U.S. patent application number 10/884695 was filed with the patent office on 2005-03-10 for rna processing protein complexes and uses thereof.
This patent application is currently assigned to PTC Therapeutics, Inc.. Invention is credited to Paushkin, Sergey, Trotta, Christopher R..
Application Number | 20050053985 10/884695 |
Document ID | / |
Family ID | 33564010 |
Filed Date | 2005-03-10 |
United States Patent
Application |
20050053985 |
Kind Code |
A1 |
Trotta, Christopher R. ; et
al. |
March 10, 2005 |
RNA processing protein complexes and uses thereof
Abstract
The invention provides human protein complexes with endonuclease
activity. In particular, the invention provides human protein
complexes with tRNA splicing endonuclease activity and/or 3' end
pre-mRNA endonuclease activity. The invention also provides a
splice variant of human Sen2, namely human Sen2deltaEx8, and human
protein complexes comprising human Sen2deltaEx8. The human
Sen2deltaEx8 complexes have pre-tRNA cleavage activity and/or 3'
end pre-mRNA endonuclease activity. The invention also provides
human protein complexes with pre-ribosomal RNA cleavage activity.
The invention also provides antibodies that immunospecifically bind
to a complex described herein or a component thereof, and methods
of diagnosing, preventing, treating, managing or ameliorating a
disorder utilizing such antibodies. The present invention also
provides methods utilizing the complexes described herein, inter
alia, in screening, diagnosis, and therapy. The invention further
provides methods of preparing and purifying the complexes. The
present invention further provides methods of identifying a
compound that modulates the expression of a component of a complex
described herein, the formation of a complex described herein or
the activity of a complex described herein, and methods of
preventing, treating, managing or ameliorating a disorder, such as
a proliferative disorder, or a symptom thereof utilizing a compound
identified in accordance with the methods.
Inventors: |
Trotta, Christopher R.;
(Somerset, NJ) ; Paushkin, Sergey; (Belle Mead,
NJ) |
Correspondence
Address: |
JONES DAY
222 EAST 41ST ST
NEW YORK
NY
10017
US
|
Assignee: |
PTC Therapeutics, Inc.
|
Family ID: |
33564010 |
Appl. No.: |
10/884695 |
Filed: |
July 2, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60484615 |
Jul 2, 2003 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/199; 435/91.2 |
Current CPC
Class: |
C12Q 1/6897 20130101;
C12N 9/22 20130101; A61P 35/00 20180101; A61P 43/00 20180101; C07K
14/47 20130101 |
Class at
Publication: |
435/006 ;
435/091.2; 435/199 |
International
Class: |
C12Q 001/68; C12P
019/34; C12N 009/22 |
Claims
What is claimed is:
1. A purified complex, wherein the complex comprises: (i) Sen2
(ACCESSION NO.: NP.sub.--079541), or a protein encoded by a nucleic
acid that hybridizes to the Sen2 encoding nucleic acid (ACCESSION
NO.: NM.sub.--025265) or its complement under high stringency
conditions; (ii) Sen15 or a protein encoded by a nucleic acid that
hybridizes to the Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the Sen34
encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (iv) Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions, wherein said high stringency conditions comprise
hybridization in a buffer consisting of 6.times.SSC, 50 mM Tris-HCl
(pH=7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA and 100
.mu.g/ml denatured salmon sperm DNA, for 48 hours at 65.degree. C.,
washing in a buffer consisting of 2.times.SSC, 0.01% PVP, 0.01%
Ficoll and 0.01% BSA, for 45 minutes at 37.degree. C., and washing
in a buffer consisting of 0.1.times.SSC, for 45 minutes at
50.degree. C.
2. The complex of claim 1, wherein the complex further comprises
Clp1 (ACCESSION NO.:NP006822) or a protein encoded by a nucleic
acid that hybridizes to the Clp1 encoding nucleic acid (ACCESSION
NO.: NM.sub.--006831) or its complement under high stringency
conditions.
3. The complex of claim 2, wherein the complex further comprises
one or more of the following: (i) Cleavage-Polyadenylation
Specificity Factor or proteins encoded by nucleic acids that
hybridize to the Cleavage-Polyadenylation Specificity Factor
encoding nucleic acids or their complements under high stringency
conditions; (ii) Cleavage Factor I.sub.m or proteins encoded by
nucleic acids that hybridize to the Cleavage Factor I.sub.m
encoding nucleic acid or their complements under high stringency
conditions; (iii) Cleavage Factor II.sub.m or proteins encoded by
nucleic acids that hybridize to the Cleavage Factor II.sub.m
encoding nucleic acids or their complements under high stringency
conditions; and (iv) Cleavage Stimulation Factor or proteins
encoded by nucleic acids that hybridize to the Cleavage Stimulation
Factor encoding nucleic acids or their complements under high
stringency conditions.
4. The complex of claim 2, wherein the complex further comprises
one or more of the following: (i) CPSF160 or a protein encoded by a
nucleic acid that hybridizes to CPSF160 encoding nucleic acid or
its complement under high stringency conditions; (ii) CPSF30 or a
protein encoded by a nucleic acid that hybridizes to CPSF30
encoding nucleic acid or its complement under high stringency
conditions; (iii) CstF64 or a protein encoded by a nucleic acid
that hybridizes to CstF64 encoding nucleic acid or its complement
under high stringency conditions; (iv) symplekin or a protein
encoded by a nucleic acid that hybridizes to symplekin encoding
nucleic acid or its complement under high stringency conditions
5. A purified complex comprising Sen2deltaEx8, or a protein encoded
by a nucleic acid that hybridizes under stringent hybridization
conditions to a Sen2deltaEx8 encoding nucleic acid.
6. A purified complex, wherein the complex comprises: (i)
Sen2deltaEx8 (SEQ ID NO.: 2), or a protein encoded by a nucleic
acid that hybridizes to the Sen2deltaEx8 encoding nucleic acid (SEQ
ID NO.: 1) or its complement under high stringency conditions; and
(ii) Sen54 (ACCESSION NO.:XP.sub.--208944), or a protein encoded by
a nucleic acid that hybridizes to the Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions; wherein said high stringency conditions
comprise hybridization in a buffer consisting of 6.times.SSC, 50 mM
Tris-HCl (pH=7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA
and 100 .mu.g/ml denatured salmon sperm DNA, for 48 hours at
65.degree. C., washing in a buffer consisting of 2.times.SSC, 0.01%
PVP, 0.01% Ficoll and 0.01% BSA, for 45 minutes at 37.degree. C.,
and washing in a buffer consisting of 0. 1.times.SSC, for 45
minutes at 50.degree. C.
7. The purified complex of claim 6, wherein the complex further
comprises: Clp1 (ACCESSION NO.:NP.sub.--006822) or a protein
encoded by a nucleic acid that hybridizes to the Clp1 encoding
nucleic acid (ACCESSION NO.: NM.sub.--006831) or its complement
under high stringency conditions.
8. The purified complex of claim 7, wherein the complex further
comprises one or more of the following: (i)
Cleavage-Polyadenylation Specificity Factor or proteins encoded by
nucleic acids that hybridize to the Cleavage-Polyadenylation
Specificity Factor encoding nucleic acids or their complements
under high stringency conditions; (ii) Cleavage Factor I.sub.m or
proteins encoded by nucleic acids that hybridize to the Cleavage
Factor I.sub.m encoding nucleic acids or their complements under
high stringency conditions; (iii) Cleavage Factor II.sub.m or
proteins encoded by nucleic acids that hybridize to the Cleavage
Factor II.sub.m encoding nucleic acids or their complements under
high stringency conditions; and (iv) Cleavage Stimulation Factor or
proteins encoded by nucleic acids that hybridize to the Cleavage
Stimulation Factor encoding nucleic acids or their complements
under high stringency conditions.
9. A purified complex, wherein the complex comprises: (i)
Sen2deltaEx8 (SEQ ID NO.: 2), or a protein encoded by a nucleic
acid that hybridizes to the Sen2deltaEx8 encoding nucleic acid (SEQ
ID NO.: 1) or its complement under high stringency conditions; (ii)
Sen15 or a protein encoded by a nucleic acid that hybridizes to the
Sen15 encoding nucleic acid (ACCESSION NO.:NM.sub.--052965) or its
complement under high stringency conditions; (iii) Sen34 (ACCESSION
NO.:NP.sub.--076980), or a protein encoded by a nucleic acid that
hybridizes to the Sen34 encoding nucleic acid (ACCESSION
NO.:NM.sub.--024075) or its complement under high stringency
conditions; and (iv) Sen54 (ACCESSION NO.:XP.sub.--208944), or a
protein encoded by a nucleic acid that hybridizes to the Sen54
encoding nucleic acid (ACCESSION NO.:XM.sub.--208944) or its
complement under high stringency conditions, wherein said high
stringency conditions comprise hybridization in a buffer consisting
of 6.times.SSC, 50 mM Tris-HCl (pH=7.5), 1 mM EDTA, 0.02% PVP,
0.02% Ficoll, 0.02% BSA and 100 .mu.g/ml denatured salmon sperm
DNA, for 48 hours at 65.degree. C., washing in a buffer consisting
of 2.times.SSC, 0.01% PVP, 0.01% Ficoll and 0.01% BSA, for 45
minutes at 37.degree. C., and washing in a buffer consisting of
0.1.times.SSC, for 45 minutes at 50.degree. C.
10. The purified complex of claim 9, wherein the complex further
comprises: Clp1 (ACCESSION NO.:NP.sub.--006822) or a protein
encoded by a nucleic acid that hybridizes to the Clp1 encoding
nucleic acid (ACCESSION NO.: NM.sub.--00683 1) or its complement
under high stringency conditions.
11. The purified complex of claim 10, wherein the complex further
comprises: (i) Cleavage-Polyadenylation Specificity Factor or
proteins encoded by nucleic acids that hybridize to the
Cleavage-Polyadenylation Specificity Factor encoding nucleic acids
or their complements under high stringency conditions; (ii)
Cleavage Factor I.sub.m or proteins encoded by nucleic acids that
hybridize to the Cleavage Factor I.sub.m encoding nucleic acids or
their complements under high stringency conditions; (iii) Cleavage
Factor II.sub.m or proteins encoded by nucleic acids that hybridize
to the Cleavage Factor II.sub.m encoding nucleic acids or their
complements under high stringency conditions; and (iv) Cleavage
Stimulation Factor or proteins encoded by nucleic acids that
hybridize to the Cleavage Stimulation Factor encoding nucleic acids
or their complements under high stringency conditions.
12. The complex of claim 10, wherein the complex further comprises
one or more of the following: (i) CPSF160 or a protein encoded by a
nucleic acid that hybridizes to CPSF160 encoding nucleic acid or
its complement under high stringency conditions; (ii) CPSF30 or a
protein encoded by a nucleic acid that hybridizes to CPSF30
encoding nucleic acid or its complement under high stringency
conditions; (iii) CstF64 or a protein encoded by a nucleic acid
that hybridizes to CstF64 encoding nucleic acid or its complement
under high stringency conditions; and (iv) symplekin or a protein
encoded by a nucleic acid that hybridizes to symplekin encoding
nucleic acid or its complement under high stringency conditions
13. A purified complex, wherein the complex comprises: (i) Sen15 or
a protein encoded by a nucleic acid that hybridizes to the Sen15
encoding nucleic acid (ACCESSION NO.:NM.sub.--052965) or its
complement under high stringency conditions; and (ii) Sen34
(ACCESSION NO.:NP.sub.--076980), or a protein encoded by a nucleic
acid that hybridizes to the Sen34 encoding nucleic acid (ACCESSION
NO.:NM.sub.--024075) or its complement under high stringency
conditions.
14. The complex of claim 1, 6, 9, or 13, wherein at least two
proteins of the complex are covalently linked to each other.
15. The complex of claim 1, 6, 9, or 13, wherein at least two
proteins of the complex are non-covalently linked to each
other.
16. The complex of claim 1, 6, 9, or 13, wherein at least one
protein of the complex is a functionally active derivative, wherein
the functionally active derivative is a fusion protein comprising
the protein fused to an amino acid sequence different from the
protein.
17. The complex of claim 1, 6, 9, or 13, wherein the complex
comprises at least one fragment of a protein, wherein the fragment
binds to one or more other protein components of the complex.
18. An antibody or a fragment thereof that immunospecifically binds
to the complex of claim 1, 6, 9, or 13 with a higher affinity than
the affinity of the antibody or antibody fragment to any of the
protein components of the complex.
19. An antibody or a fragment thereof that immunospecifically binds
to Sen2 (Accession No.:NP.sub.--079541), Sen15 (Accession
No.:NP.sub.--443197), Sen34 (Accession No.:NP.sub.--076980) or
Sen54 (Accession No.:XP.sub.--208944).
20. A method for generating an antibody comprising immunizing an
animal with the complex of claim 1, 6, 9, or 13.
21. A purified nucleic acid, wherein the nucleic acid encodes a
protein comprising the amino acid sequence of SEQ ID NO.:12.
22. A purified nucleic acid, wherein the nucleic acid comprises the
nucleic acid sequence of SEQ ID NO.:11.
23. A purified nucleic acid comprising a contiguous open reading
frame which encodes a polypeptide comprising amino acid 280 to
amino acid 330 of SEQ ID NO:12.
24. A purified nucleic acid which hybridizes over its full length
to the complement of a nucleic acid comprising SEQ ID NO:11 under
high stringency conditions, wherein said high stringency conditions
comprise hybridization in a buffer consisting of 6.times.SSC, 50 mM
Tris-HCl (pH=7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA
and 100 .mu.g/ml denatured salmon sperm DNA, for 48 hours at
65.degree. C., washing in a buffer consisting of 2.times.SSC, 0.01%
PVP, 0.01% Ficoll and 0.01% BSA, for 45 minutes at 37.degree. C.,
and washing in a buffer consisting of 0.1.times.SSC, for 45 minutes
at 50.degree. C.
25. The nucleic acid of claim 24, wherein the nucleic acid encodes
a polypeptide that has RNA nucleolytic activity.
26. The nucleic acid of claim 22, 23, or 24, further comprising a
heterologous nucleic acid sequence.
27. A vector comprising the nucleic acid of claim 21, 22, 23, or
24.
28. A host cell comprising the vector of claim 27.
29. A host cell comprising the nucleic acid of claim 21, 22, 23, or
24.
30. A method for producing a polypeptide comprising culturing the
host cell of claim 28.
31. A method for producing a polypeptide comprising culturing the
host cell of claim 29.
32. A purified polypeptide comprising the amino acid sequence of
SEQ ID NO:12, or the amino acid sequence encoded by a nucleic acid
sequence that hybridizes over its full length to the complement of
SEQ ID NO:11 under high stringency conditions, wherein said high
stringency conditions comprise hybridization in a buffer consisting
of 6.times.SSC, 50 mM Tris-HCl (pH=7.5), 1 mM EDTA, 0.02% PVP,
0.02% Ficoll, 0.02% BSA and 100 .mu.g/ml denatured salmon sperm
DNA, for 48 hours at 65.degree. C., washing in a buffer consisting
of 2.times.SSC, 0.01% PVP, 0.01% Ficoll and 0.01% BSA, for 45
minutes at 37.degree. C., and washing in a buffer consisting of
0.1.times.SSC, for 45 minutes at 50.degree. C.
33. The polypeptide of claim 32 further comprising a heterologous
amino acid sequence.
34. An antibody or fragment thereof that immunospecifically binds
to the polypeptide of claim 32.
35. The antibody or antibody fragment of claim 34, wherein the
antibody does not bind to Sen2 (ACCESSION NO.:
NP.sub.--079541).
36. A method for purifying the complex of claim 1, 6, 9, or 13,
wherein the method comprises: (a) preparing a cell extract or a
nuclear extract from a cell, wherein the cell expresses all protein
components of the complex and wherein at least one of the protein
components is fused to a peptide tag; and (b) purifying the complex
by virtue of the peptide tag.
37. A pharmaceutical composition comprising the complex of claim 1,
6, 9, or 13 and a pharmaceutically acceptable carrier.
38. A pharmaceutical composition comprising the antibody of claim
34.
39. A method of identifying a compound that modulates the formation
of a complex, wherein the method comprises the following steps: (a)
contacting a cell with a compound, wherein the cell comprises all
components of the complex of claim 1, 6, 9, or 13; and (b)
measuring the amount of the complex of formed in the cell.
40. The method of claim 39 wherein the cell is a human cell.
41. The method of claim 40, wherein the cell is a 293T, HeLa, MCF7,
Wi-38, SkBr3, Jurkat, CEM, or a THP1 cell.
42. The method of claim 39, wherein the method comprises isolating
the complex of claim 1, 6, 9, or 13 from the cell.
43. The method of claim 39, wherein the amount of complex is
measured by FRET.
44. The method of claim 39, wherein the cell is engineered to
express at least one of the protein components of the complex.
45. A method of identifying a compound that modulates the formation
of a complex, wherein the method comprises the following steps: (a)
incubating (i) Sen2 (ACCESSION NO.: NP.sub.--079541), or a protein
encoded by a nucleic acid that hybridizes to the Sen2 encoding
nucleic acid (ACCESSION NO.: NM.sub.--025265) or its complement
under high stringency conditions; (ii) Sen15 or a protein encoded
by a nucleic acid that hybridizes to the Sen15 encoding nucleic
acid (ACCESSION NO.:NM.sub.--052965) or its complement under high
stringency conditions; (iii) Sen34 (ACCESSION NO.:NP.sub.--076980),
or a protein encoded by a nucleic acid that hybridizes to the Sen34
encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (iv) Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; in the presence of a compound under conditions
conducive to formation of a complex comprising the proteins; and
(b) determining the amount of the complex, wherein a difference in
the amount of the complex determined in step (b) relative to the
amount of the complex determined in the absence of the compound
indicates that the compound modulates the formation of the
complex.
46. The method of claim 45, wherein Clp1 (ACCESSION
NO.:NP.sub.--006822) or a protein encoded by a nucleic acid that
hybridizes to the Clp1 encoding nucleic acid (ACCESSION NO.:
NM.sub.--006831) or its complement under high stringency conditions
is also incubated in step (a).
47. A method of identifying a compound that modulates the formation
of a complex, wherein the method comprises the following steps: (a)
incubating (i) Sen2deltaEx8 (SEQ ID NO.: 2), or a protein encoded
by a nucleic acid that hybridizes to the Sen2deltaEx8 encoding
nucleic acid (SEQ ID NO.: 1) or its complement under high
stringency conditions; (ii) Sen15 or a protein encoded by a nucleic
acid that hybridizes to the Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the Sen34
encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (iv) Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; in the presence of a compound under conditions
conducive to formation of a complex comprising the proteins; and
(b) determining the amount of the complex, wherein a difference in
the amount of the complex determined in step (b) relative to the
amount of the complex determined in the absence of the compound
indicates that the compound modulates the formation of the
complex.
48. The method of claim 47, wherein Clp1 (ACCESSION
NO.:NP.sub.--006822) or a protein encoded by a nucleic acid that
hybridizes to the Clp1 encoding nucleic acid (ACCESSION NO.:
NM.sub.--006831) or its complement under high stringency conditions
is also incubated in step (a).
49. A method of identifying a compound that modulates the stability
of a complex, wherein the method comprises the following steps: (a)
incubating the complex of claim 1, 6, 9, or 13 in the presence of a
compound under conditions conducive to maintaining the complex; and
(b) determining the amount of the complex, wherein a difference in
the amount of the complex determined in step (b) relative to the
amount of the complex determined in the absence of the compound
indicates that the compound modulates the stability of the
complex.
50. The method of claim 45 or 46, wherein the method further
comprises the step of comparing the ratio between the formed
complex relative to the amount of the individual proteins.
51. The method of claim 45 or 46, wherein the proteins are
incubated in step (a) in equimolar amounts.
52. A method for identifying a compound that modulates human tRNA
splicing endonuclease activity, said method comprising: (a)
contacting a member of a library of compounds with a the complex of
claim 1 and a nucleic acid comprising a reporter gene, wherein the
reporter gene comprises a tRNA intron, and wherein all factors
required for gene expression are present; and (b) detecting the
expression of said reporter gene, wherein a compound that modulates
tRNA splicing endonuclease activity is identified if the expression
of said reporter gene in the presence of a compound is altered
relative to the expression of said reporter gene in the absence of
said compound or the presence of a control.
53. A method for identifying a compound that modulates 3' end
pre-mRNA endonuclease cleavage activity, said method comprising:
(a) contacting a member of a library of compounds with a the
complex of claim 1 or 9 and a nucleic acid comprising a reporter
gene and a cleavage site for a 3' end pre-mRNA endonuclease,
wherein the reporter gene is located 3' of the cleavage site for a
3' end pre-mRNA endonuclease, and wherein all factors required for
gene expression are present; and (b) detecting the expression of
said reporter gene, wherein a compound that modulates 3' end
pre-mRNA endonuclease cleavage activity is identified if the
expression of said reporter gene in the presence of a compound is
altered relative to the expression of said reporter gene in the
absence of said compound or the presence of a control.
54. A method of identifying a compound that modulates human tRNA
splicing endonuclease activity, said method comprising: (a)
contacting the complex of claim 1 with a substrate of a tRNA
splicing endonuclease and a member of a library of compounds,
wherein the substrate is labeled at the 5' end with a fluorophore
and at the 3' end with a quencher; and (b) measuring the activity
of the tRNA splicing endonuclease, wherein a compound that
modulates tRNA splicing activity is identified if a fluorescent
signal is altered in the presence of the compound relative to the
absence of the compound or the presence of a control.
55. A method of identifying a compound that modulates human 3' end
pre-mRNA endonuclease cleavage activity, said method comprising:
(a) contacting the complex of claim 1 or 9 with a substrate of a 3'
end pre-mRNA endonuclease and a member of a library of compounds,
wherein the substrate is labeled at the 5' end with a fluorophore
and at the 3' end with a quencher; and (b) measuring the activity
of the 3' end pre-mRNA endonuclease, wherein a compound that
modulates 3' end pre-mRNA endonuclease activity is identified if a
fluorescent signal is altered in the presence of the compound
relative to the absence of the compound or the presence of a
control.
56. A method of identifying a compound that modulates human tRNA
splicing endonuclease activity, said method comprising: (a)
contacting the complex of claim 1 with a substrate of a tRNA
splicing endonuclease and a member of a library of compounds,
wherein said substrate is labeled at the 5' end with a fluorescent
donor moiety and labeled at the 3' end with a fluorescent acceptor
moiety; and (b) measuring the activity of the tRNA splicing
endonuclease, wherein a compound that modulates tRNA splicing
activity is identified if the fluorescence emission of the
fluorescent acceptor moiety at the wavelength of the fluorescent
donor moiety in the presence of the compound is altered relative to
the absence of the compound or the presence of a control.
57. A method of identifying a compound that modulates human 3' end
pre-mRNA endonuclease cleavage activity, said method comprising:
(a) contacting the complex of claim 1 or 9 with a substrate of a 3'
end pre-mRNA endonuclease and a member of a library of compounds,
wherein said substrate is labeled at the 5' end with a fluorescent
donor moiety and labeled at the 3' end with a fluorescent acceptor
moiety; and (b) measuring the activity of the 3' end pre-mRNA
endonuclease, wherein a compound that modulates 3' end pre-mRNA
endonuclease activity is identified if the fluorescence emission of
the fluorescent acceptor moiety at the wavelength of the
fluorescent donor moiety in the presence of the compound is altered
relative to the absence of the compound or the presence of a
control.
58. The method of claim 39, wherein the compound is tested for
inhibition of the formation of the complex.
59. The method of claim 45 or 46, wherein the compound is tested
for inhibition of the formation of the complex.
60. A method of treating, preventing, or managing a proliferative
disorder comprising administering a pharmaceutically acceptable
amount of a compound identified by the method of claim 58.
61. A method of treating, preventing, or managing a proliferative
disorder comprising administering a pharmaceutically acceptable
amount of a compound identified by the method of claim 59.
62. The method of claim 52, 54 or 56, wherein the compound is
tested for inhibition of human tRNA splicing endonuclease
activity.
63. A method of treating, preventing, or managing a proliferative
disorder comprising administering a pharmaceutically acceptable
amount of a compound identified by the method of claim 62.
64. The method of claim 53, wherein the compound is tested for
inhibition of human 3' end pre-mRNA endonuclease activity.
65. The method of claim 55, wherein the compound is tested for
inhibition of human 3' end pre-mRNA endonuclease activity
66. The method of claim 57, wherein the compound is tested for
inhibition of human 3' end pre-mRNA endonuclease activity
67. A method of treating, preventing, or managing a proliferative
disorder comprising administering a pharmaceutically acceptable
amount of a compound identified by the method of claim 64.
68. A method of treating, preventing, or managing a proliferative
disorder comprising administering a pharmaceutically acceptable
amount of a compound identified by the method of claim 65.
69. A method of treating, preventing, or managing a proliferative
disorder comprising administering a pharmaceutically acceptable
amount of a compound identified by the method of claim 66.
70. The method of claim 52, 54 or 56, wherein the compound enhances
tRNA splicing endonuclease activity.
71. The method of claim 53, wherein the compound enhances 3' end
pre-mRNA endonuclease activity.
72. The method of claim 55, wherein the compound enhances 3' end
pre-mRNA endonuclease activity.
73. The method of claim 57, wherein the compound enhances 3' end
pre-mRNA endonuclease activity.
74. The method of claim 52, 54 or 56, wherein the method further
comprises determining the structure of the compound.
75. The method of claim 53, wherein the method further comprises
determining the structure of the compound.
76. The method of claim 55, wherein the method further comprises
determining the structure of the compound.
77. The method of claim 57, wherein the method further comprises
determining the structure of the compound.
78. The method of claim 45, 47, 52, 54, or 56, wherein the compound
is selected from a combinatorial library of compounds comprising
peptoids; random biooligomers; diversomers such as hydantoins,
benzodiazepines and dipeptides; vinylogous polypeptides;
nonpeptidal peptidomimetics; oligocarbamates; peptidyl
phosphonates; peptide nucleic acid libraries; antibody libraries;
carbohydrate libraries; and small organic molecule libraries.
79. The method of claim 39, wherein the compound is selected from a
combinatorial library of compounds comprising peptoids; random
biooligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; and small
organic molecule libraries.
80. The method of claim 49, wherein the compound is selected from a
combinatorial library of compounds comprising peptoids; random
biooligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; and small
organic molecule libraries.
81. The method of claim 53, wherein the compound is selected from a
combinatorial library of compounds comprising peptoids; random
biooligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; and small
organic molecule libraries.
82. The method of claim 55, wherein the compound is selected from a
combinatorial library of compounds comprising peptoids; random
biooligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; and small
organic molecule libraries.
83. The method of claim 57, wherein the compound is selected from a
combinatorial library of compounds comprising peptoids; random
biooligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; and small
organic molecule libraries.
84. The method of claim 52, 54, or 56, wherein the compound
directly binds the complex.
85. The method ofclaim 39, wherein the compound directly binds the
complex.
86. The method of claim 49, wherein the compound directly binds the
complex.
87. A method for diagnosing a proliferative disorder in a subject,
wherein the method comprises (a) contacting a sample from the
subject with an antibody or fragment thereof that
immunospecifically binds to a protein selected from the group
selected of Sen2, Sen15, Sen34, Sen54, Clp1, Sen.DELTA.8Ex, CPSF,
CFI.sub.m, CFII.sub.m, and CstF; and (b) detecting the antibody of
fragment thereof, wherein a reduced level of the protein compared
to the level of the protein in a subject without a proliferative
disorder indicates that the subject has a proliferative
disorder.
88. A method for diagnosing a proliferative disorder in a subject,
wherein the method comprises (a) contacting a sample from the
subject with an antibody or fragment thereof that
immunospecifically binds to the complex of claim 1, 6, 9, or 13;
and (b) detecting the antibody of fragment thereof, wherein a
reduced level of the complex compared to the level of the complex
in a subject without a proliferative disorder indicates that the
subject has a proliferative disorder.
Description
RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional
Application Ser. No. 60/484,615, filed Jul. 2, 2003, the entire
disclosure of which is incorporated by reference herein in its
entirety.
1. INTRODUCTION
[0002] The invention provides human protein complexes with
endonuclease activity. In particular, the invention provides human
protein complexes with tRNA splicing endonuclease activity and/or
3' end pre-mRNA endonuclease activity. The invention also provides
a splice variant of human Sen2, namely human Sen2deltaEx8, and
human protein complexes comprising human Sen2deltaEx8. The human
Sen2deltaEx8 complexes have RNA-nucleolytic activity. The invention
also provides human protein complexes with pre-ribosomal RNA
cleavage activity. The invention also provides antibodies that
immunospecifically bind to a complex described herein or a
component thereof, and methods of diagnosing, preventing, treating,
managing or ameliorating a disorder utilizing such antibodies. The
present invention also provides methods utilizing the complexes
described herein, inter alia, in screening, diagnosis, and therapy.
The invention further provides methods of preparing and purifying
the complexes. The present invention further provides methods of
identifying a compound that modulates the expression of a component
of a complex described herein, the formation of a complex described
herein or the activity of a complex described herein, and methods
of preventing, treating, managing or ameliorating a disorder, such
as a proliferative disorder, or a symptom thereof utilizing a
compound identified in accordance with the methods.
2. BACKGROUND OF THE INVENTION
[0003] 2.1 tRNA Production
[0004] Maturation and maintenance of tRNA within eucaryal cells
requires several processing events including 5' and 3'
end-trimming, modification of specific bases and in some cases,
intron removal. The enzymes for these various steps in processing
have been characterized in the yeast, archaeal, mammalian and
bacterial systems (Deutscher, M. P. tRNA Processing Nucleases, in
tRNA:Structure, Biosynthesis and Function, D. Soll and U.
RjaBhandary (eds.), American Society for Microbiology, Washington
D.C., (1995), pp. 51-65). 5' end trimming requires the activity of
Rnase P and 3' end trimming requires the function of various endo-
and exo-nucleases. Modification occurs through interaction of tRNA
with various modification enzymes. Most tRNAs contain a number of
global as well as, species-specific modifications (Bjork, G.
Biosynthesis and Function of Modified Nucleosides, in tRNA:
Structure, Biosynthesis and Function, D. Soll and U. RajBhandary
(eds.), American Society for Microbiology, Washington D.C., (1995),
pp. 165-205). In archaea and eucarya, several isoaccepting groups
of tRNA contain intervening sequences ranging in size from 14-105
nucleotides (Trotta, C. R. and Abelson, J. N. tRNA Splicing: An RNA
World Add-On or an Ancient Reaction? In RNA World II, Tom Cech, Ray
Gesteland and John Atkins (eds.), Cold Spring Harbor Laboratory
Press (1999) and Abelson et al., 1998, Journal of Biological
Chemistry 273:12685-12688). Removal of the intron requires the
activity of 3 enzymes. In the first step, the tRNA is recognized
and cleaved at the 5' and 3' junction by the tRNA splicing
endonuclease. The archaeal and eucaryal tRNA endonuclease are
evolutionary conserved enzymes and contain a similar active site to
achieve cleavage at the 5' and 3' splice sites. However, they have
diverged to recognize the tRNA substrate in a different manner. The
archaeal enzyme recognizes a conserved intronic structure known as
the bulge-helix-bulge. This structure is comprised of two
3-nucleotide bulges separated by a 4-nucleotide helix. Cleavage
occurs within each bulge to release the intron. The eucaryal
endonuclease recognizes the tRNA substrate in a mature domain
dependent fashion, measuring a set distance from the mature domain
to the 5' and 3' splice sites (Reyes et al., 1988, Cell
55:719-730). It has recently been demonstrated, however, that the
eucaryal enzyme requires a bulge at each splice site and that the
enzyme has actually retained the ability to recognize tRNA by an
intron-dependent recognition mechanism identical to that of the
archaeal endonuclease (Fruscoloni et al., 2001, EMBO Rep
2:217-221). Once cleaved, the tRNA half molecules are ligated by
the action of a unique tRNA splicing ligase (Trotta, C. R. and
Abelson, J. N. tRNA Splicing: An RNA World Add-On or an Ancient
Reaction? In RNA World II, Tom Cech, Ray Gesteland and John Atkins
(eds.), Cold Spring Harbor Laboratory Press (1999) and Abelson et
al., 1998, Journal of Biological Chemistry 273:12685-12688). In
yeast, the product of ligation is a tRNA with a phosphate at the
splice junction. Removal of the phosphate is carried out by a tRNA
2'-phosphotransferase to yield a mature tRNA product (Trotta, C. R.
and Abelson, J. N. tRNA Splicing: An RNA World Add-On or an Ancient
Reaction? In RNA World II, Tom Cech, Ray Gesteland and John Atkins
(eds.), Cold Spring Harbor Laboratory Press (1999) and Abelson et
al., 1998, Journal of Biological Chemistry 273:12685-12688).
[0005] tRNA is an important component in the translational
machinery and is quite stable compared to various other
protein-based components (elongation factors, amino-acyl
synthetases, etc.). tRNA molecules have very long half-lives.
Furthermore, like rRNA and ribosomes, tRNA is present in excess
within the cytoplasm of actively growing cells (Ikemura, T. and
Okeki, H., 1983, Cold Spring Harbor Symp. Quant. Biol.
47:1087-1097). Thus, specific targeting of tRNA molecules allows a
selective inhibition of uncontrolled cell proliferation and not
cell growth.
[0006] 2.2 Pre-mRNA Cleavage
[0007] Several processing steps are required before eukaryotic mRNA
precursors (pre-mRNAs) are exported to the cytoplasm. Pre-mRNA
processing includes capping of the 5' end, splicing, and the
generation of a new 3' end by endonucleolytic cleavage and
polyadenylation. Transcription, capping, splicing and 3' end
processing of pre-mRNAs are coupled processes in vivo (reviewed in
Barabino and Kelly, 1999, Cell, 99, 9-11; Minvielle-Sebastia and
Keller, 1999, Curr. Opin. Cell Biol., 11, 352-357; Zhoa et al.,
1999, Microbiol. Mol. Biol. Rev., 63, 405-445; Hirose and Manley,
2000, Genes Dev., 14, 1415-1429; and Proudfoot, 2000, Trends
Biochem. Sci., 25, 290-293).
[0008] The 3' end of the pre-mRNAs are generated in a two-step
reaction. The pre-mRNA is first cleaved endonucleolytically and the
upstream cleavage fragment is subsequently polyadenylated and the
downstream cleavage product is subsequently degraded. Six
transacting factors are required for the in vitro reconstitution of
mammalian 3' end processing, namely CPSF, CstF, CF I.sub.m,
CFII.sub.m, PAP, PABP2 (reviewed in Wahle and Ruegsegger, 1999,
FEMS Micro Rev., 23, 277-295; and Zhoa et al., 1999, Micoboil. Mol.
Biol Rev., 63, 405-445). Cleavage and polyadenylation specificity
factor (CPSF) and cleave stimulation factor (CstF) recognize the
hexanucleotide AAUAAA upstream and a G/U-rich sequence element
downstream of the cleavage site, respectively. In addition, the
cleavage complex contains cleavage factors I.sub.m (CF I.sub.m) and
II.sub.m (CF II.sub.m) and poly(A) polymerase (PAP). After the
first step, CstF, CF I.sub.m and CF II.sub.m are released together
with the downstream cleavage fragment. CPSF remains bound to the
upstream cleavage product and tethers PAP to the RNA. PAP is the
enzyme responsible for the addition of the poly(A) tail in a
processing reaction that also requires both CPSF and
poly(A)-binding protein II (PABP2).
[0009] 2.3 Cancer and Neoplastic Disease
[0010] Cancer is the second leading cause of death in the United
States. The American Cancer Society estimated that in 2001, there
would be 1.3 million new cases of cancer and that cancer will cause
550,000 deaths. Overall rates have declined by 1% per year during
the 1990s. There are 9 million Americans alive who have ever had
cancer. NIH estimates the direct medical costs of cancer as $60
billion.
[0011] Currently, cancer therapy involves surgery, chemotherapy
and/or radiation treatment to eradicate neoplastic cells in a
patient (see, for example, Stockdale, 1998, "Principles of Cancer
Patient Management", in Scientific American: Medicine, vol. 3,
Rubenstein and Federman, eds., Chapter 12, Section IV). All of
these approaches pose significant drawbacks for the patient.
Surgery, for example, can be contraindicated due to the health of
the patient or can be unacceptable to the patient. Additionally,
surgery might not completely remove the neoplastic tissue.
Radiation therapy is effective only when the irradiated neoplastic
tissue exhibits a higher sensitivity to radiation than normal
tissue, and radiation therapy can also often elicit serious side
effects. (Id.) With respect to chemotherapy, there are a variety of
chemotherapeutic agents available for treatment of neoplastic
disease. However, despite the availability of a variety of
chemotherapeutic agents, traditional chemotherapy has many
drawbacks (see, for example, Stockdale, 1998, "Principles Of Cancer
Patient Management" in Scientific American Medicine, vol. 3,
Rubenstein and Federman, eds., ch. 12, sect. 10). Almost all
chemotherapeutic agents are toxic, and chemotherapy can cause
significant, and often dangerous, side effects, including severe
nausea, bone marrow depression, immunosuppression, etc.
Additionally, many tumor cells are resistant or develop resistance
to chemotherapeutic agents through multi-drug resistance.
[0012] Therefore, there is a significant need in the art for novel
compounds and compositions, and methods that are useful for
treating cancer or neoplastic disease with reduced or without the
aforementioned side effects. Further, there is a need for cancer
treatments that provide cancer-cell-specific therapies with
increased specificity and decreased toxicity.
[0013] Citation of any reference herein is not to be constued as an
admission of its availability as prior art.
3. SUMMARY OF THE INVENTION
[0014] The invention provides complexes involved in the processing
of RNA. In particular the invention provides complexes with
RNA-nucleolytic activity that are involved in pre-tRNA splicing, 3'
end pre-mRNA endonuclease activity, pre-tRNA cleavage activity,
and/or the pre-ribosomal RNA cleavage activity. More specifically,
the invention provides a purified complex with RNA-nucleolytic
activity comprising two or more or any combination of the following
(i) human Sen2 or a functionally active derivative or a
functionally active fragment thereof; (ii) human Sen 15 or a
functionally active derivative or a functionally active fragment
thereof; (iii) human Sen34 or a functionally active derivative or a
functionally active fragment thereof; and (iv) human Sen54 or a
functionally active derivative or a functionally active fragment
thereof.
[0015] The invention provides a purified protein complex with
endonuclease activity comprising: (i) human Sen2 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human Sen 15 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; and (iv)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof. In a specific embodiment, the protein
complex has tRNA splicing endonuclease activity. In another
embodiment, the protein complex has 3' end pre-mRNA endonuclease
activity. In yet another embodiment, the protein complex has tRNA
splicing endonuclease activity and 3' end pre-mRNA endonuclease
activity.
[0016] In a specific embodiment, the invention provides a purified
complex with endonuclease activity comprising: (i) human Sen2
(ACCESSION NO.: NP.sub.--079541), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2 encoding nucleic acid
(ACCESSION NO.: NM.sub.--025265) or its complement under high
stringency conditions; (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (iv) Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the human Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions. In accordance with this embodiment, the
complex has tRNA splicing endonuclease activity and/or 3' end
pre-mRNA endonuclease activity.
[0017] The invention also provides a purified protein complex with
endonuclease activity comprising: (i) human Sen2 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human Sen 15 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen54 or a functionally active derivative or a functionally active
fragment thereof; and (v) human Clp1 or a functionally active
derivative or a functionally active fragment thereof. In a specific
embodiment, the protein complex has tRNA splicing endonuclease
activity. In another embodiment, the protein complex has 3' end
pre-mRNA endonuclease activity. In yet another embodiment, the
protein complex has tRNA splicing endonuclease activity and 3' end
pre-mRNA endonuclease activity.
[0018] In a specific embodiment, the invention provides a purified
complex with endonuclease activity comprising: (i) human Sen2
(ACCESSION NO.: NP.sub.--079541), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2 encoding nucleic acid
(ACCESSION NO.: NM.sub.--025265) or its complement under high
stringency conditions; (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; (iv) Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; and (v) human Clp1 (ACCESSION NO.:NP.sub.--006822) or a
protein encoded by a nucleic acid that hybridizes to the human Clp1
encoding nucleic acid (ACCESSION NO.: NM.sub.--006831) or its
complement under high stringency conditions. In accordance with
this embodiment, the complex has tRNA splicing endonuclease
activity and/or 3' end pre-mRNA endonuclease activity.
[0019] The invention provides a purified protein complex with
endonuclease activity comprising: (i) human Sen2 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human Sen 15 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen54 or a functionally active derivative or a functionally active
fragment thereof; (v) human Clp1 (ACCESSION NO.:NP.sub.--006822) or
a functionally active derivative or a functionally active fragment
thereof; (vi) human Cleavage-Polyadenylation Specificity Factor
("CPSF") or a functionally active derivative or a functionally
active fragment thereof; (vii) human Cleavage Factor I.sub.m ("CF
I.sub.m") or a functionally active derivative or a functionally
active fragment thereof; (viii) human Cleavage Factor II.sub.m ("CF
II.sub.m") or a functionally active derivative or a functionally
active fragment thereof; and (ix) human Cleavage Stimulation Factor
("CSF") or a functionally active derivative or a functionally
active fragment thereof. In a specific embodiment, the protein
complex has tRNA splicing endonuclease activity. In another
embodiment, the protein complex has 3' end pre-mRNA endonuclease
activity. In yet another embodiment, the protein complex has tRNA
splicing endonuclease activity and 3' end pre-mRNA endonuclease
activity.
[0020] In one embodiment, the invention provides a purified complex
with endonuclease activity comprising: (i) human Sen2 (ACCESSION
NO.: NP.sub.--079541), or a protein encoded by a nucleic acid that
hybridizes to the human Sen2 encoding nucleic acid (ACCESSION NO.:
NM.sub.--025265) or its complement under high stringency
conditions; (ii) human Sen15 (ACCESSION NO.:NP.sub.--443197), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen15 encoding nucleic acid (ACCESSION NO.:NM.sub.--052965) or its
complement under high stringency conditions; (iii) human Sen34
(ACCESSION NO.:NP.sub.--076980), or a protein encoded by a nucleic
acid that hybridizes to the human Sen34 encoding nucleic acid
(ACCESSION NO.:NM.sub.--024075) or its complement under high
stringency conditions; (iv) Sen54 (ACCESSION NO.:XP.sub.--208944),
or a protein encoded by a nucleic acid that hybridizes to the human
Sen54 encoding nucleic acid (ACCESSION NO.:XM.sub.--208944) or its
complement under high stringency conditions; (v) human Clp1
(ACCESSION NO.:NP.sub.--006822) or a protein encoded by a nucleic
acid that hybridizes to the human Clp1 encoding nucleic acid
(ACCESSION NO.: NM.sub.--006831) or its complement under high
stringency conditions; (vi) human Cleavage-Polyadenylation
Specificity Factor ("CPSF") or proteins encoded by a nucleic acids
that hybridize to human CPSF encoding nucleic acids or their
complement under high stringency conditions; (vii) human Cleavage
Factor I.sub.m ("CF I.sub.m") or proteins encoded by nucleic acids
that hybridize to human CFI.sub.m encoding nucleic acids or their
complement under high stringency conditions; (viii) human Cleavage
Factor II.sub.m ("CF II.sub.m") or proteins encoded by nucleic
acids that hybridize to human CFII.sub.m encoding nucleic acids or
their complement under high stringency conditions; and (ix) human
Cleavage Stimulation Factor ("CSF") or proteins encoded by nucleic
acids that hybridize to human CstF encoding nucleic acids or their
complement under high stringency conditions. In accordance with
this embodiment, the complex has tRNA splicing endonuclease
activity and/or 3' end pre-mRNA endonuclease activity.
[0021] The invention provides a purified protein complex with
endonuclease activity comprising: (i) human CPSF160 or a
functionally active derivative or a functionally active fragment
thereof; (ii) human CPSF30 or a functionally active derivative or a
functionally active fragment thereof; (iii) human CstF64 or a
functionally active derivative or a functionally active fragment
thereof; (iv) human symplekin or a functionally active derivative
or a functionally active fragment thereof; (v) human Sen2 or a
functionally active derivative or a functionally active fragment
thereof; (vi) human Sen15 or a functionally active derivative or a
functionally active fragment thereof; (vii) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof; and (viii) human Sen54 or a functionally active derivative
or a functionally active fragment thereof. In certain, more
specific embodiments, the complex does not comprise PAP (poly(A)
polymerase) and Sm proteins (small nuclear ribonucleoprotein). In a
specific embodiment, the protein complex has tRNA splicing
endonuclease activity. In another embodiment, the protein complex
has 3' end pre-mRNA endonuclease activity. In yet another
embodiment, the protein complex has tRNA splicing endonuclease
activity and 3' end pre-mRNA endonuclease activity. In accordance
with this embodiment, the complex has tRNA splicing endonuclease
activity and/or 3' end pre-mRNA endonuclease activity.
[0022] The invention provides a purified protein complex with
endonuclease activity comprising: (i) human CPSF160 or a protein
encoded by a nucleic acid that hybridizes to human CPSF160 encoding
nucleic acid or its complement under high stringency conditions;
(ii) human CPSF30 or a protein encoded by a nucleic acid that
hybridizes to human CPSF30 encoding nucleic acid or its complement
under high stringency conditions; (iii) human CstF64 or a protein
encoded by a nucleic acid that hybridizes to human CstF64 encoding
nucleic acid or its complement under high stringency conditions;
(iv) human symplekin or a protein encoded by a nucleic acid that
hybridizes to human symplekin encoding nucleic acid or its
complement under high stringency conditions; (v) human Sen2 or a
protein encoded by a nucleic acid that hybridizes to human Sen2
encoding nucleic acid or its complement under high stringency
conditions; (vi) human Sen15 or a protein encoded by a nucleic acid
that hybridizes to human Sen15 encoding nucleic acid or its
complement under high stringency conditions; (vii) human Sen34 or a
protein encoded by a nucleic acid that hybridizes to human Sen34
encoding nucleic acid or its complement under high stringency
conditions; and (viii) human Sen54 or a protein encoded by a
nucleic acid that hybridizes to human Sen54 encoding nucleic acid
or its complement under high stringency conditions. In certain,
more specific embodiments, the complex does not comprise PAP
(poly(A) polymerase) and Sm proteins (small nuclear
ribonucleoprotein). In a specific embodiment, the protein complex
has tRNA splicing endonuclease activity. In another embodiment, the
protein complex has 3' end pre-mRNA endonuclease activity. In yet
another embodiment, the protein complex has tRNA splicing
endonuclease activity and 3' end pre-mRNA endonuclease activity. In
accordance with this embodiment, the complex has tRNA splicing
endonuclease activity and/or 3' end pre-mRNA endonuclease
activity.
[0023] The invention provides a splice variant of human Sen2,
namely human Sen2deltaEx8. In particular, the invention provides
nucleic acid sequences encoding human Sen2deltaEx8 or a
functionally active fragment or a functionally active derivative
thereof, and amino acid sequences coding human Sen2deltaEx8 or a
functionally active fragment or a functionally active derivative
thereof. In a specific embodiment, the invention provides a nucleic
acid sequence that hybridizes under stringent conditions to a
nucleic acid sequence encoding Sen2.DELTA.Ex8 over the entire
length of the nucleic acid sequence encoding Sen2.DELTA.Ex8.
Preferably, such a nucleic acid sequence encodes a protein having
Sen2.DELTA.Ex8 activity (such as the ability to form a complex with
Clp1 and Sen54). In another embodiment, the invention provides
nucleic acid sequences that encode a protein having an amino acid
sequence that is at least 90%, preferably at least 95%, at least
98%, at least 99%, at least 99.5%, at least 99.8% or at least 99.9%
identical to the amino acid sequence of SEQ ID NO: 12, wherein the
protein is different from Sen2 (Accession No.: NP.sub.--079541).
Preferably, such a protein has Sen2.DELTA.Ex8 activity. In another
embodiment, the invention provides a nucleic acid sequence
comprising the nucleic acid sequence of SEQ ID NO:11. The invention
further provides vectors comprising a nucleic acid sequence
encoding human Sen2.DELTA.Ex8 and host cells comprising the vector.
The invention further provides host cells comprising a nucleic acid
encoding human Sen2.DELTA.Ex8.
[0024] The invention provides a purified protein, wherein the
protein consists essentially of the amino acid sequence of SEQ ID
NO: 12 or an amino acid sequence that is at least 90%, preferably
at least 95%, at least 98%, at least 99%, at least 99.5%, at least
99.8% or at least 99.9% identical to the amino acid sequence of SEQ
ID NO:12. The invention further provides antibodies or fragments
thereof that immunospecifically bind to human Sen2.DELTA.Ex8 but do
not bind to Sen2. In particular, the invention provides an antibody
or fragment thereof that immunospecifically binds to the unique
region of Sen2.DELTA.Ex8 that is created by the deletion of Exon 8
from the Sen2 protein.
[0025] The invention also provides purified protein complexes
comprising human Sen2deltaEx8. In particular, the invention
provides purified protein complexes comprising human Sen2deltaEx8
or a functionally active derivative or a functionally active
fragment thereof and one or more, or any combination of the
following (i) human Sen54 or a functionally active derivative or a
functionally active fragment thereof; (ii) human Sen15 or a
functionally active derivative or a functionally active fragment
thereof; and (iii) human Sen34 or a functionally active derivative
or a functionally active fragment thereof.
[0026] The Sen2deltaEx8 complexes have RNA-nucleolytic activity. In
a specific embodiment, Sen2deltaEx8 complexes have pre-tRNA
cleavage activity and/or 3' end pre-mRNA endonuclease activity. The
invention provides a purified human Sen2deltaEx8 complex
comprising: (i) human Sen2deltaEx8 or a functionally active
derivative thereof; and (ii) human Sen54 or a functionally active
derivative or a functionally active fragment thereof. The invention
also provides a human Sen2deltaEx8 complex comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen15 or a functionally active
derivative or a functionally active fragment thereof; and (iv)
human Sen34 or a functionally active derivative or a functionally
active fragment thereof. In a specific embodiment, the complex has
RNA-nucleolytic activity. In a specific embodiment, the complex has
tRNA endonuclease activity. In a specific embodiment, the complex
has 3' end mRNA processing activity. These human Sen2deltaEx8
complexes cleave tRNA at multiple sites and are useful in mapping
RNA structure and 3' end pre-mRNA endonuclease processing. In
certain embodiments, the fidelity and accuracy of the tRNA cleavage
activity of a Sen2deltaEx8 comprising complex is reduced compared
to the the tRNA cleavage activity of full length Sen2 comprising
complexes.
[0027] In a specific embodiment, the invention provides a purified
human Sen2deltaEx8 complex comprising: (i) human Sen2deltaEx8 (SEQ
ID NO.: 2), or a functionally active fragment thereof or a protein
encoded by a nucleic acid that hybridizes to the human Sen2deltaEx8
encoding nucleic acid (SEQ ID NO.: 1) or its complement under high
stringency conditions; and (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions. In another embodiment, the invention provides a
purified human Sen2deltaEx8 complex comprising: (i) human
Sen2deltaEx8 (SEQ ID NO.: 2), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2deltaEx8 encoding nucleic
acid (SEQ ID NO.: 1) or its complement under high stringency
conditions; (ii) human Sen15 (ACCESSION NO.:NP.sub.--443197), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen15 encoding nucleic acid (ACCESSION NO.:NM.sub.--052965) or its
complement under high stringency conditions; (iii) human Sen34
(ACCESSION NO.:NP.sub.--076980), or a protein encoded by a nucleic
acid that hybridizes to the human Sen34 encoding nucleic acid
(ACCESSION NO.:NM.sub.--024075) or its complement under high
stringency conditions; and (iv) Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions.
[0028] In certain embodiments, the invention provides a purified
human Sen2deltaEx8 complex comprising: (i) human Sen2deltaEx8; and
(ii) human Sen34. In certain embodiments, the invention provides a
purified human Sen2deltaEx8 complex comprising: (i) human
Sen2deltaEx8; (ii) human Sen15; and (iii) human Sen34. In certain
embodiments, the invention provides a purified human Sen2deltaEx8
complex comprising: (i) Sen2deltaEx8; and (ii) Sen54.
[0029] In accordance with these embodiments, the human Sen2deltaEx8
complex has RNA-nucleolytic activity. In a particular embodiment,
the human Sen2deltaEx8 complex cleaves tRNA at multiple sites.
These human Sen2deltaEx8 complexes are useful in mapping RNA
structure and 3' endonuclease processing. In certain embodiments,
the fidelity and accuracy of the tRNA cleavage activity of a
Sen2deltaEx8 comprising complex is reduced compared to the the tRNA
cleavage activity of full length Sen2 comprising complexes.
[0030] In certain embodiments, the invention provides a purified
human Sen2deltaEx8 complex comprising: (i) human Sen2deltaEx8 or a
protein encoded by a nucleic acid that hybridizes to the human
Sen2deltaEx8 encoding nucleic acid; and (ii) human Sen34 or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid. In certain embodiments, the invention
provides a purified human Sen2deltaEx8 complex comprising: (i)
human Sen2deltaEx8 or a protein encoded by a nucleic acid that
hybridizes to the human Sen2deltaEx8 encoding nucleic acid; (ii)
human Sen15 or a protein encoded by a nucleic acid that hybridizes
to the human Sen15 encoding nucleic acid; and (iii) human Sen34 or
a protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid. In certain embodiments, the invention
provides a purified human Sen2deltaEx8 complex comprising: (i)
Sen2deltaEx8 or a protein encoded by a nucleic acid that hybridizes
to the human Sen2deltaEx8 encoding nucleic acid; and (ii) Sen54 or
a protein encoded by a nucleic acid that hybridizes to the human
Sen54 encoding nucleic acid.
[0031] The invention provides a purified human Sen2deltaEx8 complex
with 3' end pre-mRNA endonuclease activity comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen15 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen34 or a functionally active derivative or a functionally active
fragment thereof; and (v) human Clp1 (ACCESSION
NO.:NP.sub.--006822) or a functionally active derivative or a
functionally active fragment thereof. In certain embodiments, the
complex may further comprise: (i) human CPSF160 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human CPSF30 or a functionally active derivative or a functionally
active fragment thereof; (iii) human CstF64 or a functionally
active derivative or a functionally active fragment thereof; and/or
(iv) human symplekin or a functionally active derivative or a
functionally active fragment. The invention also provides a
purified human Sen2deltaEx8 complex with 3' end pre-mRNA
endonuclease activity comprising: (i) human Sen2deltaEx8 or a
functionally active derivative thereof; (ii) human Sen54 or a
functionally active derivative or a functionally active fragment
thereof; (iii) human Sen15 or a functionally active derivative or a
functionally active fragment thereof; (iv) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof; (v) human Clp1 (ACCESSION NO.:NP.sub.--006822) or a
functionally active derivative or a functionally active fragment
thereof; (vi) human CSPF or a functionally active derivative or a
functionally active fragment thereof; (vii) human CFI.sub.m or a
functionally active derivative or a functionally active fragment
thereof; (viii) human CFII.sub.m. or a functionally active
derivative or a functionally active fragment thereof; and (ix)
human CstF or a functionally active derivative or a functionally
active fragment thereof.
[0032] In a specific embodiment, the invention provides a purified
human Sen2deltaEx8 complex with 3' end pre-mRNA endonuclease
activity comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen2deltaEx8 encoding nucleic acid (SEQ ID NO.:11) or its
complement under high stringency conditions; (ii) human Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the human Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions; (iii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iv) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (v) human Clp1
(ACCESSION NO.:NP.sub.--006822) or a protein encoded by a nucleic
acid that hybridizes to the human Clp1 encoding nucleic acid
(ACCESSION NO.: NM.sub.--006831) (ACCESSION NO.: NM.sub.--006831)
or its complement under high stringency conditions.
[0033] In certain embodiments, the complex may further comprise:
(i) human CPSF160 or a protein encoded by a nucleic acid that
hybridizes to the human CPSF160 encoding nucleic acid; (ii) human
CPSF30 or a protein encoded by a nucleic acid that hybridizes to
the human CPSF30 encoding nucleic acid; (iii) human CstF64 or a
protein encoded by a nucleic acid that hybridizes to the human
CstF64 encoding nucleic acid; and/or (iv) human symplekin or a
protein encoded by a nucleic acid that hybridizes to the human
symplekin encoding nucleic acid.
[0034] In another embodiment, the invention provides a purified
human Sen2deltaEx8 complex with 3' end pre-mRNA endonuclease
activity comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen2deltaEx8 encoding nucleic acid (SEQ ID NO.: 1) or its
complement under high stringency conditions; (ii) human Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the human Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions; (iii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iv) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; (v) human Clp1
(ACCESSION NO.:NP.sub.--006822) or a protein encoded by a nucleic
acid that hybridizes to the human Clp1 encoding nucleic acid
(ACCESSION NO.: NM.sub.--006831) or its complement under high
stringency conditions; (vi) a human CPSF, or a protein encoded by a
nucleic acid that hybridizes to the human CPSF encoding nucleic
acid or its complement under high stringency conditions; (vii) a
human CFI.sub.m, or a protein encoded by a nucleic acid that
hybridizes to the human CFI.sub.m encoding nucleic acid or its
complement under high stringency conditions; (viii) a human
CFII.sub.m, or a protein encoded by a nucleic acid that hybridizes
to the human CFII.sub.m encoding nucleic acid or its complement
under high stringency conditions; and (ix) human CSF, or a protein
encoded by a nucleic acid that hybridizes to the human CstF
encoding nucleic acid or its complement under high stringency
conditions.
[0035] The invention provides a purified human Sen2deltaEx8 complex
with 3' end pre-mRNA endonuclease activity comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; and (iii) human Clp1 (ACCESSION
NO.:NP.sub.--006822) or a functionally active derivative or a
functionally active fragment thereof, and optionally one or more,
or any combination of the following: (i) human CPSF or a
functionally active derivative or a functionally active fragment
thereof; (ii) human CFI.sub.m or a functionally active derivative
or a functionally active fragment thereof; (iii) human CFII.sub.m
or a functionally active derivative or a functionally active
fragment thereof; and (iv) human CstF or a functionally active
derivative or a functionally active fragment thereof. In a specific
embodiment, the invention provides a purified Sen2deltaEx8 complex
with 3' end pre-mRNA endonuclease activity comprising: (i) human
Sen2deltaEx8 (SEQ ID NO.: 2), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2deltaEx8 encoding nucleic
acid (SEQ ID NO.: 1) or its complement under high stringency
conditions; (ii) human Sen54 (ACCESSION NO.:XP.sub.--208944), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen54 encoding nucleic acid (ACCESSION NO.:XM.sub.--208944) or its
complement under high stringency conditions; and (iii) human Clp1
(ACCESSION NO.:NP.sub.--006822) or a protein encoded by a nucleic
acid that hybridizes to the human Clp1 encoding nucleic acid
(ACCESSION NO.: NM.sub.--006831) or its complement under high
stringency conditions. In certain embodiments, the complex may
further comprise: (i) human CPSF160 or a protein encoded by a
nucleic acid that hybridizes to the human CPSF160 encoding nucleic
acid; (ii) human CPSF30 or a protein encoded by a nucleic acid that
hybridizes to the human CPSF30 encoding nucleic acid; (iii) human
CstF64 or a protein encoded by a nucleic acid that hybridizes to
the human CstF64 encoding nucleic acid; and/or (iv) human symplekin
or a protein encoded by a nucleic acid that hybridizes to the human
symplekin encoding nucleic acid. In another embodiment, the
invention provides a purified Sen2deltaEx8 complex with 3' end
pre-mRNA endonuclease activity comprising: (i) human Sen2deltaEx8
(SEQ ID NO.: 2), or a protein encoded by a nucleic acid that
hybridizes to the human Sen2deltaEx8 encoding nucleic acid (SEQ ID
NO.: 1) or its complement under high stringency conditions; (ii)
human Sen54 (ACCESSION NO.:XP.sub.--208944), or a protein encoded
by a nucleic acid that hybridizes to the human Sen54 encoding
nucleic acid (ACCESSION NO.:XM.sub.--208944) or its complement
under high stringency conditions; (iii) human Clp1 (ACCESSION
NO.:NP.sub.--006822) or a protein encoded by a nucleic acid that
hybridizes to the human Clp1 encoding nucleic acid (ACCESSION NO.:
NM.sub.--006831) or its complement under high stringency
conditions; (iv) human CPSF or a protein encoded by a nucleic acid
that hybridizes to the human CPSF or its complement under high
stringency conditions; (v) human CFI.sub.m or a protein encoded by
a nucleic acid that hybridizes to the human CFI.sub.m encoding
nucleic acid or its complement under high stringency conditions;
(vi) human CF II.sub.m or a protein encoded by a nucleic acid that
hybridizes to the human CFII.sub.m encoding nucleic acid or its
complement under high stringency conditions; and (vii) human CstF
or a protein encoded by a nucleic acid that hybridizes to the human
CstF encoding nucleic acid or its complement under high stringency
conditions.
