of
NOD2
[0152] This example shows a genotyping assay that can be used to
detect the presence or absence of a NOD2 variant.
[0153] Genotyping was performed using a genotyping assay employing
5'-exonuclease technology, the TaqMan MGB.TM. assay (PE Biosystems;
Foster City, Calif.). Primers were designed using the software
PrimerExpress 1.5.TM. (PE Biosystems) and sequence information
found in dbSNP for NOD2 variants R702W, G908R, and 1007fs. The
MGB.TM. design adds a "minor groove binder" to the 3' end of the
TaqMan.TM. probes, thereby increasing the binding temperature of
the probe and enabling the use of shorter probes than in
conventional TaqMan.TM. assays (Kutyavin et al., Nucleic Acids Res.
25:3718-3723 (1997)). This has the effect of increasing the
discrimination between the alleles in the assay (Kutyavin et al.,
Nucleic Acids Res. 28:655-661 (2000)). Assays were performed
following the manufacturer's recommendations (PE Biosystems
bulletin 4317594) in an ABI 7900 instrument. Genotyping was
performed blinded to clinical status of the subjects. Primers and
probes used in the genotyping assay are shown in Tables 1 and
2.
1TABLE 1 Primers Used in Taqman MGB .TM. Assay for NOD2 Variants
SNP SEQ ID Primer Forward Primer Reverse Primer NO R702W 5'
CTGGCTGAGTGCCAGACATCT 3' 5' GGCGGGATGGAGTGGAA 3' for 11 rev 12 G90R
5' CCACCTCAAGCTCTGGTGATC 3' 5' GTTGACTCTTTTGGCCTTTTCAG 3' for 13
rev 14 1007fs 5' CCTTACCAGACTTCCAGGATGGT 3' 5'
TGTCCAATAACTGCATCACGTACCT 3' for 15 rev 16
[0154]
2TABLE 2 TAQMAN PROBES SEQ Allele ID detected Probe sequence NO
R702W 6FAM-TGCTCCGGCGCCA-MGBNFQ 17 wild type allele R702W
TET-CTGCTCTGGCGCCA-MGBNFQ 18 variant allele G908R
6FAM-CTCTGTTGCCCCAGAA-MGBNFQ 19 wild type allele G908R
TET-CTCTGTTGCGCCAGA-MGBNFQ 20 variant allele 1007fs
TET-CTTTCAAGGGCCTGC-MGBNFQ 21 wild type allele 1007fs
6FAM-CCTTTCAAGGGGCCT-MGBNFQ 22 wild type allele ("2")
[0155] This example describes an ELISA for direct detection of IgA
anti-OmpC antibodies in patient sera.
[0156] A. ELISA
[0157] The OmpC direct ELISA is performed as follows. Plates
(Greiner, USA Scientific, Ocala, Fla.) are coated overnight at
4.degree. C. with 100 .mu.l/well OmpC prepared as described below
at 0.25 .mu.g/ml in borate buffered saline, pH8.5. After three
washes in 0.05% Tween 20 in phosphate buffered saline (PBS), the
plates are blocked with 150 .mu.l/well of 0.5% bovine serum albumin
in PBS, pH7.4 (BSA-PBS) for 30 minutes at room temperature. The
blocking solution is then replaced with 100 .mu.l/well of Crohn's
disease or normal control serum, diluted 1:100. The plates are then
incubated for 2 hours at room temperature and washed as before.
Alkaline phosphatase conjugated goat anti-human IgA (.alpha.-chain
specific), or IgG (.gamma. chain specific) (Jackson ImmunoResearch,
West Grove, Pa.) is added to the plates at a dilution of 1:1000 in
BSA-PBS. The plates are incubated for 2 hours at room temperature
before washing three times with 0.05% Tween 20/PBS followed by
another three washes with Tris buffered normal saline, pH 7.5.
Substrate solution (1.5 mg/ml disodium p-nitrophenol phosphate
(Aresco; Solon, Ohio) in 2.5 mM MgCl2, 0.01 M Tris, pH 8.6) is
added at 100 .mu.l/well, and color allowed to develop for one hour.
The plates are then analyzed at 405 nm.
[0158] IgA OmpC positive reactivity is defined as reactivity
greater than two standard deviations above the mean reactivity
obtained with control (normal) sera analyzed at the same time as
the test samples.
[0159] B. Purification of OmpC
[0160] The protocol below describes purification of OmpC using
spheroplast lysis.
[0161] OmpF_/_/OmpA_/.sub.-- mutant E. coli are inoculated from a
glycerol stock into 10-20 ml of Luria Bertani broth supplemented
with 100 .mu.g/ml streptomycin (LB-Strep, Teknova, Half Moon Bay,
Calif.), and cultured vigorously at 37.degree. C. for about 8 hours
to log phase, followed by expansion to 1 liter in LB-Strep over 15
hours at 25.degree. C.
[0162] The cells are harvested by centrifugation (JS-4.2, 4K/15
min/4.degree. C.). If necessary, cells are washed twice with 100 ml
of ice cold 20 mM Tris-Cl pH 7.5. The cells are subsequently
resuspended in ice cold spheroplast forming buffer (20 mM Tris-Cl
pH 7.5, 20% sucrose, 0.1 M EDTA pH 8.0, 1 mg/ml lysozyme), after
which the resuspended cells are incubated on ice for about 1 hour
with occasional mixing by inversion.
[0163] If required, the spheroplasts are centrifuged (JA-17, 5.5
k/10 min/4.degree. C.) and resuspended in a smaller volume of
spheroplast forming buffer (SFB). The spheroplast pellet is
optionally frozen prior to resuspension in order to improve lysis
efficiency. Hypotonic buffer is avoided in order to avoid bursting
the spheroplasts and releasing chromosomal DNA, which significantly
decreases the efficiency of lysis.
[0164] The spheroplast preparation is diluted 14-fold into ice cold
10 mM Tris-Cl pH 7.5, 1 mg/ml DNase-I, and vortexed vigorously. The
preparation is sonicated on ice 4.times.30 seconds at 50% power at
setting 4, with a pulse "On time" of 1 second, without foaming or
overheating the sample.
[0165] Cell debris is pelleted by centrifugation (JA-17, 5-10K/10
min/4.degree. C.), and the supernatant removed and clarified by
centrifugation a second time (10K/10 min/4.degree. C.). The
supernatant is removed without collecting any part of the pellet,
and placed into ultra centrifuge tubes. The tubes are filled to 1.5
millimeter from top with 20 mM Tris-Cl pH7.5.
[0166] The membrane preparation is pelleted by ultra centrifugation
at 100,000 g (35K/1 hour/4.degree. C. in Beckman SW 60 swing bucket
rotor). The pellet is resuspended by homogenizing into 20 mM
Tris-Cl pH 7.5 using a 1 ml blue pipette tip and squirting the
pellet closely before pipetting up and down for approximately 10
minutes per tube.