[0036] The invention also provides protein complexes with
pre-ribosomal RNA cleavage activity. In particular, the invention
provides a protein complex with pre-ribosomal RNA cleavage activity
comprising: (i) human Sen15 or a functionally active derivative or
a functionally active fragment thereof; and (ii) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof. More specifically, the invention provides a protein
complex with pre-ribosomal RNA cleavage activity comprising: (i)
human Sen15 (ACCESSION NO.:NP.sub.--443197), or a protein encoded
by a nucleic acid that hybridizes to the human Sen15 encoding
nucleic acid (ACCESSION NO.:NM.sub.--052965) or its complement
under high stringency conditions; and (ii) human Sen34 (ACCESSION
NO.:NP.sub.--076980), or a protein encoded by a nucleic acid that
hybridizes to the human Sen34 encoding nucleic acid (ACCESSION
NO.:NM.sub.--024075) or its complement under high stringency
conditions. This protein complex may be used in the biogenesis of
different ribosomal RNAs. For example, the production of 28S, 18S,
5.5S and 5S ribosomal RNA may be altered by modulating this protein
complex.
[0037] In certain embodiments, at least two protein components, at
least three protein components, at least four protein components or
at least five protein components of a complex of the invention are
covalently linked to each other, e.g., as fusion proteins. In
certain other embodiments, a complex of the invention comprises at
least two protein components, at least three protein components, at
least four protein components or at least five protein components
that are non-covalently linked to each other. In yet other
embodiments, a complex of the invention comprises a combination of
covalently linked and non-covalently linked protein components. In
certain other embodiments, a protein component of a complex of the
invention is fused to a heterologous amino acid sequence, i.e., an
amino acid sequence different from the protein. Further, the
complexes of the invention may comprise at least one, preferably at
least two functionally active fragments of protein components of
the complex. The complexes of the invention may comprise at least
three, at least four or at least five functionally active fragments
of protein components of the complex. The complexes of the
invention may comprise at least one, preferably at least two or at
least three, at least four or at least five functionally active
derivatives of the protein components of the complex. In one
embodiment, such functionally active derivatives are fusion
proteins. In accordance with this embodiment, such fusion proteins
may comprise a heterologous sequence, i.e., an amino acid sequence
different from the amino acid sequence of the protein
component.
[0038] The invention provides methods for purifying a complex of
the invention. In particular, the invention provides a method for
purifying a complex of the invention, the method comprising:
preparing a cell extract or a nuclear extract from a cell, wherein
the cell expresses all of the protein components of the complex and
wherein at least one of the protein components is fused to a
peptide tag; and purifying the complex by virtue of the peptide
tag.
[0039] The invention provides antibodies or fragments thereof that
immunospecifically bind to a complex of the invention. In a
specific embodiment, the invention provides an antibody or a
fragment thereof that immunospecifically binds to a complex of the
invention with higher affinity than to each individual component of
the complex in an immunoassay well-known to one of skill in the art
or described herein. In another embodiment, the invention provides
an antibody or a fragment thereof that immunospecifically binds to
a complex of the invention, but does not bind to each individual
component of the complex in an immunoassay well-known to one of
skill in the art or described herein. The invention also provides a
method for generating an antibody or a fragment thereof that
immunospecifically binds to a complex of the invention comprising
immunizing a subject with the complex of the invention.
[0040] The invention also provides antibodies or fragments thereof
that immunospecifically bind to one of the following components of
a complex of the invention: (i) human Sen2 or a functionally active
derivative or a functionally active fragment thereof; (ii) human
Sen2deltaEx8 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen15 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen34 or a functionally active derivative or a functionally active
fragment thereof; and (v) human Sen54 or a functionally active
derivative or a functionally active fragment thereof. Preferably,
the antibodies or fragments thereof are not known. The invention
also provides a method for generating an antibody or a fragment
thereof that immunospecifically binds to a component of a complex
of the invention comprising immunizing a subject with the
component.
[0041] In a specific embodiment, the invention provides an antibody
or a fragment thereof that immunospecifically binds to human
Sen2deltaEx8 with higher affinity than human Sen2 in an immunoassay
well-known to one of skill in the art or described herein. In
another embodiment, the invention provides an antibody or a
fragment thereof that immunospecifically binds to human
Sen2deltaEx8, but does not bind to human Sen2 in an immunoassay
well-known to one of skill in the art or described herein.
[0042] The invention provides methods of identifying compounds that
modulate the expression (at the RNA and/or protein level) of one or
more of the following components of a complex of the invention: (i)
human Sen2 or a functionally active derivative or a functionally
active fragment thereof; (ii) human Sen2deltaEx8 or a functionally
active derivative or a functionally active fragment thereof; (iii)
human Sen15 or a functionally active derivative or a functionally
active fragment thereof; (iv) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; and/or (v)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof. Techniques for measuring expression of
proteins are well-known to one of skill in the art and include,
e.g., immunoassays for protein expression levels, and RT-PCR or
Northern blots for RNA expression levels.
[0043] The invention provides screening assays to identify
compounds that modulate the formation of a complex of the
invention. In particular, the invention provides a method of
identifying a compound that modulates the formation of a complex of
the invention, the method comprising: contacting a cell with a
compound, wherein the cell comprises all of the components of the
complex the invention; and measuring the amount of the complex of
the invention formed in the cell. The method may further comprise
isolating the complex of the invention from the cell. The amount of
complex can be measured by any method well-known to one of skill in
the art for measuring complex formation or by any method described
herein (such as, e.g., FRET). In a specific embodiment, the
invention provides a method of identifying a compound that
modulates the formation of a complex, the method comprising:
contacting a cell comprising all of the components of the complex
with a compound, wherein the cell has been engineered to express
one, two, three, four or more of the components of the complex; and
measuring the amount of the complex formed in the cell. In
accordance with this embodiment, the cell may be any non-human cell
or a human cell deficient in one or more components of the
complex.
[0044] The invention provides a method of identifying a compound
that modulates the formation of a complex, the method comprising
the following steps: (a) incubating the components of a complex of
the invention in the presence of a compound under conditions
conducive to formation of a complex comprising the proteins; and
(b) measuring the amount of the complex, wherein a difference in
the amount of the complex measured in step (b) relative to the
amount of the complex measured in the absence of the compound or in
the presence of an appropriate control (e.g., a negative control
such as phosphate buffered saline) or a predetermined reference
range indicates that the compound modulates the formation of the
complex. Techniques for measuring complex formation are well-known
in the art or described herein.
[0045] The invention provides methods for identifying compounds
that modulate the endonucleolytic activity of a complex of the
invention. The invention provides cell-based and cell-free assays
for identifying compounds that modulate human tRNA splicing
endonuclease activity and/or human 3' end pre-mRNA splicing
endonuclease activity. In one embodiment, the invention provides a
method for identifying compounds that modulate the endonucleolytic
activity of a complex of the invention, the method comprising: (a)
contacting a compound or a member of a library of compounds with a
cell containing or engineered to contain the components of the
human complex and a substrate for the complex; and (b) detecting
the level of endonucleolytic activity by measuring either the
decrease in substrate or the increase in product of the
endonuclease reaction. In another embodiment, the invention
provides a method for identifying compounds that modulate the
endonucleolytic activity of a complex of the invention, the method
comprising: (a) incubating a complex of the invention with an
endonuclease substrate and with a compound or a member of a library
of compounds; and (b) detecting the level of endonuclease activity
by measuring either the decrease in substrate or the increase in
product of the endonuclease reaction.
[0046] In a particular embodiment, the invention provides a method
for identifying a compound that modulates human tRNA splicing
endonuclease activity, the method comprising: contacting a compound
or a member of a library of compounds with a complex of the
invention with human tRNA splicing endonuclease activity and a
nucleic acid (e.g., RNA or DNA) comprising a reporter gene under
conditions that allow transcription and translation of the reporter
gene (e.g., cell-free or cell-based assays), wherein the reporter
gene comprises a tRNA intron; and detecting the expression of said
reporter gene (ie., production of processed reporter gene mRNA
resulting from tRNA splicing endonuclease activity, the protein
product of the reporter gene, and/or activity of the reporter gene
product), wherein a compound that modulates tRNA splicing
endonuclease activity is identified if the expression of said
reporter gene in the presence of the compound is altered relative
to the expression of said reporter gene in the absence of said
compound or the presence of an appropriate control or a
predetermined reference range. A decrease in reporter gene
expression relative to a previously determined reference range, or
to the expression in the absence of the compound or the presence of
an appropriate control (e.g., a negative control) in such
reporter-gene based assays indicates that a particular compound
reduces or inhibits the activity of a human tRNA splicing
endonuclease (e.g., the recognition or cleavage of a tRNA intron).
In contrast, an increase in reporter gene expression relative to a
previously determined reference range, or to the expression in the
absence of the compound or the presence of an appropriate control
(e.g., a negative control) in such reporter-gene based assays
indicates that a particular compound enhances the activity of a
human tRNA splicing endonuclease. In a specific embodiment, the
TNT.RTM. Coupled Reticulocyte Lysate Systems is used in accordance
with the method (Promega, Madison Wis.). In other specific
embodiments, a cell extract is used to provide the factors required
for transcription and translation of the reporter gene. In even
other specific embodiments, a compound and the tRNA splicing
endonuclease are introduced into a cell (e.g., by transforming a
cell with nucleic acids encoding the complex components, preferably
under the control of a heterologous promoter). In accordance with
this embodiment of the invention, the recombinant components of a
complex of the invention can be expressed in the cell either
individually or as a fusion complex. In a preferred embodiment, the
human complex is introduced or expressed in a non-human cell.
[0047] The invention further provides a method for identifying a
compound that modulate human tRNA splicing endonuclease activity,
said method comprising: (a) expressing a nucleic acid comprising a
reporter gene in a cell, wherein the reporter gene comprises a tRNA
intron; (b) contacting said cell with a compound or a member of a
library of compounds; and (c) detecting the expression of said
reporter gene, wherein a compound that modulates tRNA splicing
endonuclease activity is identified if the expression of said
reporter gene in the presence of a compound is altered relative to
a previously determined reference range, or the expression of said
reporter gene in the absence of the compound or the presence of an
appropriate control (e.g., a negative control). In particular, an
increase in expression of the reporter gene compared to a control
indicates that the compound increases human tRNA splicing
endonuclease activity. In contrast, a decrease in expression of the
reporter gene compared to a control indicates that the compound
decreases human tRNA splicing endonuclease activity.
[0048] In another embodiment, the invention provides a method for
identifying a compound that modulates human tRNA splicing
endonuclease activity, said method comprising: (a) contacting a
member of a library of compounds with a cell containing a nucleic
acid comprising a reporter gene, wherein the reporter gene
comprises a tRNA intron; and (b) detecting the expression of said
reporter gene, wherein a compound that modulates tRNA splicing
endonuclease activity is identified if the expression of said
reporter gene in the presence of a compound is altered relative to
a previously determined reference range, or the expression of said
reporter gene in the absence of said compound or the presence of an
appropriate control (e.g., a negative control). In particular, an
increase in expression of the reporter gene compared to a control
indicates that the compound increases human tRNA splicing
endonuclease activity. In contrast, a decrease in expression of the
reporter gene compared to a control indicates that the compound
decreases human tRNA splicing endonuclease activity.
[0049] In another embodiment, the invention provides a method for
identifying a compound that modulates human tRNA splicing
endonuclease activity, the method comprising: contacting a complex
of the invention with tRNA splicing endonuclease activity with a
substrate of a tRNA splicing endonuclease and a compound or a
member of a library of compounds, wherein the substrate is labeled
at the 5' end with a fluorophore and at the 3' end with a quencher
or, alternatively, the substrate is labeled at the 5' end with a
quencher and at the 3' end with a fluorophore; and measuring the
activity of the tRNA splicing endonuclease by measuring the change
in fluorescence, wherein a compound that modulates tRNA splicing
activity is identified if a fluorescent signal is altered in the
presence of the compound relative to the signal in the absence of
the compound or the presence of an appropriate control. The tRNA
splicing endonuclease in the cell-free extract will cleave the
substrate and result in the production of a detectable fluorescent
signal. A compound that inhibits or reduces the activity of the
tRNA splicing endonuclease will inhibit or reduce the cleavage of
the substrate and thus, inhibit or reduce the production of a
detectable fluorescent signal relative to a negative control (e.g.,
PBS). A compound that enhances the activity of the tRNA splicing
endonuclease will enhance the cleavage of the substrate and thus,
increase the production of a detectable signal relative to a
negative control (e.g., PBS).
[0050] In another embodiment, the invention provides a method for
identifying a compound that modulates human tRNA splicing
endonuclease activity, the method comprising: contacting a complex
of the invention with tRNA splicing endonuclease activity with a
substrate of a tRNA splicing endonuclease and a compound or a
member of a library of compounds, wherein said substrate is labeled
at the 5' end with a fluorescent donor moiety and labeled at the 3'
end with a fluorescent acceptor moiety or, alternatively, the
substrate is labeled at the 5' end with a fluorescent acceptor
moiety and at the 3' end with a fluorescent donor moiety; and
measuring the activity of the tRNA splicing endonuclease, wherein a
compound that modulates tRNA splicing activity is identified if the
fluorescence emission of the fluorescent acceptor moiety at the
wavelength of the fluorescent donor moiety in the presence of the
compound is altered relative to the absence of the compound or the
presence of an appropriate control (e.g., a negative control such
as PBS) or a predetermined reference range. The tRNA splicing
endonuclease will cleave the substrate and result in a decrease in
the fluorescence emission by the fluorescent donor moiety and
fluorescent acceptor moiety at the wavelength of the fluorescent
donor moiety. A compound that inhibits or reduces the activity of
the human tRNA splicing endonuclease will inhibit or reduce
cleavage of the substrate and thus, increase the fluorescence
emission of the fluorescent acceptor moiety at the wavelength of
the fluorescent donor moiety. A compound that enhances the activity
of the human tRNA splicing endonuclease will enhance the cleavage
of the substrate and thus, reduce the fluorescence emission of the
fluorescent acceptor moiety at the wavelength of the fluorescent
donor moiety.
[0051] In another embodiment, the invention provides a method for
identifying a compound that modulates human 3' end pre-mRNA
endonuclease activity, the method comprising: contacting a compound
or a member of a library of compounds with a complex of the
invention with human 3' end pre-mRNA endonuclease activity and a
nucleic acid comprising a 3' end cleavage reporter gene, wherein
the reporter gene is located 3' of the cleavage site under
conditions that allow transcription and translation of the reporter
gene (e.g., cell-free or cell based assays); and detecting the
expression of said reporter gene (i.e., production of processed
mRNA resulting from the 3' end pre-mRNA endonuclease activity
cleaving 5' of the reporter gene, amount of the reporter gene
product or activity of the reporter gene product), wherein a
compound that modulates 3' end pre-mRNA endonuclease activity is
identified if the expression of said reporter gene in the presence
of a compound is altered relative to the expression of said
reporter gene in the absence of said compound or the presence of an
appropriate control (e.g., a negative control such as PBS) or to a
predetermined reference range. In accordance with this embodiment,
all factors required for the expression of the reporter gene are
also provided. In a specific embodiment, the TNT.RTM. Coupled
Reticulocyte Lysate Systems is used (Promega, Madison Wis.). In
other specific embodiments, a cell extract is used to provide the
factors required for transcription and tranlation of the reporter
gene. In even other specific embodiments, the complex and the 3'
end pre-mRNA endonuclease are introduced into a cell. In
particular, an increase in reporter gene expression relative to a
previously determined reference range, or to the expression in the
absence of the compound or the presence of an appropriate control
(e.g., a negative control) in such reporter-gene based assays
indicates that a particular compound reduces or inhibits the
activity of a 3' end pre-mRNA endonuclease (e.g., the recognition
or cleavage of a substrate). In contrast, a decrease in reporter
gene expression relative to a previously determined reference
range, or to the expression in the absence of the compound or the
presence of an appropriate control (e.g., a negative control) in
such reporter-gene based assays indicates that a particular
compound enhances the activity of a human 3' end pre-mRNA
endonuclease.
[0052] In another embodiment, the invention provides a method of
identifying a compound that inhibits or reduces human 3' end
pre-mRNA endonuclease activity, the method comprising: contacting a
complex of the invention with human 3' end pre-mRNA endonuclease
activity with a substrate of a 3' end pre-mRNA endonuclease and a
compound or a member of a library of compounds, wherein the
substrate is labeled at the 5' end with a fluorophore and at the 3'
end with a quencher or, alternatively, the substrate is labeled at
the 5' end with a quencher and at the 3' end with a fluorophore;
and measuring the activity of the 3' end pre-mRNA endonuclease;
wherein a compound that modulates 3' end pre-mRNA endonuclease
activity is identified if a fluorescent signal is altered in the
presence of the compound relative to the absence of the compound or
the presence of an appropriate control (e.g., a negative control
such as PBS), or to a predetermined reference range. A compound
that inhibits or reduces the activity of the human 3' end pre-mRNA
endonuclease will inhibit or reduce cleavage of the substrate and
thus, decrease the production of a detectable fluorescent signal
relative to a control. A compound that enhances the activity of the
human 3' end pre-mRNA endonuclease will enhance the cleavage of the
substrate and thus, increase the production of a detectable
fluorescent signal relative to a control.
[0053] In another embodiment, the invention provides a method of
identifying a compound that inhibits or reduces human 3' end
pre-mRNA endonuclease activity, the method comprising: contacting a
complex of the invention with human 3' end pre-mRNA endonuclease
activity with a substrate of 3' end pre-mRNA endonuclease and a
compound or a member of a library of compounds, wherein said
substrate is labeled at the 5' end with a fluorescent donor moiety
and labeled at the 3' end with a fluorescent acceptor moiety or,
alternatively, the substrate is labeled at the 5' end with a
fluorescent acceptor moiety and at the 3' end with a fluorescent
donor moiety; and measuring the activity of the 3' mRNA
endonuclease, wherein a compound that modulates 3' end pre-mRNA
endonuclease activity is identified if the fluorescence emission of
the fluorescent acceptor moiety at the wavelength of the
fluorescent donor moiety in the presence of the compound is altered
in the presence of the compound relative to the absence of the
compound or the presence of an appropriate control (e.g., a
negative control such as PBS), or to a predetermined reference
range. A compound that inhibits or reduces the activity of the
human 3' end pre-mRNA endonuclease will inhibit or reduce cleavage
of the substrate and thus, increase the fluorescence emission of
the fluorescent acceptor moiety at the wavelength of the
fluorescent donor moiety relative to a control. A compound that
enhances the activity of the human 3' end pre-mRNA endonuclease
will enhance the cleavage of the substrate and thus, reduce the
fluorescence emission of the fluorescent acceptor moiety at the
wavelength of the fluorescent donor moiety.
[0054] In certain embodiments, RT-PCR, such as, but not limited to
a quantitative RT-PCR assay as described in section 5.2, can be
used to measure the effect of a compound on 3' end pre-mRNA
processing; the modification of any expressed gene, e.g., GAPDH and
EFIA, can be used.
[0055] The present invention further provides methods for
identifying compounds that modulate the pre-tRNA cleavage activity
and/or pre-ribosomal RNA cleavage activity of a complex of the
invention. Techniques well-known to one of skill in the art or
described herein may be used to measure the ability of a compound
to modulate the pre-tRNA cleavage activity and/or pre-ribosomal RNA
cleavage activity of a complex of the invention. For example, the
ability of a compound to modulate the pre-tRNA cleavage activity of
a complex of the invention may be determined by comparing the level
of tRNA fragments produced from a tRNA in the presence of the
compound relative to the level of tRNA fragments produced from the
same tRNA in the absence of the compound or the presence of an
appropriate control (e.g., a negative control such as PBS), wherein
a change in the levels indicates that the compound modulates the
pre-tRNA cleavage activity of the complex. The ability of a
compound to modulate the pre-ribosomal RNA cleavage activity of a
complex of the invention may be determined by, e.g., comparing the
level of specific ribosomal RNAs (e.g., 28S, 18S, 5.8S and/or 5S)
produced from a pre-ribosomal RNA in the presence of the compound
relative to the level of the ribosomal RNA produced from the same
pre-ribosomal RNA in the absence of the compound or the presence of
an appropriate control (e.g., a negative control such as PBS),
wherein a change in the levels indicates that the compound
modulates the pre-ribosomal RNA cleavage activity of the complex.
In certain embodiments, the methods for identifying compounds that
modulate the pre-tRNA cleavage activity and/or pre-ribosomal RNA
cleavage activity of a complex of the invention are cell-based
assays. In other embodiments, the methods for identifying compounds
that modulate the pre-tRNA cleavage activity and/or pre-ribosomal
RNA cleavage activity of a complex of the invention are cell-free
assays.
[0056] A compound identified in the assays described herein that
modulates the expression of a component of a complex of the
invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) may be tested in in vitro assays (e.g.,
cell-based assays or cell-free assays) and/or in vivo assays
well-known to one of skill in the art or described herein for the
effect of the compound a disorder described herein (e.g., a
proliferative disorder or a disorder characterized by, associated
with or caused by abnormal RNA-nucleolytic activity) or on cells
from a patient with a particular disorder.
[0057] In a specific embodiment, a compound identified in the
assays described herein that inhibits or reduces the expression of
a component of a complex of the invention, the formation of a
complex of the invention, the RNA-nucleolytic activity of a complex
of the invention (e.g., the pre-tRNA splicing endonuclease
activity, the 3' end pre-mRNA endonuclease activity, the pre-tRNA
cleavage activity of a complex of the invention, and/or the
pre-ribosomal RNA cleavage activity of a complex of the invention)
may be tested in in vitro assays (e.g., cell-based assays or
cell-free assays) and/or in vivo assays well-known to one of skill
in the art or described herein for the antiproliferative effect of
the compound on hyperproliferative cells versus normal cells. In
another embodiment, a compound identified in the assays described
herein that inhibits or reduces the expression of a component of a
complex of the invention, the formation of a complex of the
invention, the RNA-nucleolytic activity of a complex of the
invention (e.g., the pre-tRNA splicing endonuclease activity, the
3' end pre-mRNA endonuclease activity, the pre-tRNA cleavage
activity of a complex of the invention, and/or the pre-ribosomal
RNA cleavage activity of a complex of the invention) may be tested
in an animal model for cancer to determine the efficacy of the
compound in the prevention, treatment or amelioration of cancer or
a symptom thereof. In yet another embodiment, a compound identified
in assays described herein that enhances the expression of a
component of a complex of the invention, the formation of a complex
of the invention, the RNA-nucleolytic activity of a complex of the
invention (e.g., the pre-tRNA splicing endonuclease activity, the
3' end pre-mRNA endonuclease activity, the pre-tRNA cleavage
activity of a complex of the invention, and/or the pre-ribosomal
RNA cleavage activity of a complex of the invention) may be tested
for its effect on wound healing.
[0058] In a specific embodiment, a compound identified in the
assays described herein can be used to assess the function of a
complex of the invention or a component of a complex of the
invention in different cellular contexts and/or under different
biological conditions. For example, cells obtained from different
pathological tissues can be contacted with a compound identified in
the assays of the invention to test the function of a complex of
the invention in such cells.
[0059] In even other embodiments, a compound identified in the
assays of the invention can be used to modulate expression of a
recombinant protein in a cell. For example, a compound that
increases the function of human tRNA splicing endonuclease and/or
3' end pre-mRNA endonuclease can be used to enhance the expression
of a recombinant protein in a cell.
[0060] The structure of the compounds identified in the assays
described herein that modulate the expression of a component of a
complex of the invention, the formation of a complex of the
invention, the nucleolytic activity of a complex of the invention
(e.g., the pre-tRNA splicing endonuclease activity, the 3' end
pre-mRNA endonuclease activity, the pre-tRNA cleavage activity of a
complex of the invention, and/or the pre-ribosomal RNA cleavage
activity of a complex of the invention) can be determined utilizing
assays well-known to one of skill in the art or described herein.
The methods used will depend, in part, on the nature of the library
screened. For example, assays or microarrays of compounds, each
having an address or identifier, may be deconvoluted, e.g., by
cross-referencing the positive sample to an original compound list
that was applied to the individual test assays. Alternatively, the
structure of the compounds identified herein may be determined
using mass spectrometry, nuclear magnetic resonance ("NMR"),
circular dichroism, X ray crystallography, or vibrational
spectroscopy.
[0061] The invention encompasses the use of the compounds that
inhibit or reduce the expression of a component of a complex of the
invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention (the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) for treatment, management or
amelioration of a proliferative disorder or a symptom thereof, or a
disorder characterized by, associated with or caused by increased
RNA-nucleolytic activity (e.g., the pre-tRNA splicing endonuclease
activity, the 3' end pre-mRNA endonuclease activity, the pre-tRNA
cleavage activity of a complex of the invention, and/or the
pre-ribosomal RNA cleavage activity of a complex of the invention)
or a symptom thereof. The invention also encompasses the use of
compounds that stimulate or enhance the expression of a component
of a complex of the invention, the formation of a complex of the
invention, the RNA-nucleolytic activity of a complex of the
invention (the pre-tRNA splicing endonuclease activity, the 3' end
pre-mRNA endonuclease activity, the pre-tRNA cleavage activity of a
complex of the invention, and/or the pre-ribosomal RNA cleavage
activity of a complex of the invention) for treatment, management
or amelioration of a disorder characterized by, associated with or
caused by decreased RNA-nucleolytic activity (e.g., the pre-tRNA
splicing endonuclease activity, the 3' end pre-mRNA endonuclease
activity, the pre-tRNA cleavage activity of a complex of the
invention, and/or the pre-ribosomal RNA cleavage activity of a
complex of the invention) or a symptom thereof. The invention also
encompasses the use of the compounds that stimulate or enhance the
expression of a component of a complex of the invention, the
formation of a complex of the invention, the nucleolytic activity
of a complex of the invention, (e.g., the pre-tRNA splicing
endonuclease activity, the 3' end pre-mRNA endonuclease activity,
the pre-tRNA cleavage activity of a complex of the invention,
and/or the pre-ribosomal RNA cleavage activity of a complex of the
invention) for augmenting wound healing in a subject.
[0062] The invention provides compositions comprising a carrier and
one of the following or a combination of two or more of the
following: (i) a component of a complex of the invention; (ii) a
complex of the invention, (iii) an antibody or a fragment thereof
that immunospecifically binds to a component of a complex of the
invention, or a complex of the invention, (iv) a compound that
modulates the expression of a component of a complex of the
invention, (v) a compound that modulates the formation of a complex
of the invention, (vi) a compound that modulates the endonuclease
activity (e.g., tRNA splicing endonuclease activity and/or 3' end
pre-mRNA endonuclease activity) of a complex of the invention,
(vii) a compound that modulates the pre-tRNA cleavage activity of a
complex of the invention, and/or (viii) a compound that modulates
pre-ribosomal RNA cleavage activity of a complex of the invention.
The compositions may further comprise one or more other
prophylactic or therapeutic agents. In a preferred embodiment, the
compositions are pharmaceutical compositions. In accordance with
this embodiment, the pharmaceutical compositions are preferably
sterile and in suitable form for the intended method of
administration or use. The invention encompasses the use of the
compositions of the invention in the prevention, treatment,
management or amelioration of a disorder described herein or a
symptom thereof.
[0063] The invention also provides methods for detecting,
diagnosing or monitoring a proliferative disorder or a disorder
associated with, characterized by or caused by abnormal pre-tRNA
processing and/or 3' end pre-mRNA processing utilizing an antibody
that immunospecifically binds to a complex of the invention or a
component thereof, or a compound identified in accordance with the
methods of the invention that specifically binds to a complex of
the invention or a component thereof. The invention also provides
methods for detecting, diagnosing or monitoring a proliferative
disorder or a disorder associated with, characterized by or caused
by abnormal pre-tRNA processing and/or 3' end pre-mRNA processing
by comparing the RNA-nucleolytic activity of a complex purified
from cells or a tissue sample from a subject with such a disorder
or suspected of having such disorder to the RNA-nucleolytic
activity of a control, e.g., a complex purified from normal,
non-cancerous cells or a tissue sample, using an assay well-known
to one of skill in the art or described herein. The invention
further provides methods for detecting, diagnosing or monitoring a
proliferative disorder or a disorder associated with, characterized
by or caused by abnormal pre-tRNA processing and/or 3' end pre-mRNA
processing by comparing the structure of a complex of the invention
purified from cells or a tissue sample from a subject (e.g., a
subject with such a disorder or suspected of having such a
disorder) to the structure of a control, e.g., a complex of the
invention purified from normal, non-cancerous cells or a tissue
sample, using an assay well-known to one of skill in the art (e.g.,
circular circular dichroism and nuclear magnetic resonance).
[0064] The invention also provides a method for modifying protein
expression in a cell, the method comprising expressing in the cell
at least one component of a complex of the invention. In more
specific embodiments, all components of a complex of the invention
and/or a fusion complex of the invention are expressed in a cell
using recombinant DNA technology. The component or the complex can
be expressed using an inducible, a constitutive or a
tissue-specific promoter, e.g., a promoter that supports the
overexpression of the component or the complex. In certain
embodiments, the component of the complex or the fusion complex is
mutated to be more active or less active (i.e., has a higher or
lower, respectively, complex-forming activity, or has a higher or
lower, respectively, RNA-nucleolytic activity) than the wild-type
component or complex.
[0065] In certain embodiments of the invention, a complex of the
invention is used to cleave an mRNA or pre-mRNA molecule containing
a pre-mature stop codon. In certain, more specific, embodiments of
the invention, a complex of the invention is used to cleave an mRNA
or pre-mRNA molecule at or in the vicinity of a pre-mature stop
codon. Without being bound by theory, a complex of the invention
cleaves an mRNA or a pre-mRNA molecule at or in the vicinity of a
pre-mature stop codon. In certain embodiments, the complex of the
invention cleaves an mRNA or a pre-mRNA molecule within 500, 400,
300, 200, 100 or 50 nucleotides of the pre-mature stop codon. In
certain embodiments, the complex of the invention cleaves an mRNA
or a pre-mRNA molecule within 1 to 50, 1 to 100, 1 to 250, 1 to
500, 10 to 50, 10 to 100, 25 to 100, 50 to 100, 50 to 250, 50 to
500, 100 to 500, or 250 to 500 nucleotides of the pre-mature stop
codon.
[0066] In certain embodiments of the invention, a complex of the
invention is used to identify pre-mature stop codons in an mRNA or
pre-mRNA molecule. In certain embodiments, the complex of the
invention cleaves an mRNA or a pre-mRNA molecule within 500, 400,
300, 200, 100 or 50 nucleotides of the pre-mature stop codon. In
certain embodiments, the complex of the invention cleaves an mRNA
or a pre-mRNA molecule within 1 to 50, 1 to 100, 1 to 250, 1 to
500, 10 to 50, 10 to 100, 25 to 100, 50 to 100, 50 to 250, 50 to
500, 100 to 500, or 250 to 500 nucleotides of the pre-mature stop
codon.
[0067] To identify the pre-mature stop codon, an mRNA or pre-mRNA
of interest is incubated with a complex of the invention under
conditions conducive to cleavage of the mRNA or pre-mRNA by the
complex. Once cleavage occurred, the cleavage products are analyzed
to determine the location of the cleavage site. The location of the
cleavage site can be determined by any method known to the skilled
artisan, such as, but not limited to Northern blot analysis.
[0068] In certain embodiments, the complexes of the invention can
be used to identify modulators of cleavage of pre-mature stop
codons by a complex of the invention. In certain embodiments, a
complex of the invention is incubated with an mRNA or pre-mRNA of
interest under conditions conducive to cleavage of the mRNA or
pre-mRNA by the complex in the presence of a compound, wherein the
mRNA or pre-mRNA is known to have a pre-mature stop codon. If the
compound increases the amount of cleavage product generated, the
compound is identified as an activator of the pre-mature stop codon
cleavage activity of a complex of the invention. If the compound
decreases the amount of cleavage product generated, the compound is
identified as an inhibitor of the pre-mature stop codon cleavage
activity of a complex of the invention.
[0069] A method of identifying a compound that modulates the
stability of a complex, wherein the method comprises the following
steps (a) incubating a complex of the invention in the presence of
a compound under conditions conducive to maintaining the complex;
and (b) determining the amount of the complex, wherein a difference
in the amount of the complex determined in step (b) relative to the
amount of the complex determined in the absence of the compound
indicates that the compound modulates the stability of the
complex.
[0070] The invention provides a method of identifying a therapeutic
agent for the treatment or prevention of cancer, or amelioration of
a symptom thereof, said method comprising: contacting a member of a
library of compounds with a cell; measuring the amount of a complex
of the invention formed in the cell; wherein if a compound that
reduces the amount of the complex relative to the amount of the
complex in the absence of said compound, then contacting the
compound with a cancer cell or a neoplastic cell and detecting the
proliferation of said cancer cell or neoplastic cell, so that if
the compound reduces or inhibits the proliferation of the cancer
cell or neoplastic cell, the compound is identified as an
antiproliferative compound. The invention further provides a method
of identifying a therapeutic agent for the treatment or prevention
of cancer, or amelioration of a symptom thereof, said method
comprising: contacting a member of a library of compounds with a
complex of the invention and a nucleic acid comprising a reporter
gene, wherein the reporter gene comprises a tRNA intron and wherein
all factors required for gene expression are present; and detecting
the expression of said reporter gene; wherein if a compound reduces
the expression of the reporter gene relative to the expression of
the reporter gene in the absence of said compound, then contacting
the compound with a cancer cell or a neoplastic cell and detecting
the proliferation of said cancer cell or neoplastic cell, so that
if the compound reduces or inhibits the proliferation of the cancer
cell or neoplastic cell, the compound is identified as an
antiproliferative compound. The invention further provides a method
of identifying a therapeutic agent for the treatment or prevention
of cancer, or amelioration of a symptom thereof, said method
comprising: contacting a member of a library of compounds with a
complex of the invention and a nucleic acid comprising a reporter
gene and a 3' end pre-mRNA cleavage site, wherein the reporter gene
is located 3' of the 3' end pre-mRNA cleavage site and wherein all
factors required for gene expression are present; and detecting the
expression of said reporter gene; wherein if a compound reduces the
expression of the reporter gene relative to the expression of the
reporter gene in the absence of said compound, then contacting the
compound with a cancer cell or a neoplastic cell and detecting the
proliferation of said cancer cell or neoplastic cell, so that if
the compound reduces or inhibits the proliferation of the cancer
cell or neoplastic cell, the compound is identified as an
antiproliferative compound. The method may further comprise testing
said compound in an animal model for cancer, wherein said testing
comprises administering said compound to said animal model and
verifying that the compound is effective in reducing the
proliferation or spread of cancer cells in said animal model. The
method may further comprise determining the cytotoxic activity of
the compound. The method may further comprise determining the
cytostatic activity of the compound.
[0071] 3.1 Terminology
[0072] As used herein, the terms "antibody" and "antibodies" refer
to monoclonal antibodies, multispecific antibodies, human
antibodies, humanized antibodies, camelised antibodies, chimeric
antibodies, single-chain Fvs (scFv), single chain antibodies,
single domain antibodies, Fab fragments, F(ab) fragments,
disulfide-linked Fvs (sdFv), and anti-idiotypic (anti-Id)
antibodies, and epitope-binding fragments of any of the above. In
particular, antibodies include immunoglobulin molecules and
immunologically active fragments of immunoglobulin molecules, i.e.,
molecules that contain an antigen binding site. Immunoglobulin
molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and
IgY), class (e.g., IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4,
IgA.sub.1 and IgA.sub.2) or subclass.
[0073] As used herein, the term "compound" refers to any agent or
complex that is being tested for its ability to modulate the
RNA-nucleolytic activity of a complex of the invention (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention), has been identified as modulating
RNA-nucleolytic activity of a complex of the invention, has been
identified as modulating the formation of a complex of the
invention, or has been identified as modulating the expression of a
component of a complex of the invention. The term "compound"
includes, but is not limited to, small molecules, antibodies and
fragments thereof, and double-stranded and single-stranded nucleic
acids. The RNA-nucleolytic activity of a complex of the invention
can be, inter alia, tRNA splicing endonuclease, 3' end pre-mRNA
cleavage endonuclease, pre-tRNA cleavage, or rRNA cleavage.
[0074] As used herein, the term "derivative" in the context of
proteinaceous agent (e.g., proteins, polypeptides, peptides, and
antibodies) refers to a proteinaceous agent that comprises an amino
acid sequence which has been altered by the introduction of amino
acid residue substitutions, deletions, and/or additions. The term
"derivative" as used herein also refers to a proteinaceous agent
which has been modified, i.e., by the covalent attachment of any
type of molecule to the proteinaceous agent. For example, but not
by way of limitation, an antibody may be modified, e.g., by
glycosylation, acetylation, pegylation, phosphorylation, amidation,
derivatization by known protecting/blocking groups, proteolytic
cleavage, linkage to a cellular ligand or other protein, etc. A
derivative of a proteinaceous agent may be produced by chemical
modifications using techniques known to those of skill in the art,
including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis in the presence of
tunicamycin, etc. Further, a derivative of a proteinaceous agent
may contain one or more non-classical amino acids. A derivative of
a proteinaceous agent possesses a similar or identical function as
the proteinaceous agent from which it was derived, e.g.,
participates in a complex with RNA-nucleolytic activity. The term
"derivative" in the context of a proteinaceous agent also refers to
a proteinaceous agent that possesses a similar or identical
function as a second proteinaceous agent (i.e., the proteinaceaous
agent from which the derivative was derived) but does not
necessarily comprise a similar or identical amino acid sequence of
the second proteinaceous agent, or possess a similar or identical
structure of the second proteinaceous agent. A proteinaceous agent
that has a similar amino acid sequence refers to a second
proteinaceous agent that satisfies at least one of the following:
(a) a proteinaceous agent having an amino acid sequence that is at
least 30%, at least 35%, at least 40%, at least 45%, at least 50%,
at least 55%, at least 60%, at least 65%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95% or at
least 99% identical to the amino acid sequence of a second
proteinaceous agent; (b) a proteinaceous agent encoded by a
nucleotide sequence that hybridizes under stringent conditions to a
nucleotide sequence encoding a second proteinaceous agent of at
least 5 contiguous amino acid residues, at least 10 contiguous
amino acid residues, at least 15 contiguous amino acid residues, at
least 20 contiguous amino acid residues, at least 25 contiguous
amino acid residues, at least 40 contiguous amino acid residues, at
least 50 contiguous amino acid residues, at least 60 contiguous
amino residues, at least 70 contiguous amino acid residues, at
least 80 contiguous amino acid residues, at least 90 contiguous
amino acid residues, at least 100 contiguous amino acid residues,
at least 125 contiguous amino acid residues, or at least 150
contiguous amino acid residues; and (c) a proteinaceous agent
encoded by a nucleotide sequence that is at least 30%, at least
35%, at least 40%, at least 45%, at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95% or at least 99% identical
to the nucleotide sequence encoding a second proteinaceous agent. A
proteinaceous agent with similar structure to a second
proteinaceous agent refers to a proteinaceous agent that has a
similar secondary, tertiary or quaternary structure to the second
proteinaceous agent. The structure of a proteinaceous agent can be
determined by methods known to those skilled in the art, including
but not limited to, peptide sequencing, X-ray crystallography,
nuclear magnetic resonance, circular dichroism, and
crystallographic electron microscopy. In a specific embodiment, a
derivative is a functionally active derivative.
[0075] To determine the percent identity of the amino acid sequence
of a derivative to the amino acid sequence of the proteinaceaous
agent from which the derivative is derived or to compare the
nucleic acid sequences encoding the derivative and the
proteinaceaous agent from which the derivative is derived, the
sequences are aligned for optimal comparison purposes (e.g., gaps
can be introduced in the sequence of a first amino acid or nucleic
acid sequence for optimal alignment with a second amino acid or
nucleic acid sequence). The amino acid residues or nucleotides at
corresponding amino acid positions or nucleotide positions are then
compared. When a position in the first sequence is occupied by the
same amino acid residue or nucleotide as the corresponding position
in the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % identity=number of identical overlapping
positions/total number of positions x 100%). In one embodiment, the
two sequences are the same length. The determination of percent
identity between two sequences can also be accomplished using a
mathematical algorithm. A preferred, non-limiting example of a
mathematical algorithm utilized for the comparison of two sequences
is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad.
Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993,
Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is
incorporated into the NBLAST and XBLAST programs of Altschul et
al., 1990, J. Mol. Biol. 215:403. BLAST nucleotide searches can be
performed with the NBLAST nucleotide program parameters set, e.g.,
for score=100, wordlength=12 to obtain nucleotide sequences
homologous to a nucleic acid molecules of the present invention.
BLAST protein searches can be performed with the XBLAST program
parameters set, e.g., to score-50, wordlength=3 to obtain amino
acid sequences homologous to a protein molecule of the present
invention. To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul et al., 1997,
Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-BLAST can be
used to perform an iterated search which detects distant
relationships between molecules (Id.). When utilizing BLAST, Gapped
BLAST, and PSI-Blast programs, the default parameters of the
respective programs (e.g., of XBLAST and NBLAST) can be used (see,
e.g., the NCBI website). Another preferred, non-limiting example of
a mathematical algorithm utilized for the comparison of sequences
is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17. Such an
algorithm is incorporated in the ALIGN program (version 2.0) which
is part of the GCG sequence alignment software package. When
utilizing the ALIGN program for comparing amino acid sequences, a
PAM120 weight residue table, a gap length penalty of 12, and a gap
penalty of 4 can be used.
[0076] The percent identity between two sequences can be determined
using techniques similar to those described above, with or without
allowing gaps. In calculating percent identity, typically only
exact matches are counted.
[0077] As used herein, the terms "disorder" and "disease" are to
refer to a condition in a subject (e.g., a proliferative disorder
or a disorder characterized by, associated with or caused by
abnormal RNA-nucleolytic activity).
[0078] As used herein, the term "effective amount" in the context
of a proliferative disorder refers to the amount of a therapy
(e.g., a compound, a complex of the invention, a component of a
complex of the invention, a nucleic acid encoding a component of a
complex of the invention, a nucleic acid that inhibits the
expression of a component of a complex of the invention, an
antibody or a fragment thereof that immunospecifically binds to a
complex of the invention, or an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention), which is sufficient to reduce or ameliorate the
progression, severity and/or duration of a proliferative disorder
or one or more symptoms thereof, prevent the development,
recurrence or onset of a proliferative disorder or one or more
symptoms thereof, prevent the advancement of a proliferative
disorder or one or more symptoms thereof, or enhance or improve the
therapeutic(s) effect(s) of another therapy. An "effective amount"
in the context of a disorder characterized by, associated with or
caused by abnormal RNA-nucleolytic activity refers to the amount of
a therapy (e.g., a compound, a complex of the invention, a
component of a complex of the invention, a nucleic acid encoding a
component of a complex of the invention, a nucleic acid that
inhibits the expression of a component of a complex of the
invention, an antibody or a fragment thereof that
immunospecifically binds to a complex of the invention, or an
antibody or a fragment thereof that immunospecifically binds to a
component of a complex of the invention), which is sufficient to
reduce or ameliorate the progression, severity and/or duration of a
disorder characterized by, associated with or caused by abnormal
RNA-nucleolytic activity or one or more symptoms thereof, prevent
the development, recurrence or onset of a disorder characterized
by, associated with or caused by abnormal RNA-nucleolytic activity
or one or more symptoms thereof, prevent the advancement of a
disorder characterized by, associated with or caused by abnormal
RNA-nucleolytic activity or one or more symptoms thereof, or
enhance or improve the therapeutic(s) effect(s) of another therapy.
As used herein, the term "effective amount" in the context of wound
healing refers to the amount of a therapy (e.g., a compound, a
complex of the invention, a component of a complex of the
invention, a nucleic acid encoding a component of a complex of the
invention, a nucleic acid that inhibits the expression of a
component of a complex of the invention, an antibody or a fragment
thereof that immunospecifically binds to a complex of the
invention, or an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention), which is sufficient to reduce or ameliorate the
progression, severity and/or duration of a wound (e.g., a wound
caused by an injury) or one or more symptoms thereof, prevent the
development, recurrence or onset of a wound, a condition associated
with a wound, or one or more symptoms thereof, prevent the
advancement of a condition associated with a wound or one or more
symptoms thereof, or enhance or improve the therapeutic(s)
effect(s) of another therapy.
[0079] As used herein, the term "fluorescent acceptor moiety"
refers to a fluorescent compound that absorbs energy from a
fluorescent donor moiety and re-emits the transferred energy as
fluorescence. Examples of fluorescent acceptor moieties include,
but are not limited to, coumarins and related fluorophores,
xanthenes (e.g., fluoresceins, rhodols, and rhodamines), resorufms,
cyanines, difluoroboradiazindacenes and phthalocyanines.
[0080] As used herein, the term "fluorescent donor moiety" refers
to a fluorescent compound that can absorb energy and is capable of
transferring the energy to an acceptor, such as another fluorescent
compound. Examples of fluorescent donor moieties include, but are
not limited to, coumarins and related dyes, xanthene dyes (e.g.,
fluoresceins, rhodols and rhodamines), resorufms, cyanine dyes,
bimanes, acridines, isoindoles, dansyl dyes, aminophthalic
hydrazides (e.g., luminol and isoluminol derivatives),
aminophthalimides, aminonaphthalimides, aminobenzofurans,
aminoquinolines, dicyanohydroquinones, fluorescent europium,
terbium complexes and related compounds.
[0081] As used herein, the term "fluorophore" refers to a
chromophore that fluoresces.
[0082] As used herein, the term "fragment" refers to a peptide or
polypeptide comprising an amino acid sequence of at least 5
contiguous amino acid residues, at least 10 contiguous amino acid
residues, at least 15 contiguous amino acid residues, at least 20
contiguous amino acid residues, at least 25 contiguous amino acid
residues, at least 40 contiguous amino acid residues, at least 50
contiguous amino acid residues, at least 60 contiguous amino
residues, at least 70 contiguous amino acid residues, at least
contiguous 80 amino acid residues, at least contiguous 90 amino
acid residues, at least contiguous 100 amino acid residues, at
least contiguous 125 amino acid residues, at least 150 contiguous
amino acid residues, at least contiguous 175 amino acid residues,
at least contiguous 200 amino acid residues, or at least contiguous
250 amino acid residues of the amino acid sequence of another
polypeptide or protein. In a specific embodiment, a fragment of a
protein or polypeptide retains at least one function of the protein
or polypeptide.
[0083] As used herein, the term "functionally active derivative" in
the context of proteinaceous agent is a derivative of a
proteinaceous agent that retains at least one function of the
polypeptide or protein from which the derivative is derived. In a
specific embodiment, a functionally active derivative retains at
least two, three, four, or five functions of the protein or
polypeptide from which the derivative is derived. In a specific
embodiment, the functionally active derivative retains the ability
of the protein from which it is derived to bind to a specific third
protein or form a specific complex with RNA-nucleolytic activity,
e.g., a complex of the invention. In another specific embodiment,
the functionally active derivative retains the RNA-nucleolytic
activity of protein from which the derivative is derived.
[0084] As used herein, the term "functionally active fragment"
refers to a fragment of a polypeptide or protein that retains at
least one function of the second, different polypeptide or protein.
In a specific embodiment, a fragment of a polypeptide or protein
retains at least two, three, four, or five functions of the protein
or polypeptide. In a specific embodiment, the functionally active
fragment retains the ability of the second protein to bind to a
specific third protein or form a specific complex. In another
specific embodiment, the functionally active fragment retains the
RNA-nucleolytic activity of the second protein.
[0085] As used herein, the term "fusion complex" means a protein
complex, wherein the protein components of the complex are linked
to each other via a peptide bond or other covalent linkage.
[0086] As used herein, the term "fusion protein" refers to a
polypeptide or protein that comprises an amino acid sequence of a
first protein or polypeptide or functional fragment, analog or
derivative thereof, and an amino acid sequence of a heterologous
protein, polypeptide, or peptide (ie., a second protein or
polypeptide or fragment, analog or derivative thereof different
than the first protein or fragment, analog or derivative thereof).
In other words, a fusion protein comprises an amino acid sequence
of a first protein, polypeptide or peptide and an amino acid
sequence that is not normally associated with or a part of the
first protein.
[0087] As used herein, the term "host cell" includes a particular
subject cell transfected or transformed with a nucleic acid
molecule and the progeny or potential progeny of such a cell.
Progeny of such a cell may not be identical to the parent cell
transfected with the nucleic acid molecule due to mutations or
environmental influences that may occur in succeeding generations
or integration of the nucleic acid molecule into the host cell
genome.
[0088] As used herein, the term "hybridizes under stringent
conditions" describes conditions for hybridization and washing
under which nucleotide sequences at least 30% (preferably, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%,
99% or 99.5%) identical to each other typically remain hybridized
to each other. Such stringent conditions are known to those skilled
in the art and can be found in Current Protocols in Molecular
Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. In one,
non-limiting example stringent hybridization conditions are
hybridization at 6.times. sodium chloride/sodium citrate (SSC) at
about 45.degree. C., followed by one or more washes in
0.1.times.SSC, 0.2% SDS at about 68 C. In a preferred, non-limiting
example stringent hybridization conditions are hybridization in
6.times.SSC at about 45.degree. C., followed by one or more washes
in 0.2.times.SSC, 0.1% SDS at 50-65.degree. C. (i.e., one or more
washes at 50.degree. C., 55.degree. C., 60.degree. C. or 65.degree.
C.). It is understood that the nucleic acids of the invention do
not include nucleic acid molecules that hybridize under these
conditions solely to a nucleotide sequence consisting of only A or
T nucleotides. In a specific embodiment, high stringency conditions
comprise hybridization in a buffer consisting of 6.times.SSC, 50 mM
Tris-HCl (pH=7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA
and 100 .mu.g/ml denatured salmon sperm DNA, for 48 hours at
65.degree. C., washing in a buffer consisting of 2.times.SSC, 0.01%
PVP, 0.01% Ficoll and 0.01% BSA, for 45 minutes at 37.degree. C.,
and washing in a buffer consisting of 0.1.times.SSC, for 45 minutes
at 50.degree. C. For an exemplary method for determining stringency
conditions, see section 4.3.1.
[0089] As used herein, the term "immunospecifically binds" and
analogous terms refer to peptides, polypeptides, proteins, fusion
proteins and antibodies or fragments thereof that specifically bind
to an antigen or a fragment and do not specifically bind to other
antigens (e.g., as determined via standard immunoassays, such as,
but not limited to, an ELISA). A peptide, polypeptide, protein, or
antibody that immunospecifically binds to an antigen may bind to
other peptides, polypeptides, or proteins with lower affinity as
determined by, e.g., immunoassays, BIAcore, or other assays known
in the art. Antibodies or fragments that immunospecifically bind to
an antigen may be cross-reactive with related antigens. Preferably,
antibodies or fragments that immunospecifically bind to an antigen
do not cross-react with other antigens.
[0090] As used herein, the term "in combination" refers to the use
of more than one therapy (e.g., prophylactic and/or therapeutic
agents). The use of the term "in combination" does not restrict the
order in which therapies (e.g., prophylactic and/or therapeutic
agents) are administered to a subject with a disorder. A first
therapy (e.g., a prophylactic or therapeutic agent such as a
compound identified in accordance with the methods of the
invention) can be administered prior to (e.g., 5 minutes, 15
minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours,
12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks,
3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before),
concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes,
30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12
hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3
weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the
administration of a second therapy (e.g., a prophylactic or
therapeutic agent such as a chemotherapeutic agent or a TNF-.alpha.
antagonist) to a subject with a disorder.
[0091] As used herein, the term "library" refers to a plurality of
compounds. A library can be a combinatorial library, e.g., a
collection of compounds synthesized using combinatorial chemistry
techniques, or a collection of unique chemicals of low molecular
weight (less than 1000 daltons) that each occupy a unique
three-dimensional space. In a specific embodiment, a library is
composed of at least 50; 100; 150; 200; 250; 500; 750; 1,000;
1,250; 1,500; 1,750; 2,000; 2,500; 5,000; 7,500; 10,000; 20,000;
30,000; 40,000; or at least 50, 000 different compounds. In a
specific embodiment, a library is composed of at most 50; 100; 150;
200; 250; 500; 750; 1,000; 1,250; 1,500; 1,750; 2,000; 2,500;
5,000; 7,500; 10,000; 20,000; 30,000; 40,000; or at most 50,000
different compounds. In a specific embodiment, a library is
composed of between 10 and 100; 10 and 150; 100 and 200; 100 and
250; 100 and 500; 100 and 750; 500 and 1,000; 500 and 1,250; 500
and 1,500; 500 and 1,750; 1,000 and 2,000; 1,000 and 2,500; 2,000
and 5,000; 2,000 and 7,500; 2,000 and 10,000; 5,000 and 20,000;
10,000 and 30,000; 10,000 and 40,000; between 20,000 and 50, 000
different compounds.
[0092] As used herein, the terms "manage", "managing" and
"management" refer to the beneficial effects that a subject derives
from a therapy (e.g., administration of a prophylactic or
therapeutic agent) which does not result in a cure of the disorder.
In certain embodiments, a subject is administered one or more
therapies to "manage" a disease or disorder so as to prevent the
progression or worsening of the disease or disorder.
[0093] As used herein, the terms "non-responsive" and refractory"
describe patients treated with a currently available therapy (e.g.,
prophylactic or therapeutic agent) for a disorder (e.g., cancer),
which is not clinically adequate to relieve the disorder or one or
more symptoms associated with such disorder. Typically, such
patients suffer from severe, persistently active disease and
require additional therapy to ameliorate the symptoms associated
with their disorder.
[0094] As used herein, the term "ORF" refers to the open reading
frame of a mRNA, ie., the region of the mRNA that is translated
into protein.
[0095] As used herein, the phrase "pharmaceutically acceptable
salt(s)," includes, but is not limited to, salts of acidic or basic
groups that may be present in compounds identified using the
methods of the present invention. Compounds that are basic in
nature are capable of forming a wide variety of salts with various
inorganic and organic acids. The acids that can be used to prepare
pharmaceutically acceptable acid addition salts of such basic
compounds are those that form non-toxic acid addition salts, i.e.,
salts containing pharmacologically acceptable anions, including but
not limited to sulfuric, citric, maleic, acetic, oxalic,
hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate,
bisulfate, phosphate, acid phosphate, isonicotinate, acetate,
lactate, salicylate, citrate, acid citrate, tartrate, oleate,
tannate, pantothenate, bitartrate, ascorbate, succinate, maleate,
gentisinate, fumarate, gluconate, glucaronate, saccharate, formate,
benzoate, glutamate, methanesulfonate, ethanesulfonate,
benzenesulfonate, p-toluenesulfonate and pamoate (i.e.,
1,1'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Compounds that
include an amino moiety may form pharmaceutically acceptable salts
with various amino acids, in addition to the acids mentioned above.
Compounds that are acidic in nature are capable of forming base
salts with various pharmacologically acceptable cations. Examples
of such salts include alkali metal or alkaline earth metal salts
and, particularly, calcium, magnesium, sodium lithium, zinc,
potassium, and iron salts.
[0096] As used herein, the terms "prevent", "preventing" and
"prevention" refer to the prevention of the development, recurrence
or onset of a disorder or one or more symptoms thereof resulting
from the administration of a therapy or the administration of a
combination of therapies.
[0097] As used herein, the term "previously determined reference
range" refers to a reference range for the readout of a particular
assay. In a specific embodiment, the term refers to a reference
range for the expression and/or the activity of a reporter gene by
a particular cell or in a particular cell-free extract. Each
laboratory will establish its own reference range for each
particular assay, each cell type and each cell-free extract. In a
preferred embodiment, at least one positive control and at least
one negative control are included in each batch of compounds
analyzed.
[0098] As used herein, the terms "prophylactic agent" and
"prophylactic agents" refer to any agent(s) which can be used in
the prevention of a disorder. In certain embodiments, the term
"prophylactic agent" refers to a compound identified in the
screening assays described herein, a complex of the invention, an
antibody or a fragment thereof that immunospecifically binds to a
complex of the invention, Sen2.DELTA.Ex8 protein, a nucleic acid
encoding Sen2.DELTA.Ex8, an antibody or a fragment thereof that
immunospecifically binds to Sen2.DELTA.Ex8, a component of a
complex of the invention or a nucleic acid encoding a component of
a complex of the invention or a nucleic acid that prevents or
reduces the expression of a component of a complex of the invention
(e.g., an antisense nucleic acid or using RNAi). In certain other
embodiments, the term "prophylactic agent" refers to an agent other
than a compound identified in the screening assays described
herein, a complex of the invention, an antibody or a fragment
thereof that immunospecifically binds to a complex of the
invention, Sen2.DELTA.Ex8 protein, a nucleic acid encoding
Sen2.DELTA.Ex8, an antibody or a fragment thereof that
immunospecifically binds to Sen2.DELTA.Ex8, a component of a
complex of the invention or a nucleic acid encoding a component of
a complex of the invention or a nucleic acid that prevents or
reduces the expression of a component of a complex of the invention
(e.g., an antisense nucleic acid or using RNAi), which is known to
be useful for, or has been or is currently being used to prevent or
impede the onset, development and/or progression of a disorder or
one or more symptoms thereof. A "prophylactic agent" in the context
of a disorder characterized by, associated with or caused by
abnormal RNA-nucleolytic activity refers to the amount of a
compound, a complex of the invention, a component of a complex of
the invention, a nucleic acid encoding a component of a complex of
the invention, a nucleic acid that inhibits the expression of a
component of a complex of the invention, an antibody or a fragment
thereof that immunospecifically binds to a complex of the
invention, or an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention, which can prevent or reduce the risk of a disorder
characterized by, associated with or caused by abnormal
RNA-nucleolytic activity or one or more symptoms thereof. As used
herein, the term "prophylactic agent" in the context of wound
healing refers to a compound, a complex of the invention, a
component of a complex of the invention, a nucleic acid encoding a
component of a complex of the invention, a nucleic acid that
inhibits the expression of a component of a complex of the
invention, an antibody or a fragment thereof that
immunospecifically binds to a complex of the invention, or an
antibody or a fragment thereof that immunospecifically binds to a
component of a complex of the invention, which can prevent the
development, recurrence or onset of a wound, a condition associated
with a wound, or one or more symptoms thereof, prevent the
advancement of a condition associated with a wound or one or more
symptoms thereof, or enhance or improve the therapeutic(s)
effect(s) of another therapy.