[0167] In a 15 ml screw cap tube filled with 4 mls, the material is
extracted for 1 hour in 20 mM Tris-Cl pH 7.5 with 1% SDS, with
rotation at 37.degree. C. The preparation is transferred to ultra
centrifugation tubes, and the membrane pelleted at 100,000 g (35K/1
hour/4.degree. C. in Beckman SW 60). The pellet is resuspended by
homogenizing into 20 mM Tris-Cl pH7.5 as before. The membrane
preparation is optionally left at 4.degree. C. overnight.
[0168] OmpC is extracted for 1 hour with rotation at 37.degree. C.
in 20 mM Tris-Cl pH 7.5, 3% SDS, and 0.5 M NaCl (SDS will
precipitate if kept below 37.degree. C.). The material is
transferred to ultra centrifugation tubes, and the membrane
pelleted by centrifugation at 100,000 g (35K/1 hour/30.degree. C.
in Beckman SW 60). Lower temperatures are avoided since further
cooling will result in extracted protein salting out of
solution.
[0169] The supernatant containing extracted OmpC is then dialyzed
against more than 10,000 volumes to eliminate high salt content.
SDS is removed by detergent exchange against 0.2% Triton. Triton is
removed by further dialysis against 50 mM Tris-Cl.
[0170] Purified OmpC, which functions as a porin in its trimeric
form, is characterized as follows when analyzed by SDS-PAGE.
Electrophoresis at room temperature results in a ladder of about
100 kDa, about 70 kDa, and about 30 kDa bands. Heating for 10-15
minutes at 65-70.degree. C. partially dissociates the complex and
results in only dimers and monomers (about 70 kDa and about 30 kDa
bands). Boiling for5 minutes results in monomers of 38 kDa.
EXAMPLE VI
ELISA and Indirect Immunofluorescence for Determining pANCA
Status
[0171] This example describes methods for determining the pANCA
status of a subject.
[0172] A. Presence of pANCA is Determined by Fixed Neutrophil
ELISA
[0173] A fixed neutrophil enzyme-linked immunosorbent assay is used
to detect PANCA as described in Saxon et al., J. Allergy Clin.
Immunol. 86:202-210 (1990), and all samples are analyzed in a
blinded fashion. Microtiter plates are coated with 2.5.times.105
neutrophils per well and treated with 100% methanol to fix the
cells. Cells are incubated with 0.25% bovine serum albumin (BSA) in
phosphate-buffered saline to block nonspecific antibody binding.
Next, control and coded sera are added at a 1:100 dilution to the
bovine serum/phosphate-buffered saline blocking buffer. Alkaline
phosphatase conjugated goat F(ab') 2 anti-human immunoglobulin G
(.gamma.-chain specific) antibody (Jackson Immunoresearch Labs,
Inc., West Grove, Pa.) is added at a1:1000 dilution to label
neutrophil bound antibody. A p-nitrophenol phosphate substrate
solution is added and color development is allowed to proceed until
absorbance at 405 nm in the positive control wells is 0.8-1.0
optical density units greater than the absorbance in blank
wells.
[0174] Levels are determined relative to a standard consisting of
pooled sera obtained from well-characterized pANCA positive
ulcerative colitis patients. Results are expressed as ELISA units.
Sera with circulating antineutrophil cytoplasmic IgG antibody
exceeding the reference range value are termed ANCA positive.
Numerical values that are below the reference range are termed ANCA
negative.
[0175] B. Indirect Immunofluorescence Assay for Determination of
ANCA Staining Pattern
[0176] Indirect immunofluorescent staining is performed on samples
that are ANCA-positive by ELISA to determine whether the
predominant staining pattern is perinuclear (PANCA) or cytoplasmic
(cANCA). Glass slides containing approximately 100,000 neutrophils
per slide are prepared by cytocentrifugation (Shandon Cytospin,
Cheshire, England) and they are fixed in 100% methanol, air-dried,
and stored at-20.degree. C. The fixed neutrophils are incubated
with human sera are diluted (1:20), and the reaction is visualized
with fluorescein-labeled F(ab')2 .gamma. chain-specific antibody as
described in Saxon et al., supra, 1990. The slides are examined
using an epifluorescence-equipped Olympus BH-2 microscope (Olympus,
Lake Success, N.Y.).
[0177] PANCA positivity is defined as a perinuclear staining
pattern combined with ELISA reactivity greater than two standard
deviations above the mean reactivity obtained with control (normal)
sera analyzed at the same time as the test samples.
EXAMPLE VII
Association of Antibody Responses to Microbial Antigens and
Complications of Small Bowel Crohn's Disease
[0178] This example demonstrates that both the number of antibody
responses toward microbial antigens, and the magnitude of the total
response, is highly associated with more complicated small bowel
Crohn's disease.
[0179] A. Patient Population and Methods
[0180] A patient study population of 303 patients was ascertained
from patients assessed at Cedars-Sinai Medical Center between 1993
and 2002. All research related activities were approved by the
Cedars-Sinai Medical Center Institutional Review Board, and a
diagnosis of Crohn's disease was based on standard endoscopic,
histologic, and radiographic features as described in Example I. In
addition to the Crohn's disease patients reported previously in
Vasiliauskas et al., Gastroenterology 123:689-699 (2002), and Abreu
et al., Gastroenterology 123:679-688 (2002), the cohort of 303
study patients also included individuals enrolled from the clinic
or at the time of surgery.
[0181] Crohn's disease phenotype designations were assigned based
on standard previously published criteria (Vasiliauskas et al.,
supra, 2002; Vasiliauskas et al., Gastroenterology 110:1810-1819
(1996), and Abreu et al., supra, 2002). The phenotypes included
fibrostenosing, internal perforating, perianal fistulizing, and
ulcerative colitis-like phenotypes. Patients considered to have
fibrostenotic disease had evidence of persistent small bowel
obstruction or history of resection for small bowel obstruction
secondary to Crohn's disease-related bowel stenosis and,
furthermore, were required to have non-inflammatory stenosis with
evidence of partial or complete small bowel obstruction not due to
adhesions on radiographic examination. Patients with a history of
or evidence of small bowel perforation (abscesses) or fistula
(entero-entero, entero-cutaneous, or entero-vesicular) were
assigned the phenotype of internal perforating disease. Perianal
perforating disease was defined as a history of perianal
abscess/fistula or recto-vaginal fistula. A single patient was in
some cases assigned more than one phenotype designation. Disease
location was based on endoscopic, histopathologic, and radiographic
evidence of chronic inflammation, and defined as presence of
inflammation in the small bowel, colon, or both. Patients
characterized as having small bowel disease included those with
only small bowel disease and those with both small bowel and
colonic disease. Significant small bowel surgeries included small
bowel resections, ileocolonic resections, and
stricturoplasties.