[0099] As used herein, the phrase "prophylactically effective
amount" refers to the amount of a therapy (e.g., a prophylactic
agent, such as a compound identified by the methods of the
invention, a complex of the invention, a component of a complex of
the invention, a nucleic acid encoding a component of a complex of
the invention, a nucleic acid that inhibits the expression of a
component of a complex of the invention, an antibody or a fragment
thereof that immunospecifically binds to a complex of the
invention, or an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention) which is sufficient to result in the prevention of the
development, recurrence or onset of a disorder or one or more
symptoms thereof.
[0100] As used herein, the term "purified" in the context of a
compound other than a proteinaceous agent or a nucleic acid, e.g.,
a compound identified in accordance with the method of the
invention, refers to a compound that is substantially free of
chemical precursors or other chemicals when chemically synthesized.
In a specific embodiment, the compound is 60%, preferably 65%, 70%,
75%, 80%, 85%, 90%, or 99% free of other, different compounds. In a
preferred embodiment, a compound identified in accordance with the
methods of the invention is purified.
[0101] Specifically, the term "purified," in the context of a
proteinaceous agent (e.g., a peptide, polypeptide, or protein, such
as a tRNA splicing endonuclease or subunit thereof) refers to a
proteinaceous agent which is substantially free of cellular
material or contaminating proteins from the cell or tissue source
from which it is derived, or substantially free of chemical
precursors or other chemicals when chemically synthesized. The
language "substantially free of cellular material" includes
preparations of a proteinaceous agent in which the proteinaceous
agent is separated from cellular components of the cells from which
it is purified or recombinantly produced. Thus, a proteinaceous
agent or an agent that is substantially free of cellular material
includes preparations of a proteinaceous agent having less than
about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein,
polypeptide, peptide, or antibody (also referred to as a
"contaminating protein"). When the proteinaceous agent is
recombinantly produced, it is also preferably substantially free of
culture medium, i.e., culture medium represents less than about
20%, 10%, or 5% of the volume of the protein preparation. When the
proteinaceous agent is produced by chemical synthesis, it is
preferably substantially free of chemical precursors or other
chemicals, i.e., it is separated from chemical precursors or other
chemicals which are involved in the synthesis of the proteinaceous
agent. Accordingly, such preparations of a proteinaceous agent have
less than about 30%, 20%, 10%, 5% (by dry weight) of chemical
precursors or compounds other than the proteinaceous agent of
interest. Preferably, proteinaceous agents disclosed herein are
purified.
[0102] As used herein, the term "purified" in the context of
nucleic acid molecules refers to a nucleic acid molecule which is
separated from other nucleic acid molecules which are present in
the natural source of the nucleic acid molecule. Moreover, a
"purified" nucleic acid molecule, such as a cDNA molecule, is
preferably substantially free of other cellular material, or
culture medium when produced by recombinant techniques, or
substantially free of chemical precursors or other chemicals when
chemically synthesized. In a specific embodiment, nucleic acid
molecules are purified. In a preferred embodiment, a nucleic acid
molecule encoding a component of a complex of the invention is
purified.
[0103] As used herein, the term "quencher" refers to a molecule or
a part of a compound that is capable of reducing the emission from
a fluorescent moiety. Such reduction includes reducing the light
after the time when a photon is normally emitted from a fluorescent
moiety.
[0104] As used herein, "RNA-nucleolytic activity" refers to, but is
not limited to, pre-tRNA splicing activity, 3' end pre-mRNA
endonuclease activity, pre-tRNA cleavage activity and pre-ribosomal
RNA cleavage activity.
[0105] As used herein, the term "small molecules" and analogous
terms include, but are not limited to, peptides, peptidomimetics,
amino acids, amino acid analogs, polynucleotides, polynucleotide
analogs, nucleotides, nucleotide analogs, organic or inorganic
compounds (ie,. including heteroorganic and organometallic
compounds) having a molecular weight less than about 10,000 grams
per mole, organic or inorganic compounds having a molecular weight
less than about 5,000 grams per mole, organic or inorganic
compounds having a molecular weight less than about 1,000 grams per
mole, organic or inorganic compounds having a molecular weight less
than about 500 grams per mole, organic or inorganic compounds
having a molecular weight less than about 100 grams per mole, and
salts, esters, and other pharmaceutically acceptable forms of such
compounds. Salts, esters, and other pharmaceutically acceptable
forms of such compounds are also encompassed.
[0106] As used herein, the term "specifically binds" and analogous
terms in the context of compounds identified in accordance with the
invention refers to refer compounds identified in accordance with
the invention that bind to a complex of the invention or a protein
component of a complex of the invention or a fragment of a protein
component of a complex of the invention and do not bind to, or bind
with lower affinity to, other complexes, proteins or polypeptides.
The binding affinity can be determined by, e.g., immunoassays,
BIAcore, or other assays known in the art. Compounds that
specifically bind to a complex of the invention or a protein
component of a complex of the invention or a fragment of a protein
component of a complex of the invention may be cross-reactive with
related proteins or polypeptides. Preferably, compounds that
specifically bind to a complex of the invention or a protein
component of a complex of the invention or a fragment of a protein
component of a complex of the invention are not cross-reactive with
related proteins or polypeptides.
[0107] As used herein, the terms "subject" and "patient" are used
interchangeably herein. The terms "subject" and "subjects" refer to
an animal, preferably a mammal including a non-primate (e.g., a
cow, pig, horse, cat, dog, rat, and mouse) and a primate (e.g., a
chimpanzee, a monkey such as a cynomolgous monkey, and a human),
and more preferably a human. In one embodiment, the subject is
refractory or non-responsive to current therapies for a
proliferative disorder. In another embodiment, the subject is a
farm animal (e.g., a horse, a cow, a pig, etc.) or a pet (e.g., a
dog or a cat). In a preferred embodiment, the subject is a
human.
[0108] As used herein, the phrase "a substrate for a human tRNA
splicing endonuclease" refers to any nucleotide sequence recognized
and excised by a human tRNA splicing endonuclease. For example, a
nucleotide sequence comprising a bulge-helix-bulge structure or a
mature domain of a precursor tRNA may be utilized as a substrate
for a human tRNA splicing endonuclease in an assay described
herein. A nucleotide sequence recognized and excised by a human
tRNA splicing endonuclease may comprise 10 nucleotides, 15
nucleotides, 20 nucleotides, 25 nucleotides, 25 nucleotides, 30
nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55
nucleotides, 60 nucleotides, 65 nucleotides, 75 nucleotides, 100
nucleotides, 125 nucleotides, 150 nucleotides, or more. In a
specific embodiment, the substrates for a tRNA splicing
endonuclease utilized in the assays described herein comprise a
tRNA intron. The substrate may comprise a mature domain or a
bulge-helix-bulge conformation. In a preferred embodiment, the
substrate comprises a mature domain of a precursor tRNA.
[0109] A substrate for a human tRNA endonuclease may be produced by
any method well-known to one of skill in the art. For example, the
substrate may be chemically synthesized using phosphoramidite or
other solution or solid-phase methods. Detailed descriptions of the
chemistry used to form polynucleotides by the phosphoramidite
method are well known (see, e.g., Caruthers et al., U.S. Pat. Nos.
4,458,066 and 4,415,732; Caruthers et al., 1982, Genetic
Engineering 4:1-17; Users Manual Model 392 and 394 Polynucleotide
Synthesizers, 1990, pages 6-1 through 6-22, Applied Biosystems,
Part No. 901237; Ojwang, et al., 1997, Biochemistry, 36:6033-6045).
After synthesis, the substrate can be purified using standard
techniques known to those skilled in the art (see Hwang et al.,
1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references
cited therein). Depending on the length of the substrate and the
method of its synthesis, such purification techniques include, but
are not limited to, reverse-phase high-performance liquid
chromatography ("reverse-phase HPLC"), fast performance liquid
chromatography ("FPLC"), and gel purification. In a specific
embodiment, the substrates depicted in FIG. 1 are utilized in the
assays described herein. To generate the hybridized tRNA substrate
depicted in FIG. 1, both strands of the hybridized substrate are
transcribed separately and the two strands are subsequently
hybridized by heating and cooling. For synthesis of the circularly
permuted tRNA substrate, the RNA is transcribed from the 5' end in
the intron (see FIG. 1C) to the 3' end in the intron.
[0110] As used herein, the phrase "a substrate for a human 3' end
pre-mRNA endonuclease" refers to any nucleotide sequence recognized
and excised by a human 3' end pre-mRNA endonuclease. For example, a
nucleotide sequence comprising a hexanucleotide with the sequence
AAUAAA upstream and a G/U-rich sequence element downstream of the
cleavage site may be utilized as a substrate for 3' end pre-mRNA
endonuclease in an assay described herein. A nucleotide sequence
recognized and excised by a 3' end pre-mRNA endonuclease may
comprise 10 nucleotides, 15 nucleotides, 20 nucleotides, 25
nucleotides, 25 nucleotides, 30 nucleotides, 40 nucleotides, 45
nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65
nucleotides, 75 nucleotides, 100 nucleotides, 125 nucleotides, 150
nucleotides, or more. In a specific embodiment, the substrates for
3' end pre-mRNA endonuclease utilized in the assays described
herein comprise a cleavage and polyadenylation site.
[0111] As used herein, the term "synergistic" refers to a
combination of a compound identified using one of the methods
described herein (i.e., that modulates the activity of a complex of
the invention), a complex of the invention, a component of a
complex of the invention, an antibody or a fragment thereof that
immunospecifically binds to a complex of the invention, an antibody
or a fragment thereof that immunospecifically binds to a component
of a complex of the invention, or a nucleic acid encoding a
component of a complex of the invention, and another therapy (e.g.,
agent) which has been or is currently being used to prevent, treat,
manage or ameliorate a disorder or a symptom thereof, which is more
effective than the additive effects of the therapies. A synergistic
effect of a combination of therapies (e.g., prophylactic or
therapeutic agents) permits the use of lower dosages of one or more
of the therapies and/or less frequent administration of said
therapies to a subject with a disorder. The ability to utilize
lower dosages of a therapy (e.g., a prophylactic or therapeutic
agent) and/or to administer said therapy less frequently reduces
the toxicity associated with the administration of said agent to a
subject without reducing the efficacy of said therapies in the
prevention, treatment, management or amelioration of a disorder or
a symptom thereof. In addition, a synergistic effect can result in
improved efficacy of therapies (e.g., agents) in the prevention,
treatment, management or amelioration of a disorder or a symptom
thereof. Finally, a synergistic effect of a combination of
therapies (e.g., prophylactic or therapeutic agents) may avoid or
reduce adverse or unwanted side effects associated with the use of
either therapy alone.
[0112] As used herein, the terms "therapeutic agent" and
"therapeutic agents" refer to any agent(s) which can be used in the
prevention, treatment, management or amelioration of a disorder or
a symptom thereof. In certain embodiments, the term "therapeutic
agent" refers to a compound identified in the screening assays
described herein, a complex of the invention, a component of a
complex of the invention, an antibody or a fragment thereof that
immunospecifically binds to a complex of the invention, an antibody
or a fragment thereof that immunospecifically binds to a component
of a complex of the invention, or a nucleic acid encoding a
component of a complex of the invention or anti-sense or RNAi
nucleic acid. In other embodiments, the term "therapeutic agent"
refers to an agent other than a compound identified in the
screening assays described herein which is known to be useful for,
or has been or is currently being used to prevent, treat, manage or
ameliorate a disorder or one or more symptoms thereof.
[0113] As used herein, the term "therapeutically effective amount"
refers to that amount of a therapy (e.g., a therapeutic agent)
sufficient to result in the amelioration of one or more symptoms of
a disorder, prevent advancement of a disorder, cause regression of
the disorder, or to enhance or improve the therapeutic effect(s) of
another therapy (e.g., therapeutic agent). In a specific
embodiment, with respect to the treatment of cancer, a
therapeutically effective amount refers to the amount of a therapy
(e.g., a therapeutic agent) that inhibits or reduces the
proliferation of cancerous cells, inhibits or reduces the spread of
tumor cells (metastasis), inhibits or reduces the onset,
development or progression of one or more symptoms associated with
cancer, or reduces the size of a tumor. Preferably, a
therapeutically effective of a therapy (e.g., a therapeutic agent)
reduces the proliferation of cancerous cells or the size of a tumor
by at least 5%, preferably at least 10%, at least 15%, at least
20%, at least 25%, at least 30%, at least 35%, at least 40%, at
least 45%, at least 50%, at least 55%, at least 60%, at least 65%,
at least 70%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, or at least 100% relative to a control such as
phosphate buffered saline ("PBS"). A "therapeutically effective
amount" in the context of a disorder characterized by, associated
with or caused by abnormal RNA-nucleolytic activity refers to the
amount of a compound, a complex of the invention, a component of a
complex of the invention, a nucleic acid encoding a component of a
complex of the invention, a nucleic acid that inhibits the
expression of a component of a complex of the invention, an
antibody or a fragment thereof that immunospecifically binds to a
complex of the invention, or an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention, which is sufficient to reduce or ameliorate the
progression, severity and/or duration of a disorder characterized
by, associated with or caused by abnormal RNA-nucleolytic activity
or one or more symptoms thereof, prevent the development,
recurrence or onset of a disorder characterized by, associated with
or caused by abnormal RNA-nucleolytic activity or one or more
symptoms thereof, prevent the advancement of a disorder
characterized by, associated with or caused by abnormal
RNA-nucleolytic activity or one or more symptoms thereof, or
enhance or improve the therapeutic(s) effect(s) of another therapy.
As used herein, the term "therapeutically effective amount" in the
context of wound healing refers to the amount of a compound, a
complex of the invention, a component of a complex of the
invention, a nucleic acid encoding a component of a complex of the
invention, a nucleic acid that inhibits the expression of a
component of a complex of the invention, an antibody or a fragment
thereof that immunospecifically binds to a complex of the
invention, or an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention, which is sufficient to reduce or ameliorate the
progression, severity and/or duration of a wound (e.g., a wound
caused by an injury) or one or more symptoms thereof, prevent the
development, recurrence or onset of a wound, a condition associated
with a wound, or one or more symptoms thereof, prevent the
advancement of a condition associated with a wound or one or more
symptoms thereof, or enhance or improve the therapeutic(s)
effect(s) of another therapy.
[0114] As used herein, the terms "treat", "treatment" and
"treating" refer to the reduction or amelioration of the
progression, severity and/or duration of a disorder or one or more
symptoms thereof resulting from the administration of one or more
therapies (e.g., compounds identified in accordance the methods of
the invention, a complex of the invention, a component of a complex
of the invention, an antibody or a fragment thereof that
immunospecifically binds to a complex of the invention, an antibody
or a fragment thereof that immunospecifically binds to a component
of a complex of the invention, or a nucleic acid encoding a
component of a complex of the invention, or a combination thereof
and another therapy). In specific embodiments, such terms refer to
the inhibition or reduction in the proliferation of cancerous
cells, the inhibition or reduction the spread of tumor cells
(metastasis), the inhibition or reduction in the onset, development
or progression of one or more symptoms associated with cancer, or
the reduction in the size of a tumor.
[0115] As used herein, the term "tRNA intron" refers to any
nucleotide sequence recognized and excised by a human tRNA splicing
endonuclease. In particular, the term "tRNA intron" refers to an
intron typically found in a precursor tRNA.
[0116] As used herein, the term "tRNA splicing endonuclease" refers
to the enzyme that is responsible for the recognition of the splice
sites contained in precursor tRNA and the cleavage of the introns
present in precursor tRNA. The archaeal tRNA splicing endonuclease
recognizes the bulge-helix-bulge motif in archaeal precursor tRNA.
The eukaryotic tRNA splicing endonuclease recognizes the splice
sites contained in precursor tRNA by measuring the distance from
the mature domain to the splice sites. The eukaryotic tRNA splicing
endonuclease also has the capacity to recognize a bulge-helix-bulge
motif contained in precursor tRNA. The yeast tRNA endonuclease is a
heterotetramer comprising subunits having the molecular masses of
54 kDa (SEN54), 44 kDa (SEN2), 34 kDa (SEN 34), and 15 kDa (SEN
15). The human homologs of these factors and their GenBank
accession numbers are set forth in Table 1.
[0117] As used herein, the terms "therapy" and "therapies" refer to
any method, protocol and/or agent that can be used in the
prevention, treatment, management or amelioration of a disease or
disorder (e.g., a proliferative disorder or a condition associated
with wound healing) or one or more symptoms thereof. In certain
embodiments, such terms refer to chemotherapy, radiation therapy,
surgery, supportive therapy and/or other therapies useful in the
prevention, treatment, management or amelioration of a disease or
disorder (e.g., a proliferative disorder or a condition associated
with wound healing) or one or more symptoms thereof known to
skilled medical personnel.
1 Abbreviations CPSF Cleavage-Polyadenylation Specificity Factor
CFI.sub.m Cleavage Factor I.sub.m CFII.sub.m Cleavage Factor
II.sub.m CstF or CSTF Cleavage Stimulation Factor HTS High
Throughput Screen FP fluorescence polarization FRET Fluorescence
Resonance Energy Transfer HPLC high-performance liquid
chromatography FPLC fast performance liquid chromatography FACS
Fluorescence activated cell sorter
3.2 BRIEF DESCRIPTION OF THE DRAWINGS
[0118] FIG. 1: Substrates for HTS Fluorescent screening. The
endogenous tRNA is shown in panel A; the hybridized tRNA substrate
is shown in panel B; and the circularly permuted tRNA substrate is
shown in panel C. The 5' ss designates the 5' splice site and 3' ss
designates the 3' splice site.
[0119] FIG. 2: Schematic representation of removal of introns from
pre-tRNA in yeast. In yeast tRNA intron removal requires the
function of three enzymes. In the first step a tRNA endonuclease
recognizes and cleaves the precursor tRNA at the 5' and 3' splice
sites. This enzyme is a heterotetramer composed of the Sen54, Sen2,
Sen34 and Sen15 proteins. The product 5' and 3' exons are ligated
by a tRNA ligase through a series of enzymatic steps which
ultimately leads to joining of the two exons with a 2' phosphate at
the splice junction. This unusual tRNA intermediate is then
processed by a 2' phosphotransferase which transfers the 2'
phosphate to an NAD acceptor yielding a mature tRNA.
[0120] FIG. 3: Schematic Representation of Yeast tRNA Splicing
Holoenzyme. Through structural Studies with the Archaeal enzyme and
subsequent two-hybrid interaction experiments with the yeast
subunits, a model for the interaction of the four subunits of the
yeast tRNA endonuclease was proposed (Li et al., 1998 Science 280,
279-284). Dimerization of heterologous subunits Sen54 and Sen15
with active site subunits Sen2 and Sen34 respectively is achieved
by the interaction of a conserved Beta sheet at the C-terminus each
subunit. The active site containing dimers are then brought
together through interaction of the conserved charged Loop L10 with
a basic groove formed between the N and Cterminal domains in the
two active site containing subunits.
[0121] FIG. 4: Model for Cleavage of tRNA by the Yeast tRNA
Endonuclease. Cleavage of tRNA occurs through catalysis of the 5'
splice site by the active site contained in the Sen2 subunit and
the 3' splice site by Sen34.
[0122] FIG. 5: Amino Acid Sequence Alignment of human (Hs) Sen2
(SEQ ID NO: 1) and HsSen2 var. (SEQ ID NO: 2)) and the yeast
Saccaromyces cerevisiae (ScSen2p (SEQ ID NO: 3)) tRNA splicing
endonuclease Sen2 subunit. The boxed amino acid residues indicate
the YRGGY (SEQ ID NO: 4) active site motif, the circled amino acid
residue indicates the active site histidine, and the underlined
amino acid residues indicate the yeast putative transmembrane
domain.
[0123] FIG. 6A,B. Sequence conservation between human and yeast
tRNA endonuclease active site subunits Sen2 and Sen34. A.
Comparison of Sen2 amino acid sequences in Saccaromyces cerevisiae
(ScSen2), Schizosaccaromyces pombe (SpSen2) and H. sapiens
(HsSen2). B. Comparison of Sen34 amino acid sequences in S.
cerevisiae (ScSen34), S. pombe (SpSen34) and H. sapiens
(HsSen34).
[0124] FIG. 7A,B. Sequence conservation between human and yeast
tRNA endonuclease subunits Sen15 and Sen54. A. Comparison of Sen54
amino acid sequences in S. cerevisiae (ScSen54), S. pombe (SpSen54)
and H. sapiens (HsSen54). B. Comparison of Sen15 amino acid
sequences in S. cerevisiae (ScSen15), S. pombe (SpSen15) and H.
sapiens (HsSen15).
[0125] FIG. 8. Protein sequence alignment of Clp1 from different
species. hClp1 is evolutionarily conserved and has an
ATP/GTP-binding motif. The alignment of H.sapiens (tr: Q92989),
D.melanogaster (tr: Q9V6Q1), C.elegans (sp: P52874), A.thaliana 1
(gb: AB010077), A.thaliana 2 (tr: QSR06), S.pombe (tr: Q10299) and
S.cerevisiae (tr: Q08685) Clp1p sequences was generated with
clustalx. The black and gray boxes indicate identical and similar
residues, respectively. The conserved Walker A motif with the
consensus sequence -A/G-X-X-X-X-G-K-S/T- and the B motif are
indicated.
[0126] FIG. 9. Identification of components of the tRNA splicing
endonuclease complex. His-Flag-Sen2 or His-Flag-Sen34 or
His-Flag-Sen15 or His-Flag-Clp1 or His-Flag-Sen54 or
His-Flag-Sen2deltaEx8 proteins were purified as described in
Example 5.1.2. Proteins co-purified with His-Flag-Sen2,His-Flag-34,
His-Flag-Sen15, His-Flag-Clp1, His-Flag-Sen54,
His-Flag-Sen2deltaEx8 were analyzed by SDS-PAGE followed by a
silver staining. Sen2, Sen34, Sen15, Sen54 and Clp1 are identified
as components of the tRNA splicing complex. Extracts from
untransfected 293 cells were used as a negative control.
[0127] FIG. 10A,B Purification of cell extract fractions containing
tRNA splicing endonuclease activity. His-Flag-Sen2, His-Flag-Sen34
and His-Flag-Sen15 proteins were purified as described in Example
5.1.2. Extracts from untransfected 293 cells were used as a
negative control. Yeast endonuclease was used as a positive control
for endonuclease activity. A. Fractions co-purifiying with
His-Flag-Sen2 or His-Flag-Sen34 show endonuclease activity,
cleaving labeled tRNA at intron/exon borders. B. Fractions
co-purifiying with His-Flag-Sen15 show endonuclease activity,
cleaving labeled tRNA at intron/exon borders. C. Proteins
co-purified with Flag-His-HsClp1 have pre-tRNA endonuclease
activity.
[0128] FIG. 11. Human tRNA Splicing endonuclease active site
subunits are localized in the nucleus. Myc-Sen2 (top panel) and
GFP-Sen34 (bottom panel) vectors were transiently trasfected into
Hela cells and and visualized by immunofluorecence
[0129] FIG. 12. Endonuclease active site subunit Sen2p is
alternatively spliced into two distinct forms. Sen2p WT contains
all 13 Sen2p exons, while the splice variant Sen2deltaEx8 (also
designated as Sen2.DELTA.Ex8) contains all exons except Exon 8. An
alignment of the active site of the archael endonuclease to the
human Sen2delta Exon8 subunit suggests that the amino acid sequence
of Exon8 corresponds exactly to a conserved Alpha helix of the
archaeal endonuclease. The alpha helix serves to orient the
N-terminal and C-terminal domains of the active site subunit,
forming the basic groove to which Loop L10 from the heterologous
Sen15 subunit is proposed to interact.
[0130] FIG. 13 A,B. Alternatively spliced endonuclease subunit
Sen2.DELTA.Ex8 is expressed in many human tissues. A. PCR analysis
of the expression of Wild-type Sen2 and splice variant
Sen2.DELTA.Ex8 in HeLa cells as well as leukemic, liver, kidney,
bone marrow, lymphocyte, brain, stomach, and adipocyte tissues as
described in Example 5.2.3. B. Northern blot analysis of 70 tissue
types probed with an oligonucleotide specific to Sen2.DELTA.Ex8
reveals Sen2.DELTA.Ex8 expression in an array of tissues.
[0131] FIG. 14. Sen2.DELTA.Ex8 has decreased ability to bind Sen15
and Sen34. His-Flag-Sen2.DELTA.Ex8 or His-Flag-Sen34 or
His-Flag-Sen2 proteins were purified as described in Example 5.1.2.
Extract prerared from 293 cells was used as a negative control.
Proteins co-purified with His-Flag-Sen2.DELTA.Ex8 or His-Flag-Sen34
or His-Flag-Sen2 were analyzed by SDS-PAGE followed by a silver
staining.
[0132] FIG. 15. Endonuclease containing Sen2.DELTA.Ex8 is deficient
in pre-tRNA cleavage activity. His-Flag-Sen2, His-Flag-Sen34 and
His-Flag-Sen2.DELTA.Ex8 proteins were purified as described in
Example 5.1.2. Extracts from untransfected 293 cells were used as a
negative control. Yeast endonuclease was used as a positive control
for endonuclease activity. Fractions co-purifiying with
His-Flag-Sen2 or His-Flag-Sen34 show endonuclease activity,
cleaving labeled tRNA at intron/exon borders, whereas fractions
co-purifiying with His-Flag-Sen2.DELTA.Ex8 show deficient
endonuclease activity.
[0133] FIG. 16. A model of assembly of two distinct complexes human
endonuclease complexes. The human holoenzyme appears to consist of
five subunits and due to the presence of conserved interaction
elements the enzyme can heterotetramerize in a manner analagous to
the yeast tRNA splicing endonuclease. Sen2.DELTA.Ex8 can dimerize
with Sen54 protein, but is unable to form a stable interaction with
the Sen34, Sen15. This purified enzyme is able to cleave pre-tRNA
in vitro, but in an aberrant fashion. Thus it suggests that in vivo
this enzyme may function to process other types of RNA substrates
such as pre-mRNA.
[0134] FIG. 17. (A)The human endonuclease complexes are associated
with pre-mRNA 3' end processing factors. Proteins co-purified with
His-Flag-Sen2, His-Flag-Sen2.DELTA.Ex8, His-Flag-Sen34,
His-Flag-Clp1, His-Flag-Sen15 were analyzed by SDS-PAGE followed by
a western blotting with antibodies against the components of 3' end
pre-mRNA processing complex, such as CPSF30, Symplekin, CstF64. Y12
antibody that recognizes pre-mRNA splicing SmB/B' proteins was used
a a negative control. His-Flag-Sen2.DELTA.Ex8 is strongly
associated with CPSF30, Symplekin, CstF64 suggsting that
Flag-Sen2.DELTA.Ex8 is largely involved in pre-mRNA processing. (B)
Proteins co-purified with His-Flag-HsSen2,
His-Flag-HsSen2.DELTA.Ex8, His-Flag-HsSen34, His-Flag-HsSen15 and
His-Flag-HsClp1 were analyzed by SDS-PAGE followed by Western
blotting with antibodies against Symplekin, CstF64. Y12 antibody
that recognizes SmB/B' proteins was used a negative control. Note
that the antibody directed to Cstf-64 recognizes two isoforms of
this protein present in 293 cell line (Wallace et al., 1999, PNAS
96:6763-6768).
[0135] FIG. 18. Human endonucleases process different types of
RNAs. The Sen2 protein together with Sen54, Sen34, Sen15, and Clp1
forms a complex that removes introns from pre-tRNA. Since the Clp1
protein also can be a part of another complex that is involved in
maturation of pre-mRNA, we propose that all the subunits of the
tRNA splicing endonuclease form a complex with the factors
responsible for the 3' end processing of pre-mRNA. Sen2.DELTA.Ex8
is unable to form a complex with Sen34 and Sen15 and deficient in
pre-tRNA cleavage but it is able to interact with Clp1. As a result
of this interaction, Sen2.DELTA.Ex8 is involved in the 3' end
processing of pre-mRNA.
[0136] FIG. 19. depicts an exemplary substrate for 3' end pre-mRNA
endonuclease. The pre-mRNA molecule is shown as a line. The
positions of the 3' end pre-mRNA endonuclease cleavage site and the
internal ribosome entry site are indicated. The open reading frames
of two reporter genes, firefly (FLuc) or renilla (RLuc) luciferase
are shown as boxes.
[0137] FIG. 20. shows the nucleic acid sequence and the amino acid
sequence of human Sen2.
[0138] FIG. 21. shows the nucleic acid sequence and the amino acid
sequence of human Sen2.DELTA.Ex8.
[0139] FIG. 22. shows the nucleic acid sequence and the amino acid
sequence of human Sen15.
[0140] FIG. 23. shows the nucleic acid sequence and the amino acid
sequence of human Sen34.
[0141] FIG. 24. shows the nucleic acid sequence and the amino acid
sequence of human Sen54.
[0142] FIG. 25. shows the nucleic acid sequence and the amino acid
sequence of human Clp1.
[0143] FIG. 26. Localization of the human tRNA splicing
endonuclease subunits. HeLa cells were transiently transfected with
a vector encoding GFP-HsSen34 (left panel), Myc-HsSen2 (middle
panel) or Myc-HsSen2deltaEx8 (right panel) and analyzed by indirect
immunofluorescence microscopy using antibody against
myc-epitope.
[0144] FIG. 27. Identification of components of the human tRNA
splicing endonuclease complex. Proteins co-purified with
His-Flag-HsSen2 and His-Flag-HsSen34 (A) or with
His-Flag-Sen2deltaEx8 and His-Flag-Sen2 (B) were analyzed by
SDS-PAGE followed by silver staining. Major bands in panel A, lane
3 and panel B, lane 2, correspond to His-Flag-Sen2 and
His-Flag-Sen2deltaEx8, respectively. These bands overlap with
endogenous HsSen54. Several bands, marked with asterisks, were
detected in the control untransfected 293 purification and thus
represent nonspecific contaminants of the purification protocol (Hu
et al., 2003). Bands 1 and 2 were identified by protein sequence as
HsSen15 and HsClp1, respectively. (C) Cell extract fraction
co-purified with His-Flag-HsSen15 was examined for endonuclease
activity with labeled pre-tRNA.sup.Phe. Cleavage products were
analyzed by denaturing polyacrylamide gel. 293 cell extract was
used as a negative control. (D) Proteins co-purified with
His-Flag-HsSen54 were analyzed by SDS-PAGE followed by silver
staining as described above. We note some additional bands present
in HsSen54 purification that are currently under investigation.
[0145] FIG. 28. HsClp1 and HsSen15 are genuine components of the
human tRNA splicing endonuclease complex. (A) Proteins that are
co-purified with His-Flag-HsSen15 and His-Flag-HsClp1 were analyzed
by SDS-PAGE followed by silver staining. Proteins co-purifying with
His-Flag-HsSen2 (on the left) are shown for a comparison with
His-Flag-HsSen15 and His-Flag-HsClp1. (B) Cell extract fractions
co-purified with His-Flag-HsSen15 were examined for endonuclease
activity with labeled pre-tRNA.sup.Phe. Cleavage products were
analyzed by denaturing polyacrylamide gel. 293 cell extract was
used as a negative control.
[0146] FIG. 29. The human endonuclease is associated with factors
essential for pre-mRNA 3'-end processing. Proteins co-purified with
His-Flag-HsSen2, His-Flag-HsSen2deltaEx8, His-Flag-HsSen34,
His-Flag-HsSen15 and His-Flag-HsClp1 were analyzed by SDS-PAGE
followed by Western blotting with antibodies against Symplekin,
CstF64. Y12 antibody that recognizes SmB/B' proteins was used a
negative control. We note that our antibody to Cstf-64 recognizes
two isoforms of this protein present in 293 cell line (Wallace et
al., 1999).
[0147] FIG. 30. The human endonuclease is involved in pre-mRNA
3'-end processing. (A) Several 293 cell lines, stably expressing
siRNA-A, specific for SEN2 exon 8, or SiRNA-B, specific for SEN2
exon 9, were transfected with either His-Flag-HsSen2 (lanes 1-3) or
His-Flag-HsSen2deltaEx8. Total cell extracts were prepared from
these cells and analyzed by Western blot analysis with anti-FLAG
(top) or anti-actin (bottom) antibodies. (B) Quantative RT-PCR
analysis of 293 cells stably expressing siRNA-A or siRNA-B, shown
in panel A. White bar corresponds to control siRNA, black bar
corresponds to siRNA-A1 and grey bar corresponds to siRNA-B2. (C)
(Top) Ribonuclease protection assay of EF1A and GAPDH 3'-extended
mRNA. Ten micrograms of yeast total RNA (lane 6), mRNA from 293
cells (lane 5) or 293 stably expressing, siRNA-B1 (lane 2),
siRNA-A1 (lane 3) or siRNA-A2 (lane 4) were hybridized to a
riboprobe corresponding to the antisense downstream of either the
EF1A or GAPDH 3'-end cleavage and polyadenylation site and digested
with ribonuclease. Lane 1 represents a 1:250 or 1:100 dilution of
the input probe for EF1A or GAPDH, respectively. (Bottom)
Measurement of the abundance of 3'-end extended EF1A (grey bars)
and GAPDH (black bars) pre-mRNA quantitated by phosphorimager. Data
is plotted as fold difference relative to 293 total RNA protected
product (lane 5); (D) shows a schematic representation of the
primers used with the siRNA experiment.
4. DETAILED DESCRIPTION OF THE INVENTION
[0148] The invention provides complexes involved in the processing
of RNA. In particular the invention provides complexes with
endonuclease activity that are involved in pre-tRNA splicing and/or
3' end pre-mRNA cleavage. More specifically, the invention provides
a purified complex with RNA-nucleolytic activity comprising two or
more or any combination of the following (i) human Sen2 or a
functionally active derivative or a functionally active fragment
thereof; (ii) human Sen 15 or a functionally active derivative or a
functionally active fragment thereof; (iii) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof; and (iv) human Sen54 or a functionally active derivative
or a functionally active fragment thereof.
[0149] The invention provides a purified protein complex with
endonuclease activity comprising: (i) human Sen2 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human Sen 15 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; and (iv)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof. In a specific embodiment, the protein
complex has tRNA splicing endonuclease activity. In another
embodiment, the protein complex has 3' end pre-mRNA endonuclease
activity. In yet another embodiment, the protein complex has tRNA
splicing endonuclease activity and 3' end pre-mRNA endonuclease
activity.
[0150] In certain embodiments, a complex of the invention may
further comprise: (i) human CPSF160 or a functionally active
derivative or a functionally active fragment thereof; (ii) human
CPSF30 or a functionally active derivative or a functionally active
fragment thereof; (iii) human CstF64 or a functionally active
derivative or a functionally active fragment thereof; and/or (iv)
human symplekin or a functionally active derivative or a
functionally active fragment.
[0151] The invention also provides a purified protein complex with
endonuclease activity comprising: (i) human Sen2 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human Sen 15 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen54 or a functionally active derivative or a functionally active
fragment thereof; and (v) human Clp1 or a functionally active
derivative or a functionally active fragment thereof. In a specific
embodiment, the protein complex has tRNA splicing endonuclease
activity. In another embodiment, the protein complex has 3' end
pre-mRNA endonuclease activity. In yet another embodiment, the
protein complex has tRNA splicing endonuclease activity and 3' end
pre-mRNA endonuclease activity.
[0152] In certain embodiments, a complex of the invention may
further comprise: (i) human CPSF160 or a functionally active
derivative or a functionally active fragment thereof; (ii) human
CPSF30 or a functionally active derivative or a functionally active
fragment thereof; (iii) human CstF64 or a functionally active
derivative or a functionally active fragment thereof; and/or (iv)
human symplekin or a functionally active derivative or a
functionally active fragment.
[0153] The accession numbers of the amino acid sequences of
components of the complexes of the invention and nucleotide
sequences encoding such components are set forth in Table 1
below.
[0154] The invention provides a purified protein complex with
endonuclease activity comprising: (i) human Sen2 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human Sen 15 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen54 or a functionally active derivative or a functionally active
fragment thereof; (v) human Clp1 or a functionally active
derivative or a functionally active fragment thereof; (vi) human
CPSF or a functionally active derivative or a functionally active
fragment thereof; (vii) human CFI.sub.m or a functionally active
derivative or a functionally active fragment thereof; (viii) human
CFII.sub.m or a functionally active derivative or a functionally
active fragment thereof; and (ix) human CstF or a functionally
active derivative or a functionally active fragment thereof. In a
specific embodiment, the protein complex has tRNA splicing
endonuclease activity. In another embodiment, the protein complex
has 3' end pre-mRNA endonuclease activity. In yet another
embodiment, the protein complex has tRNA splicing endonuclease
activity and 3' end pre-mRNA endonuclease activity.
[0155] In certain embodiments, a complex of the invention may
further comprise: (i) human CPSF160 or a functionally active
derivative or a functionally active fragment thereof; (ii) human
CPSF30 or a functionally active derivative or a functionally active
fragment thereof; (iii) human CstF64 or a functionally active
derivative or a functionally active fragment thereof; and/or (iv)
human symplekin or a functionally active derivative or a
functionally active fragment.
[0156] The invention provides a splice variant of human Sen2,
namely human Sen2deltaEx8. In particular, the invention provides
nucleic acid sequences encoding human Sen2deltaEx8 or a
functionally active fragment or a functionally active derivative
thereof, and amino acid sequences coding human Sen2deltaEx8 or a
functionally active fragment or a functionally active derivative
thereof. In a specific embodiment, the invention provides a nucleic
acid sequence that hybridizes under stringent conditions to a
nucleic acid sequence encoding Sen2.DELTA.Ex8 over the entire
length of the nucleic acid sequence encoding Sen2.DELTA.Ex8. In
another embodiment, the invention provides nucleic acid sequences
that encode a protein having an amino acid sequence that is at
least 90%, preferably at least 95%, at least 98%, at least 99%, at
least 99.5%, at least 99.8% or at least 99.9% identical to the
amino acid sequence of SEQ ID NO:12, wherein the protein is
different from Sen2 (Accession No.: NP.sub.--079541). In another
embodiment, the invention provides a nucleic acid seqauence
comprising the nucleic acid sequence of SEQ ID NO:11. The invention
further provides vectors comprising a nucleic acid sequence
encoding human Sen2.DELTA.Ex8 and host cells comprising the vector.
The invention further provides host cells comprising a nucleic acid
encoding human Sen2.DELTA.Ex8.
[0157] The invention provides a purified protein, wherein the
protein consists essentially of the amino acid sequence of SEQ ID
NO:12 or an amino acid sequence that is at least 90%, preferably at
least 95%, at least 98%, at least 99%, at least 99.5%, at least
99.8% or at least 99.9% identical to the amino acid sequence of SEQ
ID NO:12. The invention further provides antibodies or fragments
thereof that immunospecifically bind to human Sen2.DELTA.Ex8 but do
not bind to Sen2. In particular the invention provides an antibody
or fragment thereof that immunospecifically binds to the unique
region of Sen2.DELTA.Ex8 that is created by the deletion of Exon 8
from the Sen2 protein.
[0158] The invention also provides purified protein complexes
comprising human Sen2deltaEx8. The Sen2deltaEx8 complexes have
RNA-nucleolytic activity. In a specific embodiment, the
Sen2deltaEx8 complexes have pre-tRNA cleavage activity and/or 3'
end pre-mRNA endonuclease activity. The invention provides a
purified human Sen2deltaEx8 complex comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; and (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof. The invention also provides a human
Sen2deltaEx8 complex with comprising: (i) human Sen2deltaEx8 or a
functionally active derivative thereof; (ii) human Sen54 or a
functionally active derivative or a functionally active fragment
thereof; (iii) human Sen 15 or a functionally active derivative or
a functionally active fragment thereof; and (iv) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof. In certain embodiments, the Sen2deltaEx8 complex has
RNA-nucleolytic activity. In a specific embodiment the Sen2deltaEx8
complex has tRNA endonuclease and/or 3' end mRNA processing
activity. In certain embodiments, the fidelity and accuracy of the
tRNA cleavage activity of a Sen2deltaEx8 comprising complex is
reduced compared to the the tRNA cleavage activity of full length
Sen2 comprising complexes. In certain embodiments, the complex may
further comprise: (i) human CPSF160 or a functionally active
derivative or a functionally active fragment thereof; (ii) human
CPSF30 or a functionally active derivative or a functionally active
fragment thereof; (iii) human CstF64 or a functionally active
derivative or a functionally active fragment thereof; and/or (iv)
human symplekin or a functionally active derivative or a
functionally active fragment. These human Sen2deltaEx8 complexes
cleave tRNA at multiple sites and are useful in mapping RNA
structure and 3' end endonuclease processing. In certain
embodiments, the fidelity and accuracy of the tRNA cleavage
activity of a Sen2deltaEx8 comprising complex is reduced compared
to the the tRNA cleavage activity of full length Sen2 comprising
complexes.
[0159] The invention provides a purified human Sen2deltaEx8 complex
comprising: (i) human Sen2deltaEx8 or a functionally active
derivative thereof; (ii) human Sen54 or a functionally active
derivative or a functionally active fragment thereof; (iii) human
Sen15 or a functionally active derivative or a functionally active
fragment thereof; (iv) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; and (v) human
Clp1 or a functionally active derivative or a functionally active
fragment thereof. In certain embodiments, the Sen2deltaEx8 complex
has RNA-nucleolytic activity. In a specific embodiment the
Sen2deltaEx8 complex has tRNA endonuclease and/or 3' end mRNA
processing activity. In certain embodiments, the fidelity and
accuracy of the tRNA cleavage activity of a Sen2deltaEx8 comprising
complex is reduced compared to the the tRNA cleavage activity of
full length Sen2 comprising complexes. In certain embodiments, the
complex may further comprise: (i) human CPSF160 or a functionally
active derivative or a functionally active fragment thereof; (ii)
human CPSF30 or a functionally active derivative or a functionally
active fragment thereof; (iii) human CstF64 or a functionally
active derivative or a functionally active fragment thereof; and/or
(iv) human symplekin or a functionally active derivative or a
functionally active fragment. The invention also provides a
purified human Sen2deltaEx8 complex comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen 15 or a functionally
active derivative or a functionally active fragment thereof; (iv)
human Sen34 or a functionally active derivative or a functionally
active fragment thereof; (v) human Clp 1 or a functionally active
derivative or a functionally active fragment thereof; (vi) human
CSPF or a functionally active derivative or a functionally active
fragment thereof; (vii) human CFI.sub.m or a functionally active
derivative or a functionally active fragment thereof; (viii) human
CFII.sub.m. or a functionally active derivative or a functionally
active fragment thereof; and (ix) human CstF or a functionally
active derivative or a functionally active fragment thereof. The
invention also provides a purified human Sen2deltaEx8 complex
comprising: (i) human Sen2deltaEx8 or a functionally active
derivative thereof; (ii) human Sen54 or a functionally active
derivative or a functionally active fragment thereof; and (iii)
human Clp1 or a functionally active derivative or a functionally
active fragment thereof, and optionally (i) human CPSF or a
functionally active derivative or a functionally active fragment
thereof; (ii) human CFI.sub.m or a functionally active derivative
or a functionally active fragment thereof; (iii) human CFII.sub.m
or a functionally active derivative or a functionally active
fragment thereof; and (iv) human CstF or a functionally active
derivative or a functionally active fragment thereof. In certain
embodiments, the complexes of the invention have RNA nucleolytic
activity. In certain, more specific embodiments, the complexes have
tRNA cleavage activity and/or 3' end pre-mRNA processing
activity.
[0160] The invention also provides protein complexes with
pre-ribosomal RNA cleavage activity. In particular, the invention
provides a protein complex with pre-ribosomal RNA cleavage activity
comprising: (i) human Sen15 or a functionally active derivative or
a functionally active fragment thereof; and (ii) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof. This protein complex may be used in the biogenesis of
different ribosomal RNAs. For example, the production of 28S, 18S,
5.5S and 5S ribosomal RNA may be altered by modulating this protein
complex.
[0161] The invention provides methods for purifying a complex of
the invention. In particular, the invention provides a method for
purifying a complex of the invention, the method comprising:
preparing a cell extract or a nuclear extract from a cell, wherein
the cell expresses all of the protein components of the complex and
wherein at least one of the protein components is fused to a
peptide tag; and purifying the complex by virtue of the peptide
tag.
[0162] The invention provides antibodies or fragments thereof that
immunospecifically bind to a complex of the invention. In a
specific embodiment, the invention provides an antibody or a
fragment thereof that immunospecifically binds to a complex of the
invention with higher affinity than to each individual component of
the complex in an immunoassay well-known to one of skill in the art
or described herein. In another embodiment, the invention provides
an antibody or a fragment thereof that immunospecifically binds to
a complex of the invention, but does not bind to each individual
component of the complex in an immunoassay well-known to one of
skill in the art or described herein. The invention also provides a
method for generating an antibody or a fragment thereof that
immunospecifically binds to a complex of the invention comprising
immunizing a subject with the complex of the invention.
[0163] The invention also provides antibodies or fragments thereof
that immunospecifically bind to one of the following components of
a complex of the invention: (i) human Sen2 or a functionally active
derivative or a functionally active fragment thereof; (ii) human
Sen2deltaEx8 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen15 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen34 or a functionally active derivative or a functionally active
fragment thereof; and (v) human Sen54 or a functionally active
derivative or a functionally active fragment thereof. Preferably,
the antibodies or fragments thereof are not known. The invention
also provides a method for generating an antibody or a fragment
thereof that immunospecifically binds to a component of a complex
of the invention comprising immunizing a subject with the
component.
[0164] In a specific embodiment, the invention provides an antibody
or a fragment thereof that immunospecifically binds to human
Sen2deltaEx8 with higher affinity tha human Sen2 in an immunoassay
well-known to one of skill in the art or described herein. In
another embodiment, the invention provides an antibody or a
fragment thereof that immunospecifically binds to human
Sen2deltaEx8, but does not bind to human Sen2 in an immunoassay
well-known to one of skill in the art or described herein.
[0165] The invention provides methods of identifying compounds that
modulate the expression (at the RNA and/or protein level) of one or
more of the following components of a complex of the invention: (i)
human Sen2 or a functionally active derivative or a functionally
active fragment thereof; (ii) human Sen2deltaEx8 or a functionally
active derivative or a functionally active fragment thereof; (iii)
human Sen15 or a functionally active derivative or a functionally
active fragment thereof; (iv) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; and/or (v)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof. Techniques for measuring expression of
proteins are well-known to one of skill in the art and include,
e.g., immunoassays for protein expression levels, and RT-PCR or
Northern blots for RNA expression levels.
[0166] The invention provides screening assays to identify
compounds that modulate the formation of a complex of the
invention. In particular, the invention provides methods for
identifying compounds that stabilize or promote the formation of a
complex of the invention. The invention also provides methods for
identifying compounds that destabilize or promote the dissociation
of a complex of the invention. Such methods can be cell-based or
they can be conducted in a cell-free system.
[0167] The present invention also provides methods for identifying
compounds that modulate the RNA-nucleolytic activity of a complex
of the invention. In particular, the invention provides methods for
identifying a compound that modulates the pre-tRNA processing
activity and/or 3' end pre-mRNA processing activity of a complex of
the invention using assays well-known to one of skill in the art or
described herein. For example, reporter gene-based assays, FRET
assays and FISH assays may be used to in accordance with the
methods of the invention to identify compounds that modulate the
RNA-nucleolytic activity of a complex of the invention.
[0168] The present invention further provides methods for
identifying compounds that modulate the pre-tRNA cleavage activity
and/or pre-ribosomal RNA cleavage activity of a complex of the
invention. Techniques well-known to one of skill in the art or
described herein may be used to measure the ability of a compound
to modulate the pre-tRNA cleavage activity and/or pre-ribosomal RNA
cleavage activity of a complex of the invention. For example, the
ability of a compound to modulate the pre-tRNA cleavage activity of
a complex of the invention may be determined by comparing the level
of tRNA fragments produced from a tRNA in the presence of the
compound relative to the level of tRNA fragments produced from the
same tRNA in the absence of the compound or the presence of an
appropriate control (e.g., a negative control such as PBS), wherein
a change in the levels indicates that the compound modulates the
pre-tRNA cleavage activity of the complex. The ability of a
compound to modulate the pre-ribosomal RNA cleavage activity of a
complex of the invention may be determined by, e.g., comparing the
level of specific ribosomal RNAs (e.g., 28S, 18S, 5.8S and/or 5S)
produced from a pre-ribosomal RNA in the presence of the compound
relative to the level of the ribosomal RNA produced from the same
pre-ribosomal RNA in the absence of the compound or the presence of
an appropriate control (e.g., a negative control such as PBS),
wherein a change in the levels indicates that the compound
modulates the pre-ribosomal RNA cleavage activity of the
complex.
[0169] A compound identified in assays described herein that
modulates the expression of a component of a complex of the
invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) may be tested in in vitro assays (e.g.,
cell-based assays or cell-free assays) or in vivo assays well-known
to one of skill in the art or described herein for the effect of
the compound a disorder described herein (e.g., a proliferative
disorder or a disorder characterized by, associated with or caused
by abnormal RNA-nucleolytic activity) or on cells from a patient
with a particular disorder.
[0170] In a specific embodiment, a compound identified in assays
described herein that inhibits or reduces the expression of a
component of a complex of the invention, the formation of a complex
of the invention, the RNA-nucleolytic activity of a complex of the
invention (e.g., the pre-tRNA splicing endonuclease activity, the
3' end pre-mRNA endonuclease activity, the pre-tRNA cleavage
activity of a complex of the invention, and/or the pre-ribosomal
RNA cleavage activity of a complex of the invention) may be tested
in in vitro assays (e.g., cell-based assays or cell-free assays) or
in vivo assays well-known to one of skill in the art or described
herein for the antiproliferative effect of the compound on
hyperproliferative cells versus normal cells. In another
embodiment, a compound identified in assays described herein that
inhibits or reduces the expression of a component of a complex of
the invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) may be tested in an animal model for
cancer to determine the efficacy of the compound in the prevention,
treatment or amelioration of cancer or a symptom thereof. In yet
another embodiment, a compound identified in assays described
herein that enhances the expression of a component of a complex of
the invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) may be tested for its effect on wound
healing.
[0171] The structure of the compounds identified in the assays
described herein that modulate the expression of a component of a
complex of the invention, the formation of a complex of the
invention, the RNA-nucleolytic activity of a complex of the
invention (e.g., the pre-tRNA splicing endonuclease activity, the
3' end pre-mRNA endonuclease activity, the pre-tRNA cleavage
activity of a complex of the invention, and/or the pre-ribosomal
RNA cleavage activity of a complex of the invention) can be
determined utilizing assays well-known to one of skill in the art
or described herein. The methods used will depend, in part, on the
nature of the library screened. For example, assays or microarrays
of compounds, each having an address or identifier, may be
deconvoluted, e.g., by cross-referencing the positive sample to an
original compound list that was applied to the individual test
assays. Alternatively, the structure of the compounds identified
herein may be determined using mass spectrometry, nuclear magnetic
resonance ("NMR"), circular dichroism, X ray crystallography, or
vibrational spectroscopy.
[0172] The invention encompasses the use of the compounds that
inhibit or reduce the expression of a component of a complex of the
invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention, (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) which were identified in accordance
with the methods described herein for the prevention, treatment,
management or amelioration of a proliferative disorder or a symptom
thereof, or a disorder characterized by, associated with or caused
by increased RNA-nucleolytic activity (e.g., the pre-tRNA splicing
endonuclease activity, the 3' end pre-mRNA endonuclease activity,
the pre-tRNA cleavage activity of a complex of the invention,
and/or the pre-ribosomal RNA cleavage activity of a complex of the
invention) or a symptom thereof. The invention encompasses the use
of the compounds that stimulate or enhance the expression of a
component of a complex of the invention, the formation of a complex
of the invention, the RNA-nucleolytic activity of a complex of the
invention (e.g., the pre-tRNA splicing endonuclease activity, the
3' end pre-mRNA endonuclease activity, the pre-tRNA cleavage
activity of a complex of the invention, and/or the pre-ribosomal
RNA cleavage activity of a complex of the invention) which were
identified in accordance with the methods described herein for the
prevention, treatment, management or amelioration of a disorder
characterized by, associated with or caused by decreased
RNA-nucleolytic activity (e.g., the pre-tRNA splicing endonuclease
activity, the 3' end pre-mRNA endonuclease activity, the pre-tRNA
cleavage activity of a complex of the invention, and/or the
pre-ribosomal RNA cleavage activity of a complex of the invention).
The invention also encompasses the use of the compounds that
stimulate or enhance the expression of a component of a complex of
the invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention, (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) which were identified in accordance
with the methods described herein for augmenting wound healing in a
subject.
[0173] The invention provides compositions comprising a carrier and
one the following or a combination of two or more of the following:
(i) a component of the a complex of the invention; (ii) a complex
of the invention, (iii) an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention, or a complex of the invention, (iv) a compound that
modulates the expression of a component of a complex of the
invention, (v) a compound that modulates the formation of a complex
of the invention, (vi) a compound that modulates the endonuclease
activity (e.g., tRNA splicing endonuclease activity and/or 3' end
pre-mRNA endonuclease activity) of a complex of the invention,
(vii) a compound that modulates the pre-tRNA cleavage activity of a
complex of the invention, and/or (viii) a compound that modulates
pre-ribosomal RNA cleavage activity of a complex of the invention.
The compositions may further comprise one or more other
prophylactic or therapeutic agents. In a preferred embodiment, the
compositions are pharmaceutical compositions. In accordance with
this embodiment, the pharmaceutical compositions are preferably
sterile and in suitable form for the intended method of
administration or use. The invention encompasses the use of the
compositions of the invention in the prevention, treatment,
management or amelioration of a disorder described herein or a
symptom thereof.
[0174] The invention also provides methods for detecting,
diagnosing or monitoring a proliferative disorder or a disorder
associated with, characterized by or caused by abnormal pre-tRNA
processing and/or 3' end pre-mRNA processing utilizing an antibody
that immunospecifically binds to a complex of the invention or a
component thereof, or a compound identified in accordance with the
methods of the invention that specifically binds to a complex of
the invention or a component thereof. The invention also provides
methods for detecting, diagnosing or monitoring a proliferative
disorder or a disorder associated with, characterized by or caused
by abnormal pre-tRNA processing and/or 3' end pre-mRNA processing
by comparing the RNA-nucleolytic activity of a complex purified
from cells or a tissue sample from a subject with such a disorder
or suspected of having such disorder to the RNA-nucleolytic
activity of a control, e.g., a complex purified from normal,
non-cancerous cells or a tissue sample, using an assay well-known
to one of skill in the art or described herein. The invention
further provides methods for detecting, diagnosing or monitoring a
proliferative disorder or a disorder associated with, characterized
by or caused by abnormal pre-tRNA processing and/or 3' end pre-mRNA
processing by comparing the structure of a complex of the invention
purified from cells or a tissue sample from a subject (e.g., a
subject with such a disorder or suspected of having such a
disorder) to the structure of a control, e.g., a complex of the
invention purified from normal, non-cancerous cells or a tissue
sample, using an assay well-known to one of skill in the art (e.g.,
circular circular dichroism and nuclear magnetic resonance).
[0175] 4.1 Sen2.DELTA.Ex8
[0176] The invention provides nucleic acids encoding a splice
variant of Sen2, termed Sen2.DELTA.Ex8 or Sen2deltaEx8. The
Sen2.DELTA.Ex8 is a splice variant of human Sen2 lacking exon 8 of
the genomic DNA sequence for human Sen2. FIG. 2 depicts an amino
acid sequence alignment of the amino acid sequences of the two
human Sen 2 subunits (i.e., Hs Sen2 and Sen2.DELTA.Ex8) and the
amino acid sequence of the yeast subunit Sc Sen 2p. The sequence
alignment reveals a high degree of similarity in the YRGGY motif,
the active site for the 5' splice site of yeast (Sc Sen 2p) and
archael (not shown) tRNA splicing endonuclease. Based upon the
sequence alignment, human Sen2.DELTA.Ex8 lacks the putative
transmembrane domain found in the human Sen 2 endonuclease, which
may affect the localization of the Sen2.DELTA.Ex8 in a human
cell.
[0177] The invention provides for nucleic acid sequences encoding
human Sen2.DELTA.Ex8 or functionally active fragments, or
functionally active derivatives thereof. In particular, the
invention provides a nucleic acid sequence comprising a contiguous
nucleotide sequence identical to the nucleotide sequence of SEQ ID
NO:1. The invention also provides nucleic acid sequences that are
at least 90%, preferably at least 95%, at least 98%, at least 99%,
at least 99.5%, or at least 99.8% identical to the nucleotide
sequence of SEQ ID NO:1 or a complement thereof. The invention
provides nucleic acid sequences which comprise at least 15,
preferably at least 20, at least 25, at least 30, at least 35, at
least 40, at least 45, at least 50 or more contiguous nucleotides
of the nucleotide sequence of nucleotide of SEQ ID NO:1 or a
complement thereof, wherein the nucleotide sequence comprises
nucleotide 910 to nucleotide 960 of SEQ ID NO:1 or a complement
thereof. The invention also provides nucleic acid sequences
comprising a contiguous nucleotide sequence that hybridizes under
high stringency conditions to the nucleotide sequence of SEQ ID
NO:1 or a complement thereof over the entire length of the nucleic
acid sequence of SEQ ID NO:1.
[0178] The invention provides nucleic acid sequences comprising a
contiguous nucleotide sequence that encodes a polypeptide of the
amino acid sequence of SEQ ID NO:12. The invention also provides
nucleic acid sequences comprising a contiguous nucleotide sequence
that encodes a polypeptide of an amino acid sequence that is at
least 90%, preferably at least 95%, at least 98%, at least 99%, at
least 99.5%, or at least 99.8% identical to the amino acid sequence
of SEQ ID NO:12. The invention also provides nucleic acid sequences
comprising a nucleotide sequence that encodes a polypeptide
comprising at least 10, preferably at least 15, at least 20, or at
least 25, at least 30, at least 35, at least 40, at least 45, at
least 50, at least 55 or more contiguous amino acids of amino acid
sequence of SEQ ID NO:12, wherein the polypeptide contains residues
311 to 327 of SEQ ID NO:12. The invention also provides nucleic
acid sequences that hybridize under highly stringent conditions to
a nucleic acid sequence encoding the amino acid sequence of SEQ ID
NO:12 over the entire length of the nucleic acid sequence encoding
the amino acid sequence of SEQ ID NO:12.