[0182] Phenotype and disease location were assigned following
discussion of the clinical data by multiple IBD physicians who were
blinded to the results of serologic and genetic information.
Phenotype designations were generally performed at the time of
consent for serologic and genetic analysis, with most patients
enrolled during first consultation in the IBD clinic and some
additional patients enrolled at the time of surgery. The database
was constantly updated, with one hundred and four patients having
updated clinical phenotype designations by the time of data
analysis. Surgery typically occurred prior to enrollment or at the
time of enrollment, and updates were made in the database if
surgery occurred following enrollment. Of the patients in the study
cohort, twenty-six had serologic assessment at the time of surgery
and at least once six months or more following surgery.
[0183] Genetic and serological analyses were performed as follows.
Three NOD2/CARD15 single nucleotide polymorphisms were analyzed as
described in Example IV above. All blood samples for serologic
analysis were taken at the time of consent and enrollment. Sera
were analyzed for expression of anti-I2, ASCA and anti-OmpC
antibodies and pANCA as described above. Analysis of IgG and IgA
ASCA and pANCA was performed at Cedars-Sinai Medical Center or
Prometheus Laboratories using the same technology while all assays
for anti-I2 and anti-OmpC antibodies were performed at Cedars-Sinai
Medical Center. Antibody levels were determined and results
expressed as ELISA units (EU/ml), which are relative to a
Cedars-Sinai Laboratory (IgA-I2 and IgA-OmpC) or a Prometheus
Laboratory Standard (IgA and IgG ASCA, and ANCA) derived from a
pool of patient sera with well-characterized disease found to have
reactivity to the particular antigen.
[0184] Statistical analyses were performed as follows. To determine
associations between antibody responses toward microbial antigens,
autoantigens, and NOD2 genotype status and disease phenotype
characteristics, univariate analyses utilizing .chi..sup.2 tests
were performed using Statistical Analysis Software (Version 8.02;
SAS Institute, Inc.; Cary, N.C.). Odds ratios and 95% confidence
intervals were calculated to compare the odds of positive serum
reactivity towards the microbial antigens (I2, OmpC, and ASCA) in
the group of patients with a certain disease characteristic (for
example, the fibrostenotic subtype) with the group of patients
lacking this disease characteristic.
[0185] To evaluate the association between disease phenotype and
the combined level of immune response towards I2, oligomannan and
OmpC, sums of quartile scores for anti-I2, ASCA and anti-OmpC were
calculated. For each antigen, patients whose antibody levels were
in the 1.sup.st, 2.sup.nd, 3.sup.rd and 4.sup.th quartile of the
distribution were assigned a quartile score of 1, 2, 3 and 4,
respectively. By adding individual quartile scores for each
microbial antigen, a quartile sum score (ranging from 3-12)
represented the cumulative quantitative immune response towards all
three antigens for each patient.
[0186] The Cochran-Armitage test for trend was utilized to test for
a linear relationship between the proportion of patients with a
disease phenotype characteristic and the level of antibody response
quantified by quartiles. A p-value (p trend) less than or equal to
0.05 indicated that the linear trend was statistically significant.
Multivariate analysis with logistic regression modeling was also
performed to determine primary associations among qualitative
serological and genetic indicators and disease phenotypes. Analysis
of variance using the F-test was performed on the 26 patients for
whom sequential antibody data were available in order to test for
antibody level stability.
[0187] B. Clinical, Serologic and Genetic Characteristics of the
Study Population
[0188] The 303 patient cohort described above had similar
characteristics as compared to previously reported frequencies of
disease phenotypes, individual antibody responses to microbial and
autoantigens, and NOD2 gene variations. Crohn's disease patients
had previously been reported to have serum reactivity towards I2
(54%; Landers et al., Gastroenterology 123:689-699 (2002)); against
oligomannans (ASCA) (40-60%; Vasiliauskas et al., supra, 2000;
Annese et al., Gastroenterology 96:2407-2412 (2001), and Quinton et
al., Gut 42:788-791 (1998)); and towards OmpC (56%; Landers et al.,
surpa, 2002); and to have pANCA reactivity (10-40%; Vasiliauskas,
supra, 1996). FIG. 4 shows scatter graphs of the serologic
responses for each antigen in the 303 patient cohort.
[0189] Clinical characteristics as well as the serologic profile
and NOD2 genotypes of the 303 patient cohort are summarized in
Table 3. As shown in the table, there was a high proportion of
patients with fibrostenosis (54.8%) and the need for small bowel
surgery (52.2%), reflecting the severity of illness of patients
referred to the IBD Center. Anti-I2 was seen in 59.4% of patients,
and anti-OmpC was seen in 46.2%. Furthermore, approximately
thirty-seven percent of patients were heterozygotes, compound
heterozygotes, or homozygotes for the R675W, G881R, and 3020insC
NOD2 mutations.
3TABLE 3 Clinical Characteristics of the Crohn's Disease Cohort
Cohort Clinical Characteristics (n = 303) Sex (M/F) 160/143 Median
Age of Onset (yr) 23.0 Disease Location (%) Small bowel only 19.8
Colon only 20.5 Small bowel and colon 59.7 Disease Behavior (%)
Perianal perforating 37.3 Internal perforating 39.6 Fibrostenosing
disease 54.8 UC-like 25.4 Small bowel surgery 52.2 Serologic
Profile (%) pANCA positive 17.2 ASCA positive 52.5 Anti-I2 positive
59.4 Anti-OmpC positive 46.2 NOD2 Genotype for SNP 8, 12, & 13
(%) No mutations 62.7 Heterozygotes 29.7 Compound Heterozygotes or
7.6 Homozygotes
[0190] C. Anti-I2, ASCA, Anti-OmpC, and PANCA are Associated with
Distinct Disease Phenotypes
[0191] Associations between Crohn's disease patient phenotype and
the presence or absence of ASCA and pANCA have indicated that
antibody responses can be associated with specific clinical
characteristics. Furthermore, antibodies against I2 and OmpC
previously have been shown to cluster together in a cohort of CD
patients (Landers et al., supra, 2002). Table 4 shows the
proportion of patients with each phenotype segregated by response
to I2, oligomannans (ASCA), OmpC, presence of a NOD2 variant (one
or two copies of R675W, G881R, or 3020insC), and pANCA reactivity.
As shown in Table 4, anti-I2 reactivity was significantly
associated with occurrence of small bowel disease, fibrostenosis,
and small bowel surgery, while anti-OmpC was associated with
fibrostenosis, internal perforating disease, and small bowel
surgery. Reactivity against both of these antigens was negatively
associated with ulcerative colitis-like disease. ASCA had the most
significant associations with small bowel disease, fibrostenosis,
internal perforations and small bowel surgery; ASCA was also
negatively associated with UC-like disease, consistent with
previous reports (Vasiliauskas et al., supra, 2000, and Louis et
al., Gut 52:552-557 (2003)). Also consistent with earlier reports,
pANCA was associated with ulcerative colitis-like disease, and
negatively associated with small bowel disease, fibrostenosis, and
small bowel surgery (Vasiliauskas et al., supra, 2000).
[0192] In sum, these results demonstrate that antibody responses
towards I2 and OmpC are associated with complicated small bowel
Crohn's disease phenotypes.
4TABLE 4 Frequency of Disease Characteristics with Immune Responses
to Microbial and Auto-antigens Anti-I2 Anti-OmpC ASCA NOD2 pANCA
Clinical Phenotype p p p p p (%) Yes No Value Yes No Value Yes No
Value Yes No Value Yes No Value Small Bowel Disease 83.9 73.2 0.023
83.6 76.1 NS 86.8 71.5 0.001 89.4 73.7 0.001 63.5 82.9 0.002
Fibrostenosing 64.4 40.7 <0.001 62.9 47.9 0.009 71.7 36.1
<0.001 62.0 50.5 0.05 28.9 60.2 <0.001 Internal Perforating
42.8 35.0 NS 50.0 30.7 0.001 50.9 27.1 <0.001 38.1 40.5 NS 28.9
41.8 NS Small Bowel Surgery 62.2 37.4 <0.001 61.4 44.2 0.003
65.4 37.5 <0.001 55.8 50.0 NS 26.9 57.4 <0.001 UC-Like 19.4
34.2 0.004 22.1 28.2 NS 13.8 38.2 <0.001 15.9 31.1 0.004 50.0
20.3 <0.001 Columns: Yes = presence of serology, No = absence of
serology Rows: Numbers represent % of patients with a specific
disease phenotype
[0193] D. Mutations in NOD2 are Associated with Fibrostenosing
Small Bowel Crohn's Disease
[0194] As summarized in Table 4 above, NOD2 mutations in the cohort
of 303 Crohn's disease patients were associated with small bowel
disease (p=0.001) and fibrostenosis (p=0.05), and were negatively
associated with ulcerative colitis-like disease (p=0.004). NOD2
variants were not associated with small bowel surgery in this
cohort (p=0.332). These results support the association between
NOD2 mutations and fibrostenotic small bowel Crohn's disease and
are consistent with reports of associations between fibrostenotic
disease behavior and the presence of NOD2 mutations in Crohn's
(Abreu et al., supra, 2002; Helio et al., Gut 52:558-562 (2003);
and Radlmayr et al., Gastroenterology 122:2091-2092 (2002)) or an
association with small bowel disease only (Ahmad et al.,
Gastroenterology 122:854-866 (2002), and Elson, New Eng. J. of Med.
346:614-616 (2002)).
[0195] Combined with the data presented above, these results
demonstrate that there can be a high frequency of Crohn's disease
complications regardless of NOD2 genotype and indicate that immune
responses towards microbial antigens can be closer to the
pathophysiologic pathway of complicated small bowel disease course
than genetic predisposition contributed by mutations in NOD2.
[0196] E. Relative Contribution of Individual and Multiple Antibody
Responses Against Microbial Antigens to Complicated Small Bowel
Crohn's Disease
[0197] Multivariate logistic regression analysis was performed to
determine which antibody responses were independently associated
with disease characteristics. As summarized in Table 5, significant
independent serum associations were observed between anti-I2 and
fibrostenosis (p=0.027) and small bowel surgery (p=0.01); between
anti-OmpC and internal perforating behavior (p<0.006); and
between ASCA and small bowel disease (p=0.023), fibrostenosis
(p<0.001), internal perforating disease (p<0.001), and small
bowel surgery (p<0.001), and negatively with ulcerative
colitis-like disease (p=0.001). In addition, pANCA was associated
with ulcerative colitis-like disease (p<0.001) and was
negatively associated with small bowel disease (p=0.013),
fibrostenosis (p<0.002), and small bowel surgery (p=0.001). None
of the serologic responses was associated with perianal perforating
disease. The genetic marker, NOD2, was independently associated
with the occurrence of small bowel disease (p=0.003) and negatively
associated with ulcerative colitis-like disease (p<0.008). NOD2
was therefore not independently associated with any complicated
small bowel disease phenotype, indicating that Crohn's disease
phenotypes are more closely associated with immune responses
towards microbial antigens than NOD2 genotype.
5TABLE 5 Association of Clinical Features with Marker Antibodies:
Result of Multivariate Logistic Regression Small Small Bowel Marker
Bowel Disease Fibrostenosis Internal Perf. Surgery UC-like Anti-I2
NS p = 0.027 NS p = 0.01 NS Anti-OmpC NS NS p < 0.006 NS NS ASCA
p = 0.023 p < 0.001 p < 0.001 p < 0.001 p < 0.001*
pANCA p = 0.013* p < 0.002* NS p = 0.001* p < 0.001 NOD2 p =
0.003 NS NS NS p < 0.008* p values represent significant
independent associations *negative association
[0198] Many patients have immune reactivity towards more than one
of the described microbial antigens, as summarized in the Venn
diagram shown in FIG. 5. Antibody responses in a given patient
towards an increasing number of microbial antigens were analyzed
for an increased likelihood of complicated small bowel disease
phenotypes such as fibrostenosis or internal perforating disease.
The relationship between serum reactivity towards one, two, or all
three of the antigens (I2, oligomannan and OmpC) and clinical
phenotype irrespective of PANCA and NOD2 status is shown in Table 6
below. Patients with all three associated markers were found to be
more likely to have fibrostenotic disease, internal perforating
disease and small bowel surgery, compared to patients having serum
reactivity with none, one or even two of these markers (p for all
.ltoreq.0.001). These results indicate that patients who have
antibody responses towards a greater number of the microbial
antigens I2, OmpC and oligomannan are at increased risk for
fibrostenosis, internal perforating disease, and the need for small
bowel surgery as compared with patients with no serologic response
towards these microbial antigens or with a serologic response
towards a smaller number of antigens.
6TABLE 6 Disease Characteristics in Patients with Antibody
Reactivity Towards Microbial Antigens # Antibodies Towards OR
Clinical Microbial Antigens.sup.1 (3 95% Cl Phenotype 0 1 2 3
ptrend vs 0) (3 vs 0) Small Bowel 63.9 78.8 85.1 86.7 0.001 3.7
1.6-8.5 Disease (%) Fibrostenosing 23.0 50.0 66.7 72.0 <0.001
8.6 4.0-18.9 (%) Internal 27.9 27.5 42.5 58.7 <0.001 3.7 1.8-7.6
Perforating (%) Small Bowel 23.0 50.0 57.5 72.0 <0.001 8.6
4.0-18.9 Surgery (%) UC-Like (%) 42.6 27.5 24.1 10.7 <0.001 0.2
0.1-0.4 Rows: Numbers represent % of patients with a specific
disease pheonotype in the first four columns .sup.1Microbial
antigens (I2, OmpC, and oligomannans); results irrespective of
pANCA and NOD2/CARD15 status.