[0179] The invention provides host cells containing or comprising a
nucleic acid sequence encoding Sen2.DELTA.Ex8, such as, but not
limited to, the nucleic acid of SEQ ID NO:11. The invention also
provides a vector comprising a nucleic acid sequence comprising a
nucleotide sequence encoding Sen2.DELTA.Ex8, such as, but not
limited to, the nucleic acid of SEQ ID NO:11. The invention also
provide host cells containing or comprising a vector comprising a
nucleic acid sequence comprising a nucleotide sequence encoding
Sen2.DELTA.Ex8, such as, but not limited to, the nucleic acid of
SEQ ID NO:11. Techniques well-known to one of skill in the art,
such as electroporation, calcium phosphate precipitate and
lipsomes, may be used to transfect a host cell with a nucleic acid
sequence encoding Sen2.DELTA.Ex8 or a functionally active fragment
or derivative thereof. See, e.g., Section 4.5.4.1.4 and 4.5.4.1.5,
infra, for a description of vectors, transfection techniques and
host cells. Techniques well-known to one of skill in the art, such
as immunoprecitation using antibodies immunospecific human
Sen2.DELTA.Ex8 or a functionally active fragment or derivative
thereof, may be used to purify human Sen2.DELTA.Ex8 or a
functionally active fragment or derivative thereof. See Section
4.3, infra, for a description of methods of purify proteinaceous
agents such as human Sen2.DELTA.Ex8 or a functionally active
fragment or derivative thereof.
[0180] The invention provides amino acid sequences of human
Sen.DELTA.Ex8 or functionally active fragments, or functionally
active derivatives thereof. In particular, the invention provides a
purified protein comprising the amino acid sequence of SEQ ID
NO:12. The invention also provides a purified protein that is at
least 90%, preferably at least 95%, at least 98%, at least 99%, at
least 99.5%, or at least 99.8% identical to the amino acid sequence
of SEQ ID NO:12. The invention also provides a purified protein
encoded by a nucleotide sequence that hybridizes over its
full-length under highly stringent conditions to the nucleotide
sequence of SEQ ID NO:11. The invention also provides a purified
polypeptide comprising at least 10, preferably at least 15, at
least 20, or at least 25, at least 30, at least 35, at least 40, at
least 45, at least 50, at least 55 or more contiguous amino acids
of amino acid sequence of SEQ ID NO:12, wherein the polypeptide
contains residues 311 to 327 of SEQ ID NO:12. The invention also
provides a purified protein comprising a contiguous nucleotide
sequence that encodes a polypeptide that is at least 90%,
preferably at least 95%, at least 98%, at least 99%, at least
99.5%, or at least 99.8% identical to the amino acid sequence of
SEQ ID NO:12.
[0181] The invention also provides fusion proteins comprising human
Sen2.DELTA.Ex8 or a functionally active fragment or a functionally
active derivative thereof and a heterologous amino acid sequence
(ie., a different amino acid sequence; an amino acid sequence not
naturally found in conjunction with the amino acid sequence of
human Sen2.DELTA.Ex8).
[0182] 4.2 Complexes of the Invention
[0183] 4.2.1 tRNA Splicing Endonuclease Complex
[0184] The invention provides a purified protein complex with tRNA
endonuclease activity comprising two or more of the following: (i)
human Sen2 or a functionally active derivative or a functionally
active fragment thereof; (ii) human Sen 15 or a functionally active
derivative or a functionally active fragment thereof; (iii) human
Sen34 or a functionally active derivative or a functionally active
fragment thereof; and (iv) human Sen54 or a functionally active
derivative or a functionally active fragment thereof.
[0185] In particular, the invention provides a purified protein
complex with tRNA splicing endonuclease activity comprising: (i)
human Sen2 or a functionally active derivative or a functionally
active fragment thereof; (ii) human Sen 15 or a functionally active
derivative or a functionally active fragment thereof; (iii) human
Sen34 or a functionally active derivative or a functionally active
fragment thereof; and (iv) human Sen54 or a functionally active
derivative or a functionally active fragment thereof. In one
embodiment, the invention provides a purified complex with tRNA
splicing endonuclease activity comprising: (i) human Sen2
(ACCESSION NO.: NP.sub.--079541), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2 encoding nucleic acid
(ACCESSION NO.: NM.sub.--025265) or its complement under high
stringency conditions; (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (iv) Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the human Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions.
[0186] In a specific embodiment, the protein complex has 3' end
pre-mRNA endonuclease activity. In another embodiment, the protein
complex has tRNA splicing endonuclease activity and 3' end pre-mRNA
endonuclease activity.
[0187] The invention also provides a purified protein complex with
tRNA endonuclease activity comprising: (i) human Sen2 or a
functionally active derivative or a functionally active fragment
thereof; (ii) human Sen 15 or a functionally active derivative or a
functionally active fragment thereof; (iii) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof; (iv) human Sen54 or a functionally active derivative or a
functionally active fragment thereof; and (v) human Clp1 or a
functionally active derivative or a functionally active fragment
thereof.
[0188] In certain embodiments, the Sen2deltaEx8 complex has
RNA-nucleolytic activity. In a specific embodiment the Sen2deltaEx8
complex has tRNA endonuclease and/or 3' end mRNA processing
activity. In certain embodiments, the fidelity and accuracy of the
tRNA cleavage activity of a Sen2deltaEx8 comprising complex is
reduced compared to the the tRNA cleavage activity of full length
Sen2 comprising complexes. In certain embodiments, the complex may
further comprise: (i) human CPSF160 or a functionally active
derivative or a functionally active fragment thereof; (ii) human
CPSF30 or a functionally active derivative or a functionally active
fragment thereof; (iii) human CstF64 or a functionally active
derivative or a functionally active fragment thereof; and/or (iv)
human symplekin or a functionally active derivative or a
functionally active fragment.
[0189] In one embodiment, the invention provides a purified complex
with tRNA splicing endonuclease activity comprising: (i) human Sen2
(ACCESSION NO.: NP.sub.--079541), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2 encoding nucleic acid
(ACCESSION NO.: NM.sub.--025265) or its complement under high
stringency conditions; (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; (iv) Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; and (v) human Clp1 (ACCESSION NO.:NP.sub.--006822) or a
protein encoded by a nucleic acid that hybridizes to the human Clp1
encoding nucleic acid (ACCESSION NO.: NM.sub.--006831) or its
complement under high stringency conditions. In certain
embodiments, the Sen2deltaEx8 complex has RNA-nucleolytic activity.
In a specific embodiment the Sen2deltaEx8 complex has tRNA
endonuclease and/or 3' end mRNA processing activity. In certain
embodiments, the fidelity and accuracy of the tRNA cleavage
activity of a Sen2deltaEx8 comprising complex is reduced compared
to the the tRNA cleavage activity of full length Sen2 comprising
complexes. In certain embodiments, the complex may further
comprise: (i) human CPSF160 or a protein encoded by a nucleic acid
that hybridizes under stringent conditions to a CPSF160 encoding
nucleic acid; (ii) human CPSF30 or a protein encoded by a nucleic
acid that hybridizes under stringent conditions to a CPSF30
encoding nucleic acid; (iii) human CstF64 or a protein encoded by a
nucleic acid that hybridizes under stringent conditions to a CstF64
encoding nucleic acid; and/or (iv) human symplekin or a protein
encoded by a nucleic acid that hybridizes under stringent
conditions to a symplekin encoding nucleic acid. In a specific
embodiment, the protein complex has 3' end pre-mRNA endonuclease
activity. In another embodiment, the protein complex has tRNA
splicing endonuclease activity and 3' end pre-mRNA endonuclease
activity.
[0190] The invention provides a purified protein complex with tRNA
splicing endonuclease activity comprising: (i) human Sen2 or a
functionally active derivative or a functionally active fragment
thereof; (ii) human Sen 15 or a functionally active derivative or a
functionally active fragment thereof; (iii) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof; (iv) human Sen54 or a functionally active derivative or a
functionally active fragment thereof; (v) human Clp1 (ACCESSION
NO.:NP.sub.--006822) or a functionally active derivative or a
functionally active fragment thereof; (vi) human
Cleavage-Polyadenylation Specificity Factor ("CPSF") or a
functionally active derivative or a functionally active fragment
thereof; (vii) human Cleavage Factor I.sub.m ("CFI.sub.m") or a
functionally active derivative or a functionally active fragment
thereof; (viii) human Cleavage Factor II.sub.m ("CFII.sub.m") or a
functionally active derivative or a functionally active fragment
thereof; and (ix) human Cleavage Stimulation Factor ("CSF") or a
functionally active derivative or a functionally active fragment
thereof. In a specific embodiment, the protein complex has 3' end
pre-mRNA endonuclease activity. In another embodiment, the protein
complex has tRNA splicing endonuclease activity and 3' end pre-mRNA
endonuclease activity.
[0191] CPSF, CstF, CFIm and CFIIm consist of multiple subunits. The
accession numbers of the different subunits are set forth in Table
1 below. CPSF, CstF, CFIm and CFIIm can each comprise a different
set of subunits. In a specific embodiment, CPSF comprises the 160
kD factor 1 and the 30 kD factor 4. In a more specific embodiment,
CPSF comprises the 160 kD factor 1, the 100 kD factor 2, the 73 kD
factor 3, and the 30 kD factor 4. In a specific embodiment, CstF
comprises the 50 kD subunit 1, the 64 kD subunit 2, and the 77 kD
subunit 3. In a more specific embodiment, CstF comprises the 50 kD
subunit 1, the 64 kD subunit 2, the 77 kD subunit 3, and symplekin.
In a specific embodiment, CFIm comprises the 68 kD subunit and the
25 kD subunit. In a more specific embodiment, CFIm comprises the 68
kD subunit, the 25 kD subunit, the 59 kD subunit, and the 72 kD
subunit. In a specific embodiment, CFIIm comprises Clp1. In a more
specific embodiment, CFIIm comprises Clp1 and hPcf11. In another
more specific embodiment, CFIIm comprises ClpI, the CFlm 25 kD
subunit and the CFlm 68 kD subunit. In even another more specific
embodiment, CFIIm comprises ClpI, the CFlm 25 kD subunit and the
CFIm 68 kD subunit and hpcf11.
[0192] Detailed information on Symplekin can be obtained from the
homepage of Dr. Keller's laboratory at the biocentre of the
University of Basel and in Takagaki, Y. and J. Manley, 2000,
Molecular & Cellular Biol 20:1515-1525.
[0193] Wahle and Ruegsegger, 1999, FEMS Micro Rev., 23, 277-295 and
Zhoa et al., 1999, Micoboil. Mol. Biol. Rev., 63, 405-445 describe
factors involved RNA processing, both references are incorporated
herein in their entireties.
[0194] In certain embodiments, all subunits of CPSF and CstF,
respectively, are present in a complex of the invention.
2TABLE 1 GenBank Accession Numbers NUCLEOTIDE PROTEIN NAME ACC. NO.
ACC. NO. Sen2 NM_025265 NP_079541 Sen2deltaEx8 SEQ ID NO: 11 SEQ ID
NO: 12 Sen15 NM_052965 NP_443197 AF288394 AAG60614 Sen34 NM_024075;
NP_076980 XP_085899 Sen54 XM_208944 XP_208944 Clp1 NM_006831
NP_006822 CFII.sub.m subunit hPcf11 NM_015885 NP_056969 CFII.sub.m
subunit Clp1 NM_006831 NP_006822 CFI.sub.m 25 kD subunit NM_007006
NP_008937 AJ001810 CAA05026 CFI.sub.m 59 kD subunit NM_024811.2
NP_079087 AJ275970 CAC81661 CFI.sub.m 68 kD subunit NM_007007
NP_008938 X67337 CAA47752 CFI.sub.m 72 kD subunit See, e.g., de
Vries et al., 2000, EMBO J. 19: 5895-5904 CstF50 (50 kD subunit 1)
NM_001324 NP_001315 CstF64 (64 kD subunit 2) NM_001325 NP_001316
NM_015235 NP_056050 CstF77 (77 kD subunit 3) NM_001326 NP_001317
CstF subunit Symplekin NM_004819 NP_004810 CPSF160 (160 kD factor
1) NM_013291 NP_037423 XM_209402 XP_209402 CPSF100 (100 kD factor
2) XM_029311.2 XP_029311 CPSF73 (73 kD factor 3) NM_016207
NP_057291 CPSF30 (30 kD factor 4) NM_006693 NP_006684 XM_292584
XP_292584 FIP subunit of CPSF PFS2 subunit of CPSF
[0195] In one embodiment, the invention provides a purified complex
with tRNA splicing endonuclease activity comprising: (i) human Sen2
(ACCESSION NO.: NP.sub.--079541), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2 encoding nucleic acid
(ACCESSION NO.: NM.sub.--025265) or its complement under high
stringency conditions; (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; (iv) Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; (v) human Clp1 (ACCESSION NO.:NP.sub.--006822) or a
protein encoded by a nucleic acid that hybridizes to the human Clp1
encoding nucleic acid (ACCESSION NO.: NM.sub.--006831) or its
complement under high stringency conditions; (vi) human
Cleavage-Polyadenylation Specificity Factor ("CPSF") or a protein
encoded by a nucleic acid that hybridizes to the human CPSF or its
complement under high stringency conditions; (vii) human Cleavage
Factor I.sub.m ("CF I.sub.m") or a protein encoded by a nucleic
acid that hybridizes to the human CFI.sub.m encoding nucleic acid
or its complement under high stringency conditions; (viii) human
Cleavage Factor II.sub.m ("CF I.sub.m") or a protein encoded by a
nucleic acid that hybridizes to the human CFII.sub.m encoding
nucleic acid or its complement under high stringency conditions;
and (ix) human Cleavage Stimulation Factor ("CSF") or a protein
encoded by a nucleic acid that hybridizes to the human CstF
encoding nucleic acid or its complement under high stringency
conditions. In accordance with this embodiment, the complex may
also have 3' end pre-mRNA endonuclease activity.
[0196] In certain, more specific embodiments, a complex of the
invention is purified.
[0197] In certain embodiments, the invention provides complexes
that comprise homologs or analogs of the human proteins of the
complexes of the invention. Homologs or analogs of the components
of a complex of the invention are at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98%, at least
99% or at least 99.5% identical to a human protein of a complex of
the invention. Derivatives can be, e.g., fusion proteins, mutant
forms of the protein, or forms of the protein with chemical
moieties linked to the protein. A fragment of a component of a
complex of the invention is a portion of the protein component that
maintains the ability of the component to be physically integrated
into the complex.
[0198] In certain embodiments, the protein components of a complex
of the invention are derived from the same species. In more
specific embodiments, the protein components are all derived from
human. In another specific embodiment, the protein components are
all derived from a mammal.
[0199] In certain other embodiments, the protein components of a
complex of the invention are derived from a non-human species, such
as, but not limited to, cow, pig, horse, cat, dog, rat, mouse, a
primate (e.g., a chimpanzee, a monkey such as a cynomolgous
monkey). In certain embodiments, one or more components are derived
from human and the other components are derived from a mammal other
than a human to give rise to chimeric complexes.
[0200] 4.2.2 3' End Pre-mRNA Endonuclease Complex
[0201] The invention provides a purified protein complex with 3'
end pre-mRNA endonuclease activity comprising two or more of the
following: (i) human Sen2 or a functionally active derivative or a
functionally active fragment thereof; (ii) human Sen 15 or a
functionally active derivative or a functionally active fragment
thereof; (iii) human Sen34 or a functionally active derivative or a
functionally active fragment thereof; (iv) human Sen54 or a
functionally active derivative or a functionally active fragment
thereof; (v) human Clp1 (ACCESSION NO.:NP.sub.--006822) or a
functionally active derivative or a functionally active fragment
thereof; (vi) human CPSF160 or a functionally active derivative or
a functionally active fragment thereof; (vii) human CPSF30 or a
functionally active derivative or a functionally active fragment
thereof; (viii) human CstF64 or a functionally active derivative or
a functionally active fragment thereof; and/or (ix) human symplekin
or a functionally active derivative or a functionally active
fragment (x) human CPSF or a functionally active derivative or a
functionally active fragment thereof; (xi) human CFI.sub.m or a
functionally active derivative or a functionally active fragment
thereof; (xii) human CFII.sub.m or a functionally active derivative
or a functionally active fragment thereof; and (xiii) human CstF or
a functionally active derivative or a functionally active fragment
thereof.
[0202] In particular, the invention provides a purified protein
complex with 3' end pre-mRNA endonuclease activity comprising: (i)
human Sen2 or a functionally active derivative or a functionally
active fragment thereof; (ii) human Sen 15 or a functionally active
derivative or a functionally active fragment thereof; (iii) human
Sen34 or a functionally active derivative or a functionally active
fragment thereof; (iv) human Sen54 or a functionally active
derivative or a functionally active fragment thereof; (v) human
Clp1 (ACCESSION NO.:NP.sub.--006822) or a functionally active
derivative or a functionally active fragment thereof; (vi) human
CPSF or a functionally active derivative or a functionally active
fragment thereof; (vii) human CFI.sub.m or a functionally active
derivative or a functionally active fragment thereof; (viii) human
CFII.sub.m or a functionally active derivative or a functionally
active fragment thereof; and (ix) human CstF or a functionally
active derivative or a functionally active fragment thereof.
[0203] In one embodiment, the invention provides a purified complex
with 3' end pre-mRNA endonuclease activity comprising: (i) human
Sen2 (ACCESSION NO.: NP.sub.--079541), or a protein encoded by a
nucleic acid that hybridizes to the human Sen2 encoding nucleic
acid (ACCESSION NO.: NM.sub.--025265) or its complement under high
stringency conditions; (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; (iv) Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; and (v) human Clp1 (ACCESSION NO.:NP.sub.--006822) or a
protein encoded by a nucleic acid that hybridizes to the human Clp1
encoding nucleic acid (ACCESSION NO.: NM.sub.--006831) or its
complement under high stringency conditions. In certain
embodiments, the Sen2deltaEx8 complex has RNA-nucleolytic activity.
In a specific embodiment the Sen2deltaEx8 complex has tRNA
endonuclease and/or 3' end mRNA processing activity. In certain
embodiments, the fidelity and accuracy of the tRNA cleavage
activity of a Sen2deltaEx8 comprising complex is reduced compared
to the the tRNA cleavage activity of full length Sen2 comprising
complexes. In certain embodiments, the complex may further
comprise: (i) human CPSF160 or a functionally active derivative or
a functionally active fragment thereof; (ii) human CPSF30 or a
functionally active derivative or a functionally active fragment
thereof; (iii) human CstF64 or a functionally active derivative or
a functionally active fragment thereof; and/or (iv) human symplekin
or a functionally active derivative or a functionally active
fragment. In other embodiments, the complexes further comprise (i)
human Cleavage-Polyadenylation Specificity Factor ("CPSF") or
proteins encoded by nucleic acids that hybridize to human CPSF
encoding nucleic acids or their complements under high stringency
conditions; (ii) human Cleavage Factor I.sub.m ("CF I.sub.m") or
proteins encoded by nucleic acids that hybridize to human CFI.sub.m
encoding nucleic acids or their complements under high stringency
conditions; (iii) human Cleavage Factor II.sub.m ("CF II.sub.m") or
proteins encoded by nucleic acids that hybridize to human
CFII.sub.m encoding nucleic acids or their complements under high
stringency conditions; and (iv) human Cleavage Stimulation Factor
("CSF") or proteins encoded by nucleic acids that hybridize to
human CSF encoding nucleic acids or their complements under high
stringency conditions.
[0204] The invention provides purified protein complexes having 3'
end pre-mRNA endonuclease activity and comprising human
Sen2deltaEx8. The invention provides a purified protein complex
comprising two or more of the following: (i) human Sen2deltaEx8 or
a functionally active derivative thereof; (ii) human Sen54 or a
functionally active derivative or a functionally active fragment
thereof; (iii) human Sen15 or a functionally active derivative or a
functionally active fragment thereof; (iv) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof; and (v) Clp1 or a functionally active derivative or a
functionally active fragment thereof. In particular, the invention
provides a purified human Sen2deltaEx8 complex with 3' end pre-mRNA
endonuclease activity comprising: (i) human Sen2deltaEx8 or a
functionally active derivative thereof; and (ii) human Sen54 or a
functionally active derivative or a functionally active fragment
thereof. The invention also provides a human Sen2deltaEx8 complex
with 3' end pre-mRNA endonuclease activity comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen15 or a functionally active
derivative or a functionally active fragment thereof; and (iv)
human Sen34 or a functionally active derivative or a functionally
active fragment thereof. These human Sen2deltaEx8 complexes are
useful in mapping RNA structure and 3' end pre-mRNA endonuclease
processing.
[0205] In a specific embodiment, the invention provides a purified
human Sen2deltaEx8 complex with 3' end pre-mRNA endonuclease
activity comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen2deltaEx8 encoding nucleic acid (SEQ ID NO.: 1) or its
complement under high stringency conditions; and (ii) human Sen15
(ACCESSION NO.:NP.sub.--443197), or a protein encoded by a nucleic
acid that hybridizes to the human Sen15 encoding nucleic acid
(ACCESSION NO.:NM.sub.--052965) or its complement under high
stringency conditions. In another embodiment, the invention
provides a purified human Sen2deltaEx8 complex comprising: (i)
human Sen2deltaEx8 (SEQ ID NO.: 2), or a protein encoded by a
nucleic acid that hybridizes to the human Sen2deltaEx8 encoding
nucleic acid (SEQ ID NO.: 1) or its complement under high
stringency conditions; (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iii) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (iv) Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the human Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions. In accordance with these embodiments, the
human Sen2deltaEx8 complex cleaves tRNA at multiple sites. These
human Sen2deltaEx8 complexes are useful in mapping RNA structure
and 3' endonuclease processing.
[0206] The invention provides a purified human Sen2deltaEx8 complex
with 3' end pre-mRNA endonuclease activity comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen15 or a functionally active
derivative or a functionally active fragment thereof; (iv) human
Sen34 or a functionally active derivative or a functionally active
fragment thereof; and (v) human Clp1 (ACCESSION
NO.:NP.sub.--006822) or a functionally active derivative or a
functionally active fragment thereof. In certain embodiments, the
Sen2deltaEx8 complex has RNA-nucleolytic activity. In a specific
embodiment the Sen2deltaEx8 complex has tRNA endonuclease and/or 3'
end mRNA processing activity. In certain embodiments, the fidelity
and accuracy of the tRNA cleavage activity of a Sen2deltaEx8
comprising complex is reduced compared to the the tRNA cleavage
activity of full length Sen2 comprising complexes. In certain
embodiments, the complex may further comprise: (i) human CPSF160 or
a functionally active derivative or a functionally active fragment
thereof; (ii) human CPSF30 or a functionally active derivative or a
functionally active fragment thereof; (iii) human CstF64 or a
functionally active derivative or a functionally active fragment
thereof; and/or (iv) human symplekin or a functionally active
derivative or a functionally active fragment.
[0207] The invention also provides a purified human Sen2deltaEx8
complex with 3' end pre-mRNA endonuclease activity comprising: (i)
human Sen2deltaEx8 or a functionally active derivative thereof;
(ii) human Sen54 or a functionally active derivative or a
functionally active fragment thereof; (iii) human Sen15 or a
functionally active derivative or a functionally active fragment
thereof; (iv) human Sen34 or a functionally active derivative or a
functionally active fragment thereof; (v) human Clp1 (ACCESSION
NO.:NP.sub.--006822) or a functionally active derivative or a
functionally active fragment thereof; (vi) human CSPF or a
functionally active derivative or a functionally active fragment
thereof; (vii) human CFI.sub.m or a functionally active derivative
or a functionally active fragment thereof; (viii) human CFII.sub.m
or a functionally active derivative or a functionally active
fragment thereof; and (ix) human CstF or a functionally active
derivative or a functionally active fragment thereof.
[0208] In a specific embodiment, the invention provides a purified
human Sen2deltaEx8 complex with 3' end pre-mRNA endonuclease
activity comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen2deltaEx8 encoding nucleic acid (SEQ ID NO.: 1) or its
complement under high stringency conditions; (ii) human Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the human Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions; (iii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iv) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; and (v) human Clp1
(ACCESSION NO.:NP.sub.--006822) or a protein encoded by a nucleic
acid that hybridizes to the human Clp1 encoding nucleic acid
(ACCESSION NO.: NM.sub.--006831) or its complement under high
stringency conditions. In certain embodiments, the complex may
further comprise: (i) human CPSF160 or a protein encoded by a
nucleic acid that hybridizes to the human CPSF160 encoding nucleic
acid; (ii) human CPSF30 or a protein encoded by a nucleic acid that
hybridizes to the human CPSF30 encoding nucleic acid; (iii) human
CstF64 or a protein encoded by a nucleic acid that hybridizes to
the human CstF64 encoding nucleic acid; and/or (iv) human symplekin
or a protein encoded by a nucleic acid that hybridizes to the human
symplekin encoding nucleic acid.
[0209] In another embodiment, the invention provides a purified
human Sen2deltaEx8 complex with 3' end pre-mRNA endonuclease
activity comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen2deltaEx8 encoding nucleic acid (SEQ ID NO.: 1) or its
complement under high stringency conditions; (ii) human Sen54
(ACCESSION NO.:XP.sub.--208944), or a protein encoded by a nucleic
acid that hybridizes to the human Sen54 encoding nucleic acid
(ACCESSION NO.:XM.sub.--208944) or its complement under high
stringency conditions; (iii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions; (iv) human Sen34 (ACCESSION NO.:NP.sub.--076980), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen34 encoding nucleic acid (ACCESSION NO.:NM.sub.--024075) or its
complement under high stringency conditions; (v) human Clp1
(ACCESSION NO.:NP.sub.--006822) or a protein encoded by a nucleic
acid that hybridizes to the human Clp1 encoding nucleic acid
(ACCESSION NO.: NM.sub.--006831) or its complement under high
stringency conditions; (vi) a human CPSF (see Table 1 for accession
numbers of components), or proteins encoded by nucleic acids that
hybridize to the human CPSF encoding nucleic acids or their
complements under high stringency conditions; (vii) a human
CFI.sub.m (see Table 1 for accession numbers of components), or
proteins encoded by nucleic acids that hybridize to the human
CFI.sub.m encoding nucleic acids or their complements under high
stringency conditions; (viii) a human CFII.sub.m (see Table 1 for
accession numbers of components), or proteins encoded by nucleic
acids that hybridize to the human CFII.sub.m encoding nucleic acids
or their complements under high stringency conditions; and (ix)
human CstF (see Table 1 for accession numbers of components), or
proteins encoded by nucleic acids that hybridize to the human CstF
encoding nucleic acids or their complements under high stringency
conditions.
[0210] The invention provides a purified human Sen2deltaEx8 complex
with 3' end pre-mRNA endonuclease activity comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; and (iii) human Clp1 (ACCESSION
NO.:NP.sub.--006822) or a functionally active derivative or a
functionally active fragment thereof. In certain embodiments, the
Sen2deltaEx8 complex has RNA-nucleolytic activity. In a specific
embodiment the Sen2deltaEx8 complex has tRNA endonuclease and/or 3'
end mRNA processing activity. In certain embodiments, the fidelity
and accuracy of the tRNA cleavage activity of a Sen2deltaEx8
comprising complex is reduced compared to the the tRNA cleavage
activity of full length Sen2 comprising complexes. In certain
embodiments, the complex may further comprise: (i) human CPSF160 or
a functionally active derivative or a functionally active fragment
thereof; (ii) human CPSF30 or a functionally active derivative or a
functionally active fragment thereof; (iii) human CstF64 or a
functionally active derivative or a functionally active fragment
thereof; and/or (iv) human symplekin or a functionally active
derivative or a functionally active fragment.
[0211] In other embodiments, the purified complex further comprises
(i) human CPSF or a functionally active derivative or a
functionally active fragment thereof; (ii) human CFI.sub.m or a
functionally active derivative or a functionally active fragment
thereof; (iii) human CFII.sub.m or a functionally active derivative
or a functionally active fragment thereof; and (iv) human CstF or a
functionally active derivative or a functionally active fragment
thereof.
[0212] In a specific embodiment, the invention provides a purified
Sen2deltaEx8 complex with 3' end pre-mRNA endonuclease activity
comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a protein
encoded by a nucleic acid that hybridizes to the human Sen2deltaEx8
encoding nucleic acid (SEQ ID NO.: 1) or its complement under high
stringency conditions; (ii) human Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; and (iii) human Clp1 (ACCESSION NO.:NP.sub.--006822) or
a protein encoded by a nucleic acid that hybridizes to the human
Clp1 encoding nucleic acid (ACCESSION NO.: NM.sub.--006831) or its
complement under high stringency conditions.
[0213] In certain embodiments, the Sen2deltaEx8 complex has
RNA-nucleolytic activity. In a specific embodiment the Sen2deltaEx8
complex has tRNA endonuclease and/or 3' end mRNA processing
activity. In certain embodiments, the fidelity and accuracy of the
tRNA cleavage activity of a Sen2deltaEx8 comprising complex is
reduced compared to the the tRNA cleavage activity of full length
Sen2 comprising complexes. In certain embodiments, the complex may
further comprise: (i) human CPSF160 or a protein encoded by a
nucleic acid that hybridizes under stringent conditions to a
CPSF160 encoding nucleic acid; (ii) human CPSF30 or a protein
encoded by a nucleic acid that hybridizes under stringent
conditions to a CPSF30 encoding nucleic acid; (iii) human CstF64 or
a protein encoded by a nucleic acid that hybridizes under stringent
conditions to a CstF60 encoding nucleic acid; and/or (iv) human
symplekin or a protein encoded by a nucleic acid that hybridizes
under stringent conditions to a symplekin encoding nucleic
acid.
[0214] In another embodiment, the invention provides a purified
Sen2deltaEx8 complex with 3' end pre-mRNA endonuclease activity
comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a protein
encoded by a nucleic acid that hybridizes to the human Sen2deltaEx8
encoding nucleic acid (SEQ ID NO.: 1) or its complement under high
stringency conditions; (ii) human Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions; (iii) human Clp1 (ACCESSION NO.:NP.sub.--006822) or a
protein encoded by a nucleic acid that hybridizes to the human Clp1
encoding nucleic acid (ACCESSION NO.: NM.sub.--006831) or its
complement under high stringency conditions; (iv) human CPSF or
proteins encoded by nucleic acids that hybridize to the human CPSF
encoding nucleic acids or their complements under high stringency
conditions; (v) human CFI.sub.m or proteins encoded by nucleic
acids that hybridize to the human CFI.sub.m encoding nucleic acids
or their complements under high stringency conditions; (vi) human
CF II.sub.m or proteins encoded by nucleic acids that hybridize to
the human CFII.sub.m encoding nucleic acids or their complements
under high stringency conditions; and (vii) human CstF or proteins
encoded by nucleic acids that hybridize to the human CstF encoding
nucleic acids or their complements under high stringency
conditions.
[0215] CPSF, CstF, CFIm and CFIIm consist of multiple subunits. The
accession numbers of the different subunits are set forth in Table
1 in section 4.2.1. CPSF, CstF, CFIm and CFIIm can each comprise a
different set of subunits. In a specific embodiment, CPSF comprises
the 160 kD factor 1 and the 30 kD factor 4. In a more specific
embodiment, CPSF comprises the 160 kD factor 1, the 100 kD factor
2, the 73 kD factor 3, and the 30 kD factor 4. In a specific
embodiment, CstF comprises the 50 kD subunit 1, the 64 kD subunit
2, and the 77 kD subunit 3. In a more specific embodiment, CstF
comprises the 50 kD subunit 1, the 64 kD subunit 2, the 77 kD
subunit 3, and symplekin. In a specific embodiment, CFIm comprises
the 68 kD subunit and the 25 kD subunit. In a more specific
embodiment, CFIm comprises the 68 kD subunit, the 25 kD subunit,
the 59 kD subunit, and the 72 kD subunit. In a specific embodiment,
CFIIm comprises Clp1. In a more specific embodiment, CFIIm
comprises Clp1 and hPcf11. In another more specific embodiment,
CFIIm comprises ClpI, the CFlm 25 kD subunit and the CFIm 68 kD
subunit. In even another more specific embodiment, CFIIm comprises
ClpI, the CFIm 25 kD subunit and the CFIm 68 kD subunit and
hpcf11.
[0216] Detailed information on Symplekin can be obtained from the
homepage of Dr. Keller's laboratory at the biocentre of the
University of Basel and in Takagaki, Y. and J. Manley, 2000,
Molecular & Cellular Biol 20:1515-1525.
[0217] Wahle and Ruegsegger, 1999, FEMS Micro Rev., 23, 277-295 and
Zhoa et al., 1999, Micoboil. Mol. Biol. Rev., 63, 405-445 describe
factors involved RNA processing, both references are incorporated
herein in their entireties.
[0218] In certain embodiments, all subunits of CPSF and CstF,
respectively, are present in a complex of the invention.
[0219] In certain embodiments, the invention provides complexes
wherein the components are homologs or analogs of the human
components of the protein complexes of the invention. Homologs or
analogs of the human components of a complex of the invention are
at least 50%, at least 55%, at least 60%, at least 65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, at least 98%, at least 99% or at least 99.5% identical
to a human component of a complex of the invention. Derivatives can
be, e.g., fusion proteins, mutant forms of the protein, or forms of
the protein with chemical moieties linked to the protein. A
fragment of a component of a complex of the invention is a portion
of the protein component that maintains the ability of the
component to be physically integrated into the complex.
[0220] In certain embodiments, the protein components of a complex
of the invention are derived from the same species. In more
specific embodiments, the protein components are all derived from
human. In another specific embodiment, the protein components are
all derived from a mammal.
[0221] In certain other embodiments, the protein components of a
complex of the invention are derived from a non-human species, such
as, but not limited to, cow, pig, horse, cat, dog, rat, mouse, a
primate (e.g., a chimpanzee, a monkey such as a cynomolgous
monkey). In certain embodiments, one or more components are derived
from human and the other components are derived from a mammal other
than a human to give rise to chimeric complexes.
[0222] 4.2.3 tRNA Cleavage Complex
[0223] The invention provides Sen2deltaEx8 complexes with pre-tRNA
cleavage activity. The invention provides a purified protein
complex with pre-tRNA cleavage activity comprising two or more of
the following: (i) human Sen2deltaEx8 or a functionally active
derivative thereof; (ii) human Sen54 or a functionally active
derivative or a functionally active fragment thereof; (iii) human
Sen15 or a functionally active derivative or a functionally active
fragment thereof; (iv) human Sen34 or a functionally active
derivative or a functionally active fragment thereof; and (v) Clp1
or a functionally active derivative or a functionally active
fragment thereof.
[0224] In certain embodiments, the invention provides complexes
comprising two or more of the following: (i) human Sen2deltaEx8
(SEQ ID NO.: 2), or a protein encoded by a nucleic acid that
hybridizes to the human Sen2deltaEx8 encoding nucleic acid (SEQ ID
NO.: 1) or its complement under high stringency conditions; (ii)
human Sen15 (ACCESSION NO.:NP.sub.--443197), or a protein encoded
by a nucleic acid that hybridizes to the human Sen15 encoding
nucleic acid (ACCESSION NO.:NM.sub.--052965) or its complement
under high stringency conditions; (iii) human Sen34 (ACCESSION
NO.:NP.sub.--076980), or a protein encoded by a nucleic acid that
hybridizes to the human Sen34 encoding nucleic acid (ACCESSION
NO.:NM.sub.--024075) or its complement under high stringency
conditions; and (iv) human Sen54 (ACCESSION NO.:XP.sub.--208944),
or a protein encoded by a nucleic acid that hybridizes to the human
Sen54 encoding nucleic acid (ACCESSION NO.:XM.sub.--208944) or its
complement under high stringency conditions.
[0225] The invention provides a purified human Sen2deltaEx8 complex
with pre-tRNA cleavage activity comprising: (i) human Sen2deltaEx8
or a functionally active derivative thereof; and (ii) human Sen54
or a functionally active derivative or a functionally active
fragment thereof. The invention also provides a human Sen2deltaEx8
complex with pre-tRNA cleavage activity comprising: (i) human
Sen2deltaEx8 or a functionally active derivative thereof; (ii)
human Sen54 or a functionally active derivative or a functionally
active fragment thereof; (iii) human Sen15 or a functionally active
derivative or a functionally active fragment thereof; and (iv)
human Sen34 or a functionally active derivative or a functionally
active fragment thereof. These human Sen2deltaEx8 complexes cleave
tRNA at multiple sites and are useful in mapping RNA structure and
3' end endonuclease processing.
[0226] In a specific embodiment, the invention provides a purified
human Sen2deltaEx8 complex with pre-tRNA cleavage activity
comprising: (i) human Sen2deltaEx8 (SEQ ID NO.: 2), or a protein
encoded by a nucleic acid that hybridizes to the human Sen2deltaEx8
encoding nucleic acid (SEQ ID NO.: 1) or its complement under high
stringency conditions; and (ii) human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions. In another embodiment, the invention provides a
purified human Sen2deltaEx8 complex comprising: (i) human
Sen2deltaEx8 (SEQ ID NO.: 2), or a protein encoded by a nucleic
acid that hybridizes to the human Sen2deltaEx8 encoding nucleic
acid (SEQ ID NO.: 1) or its complement under high stringency
conditions; (ii) human Sen15 (ACCESSION NO.:NP.sub.--443197), or a
protein encoded by a nucleic acid that hybridizes to the human
Sen15 encoding nucleic acid (ACCESSION NO.:NM.sub.--052965) or its
complement under high stringency conditions; (iii) human Sen34
(ACCESSION NO.:NP.sub.--076980), or a protein encoded by a nucleic
acid that hybridizes to the human Sen34 encoding nucleic acid
(ACCESSION NO.:NM.sub.--024075) or its complement under high
stringency conditions; and (iv) Sen54 (ACCESSION
NO.:XP.sub.--208944), or a protein encoded by a nucleic acid that
hybridizes to the human Sen54 encoding nucleic acid (ACCESSION
NO.:XM.sub.--208944) or its complement under high stringency
conditions. In certain embodiments, the Sen2deltaEx8 complex has
RNA-nucleolytic activity. In a specific embodiment the Sen2deltaEx8
complex has tRNA endonuclease and/or 3' end mRNA processing
activity. In certain embodiments, the fidelity and accuracy of the
tRNA cleavage activity of a Sen2deltaEx8 comprising complex is
reduced compared to the the tRNA cleavage activity of full length
Sen2 comprising complexes. In certain embodiments, the complex may
further comprise: (i) human CPSF160 or a protein encoded by a
nucleic acid that hybridizes under stringent conditions to a
CPSF160 encoding nucleic acid; (ii) human CPSF30 or a protein
encoded by a nucleic acid that hybridizes under stringent
conditions to a CPSF30 encoding nucleic acid; (iii) human CstF64 or
a protein encoded by a nucleic acid that hybridizes under stringent
conditions to a CstF64 encoding nucleic acid; and/or (iv) human
symplekin or a protein encoded by a nucleic acid that hybridizes
under stringent conditions to a symplekin encoding nucleic acid. In
accordance with these embodiments, the human Sen2deltaEx8 complex
cleaves tRNA at multiple sites. These human Sen2deltaEx8 complexes
are useful in mapping RNA structure and 3' endonuclease
processing.
[0227] In certain embodiments, the invention provides complexes
wherein the components are homologs or analogs of the human
components of the protein complexes of the invention. Homologs or
analogs of the human components of a complex of the invention are
at least 50%, at least 55%, at least 60%, at least 65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, at least 98%, at least 99% or at least 99.5% identical
to a human component of a complex of the invention. Derivatives can
be, e.g., fusion proteins, mutant forms of the protein, or forms of
the protein with chemical moieties linked to the protein. A
fragment of a component of a complex of the invention is a portion
of the protein component that maintains the ability of the
component to be physically integrated into the complex.
[0228] 4.2.4 Ribosomal RNA Cleavape Complex
[0229] The invention also provides protein complexes with
pre-ribosomal RNA cleavage activity. In particular, the invention
provides a protein complex with pre-ribosomal RNA cleavage activity
comprising: (i) human Sen15 or a functionally active derivative or
a functionally active fragment thereof; and (ii) human Sen34 or a
functionally active derivative or a functionally active fragment
thereof. This protein complex may be used in the biogenesis of
different ribosomal RNAs. For example, the production of 28S, 18S,
5.5S and 5S ribosomal RNA may be altered by modulating this protein
complex.
[0230] In particular, the invention provides a complex with
pre-ribosomal RNA cleavage activity, wherein the complex comprises:
human Sen34 (ACCESSION NO.:NP.sub.--076980), or a protein encoded
by a nucleic acid that hybridizes to the human Sen34 encoding
nucleic acid (ACCESSION NO.:NM.sub.--024075) or its complement
under high stringency conditions; and human Sen15 (ACCESSION
NO.:NP.sub.--443197), or a protein encoded by a nucleic acid that
hybridizes to the human Sen15 encoding nucleic acid (ACCESSION
NO.:NM.sub.--052965) or its complement under high stringency
conditions.
[0231] In certain embodiments, the invention provides complexes
wherein the components are homologs or analogs of the human
components of the protein complexes of the invention. Homologs or
analogs of the human components of a complex of the invention are
at least 50%, at least 55%, at least 60%, at least 65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at
least 95%, at least 98%, at least 99% or at least 99.5% identical
to a human component of a complex of the invention. Derivatives can
be, e.g., fusion proteins, mutant forms of the protein, or forms of
the protein with chemical moieties linked to the protein. A
fragment of a component of a complex of the invention is a portion
of the protein component that maintains the ability of the
component to be physically integrated into the complex.
[0232] In certain embodiments, the protein components of a complex
of the invention are derived from the same species. In more
specific embodiments, the protein components are all derived from
human. In another specific embodiment, the protein components are
all derived from a mammal.
[0233] In certain other embodiments, the protein components of a
complex of the invention are derived from a non-human species, such
as, but not limited to, cow, pig, horse, cat, dog, rat, mouse, a
primate (e.g., a chimpanzee, a monkey such as a cynomolgous
monkey). In certain embodiments, one or more components are derived
from human and the other components are derived from a mammal other
than a human to give rise to chimeric complexes.
[0234] 4.3 Generation and Purification of Complexes of the
Invention
[0235] The complexes of the invention can be generated by any
method known to the skilled artisan. In certain embodiments, the
complexes can be generated by co-expressing the components of the
complex in a cell and subsequently purifying the complex. In
certain, more specific embodiments, the cell expresses at least one
component of the complex by recombinant DNA technology. In other
embodiments, the cells normally express the components of the
complex. In certain other embodiments, the components of the
complex are expressed separately, wherein the components can be
expressed using recombinant DNA technology or wherein at least one
component is purified from a cell that normally expresses the
component. The individual components of the complex are incubated
in vitro under conditions conducive to the binding of the
components of a complex of the invention to each other to generate
a complex of the invention.
[0236] If one or more of the components is expressed by recombinant
DNA technology, any method known to the skilled artisan can be used
to produce the recombinant protein. The nucleic and amino acid
sequences of the component proteins of the protein complexes of the
present invention are provided herein (see Table 1; and SEQ ID NOs:
1-2), and can be obtained by any method known in the art, e.g., by
PCR amplification using synthetic primers hybridizable to the 3'
and 5' ends of each sequence, and/or by cloning from a cDNA or
genomic library using an oligonucleotide specific for each
nucleotide sequence.
[0237] The protein components, either alone or in a complex, can be
obtained by methods well known in the art for protein purification
and recombinant protein expression. For recombinant expression of
one or more of the proteins, the nucleic acid containing all or a
portion of the nucleotide sequence encoding the protein can be
inserted into an appropriate expression vector, i.e., a vector that
contains the necessary elements for the transcription and
translation of the inserted protein coding sequence. The necessary
transcriptional and translational signals can also be supplied by
the native promoter of the component protein gene, and/or flanking
regions.
[0238] A variety of host-vector systems may be utilized to express
the protein coding sequence. These include but are not limited to
mammalian cell systems infected with virus (e.g., vaccinia virus,
adenovirus, etc.); insect cell systems infected with virus (e.g.,
baculovirus); microorganisms such as yeast containing yeast
vectors; or bacteria transformed with bacteriophage, DNA, plasmid
DNA, or cosmid DNA. The expression elements of vectors vary in
their strengths and specificities. Depending on the host-vector
system utilized, any one of a number of suitable transcription and
translation elements may be used.
[0239] In a preferred embodiment, a complex of the present
invention is obtained by expressing the entire coding sequences of
the component proteins in the same cell, either under the control
of the same promoter or separate promoters. In yet another
embodiment, a derivative, fragment or homolog of a component
protein is recombinantly expressed. Preferably the derivative,
fragment or homolog of the protein forms a complex with the other
components of the complex. In a specific embodiment, the protein
components form a complex that binds to an anti-complex
antibody.
[0240] Any method available in the art can be used for the
insertion of DNA fragments into a vector to construct expression
vectors containing a chimeric gene consisting of appropriate
transcriptional/translational control signals and protein coding
sequences. These methods may include in vitro recombinant DNA and
synthetic techniques and in vivo recombinant techniques (genetic
recombination). Expression of nucleic acid sequences encoding a
component protein, or a derivative, fragment or homolog thereof,
may be regulated by a second nucleic acid sequence so that the gene
or fragment thereof is expressed in a host transformed with the
recombinant DNA molecule(s). For example, expression of the
proteins may be controlled by any promoter/enhancer known in the
art. In a specific embodiment, the promoter is not native to the
genes for the component protein. In certain embodiments, a promoter
that may be used is a constitutive promoter. In certain
embodiments, a promoter that may be used is a inducible promoter.
In certain embodiments, a promoter that may be used is a
tissue-specific promoter. Promoters that may be used include but
are not limited to the SV40 early promoter (Bemoist and Chambon,
1981, Nature 290:304-310), the promoter contained in the 3' long
terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell
22:787-797), the herpes thymidine kinase promoter (Wagner et al.,
1981, Proc. Natl. Acad. Sci. USA 78:1441-1445), the regulatory
sequences of the metallothionein gene (Brinster et al., 1982,
Nature 296:39-42); prokaryotic expression vectors such as the
P-lactamase promoter (Villa-Kamaroff et al., 1978, Proc. Natl.
Acad. Sci. USA 75:3727-3731) or the tac promoter (DeBoer et al.,
1983, Proc. Natl. Acad. Sci. USA 80:21-25; Gilbert et al., 1980,
Scientific American 242:79-94); plant expression vectors comprising
the nopaline synthetase promoter (Herrar-Estrella et al., 1984,
Nature 303:209-213) or the cauliflower mosaic virus 35S RNA
promoter (Garder et al., 1981, Nucleic Acids Res. 9:2871), and the
promoter of the photosynthetic enzyme ribulose bisphosphate
carboxylase (Herrera-Estrella et al., 1984, Nature 310:115-120);
promoter elements from yeast and other fungi such as the Gal4
promoter (Johnston et al., 1987, Microbiol. Rev. 51:458-476), the
alcohol dehydrogenase promoter (Schibler et al., 1987, Annual
Review Genetics 21:237-257), the phosphoglycerol kinase promoter
(Struhl et al., 1995, Annual Review Genetics 29:651-674-257;
Guarente 1987, Annual Review Genetics 21:425-452), the alkaline
phosphatase promoter (Struhl et al., 1995, Annual Review Genetics
29:651-674-257; Guarente 1987, Annual Review Genetics 21:425-452),
and the following animal transcriptional control regions that
exhibit tissue specificity and have been utilized in transgenic
animals: elastase I gene control region which is active in
pancreatic acinar cells (Swift et al., 1984, Cell 38:639-646;
Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol.
50:399-409; MacDonald 1987, Hepatology 7:425-515); insulin gene
control region which is active in pancreatic beta cells (Hanahan et
al., 1985, Nature 315:115-122), immunoglobulin gene control region
which is active in lymphoid cells (Grosschedl et al., 1984, Cell
38:647-658; Adams et al., 1985, Nature 318:533-538; Alexander et
al., 1987, Mol. Cell Biol. 7:1436-1444), mouse mammary tumor virus
control region which is active in testicular, breast, lymphoid and
mast cells (Leder et al., 1986, Cell 45:485-495), albumin gene
control region which is active in liver (Pinckert et al., 1987,
Genes and Devel. 1:268-276), alpha-fetoprotein gene control region
which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol.
5:1639-1648; Hammer et al., 1987, Science 235:53-58), alpha-1
antitrypsin gene control region which is active in liver (Kelsey et
al., 1987, Genes and Devel. 1:161-171), beta globin gene control
region which is active in myeloid cells (Mogram et al., 1985,
Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94), myelin
basic protein gene control region which is active in
oligodendrocyte cells of the brain (Readhead et al., 1987, Cell
48:703-712), myosin light chain-2 gene control region which is
active in skeletal muscle (Sani 1985, Nature 314:283-286), and
gonadotrophic releasing hormone gene control region which is active
in gonadotrophs of the hypothalamus (Mason et al., 1986, Science
234:1372-1378).
[0241] In a specific embodiment, a vector is used that comprises a
promoter operably linked to nucleic acid sequences encoding a
component protein, or a fragment, derivative or homolog thereof,
one or more origins of replication, and optionally, one or more
selectable markers (e.g., an antibiotic resistance gene). In
accordance with this embodiment, a promoter can be any promoter
known to the skilled artisan. The promoter can be, but is not
limited to be, a constitutive promoter, a tissue-specific promoter
or an inducible promoter.
[0242] In another specific embodiment, an expression vector
containing the coding sequence, or a portion thereof, of a
component protein, either together or separately, is made by
subcloning the gene sequences into the multiple cloning site of one
of the three pGEX vectors (glutathione S-transferase expression
vectors; Smith and Johnson, 1988, Gene 7:31-40). Care should be
taken that the nucleotide sequence encoding the protein component
is in the same reading frame as the nucleotide sequence encoding
the GST such that the protein component and the GST are expressed
as one fusion protein.
[0243] Expression vectors containing the sequences of interest can
be identified by three general approaches: (1) nucleic acid
hybridization, (2) presence or absence of "marker" gene function,
and (3) expression of the inserted sequences. In the first
approach, coding sequences can be detected by nucleic acid
hybridization to probes comprising sequences homologous and
complementary to the inserted sequences. In the second approach,
the recombinant vector/host system can be identified and selected
based upon the presence or absence of certain "marker" functions
(e.g., resistance to antibiotics, occlusion body formation in
baculovirus, etc.) caused by insertion of the sequences of interest
in the vector. For example, if a component protein gene, or portion
thereof, is inserted within the marker gene sequence of the vector,
recombinants containing the encoded protein or portion will be
identified by the absence of the marker gene function (e.g., loss
of beta-galactosidase activity). In the third approach, recombinant
expression vectors can be identified by assaying for the component
protein expressed by the recombinant vector. Such assays can be
based, for example, on the physical or functional properties of the
interacting species in in vitro assay systems, e.g., formation of a
complex comprising the protein or binding to an anti-complex
antibody. The expressed sequences can be detected using antibodies
that are specifically directed to the expressed protein component.
In certain embodiments, the expressed sequence is a fusion protein
of the protein component and comprises a peptide tag, wherein the
peptide tag can be visualized, such as a GFP tag.
[0244] Once recombinant component protein molecules are identified
and the complexes or individual proteins purified, several methods
known in the art can be used to propagate them. Using a suitable
host system and growth conditions, recombinant expression vectors
can be propagated and amplified in quantity. As previously
described, the expression vectors or derivatives which can be used
include, but are not limited to, human or animal viruses such as
vaccinia virus or adenovirus; insect viruses such as baculovirus,
yeast vectors; bacteriophage vectors such as lambda phage; and
plasmid and cosmid vectors.
[0245] In addition, a host cell strain may be chosen that modulates
the expression of the inserted sequences, or modifies or processes
the expressed proteins in the specific fashion desired. Expression
from certain promoters can be elevated in the presence of certain
inducers; thus expression of the genetically-engineered component
proteins may be controlled. Furthermore, different host cells have
characteristic and specific mechanisms for the translational and
post-translational processing and modification (e.g.,
glycosylation, phosphorylation, etc.) of proteins. Appropriate cell
lines or host systems can be chosen to ensure that the desired
modification and processing of the foreign protein is achieved. For
example, expression in a bacterial system can be used to produce an
unglycosylated core protein, while expression in mammalian cells
ensures "native" glycosylation of a heterologous protein.
Furthermore, different vector/host expression systems may effect
processing reactions to different extents.
[0246] In other specific embodiments, a component protein or a
fragment, homolog or derivative thereof, may be expressed as fusion
or chimeric protein product comprising the protein, fragment,
homolog, or derivative joined via a peptide bond to a heterologous
protein sequence. Such chimeric products can be made by ligating
the appropriate nucleic acid sequences encoding the desired amino
acids to each other by methods known in the art, in the proper
coding frame, and expressing the chimeric products in a suitable
host by methods commonly known in the art. Alternatively, such a
chimeric product can be made by protein synthetic techniques, e.g.,
by use of a peptide synthesizer. Chimeric genes comprising a
portion of a component protein fused to any heterologous
protein-encoding sequences may be constructed.
[0247] In a specific embodiment, fusion proteins are provided that
contain the interacting domains of the component proteins and,
optionally, a peptide linker between the two domains, where such a
linker promotes the interaction of the binding domains. These
fusion proteins may be particularly useful where the stability of
the interaction is desirable (due to the formation of the complex
as an intra-molecular reaction), for example, in production of
antibodies specific to the complex.
[0248] In particular, protein component derivatives can be made by
altering their sequences by substitutions, additions or deletions
that provide for functionally equivalent molecules. Due to the
degeneracy of nucleotide coding sequences, other DNA sequences that
encode substantially the same amino acid sequence as a component
gene or cDNA can be used in the practice of the present invention.
These include but are not limited to nucleotide sequences
comprising all or portions of the component protein gene that are
altered by the substitution of different codons that encode a
functionally equivalent amino acid residue within the sequence,
thus producing a silent change. Likewise, the derivatives of the
invention include, but are not limited to, those containing, as a
primary amino acid sequence, all or part of the amino acid sequence
of a component protein, including altered sequences in which
functionally equivalent amino acid residues are substituted for
residues within the sequence resulting in a silent change. For
example, one or more amino acid residues within the sequence can be
substituted by another amino acid of a similar polarity that acts
as a functional equivalent, resulting in a silent alteration.
Substitutes for an amino acid within the sequence may be selected
from other members of the class to which the amino acid belongs.
For example, the nonpolar (hydrophobic) amino acids include
alanine, leucine, isoleucine, valine, proline, phenylalanine,
tryptophan and methionine. The polar neutral amino acids include
glycine, serine, threonine, cysteine, tyrosine, asparagine, and
glutamine. The positively charged (basic) amino acids include
arginine, lysine and histidine. The negatively charged (acidic)
amino acids include aspartic acid and glutamic acid.
[0249] The protein component derivatives and analogs of the
invention can be produced by various methods known in the art. The
manipulations which result in their production can occur at the
gene or protein level. For example, the cloned gene sequences can
be modified by any of numerous strategies known in the art
(Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d
Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.). The sequences can be cleaved at appropriate sites with
restriction endonuclease(s), followed by further enzymatic
modification if desired, isolated, and ligated in vitro. In the
production of the gene encoding a derivative, homolog or analog of
a component protein, care should be taken to ensure that the
modified gene retains the original translational reading frame,
uninterrupted by translational stop signals, in the gene region
where the desired activity is encoded.
[0250] Additionally, the encoding nucleic acid sequence can be
mutated in vitro or in vivo, to create and/or destroy translation,
initiation, and/or termination sequences, or to create variations
in coding regions and/or form new restriction endonuclease sites or
destroy pre-existing ones, to facilitate further in vitro
modification. Any technique for mutagenesis known in the art can be
used, including but not limited to, chemical mutagenesis and in
vitro site-directed mutagenesis (Hutchinson et al., 1978, J. Biol.
Chem 253:6551-6558), amplification with PCR primers containing a
mutation, use of chimeric oligonucleotides, etc.
[0251] Once a recombinant cell expressing a component protein, or
fragment or derivative thereof, is identified, the individual gene
product or complex can be purified and analyzed. This is achieved
by assays based on the physical and/or functional properties of the
protein or complex, including, but not limited to, radioactive
labeling of the product followed by analysis by gel
electrophoresis, immunoassay, cross-linking to marker-labeled
product, etc.
[0252] The component proteins and complexes may be purified by
standard methods known in the art (either from natural sources or
recombinant host cells expressing the complexes or proteins),
including but not restricted to column chromatography (e.g., ion
exchange, affinity, gel exclusion, reversed-phase high pressure,
fast protein liquid, etc.), differential centrifugation,
differential solubility, or by any other standard technique used
for the purification of proteins. Functional properties may be
evaluated using any suitable assay known in the art. For a more
detailed description of purification procedures of the components
and the complexes of the invention, see below.
[0253] Alternatively, once a component protein or its derivative,
is identified, the amino acid sequence of the protein can be
deduced from the nucleic acid sequence of the chimeric gene from
which it was encoded. As a result, the protein or its derivative
can be synthesized by standard chemical methods known in the art
(e.g., Hunkapiller et al., 1984, Nature 310: 105-111).
[0254] Manipulations of component protein sequences may be made at
the protein level. Included within the scope of the invention is a
complex in which the component proteins or derivatives and analogs
that are differentially modified during or after translation, e.g.,
by glycosylation, acetylation, phosphorylation, amidation,
derivatization by known protecting/blocking groups, proteolytic
cleavage, linkage to an antibody molecule or other cellular ligand,
etc. Any of numerous chemical modifications may be carried out by
known techniques, including but not limited to specific chemical
cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8
protease, NaBH.sub.4, acetylation, formylation, oxidation,
reduction, metabolic synthesis in the presence of tunicamycin,
etc.
[0255] In specific embodiments, the amino acid sequences are
modified to include a fluorescent label. In another specific
embodiment, the protein sequences are modified to have a
heterofunctional reagent; such heterofunctional reagents can be
used to crosslink the members of the complex.
[0256] In addition, complexes of analogs and derivatives of
component proteins can be chemically synthesized. For example, a
peptide corresponding to a portion of a component protein, which
comprises the desired domain or mediates the desired activity in
vitro (e.g., complex formation) can be synthesized by use of a
peptide synthesizer. Furthermore, if desired, non-classical amino
acids or chemical amino acid analogs can be introduced as a
substitution or addition into the protein sequence. Non-classical
amino acids include but are not limited to the D-isomers of the
common amino acids, .alpha.-amino isobutyric acid, 4-aminobutyric
acid (4-Abu), 2-aminobutyric acid (2-Abu), 6-amino hexanoic acid
(Ahx), 2-amino isobutyric acid (2-Aib), 3-amino propionoic acid,
ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, cysteic acid, t-butylglycine, t-butylalanine,
phenylglycine, cyclohexylalanine, .beta.-alanine, fluoro-amino
acids, designer amino acids such as .beta.-methyl amino acids,
C.alpha.-methyl amino acids, N.alpha.-methyl amino acids, and amino
acid analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L (levorotary).
[0257] In cases where natural products are suspected of being
mutant or are purified from new species, the amino acid sequence of
a component protein purified from the natural source, as well as
those expressed in vitro, or from synthesized expression vectors in
vivo or in vitro, can be determined from analysis of the DNA
sequence, or alternatively, by direct sequencing of the purified
protein. Such analysis can be performed by manual sequencing or
through use of an automated amino acid sequenator.
[0258] The complexes can also be analyzed by hydrophilicity
analysis (Hopp and Woods, 1981, Proc. Natl. Acad. Sci. USA
78:3824-3828). A hydrophilicity profile can be used to identify the
hydrophobic and hydrophilic regions of the proteins, and help
predict their orientation in designing substrates for experimental
manipulation, such as in binding experiments, antibody synthesis,
etc. Secondary structural analysis can also be done to identify
regions of the component proteins, or their derivatives, that
assume specific structures (Chou and Fasman, 1974, Biochemistry
13:222-23). Manipulation, translation, secondary structure
prediction, hydrophilicity and hydrophobicity profile predictions,
open reading frame prediction and plotting, and determination of
sequence homologies, etc., can be accomplished using computer
software programs available in the art.
[0259] Other methods of structural analysis including but not
limited to X-ray crystallography (Engstrom, 1974 Biochem. Exp.
Biol. 11:7-13), mass spectroscopy and gas chromatography (Methods
in Protein Science, J. Wiley and Sons, New York, 1997), and
computer modeling (Fletterick and Zoller, eds., 1986, Computer
Graphics and Molecular Modeling, In: Current Communications in
Molecular Biology, Cold Spring Harbor Laboratory, Cold Spring
Harbor Press, N.Y.) can also be employed.
[0260] In certain embodiments, at least one component of the
complex is generated by recombinant DNA technology and is a
derivative of the naturally occurring protein. In certain
embodiments, the derivative is a fusion protein, wherein the amino
acid sequence of the naturally occurring protein is fused to a
second amino acid sequence. The second amino acid sequence can be a
peptide tag that facilitates the purification, immunological
detection and identification as well as visualization of the
protein. A variety of peptide tags with different functions and
affinities can be used in the invention to facilitate the
purification of the component or the complex comprising the
component by affinity chromatography. A specific peptide tag
comprises the constant regions of an immunoglobulin. In other
embodiments, the component is fused to a leader sequence to promote
secretion of the protein component from the cell that expresses the
protein component. Other peptide tags that can be used with the
invention include, but are not limited to, FLAG epitope or
polyHistidine tag, e.g., Hisx6 tag.
[0261] If the components of the complex are co-expressed, the
complex can be purified by any method known to the skilled artisan,
including immunoprecipitation, ammonium sulfate precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, immunoaffmity chromatography,
hydroxyapatite chromatography, and lectin chromatography.
[0262] The methods described herein can be used to purify the
individual components of the complex of the invention. The methods
can also be used to purify the entire complex. Generally, the
purification conditions as well as the dissociation constant of the
complex will determine whether the complex remains intact during
the purification procedure. Such conditions include, but are not
limited to, salt concentration, detergent concentration, pH and
redox-potential.
[0263] If at least one component of the complex comprises a peptide
tag, the invention the invention also contemplates methods for the
purification of the complexes of the invention which are based on
the properties of the peptide tag. One approach is based on
specific molecular interactions between a tag and its binding
partner. The other approach relies on the immunospecific binding of
an antibody to an epitope present on the tag. The principle of
affinity chromatography well known in the art is generally
applicable to both of these approaches. In another embodiment, the
complex is purified using immunoprecipitation.
[0264] Described in section 4.3.5 below are several methods based
on specific molecular interactions of a tag and its binding
partner. The embodiments described in section 4.3.5 may be used to
recover and purify protein components of the complex separately or
to recover and purify the complexes of the invention. Methods that
do not require lowering pH or denaturing conditions are most
preferred for purification of the complexes.
[0265] In certain embodiments, the individual components of a
complex of the invention are expressed separately. The components
are subsequently incubated under conditions conducive to the
binding of the components of the complex to each other to generate
the complex. In certain, more specific embodiments, the components
are purified before complex-formation. In other embodiments the
supernatants of cells that express the component (if the component
is secreted) or cell lysates of cells that express the component
(if the component is not secreted) are combined first to give rise
to the complex, and the complex is purified subsequently.
Parameters affecting the ability of the components of the invention
to bind to each other include, but are not limited to, salt
concentration, detergent concentration, pH, and redox-potential.
Once the complex has formed, the complex can be purified or
concentrated by any method known to the skilled artisan. In certain
embodiments, the complex is separated from the remaining individual
components by filtration. The pore size of the filter should be
such, that the individual components can still pass through the
filter, but the complex does not pass through the filter. Other
methods for enriching the complex include sucrose gradient
centrifugation and chromatography.
[0266] 4.3.1 Homologs, Derivatives and Fragments of the
Components
[0267] In certain embodiments, at least one component of a complex
of the invention is a homolog, a derivative, e.g., a functionally
active derivative, a fragment, e.g., a functionally active
fragment, of a protein component of a complex of the invention. In
certain embodiments of the invention, a homolog, derivative or
fragment of a protein component of a complex of the invention is
still capable of forming a complex with the other component(s).
Complex-formation can be tested by any method known to the skilled
artisan. Such methods include, but are not limited to,
non-denaturing PAGE, FRET, and Fluorescence Polarization Assay.
[0268] In certain embodiments, a fragment of a protein component of
the complex consists of at least 6 (continuous) amino acids, of at
least 10, at least 20 amino acids, at least 30 amino acids, at
least 40 amino acids, at least 50 amino acids, at least 75 amino
acids, at least 100 amino acids, at least 150 amino acids, at least
200 amino acids, at least 250 amino acids, at least 300 amino
acids, at least 400 amino acids, or at least 500 amino acids of the
protein component of the naturally occurring proteins. In specific
embodiments, such fragments are not larger than 40 amino acids, 50
amino acids, 75 amino acids, 100 amino acids, 150 amino acids, 200
amino acids, 250 amino acids, 300 amino acids, 400 amino acids, or
than 500 amino acids. In more specific embodiments, the functional
fragment is capable of forming a complex of the invention, i.e.,
the fragment can still bind to at least one other protein component
to form a complex of the invention.
[0269] Derivatives or analogs of component proteins include, but
are not limited, to molecules comprising regions that are
substantially homologous to the component proteins, in various
embodiments, by at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%
identity over an amino acid sequence of identical size or when
compared to an aligned sequence in which the alignment is done by a
computer homology program known in the art, or whose encoding
nucleic acid is capable of hybridizing to a sequence encoding the
component protein under stringent, moderately stringent, or
nonstringent conditions.
[0270] Derivatives or analogs of component proteins also include,
but are not limited, to molecules that (i) comprise regions that
are substantially homologous to the component proteins, in various
embodiments, by at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%
identity over an amino acid sequence of identical size or when
compared to an aligned sequence in which the alignment is done by a
computer homology program known in the art, or whose encoding
nucleic acid is capable of hybridizing to a sequence encoding the
component protein under stringent, moderately stringent, or
nonstringent conditions; (ii) are capable of forming a complex of
the invention. Further, derivatives or analogs of component
proteins also include, but are not limited, to molecules that
comprise regions that are substantially homologous to the component
proteins, in various embodiments, by at least 30%, 40%, 50%, 60%,
70%, 80%, 90% or 95% identity over an amino acid sequence of
identical size or when compared to an aligned sequence in which the
alignment is done by a computer homology program known in the art,
or whose encoding nucleic acid is capable of hybridizing to a
sequence encoding the component protein under stringent, moderately
stringent, or nonstringent conditions and wherein a complex that
comprises the derivative has RNA-nucleolytic activity (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention).
[0271] Derivatives of a protein component include, but are not
limited to, fusion proteins of a protein component of a complex of
the invention to a heterologous amino acid sequence, mutant forms
of a protein component of a complex of the invention, and
chemically modified forms of a protein component of a complex of
the invention. In a specific embodiment, the functional derivative
of a protein component of a complex of the invention is capable of
forming a complex of the invention, i.e., the derivative can still
bind to at least one other protein component to form a complex of
the invention.
[0272] Homologs (e.g., nucleic acids encoding component proteins
from other species) or other related sequences (e.g., paralogs)
which are members of a native cellular protein complex can be
identified and obtained by low, moderate or high stringency
hybridization with all or a portion of the particular nucleic acid
sequence as a probe, using methods well known in the art for
nucleic acid hybridization and cloning.
[0273] In certain embodiments, a homolog of a first protein binds
to the same proteins to which the first protein binds. In certain,
more specific embodiments, a homolog of a first protein binds to
the same proteins to which the first protein binds wherein the
binding affinity between the homolog and the binding partner of the
first protein is at least 10%, at least 20%, at least 30%, at least
40%, at least 50%, at least 60%, at least 70%, at least 80%, at
least 90%, at least 95% or at least 98% of the binding affinity
between the first protein and the binding partner. Binding
affinities between proteins can be determined by any method known
to the skilled artisan.
[0274] It is well-known to the skilled artisan that hybridization
conditions, such as, but not limited to, temperature, salt
concentration, pH, formamide concentration (see, e.g., Sambrook et
al., 1989, Chapters 9 to 11, Molecular Cloning, A Laboratory
Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y.). In certain embodiments, hybridization is performed
in aqueous solution and the ionic strength of the solution is kept
constant while the hybridization temperature is varied dependent on
the degree of sequence homology between the sequences that are to
be hybridized. For DNA sequences that 100% identical to each other
and are longer than 200 basebairs, hybridization is carried out at
approximately 15-25.degree. C. below the melting temperature
(T.sub.m) of the perfect hybrid. The melting temperature (T.sub.m)
can be calculated using the following equation (Bolton and
McCarthy, Proc. Natl. Acad. Sci. USA 84:1390 (1962)):
[0275] T.sub.m=81.5.degree. C.-16.6(log.sub.10[Na.sup.+])+(%
G+C)-0.63(%formamide)-(600/l)
[0276] Wherein (T.sub.m) is the melting temperature, [Na.sup.+] is
the sodium concentration, G+C is the Guanine and Cytosine content,
and 1 is the length of the hybrid in basepairs. The effect of
mismatches between the sequences can be calculated using the
formula by Bonner et al. (Bonner et al., 1973, J. Mol. Biol.
81:123-135): for every 1% of mismatching of bases in the hybrid,
the melting temperature is reduced by 1-1.5.degree. C.
[0277] Thus, by determining the hybridization temperature of the
hybrid of two sequences with a certain percentage of homology to
each other and comparing the determined hybridization temperature
with the temperature at which the perfect hybrids of the two
sequences form allows to estimate the difference in sequence
between the two sequences.
[0278] By way of example and not limitation, procedures using such
conditions of high stringency are as follows. Prehybridization of
filters containing DNA is carried out for 8 h to overnight at 65 C
in buffer composed of 6.times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM
EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 .mu.g/ml
denatured salmon sperm DNA. Filters are hybridized for 48 h at 65 C
in prehybridization mixture containing 100 .mu.g/ml denatured
salmon sperm DNA and 5-20.times.106 cpm of 32P-labeled probe.
Washing of filters is done at 37 C for 1 h in a solution containing
2.times.SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is
followed by a wash in 0.1.times.SSC at 50 C for 45 min before
autoradiography. Other conditions of high stringency which may be
used are well known in the art. Alternatively, another system for
high stringency is as follows: hybridization to filter-bound DNA in
0.5 M NaHPO.sub.4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at
65.degree. C., and washing in 0.1.times.SSC/0.1% SDS at 68.degree.
C. (Ausubel F.M. et al., eds., 1989, Current Protocols in Molecular
Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley
& sons, Inc., New York, at p. 2.10.3). Other conditions of high
stringency which may be used are well known in the art.
[0279] In other embodiments of the invention, hybridization is
performed under moderate or low stringency conditions, such
conditions are well-known to the skilled artisan (see e.g.,
Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d
Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.;
see also, Ausubel et al., eds., in the Current Protocols in
Molecular Biology series of laboratory technique manuals, 1987-1997
Current Protocols,.COPYRGT. 1994-1997 John Wiley and Sons, Inc.).
An illustrative low stringency condition is provided by the
following system of buffers: hybridization in a buffer comprising
35% formamide, 5.times.SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA,
0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 .mu.g/ml denatured salmon
sperm DNA, and 10% (wt/vol) dextran sulfate for 18-20 hours at
40.degree. C., washing in a buffer consisting of 2.times.SSC, 25 mM
Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS for 1.5 hours at
55.degree. C., and washing in a buffer consisting of 2.times.SSC,
25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS for 1.5 hours at
60.degree. C.
[0280] Exemplary moderately stringent hybridization conditions are
as follows: prehybridization of filters containing DNA is carried
out for 8 hours to overnight at 65.degree. C. in buffer composed of
6.times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02%
Ficoll, 0.02% BSA, and 500 .mu.g/ml denatured salmon sperm DNA.
Filters are hybridized for 48 hours at 65.degree. C. in
prehybridization mixture containing 100 .mu.g/ml denatured salmon
sperm DNA and 5-20.times.10.sup.6 cpm of .sup.32P-labeled probe.
Washing of filters is done at 37.degree. C. for 1 hour in a
solution containing 2.times.SSC, 0.01% PVP, 0.01% Ficoll, and 0.01%
BSA. This is followed by a wash in 0.1.times.SSC at 50.degree. C.
for 45 min before autoradiography.
[0281] 4.3.2 Intersubunit Crosslinks
[0282] In certain embodiments of the invention, at least two
components of a complex of the invention are linked to each other
via at least one covalent bond. A covalent bond between components
of a complex of the invention increases the stability of the
complex of the invention because it prevents the dissociation of
the components. Any method known to the skilled artisan can be used
to achieve a covalent bond between at least two components of the
invention.
[0283] In specific embodiments, covalent cross-links are introduced
between adjacent subunits. Such cross-links can be between the
sidechains of amino acids at opposing sides of the dimer interface.
Any functional groups of amino acid residues at the dimer interface
in combination with suitable cross-linking agents can be used to
create covalent bonds between the protein components at the dimer
interface. Existing amino acids at the dimer interface can be used
or, alternatively, suitable amino acids can be introduced by
site-directed mutagenesis.
[0284] In exemplary embodiments, cysteine residues at opposing
sides of the dimer interface are oxidized to form disulfide bonds.
See, e.g., Reznik et al., 1996, Nature Biotechnology 14:1007-1011,
at page 1008. 1,3-dibromoacetone can also be used to create an
irreversible covalent bond between two sulfhydryl groups at the
dimer interface. In certain other embodiments, lysine residues at
the dimer interface are used to create a covalent bond between the
protein components of the complex. Crosslinkers that can be used to
create covalent bonds between the epsilon amino groups of lysine
residues are, e.g., but are not limited to,
bis(sulfosuccinimidyl)suberate; dimethyladipimidate-2HDl;
disuccinimidyl glutarate; N-hydroxysuccinimidyl
2,3-dibromoproprionate.
[0285] 4.3.3 Fusion Complexes
[0286] In specific embodiments, at least two components of a
complex of the invention are expressed as a fusion protein, ie.,
fusion complexes. Any recombinant DNA technology known to the
skilled artisan can be used to construct the DNA encoding the
fusion complex. Care should be taken that the two or more open
reading frames are cloned in frame with each other. Any method
known to the skilled artisan can be used to express and purify the
fusion protein. Exemplary methods are discussed herein. In certain,
more specific embodiments, the two components that form the fusion
protein are connected to each other via a linker peptide. Thus, the
fusion complex is encoded by the ORF for the first component
protein, the ORF encoding the linker peptide, and the ORF encoding
the second component protein. Without being bound by theory, the
linker peptide retains the two components of the complex in close
spatial proximity, thus increasing the rate of binding of the two
components to each other and thereby stabilizing the complex of the
invention.
[0287] 4.3.4 Peptide Tag and/or Leader Peptide Fusion
[0288] The protein components of the complexes of the invention can
be fusion proteins comprising a peptide tag. In certain
embodiments, a leader peptide may also be fused to a protein
component thereby facilitating the transport of the protein
component into the endoplasmic reticulum (ER) for secretion.
[0289] In various embodiments, such a fusion protein can be made by
ligating a gene sequence encoding a protein component of a complex
of the invention to the sequence encoding the peptide tag or the
leader peptide in the proper reading frame. If genomic sequences
are used, care should be taken to ensure that the modified gene
remains within the same translational reading frame, uninterrupted
by translational stop signals and/or spurious messenger RNA
splicing signals.
[0290] In a specific embodiment, the peptide tag is fused at its
amino terminal to the carboxyl terminal of the ORF for the protein
component. The precise site at which the fusion is made in the
carboxyl terminal is not critical. For example, the peptide tag may
replace part of the ORF encoding the protein component. The optimal
site can be determined by routine experimentation.
[0291] A variety of peptide tags known in the art may be used to
generate fusion proteins of the protein components of a complex of
the invention, such as but not limited to the immunoglobulin
constant regions, polyhistidine sequence (Petty, 1996,
Metal-chelate affinity chromatography, in Current Protocols in
Molecular Biology, Vol. 2, Ed. Ausubel et al., Greene Publish.
Assoc. & Wiley Interscience), glutathione S-transferase (GST;
Smith, 1993, Methods Mol. Cell Bio. 4:220-229), the E. coli maltose
binding protein (Guan et al., 1987, Gene 67:21-30), and various
cellulose binding domains (U.S. Pat. Nos. 5,496,934; 5,202,247;
5,137,819; Tomme et al., 1994, Protein Eng. 7:117-123), etc. Some
peptide tags may afford the fusion protein novel structural
properties, such as the ability to form multimers. Peptide tags
that promote homodimerization or homopolymerization are usually
derived from proteins that normally exist as homopolymers. Peptide
tags such as the extracellular domains of CD8(Shiue et al., 1988,
J. Exp. Med. 168:1993-2005), or CD28 (Lee et al., 1990, J. Immunol.
145:344-352), or portions of the immunoglobulin molecule containing
sites for interchain disulfide bonds, could lead to the formation
of multimers. In certain embodiments, the formation of homodimers
or homomultimers can interfere with the formation of a complex of
the invention. If this is the case, peptide tags that do not
promote the formation of homodimers or homomultimers should be
used.
[0292] Other possible peptide tags are short amino acid sequences
to which monoclonal antibodies are available, such as but not
limited to the following well known examples, the FLAG epitope, the
myc epitope at amino acids 408-439, the influenza virus
hemaglutinin (HA) epitope. Other peptide tags are recognized by
specific binding partners and thus facilitate isolation by affinity
binding to the binding partner, which is preferably immobilized
and/or on a solid support. As will be appreciated by those skilled
in the art, many methods can be used to obtain the coding region of
the above-mentioned peptide tags, including but not limited to, DNA
cloning, DNA amplification, and synthetic methods. Some of the
peptide tags and reagents for their detection and isolation are
available commercially.
[0293] In certain embodiments, a combination of different peptide
tags is used for the purification of the protein components of a
complex of the invention or for the purification of a complex. In
certain embodiments, at least one component has at least two
peptide tags, e.g., a FLAG tag and a His tag. The different tags
can be fused together or can be fused in different positions to the
protein component. In the purification procedure, the different
peptide tags are used subsequently or concurrently for
purification. In certain embodiments, at least two different
components are fused to a peptide tag, wherein the peptide tags of
the two components can be identical or different. Using different
tagged components for the purification of the complex ensures that
only complex will be purified and minimizes the amount of
uncomplexed protein components, such as monomers or homodimers.
[0294] A specific peptide tag is a non-variable portion of the
immunoglobulin molecule. Typically, such portions comprises at
least a functionally CH2 and CH3 domains of the constant region of
an immunoglobulin heavy chain. Fusions are also made using the
carboxyl terminus of the Fc portion of a constant domain, or a
region immediately amino-terminal to the CH1 of the heavy or light
chain. Suitable immunoglobulin-based peptide tag may be obtained
from IgG-1, -2, -3, or -4 subtypes, IgA, IgE, IgD, or IgM, but
preferably IgG1. Preferably, a human immunoglobulin is used when
the protein component is intended for in vivo use for humans. DNA
sequences encoding immunoglobulin light or heavy chain constant
regions are well-known or readily available from cDNA libraries. In
a specific embodiment, such DNA sequences can be amplified using
PCR. See, for example, Adams et al., Biochemistry, 1980,
19:2711-2719; Gough et al., 1980, Biochemistry, 19:2702-2710; Dolby
et al., 1980, Proc. Natl. Acad. Sci. U.S.A., 77:6027-6031; Rice et
al., 1982, Proc. Natl. Acad. Sci. U.S.A., 79:7862-7865; Falkner et
al., 1982, Nature, 298:286-288; and Morrison et al., 1984, Ann.
Rev. Immunol, 2:239-256. Because many immunological reagents and
labeling systems are available for the detection of
immunoglobulins, the fusion protein of a protein component of a
complex of the invention can readily be detected and quantified by
a variety of immunological techniques known in the art, such as the
use of enzyme-linked immunosorbent assay (ELISA),
immunoprecipitation, fluorescence activated cell sorting (FACS),
etc. Similarly, if the peptide tag is an epitope with readily
available antibodies, such reagents can be used with the techniques
mentioned above to detect, quantitate, and isolate the fusion
protein component of a complex of the invention containing the
peptide tag.
[0295] In a specific embodiment, a protein component is fused to
the hinge, CH2 and CH3 domains of murine immunoglobulin G-1
(IgG-1)(Bowen et al., J. Immunol. 156:442-9). This peptide contains
three cysteine residues which are normally involved in disulfide
bonding with other cysteines in the Ig molecule. Since none of the
cysteines are required for the peptide to function as a tag, one or
more of these cysteine residues may optionally be substituted by
another amino acid residue, such as for example, serine.
[0296] Various leader sequences known in the art can be used for
the efficient secretion of a protein component of a complex of the
invention from bacterial and mammalian cells (von Heijne, 1985, J.
Mol. Biol. 184:99-105). Leader peptides are selected based on the
intended host cell, and may include bacterial, yeast, viral,
animal, and mammalian sequences. For example, the herpes virus
glycoprotein D leader peptide is suitable for use in a variety of
mammalian cells. A preferred leader peptide for use in mammalian
cells can be obtained from the V-J2-C region of the mouse
immunoglobulin kappa chain (Bernard et al., 1981, Proc. Natl. Acad.
Sci. 78:5812-5816).
[0297] DNA sequences encoding desired peptide tag or leader peptide
which are known or readily available from libraries or commercial
suppliers are suitable in the practice of this invention.
[0298] 4.3.5 Purification of Complexes of the Invention
[0299] The complexes of the invention can be purified by any method
known to the skilled artisan. The methods described for the
purification of a complex may also be used to purify individual
protein components. In certain embodiments, the complex is formed
in the expression system itself, wherein the expression system can
be, e.g., a cell or a cell-free expression system (such as a
TNT.RTM. Coupled Reticulocyte Lysate System, which is commercially
available from Promega Corporation, Madison Wis.). Once the protein
components are expressed and the complex is formed, the complex is
purified from the other components of the expression system and the
individual protein components by any method known to the skilled
artisan. If the expression system is a cell, the cell is lysed once
the protein components are expressed and once the complex is
formed, the protein complex of the invention is then purified from
the lysate. In certain other embodiments, the protein components of
a complex of the invention are expressed and purified individually
and subsequently the purified components are combined to form the
complex. The individual protein components can be purified by any
method known to the skilled artisan.
[0300] In certain embodiments, the complex is purified via affinity
chromatography using antibodies that are specific to the complex.
In other embodiments, the complex is purified by performing
subsequent purification steps wherein each step requires the
presence of a different protein component in the complex to ensure
that the purified complex is free of any monomeric protein
components. Each individual purification step can be, e.g., based
on the peptide tag of a protein component (for a more detailed
description of the use of peptide tags in protein purification see
below) or an affinity purification using antibodies specific to the
protein component. Care should be taken that the antibodies to be
used for the purification of the complex are not directed to
epitopes that are located at the binding interface of the protein
component.
[0301] In certain embodiments, a complex of the invention is
purified via a protein tag that is fused to at least one of the
protein components of the complex. In more specific embodiments,
two protein components of a complex are fused to a peptide tag and
one protein component is fused to a peptide tag different from the
peptide tag to which the other protein component is fused. The
complex is first purified via the one and subsequently via the
other peptide tag to ensure that the purified complex is free from
any monomeric protein components.
[0302] A method that is generally applicable to purifying a protein
component that is fused to the constant regions of immunoglobulin
or a complex that comprises a component that is fused to the
constant regions of immunoglobulin is protein A affinity
chromatography, a technique that is well known in the art.
Staphylococcus protein A is a 42 kD polypeptide that binds
specifically to a region located between the second and third
constant regions of heavy chain immunoglobulins. Because of the Fc
domains of different classes, subclasses and species of
immunoglobulins, affinity of protein A for human Fc regions is
strong, but may vary with other species. Subclasses that are less
preferred include human IgG-3, and most rat subclasses. For certain
subclasses, protein G (of Streptococci) may be used in place of
protein A in the purification. Protein-A sepharose (Pharmacia or
Biorad) is a commonly used solid phase for affinity purification of
antibodies, and can be used essentially in the same manner for the
purification of a protein component fused to an immunoglobulin Fc
fragment. The protein component that is fused to the constant
regions of immunoglobulin or a complex that comprises a component
that is fused to the constant regions of immunoglobulin binds
specifically to protein A on the solid phase, while the
contaminants are washed away. Bound protein component that is fused
to the constant regions of immunoglobulin or a complex that
comprises a component that is fused to the constant regions of
immunoglobulin can be eluted by various buffer systems known in the
art, including a succession of citrate, acetate and glycine-HCl
buffers which gradually lowers the pH. This method is less
preferred if the recombinant cells also produce antibodies which
will be copurified with the protein component that is fused to the
constant regions of immunoglobulin or a complex that comprises a
component that is fused to the constant regions of immunoglobulin.
See, for example, Langone, 1982, J. Immmunol. meth. 51:3; Wilchek
et al., 1982, Biochem. Intl. 4:629; Sjobring et al., 1991, J. Biol.
Chem. 26:399; page 617-618, in Antibodies A Laboratory Manual,
edited by Harlow and Lane, Cold Spring Harbor laboratory, 1988.
[0303] Alternatively, a polyhistidine tag may be used, in which
case, the protein component that is fused to the polyhistidine tag
or a complex that comprises a component that is fused to the
polyhistidine tag can be purified by metal chelate chromatography.
The polyhistidine tag, usually a sequence of six histidines, has a
high affinity for divalent metal ions, such as nickel ions
(Ni.sup.2+), which can be immobilized on a solid phase, such as
nitrilotriacetic acid-matrices. Polyhistidine has a well
characterized affinity for Ni.sup.2+-NTA-agarose, and can be eluted
with either of two mild treatments: imidazole (0.1-0.2 M) will
effectively compete with the resin for binding sites; or lowering
the pH just below 6.0 will protonate the histidine sidechains and
disrupt the binding. The purification method comprises loading the
cell culture supernatant onto the Ni.sup.2+-NTA-agarose column,
washing the contaminants through, and eluting the protein component
that is fused to the polyhistidine tag or a complex that comprises
a component that is fused to the polyhistidine tag with imidazole
or weak acid. Ni.sup.2+-NTA-agarose can be obtained from commercial
suppliers such as Sigma (St. Louis) and Qiagen. Antibodies that
recognize the polyhistidine tag are also available which can be
used to detect and quantitate the protein component that is fused
to the polyhistidine tag or a complex that comprises a component
that is fused to the polyhistidine tag.
[0304] Another exemplary peptide tag that can be used is the
glutathione-S-transferase (GST) sequence, originally cloned from
the helminth, Schistosoma japonicum. In general, a protein
component-GST fusion or a complex comprising a protein
component-GST fusion expressed in a host cell can be purified from
the cell culture supernatant by absorption with glutathione agarose
beads, followed by elution in the presence of free reduced
glutathione at neutral pH. Denaturing conditions are not required
at any stage during purification, and therefore, it may be
desirable for the purification of the complex. Moreover, since GST
is known to form dimers under certain conditions, dimeric protein
components may be obtained. See, Smith, 1993, Methods Mol. Cell
Bio. 4:220-229.
[0305] Another useful peptide tag that can be used is the maltose
binding protein (MBP) of E. coli, which is encoded by the malE
gene. The protein component-MBP fusion protein or the complex
comprising a component-MPP fusion protein binds to amylose resin
while contaminants are washed away. The bound modified protein
component-MBP is eluted from the amylose resin by maltose. See, for
example, Guan et al., 1987, Gene 67:21-30.
[0306] The second approach for purifying protein component fusion
proteins is applicable to peptide tags that contain an epitope for
which polyclonal or monoclonal antibodies are available. Various
methods known in the art for purification of protein by
immunospecific binding, such as immunoaffinity chromatography, and
immunoprecipitation, can be used. See, for example, Chapter 13 in
Antibodies A Laboratory Manual, edited by Harlow and Lane, Cold
Spring Harbor laboratory, 1988; and Chapter 8, Sections I and II,
in Current Protocols in Immunology, ed. by Coligan et al., John
Wiley, 1991; the disclosure of which are both incorporated by
reference herein.
[0307] A protein component of a complex of the invention can also
be purified by immunoaffinity chromatography or immunoprecipitation
using antibodies that are specific to the component. Likewise, a
complex of the invention can be purified by immunoaffinity
chromatography or immunoprecipitation using antibodies that bind to
at least one of the components of the complex. In a specific
embodiment, a complex of the invention can be purified by
immunoaffmity chromatography or immunoprecipitation using
antibodies that are specific to the complex.
[0308] 4.4 Antibodies of the Invention
[0309] The present invention provides antibodies or fragments
thereof that immunospecifically bind to a complex of the invention,
to Sen2, to Sen15, to Sen34, to Sen54, or to Sen2deltaEx8.
[0310] According to the present invention, a protein complex of the
present invention as described in section 4.2 or Sen2, Sen15,
Sen34, Sen54, or Sen2deltaEx8 can be used as an immunogen to
generate antibodies which immunospecifically bind such immunogen.
In certain embodiments, the immunogen is a complex of the
invention, wherein the protein components of the complex are
covalently linked to each other. In certain embodiments of the
invention, the affinity of an antibody that binds to a complex of
the invention is higher than the affinity of the antibody to any of
the components of the complex individually. In certain embodiments
of the invention, the affinity of an antibody that binds to a
complex of the invention is at least 2 times, at least 5 times, at
least 10 times, at least 100 times, at least 1,000 times, at least
10,000 times or at least 100,000 times higher than the affinity of
the antibody to any of the components of the complex individually.
In certain embodiments of the invention, the affinity of an
antibody that binds to a complex of the invention is at most 2
times, at most 5 times, at most 10 times, at most 100 times, at
most 1,000 times, at most 10,000 times or at most 100,000 times
higher than the affinity of the antibody to any of the components
of the complex individually. In a specific embodiment, the antibody
specific to the complex and the antibody does not bind the
individual protein components of the complex. The binding affinity
of an antibody to an antigen, such as the complex or a protein
component, can be determined by any method described herein (e.g.,
the BIAcore assay) or known to the skilled artisan (see, e.g., van
Cott et al., 1992, Real-time biospecific interaction analysis of
antibody reactivity to peptides from the envelope glycoprotein,
gp160, of HIV-1, J Immunol Methods 146(2):163-76).
[0311] According to the present invention, Sen2.DELTA.Ex8 as
described in section 4.1 can be used as an immunogen to generate
antibodies which immunospecifically bind such immunogen.
[0312] In a preferred embodiment, an antibody of the invention
immuno-specifically binds to Sen2deltaEx8 but not to Sen2. In
certain embodiments of the invention, the affinity of an antibody
that binds to Sen2deltaEx8 is higher than the affinity of the
antibody to Sen2. In certain embodiments of the invention, the
affinity of an antibody that binds to Sen2deltaEx8 is at least 2
times, at least 5 times, at least 10 times, at least 100 times, at
least 1,000 times, at least 10,000 times or at least 100,000 times
higher than the affinity of the antibody to Sen2. In certain
embodiments of the invention, the affinity of an antibody that
binds to Sen2deltaEx8 is at most 2 times, at most 5 times, at most
10 times, at most 100 times, at most 1,000 times, at most 10,000
times or at most 100,000 times higher than the affinity of the
antibody to Sen2. In accordance with these embodiments, the
affinity of the antibody may be determined utilizing methods
described herein or known in the art (e.g., the BIAcore Assay).
[0313] Such antibodies include, but are not limited to, polyclonal,
monoclonal, chimeric, single chain, Fab fragments, and an Fab
expression library. In a specific embodiment, antibodies to a
complex comprising human protein components are produced. In
another embodiment, a complex formed from a fragment of said first
protein component and a fragment of said second protein component,
which fragments contain the protein domain that interacts with the
other component of the complex, are used as an immunogen for
antibody production.
[0314] The antibodies that immunospecifically bind to an antigen
can be produced by any method known in the art for the synthesis of
antibodies, in particular, by chemical synthesis or preferably, by
recombinant expression techniques.
[0315] Polyclonal antibodies immunospecific for an antigen can be
produced by various procedures well-known in the art. For example,
the antigen (i.e., a complex of the invention or a component of a
complex of the invention) can be administered to various host
animals including, but not limited to, rabbits, mice, rats, etc. to
induce the production of sera containing polyclonal antibodies
specific for the human antigen. Various adjuvants may be used to
increase the immunological response, depending on the host species,
and include but are not limited to, Freund's (complete and
incomplete), mineral gels such as aluminum hydroxide, surface
active substances such as lysolecithin, pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and potentially useful human adjuvants such as BCG
(bacille Calmette-Guerin) and corynebacterium parvum. Such
adjuvants are also well known in the art.
[0316] Monoclonal antibodies can be prepared using a wide variety
of techniques known in the art including the use of hybridoma,
recombinant, and phage display technologies, or a combination
thereof. For example, monoclonal antibodies can be produced using
hybridoma techniques including those known in the art and taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et
al., in: Monoclonal Antibodies and T Cell Hybridomas 563 681
(Elsevier, N.Y., 1981) (said references incorporated by reference
in their entireties). The term "monoclonal antibody" as used herein
is not limited to antibodies produced through hybridoma technology.
The term "monoclonal antibody" refers to an antibody that is
derived from a single clone, including any eukaryotic, prokaryotic,
or phage clone, and not the method by which it is produced.
[0317] Methods for producing and screening for specific antibodies
using hybridoma technology are routine and well known in the art.
Briefly, mice can be immunized with a non-murine antigen and once
an immune response is detected, e.g., antibodies specific for the
antigen are detected in the mouse serum, the mouse spleen is
harvested and splenocytes isolated. The splenocytes are then fused
by well known techniques to any suitable myeloma cells, for example
cells from cell line SP20 available from the ATCC. Hybridomas are
selected and cloned by limited dilution. The hybridoma clones are
then assayed by methods known in the art for cells that secrete
antibodies capable of binding a polypeptide of the invention.
Ascites fluid, which generally contains high levels of antibodies,
can be generated by immunizing mice with positive hybridoma
clones.
[0318] The present invention provides methods of generating
monoclonal antibodies as well as antibodies produced by the method
comprising culturing a hybridoma cell secreting an antibody of the
invention wherein, preferably, the hybridoma is generated by fusing
splenocytes isolated from a mouse immunized with a non-murine
antigen with myeloma cells and then screening the hybridomas
resulting from the fusion for hybridoma clones that secrete an
antibody able to bind to the antigen.
[0319] Antibody fragments which recognize specific particular
epitopes may be generated by any technique known to those of skill
in the art. For example, Fab and F(ab')2 fragments of the invention
may be produced by proteolytic cleavage of immunoglobulin
molecules, using enzymes such as papain (to produce Fab fragments)
or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments contain
the variable region, the light chain constant region and the CH1
domain of the heavy chain. Further, the antibodies of the present
invention can also be generated using various phage display methods
known in the art.
[0320] In phage display methods, functional antibody domains are
displayed on the surface of phage particles which carry the
polynucleotide sequences encoding them. In particular, DNA
sequences encoding VH and VL domains are amplified from animal cDNA
libraries (e.g., human or murine cDNA libraries of affected
tissues). The DNA encoding the VH and VL domains are recombined
together with an scFv linker by PCR and cloned into a phagemid
vector. The vector is electroporated in E. coli and the E. coli is
infected with helper phage. Phage used in these methods are
typically filamentous phage including fd and M13 and the VH and VL
domains are usually recombinantly fused to either the phage gene
III or gene VIII. Phage expressing an antigen binding domain that
binds to a particular antigen can be selected or identified with
antigen, e.g., using labeled antigen or antigen bound or captured
to a solid surface or bead. Examples of phage display methods that
can be used to make the antibodies of the present invention include
those disclosed in Brinkman et al., 1995, J. Immunol. Methods
182:41-50; Ames et al., 1995, J. Immunol. Methods 184:177-186;
Kettleborough et al., 1994, Eur. J. Immunol. 24:952-958; Persic et
al., 1997, Gene 187:9-18; Burton et al., 1994, Advances in
Immunology 57:191-280; International application No. PCT/GB91/O1
134; International publication Nos. WO 90/02809, WO 91/10737, WO
92/01047, WO 92/18619, WO 93/11236, WO 95/15982, WO 95/20401, and
WO97/13844; and U.S. Pat. Nos. 5,698,426, 5,223,409, 5,403,484,
5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698, 5,427,908,
5,516,637, 5,780,225, 5,658,727, 5,733,743 and 5,969,108; each of
which is incorporated herein by reference in its entirety.
[0321] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described below. Techniques to
recombinantly produce Fab, Fab' and F(ab')2 fragments can also be
employed using methods known in the art such as those disclosed in
PCT publication No. WO 92/22324; Mullinax et al., 1992,
BioTechniques 12(6):864-869; Sawai et al., 1995, AJRI 34:26-34; and
Better et al., 1988, Science 240:1041-1043 (said references
incorporated by reference in their entireties).
[0322] To generate whole antibodies, PCR primers including VH or VL
nucleotide sequences, a restriction site, and a flanking sequence
to protect the restriction site can be used to amplify the VH or VL
sequences in scFv clones. Utilizing cloning techniques known to
those of skill in the art, the PCR amplified VH domains can be
cloned into vectors expressing a VH constant region, e.g., the
human gamma 4 constant region, and the PCR amplified VL domains can
be cloned into vectors expressing a VL constant region, e.g., human
kappa or lamba constant regions. Preferably, the vectors for
expressing the VH or VL domains comprise an EF-1.alpha. promoter, a
secretion signal, a cloning site for the variable domain, constant
domains, and a selection marker such as neomycin. The VH and VL
domains may also cloned into one vector expressing the necessary
constant regions. The heavy chain conversion vectors and light
chain conversion vectors are then co-transfected into cell lines to
generate stable or transient cell lines that express full-length
antibodies, e.g., IgG, using techniques known to those of skill in
the art.
[0323] For some uses, including in vivo use of antibodies in humans
and in vitro detection assays, it may be preferable to use
humanized antibodies or chimeric antibodies. Completely human
antibodies and humanized antibodies are particularly desirable for
therapeutic treatment of human subjects. Human antibodies can be
made by a variety of methods known in the art including phage
display methods described above using antibody libraries derived
from human immunoglobulin sequences. See also U.S. Pat. Nos.
4,444,887 and 4,716,111; and International publication Nos. WO
98/46645, WO 98/50433, WO 98/24893, W098/16654, WO 96/34096, WO
96/33735, and WO 91/10741; each of which is incorporated herein by
reference in its entirety.
[0324] Human antibodies can also be produced using transgenic mice
which are incapable of expressing functional endogenous
immunoglobulins, but which can express human immunoglobulin genes.
For example, the human heavy and light chain immunoglobulin gene
complexes may be introduced randomly or by homologous recombination
into mouse embryonic stem cells. Alternatively, the human variable
region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin
genes may be rendered non functional separately or simultaneously
with the introduction of human immunoglobulin loci by homologous
recombination. In particular, homozygous deletion of the JH region
prevents endogenous antibody production. The modified embryonic
stem cells are expanded and microinjected into blastocysts to
produce chimeric mice. The chimeric mice are then be bred to
produce homozygous offspring which express human antibodies. The
transgenic mice are immunized in the normal fashion with a selected
antigen, e.g., all or a portion of a polypeptide of the invention.
Monoclonal antibodies directed against the antigen can be obtained
from the immunized, transgenic mice using conventional hybridoma
technology. The human immunoglobulin transgenes harbored by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar,
1995, Int. Rev. Immnunol. 13:65 93. For a detailed discussion of
this technology for producing human antibodies and human monoclonal
antibodies and protocols for producing such antibodies, see, e.g.,
International publication Nos. WO 98/24893, WO 96/34096, and WO
96/33735; and U.S. Pat. Nos. 5,413,923, 5,625,126, 5,633,425,
5,569,825, 5,661,016, 5,545,806, 5,814,318, and 5,939,598, which
are incorporated by reference herein in their entirety. In
addition, companies such as Abgenix, Inc. (Freemont, Calif.) and
Genpharm (San Jose, Calif.) can be engaged to provide human
antibodies directed against a selected antigen using technology
similar to that described above.
[0325] A chimeric antibody is a molecule in which different
portions of the antibody are derived from different immunoglobulin
molecules. Methods for producing chimeric antibodies are known in
the art. See e.g., Morrison, 1985, Science 229:1202; Oi et al.,
1986, BioTechniques 4:214; Gillies et al., 1989, J. Immunol.
Methods 125:191-202; and U.S. Pat. Nos. 5,807,715, 4,816,567,
4,816,397, and 6,311,415, which are incorporated herein by
reference in their entirety.
[0326] A humanized antibody is an antibody or its variant or
fragment thereof which is capable of binding to a predetermined
antigen and which comprises a framework region having substantially
the amino acid sequence of a human immunoglobulin and a CDR having
substantially the amino acid sequence of a non-human immuoglobulin.
A humanized antibody comprises substantially all of at least one,
and typically two, variable domains (Fab, Fab', F(ab').sub.2, Fabc,
Fv) in which all or substantially all of the CDR regions correspond
to those of a non human immunoglobulin (ie., donor antibody) and
all or substantially all of the framework regions are those of a
human immunoglobulin consensus sequence. Preferably, a humanized
antibody also comprises at least a portion of an immunoglobulin
constant region (Fc), typically that of a human immunoglobulin.
Ordinarily, the antibody will contain both the light chain as well
as at least the variable domain of a heavy chain. The antibody also
may include the CH1, hinge, CH2, CH3, and CH4 regions of the heavy
chain. The humanized antibody can be selected from any class of
immunoglobulins, including IgM, IgG, IgD, IgA and IgE, and any
isotype, including IgG1, IgG2, IgG3 and IgG4. Usually the constant
domain is a complement fixing constant domain where it is desired
that the humanized antibody exhibit cytotoxic activity, and the
class is typically IgG1. Where such cytotoxic activity is not
desirable, the constant domain may be of the IgG2 class. The
humanized antibody may comprise sequences from more than one class
or isotype, and selecting particular constant domains to optimize
desired effector functions is within the ordinary skill in the art.
The framework and CDR regions of a humanized antibody need not
correspond precisely to the parental sequences, e.g., the donor CDR
or the consensus framework may be mutagenized by substitution,
insertion or deletion of at least one residue so that the CDR or
framework residue at that site does not correspond to either the
consensus or the import antibody. Such mutations, however, will not
be extensive. Usually, at least 75% of the humanized antibody
residues will correspond to those of the parental framework and CDR
sequences, more often 90%, and most preferably greater than 95%. A
humanized antibody can be produced using variety of techniques
known in the art, including but not limited to, CDR-grafting (see
e.g., European Patent No. EP 239,400; International Publication No.
WO 91/09967; and U.S. Pat. Nos. 5,225,539, 5,530,101, and
5,585,089, each of which is incorporated herein in its entirety by
reference), veneering or resurfacing (see e.g., European Patent
Nos. EP 592,106 and EP 519,596; Padlan, 1991, Molecular Immunology
28(4/5):489-498; Studnicka et al., 1994, Protein Engineering
7(6):805-814; and Roguska et al., 1994, PNAS 91:969-973, each of
which is incorporated herein by its entirety by reference), chain
shuffling (see e.g., U.S. Pat. No. 5,565,332, which is incorporated
herein in its entirety by reference), and techniques disclosed in,
e.g., U.S. Pat. No. 6,407,213, U.S. Pat. No. 5,766,886,
International Publication No. WO 9317105, Tan et al., J. Immunol.
169:1119 25 (2002), Caldas etal., Protein Eng. 13(5):353 60 (2000),
Morea et al., Methods 20(3):267 79 (2000), Baca et al., J. Biol.
Chem. 272(16):10678 84 (1997), Roguska et al., Protein Eng.
9(10):895 904 (1996), Couto et al., Cancer Res. 55 (23
Supp):5973s-5977s (1995), Couto et al., Cancer Res. 55(8):1717 22
(1995), Sandhu J S, Gene 150(2):409 10 (1994), and Pedersen et al.,
J. Mol. Biol. 235(3):959 73 (1994), each of which is incorporated
herein in its entirety by reference. Often, framework residues in
the framework regions will be substituted with the corresponding
residue from the CDR donor antibody to alter, preferably improve,
antigen binding. These framework substitutions are identified by
methods well known in the art, e.g. by modeling of the interactions
of the CDR and framework residues to identify framework residues
important for antigen binding and sequence comparison to identify
unusual framework residues at particular positions. (See, e.g.,
Queen et al., U.S. Pat. No. 5,585,089; and Riechmann et al., 1988,
Nature 332:323, which are incorporated herein by reference in their
entireties.)
[0327] Further, the antibodies that immunospecifically bind to a
complex of the invention or a component of a complex of the
invention, in turn, be utilized to generate anti-idiotype
antibodies that "mimic" an antigen using techniques well known to
those skilled in the art. (See, e.g., Greenspan & Bona, 1989,
FASEB J. 7(5):437-444; and Nissinoff, 1991, J. Immunol.
147(8):2429-2438).
[0328] 4.4.1 Polynucleotide Sequences Encoding an Antibody
[0329] The invention provides polynucleotides comprising a
nucleotide sequence encoding an antibody or fragment thereof that
immunospecifically binds to a complex of the invention or a
component of a complex of the invention. The invention also
encompasses polynucleotides that hybridize under high stringency,
intermediate or lower stringency hybridization conditions, e.g., as
defined supra, to polynucleotides that encode an antibody of the
invention.
[0330] The polynucleotides may be obtained, and the nucleotide
sequence of the polynucleotides determined, by any method known in
the art. The nucleotide sequence of antibodies immunospecific for a
desired antigen can be obtained, e.g., from the literature or a
database such as GenBank. Such a polynucleotide encoding the
antibody may be assembled from chemically synthesized
oligonucleotides (e.g., as described in Kutmeier et al., 1994,
BioTechniques 17:242), which, briefly, involves the synthesis of
overlapping oligonucleotides containing portions of the sequence
encoding the antibody, annealing and ligating of those
oligonucleotides, and then amplification of the ligated
oligonucleotides by PCR.
[0331] Alternatively, a polynucleotide encoding an antibody may be
generated from nucleic acid from a suitable source. If a clone
containing a nucleic acid encoding a particular antibody is not
available, but the sequence of the antibody molecule is known, a
nucleic acid encoding the immunoglobulin may be chemically
synthesized or obtained from a suitable source (e.g., an antibody
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A+RNA, isolated from, any tissue or cells
expressing the antibody, such as hybridoma cells selected to
express an antibody of the invention) by PCR amplification using
synthetic primers hybridizable to the 3' and 5' ends of the
sequence or by cloning using an oligonucleotide probe specific for
the particular gene sequence to identify, e.g., a cDNA clone from a
cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR may then be cloned into replicable cloning vectors
using any method well known in the art.
[0332] Once the nucleotide sequence of the antibody is determined,
the nucleotide sequence of the antibody may be manipulated using
methods well known in the art for the manipulation of nucleotide
sequences, e.g., recombinant DNA techniques, site directed
mutagenesis, PCR, etc. (see, for example, the techniques described
in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual,
2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and
Ausubel et al., eds., 1998, Current Protocols in Molecular Biology,
John Wiley & Sons, NY, which are both incorporated by reference
herein in their entireties), to generate antibodies having a
different amino acid sequence, for example to create amino acid
substitutions, deletions, and/or insertions.
[0333] In a specific embodiment, one or more of the CDRs is
inserted within framework regions using routine recombinant DNA
techniques. The framework regions may be naturally occurring or
consensus framework regions, and preferably human framework regions
(see, e.g., Chothia et al., 1998, J. Mol. Biol. 278: 457-479 for a
listing of human framework regions). Preferably, the polynucleotide
generated by the combination of the framework regions and CDRs
encodes an antibody that immunospecifically binds to a particular
antigen. Preferably, as discussed supra, one or more amino acid
substitutions may be made within the framework regions, and,
preferably, the amino acid substitutions improve binding of the
antibody to its antigen. Additionally, such methods may be used to
make amino acid substitutions or deletions of one or more variable
region cysteine residues participating in an intrachain disulfide
bond to generate antibody molecules lacking one or more intrachain
disulfide bonds. Other alterations to the polynucleotide are
encompassed by the present invention and within the skill of the
art.
[0334] 4.4.2 Recombinant Expression of an Antibody
[0335] Recombinant expression of an antibody of the invention,
derivative, analog or fragement thereof, (e.g., a heavy or light
chain of an antibody of the invention or a portion thereof or a
single chain antibody of the invention), requires construction of
an expression vector containing a polynucleotide that encodes the
antibody. Once a polynucleotide encoding an antibody molecule or a
heavy or light chain of an antibody, or portion thereof
(preferably, but not necessarily, containing the heavy or light
chain variable domain), of the invention has been obtained, the
vector for the production of the antibody molecule may be produced
by recombinant DNA technology using techniques well-known in the
art. See, e.g., U.S. Pat. No. 6,331,415, which is incorporated
herein by reference in its entirety. Thus, methods for preparing a
protein by expressing a polynucleotide containing an antibody
encoding nucleotide sequence are described herein. Methods which
are well known to those skilled in the art can be used to construct
expression vectors containing antibody coding sequences and
appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of
the invention, a heavy or light chain of an antibody, a heavy or
light chain variable domain of an antibody or a portion thereof, or
a heavy or light chain CDR, operably linked to a promoter. Such
vectors may include the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., International
Publication No. WO 86/05807 and WO 89/01036; and U.S. Pat. No.
5,122,464) and the variable domain of the antibody may be cloned
into such a vector for expression of the entire heavy, the entire
light chain, or both the entire heavy and light chains.
[0336] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the invention.
Thus, the invention includes host cells containing a polynucleotide
encoding an antibody of the invention or fragments thereof, or a
heavy or light chain thereof, or portion thereof, or a single chain
antibody of the invention, operably linked to a heterologous
promoter. In preferred embodiments for the expression of
double-chained antibodies, vectors encoding both the heavy and
light chains may be co-expressed in the host cell for expression of
the entire immunoglobulin molecule, as detailed below.
[0337] A variety of host-expression vector systems may be utilized
to express the antibody molecules of the invention (see, e.g., U.S.
Pat. No. 5,807,715). Such host-expression systems represent
vehicles by which the coding sequences of interest may be produced
and subsequently purified, but also represent cells which may, when
transformed or transfected with the appropriate nucleotide coding
sequences, express an antibody molecule of the invention in situ.
These include but are not limited to microorganisms such as
bacteria (e.g., E. coli and B. subtilis) transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing antibody coding sequences; yeast (e.g.,
Saccharomyces Pichia) transformed with recombinant yeast expression
vectors containing antibody coding sequences; insect cell systems
infected with recombinant virus expression vectors (e.g.,
baculovirus) containing antibody coding sequences; plant cell
systems infected with recombinant virus expression vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed with recombinant plasmid expression vectors (e.g., Ti
plasmid) containing antibody coding sequences; or mammalian cell
systems (e.g., COS, CHO, BHK, 293, NS0, and 3T3 cells) harboring
recombinant expression constructs containing promoters derived from
the genome of mammalian cells (e.g., metallothionein promoter) or
from mammalian viruses (e.g., the adenovirus late promoter; the
vaccinia virus 7.5K promoter). Preferably, bacterial cells such as
Escherichia coli, and more preferably, eukaryotic cells, especially
for the expression of whole recombinant antibody molecule, are used
for the expression of a recombinant antibody molecule. For example,
mammalian cells such as Chinese hamster ovary cells (CHO), in
conjunction with a vector such as the major intermediate early gene
promoter element from human cytomegalovirus is an effective
expression system for antibodies (Foecking et al., 1986, Gene
45:101; and Cockett et al., 1990, Bio/Technology 8:2).
[0338] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such an antibody is to be produced, for the generation
of pharmaceutical compositions of an antibody molecule, vectors
which direct the expression of high levels of fusion protein
products that are readily purified may be desirable. Such vectors
include, but are not limited to, the E. coli expression vector
pUR278 (Ruther et al., 1983, EMBO 12:1791), in which the antibody
coding sequence may be ligated individually into the vector in
frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids
Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
24:5503-5509); and the like. pGEX vectors may also be used to
express foreign polypeptides as fusion proteins with glutathione
5-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to matrix glutathione agarose beads followed by elution in
the presence of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that the
cloned target gene product can be released from the GST moiety.
[0339] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter).
[0340] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the antibody coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the
antibody molecule in infected hosts (e.g., see Logan & Shenk,
1984, Proc. Natl. Acad. Sci. USA 8 1:355-359). Specific initiation
signals may also be required for efficient translation of inserted
antibody coding sequences. These signals include the ATG initiation
codon and adjacent sequences. Furthermore, the initiation codon
must be in phase with the reading frame of the desired coding
sequence to ensure translation of the entire insert. These
exogenous translational control signals and initiation codons can
be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see, e.g., Bittner et al., 1987, Methods in
Enzymol. 153:51-544).
[0341] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERY, BHK, Hela,
COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT2O and T47D, NS0
(a murine myeloma cell line that does not endogenously produce any
immunoglobulin chains), CRL7O3O and HsS78Bst cells.
[0342] For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell lines
which stably express the antibody molecule may be engineered.
Rather than using expression vectors which contain viral origins of
replication, host cells can be transformed with DNA controlled by
appropriate expression control elements (e.g., promoter, enhancer,
sequences, transcription terminators, polyadenylation sites, etc.),
and a selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in an
enriched media, and then are switched to a selective media. The
selectable marker in the recombinant plasmid confers resistance to
the selection and allows cells to stably integrate the plasmid into
their chromosomes and grow to form foci which in turn can be cloned
and expanded into cell lines. This method may advantageously be
used to engineer cell lines which express the antibody molecule.
Such engineered cell lines may be particularly useful in screening
and evaluation of compositions that interact directly or indirectly
with the antibody molecule.
[0343] A number of selection systems may be used, including but not
limited to, the herpes simplex virus thymidine kinase (Wigler et
a., 1977, Cell 11:223), hypoxanthineguanine
phosphoribosyltransferase (Szybalska & Szyalski, 1992, Proc.
Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase
(Lowy et al., 1980, Cell 22:8-17) genes can be employed in tk-,
hgprt- or aprt-cells, respectively. Also, antimetabolite resistance
can be used as the basis of selection for the following genes:
dhfr, which confers resistance to methotrexate (Wigler et al.,
1980, Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl.
Acad. Sci. USA 78:1527); gpt, which confers resistance to
mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad.
Sci. USA 78:2072); neo, which confers resistance to the
aminoglycoside G-418 (Wu and Wu, 1991, Biotherapy 3:87-95;
Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596;
Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993,
Ann. Rev. Biochem. 62: 191-217; May, 1993, TIB TECH 11(5):155-2
15); and hygro, which confers resistance to hygromycin (Santerre et
al., 1984, Gene 30:147). Methods commonly known in the art of
recombinant DNA technology may be routinely applied to select the
desired recombinant clone, and such methods are described, for
example, in Ausubel et al., (eds.), Current Protocols in Molecular
Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer
and Expression, A Laboratory Manual, Stockton Press, NY (1990); and
in Chapters 12 and 13, Dracopoli et al., (eds), Current Protocols
in Human Genetics, John Wiley & Sons, NY (1994);
Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1, which are
incorporated by reference herein in their entireties.
[0344] The expression levels of an antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning,
Vol.3. (Academic Press, New York, 1987)). When a marker in the
vector system expressing antibody is amplifiable, increase in the
level of inhibitor present in culture of host cell will increase
the number of copies of the marker gene. Since the amplified region
is associated with the antibody gene, production of the antibody
will also increase (Crouse et al., 1983, Mol. Cell. Biol.
3:257).
[0345] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes, and is capable of expressing, both heavy and light
chain polypeptides. In such situations, the light chain should be
placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, 1986, Nature 322:52; and Kohler, 1980,
Proc. Natl. Acad. Sci. USA 77:2 197). The coding sequences for the
heavy and light chains may comprise cDNA or genomic DNA.
[0346] Once an antibody molecule of the invention has been produced
by recombinant expression, it may be purified by any method known
in the art for purification of an immunoglobulin molecule, for
example, by chromatography (e.g., ion exchange, affinity,
particularly by affinity for the specific antigen after Protein A,
and sizing column chromatography), centrifugation, differential
solubility, or by any other standard technique for the purification
of proteins. Further, the antibodies of the present invention or
fragments thereof may be fused to heterologous polypeptide
sequences described herein or otherwise known in the art to
facilitate purification.
[0347] 4.4.3 Immunological Methods Using the Antibodies of the
Invention
[0348] The antibodies of the invention can be used with any method
known to the skilled artisan. In certain embodiments, an antibody
of the invention is used to detect or quantify a complex of the
invention or a component of a complex of the invention. To this
end, Western blot analyses, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, or fluorescent immunoassays can
be performed using an antibody of the invention.
[0349] The affinity of an antibody to its antigen can be measured
by using, e.g, a Biacore.RTM. assay.
[0350] 4.5 Screening Methods
[0351] 4.5.1 Modulators of Complex Formation
[0352] A complex of the present invention, the component proteins
of the complex and nucleic acids encoding the component proteins,
as well as derivatives and fragments of the amino and nucleic
acids, can be used to screen for compounds that bind to, or
modulate the amount of, activity of, or protein component
composition of, said complex, and thus, have potential use as
modulators, i.e., agonists or antagonists, of complex activity,
and/or complex formation, i.e., the amount of complex formed,
and/or protein component composition of the complex.
[0353] Thus, the present invention is also directed to methods for
screening for molecules that bind to, or modulate the amount of,
activity of, or protein component composition of, a complex of the
present invention. In one embodiment of the invention, the method
for screening for a molecule that modulates directly or indirectly
the function, activity or formation of a complex of the present
invention comprises exposing said complex, or a cell or organism
containing the complex machinery, to one or more compounds under
conditions conducive to modulation; and determining the amount of,
activity of, or identities of the protein components of said
complex, wherein a change in said amount, activity, or identities
relative to said amount, activity or identities in the absence of
said compounds indicates that the compounds modulate function,
activity or formation of said complex. Such screening assays can be
carried out using cell-free and cell-based methods that are
commonly known in the art.
[0354] The present invention is further directed to methods for for
screening for molecules that modulate the expression of a component
of a complex of the present invention, such as, e.g., Sen2deltaEx8.
In one embodiment of the invention, the method for screening for a
molecule that modulates the expression of a component of a complex
of the invention comprises exposing a cell or organism containing
the nucleic acid encoding the component, to one or more compounds
under conditions conducive to modulation; and determining the
amount of, activity of, or identities of the protein components of
said complex, wherein a change in said amount, activity, or
identities relative to said amount, activity or identities in the
absence of said compounds indicates that the compounds modulate
expression of said complex. Such screening assays can be carried
out using cell-free and cell-based methods that are commonly known
in the art. If activity of the complex or component is used as
read-out of the assay, subsequent assays, such as Western blot
analysis or Northern blot analysis, may be performed to verify that
the modulated expression levels of the component are responsible
for the modulated activity.