[0199] F. Higher Levels of Antibody Response Toward Individual and
Multiple Microbial Antigens is Associated with Higher Frequency of
Complicated Small Bowel Disease Phenotype
[0200] The association between qualitative antibody responses
towards microbial antigens and disease phenotypes has been
described above. To assess the importance of quantitative antibody
response, the association between the level of antibody response
divided by quartiles towards I2, oligomannan, and OmpC, and the
frequency of various Crohn's disease clinical subtypes was
analyzed. Table 7A shows the results of quartile analysis for
anti-I2, ASCA and anti-OmpC for each disease characteristic. As
shown in Table 7A, there is an increasing percentage of patients
with small bowel disease, fibrostenotic disease, internal
perforating disease, small bowel surgery, and a decreasing
likelihood of UC-like disease, as the magnitude of the antibody
response toward a microbial antigen increases. Furthermore, the
increased frequency of complications of small bowel disease
associated with increasing levels of antibody responses was not
solely related to the increase in frequency of small bowel disease.
As shown in Table 7B, the frequency of small bowel surgery when
only patients with small bowel disease were analyzed also
increased. As an example, in the anti-I2 quartile analysis, the
frequency of patients with small bowel disease requiring surgery
was 42.3% in the lowest quartile while this rate rose to 73.4% in
the highest quartile (p<0.001). In sum, these results
demonstrate that the presence and increasing level of an antibody
response towards I2, OmpC, or oligomannan are associated with
increasing frequency of complicated small bowel CD phenotypes.
7TABLE 7A Disease Characteristics Within Individual Immune Response
Quartiles Clinical Anti-I2 Anti-OmpC ASCA Phenotype (%) Q1 Q2 Q3 Q4
ptrend Q1 Q2 Q3 Q4 ptrend Q1 Q2 Q3 Q4 ptrend Small Bowel 68.4 82.7
81.8 85.3 0.016 76.3 76.0 77.6 88.2 NS 67.1 74.7 84.2 92.1
<0.001 Disease Fibrostenosing 36.8 50.7 66.2 65.3 <0.001 43.4
52.0 55.3 68.4 0.002 36.8 37.3 72.4 72.4 <0.001 Internal 26.3
50.7 35.1 46.7 NS 26.3 37.3 40.8 54.0 0.001 25.0 29.3 48.7 55.3
<0.001 Perforating Small Bowel 32.9 49.3 61.0 65.3 <0.001
42.1 48.0 54.0 64.5 0.004 35.5 42.7 63.2 67.1 <0.001 Surgery
UC-Like 36.8 29.3 18.2 17.3 0.002 21.1 34.7 29.0 17.1 NS 43.4 28.0
18.4 11.8 <0.001
[0201]
8TABLE 7B Frequency of Small Bowel Surgery in Patients with Small
Bowel Disease Clinical Anti-I2 Anti-OmpC ASCA Phenotype Q1 Q2 Q3 Q4
ptrend Q1 Q2 Q3 Q4 ptrend Q1 Q2 Q3 Q4 ptrend Small Bowel 42.3 54.8
69.8 73.4 <0.001 48.3 56.1 64.4 73.1 0.003 47.1 51.8 70.3 70.0
0.002 Surgery (%) Columns: Q1-Q4 represent the groups patients
broken down by quartiles for each serology Quartile 1 patients have
the lowest level response up to Quartile 4 representing patients
with the highest level response Rows: Numbers represent % of
patients with a specific disease phenotype
[0202] The level of the immune responses was analyzed over time in
order to determine the influence of surgery on these antibody
responses. In particular, levels of antibody responses towards
microbial and autoantigens were analyzed in 26 patients following
surgery. As shown in FIG. 6, antibody responses towards microbial
antigens remain stable for up to 20 months following surgery. In a
separate statistically significant analysis, variation among a
given patient's antibody levels over time was less than the
variation seen among antibody levels from different individuals in
the population for all tested serologies: anti-I2 (p<0.001),
anti-OmpC (p=0.002), IgA ASCA (p<0.001), IgG ASCA (p<0.001),
and ANCA (p=0.015). These statistically significant results
demonstrate that antibody level variation among patients is greater
than within-patient variation, indicating that antibody levels in
an individual are relatively stable. These results further indicate
that immune reactions, rather than disease duration, are a major
factor in development of complicated Crohn's disease phenotype.
[0203] The total level of antibody response towards all three
microbial antigens was analyzed for any association with disease
phenotype using quartile sums, a methodology for summarizing the
level of antibody response towards multiple microbial antigens in a
given patient population (Landers et al., supra, 2002). In
particular, quartile sum analysis (sum of quartile scores for
anti-I2, ASCA and anti-OmpC) was performed to evaluate a possible
association between the level of combined immune response towards
I2, oligomannan and OmpC, and disease characteristics for an
individual patient. FIG. 7 shows individual serologic responses
broken down by quartiles and assigned scores of 1 to 4 based on
their designated quartile. Individual quartile scores for each
microbial antigen were added to obtain a quartile sum score ranging
from 3 to 12; this sum score represents the cumulative quantitative
immune response towards the three microbial antigens. The right
panel of FIG. 7 indicates the number of patients within each
individual cumulative quartile sum score.
[0204] As shown in FIG. 8, patients with increasing quartile sum
scores tended to have an increasing likelihood of small bowel
disease, fibrostenotic disease, and internal perforating disease,
an increasing need for small bowel surgery, and a decreasing
frequency of UC-like phenotype. Furthermore, when comparing the
frequency of disease characteristics in the patients with quartile
scores of 10-12 to the patients with the lowest three scores for
response to all three antigens (quartile scores of 3-5), patients
with quartile sum scores of 10-12 were observed to have the
following associations: small bowel disease (OR 4.9, 95%
CI=2.1-11.5, p<0.001); fibrostenosis (OR 4.8, 95% CI=2.5-9.4,
p<0.001); internal perforations (OR 4.4, 95% CI=2.2-8.8,
p<0.001; small bowel surgery (OR 4.5, 95% CI=2.3-8.8,
p<0.001); and a decreased likelihood of UC-like disease (OR 0.2,
95% CI=0.1-0.5, p<0.001).