[0355] Screening the libraries can be accomplished by any of a
variety of commonly known methods. See, e.g., the following
references, which disclose screening of peptide libraries: Parmley
and Smith, 1989, Adv. Exp. Med. Biol. 251:215-218; Scott and Smith,
1990, Science 249:386-390; Fowlkes et al., 1992, BioTechniques
13:422-427; Oldenburg et al., 1992, Proc. Natl. Acad. Sci. USA
89:5393-5397; Yu et al., 1994, Cell 76:933-945; Staudt et al.,
1988, Science 241:577-580; Bock et al., 1992, Nature 355:564-566;
Tuerk et al., 1992, Proc. Natl. Acad. Sci. USA 89:6988-6992;
Ellington et al., 1992, Nature 355:850-852; U.S. Pat. No.
5,096,815, U.S. Pat. No. 5,223,409, and U.S. Pat. No. 5,198,346,
all to Ladner et al.; Rebar and Pabo, 1993, Science 263:671-673;
and International Patent Publication No. WO 94/18318.
[0356] In a specific embodiment, fragments and/or analogs of
protein components of a complex, especially peptidomimetics, are
screened for activity as competitive or non-competitive inhibitors
of complex formation, which thereby inhibit complex activity or
formation.
[0357] Methods for screening may involve labeling the component
proteins of the complex with radioligands (e.g., .sup.125I or
.sup.3H), magnetic ligands (e.g., paramagnetic beads covalently
attached to photobiotin acetate), fluorescent ligands (e.g.,
fluorescein or rhodamine), or enzyme ligands (e.g., luciferase or
beta-galactosidase). The reactants that bind in solution can then
be isolated by one of many techniques known in the art, including
but not restricted to, co-immunoprecipitation of the labeled
complex moiety using antisera against the unlabeled binding partner
(or labeled binding partner with a distinguishable marker from that
used on the second labeled complex moiety), immunoaffinity
chromatography, size exclusion chromatography, and gradient density
centrifugation. In a preferred embodiment, the labeled binding
partner is a small fragment or peptidomimetic that is not retained
by a commercially available filter. Upon binding, the labeled
species is then unable to pass through the filter, providing for a
simple assay of complex formation.
[0358] In certain embodiments, the protein components of a complex
of the invention are labeled with different fluorophores such that
binding of the components to each other results in FRET
(Fluorescence Resonance Energy Transfer). If the addition of a
compound results in a difference in FRET compared to FRET in the
absence of the compound, the compound is identified as a modulator
of complex formation. If FRET in the presence of the compound is
decreased in comparison to FRET in the absence of the compound, the
compound is identified as an inhibitor of complex formation. If
FRET in the presence of the compound is increased in comparison to
FRET in the absence of the compound, the compound is identified as
an activator of complex formation.
[0359] In certain other embodiments, a protein component of a
complex of the invention is labeled with a fluorophore such that
binding of the component to another protein component to form a
complex of the invention results in FP (Flourescence Polarization).
If the addition of a compound results in a difference in FP
compared to FP in the absence of the compound, the compound is
identified as a modulator of complex formation.
[0360] Methods commonly known in the art are used to label at least
one of the component members of the complex. Suitable labeling
methods include, but are not limited to, radiolabeling by
incorporation of radiolabeled amino acids, e.g., .sup.3H-leucine or
.sup.35S-methionine, radiolabeling by post-translational iodination
with .sup.125I or .sup.131I using the chloramine T method,
Bolton-Hunter reagents, etc., or labeling with .sup.32P using
phosphorylase and inorganic radiolabeled phosphorous, biotin
labeling with photobiotin-acetate and sunlamp exposure, etc. In
cases where one of the members of the complex is immobilized, e.g.,
as described in section 4.5.1.1, the free species is labeled. Where
neither of the interacting species is immobilized, each can be
labeled with a distinguishable marker such that isolation of both
moieties can be followed to provide for more accurate
quantification, and to distinguish the formation of homomeric from
heteromeric complexes. Methods that utilize accessory proteins that
bind to one of the modified components to improve the sensitivity
of detection, increase the stability of the complex, etc., are
provided.
[0361] The physical parameters of complex formation can be analyzed
by quantification of complex formation using assay methods specific
for the label used, e.g., liquid scintillation counting for
radioactivity detection, enzyme activity for enzyme-labeled
moieties, etc. The reaction results are then analyzed utilizing
Scatchard analysis, Hill analysis, and other methods commonly known
in the arts (see, e.g., Proteins, Structures, and Molecular
Principles, 2.sup.nd Edition (1993) Creighton, Ed., W. H. Freeman
and Company, New York).
[0362] Compounds to be screened can be provided as mixtures of a
limited number of specified compounds, or as compound libraries,
peptide libraries and the like. Agents/molecules/compounds to be
screened may also include all forms of antisera, antisense nucleic
acids, etc., that can modulate complex activity or formation.
Exemplary compounds and libraries for screening are set forth in
section 4.5.12.
[0363] In a specific embodiment of the invention, compounds are
identified that promote the formation of a complex comprising
Sen2.DELTA.Ex8, Clp1, Sen54, Sen15, and Sen34 instead of a complex
comprising Sen2.DELTA.Ex8, Clp1, Sen54, Sen15, Send34, CPSF, CFIm,
CFIIm and CstF. In certain embodiments, compounds are identified
that promote the formation of a Sen2.DELTA.Ex8 containing complex
but not the formation of a Sen2 containing complex. In certain
embodiments, compounds are identified that promote the formation of
a Sen2 containing complex but not the formation of a Sen2.DELTA.Ex8
containing complex.
[0364] In certain embodiments, the compounds are screened in pools.
Once a positive pool has been identified, the individual molecules
of that pool are tested separately. In certain embodiments, the
pool size is at least 2, at least 5, at least 10, at least 25, at
least 50, at least 75, at least 100, at least 150, at least 200, at
least 250, or at least 500 compounds.
[0365] In certain embodiments of the invention, the screening
method further comprises determining the structure of the candidate
molecule. The structure of a candidate molecule can be determined
by any technique known to the skilled artisan. Exemplary methods
are described in section 0.
[0366] 4.5.1.1 Cell-Free Assays
[0367] In certain embodiments, the method for identifying a
modulator of the formation or stability of a complex of the
invention can be carried out in vitro, particularly in a cell-free
system. In certain, more specific embodiments, the complex is
purified. In certain embodiments the candidate molecule is
purified.
[0368] In a specific embodiment, screening can be carried out by
contacting the library members with a complex immobilized on a
solid phase, and harvesting those library members that bind to the
protein (or encoding nucleic acid or derivative). Examples of such
screening methods, termed "panning" techniques, are described by
way of example in Parmley and Smith, 1988, Gene 73:305-318; Fowlkes
et al., 1992, BioTechniques 13:422-427; International Patent
Publication No. WO 94/18318; and in references cited
hereinabove.
[0369] In one embodiment, agents that modulate (i.e., antagonize or
agonize) complex activity or formation can be screened for using a
binding inhibition assay, wherein agents are screened for their
ability to modulate formation of a complex under aqueous, or
physiological, binding conditions in which complex formation occurs
in the absence of the agent to be tested. Agents that interfere
with the formation of complexes of the invention are identified as
antagonists of complex formation. Agents that promote the formation
of complexes are identified as agonists of complex formation.
Agents that completely block the formation of complexes are
identified as inhibitors of complex formation. In an exemplary
embodiment, the binding conditions are, for example, but not by way
of limitation, in an aqueous salt solution of 10-250 mM NaCl, 5-50
mM Tris-HCl, pH 5-8, and 0.5% Triton X-100 or other detergent that
improves specificity of interaction. Metal chelators and/or
divalent cations may be added to improve binding and/or reduce
proteolysis. Reaction temperatures may include 4, 10, 15, 22, 25,
35, or 42 degrees Celsius, and time of incubation is typically at
least 15 seconds, but longer times are preferred to allow binding
equilibrium to occur. Particular complexes can be assayed using
routine protein binding assays to determine optimal binding
conditions for reproducible binding.
[0370] In certain embodiments, another common approach to in vitro
binding assays is used. In this assay, one of the binding species
is immobilized on a filter, in a microtiter plate well, in a test
tube, to a chromatography matrix, etc., either covalently or
non-covalently. Proteins can be covalently immobilized using any
method well known in the art, for example, but not limited to the
method of Kadonaga and Tjian, 1986, Proc. Natl. Acad. Sci. USA
83:5889-5893, i.e., linkage to a cyanogen-bromide derivatized
substrate such as CNBr-Sepharose 4B (Pharmacia). Where needed, the
use of spacers can reduce steric hindrance by the substrate.
Non-covalent attachment of proteins to a substrate include, but are
not limited to, attachment of a protein to a charged surface,
binding with specific antibodies, binding to a third unrelated
interacting protein, etc.
[0371] Assays of agents (including cell extracts or a library pool)
for competition for binding of one member of a complex (or
derivatives thereof) with another member of the complex labeled by
any means (e.g., those means described above) are provided to
screen for competitors or enhancers of complex formation. In
specific embodiments, blocking agents to inhibit non-specific
binding of reagents to other protein components, or absorptive
losses of reagents to plastics, immobilization matrices, etc., are
included in the assay mixture. Blocking agents include, but are not
restricted to bovine serum albumin, beta-casein, nonfat dried milk,
Denhardt's reagent, Ficoll, polyvinylpyrolidine, nonionic
detergents (NP40, Triton X-100, Tween 20, Tween 80, etc.), ionic
detergents (e.g., SDS, LDS, etc.), polyethylene glycol, etc.
Appropriate blocking agent concentrations allow complex
formation.
[0372] After binding is performed, unbound, labeled protein is
removed in the supernatant, and the immobilized protein retaining
any bound, labeled protein is washed extensively. The amount of
bound label is then quantified using standard methods in the art to
detect the label.
[0373] In preferred embodiments, polypeptide derivatives that have
superior stabilities but retain the ability to form a complex
(e.g., one or more component proteins modified to be resistant to
proteolytic degradation in the binding assay buffers, or to be
resistant to oxidative degradation), are used to screen for
modulators of complex activity or formation. Such resistant
molecules can be generated, e.g., by substitution of amino acids at
proteolytic cleavage sites, the use of chemically derivatized amino
acids at proteolytic susceptible sites, and the replacement of
amino acid residues subject to oxidation, i.e. methionine and
cysteine.
[0374] 4.5.1.2 Cell-Based Assays
[0375] In certain embodiments, assays can be carried out using
recombinant cells expressing the protein components of a complex,
to screen for molecules that bind to, or interfere with, or promote
complex activity or formation. In certain embodiments, at least one
of the protein components is expressed in the recombinant cell as
fusion protein, wherein the protein component is fused to a peptide
tag to facilitate purification and subsequent quantification and/or
immunological visualization and quantification.
[0376] A particular aspect of the present invention relates to
identifying molecules that inhibit or promote formation or
degradation of a complex of the present invention, e.g., using the
method described for isolating the complex and identifying members
of the complex using the TAP assay described in WO 00/09716 and
Rigaut et al., 1999, Nature Biotechnology 17:1030-1032, which are
each incorporated by reference in their entireties.
[0377] In another embodiment of the invention, a modulator is
identified by administering a candidate molecule to a transgenic
non-human animal expressing the recombinant component proteins of a
complex of the invention. In certain embodiments, the complex
components are distinguishable from the homologous endogenous
protein components. In certain embodiments, the recombinant
component proteins are fusion proteins, wherein the protein
component is fused to a peptide tag. In certain embodiments, the
amino acid sequence of the recombinant protein component is
different from the amino acid sequence of the endogenous protein
component such that antibodies specific to the recombinant protein
component can be used to determine the level of the protein
component or the complex formed with the component. In certain
embodiments, the recombinant protein component is expressed from
promoters that are not the native promoters of the respective
proteins. In a specific embodiment, the recombinant protein
component is expressed in tissues where it is normally not
expressed. In a specific embodiment, the compound is also
recombinantly expressed in the transgenic non-human animal.
[0378] In certain embodiments, a mutant form of a protein component
of a complex of the invention is expressed in a cell, wherein the
mutant form of the protein component has a binding affinity that is
lower than the binding affinity of the naturally occurring protein
to the other protein component of a complex of the invention. In a
specific embodiment, a dominant negative mutant form of a protein
component is expressed in a cell. A dominant negative form can be
the domain of the protein component that binds to the other protein
component, i.e., the binding domain. Without being bound by theory,
the binding domain will compete with the naturally occurring
protein component for binding to the other protein component of the
complex thereby preventing the formation of complex that contains
full length protein components. Instead, with increasing level of
the dominant negative form in the cell, an increasing amount of
complex lacks those domains that are normally provided to the
complex by the protein component which is expressed as dominant
negative.
[0379] The binding domain of a protein component can be identified
by any standard technique known to the skilled artisan. In a
non-limiting example, alanine-scanning mutagenesis (Cunningham and
Wells, Science 244:1081-1085 (1989) is conducted to identify the
region(s) of the protein that is/are required for dimerization with
another protein component. In other embodiments, different deletion
mutants of the protein component are generated such that the
combined deleted regions would span the entire protein. In a
specific embodiment, the different deletions overlap with each
other. Once mutant forms of a protein component are generated, they
are tested for their ability to form a dimer with another protein
component. If a particular mutant fails to form a dimer with
another protein component or binds the other protein component with
reduced affinity compared to the naturally occurring form, the
mutation of this mutant form is identified as being in a region of
the protein that is involved in the dimer formation. To exclude
that the mutation simply interfered with proper folding of the
protein, any structural analysis known to the skilled artisan can
be performed to determine the 3-dimensional conformation of the
protein. Such techniques include, but are not limited to, circular
dichroism (CD), NMR, and x-ray cristallography.
[0380] In certain embodiments, a mutated form of a component of a
complex of the invention can be expressed in a cell under an
inducible promoter. Any method known to the skilled artisan can be
used to mutate the nucleotide sequence encoding the component. Any
inducible promoter known to the skilled artisan can be used. In
particular, the mutated form of the component of a complex of the
invention has reduced activity, e.g., reduced RNA-nucleolytic
activity and/or reduced affinity to the other components of the
complex.
[0381] In certain embodiments, the assays of the invention are
performed in high-throughput format.
[0382] 4.5.2 Use of Complexes to Identify New Binding Partners
[0383] In certain embodiments of the invention, a complex of the
invention is used to identify new components the complex. In
certain embodiments, new binding partners of a complex of the
invention are identified and thereby implicated in RNA processing.
Any technique known to the skilled artisan can be used to identify
such new binding partners. In certain embodiments, a binding
partner of a complex of the invention binds to a complex of the
invention but not to an individual protein component of a complex
of the invention. In a specific embodiment, immunoprecipitation is
used to identify binding partners of a complex of the
invention.
[0384] In certain embodiments, the assays of the invention are
performed in high-throughput format.
[0385] 4.5.3 Use of Complexes to Identify Pre-Mature Stop Codons
and Modulators Thereof
[0386] In certain embodiments of the invention, a complex of the
invention is used to cleave an mRNA or pre-mRNA molecule containing
a pre-mature stop codon. In certain, more specific, embodiments of
the invention, a complex of the invention is used to cleave an mRNA
or pre-mRNA molecule at or in the vicinity of a pre-mature stop
codon. Without being bound by theory, a complex of the invention
cleaves an mRNA or a pre-mRNA molecule at or in the vicinity of a
pre-mature stop codon. In certain embodiments, the complex of the
invention cleaves an mRNA or a pre-mRNA molecule within 500, 400,
300, 200, 100 or 50 nucleotides of the pre-mature stop codon. In
certain embodiments, the complex of the invention cleaves an mRNA
or a pre-mRNA molecule within 1 to 50, 1 to 100, 1 to 250, 1 to
500, 10 to 50, 10 to 100, 25 to 100, 50 to 100, 50 to 250, 50 to
500, 100 to 500, or 250 to 500 nucleotides of the pre-mature stop
codon.
[0387] In certain embodiments of the invention, a complex of the
invention is used to identify pre-mature stop codons in an mRNA or
pre-mRNA molecule. In certain embodiments, the complex of the
invention cleaves an mRNA or a pre-mRNA molecule within 500, 400,
300, 200, 100 or 50 nucleotides of the pre-mature stop codon. In
certain embodiments, the complex of the invention cleaves an mRNA
or a pre-mRNA molecule within 1 to 50, 1 to 100, 1 to 250, 1 to
500, 10 to 50, 10 to 100, 25 to 100, 50 to 100, 50 to 250, 50 to
500, 100 to 500, or 250 to 500 nucleotides of the pre-mature stop
codon.
[0388] To identify the pre-mature stop codon, an mRNA or pre-mRNA
of interest is incubated with a complex of the invention under
conditions conducive to cleavage of the mRNA or pre-mRNA by the
complex. Once cleavage occurred, the cleavage products are analyzed
to determine the location of the cleavage site. The location of the
cleavage site can be determined by any method known to the skilled
artisan, such as, but not limited to Northern blot analysis.
[0389] In certain embodiments, the complexes of the invention can
be used to identify modulators of cleavage of pre-mature stop
codons by a complex of the invention. In certain embodiments, a
complex of the invention is incubated with an mRNA or pre-mRNA of
interest under conditions conducive to cleavage of the mRNA or
pre-mRNA by the complex in the presence of a compound, wherein the
mRNA or pre-mRNA is known to have a pre-mature stop codon. If the
compound increases the amount of cleavage product generated, the
compound is identified as an activator of the pre-mature stop codon
cleavage activity of a complex of the invention. If the compound
decreases the amount of cleavage product generated, the compound is
identified as an inhibitor of the pre-mature stop codon cleavage
activity of a complex of the invention.
[0390] In certain embodiments, the assays of the invention are
performed in high-throughput format.
[0391] 4.5.4 Modulators of Complex Function
[0392] Any method known to the skilled artisan can be used to
identify compound that modulate the activity of a complex of the
invention. In certain embodiments, compounds can be identified that
modulate the activity of a pre-tRNA splicing endonuclease complex.
In other embodiments, compounds can be identified using the methods
of the invention that modulate the activity of a 3' end pre-mRNA
processing complex. In even other embodiments, compounds can be
identified using the methods of the invention that modulate the
activity of a pre-tRNA cleavage complex. In yet other embodiments,
compounds can be identified using the methods of the invention that
modulate the activity of a complex involved in the biogenesis of
mature ribosomal RNAs from precursor ribosomal RNA.
[0393] In certain embodiments, the substrate of the pre-tRNA
splicing endonuclease complex or the 3' end pre-mRNA endonuclease
complex comprises a reporter gene such that the endonuclease
reaction results either in increased or decreased expression of the
reporter gene. Any reporter gene can be used with the methods of
the invention. Exemplary methods are set forth below. The substrate
of the pre-tRNA splicing endonuclease complex, the 3' end pre-mRNA
endonuclease complex, pre-tRNA cleavage complex or the complex
involved in the biogenesis of mature ribosomal RNAs from precursor
ribosomal RNA can be an RNA molecule that is detectably labeled and
that is known to be cleaved by the complex. The complex and its
substrate are then incubated under conditions conducive to the
cleavage of the substrate by the complex and subsequently the
activity is evaluated by measuring the amount of substrate and/or
cleavage product. See, e.g., section 4.5.4.1.
[0394] In certain embodiments, the assays of the invention are
performed in high-throughput format.
[0395] Various in vitro assays can be used to identify and verify
the ability of a compound to modulate the activity of a pre-tRNA
splicing endonuclease complex or a 3' end pre-mRNA endonuclease
complex. Multiple in vitro assays can be performed simultaneously
or sequentially to assess the affect of a compound on the activity
of a human tRNA splicing endonuclease.
[0396] In certain embodiments, the pre-tRNA splicing endonuclease
complex is incubated with a detectably labeled pre-tRNA substrate
under conditions conducive to the endonuclease reaction. After a
period of time, the reaction is stopped and the RNA is resolved
using PAGE. In certain embodiments, the RNA is precipitated from
the reaction before the RNA is resolved on the gel. The amount of
cleavage product can be determined based on the different length
between substrate and product. In certain embodiments, the RNA
substrate is radioactively labeled and can be detected using
autoradiography. The more active the pre-tRNA splicing endonuclease
complex is the more cleavage product relative to the substrate is
detected.
[0397] In certain embodiments, the 3' end pre-mRNA endonuclease
complex is incubated with a detectably labeled 3' end pre-mRNA
substrate under conditions conducive to the endonuclease reaction.
After a period of time, the reaction is stopped and the RNA is
resolved using PAGE. In certain embodiments, the RNA is
precipitated from the reaction before the RNA is resolved on the
gel. The amount of cleavage product can be determined based on the
different length between substrate and product. In certain
embodiments, the RNA substrate is radioactively labeled and can be
detected using autoradiography. The more active the 3' end pre-mRNA
endonuclease complex is the more cleavage product relative to the
substrate is detected. Such an assay can analogously be used to
identify modulators of tRNA splicing endonuclease, rRNA
endonuclease or tRNA cleavage activity.
[0398] To identify compounds that modulate the 3' end pre-mRNA
endonuclease activity of a complex of the invention, the complex
can be incubated with its substrate, wherein the substrate is
detectably labeled. In certain, more specific embodiments, the
detectable label is a radioactive label, such as, but not limited
to, .sup.33P or .sup.32p. In other embodiments, the label is a
fluorescent label. The detectably labeled substrate is incubated
with the 3' end pre-mRNA endonuclease under conditions conducive to
the cleavage of the pre-mRNA substrate by the 3' end pre-mRNA
endonuclease. The detectably labeled substrate can be microinjected
into a cell or transfected into a cell. The substrate can be
incubated with cell extract or the substrate can be incubated with
purified 3' end pre-mRNA endonuclease complex. After a time
sufficient for the cleavage reaction to take place, the substrate
is resolved using PAGE and the reaction product and any remaining
substrate is visualized. If the substrate is labeled radioactively,
the reaction product can be visualized using autoradiography. In
certain embodiments, the time for incubating is at least 1 min, 5
min, 10 min, 30 min, 45 min, 1 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h,
18 h, or at least 14 h. Such an assay can analogously be used to
identify modulators of tRNA endonuclease, rRNA endonuclease or tRNA
splicing endonuclease activity.
[0399] To identify compounds that modulate the tRNA cleavage
activity of a complex of the invention or the activity of a complex
of the invention in the biogenesis of mature ribosomal RNAs from
precursor ribosomal RNA, the complex can be incubated with its
substrate, wherein the substrate is detectably labeled. In certain
embodiments, a complex with tRNA cleavage activity or a complex
involved in the biogenesis of mature ribosomal RNAs from precursor
ribosomal RNA are incubated under conditions conducive to the
cleavage of the substrate by the complex and subsequently the
activity is evaluated by measuring the amount of substrate and/or
cleavage product. The complex and substrate can be incubated in the
presence and absence of a compound and the effect of the compound
on the RNA-nucleolytic activity of the complex is determined. In
other embodiments, a pre-tRNA or a pre-rRNA is incubated with a
complex of the invention to determine where cleavage sites are
present in the RNA.
[0400] In certain specific embodiments, the assay is performed
concurrently with a control, ie., the assay is performed in the
presence and the absence of a compound to determine the effect of
the compound on the endonuclease reaction. The assay can include
steps in the presence and the absence of a compound to determine
the effect of the compound on the endonuclease reaction. In other
embodiments, a historic value is used for comparison.
[0401] In certain embodiments, the invention provides a method
comprising: (i) identifying a compound as a modulator of tRNA
splicing activity, 3' end pre-mRNA endonuclease activity, and/or
pre-tRNA cleavage activity in a cell-based assay, e.g., as
described below; and (ii) testing the compound identified in step
(i) for its ability to modify tRNA splicing activity, 3' end
pre-mRNA endonuclease activity, and/or pre-tRNA cleavage activity
in a cell-free assay using a purified complex of the invention.
[0402] Assays for tRNA endonuclease activity can be used to
determine tRNA cleavage activity.
[0403] 4.5.4.1 Reporter Gene Constructs, Transfected Cells and Cell
Extracts
[0404] The invention provides for specific vectors comprising a
reporter gene comprising a tRNA intron operably linked to one or
more regulatory elements and host cells transfected with the
vectors if tRNA endonuclease activity is to be tested. If 3' end
pre-mRNA endonuclease activity is to be tested, the substrate
comprises a 3' end pre-mRNA reporter (see section 4.5.4.1.3). The
invention also provides for the in vitro translation of a reporter
gene flanked by one or more regulatory elements. Techniques for
practicing this specific aspect of this invention will employ,
unless otherwise indicated, conventional techniques of molecular
biology, microbiology, and recombinant DNA manipulation and
production, which are routinely practiced by one of skill in the
art. See, e.g., Sambrook, 1989, Molecular Cloning, A Laboratory
Manual, Second Edition; DNA Cloning, Volumes I and II (Glover, Ed.
1985); Oligonucleotide Synthesis (Gait, Ed. 1984); Nucleic Acid
Hybridization (Hames & Higgins, Eds. 1984); Transcription and
Translation (Hames & Higgins, Eds. 1984); Animal Cell Culture
(Freshney, Ed. 1986); Immobilized Cells and Enzymes (IRL Press,
1986); Perbal, A Practical Guide to Molecular Cloning (1984); Gene
Transfer Vectors for Mammalian Cells (Miller & Calos, Eds.
1987, Cold Spring Harbor Laboratory); Methods in Enzymology,
Volumes 154 and 155 (Wu & Grossman, and Wu, Eds.,
respectively), (Mayer & Walker, Eds., 1987); Immunochemical
Methods in Cell and Molecular Biology (Academic Press, London,
Scopes, 1987), Expression of Proteins in Mammalian Cells Using
Vaccinia Viral Vectors in Current Protocols in Molecular Biology,
Volume 2 (Ausubel et al., Eds., 1991).
[0405] 4.5.4.1.1 Reporter Genes
[0406] Any reporter gene well-known to one of skill in the art may
be used in reporter gene constructs to ascertain the effect of a
compound on a tRNA endonuclease complex or a 3' end pre-mRNA
endonuclease. Reporter genes refer to a nucleotide sequence
encoding a protein that is readily detectable either by its
presence or activity. Reporter genes may be obtained and the
nucleotide sequence of the elements determined by any method
well-known to one of skill in the art. The nucleotide sequence of a
reporter gene can be obtained, e.g., from the literature or a
database such as GenBank. Alternatively, a polynucleotide encoding
a reporter gene may be generated from nucleic acid from a suitable
source. If a clone containing a nucleic acid encoding a particular
reporter gene is not available, but the sequence of the reporter
gene is known, a nucleic acid encoding the reporter gene may be
chemically synthesized or obtained from a suitable source (e.g., a
cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly A+RNA, isolated from, any tissue or cells
expressing the reporter gene) by PCR amplification. Once the
nucleotide sequence of a reporter gene is determined, the
nucleotide sequence of the reporter gene may be manipulated using
methods well-known in the art for the manipulation of nucleotide
sequences, e.g., recombinant DNA techniques, site directed
mutagenesis, PCR, etc. (see, for example, the techniques described
in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual,
2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and
Ausubel et al., eds., 1998, Current Protocols in Molecular Biology,
John Wiley & Sons, NY, which are both incorporated by reference
herein in their entireties), to generate reporter genes having a
different amino acid sequence, for example to create amino acid
substitutions, deletions, and/or insertions.
[0407] Examples of reporter genes include, but are not limited to,
luciferase (e.g., firefly luciferase, renilla luciferase, and click
beetle luciferase), green fluorescent protein ("GFP") (e.g., green
fluorescent protein, yellow fluorescent protein, red fluorescent
protein, cyan fluorescent protein, and blue fluorescent protein),
beta-galactosidase ("beta-gal"), beta-glucoronidase,
beta-lactamase, chloramphenicol acetyltransferase ("CAT"), and
alkaline phosphatase ("AP"). Table 2 below lists various reporter
genes and the properties of the products of the reporter genes that
can be assayed. In a preferred embodiment, a reporter gene utilized
in the reporter constructs is easily assayed and has an activity
which is not normally found in the cell or organism of
interest.
3TABLE 2 Reporter Genes and the Properties of the Reporter Gene
Products Reporter Gene Protein Activity & Measurement CAT
(chloramphenicol Transfers radioactive acetyl groups to
acetyltransferase) chloramphenicol or detection by thin layer
chromatography and autoradiography GAL (beta-galactosidase)
Hydrolyzes colorless galactosides to yield colored products. GUS
(beta- Hydrolyzes colorless glucuronides to yield glucuronidase)
colored products. LUC (luciferase) Oxidizes luciferin, emitting
photons GFP (green fluorescent Fluorescent protein without
substrate protein) SEAP (secreted alkaline Luminescence reaction
with suitable substrates phosphatase) or with substrates that
generate chromophores HRP (horseradish In the presence of hydrogen
oxide, oxidation of peroxidase) 3,3',5,5'-tetramethylbenzidine to
form a colored complex AP (alkaline Luminescence reaction with
suitable substrates phosphatase) or with substrates that generate
chromophores
[0408] Described hereinbelow in further detailed are specific
reporter genes and characteristics of those reporter genes.
[0409] Luciferase
[0410] Luciferases are enzymes that emit light in the presence of
oxygen and a substrate (luciferin) and which have been used for
real-time, low-light imaging of gene expression in cell cultures,
individual cells, whole organisms, and transgenic organisms
(reviewed by Greer & Szalay, 2002, Luminescence
17(1):43-74).
[0411] As used herein, the term "luciferase" is intended to embrace
all luciferases, or recombinant enzymes derived from luciferases
which have luciferase activity. The luciferase genes from fireflies
have been well characterized, for example, from the Photinus and
Luciola species (see, e.g., International Patent Publication No. WO
95/25798 for Photinus pyralis, European Patent Application No. EP 0
524 448 for Luciola cruciata and Luciola lateralis, and Devine et
al., 1993, Biochim. Biophys. Acta 1173(2):121-132 for Luciola
mingrelica). Other eucaryotic luciferase genes include, but are not
limited to, the click beetle (Photinus plagiophthalamus, see, e.g.,
Wood et al., 1989, Science 244:700-702), the sea panzy (Renilla
reniformis, see, e.g., Lorenz et al., 1991, Proc Natl Acad Sci U S
A 88(10):4438-4442), and the glow worm (Lampyris noctiluca, see
e.g., Sula-Newby et al., 1996, Biochem J. 313:761-767). The click
beetle is unusual in that different members of the species emit
bioluminescence of different colors, which emit light at 546 nm
(green), 560 nm (yellow-green), 578 nm (yellow) and 593 nm (orange)
(see, e.g, U.S. Pat. Nos. 6,475,719; 6,342,379; and 6,217,847, the
disclosures of which are incorporated by reference in their
entireties). Bacterial luciferin-luciferase systems include, but
are not limited to, the bacterial lux genes of terrestrial
Photorhabdus luminescens (see, e.g., Manukhov et al., 2000,
Genetika 36(3):322-30) and marine bacteria Vibriofischeri and
Vibrio harveyi (see, e.g., Miyamoto et al., 1988, J Biol Chem.
263(26):13393-9, and Cohn et al., 1983, Proc Natl Acad Sci USA.,
80(1):120-3, respectively). The luciferases encompassed by the
present invention also includes the mutant luciferases described in
U.S. Pat. No. 6,265,177 to Squirrell et al., which is hereby
incorporated by reference in its entirety.
[0412] In a preferred embodiment, the luciferase is a firefly
luciferase, a renilla luciferase, or a click beetle luciferase, as
described in any one of the references listed supra, the
disclosures of which are incorporated by reference in their
entireties.
[0413] Green Fluorescent Protein Green fluorescent protein ("GFP")
is a 238 amino acid protein with amino acid residues 65 to 67
involved in the formation of the chromophore which does not require
additional substrates or cofactors to fluoresce (see, e.g., Prasher
et al., 1992, Gene 111:229-233; Yang et al., 1996, Nature
Biotechnol. 14:1252-1256; and Cody et al., 1993, Biochemistry
32:1212-1218).
[0414] As used herein, the term "green fluorescent protein" or
"GFP" is intended to embrace all GFPs (including the various forms
of GFPs which exhibit colors other than green), or recombinant
enzymes derived from GFPs which have GFP activity. In a preferred
embodiment, GFP includes green fluorescent protein, yellow
fluorescent protein, red fluorescent protein, cyan fluorescent
protein, and blue fluorescent protein. The native gene for GFP was
cloned from the bioluminescent jellyfish Aequorea Victoria (see,
e.g., Morin et al., 1972, J. Cell Physiol. 77:313-318). Wild type
GFP has a major excitation peak at 395 nm and a minor excitation
peak at 470 nm. The absorption peak at 470 nm allows the monitoring
of GFP levels using standard fluorescein isothiocyanate (FITC)
filter sets. Mutants of the GFP gene have been found useful to
enhance expression and to modify excitation and fluorescence. For
example, mutant GFPs with alanine, glycine, isoleucine, or
threonine substituted for serine at position 65 result in mutant
GFPs with shifts in excitation maxima and greater fluorescence than
wild type protein when excited at 488 nm (see, e.g., Heim et al.,
1995, Nature 373:663-664; U.S. Pat. No. 5,625,048; Delagrave et
al., 1995, Biotechnology 13:151-154; Cormack et al., 1996, Gene
173:33-38; and Cramer et al., 1996, Nature Biotechnol. 14:315-319).
The ability to excite GFP at 488 nm permits the use of GFP with
standard fluorescence activated cell sorting ("FACS") equipment. In
another embodiment, GFPs are isolated from organisms other than the
jellyfish, such as, but not limited to, the sea pansy, Renilla
reriformis.
[0415] Techniques for labeling cells with GFP in general are
described in U.S. Pat. Nos. 5,491,084 and 5,804,387, which are
incorporated by reference in their entireties; Chalfie et al.,
1994, Science 263:802-805; Heim et al., 1994, Proc. Natl. Acad.
Sci. USA 91:12501-12504; Morise et al., 1974, Biochemistry
13:2656-2662; Ward et al., 1980, Photochem. Photobiol. 31:611-615;
Rizzuto et al., 1995, Curr. Biology 5:635-642; and Kaether &
Gerdes, 1995, FEBS Lett 369:267-271. The expression of GFPs in E.
coli and C. elegans are described in U.S. Pat. No. 6,251,384 to Tan
et al., which is incorporated by reference in its entirety. The
expression of GFP in plant cells is discussed in Hu & Cheng,
1995, FEBS Lett 369:331-33, and GFP expression in Drosophila is
described in Davis et al., 1995, Dev. Biology 170:726-729.
[0416] Beta-galactosidase
[0417] Beta galactosidase ("beta-gal") is an enzyme that catalyzes
the hydrolysis of beta-galactosides, including lactose, and the
galactoside analogs o-nitrophenyl-beta-D-galactopyranoside ("ONPG")
and chlorophenol red-beta-D-galactopyranoside ("CPRG") (see, e.g.,
Nielsen et al., 1983 Proc Natl Acad Sci USA 80(17):5198-5202;
Eustice et al., 1991, Biotechniques 11:739-742; and Henderson et
al., 1986, Clin. Chem. 32:1637-1641). The beta-gal gene functions
well as a reporter gene because the protein product is extremely
stable, resistant to proteolytic degradation in cellular lysates,
and easily assayed. When ONPG is used as the substrate, beta-gal
activity can be quantitated with a spectrophotometer or microplate
reader.
[0418] As used herein, the term "beta galactosidase" or "beta-gal"
is intended to embrace all beta-gals, including lacZ gene products,
or recombinant enzymes derived from beta-gals which have beta-gal
activity. The beta-gal gene functions well as a reporter gene
because the protein product is extremely stable, resistant to
proteolytic degradation in cellular lysates, and easily assayed. In
an embodiment where ONPG is the substrate, beta-gal activity can be
quantitated with a spectrophotometer or microplate reader to
determine the amount of ONPG converted at 420 mn. In an embodiment
when CPRG is the substrate, beta-gal activity can be quantitated
with a spectrophotometer or microplate reader to determine the
amount of CPRG converted at 570 to 595 nm. In yet another
embodiment, the beta-gal activity can be visually ascertained by
plating bacterial cells transformed with a beta-gal construct onto
plates containing Xgal and IPTG. Bacterial colonies that are dark
blue indicate the presence of high beta-gal activity and colonies
that are varying shades of blue indicate varying levels of beta-gal
activity.
[0419] Beta-glucoronidase
[0420] Beta-glucuronidase ("GUS") catalyzes the hydrolysis of a
very wide variety of beta-glucuronides, and, with much lower
efficiency, hydrolyzes some beta-galacturonides. GUS is very
stable, will tolerate many detergents and widely varying ionic
conditions, has no cofactors, nor any ionic requirements, can be
assayed at any physiological pH, with an optimum between 5.0 and
7.8, and is reasonably resistant to thermal inactivation (see,
e.g., U.S. Pat. No. 5,268,463, which is incorporated by reference
in its entirety).
[0421] In one embodiment, the GUS is derived from the Esherichia
coli beta-glucuronidase gene. In alternate embodiments of the
invention, the beta-glucuronidase encoding nucleic acid is
homologous to the E. coli beta-glucuronidase gene and/or may be
derived from another organism or species.
[0422] GUS activity can be assayed either by fluorescence or
spectrometry, or any other method described in U.S. Pat. No.
5,268,463, the disclosure of which is incorporated by reference in
its entirety. For a fluorescent assay,
4-trifluoromethylumbelliferyl beta-D-glucuronide is a very
sensitive substrate for GUS. The fluorescence maximum is close to
500 nm--bluish green, where very few plant compounds fluoresce or
absorb. 4-trifluoromethylumbelliferyl beta-D-glucuronide also
fluoresces much more strongly near neutral pH, allowing continuous
assays to be performed more readily than with MUG.
4-trifluoromethylumbelliferyl beta-D-glucuronide can be used as a
fluorescent indicator in vivo. The spectrophotometric assay is very
straightforward and moderately sensitive (Jefferson et al., 1986,
Proc. Natl. Acad. Sci. USA 86:8447-8451). A preferred substrate for
spectrophotometric measurement is p-nitrophenyl beta-D-glucuronide,
which when cleaved by GUS releases the chromophore p-nitrophenol.
At a pH greater than its pK.sub.a (around 7.15) the ionized
chromophore absorbs light at 400-420 nm, giving a yellow color.
[0423] Beta-lactamase
[0424] Beta-lactamases are nearly optimal enzymes in respect to
their almost diffusion-controlled catalysis of beta-lactam
hydrolysis, making them suited to the task of an intracellular
reporter enzyme (see, e.g., Christensen et al., 1990, Biochem. J.
266: 853-861). They cleave the beta-lactam ring of beta-lactam
antibiotics, such as penicillins and cephalosporins, generating new
charged moieties in the process (see, e.g., O'Callaghan et al.,
1968, Antimicrob. Agents. Chemother. 8: 57-63 and Stratton, 1988,
J. Antimicrob. Chemother. 22, Suppl. A: 23-35). A large number of
beta-lactamases have been isolated and characterized, all of which
would be suitable for use in accordance with the present invention
(see, e.g., Richmond & Sykes, 1978, Adv.Microb.Physiol. 9:31-88
and Ambler, 1980, Phil. Trans. R. Soc. Lond. [Ser.B.] 289: 321-331,
the disclosures of which are incorporated by reference in their
entireties).
[0425] The coding region of an exemplary beta-lactamase employed
has been described in U.S. Patent No. 6,472,205, Kadonaga et al.,
1984, J.Biol.Chem. 259: 2149-2154, and Sutcliffe, 1978, Proc. Natl.
Acad. Sci. USA 75: 3737-3741, the disclosures of which re
incorporated by reference in their entireties. As would be readily
apparent to those skilled in the field, this and other comparable
sequences for peptides having beta-lactamase activity would be
equally suitable for use in accordance with the present invention.
The combination of a fluorogenic substrate described in U.S. Pat.
Nos. 6,472,205, 5,955,604, and 5,741,657, the disclosures of which
are incorporated by reference in their entireties, and a suitable
beta-lactamase can be employed in a wide variety of different assay
systems, such as are described in U.S. Pat. No. 4,740,459, which is
hereby incorporated by reference in its entirety.
[0426] Chloramphenicol Acetyltransferase
[0427] Chloramphenicol acetyl transferase ("CAT") is commonly used
as a reporter gene in mammalian cell systems because mammalian
cells do not have detectable levels of CAT activity. The assay for
CAT involves incubating cellular extracts with radiolabeled
chloramphenicol and appropriate co-factors, separating the starting
materials from the product by, for example, thin layer
chromatography ("TLC"), followed by scintillation counting (see,
e.g., U.S. Pat. No. 5,726,041, which is hereby incorporated by
reference in its entirety).
[0428] As used herein, the term "chloramphenicol acetyltransferase"
or "CAT" is intended to embrace all CATs, or recombinant enzymes
derived from CAT which have CAT activity. While it is preferable
that a reporter system which does not require cell processing,
radioisotopes, and chromatographic separations would be more
amenable to high through-put screening, CAT as a reporter gene may
be preferable in situations when stability of the reporter gene is
important. For example, the CAT reporter protein has an in vivo
half life of about 50 hours, which is advantageous when an
accumulative versus a dynamic change type of result is desired.
[0429] Secreted Alkaline Phosphatase
[0430] The secreted alkaline phosphatase ("SEAP") enzyme is a
truncated form of alkaline phosphatase, in which the cleavage of
the transmembrane domain of the protein allows it to be secreted
from the cells into the surrounding media. In a preferred
embodiment, the alkaline phosphatase is isolated from human
placenta.
[0431] As used herein, the term "secreted alkaline phosphatase" or
"SEAP" is intended to embrace all SEAP or recombinant enzymes
derived from SEAP which have alkaline phosphatase activity. SEAP
activity can be detected by a variety of methods including, but not
limited to, measurement of catalysis of a fluorescent substrate,
immunoprecipitation, HPLC, and radiometric detection. The
luminescent method is preferred due to its increased sensitivity
over calorimetric detection methods. The advantages of using SEAP
is that a cell lysis step is not required since the SEAP protein is
secreted out of the cell, which facilitates the automation of
sampling and assay procedures. A cell-based assay using SEAP for
use in cell-based assessment of inhibitors of the Hepatitis C virus
protease is described in U.S. Pat. No. 6,280,940 to Potts et al.
which is hereby incorporated by reference in its entirety.
[0432] 4.5.4.1.2 tRNA Introns
[0433] Any nucleotide sequence recognized and excised by a tRNA
splicing endonuclease complex may be inserted into the coding
region of a reporter gene such that the mRNA coding the reporter
gene out of frame utilizing well-known molecular biology
techniques. For example, a nucleotide sequence comprising a
bulge-helix-bulge structure or a mature domain of a precursor tRNA
may be inserted into the coding region of a reporter gene such that
the mRNA coding the reporter gene out of frame. Alternatively, a
nucleotide sequence recognized and excised by a tRNA splicing
endonuclease complex may be inserted into the 5' untranslated
region, 3' untranslated region or both the 5' and 3' untranslated
regions of a reporter gene construct. A nucleotide sequence
recognized and excised by a tRNA splicing endonuclease complex may
comprise 10 nucleotides, 15 nucleotides, 20 nucleotides, 25
nucleotides, 25 nucleotides, 30 nucleotides, 40 nucleotides, 45
nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65
nucleotides, 75 nucleotides, 100 nucleotides, 125 nucleotides, 150
nucleotides, or more. In certain embodiments, the nucleotide
sequence is at least 10 nucleotides in length.
[0434] In a specific embodiment, a tRNA intron is inserted within
the open reading frame of a reporter gene. In another embodiment,
two, three, four, five or more tRNA introns are inserted within the
open reading frame of a reporter gene. In an alternative
embodiment, a tRNA intron is inserted within the 5' untranslated
region, 3' untranslated region or both the 5' and 3' untranslated
region of a reporter gene construct. In an alternative embodiment,
two, three, four, five or more tRNA introns are inserted within the
5' untranslated region, 3' untranslated region or both the 5' and
3' untranslated region of a reporter gene construct. The tRNA
intron may comprise a bulge-helix-bulge conformation.
[0435] A reporter gene containing a tRNA intron may be produced by
any method well-known to one of skill in the art. For example, the
reporter gene containing a tRNA intron may be chemically
synthesized using phosphoramidite or other solution or solid-phase
methods. Detailed descriptions of the chemistry used to form
polynucleotides by the phosphoramidite method are well known (see,
e.g., Caruthers et aL, U.S. Pat. Nos. 4,458,066 and 4,415,732;
Caruthers et al., 1982, Genetic Engineering 4:1-17; Users Manual
Model 392 and 394 Polynucleotide Synthesizers, 1990, pages 6-1
through 6-22, Applied Biosystems, Part No. 901237; Ojwang, et al.,
1997, Biochemistry, 36:6033-6045). After synthesis, the reporter
gene containing a tRNA intron can be purified using standard
techniques known to those skilled in the art (see Hwang et al.,
1999, Proc. Natl. Acad. Sci. USA 96(23): 12997-13002 and references
cited therein). Depending on the length of the reporter gene
containing a tRNA intron and the method of its synthesis, such
purification techniques include, but are not limited to,
reverse-phase high-performance liquid chromatography
("reverse-phase HPLC"), fast performance liquid chromatography
("FPLC"), and gel purification. Methods for labeling the substrate
with a fluorescent acceptor moiety, a fluorescent donor moiety
and/or quencher are well-known in the art (see, e.g., U.S. Pat.
Nos. 6,472,156, 6,451,543, 6,348,322, 6,342,379, 6,323,039,
6,297,018, 6,291,201, 6,280,981, 5,843,658, and 5,439,797, the
disclosures of which are incorporated by reference in their
entirety).
[0436] 4.5.4.1.3 3' end pre-mRNA Cleavage Site
[0437] 3' end pre-mRNA endonuclease cleaves pre-mRNA at the 3' end
to give rise to to a 3' end of the mRNA that is subsequently
polyadenylated. The cleavage and polyadenylation site is located
between a conserved hexanucleotide, AAUAAA, upstream and a G/U-rich
sequence element downstream. Any method known to the skilled
artisan can be used to detect and quantify the activity of a 3' end
pre-mRNA endonuclease.
[0438] An assay for the activity of a 3' end pre-mRNA endonuclease
can be performed in a cell, using a cell extract or in vitro using
a purified mammalian 3' end pre-mRNA endonuclease complex. For a
description of 3' end pre-mRNA endonuclease complexes see section
4.2.2.
[0439] If the assay is performed in a cell, the cell expresses all
components required for the activity of the 3' end pre-mRNA
endonuclease. In certain, more specific embodiments, the cell is a
mammalian cell, e.g., a human cell, that endogenously expresses all
components of a 3' end pre-mRNA endonuclease complex. In other
embodiments, the cell has been modified to recombinantly express
one or more components of the 3' end pre-mRNA endonuclease complex.
Further, the detectably labeled substrate of the 3' end pre-mRNA
endonuclease reaction can be microinjected or transfected
(permanently or transiently) into the cell by any method known to
the skilled artisan. If a reporter gene construct is used as a
substrate, the substrate can be microinjected or transfected
(permanently or transiently) into the cell or the cell can be
modified such that the reporter gene is integrated into the genome
of the cell.
[0440] In certain embodiments, a 3' end pre-mRNA reporter gene
construct is used as substrate to detect and/or quantify the
activity of a 3' end pre-mRNA endonuclease (see FIG. 19). In
certain embodiments, a 3' end pre-mRNA reporter gene construct
encodes two open reading frames (ORF), the upstream and the
downstream ORF, wherein the two ORFs are separated by a cleavage
and polyadenylation signal and the 3' located ORF is preceded by an
internal ribosome entry site (IRES). For an example of a 3' end
pre-mRNA reporter gene construct, see FIG. 18. If the cleavage
takes place at the cleavage and polyadenylation site, the
downstream reporter gene at the 3' end of the construct is not
transcribed. Thus, the more active the 3' end pre-mRNA endonuclease
is the less of the downstream reporter gene is expressed. The less
active, i.e., in the presence of an inhibitor, the 3' end pre-mRNA
endonuclease is the more RNA that includes the downstream reporter
gene will be transcribed. The downstream reporter gene can then be
translated via the IRES. Any IRES can be used with the methods of
the invention. In a specific embodiment, the IRES is an IRES of the
Hepatitis C virus (HCV). The substrate can be generated by any
recombinant DNA technology known to the skilled artisan.
[0441] In certain embodiments, the ratio between the upstream
reporter gene and the downstream reporter gene of the 3' end
pre-mRNA reporter gene construct is the read-out. Thus, an increase
in 3' end pre-mRNA cleavage will result in an increase of the
upstream reporter gene:downstream reporter gene ratio. A decrease
in 3' end pre-mRNA cleavage will result in an decrease of the
upstream reporter gene:downstream reporter gene ratio.
[0442] 4.5.4.1.4 Vectors
[0443] The nucleotide sequence coding for a reporter gene and the
nucleotide sequence coding for a tRNA intron, the 3' end pre-mRNA
cleavage site, the pre-tRNA cleavage site or the rRNA cleavage site
can be inserted into an appropriate expression vector, ie., a
vector which contains the necessary elements for the transcription
and translation of the inserted protein-coding sequence. The
necessary transcriptional and translational signals can also be
supplied by the reporter gene. A variety of host-vector systems may
be utilized to express the reporter gene. These include, but are
not limited to, mammalian cell systems infected with virus (e.g.,
vaccinia virus, adenovirus, etc.); insect cell systems infected
with virus (e.g., baculovirus); microorganisms such as yeast
containing yeast vectors, or bacteria transformed with
bacteriophage, DNA, plasmid DNA, or cosmid DNA; and stable cell
lines generated by transformation using a selectable marker. The
expression elements of vectors vary in their strengths and
specificities. Depending on the host-vector system utilized, any
one of a number of suitable transcription and translation elements
may be used.
[0444] Any of the methods previously described for the insertion of
DNA fragments into a vector may be used to construct expression
vectors containing a chimeric nucleic acid consisting of
appropriate transcriptional/translational control signals and the
protein coding sequences. These methods may include in vitro
recombinant DNA and synthetic techniques and in vivo recombinants
(genetic recombination). Expression of the reporter gene construct
may be regulated by a second nucleic acid sequence so that the
reporter gene is expressed in a host transformed with the
recombinant DNA molecule. For example, expression of a reporter
gene construct may be controlled by any promoter/enhancer element
known in the art, such as a constitutive promoter, a
tissue-specific promoter, or an inducible promoter. Specific
examples of promoters which may be used to control gene expression
include, but are not limited to, the SV40 early promoter region
(Bemoist & Chambon, 1981, Nature 290:304-310), the promoter
contained in the 3' long terminal repeat of Rous sarcoma virus
(Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine
kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A.
78:1441-1445), the regulatory sequences of the metallothionein gene
(Brinster et al., 1982, Nature 296:39-42); prokaryotic expression
vectors such as the .beta.-lactamase promoter (Villa-Kamaroff et
al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac
promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. U.S.A.
80:21-25); see also "Useful proteins from recombinant bacteria" in
Scientific American, 1980, 242:74-94; plant expression vectors
comprising the nopaline synthetase promoter region
(Herrera-Estrella et al., Nature 303:209-213) or the cauliflower
mosaic virus 35S RNA promoter (Gardner, et al., 1981, Nucl. Acids
Res. 9:2871), and the promoter of the photosynthetic enzyme
ribulose biphosphate carboxylase (Herrera-Estrella et al., 1984,
Nature 310:115-120); promoter elements from yeast or other fungi
such as the Gal 4 promoter, the ADC (alcohol dehydrogenase)
promoter, PGK (phosphoglycerol kinase) promoter, alkaline
phosphatase promoter, and the following animal transcriptional
control regions, which exhibit tissue specificity and have been
utilized in transgenic animals: elastase I gene control region
which is active in pancreatic acinar cells (Swift et al., 1984,
Cell 38:639-646; Omitz et al., 1986, Cold Spring Harbor Symp.
Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515);
insulin gene control region which is active in pancreatic beta
cells (Hanahan, 1985, Nature 315:115-122), immunoglobulin gene
control region which is active in lymphoid cells (Grosschedl et
al., 1984, Cell 38:647-658; Adames et al., 1985, Nature
318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444),
mouse mammary tumor virus control region which is active in
testicular, breast, lymphoid and mast cells (Leder et al., 1986,
Cell 45:485-495), albumin gene control region which is active in
liver (Pinkert et al., 1987, Genes and Devel. 1:268-276),
alpha-fetoprotein gene control region which is active in liver
(Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et
al., 1987, Science 235:53-58; alpha 1-antitrypsin gene control
region which is active in the liver (Kelsey et al., 1987, Genes and
Devel. 1:161-171), beta-globin gene control region which is active
in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias
et al., 1986, Cell 46:89-94; myelin basic protein gene control
region which is active in oligodendrocyte cells in the brain
(Readhead et al., 1987, Cell 48:703-712); myosin light chain-2 gene
control region which is active in skeletal muscle (Sani, 1985,
Nature 314:283-286), and gonadotropic releasing hormone gene
control region which is active in the hypothalamus (Mason et al.,
1986, Science 234:1372-1378).
[0445] In a specific embodiment, a vector is used that comprises a
promoter operably linked to a reporter gene, one or more origins of
replication, and, optionally, one or more selectable markers (e.g.,
an antibiotic resistance gene). In a preferred embodiment, the
vectors are CMV vectors, T7 vectors, lac vectors, pCEP4 vectors,
5.0/F vectors, or vectors with a tetracycline-regulated promoter
(e.g., pcDNA .TM.5/FRT/TO from Invitrogen
[0446] Expression vectors containing the reporter gene construct of
the present invention can be identified by three general
approaches: (a) nucleic acid hybridization, (b) presence or absence
of "marker" nucleic acid functions, (c) expression of inserted
sequences, and (d) sequencing. In the first approach, the presence
of the reporter gene inserted in an expression vector can be
detected by nucleic acid hybridization using probes comprising
sequences that are homologous to the inserted reporter gene. In the
second approach, the recombinant vector/host system can be
identified and selected based upon the presence or absence of
certain "marker" nucleic acid functions (e.g., thymidine kinase
activity, resistance to antibiotics, transformation phenotype,
occlusion body formation in baculovirus, etc.) caused by the
insertion of the nucleic acid of interest, i.e., the reporter gene
construct, in the vector. For example, if the nucleic acid of
interest is inserted within the marker nucleic acid sequence of the
vector, recombinants containing the insert can be identified by the
absence of the marker nucleic acid function. In the third approach,
recombinant expression vectors can be identified by assaying the
reporter gene product expressed by the recombinant. Such assays can
be based, for example, on the physical or functional properties of
the particular reporter gene.
[0447] In a preferred embodiment, the reporter gene constructs are
cloned into stable cell line expression vectors. In a preferred
embodiment, the stable cell line expression vector contains a site
specific genomic integration site. In another preferred embodiment,
the reporter gene construct is cloned into an episomal mammalian
expression vector.
[0448] 4.5.4.1.5 Transfection
[0449] Once a vector encoding the appropriate gene has been
synthesized, a host cell is transformed or transfected with the
vector of interest. The use of stable transformants is preferred.
In a preferred embodiment, the host cell is a mammalian cell. In a
more preferred embodiment, the host cell is a human cell. In
another embodiment, the host cells are primary cells isolated from
a tissue or other biological sample of interest. Host cells that
can be used in the methods of the present invention include, but
are not limited to, hybridomas, pre-B cells, 293 cells, 293T cells,
HeLa cells, HepG2 cells, K562 cells, 3T3 cells. In another
preferred embodiment, the host cells are immortalized cell lines
derived from a source, e.g., a tissue. Other host cells that can be
used in the present invention include, but are not limited to,
virally-infected cells.
[0450] Transformation may be by any known method for introducing
polynucleotides into a host cell, including, for example packaging
the polynucleotide in a virus and transducing a host cell with the
virus, and by direct uptake of the polynucleotide. The
transformation procedure used depends upon the host to be
transformed. Mammalian transformations (i.e., transfections) by
direct uptake may be conducted using the calcium phosphate
precipitation method of Graham & Van der Eb, 1978, Virol.
52:546, or the various known modifications thereof. Other methods
for introducing recombinant polynucleotides into cells,
particularly into mammalian cells, include dextran-mediated
transfection, calcium phosphate mediated transfection, polybrene
mediated transfection, protoplast fusion, electroporation,
encapsulation of the polynucleotide(s) in liposomes, and direct
microinjection of the polynucleotides into nuclei. Such methods are
well-known to one of skill in the art.
[0451] In a preferred embodiment, stable cell lines containing the
constructs of interest are generated for high throughput screening.
Such stable cells lines may be generated by introducing a reporter
gene construct comprising a selectable marker, allowing the cells
to grow for 1-2 days in an enriched medium, and then growing the
cells on a selective medium. The selectable marker in the
recombinant plasmid confers resistance to the selection and allows
cells to stably integrate the plasmid into their chromosomes and
grow to form foci which in turn can be cloned and expanded into
cell lines.
[0452] A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler, et
al., 1977, Cell 11:223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc.
Natl. Acad. Sci. USA 48:2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes
can be employed in tk-, hgprt- or aprt-cells, respectively. Also,
anti-metabolite resistance can be used as the basis of selection
for dhfr, which confers resistance to methotrexate (Wigler, et al.,
1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to
mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad.
Sci. USA 78:2072); neo, which confers resistance to the
aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol.
150:1); and hygro, which confers resistance to hygromycin
(Santerre, et al., 1984, Gene 30:147) genes.
[0453] 4.5.4.1.6 Cell-Free Extracts
[0454] The invention provides for the translation of the reporter
gene constructs in a cell-free system. Techniques for practicing
this specific aspect of this invention will employ, unless
otherwise indicated, conventional techniques of molecular biology,
microbiology, and recombinant DNA manipulation and production,
which are routinely practiced by one of skill in the art. See,
e.g., Sambrook, 1989, Molecular Cloning, A Laboratory Manual,
Second Edition; DNA Cloning, Volumes I and II (Glover, Ed. 1985);
and Transcription and Translation (Hames & Higgins, Eds.
1984).
[0455] Any technique well-known to one of skill in the art may be
used to generate cell-free extracts for translation in vitro. For
example, the cell-free extracts for in vitro translation reactions
can be generated by centrifuging cells and clarifying the
supernatant. In particular, a cell extract utilized in accordance
with the invention may be an S1 extract (ie., the supernatant from
a 1,000.times.g spin) to an S500 extract (i.e., the supernatant
from a 500,000.times.g spin), preferably an S10 extract (i.e., the
supernatant from a 10,000.times.g spin) to an S250 extract (i.e.,
the supernatant from a 250,000.times.g spin). In a specific
embodiment, a cell extract utilized in accordance with the
invention is an S50 extract (ie., the supernatant from a
50,000.times.g spin) to an S100 extract (i.e., the supernatant from
a 100,000.times.g spin).
[0456] The cell-free translation extract may be isolated from cells
of any species origin. For example, the cell-free translation
extract may be isolated from human cells, cultured mouse cells,
cultured rat cells, Chinese hamster ovary (CHO) cells, Xenopus
oocytes, rabbit reticulocytes, wheat germ, or rye embryo (see,
e.g., Krieg & Melton, 1984, Nature 308:203 and Dignam et al.,
1990 Methods Enzymol. 182:194-203). Alternatively, the cell-free
translation extract, e.g., rabbit reticulocyte lysates and wheat
germ extract, can be purchased from, e.g., Promega, (Madison,
Wis.). In a preferred embodiment, the cell-free extract is an
extract isolated from human cells. In a more preferred embodiment,
the human cells are HeLa cells.
[0457] 4.5.5 Reporter Gene-Based Assavs
[0458] 4.5.5.1 Cell-Based Assays
[0459] After a vector containing the reporter gene construct is
transformed or transfected into a host cell and a compound library
is synthesized or purchased or both, the cells are used to screen
the library to identify compounds that modulate the activity of a
mammalian tRNA splicing endonuclease, a mammalian 3' end pre-mRNA
endonuclease, pre-tRNA cleavage activity, or rRNA cleavage
activity.