[0205] Similar to the individual quartile analysis, the increasing
frequency of complicated small bowel disease with rise in the
quartile sum score was not solely due to an increase in the
frequency of small bowel disease. Specifically, the frequency of
surgery in patients with small bowel disease was 18.2% (11.8%
divided by 64.7%) for a quartile sum score of 3, while this rate
rose dramatically to 90% (77.3% divided by 86.3%) in patients with
the highest response to all three antigens (quartile sum score of
12; p<0.001). Furthermore, this association was higher than any
of the trends demonstrated for individual antibody responses based
on quartile analysis, which were usually around 72% (see Table 7, A
and B). These results demonstrate that in this 303 patient cohort,
the presence of multiple high-level antibody responses towards
microbial antigens (I2, oligomannan and OmpC) is associated with a
higher frequency of complicated small bowel disease, an association
not solely related to an increase in the frequency of small bowel
disease.
[0206] In sum, around 80% of Crohn's disease patients express a
response towards at least one microbial antigen (I2, oligomannan or
OmpC). However, high-level antibody reactivity towards a larger
number of these microbial antigens is more highly associated with
complicated small bowel disease phenotypes, specifically
fibrostenosis, internal perforating disease, and the need for small
bowel surgery.
[0207] All journal article, reference and patent citations provided
herein, including referenced sequence accession numbers of
nucleotide and amino acid sequences contained in various databases,
in parentheses or otherwise, whether previously stated or not, are
incorporated herein by reference in their entirety.
[0208] Although the invention has been described with reference to
the disclosed embodiments, those skilled in the art will readily
appreciate that the specific experiments detailed are only
illustrative of the invention. It should be understood that various
modifications can be made without departing from the spirit of the
invention.
Sequence CWU 1
1
22 1 302 DNA P. aeruginosa CDS (2)...(301) 1 a gat ctg gcc agc gcc
gtg ggc atc cag tcc ggc agc atc ttt cat cac 49 Asp Leu Ala Ser Ala
Val Gly Ile Gln Ser Gly Ser Ile Phe His His 1 5 10 15 ttc aag agc
aag gat gag ata ttg cgt gcc gtg atg gag gaa acc atc 97 Phe Lys Ser
Lys Asp Glu Ile Leu Arg Ala Val Met Glu Glu Thr Ile 20 25 30 cat
tac aac acc gcg atg atg cgc gct tca ctg gag gag gcg agc acg 145 His
Tyr Asn Thr Ala Met Met Arg Ala Ser Leu Glu Glu Ala Ser Thr 35 40
45 gtg cgc gaa cgc gtg ctg gcg ctg atc cgc tgc gag ttg cag tcg atc
193 Val Arg Glu Arg Val Leu Ala Leu Ile Arg Cys Glu Leu Gln Ser Ile
50 55 60 atg ggc ggc agt ggc gag gcc atg gcg gtg ctg gtc tac gaa
tgg cgc 241 Met Gly Gly Ser Gly Glu Ala Met Ala Val Leu Val Tyr Glu
Trp Arg 65 70 75 80 tcg ctg tcg gcc gaa ggc cag gcg cac gtg ctg gcc
ctg cgt gac gtg 289 Ser Leu Ser Ala Glu Gly Gln Ala His Val Leu Ala
Leu Arg Asp Val 85 90 95 tat gag cag atc t 302 Tyr Glu Gln Ile 100
2 100 PRT P. aeruginosa 2 Asp Leu Ala Ser Ala Val Gly Ile Gln Ser
Gly Ser Ile Phe His His 1 5 10 15 Phe Lys Ser Lys Asp Glu Ile Leu
Arg Ala Val Met Glu Glu Thr Ile 20 25 30 His Tyr Asn Thr Ala Met
Met Arg Ala Ser Leu Glu Glu Ala Ser Thr 35 40 45 Val Arg Glu Arg
Val Leu Ala Leu Ile Arg Cys Glu Leu Gln Ser Ile 50 55 60 Met Gly
Gly Ser Gly Glu Ala Met Ala Val Leu Val Tyr Glu Trp Arg 65 70 75 80
Ser Leu Ser Ala Glu Gly Gln Ala His Val Leu Ala Leu Arg Asp Val 85
90 95 Tyr Glu Gln Ile 100 3 494 DNA Homo sapiens 3 accttcagat
cacagcagcc ttcctggcag ggctgttgtc ccgggagcac tggggcctgc 60
tggctgagtg ccagacatct gagaaggccc tgctccggcg ccaggcctgt gcccgctggt
120 gtctggcccg cagcctccgc aagcacttcc actccatccc gccagctgca
ccgggtgagg 180 ccaagagcgt gcatgccatg cccgggttca tctggctcat
ccggagcctg tacgagatgc 240 aggaggagcg gctggctcgg aaggctgcac
gtggcctgaa tgttgggcac ctcaagttga 300 cattttgcag tgtgggcccc
actgagtgtg ctgccctggc ctttgtgctg cagcacctcc 360 ggcggcccgt
ggccctgcag ctggactaca actctgtggg tgacattggc ctggagcagc 420
tgctgccttg ccttggtgtc tgcaaggctc tgtagtgagt gttactgggc attgctgttc
480 aggtatgggg gagc 494 4 494 DNA Homo sapiens 4 gctcccccat
acctgaacag caatgcccag taacactcac tacagagcct tgcagacacc 60
aaggcaaggc agcagctgct ccaggccaat gtcacccaca gagttgtagt ccagctgcag
120 ggccacgggc cgccggaggt gctgcagcac aaaggccagg gcagcacact
cagtggggcc 180 cacactgcaa aatgtcaact tgaggtgccc aacattcagg
ccacgtgcag ccttccgagc 240 cagccgctcc tcctgcatct cgtacaggct
ccggatgagc cagatgaacc cgggcatggc 300 atgcacgctc ttggcctcac
ccggtgcagc tggcgggatg gagtggaagt gcttgcggag 360 gctgcgggcc
agacaccagc gggcacaggc ctggcgccgg agcagggcct tctcagatgt 420
ctggcactca gccagcaggc cccagtgctc ccgggacaac agccctgcca ggaaggctgc
480 tgtgatctga aggt 494 5 540 DNA Homo sapiens 5 atcaaaaccc
tgagaggaca agggacattt ccaagtcacc cagaaagact cgagtgtcct 60
ctcttgaaat ccaatggtct tttttcctta ctccattgcc taacattgtg gggtagaaat
120 aaagttcaaa gaccttcaga actggcccca gctcctccct cttcacctga
tctccccaag 180 aaaactgcag gatagactct gaagcttacc tgagccacct
caagctctgg tgatcaccca 240 aggcttcagc cagggcctgg gccccctcgt
cacccactct gttgccccag aatctgaaaa 300 ggccaaaaga gtcaacagac
agtgtcagtg agtacctgat atgtgttcta gacatgaact 360 aacagtcctc
ctccctctgc agtcccagcc agaggggcag gaccactcaa tcccagagtg 420
gcctcactgg ggctcctggt cccagcaaag tggacctgcc tccatctttt gggtgggatg
480 gccaaactta acccaagagt tttcagtggc tttacattac agacttagag
aatagtagag 540 6 540 DNA Homo sapiens 6 ctctactatt ctctaagtct
gtaatgtaaa gccactgaaa actcttgggt taagtttggc 60 catcccaccc
aaaagatgga ggcaggtcca ctttgctggg accaggagcc ccagtgaggc 120
cactctggga ttgagtggtc ctgcccctct ggctgggact gcagagggag gaggactgtt
180 agttcatgtc tagaacacat atcaggtact cactgacact gtctgttgac
tcttttggcc 240 ttttcagatt ctggggcaac agagtgggtg acgagggggc
ccaggccctg gctgaagcct 300 tgggtgatca ccagagcttg aggtggctca
ggtaagcttc agagtctatc ctgcagtttt 360 cttggggaga tcaggtgaag
agggaggagc tggggccagt tctgaaggtc tttgaacttt 420 atttctaccc
cacaatgtta ggcaatggag taaggaaaaa agaccattgg atttcaagag 480
aggacactcg agtctttctg ggtgacttgg aaatgtccct tgtcctctca gggttttgat
540 7 541 DNA Homo sapiens 7 tttaaaaatg aaatcattgc tccctactta
aagaggtaaa gacttctttc ttagacagag 60 aatcagatcc ttcacatgca
gaatcattct cactgaatgt cagaatcaga agggatcctc 120 aaaattctgc
cattcctctc tcccgtcacc ccattttaca gatagaaaaa ctgaggttcg 180
gagagctaaa acaggcctgc ccaggggcct taccagactt ccaggatggt gtcattcctt
240 tcaaggggcc tgcaggaggg cttctgcccc taggtaggtg atgcagttat
tggacaacct 300 ggaaaagaag atacaatggt gagcttcaag gattcttggt
tttcctcttg aaactgtcca 360 gttaaagaga ctgcaggagt tagccagtct
actgaagccc acctgtccct tagacacatc 420 ctgctcatgt ctgagattcc
caatgagctc atcaacaaag gctcagtacc atcagtgaaa 480 tgtaaccgtc
tctcttccat tcactagatg agtttatcaa attaagtagc cactccctta 540 g 541 8
541 DNA Homo sapiens 8 ctaagggagt ggctacttaa tttgataaac tcatctagtg
aatggaagag agacggttac 60 atttcactga tggtactgag cctttgttga
tgagctcatt gggaatctca gacatgagca 120 ggatgtgtct aagggacagg
tgggcttcag tagactggct aactcctgca gtctctttaa 180 ctggacagtt
tcaagaggaa aaccaagaat ccttgaagct caccattgta tcttcttttc 240
caggttgtcc aataactgca tcacctacct aggggcagaa gccctcctgc aggccccttg
300 aaaggaatga caccatcctg gaagtctggt aaggcccctg ggcaggcctg
ttttagctct 360 ccgaacctca gtttttctat ctgtaaaatg gggtgacggg
agagaggaat ggcagaattt 420 tgaggatccc ttctgattct gacattcagt
gagaatgatt ctgcatgtga aggatctgat 480 tctctgtcta agaaagaagt
ctttacctct ttaagtaggg agcaatgatt tcatttttaa 540 a 541 9 1101 DNA E.
coli CDS (1)...(1101) 9 atg aaa gtt aaa gta ctg tcc ctc ctg gtc cca
gct ctg ctg gta gca 48 Met Lys Val Lys Val Leu Ser Leu Leu Val Pro
Ala Leu Leu Val Ala 1 5 10 15 ggc gca gca aac gct gct gaa gtt tac
aac aaa gac ggc aac aaa tta 96 Gly Ala Ala Asn Ala Ala Glu Val Tyr
Asn Lys Asp Gly Asn Lys Leu 20 25 30 gat ctg tac ggt aaa gta gac
ggc ctg cac tat ttc tct gac aac aaa 144 Asp Leu Tyr Gly Lys Val Asp
Gly Leu His Tyr Phe Ser Asp Asn Lys 35 40 45 gat gta gat ggc gac
cag acc tac atg cgt ctt ggc ttc aaa ggt gaa 192 Asp Val Asp Gly Asp
Gln Thr Tyr Met Arg Leu Gly Phe Lys Gly Glu 50 55 60 act cag gtt
act gac cag ctg acc ggt tac ggc cag tgg gaa tat cag 240 Thr Gln Val
Thr Asp Gln Leu Thr Gly Tyr Gly Gln Trp Glu Tyr Gln 65 70 75 80 atc
cag ggc aac agc gct gaa aac gaa aac aac tcc tgg acc cgt gtg 288 Ile
Gln Gly Asn Ser Ala Glu Asn Glu Asn Asn Ser Trp Thr Arg Val 85 90
95 gca ttc gca ggt ctg aaa ttc cag gat gtg ggt tct ttc gac tac ggt
336 Ala Phe Ala Gly Leu Lys Phe Gln Asp Val Gly Ser Phe Asp Tyr Gly
100 105 110 cgt aac tac ggc gtt gtt tat gac gta act tcc tgg acc gac
gta ctg 384 Arg Asn Tyr Gly Val Val Tyr Asp Val Thr Ser Trp Thr Asp
Val Leu 115 120 125 cca gaa ttc ggt ggt gac acc tac ggt tct gac aac
ttc atg cag cag 432 Pro Glu Phe Gly Gly Asp Thr Tyr Gly Ser Asp Asn
Phe Met Gln Gln 130 135 140 cgt ggt aac ggc ttc gcg acc tac cgt aac
act gac ttc ttc ggt ctg 480 Arg Gly Asn Gly Phe Ala Thr Tyr Arg Asn