[0460] An assay for the activity of a tRNA endonuclease can be
performed in a cell, using a cell extract or in vitro using a
purified mammalian tRNA endonuclease complex. If the assay is
performed in a cell, the cell expresses all components required for
the activity of the tRNA endonuclease. In certain, more specific
embodiments, the cell is a mammalian cell, e.g., a human cell, that
endogenously expresses all components of a tRNA endonuclease
complex. In other embodiments, the cell has been modified to
recombinantly express one or more components of the tRNA
endonuclease complex. Further, the detectably labeled substrate of
the tRNA endonuclease reaction can be microinjected or transfected
(permanently or transiently) into the cell by any method known to
the skilled artisan. If a reporter gene construct is used as a
substrate, the substrate can be microinjected or transfected
(permanently or transiently) into the cell or the cell can be
modified such that the reporter gene is integrated into the genome
of the cell.
[0461] The reporter gene-based assays for tRNA splicing
endonuclease activity may be conducted by contacting a compound or
a member of a library of compounds with a cell genetically
engineered to contain a reporter gene construct comprising a
reporter gene and a tRNA intron within the open reading frame of
the reporter gene, or within the 5' untranslated region, 3'
untranslated region or both the 5' and 3' untranslated regions of
the reporter gene construct, or within a mRNA splice site of the
reporter gene; and measuring the expression of said reporter gene
if pre-tRNA splicing endonuclease activity is to be assayed.
[0462] The alteration in reporter gene expression relative to a
previously determined reference range, the absence of the compound
or a control in such reporter-gene based assays indicates that a
particular compound modulates the activity of a tRNA splicing
endonuclease. A decrease in reporter gene expression relative to a
previously determined reference range, the absence of the compound
or a control in such reporter-gene based assays indicates that a
particular compound reduces or inhibits the activity of a tRNA
splicing endonuclease (e.g., the recognition or cleavage of a tRNA
intron). An increase in reporter gene expression relative to a
previously determined reference range, the absence of the compound
or a control in such reporter-gene based assays indicates that a
particular compound enhances the activity of a tRNA splicing
endonuclease. In a preferred embodiment, a negative control (e.g.,
PBS or another agent that is known to have no effect on the
expression of the reporter gene) and a positive control (e.g., an
agent that is known to have an effect on the expression of the
reporter gene, preferably an agent that effects the activity of a
human tRNA splicing endonuclease) are included in the cell-based
assays described herein. In a particular embodiment, the pre-tRNA
splicing endonuclease is a human pre-tRNA splicing endonuclease
complex.
[0463] An assay for the activity of a 3' end pre-mRNA endonuclease
can be performed in a cell, using a cell extract or in vitro using
a purified mammalian 3' end pre-mRNA endonuclease complex. If the
assay is performed in a cell, the cell expresses all components
required for the activity of the 3' end pre-mRNA endonuclease. In
certain, more specific embodiments, the cell is a mammalian cell,
e.g., a human cell, that endogenously expresses all components of a
3' end pre-mRNA endonuclease complex. In other embodiments, the
cell has been modified to recombinantly express one or more
components of the 3' end pre-mRNA endonuclease complex. Further,
the detectably labeled substrate of the 3' end pre-mRNA
endonuclease reaction can be microinjected or transfected
(permanently or transiently) into the cell by any method known to
the skilled artisan. If a reporter gene construct is used as a
substrate, the substrate can be microinjected or transfected
(permanently or transiently) into the cell or the cell can be
modified such that the reporter gene is integrated into the genome
of the cell.
[0464] The reporter gene based assays for 3' end pre-mRNA
endonuclease activity may be conducted by contacting a compound or
a member of a library of compounds with a cell genetically
engineered to contain a reporter gene construct comprising a
reporter gene and a 3' end pre-mRNA cleavage site. In a particular
embodiment, the 3' end pre-mRNA endonuclease is a human 3' end
pre-mRNA endonuclease complex.
[0465] In certain embodiments, a 3' end pre-mRNA reporter gene
construct encodes two open reading frames (ORF), the upstream and
the downstream ORF, wherein the two ORFs are separated by a
cleavage and polyadenylation signal and the 3' located ORF is
preceded by an internal ribosome entry site (IRES). For an example
of a 3' end pre-mRNA reporter gene construct, see FIG. 18. If the
cleavage takes place at the cleavage and polyadenylation site, the
downstream reporter gene at the 3' end of the construct is not
transcribed. Thus, the more active the 3' end pre-mRNA endonuclease
is the less of the downstream reporter gene is expressed. The less
active, i.e., in the presence of an inhibitor, the 3' end pre-mRNA
endonuclease is the more RNA that includes the downstream reporter
gene will be transcribed. The downstream reporter gene can then be
translated via the IRES.
[0466] In certain embodiments, the ratio between the upstream
reporter gene and the downstream reporter gene of the 3' end
pre-mRNA reporter gene construct is the read-out. Thus, an increase
in 3' end pre-mRNA cleavage will result in an increase of the
upstream reporter gene:downstream reporter gene ratio. A decrease
in 3' end pre-mRNA cleavage will result in an decrease of the
upstream reporter gene:downstream reporter gene ratio.
[0467] The step of contacting a compound or a member of a library
of compounds with a cell genetically engineered to contain a
reporter gene construct may be conducted under physiologic
conditions. In specific embodiment, a compound or a member of a
library of compounds is added to the cells in the presence of an
aqueous solution. In accordance with this embodiment, the aqueous
solution may comprise a buffer and a combination of salts,
preferably approximating or mimicking physiologic conditions.
Alternatively, the aqueous solution may comprise a buffer, a
combination of salts, and a detergent or a surfactant. Examples of
salts which may be used in the aqueous solution include, but not
limited to, KCl, NaCl, and/or MgCl.sub.2. The optimal concentration
of each salt used in the aqueous solution is dependent on the cells
and compounds used and can be determined using routine
experimentation. The step of contacting a compound or a member of a
library of compounds with a human cell genetically engineered to
contain the reporter gene construct may be performed for at least
0.2 hours, 0.25 hours, 0.5 hours, 1 hour, 2 hours, 3 hours, 4
hours, 5 hours, 6 hours, 8 hours, 10 hours, 12 hours, 18 hours, or
at least 1 day.
[0468] In one embodiment, the invention provides a method for
identifying a compound that modulates tRNA splicing endonuclease
activity or 3' end pre-mRNA endonuclease activity, wherein the
method comprises: (a) expressing a nucleic acid comprising a
reporter gene in a cell, wherein the reporter gene comprises a tRNA
intron or a 3' end pre-mRNA cleavage site; (b) contacting said cell
with a compound or a member of a library of compounds; and (c)
detecting the expression of said reporter gene, wherein a compound
that modulates tRNA splicing endonuclease activity is identified if
the expression of said reporter gene in the presence of a compound
is altered relative to a previously determined reference range or
the expression of said reporter gene in the absence of the compound
or the presence of a control. In another embodiment, the invention
provides a method for identifying a compound that modulates tRNA
splicing endonuclease activity or pre-tRNA splicing endonuclease
activity, said method comprising: (a) contacting a member of a
library of compounds with a cell containing a nucleic acid
comprising a reporter gene, wherein the reporter gene comprises a
tRNA intron or a 3' end pre-mRNA endonuclease cleavage site; and
(b) detecting the expression of said reporter gene, wherein a
compound that modulates tRNA splicing endonuclease activity or 3'
end pre-mRNA endonuclease activity is identified if the expression
of said reporter gene in the presence of a compound is altered
relative to a previously determined reference range the expression
of said reporter gene in the absence of said compound or the
presence of a control.
[0469] The expression of a reporter gene and/or activity of the
protein encoded by the reporter gene in the cell-based
reporter-gene assays may be detected by any technique well-known to
one of skill in the art. The expression of a reporter gene can be
readily detected, e.g., by quantifying the protein and/or RNA
encoded by said gene. Many methods standard in the art can be thus
employed, including, but not limited to, immunoassays to detect
and/or visualize gene expression (e.g., Western blot,
immunoprecipitation followed by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE), immunocytochemistry,
etc) and/or hybridization assays to detect gene expression by
detecting and/or visualizing respectively mRNA encoding a gene
(e.g., Northern assays, dot blots, in situ hybridization, etc),
etc. Such assays are routine and well known in the art (see, e.g.,
Ausubel et al, eds, 1994, Current Protocols in Molecular Biology,
Vol. 1, John Wiley & Sons, Inc., New York, which is
incorporated by reference herein in its entirety). Exemplary
immunoassays are described briefly below (but are not intended by
way of limitation).
[0470] Immunoprecipitation protocols generally comprise lysing a
population of cells in a lysis buffer such as RIPA buffer (1% NP-40
or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl,
0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with
protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium vanadate), adding the antibody which recognizes
the antigen to the cell lysate, incubating for a period of time
(e.g., 1 to 4 hours) at 40.degree. C., adding protein A and/or
protein G sepharose beads to the cell lysate, incubating for about
an hour or more at 40.degree. C., washing the beads in lysis buffer
and resuspending the beads in SDS/sample buffer. The ability of the
antibody to immunoprecipitate a particular antigen can be assessed
by, e.g., western blot analysis. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase
the binding of the antibody to an antigen and decrease the
background (e.g., pre-clearing the cell lysate with sepharose
beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
10.16.1.
[0471] Western blot analysis generally comprises preparing protein
samples, electrophoresis of the protein samples in a polyacrylamide
gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the
antigen), transferring the protein sample from the polyacrylamide
gel to a membrane such as nitrocellulose, PVDF or nylon, blocking
the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat
milk), washing the membrane in washing buffer (e.g., PBS-Tween 20),
blocking the membrane with primary antibody (the antibody which
recognizes the antigen) diluted in blocking buffer, washing the
membrane in washing buffer, blocking the membrane with a secondary
antibody (which recognizes the primary antibody, e.g., an
anti-human antibody) conjugated to an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive
molecule (e.g., .sup.32P or .sup.125I) diluted in blocking buffer,
washing the membrane in wash buffer, and detecting the presence of
the antigen. One of skill in the art would be knowledgeable as to
the parameters that can be modified to increase the signal detected
and to reduce the background noise. For further discussion
regarding western blot protocols see, e.g., Ausubel et al, eds,
1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley
& Sons, Inc., New York at 10.8.1.
[0472] ELISAs comprise preparing antigen, coating the well of a 96
well microtiter plate with the antigen, adding a primary antibody
(which recognizes the antigen) conjugated to a detectable compound
such as an enzymatic substrate (e.g., horseradish peroxidase or
alkaline phosphatase) to the well and incubating for a period of
time, and detecting the presence of the antigen. In ELISAs the
antibody of interest does not have to be conjugated to a detectable
compound; instead, a second antibody (which recognizes the primary
antibody) conjugated to a detectable compound may be added to the
well. Further, instead of coating the well with the antigen, the
antibody may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the
addition of the antigen of interest to the coated well. One of
skill in the art would be knowledgeable as to the parameters that
can be modified to increase the signal detected as well as other
variations of ELISAs known in the art. For further discussion
regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons,
Inc., New York at 11.2.1.
[0473] Methods for detecting the activity of a protein encoded by a
reporter gene will vary with the reporter gene used. Assays for the
various reporter genes are well-known to one of skill in the art.
For example, as described in Section 5.2.1., luciferase,
beta-galactosidase ("beta-gal"), beta-glucoronidase ("GUS"),
beta-lactamase, chloramphenicol acetyltransferase ("CAT"), and
alkaline phosphatase ("AP") are enzymes that can be analyzed in the
presence of a substrate and could be amenable to high throughput
screening. For example, the reaction products of luciferase,
beta-galactosidase ("beta-gal"), and alkaline phosphatase ("AP")
are assayed by changes in light imaging (e.g., luciferase),
spectrophotometric absorbance (e.g., beta-gal), or fluorescence
(e.g., AP). Assays for changes in light output, absorbance, and/or
fluorescence are easily adapted for high throughput screening. For
example, beta-gal activity can be measured with a microplate
reader. Green fluorescent protein ("GFP") activity can be measured
by changes in fluorescence. For example, in the case of mutant GFPs
that fluoresce at 488 nm, standard fluorescence activated cell
sorting ("FACS") equipment can be used to separate cells based upon
GFP activity.
[0474] Alterations in the expression of a reporter gene may be
determined by comparing the level of expression of the reporter
gene to a negative control (e.g., PBS or another agent that is
known to have no effect on the expression of the reporter gene) and
optionally, a positive control (e.g., an agent that is known to
have an effect on the expression of the reporter gene, preferably
an agent that effects the activity of a human tRNA splicing
endonuclease). Alternatively, alterations in the expression of a
reporter gene may be determined by comparing the level of
expression of the reporter gene to a previously determined
reference range.
[0475] 4.5.5.2 Cell-Free Assays
[0476] After a vector containing the reporter gene construct is
produced, a cell-free translation extract is generated or
purchased, and a compound library is synthesized or purchased or
both, the cell-free translation extract and nucleic acid are used
to screen the library to identify compounds that modulate the
activity of tRNA splicing endonuclease or 3' end pre-mRNA
endonuclease. The reporter gene-based assays may be conducted in a
cell-free manner by contacting a compound with a cell-free extract
and a reporter gene construct comprising the reporter gene
construct (which, depending on whether 3' end pre-mRNA endonuclease
activity or pre-tRNA splicing endonuclease activity is to be
assayed, comprises a reporter gene and a pre-tRNA splice site or a
3' end pre-mRNA endonuclease site, respectively), and measuring the
expression of said reporter gene. The alteration in reporter gene
expression relative to a previously determined reference range, the
absence of the compound or a control in such reporter-gene based
assays indicates that a particular compound modulates the activity
of a tRNA splicing endonuclease or a pre-tRNA splicing
endonuclease.
[0477] The activity of a compound in the cell-free extract can be
determined by assaying the activity of a reporter protein encoded
by a reporter gene, or alternatively, by quantifying the expression
of the reporter gene by, for example, labeling the in vitro
translated protein (e.g., with .sup.35S-labeled methionine),
northern blot analysis, RT-PCR or by immunological methods, such as
western blot analysis or immunoprecipitation. Such methods are
well-known to one of skill in the art.
[0478] 4.5.6 FRET Assays
[0479] Fluorescence resonance energy transfer ("FRET") can be used
to detect alterations in the activity of a tRNA splicing
endonuclease or a 3' end pre-mRNA endonuclease complex. In the FRET
assays described herein, the subunits of a complex of the invention
or a substrate for a tRNA splicing endonuclease or a 3' end
pre-mRNA endonuclease complex may be labeled with fluorophores.
[0480] In order to obtain FRET between the fluorescent donor moiety
and the fluorescent acceptor moiety or a quencher, the two moieties
have to be in spatial proximity with each other. Thus, in certain
embodiments, a substrate or subunits of a complex of the invention
are labeled such that the fluorescent donor moiety and the
fluorescent acceptor moiety or a quencher are at most 0.5 nm, at
most 1 nm, at most 5 nm, at most 10 nm, at most 20 nm, at most 30
nm, at most 40 nm, at most 50 nm or at most 100 nm apart from each
other.
[0481] Any nucleotide sequence recognized and excised by a human
tRNA splicing endonuclease may be utilized as a substrate for a
human tRNA splicing endonuclease in a FRET assay described herein.
For example, a nucleotide sequence comprising a bulge-helix-bulge
structure or a mature domain of a precursor tRNA may be utilized as
a substrate for a human tRNA splicing endonuclease in a FRET assay
described herein. A nucleotide sequence recognized and excised by a
human tRNA splicing endonuclease may comprise 10 nucleotides, 15
nucleotides, 20 nucleotides, 25 nucleotides, 25 nucleotides, 30
nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55
nucleotides, 60 nucleotides, 65 nucleotides, 75 nucleotides, 100
nucleotides, 125 nucleotides, 150 nucleotides, or more. In a
specific embodiment, the substrates for a tRNA splicing
endonuclease utilized in the FRET assays described herein comprise
a tRNA intron. The substrate may comprise a bulge-helix-bulge
conformation. In a preferred embodiment, the substrate comprises a
tRNA mature domain that contains an intron.
[0482] In certain embodiments, the substrates depicted in FIG. 1
are used in the FRET assays. In particular, the hybridized tRNA
substrate and circularly permuted tRNA substrate depicted in FIGS.
1B and 1C, respectively, are used in the FRET assays. The free 5'
and 3' ends of the intron of the hybridized tRNA substrate (FIG.
1B) or the free 5' and 3' ends of the intron of circularly permuted
tRNA substrate (FIG. 1C) may be labeled with a fluorophore such
that the close spatial proximity of the fluorophore on the 5' end
with the fluorophore on the 3' end results in fluorescence
resonance energy transfer. Cleavage of the substrate will then
result in a spatial separation of the labeled 5' end from the
labeled 3' end and thus, in reduced fluorescence resonance energy
transfer. Thus, the skilled artisan can measure FRET and determine
the concentration of cleaved versus uncleaved substrate. The
concentration of uncleaved substrate decreases as FRET
declines.
[0483] Alternatively, the 3' end or the 5' end is labeled with a
fluorophore and the other end, i.e., the 5' end or the 3' end,
respectively, is labeled with a quencher of the fluorophore. Upon
cleavage of the intron by tRNA splicing endonculease, the quencher
and the fluorophore are separated from each other resulting in a
measurable change in fluorescence. The fluorescence signal
increases as the cleavage reaction proceeds.
[0484] In certain embodiments, a substrate of 3' end pre-mRNA
endonuclease complex is labeled such that its cleavage would result
in loss of FRET, i.e., one end is labeled with the donor
fluorophore and the other end is labeled with an acceptor
fluorophore. Alternatively, a substrate of 3' end pre-mRNA
endonuclease complex is labeled such that its cleavage would result
in emergence of a signal. In this embodiment, one end of the
substrate is labeled with a fluorophore and the other end is
labeled with a quencher.
[0485] In accordance with the invention, a substrate can be labeled
with a single pair of fluorescent donor and acceptor moieties. A
substrate can be labeled with different pairs of fluorescent donor
moieties and fluorescent acceptor moieties. For example, two,
three, four, five or more pairs of fluorescent donor moieties and
fluorescent acceptor moieties can be used. In this situation,
preferably, at least one of the pairs comprise a fluorescent
acceptor moiety that has a different emission spectrum from the
fluorescent acceptor moiety of at least one of the other pairs.
Alternatively, when at least three pairs are used, the fluorescent
acceptor moiety of the first pair, second pair and third pair has a
different emission spectrum than the fluorescent acceptor moiety of
the other two. Methods for labeling the substrate with a
fluorescent acceptor moiety, a fluorescent donor moiety and/or
quencher are well-known in the art (see, e.g., U.S. Pat. Nos.
6,472,156, 6,451,543, 6,348,322, 6,342,379, 6,323,039, 6,297,018,
6,291,201, 6,280,981, 5,843,658, and 5,439,797, the disclosures of
which are incorporated by reference in their entirety). The labeled
substrate can be microinjected or transfected into human cells
(preferably, mammalian cells and more preferably, human cells)
utilizing techniques well-known to one of skill in the art (see,
e.g., Adams et al., 1991, Nature 349:694-697).
[0486] 4.5.6.1 Cell-Based Assays with a Labeled Substrate
[0487] The FRET cell-based assays may be conducted by
microinjecting or transfecting (e.g., using liposomes or
electroporation) a substrate for a tRNA splicing endonuclease or a
substrate for a 3' end pre-mRNA endonuclease into a cell and
contacting the cell with a compound, wherein the substrate is
labeled such that its cleavage by either 3' end pre-mRNA
endonuclease complex or the pre-tRNA splicing endonuclease complex
would result in the loss of FRET or the emergence of fluorescence,
e.g., fluorescence microscopy or a fluorescence emission detector
such as a Viewlux or Analyst.
[0488] In certain embodiments, a substrate is labeled with a
fluorophore and a quencher in spatial proximity such that the
quencher reduces or eliminates the signal emitted from the
flourophore. Upon cleavage of the labeled substrate the quencher
and the flourophore are no longer in spatial proximity and the
signal emitted from the fluorophore increases or emerges. The
labeled substrate is then microinjected or transfected into a cell
for assaying the effect of a compound on 3' end pre-mRNA
endonuclease activity or pre-tRNA endonuclease activity. In other
embodiments, a substrate can be labeled with two different
fluorophores. The FRET cell-based assays may be conducted by
microinjecting or transfecting a substrate for a human tRNA
splicing endonuclease into a cell and contacting the cell with a
compound, wherein the substrate is labeled at the 5' end with a
fluorescent donor moiety and labeled at the 3' end with a
fluorescent acceptor moiety, or, alternatively, the substrate is
labeled at the 5' end with a fluorescent acceptor moiety and
labeled at the 3' end with a fluorescent donor moiety, and
measuring the fluorescence of the substrate by, e.g., fluorescence
microscopy or a fluorescence emission detector such as a Viewlux or
Analyst. The endogenous tRNA splicing endonuclease will cleave the
substrate and result in the production of a detectable fluorescent
signal by the fluorescent donor moiety and fluorescent acceptor
moiety at the wavelength of the fluorescent donor moiety. A
compound that inhibits or reduces the activity of the endogenous
tRNA splicing endonuclease will inhibit or reduce cleavage of the
substrate and thus, increase the fluorescence emission of the
fluorescent acceptor moiety at the wavelength of the fluorescent
donor moiety relative to a negative control (e.g., PBS). A compound
that enhances the activity of the endogenous tRNA splicing
endonuclease will enhance the cleavage of the substrate and thus,
reduce the fluorescence emission of the fluorescent acceptor moiety
at the wavelength of the fluorescent donor moiety relative to a
negative control (e.g., PBS). In a preferred embodiment, a negative
control (e.g., PBS or another agent that is known to have no effect
on the cleavage of the substrate) and a positive control (e.g., an
agent that is known to have an effect on the cleavage of the
substrate) are included in the FRET cell-based assays described
herein.
[0489] Alternatively, the FRET cell-based assays may be conducted
by microinjecting or transfecting a substrate for a human tRNA
splicing endonuclease into a cell and contacting the cell with a
compound, wherein the substrate is labeled at the 5' end with a
fluorescent donor moiety and labeled at the 3' end with a
fluorescent acceptor moiety, or, alternatively, the substrate is
labeled at the 5' end with a fluorescent acceptor moiety and
labeled at the 3' end with a fluorescent donor moiety, and
measuring the fluorescence of the substrate by, e.g., fluorescence
microscopy or a fluorescence emission detector such as a Viewlux or
Analyst. The endogenous tRNA splicing endonuclease will cleave the
substrate and result in the production of a detectable fluorescent
signal by the fluorescent donor moiety and fluorescent acceptor
moiety at the wavelength of the fluorescent donor moiety. A
compound that inhibits or reduces the activity of the endogenous
tRNA splicing endonuclease will inhibit or reduce cleavage of the
substrate and thus, increase the fluorescence emission of the
fluorescent acceptor moiety at the wavelength of the fluorescent
donor moiety relative to a negative control (e.g., PBS). A compound
that enhances the activity of the endogenous tRNA splicing
endonuclease will enhance the cleavage of the substrate and thus,
reduce the fluorescence emission of the fluorescent acceptor moiety
at the wavelength of the fluorescent donor moiety relative to a
negative control (e.g., PBS). In a preferred embodiment, a negative
control (e.g., PBS or another agent that is known to have no effect
on the cleavage of the substrate) and a positive control (e.g., an
agent that is known to have an effect on the cleavage of the
substrate) are included in the FRET cell-based assays described
herein.
[0490] The assay can be conducted in any buffer system that
provides conditions conducive to the tRNA endonuclease reaction.
Such buffer systems are well known to the skilled artisan. In a
specific embodiment, the buffer is the medium in which the cell
culture is kept. Care should be taken that Magnesium ions are
present in the medium.
[0491] In certain embodiments, the assay is conducted for at least
0.2 hours, 0.25 hours, 0.5 hours, 1 hour, 2 hours, 3 hours, 4
hours, 5 hours, 6 hours, 8 hours, 10 hours, 12 hours, 18 hours, or
at least 1 day.
[0492] In a specific embodiment, the invention provides a method of
identifying an antiproliferative compound that inhibits or reduces
human tRNA splicing endonuclease activity, said method comprising:
(a) microinjecting or transfecting a substrate of a tRNA splicing
endonuclease into a human cell, wherein the substrate is labeled at
the 5' end with a fluorophore and labeled at the 3' end with a
quencher, or alternatively, the substrate is labeled at the 5' end
with a quencehr and labeled at the 3' end with a fluorophore; (b)
contacting the cell with a compound or a member of a library of
compounds; and (c) measuring the activity of the tRNA splicing
endonuclease, wherein an antiproliferative compound that inhibits
or reduces tRNA splicing activity is identified if a fluorescent
signal is not detectable in the presence of the compound relative
to the absence of the compound or the presence of a control. In
another embodiment, the invention provides a method of identifying
an antiproliferative compound that inhibits or reduces human tRNA
splicing endonuclease activity, said method comprising: (a)
contacting a human cell containing a substrate of a tRNA splicing
endonuclease with a compound or a member of a library of compounds,
wherein the substrate is labeled at the 5' end with a fluorophore
and at the 3' end with a quencher, or alternatively, the substrate
is labeled at the 5' end with a quencehr and labeled at the 3' end
with a fluorophore; and (b) measuring the activity of the tRNA
splicing endonuclease, wherein an antiproliferative compound that
inhibits or reduces tRNA splicing activity is identified if a
fluorescent signal is not detectable in the presence of the
compound relative to the absence of the compound or the presence of
a control.
[0493] In another embodiment, the invention provides a method of
identifying an antiproliferative compound that inhibits or reduces
human tRNA splicing endonuclease activity, said method comprising:
(a) microinjecting or transfecting a substrate of a tRNA splicing
endonuclease into a human cell, wherein the substrate is labeled at
the 5' end with a fluorescent donor moiety and labeled at the 3'
end with a fluorescent acceptor moiety, or alternatively, the
substrate is labeled at the 5' end with a fluorescent acceptor
moiety and labeled at the 3' end with a fluorescent donor moiety;
(b) contacting the cell with a compound or a member of a library of
compounds; and (c) measuring the activity of the tRNA splicing
endonuclease, wherein an antiproliferative compound that inhibits
or reduces tRNA splicing activity is identified if the fluorescent
signal detected in the presence of the compound is altered relative
to the absence of the compound or the presence of a control. In
another embodiment, the invention provides a method of identifying
an antiproliferative compound that inhibits or reduces human tRNA
splicing endonuclease activity, said method comprising: (a)
contacting a human cell containing substrate of a tRNA splicing
endonuclease with a compound or a member of a library of compounds,
wherein the substrate is labeled at the 5' end with a fluorescent
donor moiety and labeled at the 3' end with a fluorescent acceptor
moiety, or alternatively, the substrate is labeled at the 5' end
with a fluorescent acceptor moiety and labeled at the 3' end with a
fluorescent donor moiety; and (b) measuring the activity of the
tRNA splicing endonuclease, wherein an antiproliferative compound
that inhibits or reduces tRNA splicing activity is identified if
the fluorescence emission of the fluorescent acceptor moiety at the
wavelength of the fluorescent donor moiety in the presence of the
compound is reduced relative to the absence of the compound or the
presence of a control.
[0494] The activity of a compound on a human tRNA splicing
endonuclease or a 3' end pre-mRNA endonuclease in the FRET
cell-based assays can be determined by measuring the fluorescent
emission spectra of the substrate utilizing techniques well-known
to one of skill in the art. The fluorescent emission spectra
measured depends, in part, on the fluorophore used.
[0495] 4.5.6.2 Cell-Free Assays with a Labeled Substrate
[0496] The FRET cell-free assays for human tRNA splicing
endonuclease may be conducted by contacting a substrate for a human
tRNA splicing endonuclease with a cell-free extract (see Section
4.4.1.2 supra regarding cell-free extracts, preferably, a tRNA
splicing endonuclease extract) or a purified human tRNA splicing
endonuclease and a compound, wherein the substrate is labeled at
the 5' end with a fluorophore and labeled at the 3' end with a
quencher or, alternatively, the the substrate is labeled at the 3'
end with a fluorophore and labeled at the 5' end with a quencher,
and measuring the fluorescence of the substrate in, e.g., a
fluorescence emission detector such as a Viewlux or Analyst. The
tRNA splicing endonuclease in the cell-free extract will cleave the
substrate and result in the production of a detectable fluorescent
signal. A compound that inhibits or reduces the activity of the
tRNA splicing endonuclease will inhibit or reduce the cleavage of
the substrate and thus, inhibit or reduce the production of a
detectable fluorescent signal relative to a negative control (e.g.,
PBS). A compound that enhances the activity of the tRNA splicing
endonuclease will enhance the cleavage of the substrate and thus,
increase the production of a detectable signal relative to a
negative control (e.g., PBS).
[0497] Alternatively, the FRET cell-free-based assays for human
tRNA splicing endonuclease may be conducted by contacting a
substrate for a human tRNA splicing endonuclease with a cell-free
extract (preferably, a tRNA splicing endonuclease extract) or a
purified human tRNA splicing endonuclease and a compound, wherein
the substrate is labeled at the 5' end with a fluorescent donor
moiety and labeled at the 3' end with a fluorescent acceptor
moiety, or alternatively, the substrate is labeled at the 5' end
with a fluorescent acceptor moiety and labeled at the 3' end with a
fluorescent donor moiety, and measuring the fluorescence of the
substrate by, e.g., a fluorescence emission detector such as a
Viewlux or Analyst. The tRNA splicing endonuclease will cleave the
substrate and result in the production of a detectable fluorescent
signal by the fluorescent donor moiety and fluorescent acceptor
moiety at the wavelength of the fluorescent donor moiety. A
compound that inhibits or reduces the activity of the tRNA splicing
endonuclease will inhibit or reduce cleavage of the substrate and
thus, increase the fluorescence emission of the fluorescent
acceptor moiety at the wavelength of the fluorescent donor moiety
relative to a negative control (e.g., PBS). A compound that
enhances the activity of the tRNA splicing endonuclease will
enhance the cleavage of the substrate and thus, reduce the
fluorescence emission of the fluorescent acceptor moiety at the
wavelength of the fluorescent donor moiety relative to a negative
control (e.g., PBS). In a preferred embodiment, a negative control
(e.g., PBS or another agent that is known to have no effect on the
cleavage of the substrate) and a positive control (e.g., an agent
that is known to have an effect on the cleavage of the substrate)
are included in the FRET cell-free assays described herein.
[0498] The FRET cell-free assays for human 3' end mRNA endonuclease
may be conducted by contacting a substrate for a human 3' end
pre-mRNA endonuclease with a cell-free extract (see Section 4.4.1.2
supra regarding cell-free extracts, preferably, a tRNA splicing
endonuclease extract) or a purified human 3' end pre-mRNA
endonuclease and a compound, wherein the substrate is labeled at
the 5' end with a fluorophore and labeled at the 3' end with a
quencher or, alternatively, the substrate is labeled at the 3' end
with a fluorophore and labeled at the 5' end with a quencher, and
measuring the fluorescence of the substrate in, e.g., a
fluorescence emission detector such as a Viewlux or Analyst. The 3'
end pre-mRNA endonuclease in the cell-free extract will cleave the
substrate and result in the production of a detectable fluorescent
signal. A compound that inhibits or reduces the activity of the 3'
end pre-mRNA endonuclease will inhibit or reduce the cleavage of
the substrate and thus, inhibit or reduce the production of a
detectable fluorescent signal relative to a negative control (e.g.,
PBS). A compound that enhances the activity of the 3' end pre-mRNA
endonuclease will enhance the cleavage of the substrate and thus,
increase the production of a detectable signal relative to a
negative control (e.g., PBS).
[0499] The FRET cell-free assays for human 3' end mRNA endonuclease
may be conducted by contacting a substrate for a human 3' end
pre-mRNA endonuclease with a cell-free extract (see Section 4.4.1.2
supra regarding cell-free extracts, preferably, a tRNA splicing
endonuclease extract) or a purified human 3' end pre-mRNA
endonuclease and a compound, wherein the substrate is labeled at
the 5' end with a fluorophore donor and labeled at the 3' end with
a fluorophore acceptor or, alternatively, the substrate is labeled
at the 3' end with a fluorophore donor and labeled at the 5' end
with a fluorophore acceptor, and measuring the fluorescence of the
substrate in, e.g., a fluorescence emission detector such as a
Viewlux or Analyst. The 3' end pre-mRNA endonuclease or tRNA
splicing endonuclease in the cell-free extract will cleave the
substrate and result in the production of a detectable fluorescent
signal. A compound that inhibits or reduces the activity of the 3'
end pre-mRNA endonuclease or tRNA splicing endonuclease will
inhibit or reduce the cleavage of the substrate and thus, increase
the production of a detectable signal relative to a negative
control (e.g., PBS). A compound that enhances the activity of the
3' end pre-mRNA endonuclease or tRNA splicing endonuclease will
enhance the cleavage of the substrate and thus, inhibit or reduce
the production of a detectable fluorescent signal relative to a
negative control (e.g., PBS).
[0500] A FRET assay can be conducted in any buffer system that
provides conditions conducive to the tRNA endonuclease reaction.
Such buffer systems are well known to the skilled artisan. In a
specific embodiment, the buffer comprises 20 mM Tris at a pH of
7.0, 50 mM KCl, 0.1 mM DTT, 5 mM MgCl.sub.2, and 0.4% Triton X100.
Care should be taken that pH, salt concentration, detergent
concentration etc. of the buffer system do not interfere with
FRET.
[0501] In certain embodiments, the assay is conducted for at least
0.2 hours, 0.25 hours, 0.5 hours, 1 hour, 2 hours, 3 hours, 4
hours, 5 hours, 6 hours, 8 hours, 10 hours, 12 hours, 18 hours, or
at least 1 day.
[0502] In one embodiment, the invention provides a method of
identifying an antiproliferative compound that inhibits or reduces
human tRNA splicing endonuclease activity, said method comprising:
(a) contacting a human cell-free extract (preferably, a tRNA
splicing endonuclease extract) or a purified human tRNA splicing
endonuclease with a substrate of a tRNA splicing endonuclease and a
member of a library of compounds, wherein the substrate is labeled
at the 5' end with a fluorophore and labeled at the 3' end with a
quencher, or alternatively, the substrate is labeled at the 5' end
with a quencher and labeled at the 3' end with a fluorophore; and
(b) measuring the activity of the tRNA splicing endonuclease,
wherein an antiproliferative compound that inhibits or reduces tRNA
splicing activity is identified if a fluorescent signal is not
detectable in the presence of the compound relative to the absence
of the compound or the presence of a control. In another
embodiment, the invention provides a method of identifying an
antiproliferative compound that inhibits or reduces human tRNA
splicing endonuclease activity, said method comprising: (a)
contacting a human cell-free extract (preferably, a tRNA splicing
endonuclease extract) or a purified human tRNA splicing
endonuclease with a substrate of a tRNA splicing endonuclease and a
member of a library of compounds, wherein said substrate is labeled
at the 5' end with a fluorescent donor moiety and labeled at the 3'
end with a fluorescent acceptor moiety, or alternatively, the
substrate is labeled at the 5' end with a fluorescent acceptor
moiety and labeled at the 3' end with a fluorescent donor moiety;
and (b) measuring the activity of the tRNA splicing endonuclease,
wherein an antiproliferative compound that inhibits tRNA splicing
activity is identified if the fluorescence emission of the
fluorescent acceptor moiety at the wavelength of the fluroescent
donor moiety detected in the presence of the compound is decreased
relative to the absence of the compound or the presence of a
control.
[0503] In one embodiment, the invention provides a method of
identifying an antiproliferative compound that inhibits or reduces
human 3' pre-mRNA endonuclease activity, said method comprising:
(a) contacting a human cell-free extract (preferably, a 3' pre-mRNA
endonuclease extract) or a purified human 3' pre-mRNA endonuclease
with a substrate of a 3' pre-mRNA endonuclease and a member of a
library of compounds, wherein the substrate is labeled at the 5'
end with a fluorophore and labeled at the 3' end with a quencher,
or alternatively, the substrate is labeled at the 5' end with a
quencher and labeled at the 3' end with a fluorophore; and (b)
measuring the activity of the 3' pre-mRNA endonuclease, wherein an
antiproliferative compound that inhibits or reduces 3' pre-mRNA
endonuclease activity is identified if a fluorescent signal is not
detectable in the presence of the compound relative to the absence
of the compound or the presence of a control. In another
embodiment, the invention provides a method of identifying an
antiproliferative compound that inhibits or reduces human 3'
pre-mRNA endonuclease activity, said method comprising: (a)
contacting a human cell-free extract (preferably, a 3' pre-mRNA
endonuclease extract) or a purified human 3' pre-mRNA endonuclease
with a substrate of a tRNA splicing endonuclease and a member of a
library of compounds, wherein said substrate is labeled at the 5'
end with a fluorescent donor moiety and labeled at the 3' end with
a fluorescent acceptor moiety, or alternatively, the substrate is
labeled at the 5' end with a fluorescent acceptor moiety and
labeled at the 3' end with a fluorescent donor moiety; and (b)
measuring the activity of the 3' pre-mRNA endonuclease, wherein an
antiproliferative compound that inhibits tRNA splicing activity is
identified if the fluorescence emission of the fluorescent acceptor
moiety at the wavelength of the fluroescent donor moiety detected
in the presence of the compound is decreased relative to the
absence of the compound or the presence of a control.
[0504] The activity of a compound on a human tRNA splicing
endonuclease or 3' pre-mRNA endonuclease in the FRET cell-free
assays can be determined by measuring the fluorescent emission
spectra of the substrate utilizing techniques well-known to one of
skill in the art. The fluorescent emission spectra measured
depends, in part, on the fluorophore used.
[0505] 4.5.6.3 Cell-Based Assays with Labeled Enzyme
[0506] A FRET cell-based assay may be conducted by microinjecting
or transfecting a first subunit of a human tRNA splicing
endonuclease (see Table 1 for the components of the complex)
labeled with a fluorophore and a second, different subunit of a
human tRNA splicing endonuclease (see Table 1 for the components of
the complex) labeled with a quencher into a cell and contacting the
cell with a compound, and measuring the fluorescence of the human
tRNA splicing endonuclease by, e.g., fluorescence microscopy or a
fluorescence emission detector such as a Viewlux or Analyst.
Preferably, the cell microinjected or transfected is deficient in
one or more of the subunits of the human tRNA splicing
endonuclease. Any methods known to the skilled artisan can be used
to remove the expression and/or function of one or more subunits of
the human tRNA splicing endonuclease from the cell. In a specific
embodiment, RNAi is used to transiently remove one or more of the
subunits of the human tRNA splicing endonuclease. The formation of
the human tRNA splicing endonuclease from the labeled subunits will
result in a reduction in the fluorescence detectable. A compound
that inhibits or reduces the formation of the human tRNA splicing
endonuclease will reduce or inhibit the production of a detectable
fluorescent signal relative to a negative control (e.g., PBS). A
compound that enhances the formation of the human tRNA splicing
endonuclease will increase the fluorescence detectable relative to
a negative control (e.g., PBS).
[0507] Alternatively, a FRET cell-based assay may be conducted by
microinjecting a first subunit of a human tRNA splicing
endonuclease (e.g., SEN2) labeled with a fluorescent donor moiety
and a second, different subunit of a human tRNA splicing
endonuclease (e.g., SEN34) labeled with a fluorescent acceptor
moiety into a cell and contacting the cell with a compound, and
measuring the fluorescence of the human tRNA splicing endonuclease
by, e.g., fluorescence microscopy or a fluorescence emission
detector such as a Viewlux or Analyst. The formation of the human
tRNA splicing endonuclease will result in the production of a
detectable fluorescent signal by the fluorescent donor moiety and
fluorescent acceptor moiety at the wavelength of the fluorescent
donor moiety. A compound that inhibits or reduces the formation of
the human tRNA splicing endonuclease will reduce the fluorescence
emission of the fluorescent acceptor moiety at the wavelength of
the fluorescent donor moiety relative to a negative control (e.g.,
PBS). A compound that enhances the formation of the human tRNA
splicing endonuclease will increase the fluorescence emission of
the fluorescent acceptor moiety at the wavelength of the
fluorescent donor moiety relative to a negative control (e.g.,
PBS). In a preferred embodiment, a negative control (e.g., PBS or
another agent that is known to have no effect on the cleavage of
the substrate) and a positive control (e.g., an agent that is known
to have an effect on the cleavage of the substrate) are included in
the FRET cell-based assays described herein.
[0508] In certain embodiments, the compound and the cell are
incubated for at least 0.2 hours, 0.25 hours, 0.5 hours, 1 hour, 2
hours, 3 hours, 4 hours, 5 hours, 6 hours, 8 hours, 10 hours, 12
hours, 18 hours, or at least 1 day.
[0509] Methods for labeling a subunit of a human tRNA splicing
endonuclease with a fluorescent acceptor moiety, a fluorescent
donor moiety and/or quencher are well-known in the art (see, e.g.,
U.S. Pat. Nos. 6,472,156, 6,451,543, 6,348,322, 6,342,379,
6,323,039, 6,297,018, 6,291,201, 6,280,981, 5,843,658, and
5,439,797, the disclosures of which are incorporated by reference
in their entirety).
[0510] Such an assay can analogously be used to identify modulators
of 3' end pre-mRNA processing, rRNA endonuclease or tRNA
endonuclease activity.
[0511] 4.5.6.4 Cell-Free Assays with Labeled Enzyme
[0512] A FRET cell-free assay may be conducted by contacting a
first subunit of a human tRNA splicing endonuclease (see Table 1
for the components of the complex) labeled with a fluorophore and a
second subunit of a human tRNA splicing endonuclease (see Table 1
for the components of the complex) labeled with a quencher with a
compound in vitro under conditions conducive to the formation of
the endonuclease, and measuring the fluorescence of the human tRNA
splicing endonuclease by, e.g., a fluorescence emission detector
such as a Viewlux or Analyst. The formation of the human tRNA
splicing endonuclease from the labeled subunits will result in a
reduction in the fluorescence detectable. A compound that inhibits
or reduces the formation of the human tRNA splicing endonuclease
will enhance the production of detectable fluorescent signal
relative to the absence of the compound or the presence of a
negative control (e.g., PBS). A compound that enhances the
formation of the human tRNA splicing endonuclease will reduce or
inhibit the fluorescence detectable relative to the absence of the
compound or a negative control (e.g., PBS).
[0513] Alternatively, a FRET cell-free assay may be conducted by
contacting a first subunit of a human tRNA splicing endonuclease
(e.g., SEN2) labeled with a fluorescent donor moiety and a second,
different subunit of a human tRNA splicing endonuclease (e.g.,
SEN34) labeled with a fluorescent acceptor moiety with a compound
in vitro under conditions conducive to the formation of the
endonuclease, and measuring the fluorescence of the human tRNA
splicing endonuclease by, e.g., a fluorescence emission detector
such as a Viewlux or Analyst. The formation of the human tRNA
splicing endonuclease will result in the production of a detectable
fluorescent signal by the fluorescent donor moiety and fluorescent
acceptor moiety at the wavelength of the fluorescent donor. A
compound that inhibits or reduces the formation of the human tRNA
splicing endonuclease will reduce the fluorescence emission of the
fluorescent acceptor moiety at the wavelength of the fluorescent
donor moiety relative to the absence of the compound or the
presence of a negative control (e.g., PBS). A compound that
enhances the formation of the human tRNA splicing endonuclease will
increase the fluorescence emission of the fluorescent acceptor
moiety at the wavelength of the fluorescent donor moiety relative
to the absence of the compound or the presence of a negative
control (e.g., PBS). In a preferred embodiment, a negative control
(e.g., PBS or another agent that is known to have no effect on the
cleavage of the substrate) and a positive control (e.g., an agent
that is known to have an effect on the cleavage of the substrate)
are included in the FRET cell-free assays described herein.
[0514] Such an assay can analogously be used to identify modulators
of 3' end pre-mRNA processing, rRNA endonuclease or tRNA
endonuclease activity.
[0515] 4.5.7 Direct Binding Assays
[0516] Compounds that modulate the activity of pre-tRNA splicing
endonuclease, 3' end pre-mRNA endonuclease, pre-tRNA cleavage or
pre-rRNA cleavage can be identified by direct binding assays. In
particular, compounds that inhibit the activity of a human pre-tRNA
splicing endonuclease, 3' end pre-mRNA endonuclease, pre-tRNA
cleavage or pre-rRNA cleavage by directly or indirectly reducing or
inhibiting the interaction between a substrate and a complex of the
invention. The pre-tRNA splicing endonuclease, a 3' end pre-mRNA
endonuclease, a pre-tRNA cleavage complex or a pre-rRNA cleavage
complex can be purified. Such assays are described in International
Patent Publication Nos. WO 02/083837 and WO 02/083953, the
disclosures of which are hereby incorporated by reference in their
entireties. Briefly, direct binding assays may be conducted by
attaching a library of compounds to solid supports, e.g., polymer
beads, with each solid support having substantially one type of
compound attached to its surface. The plurality of solid supports
of the library is exposed in aqueous solution to a substrate for a
pre-tRNA splicing endonuclease, a 3' end pre-mRNA endonuclease, a
pre-tRNA cleavage complex or a pre-rRNA cleavage complex having a
detectable label, forming a dye-labeled substrate:support-attached
compound complex. Binding of a substrate to a particular compound
labels the solid support, e.g., bead, comprising the compound,
which can be physically separated from other, unlabeled solid
supports. Once labeled solid supports are identified, the chemical
structures of the compounds thereon can be determined by, e.g.,
reading a code on the solid support that correlates with the
structure of the attached compound.
[0517] Alternatively, direct binding assays may be conducted by
contacting a substrate for a pre-tRNA splicing endonuclease, a 3'
end pre-mRNA endonuclease, a pre-tRNA cleavage complex or a
pre-rRNA cleavage complex having a detectable label with a compound
or a member of a library of compounds free in solution, in labeled
tubes or microtiter wells, or a microarray. Compounds in the
library that bind to the labeled substrate of a pre-tRNA splicing
endonuclease, a 3' end pre-mRNA endonuclease, a pre-tRNA cleavage
complex or a pre-rRNA cleavage complex will form a detectably
labeled complex that can be identified and removed from the
uncomplexed, unlabeled compounds in the library, and from
uncomplexed, labeled substrate of a pre-tRNA splicing endonuclease,
a 3' end pre-mRNA endonuclease, a pre-tRNA cleavage complex or a
pre-rRNA cleavage complex, by a variety of methods including, but
not limited to, methods that differentiate changes in the
electrophoretic, chromatographic, or thermostable properties of the
complexed substrate.
[0518] 4.5.8 Fluorescence Polarization Assay
[0519] The effect of a compound on the activity of a pre-tRNA
splicing endonuclease, a 3' end pre-mRNA endonuclease, a pre-tRNA
cleavage complex or a pre-rRNA cleavage complex may be determined
utilizing a fluorescence polarization-based assay. In such an
assay, a fluorescently labeled substrate for pre-tRNA splicing
endonuclease, a 3' end pre-mRNA endonuclease, a pre-tRNA cleavage
complex or a pre-rRNA cleavage complex is contacted with a
cell-free extract (preferably, human tRNA splicing endonuclease
extract or a human 3' end pre-mRNA processing extract) or a
purified pre-tRNA splicing endonuclease, a purified 3' end pre-mRNA
endonuclease, a purified pre-tRNA cleavage complex or a purified
pre-rRNA cleavage complex and a compound or a member of a library
of compounds; and the fluorescently polarized light emitted is
measured. An important aspect of this assay is that the size of the
substrate used in the assay is large enough to distinguish a change
in fluorescent polarized light emitted following cleavage of the
substrate.
[0520] In certain embodiments, substrates for the FP assay can be
labeled with a fluorophore by any method known to the skilled
artisan.
[0521] The pre-tRNA splicing endonuclease, a 3' end pre-mRNA
endonuclease, a pre-tRNA cleavage complex or a pre-rRNA cleavage
complex will cleave the substrate and result in a change in
intensity of emitted polarized light. Fluorescently labeled
substrates when excited with plane polarized light will emit light
in a fixed plane only if they do not rotate during the period
between excitation and emission. The extent of depolarization of
the emitted light depends upon the amount of rotation of the
substrate, which is dependent on the size of the substrate. Small
substrates rotate more than larger substrates between the time they
are excited and the time they emit fluorescent light. A small
fluorescently labeled substrate rotates rapidly and the emitted
light is depolarized. A large fluorescently labeled substrate
rotates more slowly and results in the emitted light remaining
polarized. A compound that inhibits the activity of the pre-tRNA
splicing endonuclease, a 3' end pre-mRNA endonuclease, a pre-tRNA
cleavage complex or a pre-rRNA cleavage complex will inhibit or
reduce the cleavage of the substrate and thus, decrease the
rotation of the substrate relative to a negative control (e.g.,
PBS) or the absence of the compound, which will result in the
emitted light remaining polarized. A compound that enhances the
activity of the pre-tRNA splicing endonuclease, a 3' end pre-mRNA
endonuclease, a pre-tRNA cleavage complex or a pre-rRNA cleavage
complex will enhance the cleavage of the substrate and thus,
increase the rotation of the substrate relative to a negative
control (e.g., PBS) or the absence of the compound, which will
result in more of the emitted light being depolarized.
[0522] The intensities of the light are measured in planes
90.degree. apart and are many times designated the horizontal and
vertical intensities. In some instruments the excitation filter is
moveable while the emission filter is fixed. In certain other
machines the horizontal and vertical intensities are measured
simultaneously via fiber optics. Research grade fluorescence
polarization instruments are commercially available from, e.g., Pan
Vera, BMG Lab Technologies, and UJL Biosystems. Abott provides
clinical laboratory instrumentation. The value of fluorescence
polarization is determined by the following equation: 1
polarization = intensity vertical - intensity horizontal intensity
vertical + intensity horizontal .
[0523] Fluorescence polarization values are most often divided by
1000 and expressed as millipolarization units (mP).
[0524] In a specific embodiment, the hybridized tRNA or circularly
permuted tRNA depicted in FIG. 1 are used as a substrate for the
pre-tRNA splicing endonuclease complex. In accordance with this
embodiment, the 5' end in the intron of the hybridized tRNA or the
circularly permuted tRNA, or the 3' end in the intron of the
hybridized tRNA or the circularly permuted tRNA or both are labeled
with a fluorophore. Upon cleavage, the size of the molecule to
which the fluorophore is attached changes because the intron is
released from the substrate. The decrease in molecular weight of
the labeled molecule results in an increase of depolarization of
light that is emitted from the fluorophore. Measuring the amount of
depolarization allows the skilled artisan to determine the amount
of cleaved substrate.
[0525] 4.5.9 tRNA Endonuclease Suppression Assay
[0526] The effect of a compound or a member of a library of
compounds on the activity of a human tRNA splicing endonuclease may
be determined using a tRNA endonuclease suppression assay. In such
an assay, a host cell is engineered to contain a first reporter
gene construct and a suppressor tRNA; the expression of the
suppressor tRNA is induced; the host cell is contacted with a
compound or a member of a library of compounds; and the expression
of the reporter gene and/or the activity of the protein encoded by
the reporter gene is measured. The first reporter gene construct
comprises a reporter gene with a nonsense codon in its open reading
frame such that the open reading frame is interrupted. Standard
mutagenesis techniques described, e.g., in Sambrook (Sambrook,
1989, Molecular Cloning, A Laboratory Manual, Second Edition; DNA
Cloning, Volumes I and II (Glover, Ed. 1985)) may be used to
introduce a nonsense codon into the open reading frame of any
reporter gene well-known to one of skill in the art. The first
reporter gene construct is transfected into a host cell engineered
to contain a suppressor tRNA. Alternatively, the first reporter
gene is cotransfected into a host cell with a suppressor tRNA. The
suppressor tRNA's expression is regulated by a controllable
regulatory element; such as by a tetracycline regulated regulatory
element (see, e.g., Buvoli et al, 2000, Molecular and Cellular
Biology 20:3116-3124; Park and Bhandary, 1998, Molecular and
Cellular Biology 18:4418-4425) and the suppressor tRNA contains a
tRNA intron in the anticodon stem such that only properly spliced
suppressor tRNA is functional. Expression of functional suppressor
tRNA is dependent on (i) the transcription of the suppressor tRNA,
and (ii) tRNA splicing. The expression of functional suppressor
tRNA suppresses the nonsense codon in the reporter gene and results
in full length, functional reporter gene expression. Accordingly,
the expression of full length, functional reporter gene correlates
with the expression of functional suppressor tRNA, which in turn
correlates with the level of transcription of the suppressor tRNA
and tRNA splicing. The expression of full-length reporter gene and
the activity of the protein encoded by the reporter gene can be
assayed by any method well known to the skilled artisan or as
described herein.
[0527] A compound that inhibits or reduces the activity of a human
tRNA splicing endonuclease will inhibit or reduce the production of
functional suppressor tRNA and thus, reduce the expression of the
reporter gene relative to a previously determined reference range
or a control. A compound that enhances the activity of a human tRNA
splicing endonuclease will enhance the production of functional
suppressor tRNA and thus, enhance the production of the reporter
gene relative to a previously determined reference range or a
control.
[0528] The step of inducing the expression of the suppressor tRNA
may be conducted simultaneously with the step of contacting the
host cell with a compound or at least 5 minutes, at least 15
minutes, at least 0.5 hours, at least 1 hour, at least 1.5 hours,
at least 2 hours, at least 3 hours, at least 4 hours, at least 5
hours, at least 6 hours, at least 8 hours, at least 10 hours or at
least 12 hours before the step of contacting the compound with the
host cell. In certain embodiments, the expression of the suppressor
tRNA is induced by incubating the host cell with an agent such as,
e.g., tetracycline, for approximately 5 minutes, approximately 15
minutes, approximately 0.5 hours, approximately 1 hour,
approximately 1.5 hours, approximately 2 hours, approximately 3
hours, approximately 4 hours, approximately 5 hours, 6
approximately hours, 8 approximately hours, approximately 10 hours
or approximately 12 hours. In other embodiments, the host cell is
contacted with the compound for approximately 5 minutes,
approximately 15 minutes, approximately 0.5 hours, approximately 1
hour, approximately 1.5 hours, approximately 2 hours, approximately
3 hours, approximately 4 hours, approximately 5 hours, 6
approximately hours, 8 approximately hours, approximately 10 hours
or approximately 12 hours.
[0529] Optionally, the host cell is engineered to contain a second
reporter gene construct comprising a reporter gene different from
the first reporter gene that does not contain a nonsense codon. In
a specific embodiment, the reporter genes used in the tRNA
endonuclease suppression assay are Red and Green Click Beetle
luciferase, wherein the Red luciferase contains the nonsense codon.
A host cell may be engineered to stably express the two luciferase
genes and the suppressor tRNA whose expression is regulated by a
controlled regulatory element (such as a tetracycline controlled
regulatory element). In the absence of an agent such as
tetracycline, the suppressor tRNA is not expressed and thus the
red-to-green ratio is low. In the presence of an agent such as
tetracycline, the suppressor tRNA is expressed and thus the
red-to-green ratio increases. For a high throughput screening,
cells are plated in the presence of a compound. After a certain
time-period media containing an agent such as tetracycline is added
to induce suppressor tRNA expression.
[0530] Compounds that inhibit tRNA splicing endonuclease will
decrease the red-to-green ration compared to a control without the
compound. Once compounds are identified in this assay that modulate
the activity of human tRNA splicing endonuclease, they may be
tested using one or more of the assays described above to confirm
their activity.
[0531] 4.5.10 FISH Assay
[0532] The activity of a tRNA splicing endonuclease may be
determined in an assay in which the persistence and quantity of
tRNA intron is detected in a human cell. The amount of tRNA intron
is quantified at different time points after or during the
incubation of the cell with the compound. The tRNA intron can be
detected by means of Fluorescence in situ hybridization (FISH)
using a tRNA intron-specific probe. In certain embodiments, a
control experiment is conducted in parallel wherein the human cell
is not contacted with a compound.
[0533] In the absence of an inhibitor of human tRNA splicing
endonuclease, the splicing reaction is fast and the concentration
of intron in the cell is low. Without being bound by theory,
because the spliced intron is normally degraded the concentration
of tRNA intron in the human cell is below the detection threshold.
In the presence of an inhibitor of human tRNA splicing
endonuclease, the splicing reaction is slowed down and the amount
of tRNA intron increases. Thus, a compound that inhibits human tRNA
splicing endonuclease can be identified by its ability to increase
the level of tRNA intron in the human cell.
[0534] Similarly, the activity of 3' end pre-mRNA endonuclease
complex can be determined using FISH via measuring the amount of
polyadenylated mRNA. An increased level of polyadenylated mRNA
indicates increased activity of 3' end pre-mRNA endonuclease
complex. Thus, if the assay is performed in the presence of a
compound and the level of polyadenylated mRNA is increased the
compound is an activator of 3' end pre-mRNA endonuclease complex.
If the level of polyadenylated mRNA is decreased in the presence of
a compound, the compound is an antagonist of 3' end pre-mRNA
endonuclease complex. Alternatively, the part of the pre-mRNA that
is 3' of the cleavage site can be detected; increased level of the
part of the pre-mRNA that is 3' of the cleavage site indicates a
decreased activity of 3' end pre-mRNA endonuclease complex. Thus,
if the assay is performed in the presence of a compound and the
level of polyadenylated mRNA is increased the compound is an
antagonist of 3' end pre-mRNA endonuclease complex. If the level of
polyadenylated mRNA is decreased in the presence of a compound, the
compound is an activator of 3' end pre-mRNA endonuclease
complex.
[0535] Methods for conducting FISH are well-known to the skilled
artisan and can be used with the invention. Exemplary methods for
FISH are described in Sarkar and Hopper, 1998 (Mol. Biol. Cell
9:3041-3055), which is incorporated herein in its entirety.
[0536] In certain embodiments, a FISH assay is used to determine
the effect of a compound on the activity of a human tRNA splicing
endonuclease or 3' end pre-mRNA endonuclease in a high-throughput
screen. In particular a 96-lens microscope can be used for a
high-throughput screen based on FISH. In a specific embodiment, 96
cell cultures are incubated in a 96-well plate with different
compounds. Subsequently, the cells are subjected to a FISH analysis
using a tRNA intron specific probe or a 3' end pre-mRNA specific
probe and analyzed using the 96-lens microscope. The presence of a
signal or the presence of a significantly stronger signal
demonstrates that tRNA intron or 3' end pre-mRNA, respectively, was
present in the cells at elevated levels and thus the compound is a
candidate inhibitor of tRNA splicing endonuclease or pre-mRNA
endonuclease activity, respectively.
[0537] Without being bound by theory, the FISH assay identifies the
compound as inhibitor of the tRNA splicing endonuclease or 3' end
pre-mRNA endonuclease directly. Thus, in certain embodiments, a
compound that was identified in a FISH assay as an inhibitor of
tRNA splicing or 3' end pre-mRNA endonuclease activity,
respectively, is a primafacie candidate for an inhibitor of tRNA
splicing endonuclease.