Thr Asp Phe Phe Gly Leu 145 150 155 160 gtt gac ggc ctg aac ttt gct
gtt cag tac cag ggt aaa aac ggc aac 528 Val Asp Gly Leu Asn Phe Ala
Val Gln Tyr Gln Gly Lys Asn Gly Asn 165 170 175 cca tct ggt gaa ggc
ttt act agt ggc gta act aac aac ggt cgt gac 576 Pro Ser Gly Glu Gly
Phe Thr Ser Gly Val Thr Asn Asn Gly Arg Asp 180 185 190 gca ctg cgt
caa aac ggc gac ggc gtc ggc ggt tct atc act tat gat 624 Ala Leu Arg
Gln Asn Gly Asp Gly Val Gly Gly Ser Ile Thr Tyr Asp 195 200 205 tac
gaa ggt ttc ggt atc ggt ggt gcg atc tcc agc tcc aaa cgt act 672 Tyr
Glu Gly Phe Gly Ile Gly Gly Ala Ile Ser Ser Ser Lys Arg Thr 210 215
220 gat gct cag aac acc gct gct tac atc ggt aac ggc gac cgt gct gaa
720 Asp Ala Gln Asn Thr Ala Ala Tyr Ile Gly Asn Gly Asp Arg Ala Glu
225 230 235 240 acc tac act ggt ggt ctg aaa tac gac gct aac aac atc
tac ctg gct 768 Thr Tyr Thr Gly Gly Leu Lys Tyr Asp Ala Asn Asn Ile
Tyr Leu Ala 245 250 255 gct cag tac acc cag acc tac aac gca act cgc
gta ggt tcc ctg ggt 816 Ala Gln Tyr Thr Gln Thr Tyr Asn Ala Thr Arg
Val Gly Ser Leu Gly 260 265 270 tgg gcg aac aaa gca cag aac ttc gaa
gct gtt gct cag tac cag ttc 864 Trp Ala Asn Lys Ala Gln Asn Phe Glu
Ala Val Ala Gln Tyr Gln Phe 275 280 285 gac ttc ggt ctg cgt ccg tcc
ctg gct tac ctg cag tct aaa ggt aaa 912 Asp Phe Gly Leu Arg Pro Ser
Leu Ala Tyr Leu Gln Ser Lys Gly Lys 290 295 300 aac ctg ggt cgt ggc
tac gac gac gaa gat atc ctg aaa tat gtt gat 960 Asn Leu Gly Arg Gly
Tyr Asp Asp Glu Asp Ile Leu Lys Tyr Val Asp 305 310 315 320 gtt ggt
gct acc tac tac ttc aac aaa aac atg tcc acc tac gtt gac 1008 Val
Gly Ala Thr Tyr Tyr Phe Asn Lys Asn Met Ser Thr Tyr Val Asp 325 330
335 tac aaa atc aac ctg ctg gac gac aac cag ttc act cgt gac gct ggc
1056 Tyr Lys Ile Asn Leu Leu Asp Asp Asn Gln Phe Thr Arg Asp Ala
Gly 340 345 350 atc aac act gat aac atc gta gct ctg ggt ctg gtt tac
cag ttc 1101 Ile Asn Thr Asp Asn Ile Val Ala Leu Gly Leu Val Tyr
Gln Phe 355 360 365 10 367 PRT E. coli 10 Met Lys Val Lys Val Leu
Ser Leu Leu Val Pro Ala Leu Leu Val Ala 1 5 10 15 Gly Ala Ala Asn
Ala Ala Glu Val Tyr Asn Lys Asp Gly Asn Lys Leu 20 25 30 Asp Leu
Tyr Gly Lys Val Asp Gly Leu His Tyr Phe Ser Asp Asn Lys 35 40 45
Asp Val Asp Gly Asp Gln Thr Tyr Met Arg Leu Gly Phe Lys Gly Glu 50
55 60 Thr Gln Val Thr Asp Gln Leu Thr Gly Tyr Gly Gln Trp Glu Tyr
Gln 65 70 75 80 Ile Gln Gly Asn Ser Ala Glu Asn Glu Asn Asn Ser Trp
Thr Arg Val 85 90 95 Ala Phe Ala Gly Leu Lys Phe Gln Asp Val Gly
Ser Phe Asp Tyr Gly 100 105 110 Arg Asn Tyr Gly Val Val Tyr Asp Val
Thr Ser Trp Thr Asp Val Leu 115 120 125 Pro Glu Phe Gly Gly Asp Thr
Tyr Gly Ser Asp Asn Phe Met Gln Gln 130 135 140 Arg Gly Asn Gly Phe
Ala Thr Tyr Arg Asn Thr Asp Phe Phe Gly Leu 145 150 155 160 Val Asp
Gly Leu Asn Phe Ala Val Gln Tyr Gln Gly Lys Asn Gly Asn 165 170 175
Pro Ser Gly Glu Gly Phe Thr Ser Gly Val Thr Asn Asn Gly Arg Asp 180
185 190 Ala Leu Arg Gln Asn Gly Asp Gly Val Gly Gly Ser Ile Thr Tyr
Asp 195 200 205 Tyr Glu Gly Phe Gly Ile Gly Gly Ala Ile Ser Ser Ser
Lys Arg Thr 210 215 220 Asp Ala Gln Asn Thr Ala Ala Tyr Ile Gly Asn
Gly Asp Arg Ala Glu 225 230 235 240 Thr Tyr Thr Gly Gly Leu Lys Tyr
Asp Ala Asn Asn Ile Tyr Leu Ala 245 250 255 Ala Gln Tyr Thr Gln Thr
Tyr Asn Ala Thr Arg Val Gly Ser Leu Gly 260 265 270 Trp Ala Asn Lys
Ala Gln Asn Phe Glu Ala Val Ala Gln Tyr Gln Phe 275 280 285 Asp Phe
Gly Leu Arg Pro Ser Leu Ala Tyr Leu Gln Ser Lys Gly Lys 290 295 300
Asn Leu Gly Arg Gly Tyr Asp Asp Glu Asp Ile Leu Lys Tyr Val Asp 305
310 315 320 Val Gly Ala Thr Tyr Tyr Phe Asn Lys Asn Met Ser Thr Tyr
Val Asp 325 330 335 Tyr Lys Ile Asn Leu Leu Asp Asp Asn Gln Phe Thr
Arg Asp Ala Gly 340 345 350 Ile Asn Thr Asp Asn Ile Val Ala Leu Gly
Leu Val Tyr Gln Phe 355 360 365 11 21 DNA Artificial Sequence
primer 11 ctggctgagt gccagacatc t 21 12 17 DNA Artificial Sequence
primer 12 ggcgggatgg agtggaa 17 13 21 DNA Artificial Sequence
primer 13 ccacctcaag ctctggtgat c 21 14 23 DNA Artificial Sequence
primer 14 gttgactctt ttggcctttt cag 23 15 23 DNA Artificial
Sequence primer 15 ccttaccaga cttccaggat ggt 23 16 25 DNA
Artificial Sequence primer 16 tgtccaataa ctgcatcacc tacct 25 17 13
DNA Artificial Sequence primer 17 tgctccggcg cca 13 18 14 DNA
Artificial Sequence primer 18 ctgctctggc gcca 14 19 16 DNA
Artificial Sequence primer 19 ctctgttgcc ccagaa 16 20 15 DNA
Artificial Sequence primer 20 ctctgttgcg ccaga 15 21 15 DNA
Artificial Sequence primer 21 ctttcaaggg cctgc 15 22 15 DNA
Artificial Sequence primer 22 cctttcaagg ggcct 15
* * * * *