[0538] 4.5.11 Other Screening Assays
[0539] The activity of a human tRNA splicing endonuclease, 3' end
pre-mRNA endoncuclease, pre-tRNA cleavage endonuclease or ribosomal
RNA endonuclease may be determined in an assay in which the amount
of substrate for a tRNA splicing endonuclease, 3' end pre-mRNA
endoncuclease, pre-tRNA cleavage endonuclease or ribosomal RNA
endonuclease, respectively, cleaved by the endonuclease in the
presence of a compound relative to a control (preferably, a
negative control and more preferably, a negative control and a
positive control) is detected. Such an assay may be conducted by
contacting or incubating a compound with a labeled substrate for an
tRNA splicing endonuclease, 3' end pre-mRNA endoncuclease, pre-tRNA
cleavage endonuclease or ribosomal RNA endonuclease, respectively
and a cell-free extract or purified tRNA splicing endonuclease, 3'
end pre-mRNA endoncuclease, pre-tRNA cleavage endonuclease or
ribosomal RNA endonuclease under conditions conducive for
endonuclease activity, and measuring the amount of cleaved
substrate. The substrate can be labeled with any detectable agent.
Useful labels in the present invention can include, but are not
limited to, spectroscopic labels such as fluorescent dyes (e.g.,
fluorescein and derivatives such as fluorescein isothiocyanate
(FITC) and Oregon Green.TM., rhodamine and derivatives (e.g., Texas
red, tetramethylrhodimine isothiocynate (TRITC), bora-3a,
4a-diaza-s-indacene (BODIPY.RTM.) and derivatives, etc.),
digoxigenin, biotin, phycoerythrin, AMCA, CyDye.TM., and the like),
radiolabels (e.g., .sup.3H, .sup.125I, .sup.35S, .sup.14C,
.sup.32p, .sup.33P, etc.), enzymes (e.g., horse radish peroxidase,
alkaline phosphatase etc.), spectroscopic colorimetric labels such
as colloidal gold or colored glass or plastic (e.g., polystyrene,
polypropylene, latex, etc.) beads, or nanoparticles--nanoclusters
of inorganic ions with defined dimension from 0.1 to 1000 nm)
utilizing techniques known to one of skill in the art.
[0540] For example, a substrate can be labeled by any method known
to the skilled artisan. In certain embodiments, a substrate can be
labeled using site-specific labeling of RNA with fluorophores. In
more specific embodiments, a substrate is labeled using the methods
described in Qin and Pyle, 1999 (Methods 18(1):60-70), which is
incorporated in its entirety herein. The optimal method for
labeling of a substrate can be determined by the skilled artisan
using routine experimentation. In a specific embodiment, a
substrate is labeled using different methods, different labels
and/or different positions in the substrate. The differently
labeled substrates are then subjected separately to a splicing
assay in the presence and absence, respectively of an inhibitor or
an activator of an endonuclease. The optimal label for the
screening assays is the label that allows for the most easily
detectable and most reproducible detection of the effect of the
inhibitor or the activater. Other labeling procedures, however, may
also be used that, for example, provide other desirable
advantages.
[0541] In certain embodiments, a compound is contacted or incubated
with a labeled substrate and a cell-free extract or purified
endonuclease complex of the invention for at least 5 minutes, at
least 10 minutes, at least 15 minutes, at least 30 minutes, at
least 1 hour, at least 2 hours, or more. The amount of cleaved
substrate is proportional to the activity of the endonuclease. The
amount of cleavage product can be measured by any technique known
to one skilled in the art.
[0542] In certain embodiments, the cleaved product is separated
from the uncleaved RNA substrate by gel-electrophoresis. The amount
of cleaved product can be quantified by measuring the intensity of
the signal of the cleaved substrate. The stronger the signal
produced by the cleaved product relative to the uncleaved substrate
the more active is the endonuclease. The signal intensity can be
quantified using autoradiography or a phosphoimager. If the
activity of the endonuclease is decreased in the presence of a
compound, i.e., if the signal of the cleaved product relative to
the uncleaved substrate is decreased compared to the reaction
without the compound or in the presence of a negative control, the
compound is identified as an inhibitor of the endonuclease.
[0543] In other embodiments, the amount of cleaved product is
determined using mass spectrometry.
[0544] 4.5.12 Compounds
[0545] Any molecule known in the art can be tested for its ability
to modulate (increase or decrease) the amount of, activity of, or
protein component composition of a complex of the present invention
as detected by a change in the amount of, activity of, or protein
component composition of, said complex. By way of example, a change
in the amount of the complex can be detected by detecting a change
in the amount of the complex that can be isolated from a cell
expressing the complex machinery. In other embodiments, a change in
signal intensity (e.g., when using FRET or FP) in the presence of a
compound compare to the absence of the compound indicates that the
compound is a modulator of complex formation. For identifying a
molecule that modulates complex activity, candidate molecules can
be directly provided to a cell expressing the complex, or, in the
case of candidate proteins, can be provided by providing their
encoding nucleic acids under conditions in which the nucleic acids
are recombinantly expressed to produce the candidate proteins
within the cell expressing the complex machinery, the complex is
then purified from the cell and the purified complex is assayed for
activity using methods well known in the art, not limited to those
described, supra.
[0546] In certain embodiments, the invention provides screening
assays using chemical libraries for molecules which modulate, e.g.,
inhibit, antagonize, or agonize, the amount of, activity of, or
protein component composition of the complex. The chemical
libraries can be peptide libraries, peptidomimetic libraries,
chemically synthesized libraries, recombinant, e.g., phage display
libraries, and in vitro translation-based libraries, other
non-peptide synthetic organic libraries, etc.
[0547] Exemplary libraries are commercially available from several
sources (ArQule, Tripos/PanLabs, ChemDesign, Pharmacopoeia). In
some cases, these chemical libraries are generated using
combinatorial strategies that encode the identity of each member of
the library on a substrate to which the member compound is
attached, thus allowing direct and immediate identification of a
molecule that is an effective modulator. Thus, in many
combinatorial approaches, the position on a plate of a compound
specifies that compound's composition. Also, in one example, a
single plate position may have from 1-20 chemicals that can be
screened by administration to a well containing the interactions of
interest. Thus, if modulation is detected, smaller and smaller
pools of interacting pairs can be assayed for the modulation
activity. By such methods, many candidate molecules can be
screened.
[0548] Many diversity libraries suitable for use are known in the
art and can be used to provide compounds to be tested according to
the present invention. Alternatively, libraries can be constructed
using standard methods. Chemical (synthetic) libraries, recombinant
expression libraries, or polysome-based libraries are exemplary
types of libraries that can be used.
[0549] The libraries can be constrained or semirigid (having some
degree of structural rigidity), or linear or non-constrained. The
library can be a cDNA or genomic expression library, random peptide
expression library or a chemically synthesized random peptide
library, or non-peptide library. Expression libraries are
introduced into the cells in which the assay occurs, where the
nucleic acids of the library are expressed to produce their encoded
proteins.
[0550] In one embodiment, peptide libraries that can be used in the
present invention may be libraries that are chemically synthesized
in vitro. Examples of such libraries are given in Houghten et al.,
1991, Nature 354:84-86, which describes mixtures of free
hexapeptides in which the first and second residues in each peptide
were individually and specifically defined; Lam et al., 1991,
Nature 354:82-84, which describes a "one bead, one peptide"
approach in which a solid phase split synthesis scheme produced a
library of peptides in which each bead in the collection had
immobilized thereon a single, random sequence of amino acid
residues; Medynski, 1994, Bio/Technology 12:709-710, which
describes split synthesis and T-bag synthesis methods; and Gallop
et al., 1994, J. Medicinal Chemistry 37(9):1233-1251. Simply by way
of other examples, a combinatorial library may be prepared for use,
according to the methods of Ohlmeyer et al., 1993, Proc. Natl.
Acad. Sci. USA 90:10922-10926; Erb et al., 1994, Proc. Natl. Acad.
Sci. USA 91:11422-11426; Houghten et al., 1992, Biotechniques
13:412; Jayawickreme et al., 1994, Proc. Natl. Acad. Sci. USA
91:1614-1618; or Salmon et al., 1993, Proc. Natl. Acad. Sci. USA
90:11708-11712. PCT Publication No. WO 93/20242 and Brenner and
Lemer, 1992, Proc. Natl. Acad. Sci. USA 89:5381-5383 describe
"encoded combinatorial chemical libraries," that contain
oligonucleotide identifiers for each chemical polymer library
member.
[0551] In a preferred embodiment, the library screened is a
biological expression library that is a random peptide phage
display library, where the random peptides are constrained (e.g.,
by virtue of having disulfide bonding).
[0552] Further, more general, structurally constrained, organic
diversity (e.g., nonpeptide) libraries, can also be used.
[0553] Conformationally constrained libraries that can be used
include but are not limited to those containing invariant cysteine
residues which, in an oxidizing environment, cross-link by
disulfide bonds to form cystines, modified peptides (e.g.,
incorporating fluorine, metals, isotopic labels, are
phosphorylated, etc.), peptides containing one or more
non-naturally occurring amino acids, non-peptide structures, and
peptides containing a significant fraction of
.gamma.-carboxyglutamic acid.
[0554] Libraries of non-peptides, e.g., peptide derivatives (for
example, that contain one or more non-naturally occurring amino
acids) can also be used. One example of these are peptoid libraries
(Simon et al., 1992, Proc. Natl. Acad. Sci. USA 89:9367-9371).
Peptoids are polymers of non-natural amino acids that have
naturally occurring side chains attached not to the alpha carbon
but to the backbone amino nitrogen. Since peptoids are not easily
degraded by human digestive enzymes, they are advantageously more
easily adaptable to drug use. Another example of a library that can
be used, in which the amide functionalities in peptides have been
permethylated to generate a chemically transformed combinatorial
library, is described by Ostresh et al., 1994, Proc. Natl. Acad.
Sci. USA 91:11138-11142).
[0555] The members of the peptide libraries that can be screened
according to the invention are not limited to containing the 20
naturally occurring amino acids. In particular, chemically
synthesized libraries and polysome based libraries allow the use of
amino acids in addition to the 20 naturally occurring amino acids
(by their inclusion in the precursor pool of amino acids used in
library production). In specific embodiments, the library members
contain one or more non-natural or non-classical amino acids or
cyclic peptides. Non-classical amino acids include but are not
limited to the D-isomers of the common amino acids, .alpha.-amino
isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid;
.gamma.-Abu, .epsilon.-Ahx, 6-amino hexanoic acid; Aib, 2-amino
isobutyric acid; 3-amino propionic acid; ornithine; norleucine;
norvaline, hydroxyproline, sarcosine, citrulline, cysteic acid,
t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine,
B-alanine, designer amino acids such as .beta.-methyl amino acids,
C.alpha.-methyl amino acids, N.alpha.-methyl amino acids,
fluoro-amino acids and amino acid analogs in general. Furthermore,
the amino acid can be D (dextrorotary) or L (levorotary).
[0556] In a specific embodiment, fragments and/or analogs of
complexes of the invention, or protein components thereof,
especially peptidomimetics, are screened for activity as
competitive or non-competitive inhibitors of complex activity or
formation.
[0557] In another embodiment of the present invention,
combinatorial chemistry can be used to identify modulators of a the
complexes. Combinatorial chemistry is capable of creating libraries
containing hundreds of thousands of compounds, many of which may be
structurally similar. While high throughput screening programs are
capable of screening these vast libraries for affinity for known
targets, new approaches have been developed that achieve libraries
of smaller dimension but which provide maximum chemical diversity.
(See, e.g., Matter, 1997, Journal of Medicinal Chemistry
40:1219-1229).
[0558] One method of combinatorial chemistry, affinity
fingerprinting, has previously been used to test a discrete library
of small molecules for binding affinities for a defined panel of
proteins. The fingerprints obtained by the screen are used to
predict the affinity of the individual library members for other
proteins or receptors of interest (in the instant invention, the
protein complexes of the present invention and protein components
thereof.) The fingerprints are compared with fingerprints obtained
from other compounds known to react with the protein of interest to
predict whether the library compound might similarly react. For
example, rather than testing every ligand in a large library for
interaction with a complex or protein component, only those ligands
having a fingerprint similar to other compounds known to have that
activity could be tested. (See, e.g., Kauvar et al., 1995,
Chemistry and Biology 2:107-118; Kauvar, 1995, Affinity
fingerprinting, Pharmaceutical Manufacturing International.
8:25-28; and Kauvar, Toxic-Chemical Detection by Pattern
Recognition in New Frontiers in Agrochemical Immunoassay, D. Kurtz.
L. Stanker and J.H. Skerritt. Editors, 1995, AOAC: Washington,
D.C., 305-312).
[0559] Kay et al., 1993, Gene 128:59-65 (Kay) discloses a method of
constructing peptide libraries that encode peptides of totally
random sequence that are longer than those of any prior
conventional libraries. The libraries disclosed in Kay encode
totally synthetic random peptides of greater than about 20 amino
acids in length. Such libraries can be advantageously screened to
identify complex modulators. (See also U.S. Pat. No. 5,498,538
dated Mar. 12, 1996; and PCT Publication No. WO 94/18318 dated Aug.
18, 1994).
[0560] A comprehensive review of various types of peptide libraries
can be found in Gallop et al., 1994, J. Med. Chem.
37:1233-1251.
[0561] Libraries screened using the methods of the present
invention can comprise a variety of types of compounds. Examples of
libraries that can be screened in accordance with the methods of
the invention include, but are not limited to, peptoids; random
biooligomers; diversomers such as hydantoins, benzodiazepines and
dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics;
oligocarbamates; peptidyl phosphonates; peptide nucleic acid
libraries; antibody libraries; carbohydrate libraries; and small
molecule libraries (preferably, small organic molecule libraries).
In some embodiments, the compounds in the libraries screened are
nucleic acid or peptide molecules. In a non-limiting example,
peptide molecules can exist in a phage display library. In other
embodiments, the types of compounds include, but are not limited
to, peptide analogs including peptides comprising non-naturally
occurring amino acids, e.g., D-amino acids, phosphorous analogs of
amino acids, such as .alpha.-amino phosphoric acids and
.alpha.-amino phosphoric acids, or amino acids having non-peptide
linkages, nucleic acid analogs such as phosphorothioates and PNAs,
hormones, antigens, synthetic or naturally occurring drugs,
opiates, dopamine, serotonin, catecholamines, thrombin,
acetylcholine, prostaglandins, organic molecules, pheromones,
adenosine, sucrose, glucose, lactose and galactose. Libraries of
polypeptides or proteins can also be used in the assays of the
invention.
[0562] In a preferred embodiment, the combinatorial libraries are
small organic molecule libraries including, but not limited to,
benzodiazepines, isoprenoids, thiazolidinones, metathiazanones,
pyrrolidines, morpholino compounds, and benzodiazepines. In another
embodiment, the combinatorial libraries comprise peptoids; random
bio-oligomers; benzodiazepines; diversomers such as hydantoins,
benzodiazepines and dipeptides;, vinylogous polypeptides;
nonpeptidal peptidomimetics; oligocarbamates; peptidyl
phosphonates; peptide nucleic acid libraries; antibody libraries;
or carbohydrate libraries. Combinatorial libraries are themselves
commercially available (see, e.g., ComGenex, Princeton, N.J.;
Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo.; ChemStar, Ltd,
Moscow, Russia; 3D Pharmaceuticals, Exton, Pa.; Martek Biosciences,
Columbia, Md.; etc.).
[0563] In a preferred embodiment, the library is preselected so
that the compounds of the library are more amenable for cellular
uptake. For example, compounds are selected based on specific
parameters such as, but not limited to, size, lipophilicity,
hydrophilicity, and hydrogen bonding, which enhance the likelihood
of compounds getting into the cells. In another embodiment, the
compounds are analyzed by three-dimensional or four-dimensional
computer computation programs.
[0564] The combinatorial compound library for use in accordance
with the methods of the present invention may be synthesized. There
is a great interest in synthetic methods directed toward the
creation of large collections of small organic compounds, or
libraries, which could be screened for pharmacological, biological
or other activity. The synthetic methods applied to create vast
combinatorial libraries are performed in solution or in the solid
phase, i.e., on a solid support. Solid-phase synthesis makes it
easier to conduct multi-step reactions and to drive reactions to
completion with high yields because excess reagents can be easily
added and washed away after each reaction step. Solid-phase
combinatorial synthesis also tends to improve isolation,
purification and screening. However, the more traditional solution
phase chemistry supports a wider variety of organic reactions than
solid-phase chemistry.
[0565] Combinatorial compound libraries of the present invention
may be synthesized using the apparatus described in U.S. Pat. No.
6,190,619 to Kilcoin et al., which is hereby incorporated by
reference in its entirety. U.S. Pat. No. 6,190,619 discloses a
synthesis apparatus capable of holding a plurality of reaction
vessels for parallel synthesis of multiple discrete compounds or
for combinatorial libraries of compounds.
[0566] In one embodiment, the combinatorial compound library can be
synthesized in solution. The method disclosed in U.S. Pat. No.
6,194,612 to Boger et al., which is hereby incorporated by
reference in its entirety, features compounds useful as templates
for solution phase synthesis of combinatorial libraries. The
template is designed to permit reaction products to be easily
purified from unreacted reactants using liquid/liquid or
solid/liquid extractions. The compounds produced by combinatorial
synthesis using the template will preferably be small organic
molecules. Some compounds in the library may mimic the effects of
non-peptides or peptides. In contrast to solid phase synthesize of
combinatorial compound libraries, liquid phase synthesis does not
require the use of specialized protocols for monitoring the
individual steps of a multistep solid phase synthesis (Egner et
al., 1995, J. Org. Chem. 60:2652; Anderson et al., 1995, J. Org.
Chem. 60:2650; Fitch et al., 1994, J. Org. Chem. 59:7955; Look et
al., 1994, J. Org. Chem. 49:7588; Metzger et al., 1993, Angew.
Chem., Int. Ed. Engl. 32:894; Youngquist et al., 1994, Rapid
Commun. Mass Spect. 8:77; Chu et al., 1995, J. Am. Chem. Soc.
117:5419; Brummel et al., 1994, Science 264:399; and Stevanovic et
al., 1993, Bioorg. Med. Chem. Lett. 3:431).
[0567] Combinatorial compound libraries useful for the methods of
the present invention can be synthesized on solid supports. In one
embodiment, a split synthesis method, a protocol of separating and
mixing solid supports during the synthesis, is used to synthesize a
library of compounds on solid supports (see e.g., Lam et al., 1997,
Chem. Rev. 97:41-448; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci.
USA 90:10922-10926 and references cited therein). Each solid
support in the final library has substantially one type of compound
attached to its surface. Other methods for synthesizing
combinatorial libraries on solid supports, wherein one product is
attached to each support, will be known to those of skill in the
art (see, e.g., Nefzi et al., 1997, Chem. Rev. 97:449-472).
[0568] As used herein, the term "solid support" is not limited to a
specific type of solid support. Rather a large number of supports
are available and are known to one skilled in the art. Solid
supports include silica gels, resins, derivatized plastic films,
glass beads, cotton, plastic beads, polystyrene beads, alumina
gels, and polysaccharides. A suitable solid support may be selected
on the basis of desired end use and suitability for various
synthetic protocols. For example, for peptide synthesis, a solid
support can be a resin such as p-methylbenzhydrylamine (pMBHA)
resin (Peptides International, Louisville, KY), polystyrenes (e.g.,
PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.),
including chloromethylpolystyrene, hydroxymethylpolystyrene and
aminomethylpolystyrene, poly (dimethylacrylamide)-grafted styrene
co-divinyl-benzene (e.g., POLYHIPE resin, obtained from Aminotech,
Canada), polyamide resin (obtained from Peninsula Laboratories),
polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL
or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin
(obtained from Milligen/Biosearch, California), or Sepharose
(Pharmacia, Sweden).
[0569] In some embodiments of the present invention, compounds can
be attached to solid supports via linkers. Linkers can be integral
and part of the solid support, or they may be nonintegral that are
either synthesized on the solid support or attached thereto after
synthesis. Linkers are useful not only for providing points of
compound attachment to the solid support, but also for allowing
different groups of molecules to be cleaved from the solid support
under different conditions, depending on the nature of the linker.
For example, linkers can be, inter alia, electrophilically cleaved,
nucleophilically cleaved, photocleavable, enzymatically cleaved,
cleaved by metals, cleaved under reductive conditions or cleaved
under oxidative conditions. In a preferred embodiment, the
compounds are cleaved from the solid support prior to high
throughput screening of the compounds.
[0570] In certain embodiments of the invention, the compound is a
small molecule.
[0571] 4.5.13 Characterization of the Structure of Compounds
[0572] If the library comprises arrays or microarrays of compounds,
wherein each compound has an address or identifier, the compound
can be deconvoluted, e.g., by cross-referencing the positive sample
to original compound list that was applied to the individual test
assays.
[0573] If the library is a peptide or nucleic acid library, the
sequence of the compound can be determined by direct sequencing of
the peptide or nucleic acid. Such methods are well known to one of
skill in the art.
[0574] A number of physico-chemical techniques can be used for the
de novo characterization of compounds identified by the screening
methods of the invention. Examples of such techniques include, but
are not limited to, mass spectrometry, NMR spectroscopy, X-ray
crytallography and vibrational spectroscopy.
[0575] 4.5.13.1 Mass Spectrometry
[0576] Mass spectrometry (e.g., electrospray ionization ("ESr"),
matrix-assisted laser desorption-ionization ("MALDI"), and
Fourier-transformation cyclotron resonance ("FT-ICR") can be used
for elucidating the structure of a compound.
[0577] ESI mass spectrometry ("ESI-MS") has been of greater utility
for studying non-covalent molecular interactions because, unlike
the MALDI process, ESI-MS generates molecular ions with little to
no fragmentation (Xavier et al., 2000, Trends Biotechnol.
18(8):349-356). ESI-MS has been used to study the complexes formed
by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et
al., 1997, Anal. Chem. 69:5130-5135).
[0578] Fourier-transformation cyclotron resonance ("FT-ICR") mass
spectrometry provides high-resolution spectra, isotope-resolved
precursor ion selection, and accurate mass assignments (Xavier et
al., 2000, Trends Biotechnol. 18(8):349-356). FT-ICR has been used
to study the interaction of aminoglycoside antibiotics with cognate
and non-cognate RNAs (Hofstadler et al., 1999, Anal. Chem.
71:3436-3440; and Griffey et al., 1999, Proc. Natl. Acad. Sci. USA
96:10129-10133). As true for all of the mass spectrometry methods
discussed herein, FT-ICR does not require labeling a compound.
[0579] 4.5.13.2 NMR Spectroscopy
[0580] NMR spectroscopy is a valuable technique for determining the
structure of a compound by qualitatively determining changes in
chemical shift, specifically from distances measured using
relaxation effects. SAR by NMR can be used to elucidate the
structure of a compound.
[0581] Examples of NMR that can be used for the invention include,
but are not limited to, one-dimentional NMR, two-dimentional NMR,
correlation spectroscopy ("COSY"), and nuclear Overhauser effect
("NOE") spectroscopy. Such methods of structure determination of
compounds are well-known to one of skill in the art.
[0582] 4.5.13.3 X ray Crystallography
[0583] X-ray crystallography can be used to elucidate the structure
of a compound. For a review of x-ray crystallography see, e.g.,
Blundell et al. 2002, Nat Rev Drug Discov 1(1):45-54. The first
step in x-ray crystallography is the formation of crystals. The
formation of crystals begins with the preparation of highly
purified and soluble samples. The conditions for crystallization is
then determined by optimizing several solution variables known to
induce nucleation, such as pH, ionic strength, temperature, and
specific concentrations of organic additives, salts and detergent.
Techniques for automating the crystallization process have been
developed to automate the production of high-quality protein
crystals. Once crystals have been formed, the crystals are
harvested and prepared for data collection. The crystals are then
analyzed by diffraction (such as multi-circle diffractometers,
high-speed CCD detectors, and detector off-set). Generally,
multiple crystals must be screened for structure
determinations.
[0584] 4.5.13.4 Vibrational Spectroscopy
[0585] Vibrational spectroscopy (e.g. infrared (IR) spectroscopy or
Raman spectroscopy) can be used for elucidating the structure of a
compound. Infrared spectroscopy measures the frequencies of
infrared light (wavelengths from 100 to 10,000 nm) absorbed by the
compound as a result of excitation of vibrational modes according
to quantum mechanical selection rules which require that absorption
of light cause a change in the electric dipole moment of the
molecule. The infrared spectrum of any molecule is a unique pattern
of absorption wavelengths of varying intensity that can be
considered as a molecular fingerprint to identify any compound.
[0586] Infrared spectra can be measured in a scanning mode by
measuring the absorption of individual frequencies of light,
produced by a grating which separates frequencies from a
mixed-frequency infrared light source, by the compound relative to
a standard intensity (double-beam instrument) or pre-measured
(`blank`) intensity (single-beam instrument). In a preferred
embodiment, infrared spectra are measured in a pulsed mode
("FT-IR") where a mixed beam, produced by an interferometer, of all
infrared light frequencies is passed through or reflected off the
compound. The resulting interferogram, which may or may not be
added with the resulting interferograms from subsequent pulses to
increase the signal strength while averaging random noise in the
electronic signal, is mathematically transformed into a spectrum
using Fourier Transform or Fast Fourier Transform algorithms.
[0587] Raman spectroscopy measures the difference in frequency due
to absorption of infrared frequencies of scattered visible or
ultraviolet light relative to the incident beam. The incident
monochromatic light beam, usually a single laser frequency, is not
truly absorbed by the compound but interacts with the electric
field transiently. Most of the light scattered off the sample will
be unchanged (Rayleigh scattering) but a portion of the scatter
light will have frequencies that are the sum or difference of the
incident and molecular vibrational frequencies. The selection rules
for Raman (inelastic) scattering require a change in polarizability
of the molecule. While some vibrational transitions are observable
in both infrared and Raman spectrometry, must are observable only
with one or the other technique. The Raman spectrum of any molecule
is a unique pattern of absorption wavelengths of varying intensity
that can be considered as a molecular fingerprint to identify any
compound.
[0588] Raman spectra are measured by submitting monochromatic light
to the sample, either passed through or preferably reflected off,
filtering the Rayleigh scattered light, and detecting the frequency
of the Raman scattered light. An improved Raman spectrometer is
described in U.S. Pat. No. 5,786,893 to Fink et al., which is
hereby incorporated by reference.
[0589] Vibrational microscopy can be measured in a spatially
resolved fashion to address single beads by integration of a
visible microscope and spectrometer. A microscopic infrared
spectrometer is described in U.S. Pat. No. 5,581,085 to Reffner et
al., which is hereby incorporated by reference in its entirety. An
instrument that simultaneously performs a microscopic infrared and
microscopic Raman analysis on a sample is described in U.S. Pat.
No. 5,841,139 to Sostek et al., which is hereby incorporated by
reference in its entirety.
[0590] 4.6 Secondary Assays
[0591] The compounds identified in the assays described supra that
modulate the activity or stability of a pre-tRNA splicing
endonuclease, a 3' end pre-mRNA endonuclease, a pre-tRNA cleavage
complex, rRNA endonuclease or a pre-rRNA cleavage complex (for
convenience referred to herein as a "lead" compound) can be further
tested for both direct binding to RNA and biological activity. In
one embodiment, the compounds are tested for biological activity in
further assays and/or animal models. In another embodiment, the
lead compound is used to design congeners or analogs. In another
embodiment, mutagenesis studies can be conducted to assess the
mechanism by which a lead compound is modulating the activity of a
human pre-tRNA splicing endonuclease, a human 3' end pre-mRNA
endonuclease, a human pre-tRNA cleavage complex, rRNA endonuclease
or a human pre-rRNA cleavage complex. In yet another embodiment, a
lead compound is tested for its ability to affect wound healing in
a model system.
[0592] 4.6.1 Phenotypic or Physiological Readout
[0593] The compounds identified in the assays described supra (for
convenience referred to herein as a "lead" compound) can be tested
for biological activity using host cells containing or engineered
to contain a human tRNA splicing endonuclease or a 3' end pre-mRNA
endonuclease coupled to a functional readout system.
[0594] In one embodiment, the effect of a lead compound can be
assayed by measuring the cell growth or viability of the target
cell. Such assays can be carried out with representative cells of
cell types involved in a particular proliferative disorder. A lower
level of proliferation or survival of the contacted cells indicates
that the lead compound is effective to treat a condition in the
patient characterized by uncontrolled cell growth. Alternatively,
instead of culturing cells from a patient, a lead compound may be
screened using cells of a tumor or malignant cell line or an
endothelial cell line. Specific examples of cell culture models
include, but are not limited to, for lung cancer, primary rat lung
tumor cells (Swafford et al., 1997, Mol. Cell. Biol., 17:1366-1374)
and large-cell undifferentiated cancer cell lines (Mabry et al.,
1991, Cancer Cells, 3:53-58); colorectal cell lines for colon
cancer (Park and Gazdar, 1996, J. Cell Biochem. Suppl. 24:131-141);
multiple established cell lines for breast cancer (Hambly et al.,
1997, Breast Cancer Res. Treat. 43:247-258; Gierthy et al., 1997,
Chemosphere 34:1495-1505; Prasad and Church, 1997, Biochem.
Biophys. Res. Commun. 232:14-19); a number of well-characterized
cell models for prostate cancer (Webber et al., 1996, Prostate,
Part 1, 29:386-394; Part 2, 30:58-64; and Part 3, 30:136-142;
Boulikas, 1997, Anticancer Res. 17:1471-1505); for genitourinary
cancers, continuous human bladder cancer cell lines (Ribeiro et
al., 1997, Int. J. Radiat. Biol. 72:11-20); organ cultures of
transitional cell carcinomas (Booth et al., 1997, Lab Invest.
76:843-857) and rat progression models (Vet et al., 1997, Biochim.
Biophys Acta 1360:39-44); and established cell lines for leukemias
and lymphomas (Drexler, 1994, Leuk. Res. 18:919-927, Tohyama, 1997,
Int. J. Hematol. 65:309-317). More specific examples of cell lines
include the cancer cell line Huh7 (human hepatocellular carcinoma
cell line) and the cancer cell line Caco-2 (a colon-cancer cell
line). In certain embodiments, the effect of a lead compound on the
growth and/or viability of a cancerous cell of a transformed cell
is compared to the effect of such a compound on the growth and/or
viability of non-cancerous, normal cells. Preferably, compounds
that differentially affect the growth and/or viability of cancerous
cells or transformed cells are chosen as anti-proliferative
agents.
[0595] Many assays well-known in the art can be used to assess the
survival and/or growth of a patient cell or cell line following
exposure to a lead compound; for example, cell proliferation can be
assayed by measuring Bromodeoxyuridine (BrdU) incorporation (see,
e.g., Hoshino et al., 1986, Int. J. Cancer 38, 369; Campana et al.,
1988, J. Immunol. Meth. 107:79) or (.sup.3H)-thymidine
incorporation (see, e.g., Chen, J., 1996, Oncogene 13:1395-403;
Jeoung, J., 1995, J. Biol. Chem. 270:18367-73), by direct cell
count, by detecting changes in transcription, translation or
activity of known genes such as proto-oncogenes (e.g.,fos, myc) or
cell cycle markers (Rb, cdc2, cyclin A, D1, D2, D3, E, etc). The
levels of such protein and mRNA and activity can be determined by
any method well known in the art. For example, protein can be
quantitated by known immunodiagnostic methods such as Western
blotting or immunoprecipitation using commercially available
antibodies. mRNA can be quantitated using methods that are well
known and routine in the art, for example, using northern analysis,
RNase protection, the polymerase chain reaction in connection with
the reverse transcription. Cell viability can be assessed by using
trypan-blue staining or other cell death or viability markers known
in the art. In a specific embodiment, the level of cellular ATP is
measured to determined cell viability. Differentiation can be
assessed, for example, visually based on changes in morphology.
[0596] The lead compound can also be assessed for its ability to
inhibit cell transformation (or progression to malignant phenotype)
in vitro. In this embodiment, cells with a transformed cell
phenotype are contacted with a lead compound, and examined for
change in characteristics associated with a transformed phenotype
(a set of in vitro characteristics associated with a tumorigenic
ability in vivo), for example, but not limited to, colony formation
in soft agar, a more rounded cell morphology, looser substratum
attachment, loss of contact inhibition, loss of anchorage
dependence, release of proteases such as plasminogen activator,
increased sugar transport, decreased serum requirement, or
expression of fetal antigens, etc. (see Luria et al., 1978, General
Virology, 3d Ed., John Wiley & Sons, New York, pp.
436-446).
[0597] Loss of invasiveness or decreased adhesion can also be
assessed to demonstrate the anti-cancer effects of a lead compound.
For example, an aspect of the formation of a metastatic cancer is
the ability of a precancerous or cancerous cell to detach from
primary site of disease and establish a novel colony of growth at a
secondary site. The ability of a cell to invade peripheral sites
reflects its potential for a cancerous state. Loss of invasiveness
can be measured by a variety of techniques known in the art
including, for example, induction of E-cadherin-mediated cell-cell
adhesion. Such E-cadherin-mediated adhesion can result in
phenotypic reversion and loss of invasiveness (Hordijk et al.,
1997, Science 278:1464-66).
[0598] Loss of invasiveness can further be examined by inhibition
of cell migration. A variety of 2-dimensional and 3-dimensional
cellular matrices are commercially available
(Calbiochem-Novabiochem Corp. San Diego, Calif.). Cell migration
across or into a matrix can be examined using microscopy,
time-lapsed photography or videography, or by any method in the art
allowing measurement of cellular migration. In a related
embodiment, loss of invasiveness is examined by response to
hepatocyte growth factor (HGF). HGF-induced cell scattering is
correlated with invasiveness of cells such as Madin-Darby canine
kidney (MDCK) cells. This assay identifies a cell population that
has lost cell scattering activity in response to HGF (Hordijk et
al., 1997, Science 278:1464-66).
[0599] Alternatively, loss of invasiveness can be measured by cell
migration through a chemotaxis chamber (Neuroprobe/Precision
Biochemicals Inc. Vancouver, BC). In such assay, a chemo-attractant
agent is incubated on one side of the chamber (e.g., the bottom
chamber) and cells are plated on a filter separating the opposite
side (e.g., the top chamber). In order for cells to pass from the
top chamber to the bottom chamber, the cells must actively migrate
through small pores in the filter. Checkerboard analysis of the
number of cells that have migrated can then be correlated with
invasiveness (see e.g., Ohnishi, T., 1993, Biochem. Biophys. Res.
Commun.193:518-25).
[0600] In certain embodiments, a lead compound is tested for its
effects, such as, but not limited to, cytotoxicity, altered gene
expression, and altered morphology, on PBMCs (Peripheral Blood
Mononuclear Cells).
[0601] 4.6.2 Animal Models
[0602] The lead compounds identified in the assays described herein
can be tested for biological activity using animal models for a
proliferative disorder. These include animals engineered to contain
a tRNA splicing endonuclease or a 3' end pre-mRNA endonuclease
coupled to a functional readout system, such as a transgenic mouse.
Such animal model systems include, but are not limited to, rats,
mice, chicken, cows, monkeys, pigs, dogs, rabbits, etc. In a
specific embodiment of the invention, a compound identified in
accordance with the methods of the invention is tested in a mouse
model system. Such model systems are widely used and well-known to
the skilled artisan such as the SCID mouse model or transgenic
mice.
[0603] The anti-angiogenic activity of a compound identified in
accordance with the invention can be determined by using various
experimental animal models of vascularized tumors. The anti-tumor
activity of a compound identified in accordance with the invention
can be determined by administering the compound to an animal model
and verifying that the compound is effective in reducing the
proliferation or spread of cancer cells in said animal model. An
example of an animal model for human cancer in general includes,
but is not limited to, spontaneously occurring tumors of companion
animals (see, e.g., Vail & MacEwen, 2000, Cancer Invest
18(8):781-92).
[0604] Examples of animal models for lung cancer include, but are
not limited to, lung cancer animal models described by Zhang &
Roth (1994, In Vivo 8(5):755-69) and a transgenic mouse model with
disrupted p53 function (see, e.g., Morris et al., 1998, J La State
Med Soc 150(4):179-85). An example of an animal model for breast
cancer includes, but is not limited to, a transgenic mouse that
overexpresses cyclin D1 (see, e.g., Hosokawa et al., 2001,
Transgenic Res 10(5):471-8). An example of an animal model for
colon cancer includes, but is not limited to, a TCRbeta and p53
double knockout mouse (see, e.g., Kado et al., 2001, Cancer Res
61(6):2395-8). Examples of animal models for pancreatic cancer
include, but are not limited to, a metastatic model of Panc02
murine pancreatic adenocarcinoma (see, e.g., Wang et al., 2001, Int
J Pancreatol 29(1):37-46) and nu-nu mice generated in subcutaneous
pancreatic tumours (see, e.g., Ghaneh et al., 2001, Gene Ther
8(3):199-208). Examples of animal models for non-Hodgkin's lymphoma
include, but are not limited to, a severe combined immunodeficiency
("SCID") mouse (see, e.g., Bryant et al., 2000, Lab Invest
80(4):553-73) and an IgHmu-HOX11 transgenic mouse (see, e.g., Hough
et al., 1998, Proc Natl Acad Sci USA 95(23):13853-8). An example of
an animal model for esophageal cancer includes, but is not limited
to, a mouse transgenic for the human papillomavirus type 16 E7
oncogene (see, e.g., Herber et al., 1996, J Virol 70(3):1873-81).
Examples of animal models for colorectal carcinomas include, but
are not limited to, Apc mouse models (see, e.g., Fodde & Smits,
2001, Trends Mol Med 7(8):369-73 and Kuraguchi et al., 2000,
Oncogene 19(50):5755-63).
[0605] In certain embodiments, the animal model is a model system
for vascular wound healing, for degenerated, leisured or insured
tissue. Models for wound healing include sores, lesions, ulcers and
bedsores. The lead compounds of the invention can be tested for
their ability to facilitate, promote and/or enhance the process of
wound healing.
[0606] 4.6.3 Toxicity
[0607] The toxicity and/or efficacy of a compound identified in
accordance with the invention can be determined by standard
pharmaceutical procedures in cell cultures or experimental animals,
e.g., for determining the LD.sub.50 (the dose lethal to 50% of the
population) and the ED.sub.50 (the dose therapeutically effective
in 50% of the population). Cells and cell lines that can be used to
assess the cytotoxicity of a compound identified in accordance with
the invention include, but are not limited to, peripheral blood
mononuclear cells (PBMCs), Caco-2 cells, and Huh7 cells. The dose
ratio between toxic and therapeutic effects is the therapeutic
index and it can be expressed as the ratio LD.sub.50/ED.sub.50. A
compound identified in accordance with the invention that exhibits
large therapeutic indices is preferred. While a compound identified
in accordance with the invention that exhibits toxic side effects
may be used, care should be taken to design a delivery system that
targets such agents to the site of affected tissue in order to
minimize potential damage to uninfected cells and, thereby, reduce
side effects.
[0608] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage of a compound
identified in accordance with the invention for use in humans. The
dosage of such agents lies preferably within a range of circulating
concentrations that include the ED.sub.50 with little or no
toxicity. The dosage may vary within this range depending upon the
dosage form employed and the route of administration utilized. For
any agent used in the method of the invention, the therapeutically
effective dose can be estimated initially from cell culture assays.
A dose may be formulated in animal models to achieve a circulating
plasma concentration range that includes the IC.sub.50 (i.e., the
concentration of the compound that achieves a half-maximal
inhibition of symptoms) as determined in cell culture. Such
information can be used to more accurately determine useful doses
in humans. Levels in plasma may be measured, for example, by high
performance liquid chromatography.
[0609] 4.6.4 Design of Congeners or Analogs
[0610] The compounds which display the desired biological activity
can be used as lead compounds for the development or design of
congeners or analogs having useful pharmacological activity. For
example, once a lead compound is identified, molecular modeling
techniques can be used to design variants of the compound that can
be more effective. Examples of molecular modeling systems are the
CHARM and QUANTA programs (Polygen Corporation, Waltham, Mass.).
CHARM performs the energy minimization and molecular dynamics
functions. QUANTA performs the construction, graphic modelling and
analysis of molecular structure. QUANTA allows interactive
construction, modification, visualization, and analysis of the
behavior of molecules with each other.
[0611] A number of articles review computer modeling of drugs
interactive with specific proteins, such as Rotivinen et al., 1988,
Acta Pharmaceutical Fennica 97:159-166; Ripka, 1998, New Scientist
54-57; McKinaly & Rossmann, 1989, Annu. Rev. Pharmacol.
Toxiciol. 29:111-122; Perry & Davies, OSAR: Quantitative
Structure-Activity Relationships in Drug Design pp. 189-193 (Alan
R. Liss, Inc. 1989); Lewis & Dean, 1989, Proc. R. Soc. Lond.
236:125-140 and 141-162; Askew et al., 1989, J. Am. Chem. Soc.
111:1082-1090. Other computer programs that screen and graphically
depict chemicals are available from companies such as BioDesign,
Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga, Ontario,
Canada), and Hypercube, Inc. (Cambridge, Ontario). Although these
are primarily designed for application to drugs specific to
particular proteins, they can be adapted to design of drugs
specific to any identified region. The analogs and congeners can be
tested for binding to a human tRNA splicing endonuclease using the
above-described screens for biologic activity. Alternatively, lead
compounds with little or no biologic activity, as ascertained in
the screen, can also be used to design analogs and congeners of the
compound that have biologic activity.
[0612] 4.7 Pharmaceutical Compositions of the Invention
[0613] In certain embodiments, the invention provides compositions
comprising a carrier and one the following or a combination of two
or more of the following: (i) a component of a complex of the
invention (e.g., human Sen2, human Sen15, human Sen34, human Sen54,
human Sen2deltaEx8, or functionally active derivatives of
functionally active fragments thereof; (ii) a complex of the
invention, (iii) an antibody or a fragment thereof that
immunospecifically binds to a component of a complex of the
invention, or a complex of the invention, (iv) a compound that
modulates the expression of a component of a complex of the
invention, (v) a compound that modulates the formation of a complex
of the invention, (vi) a compound that modulates the endonuclease
activity (e.g., tRNA splicing endonuclease activity and/or 3' end
pre-mRNA endonuclease activity) of a complex of the invention,
(vii) a compound that modulates the pre-tRNA cleavage activity of a
complex of the invention, and/or (viii) a compound that modulates
pre-ribosomal RNA cleavage activity of a complex of the invention.
The compositions may further comprise one or more other
prophylactic or therapeutic agents. In a preferred embodiment, the
compositions are pharmaceutical compositions. In accordance with
this embodiment, the pharmaceutical compositions are preferably
sterile and in suitable form for the intended method of
administration or use. The invention encompasses the use of the
compositions of the invention in the prevention, treatment,
management or amelioration of a disorder described herein or a
symptom thereof.
[0614] In certain embodiments of the invention, a pharmaceutical
composition of the invention comprises Sen2, Clp1, Sen54, Sen15,
and Sen34. In certain embodiments of the invention, a
pharmaceutical composition of the invention comprises Sen2, Sen54,
Sen15, and Sen34. In certain embodiments of the invention, a
pharmaceutical composition of the invention comprises Sen2deltaEx8.
In certain embodiments of the invention, a pharmaceutical
composition of the invention comprises Sen2deltaEx8 and Sen54. In
certain embodiments of the invention, a pharmaceutical composition
of the invention comprises Sen2deltaEx8, Sen54, Sen15 and Sen34. In
accordance with these embodiments, a pharmaceutical composition of
the invention may further comprise: (i) human CPSF160; (ii) human
CPSF30; (iii) human CstF64; and/or (iv) human symplekin.
[0615] The different protein components can be present in the form
of a complex or not in the form of a complex. In other embodiments,
a pharmaceutical composition comprises Sen2, Clp1, Sen54, Sen15,
Send34, CPSF, CFIm, CFIIm and CstF. The different protein
components can be present in the form of a complex or not in the
form of a complex. In even other embodiments, a pharmaceutical
composition comprises Sen2.DELTA.Ex8, Clp1, Sen54, Sen15, Send34,
CPSF, CFIm, CFIIm and CstF. The different protein components can be
present in the form of a complex or not in the form of a
complex.
[0616] In even other embodiments, a pharmaceutical composition
comprises an antibody that binds specifically to Sen2.DELTA.Ex8. In
even more specific embodiments, the antibody does not bind to Sen2.
In yet other embodiments, a pharmaceutical composition comprises an
oligonucleotide that hybridizes specifically to a nucleic acid
encoding Sen2.DELTA.Ex8.
[0617] In even other embodiments, a pharmaceutical composition
comprises an antibody that binds specifically to a component of a
complex of the invention. In yet other embodiments, a
pharmaceutical composition comprises an oligonucleotide that
hybridizes specifically to a nucleic acid encoding a component of a
complex of the invention. In even other embodiments, a
pharmaceutical composition comprises an antibody that binds
immunospecifically to a complex of the invention. In a more
specific embodiments, the antibody does not bind to an individual
component of a complex of the invention.
[0618] In certain embodiments, a pharmaceutical composition of the
invention also comprises a pharmaceutically acceptable carrier.
[0619] The compositions of the invention include, but are not
limited to, bulk drug compositions useful in the manufacture of
pharmaceutical compositions (e.g., impure or non-sterile
compositions) and pharmaceutical compositions (ie., compositions
that are suitable for administration to a subject or patient) which
can be used in the preparation of unit dosage forms. Such
compositions comprise a prophylactically or therapeutically
effective amount of a prophylactic and/or therapeutic agent
disclosed herein or a combination of those agents and a
pharmaceutically acceptable carrier.
[0620] In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, and more
particularly in humans. The term "carrier" refers to a diluent,
adjuvant (e.g., Freund's adjuvant (complete and incomplete)),
excipient, or vehicle with which the therapeutic is contained in or
administered. Such pharmaceutical carriers can be sterile liquids,
such as water and oils, including those of petroleum, animal,
vegetable or synthetic origin, such as peanut oil, soybean oil,
mineral oil, sesame oil and the like. Water is a preferred carrier
when the pharmaceutical composition is administered intravenously.
Saline solutions and aqueous dextrose and glycerol solutions can
also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk,
silica gel, sodium stearate, glycerol monostearate, talc, sodium
chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain
minor amounts of wetting or emulsifying agents, or pH buffering
agents. These compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, capsules, powders,
sustained-release formulations and the like.
[0621] Generally, the ingredients of compositions of the invention
are supplied either separately or mixed together in unit dosage
form, for example, as a dry lyophilized powder or water free
concentrate in a hermetically sealed container such as an ampoule
or sachette indicating the quantity of active agent. Where the
composition is to be administered by infusion, it can be dispensed
with an infusion bottle containing sterile pharmaceutical grade
water or saline. Where the composition is administered by
injection, an ampoule of sterile water for injection or saline can
be provided so that the ingredients may be mixed prior to
administration.
[0622] The compositions of the invention can be formulated as
neutral or salt forms. Pharmaceutically acceptable salts include
those formed with anions such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with cations such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0623] For routes of administration see section 4.9.
[0624] 4.8 Prophylactic and Therapeutic Uses
[0625] A compound identified in assays described herein that
modulates the expression of a component of a complex of the
invention, the formation of a complex of the invention, the
RNA-nucleolytic activity of a complex of the invention (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention) may be tested in in vitro assays (e.g.,
cell-based assays or cell-free assays) or in vivo assays well-known
to one of skill in the art or described herein for the effect of
the compound a disorder described herein (e.g., a proliferative
disorder or a disorder characterized by, associated with or caused
by abnormal RNA-nucleolytic activity) or on cells from a patient
with a particular disorder.
[0626] The present invention provides methods of preventing,
treating, managing or ameliorating a proliferative disorder or a
disorder characterized by, associated with or caused by abnormal
RNA-nucleolytic activity or one or more symptoms thereof, said
methods comprising administering to a subject in need thereof one
or more compounds identified in accordance with the methods of the
invention. In one embodiment, the invention provides a method of
preventing, treating, managing or ameliorating a proliferative
disorder or a disorder characterized by, associated with or caused
by abnormal RNA-nucleolytic activity or one or more symptoms
thereof, said method comprising administering to a subject in need
thereof a dose of a prophylactically or therapeutically effective
amount of one or more compounds identified in accordance with the
methods of the invention. In another embodiment, a compound
identified in accordance with the methods of the invention is not
administered to prevent, treat, or ameliorate a proliferative
disorder or a disorder characterized by, associated with or caused
by abnormal RNA-nucleolytic activity or one or more symptoms
thereof, if such compound has been used previously to prevent,
treat, manage or ameliorate said proliferative disorder. In a
specific embodiment, a therapeutic method of the invention
comprises administering an effective amount of a compound that has
been identified using the methods of the invention as an antagonist
of a pre-tRNA splicing endonuclease complex or a 3' end pre-mRNA
endonuclease complex. An antagonist can be a compound that
destabilizes the complex, prevents its formation or decreases its
catalytic activity.
[0627] In certain other embodiments, a therapeutically effective
amount of a compound identified using the methods of the invention
as an agonist of 3' end pre-mRNA endonuclease or pre-tRNA splicing
endonuclease is administered to promote wound healing. An agonist
may act by stabilizing the complex or by activating the catalytic
activity of the complex.
[0628] In certain embodiments, a therapeutic method of the
invention comprises administering a pharmaceutically effective
amount of two or more of the following: Sen2, Clp1, Sen54, Sen15,
and Sen34. In certain embodiments, a therapeutic method of the
invention comprises administering a pharmaceutically effective
amount of Sen2, Clp1, Sen54, Sen15, and Sen34. In accordance with
these embodiments, a pharmaceutical composition of the invention
may further comprise: (i) human CPSF160; (ii) human CPSF30; (iii)
human CstF64; and/or (iv) human symplekin. In other embodiments, a
therapeutic method of the invention comprises administering a
pharmaceutically effective amount of Sen2, Clp1, Sen54, Sen15,
Send34, CPSF, CFIm, CFIIm and CstF. In other embodiments, a
therapeutic method comprises administering Sen2deltaEx8 and
optionally Sen15, Sen34, Sen54 and Clp1. In accordance with these
embodiments, a pharmaceutical composition of the invention may
further comprise: (i) human CPSF160; (ii) human CPSF30; (iii) human
CstF64; and/or (iv) human symplekin. In even other embodiments, a
therapeutic method of the invention comprises administering a
pharmaceutically effective amount of Sen2.DELTA.Ex8, Clp1, Sen54,
Sen15, Send34, CPSF, CFIm, CFIIm and CstF. The different protein
components can be present in the form of a complex or not in the
form of a complex.
[0629] In even other embodiments, a therapeutic method of the
invention comprises administering a pharmaceutically effective
amount of an antibody that binds specifically to Sen2.DELTA.Ex8. In
even more specific embodiments, the antibody does not bind to
Sen2.
[0630] In yet other embodiments, a therapeutic method of the
invention comprises administering a pharmaceutically effective
amount of an oligonucleotide that hybridizes specifically to a
nucleic acid encoding Sen2.DELTA.Ex8.
[0631] The invention also provides methods of preventing, treating,
managing or ameliorating a proliferative disorder or a disorder
characterized by, associated with or caused by abnormal
RNA-nucleolytic activity (e.g., the pre-tRNA splicing endonuclease
activity, the 3' end pre-mRNA endonuclease activity, the pre-tRNA
cleavage activity of a complex of the invention, and/or the
pre-ribosomal RNA cleavage activity of a complex of the invention)
or one or more symptoms thereof, said methods comprising
administering to a subject in need thereof one or more of the
compounds identified utilizing the screening methods described
herein, and one or more other therapies (e.g., prophylactic or
therapeutic agents), which therapies are currently being used, have
been used or are known to be useful in the prevention, treatment,
management or amelioration of one or more symptoms associated with
said proliferative disorder (including, but not limited to the
prophylactic or therapeutic agents listed in Section 4.8.3
hereinbelow). The therapies (e.g., prophylactic or therapeutic
agents) of the combination therapies of the invention can be
administered sequentially or concurrently. In a specific
embodiment, the combination therapies of the invention comprise a
compound identified in accordance with the invention and at least
one other therapy that has the same mechanism of action as said
compound. In another specific embodiment, the combination therapies
of the invention comprise a compound identified in accordance with
the methods of the invention and at least one other therapy (e.g.,
prophylactic or therapeutic agent) which has a different mechanism
of action than said compound. The combination therapies of the
present invention improve the prophylactic or therapeutic effect of
a compound of the invention by functioning together with the
compound to have an additive or synergistic effect. The combination
therapies of the present invention reduce the side effects
associated with the therapies (e.g., prophylactic or therapeutic
agents).
[0632] The prophylactic or therapeutic agents of the combination
therapies can be administered to a subject in the same
pharmaceutical composition. Alternatively, the prophylactic or
therapeutic agents of the combination therapies can be administered
concurrently to a subject in separate pharmaceutical compositions.
The prophylactic or therapeutic agents may be administered to a
subject by the same or different routes of administration.
[0633] In specific embodiment, a pharmaceutical composition
comprising one or more compounds identified in a screening assay
described herein is administered to a subject, preferably a human,
to prevent, treat, manage or ameliorate a proliferative disorder or
one or more symptoms thereof. In accordance with the invention, the
pharmaceutical composition may also comprise one or more
prophylactic or therapeutic agents which are currently being used,
have been used or are known to be useful in the prevention,
treatment, management or amelioration of a proliferative disorder
or one or more symptoms thereof.
[0634] A compound identified in accordance with the methods of the
invention may be used as a first, second, third, fourth or fifth
line of therapy for a proliferative disorder or a disorder
characterized by, associated with or caused by abnormal
RNA-nucleolytic activity (e.g., the pre-tRNA splicing endonuclease
activity, the 3' end pre-mRNA endonuclease activity, the pre-tRNA
cleavage activity of a complex of the invention, and/or the
pre-ribosomal RNA cleavage activity of a complex of the invention).
The invention provides methods for treating, managing or
ameliorating a proliferative disorder or a disorder characterized
by, associated with or caused by abnormal RNA-nucleolytic activity
(e.g., the pre-tRNA splicing endonuclease activity, the 3' end
pre-mRNA endonuclease activity, the pre-tRNA cleavage activity of a
complex of the invention, and/or the pre-ribosomal RNA cleavage
activity of a complex of the invention) or one or more symptoms
thereof in a subject refractory to conventional therapies for such
proliferative disorder, said methods comprising administering to
said subject a dose of a prophylactically or therapeutically
effective amount of a compound identified in accordance with the
methods of the invention. In particular, a cancer or a disorder
characterized by, associated with or caused by abnormal
RNA-nucleolytic activity (e.g., the pre-tRNA splicing endonuclease
activity, the 3' end pre-mRNA endonuclease activity, the pre-tRNA
cleavage activity of a complex of the invention, and/or the
pre-ribosomal RNA cleavage activity of a complex of the invention)
may be determined to be refractory to a therapy means when at least
some significant portion of the cancer cells or cells characterized
by, associated with or caused by abnormal RNA-nucleolytic activity
(e.g., the pre-tRNA splicing endonuclease activity, the 3' end
pre-mRNA endonuclease activity, the pre-tRNA cleavage activity of a
complex of the invention, and/or the pre-ribosomal RNA cleavage
activity of a complex of the invention) are not killed or their
cell division arrested in response to the therapy. Such a
determination can be made either in vivo or in vitro by any method
known in the art for assaying the effectiveness of treatment on
cancer cells, using the art-accepted meanings of "refractory" in
such a context. In a specific embodiment, a cancer is refractory
where the number of cancer cells has not been significantly
reduced, or has increased.
[0635] In more specific embodiments, the invention provides methods
for treating, managing or ameliorating one or more symptoms of a
proliferative disorder in a subject refractory to existing single
agent therapies for such proliferative disorder, said methods
comprising administering to said subject a dose of a
prophylactically or therapeutically effective amount of a compound
identified in accordance with the methods of the invention and a
dose of a prophylactically or therapeutically effective amount of
one or more other therapies (e.g., prophylactic or therapeutic
agents). The invention also provides methods for treating or
managing a proliferative disorder by administering a compound
identified in accordance with the methods of the invention in
combination with any other therapy (e.g., radiation therapy,
chemotherapy or surgery) to patients who have proven refractory to
other therapies but are no longer on these therapies. The invention
also provides methods for the treatment or management of a patient
having a proliferative disorder and immunosuppressed by reason of
having previously undergone other therapies. The invention also
provides alternative methods for the treatment or management of a
proliferative disorder such as cancer where chemotherapy, radiation
therapy, hormonal therapy, and/or biological therapy/immunotherapy
has proven or may prove too toxic, i.e., results in unacceptable or
unbearable side effects, for the subject being treated or managed.
Further, the invention provides methods for preventing the
recurrence of a proliferative disorder such as cancer in patients
that have been treated and have no disease activity by
administering a compound identified in accordance with the methods
of the invention.
[0636] Proliferative disorders that can be treated by the methods
encompassed by the invention include, but are not limited to,
neoplasms, tumors, metastases, or any disease or disorder
characterized by uncontrolled cell growth (e.g., psoriasis and
pulmonary fibrosis). The cancer may be a primary or metastatic
cancer.
[0637] Specific examples of cancers that can be treated by the
methods encompassed by the invention include, but are not limited
to, cancer of the head, neck, eye, mouth, throat, esophagus, chest,
bone, lung, colon, rectum, stomach, prostate, breast, ovaries,
kidney, liver, pancreas, and brain. Additional cancers include, but
are not limited to, the following: leukemias such as but not
limited to, acute leukemia, acute lymphocytic leukemia, acute
myelocytic leukemias such as myeloblastic, promyelocytic,
myelomonocytic, monocytic, erythroleukemia leukemias and
myelodysplastic syndrome, chronic leukemias such as but not limited
to, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic
leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as
but not limited to Hodgkin's disease, non-Hodgkin's disease;
multiple myelomas such as but not limited to smoldering multiple
myeloma, nonsecretory myeloma, osteosclerotic myeloma, plasma cell
leukemia, solitary plasmacytoma and extramedullary plasmacytoma;
Waldenstrom's macroglobulinemia; monoclonal gammopathy of
undetermined significance; benign monoclonal gammopathy; heavy
chain disease; bone and connective tissue sarcomas such as but not
limited to bone sarcoma, osteosarcoma, chondrosarcoma, Ewing's
sarcoma, malignant giant cell tumor, fibrosarcoma of bone,
chordoma, periosteal sarcoma, soft-tissue sarcomas, angiosarcoma
(hemangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma,
liposarcoma, lymphangiosarcoma, neurilemmoma, rhabdomyosarcoma,
synovial sarcoma; brain tumors such as but not limited to, glioma,
astrocytoma, brain stem glioma, ependymoma, oligodendroglioma,
nonglial tumor, acoustic neurinoma, craniopharyngioma,
medulloblastoma, meningioma, pineocytoma, pineoblastoma, primary
brain lymphoma; breast cancer including but not limited to
adenocarcinoma, lobular (small cell) carcinoma, intraductal
carcinoma, medullary breast cancer, mucinous breast cancer, tubular
breast cancer, papillary breast cancer, Paget's disease, and
inflammatory breast cancer; adrenal cancer such as but not limited
to pheochromocytom and adrenocortical carcinoma; thyroid cancer
such as but not limited to papillary or follicular thyroid cancer,
medullary thyroid cancer and anaplastic thyroid cancer; pancreatic
cancer such as but not limited to, insulinoma, gastrinoma,
glucagonoma, vipoma, somatostatin-secreting tumor, and carcinoid or
islet cell tumor; pituitary cancers such as but limited to
Cushing's disease, prolactin-secreting tumor, acromegaly, and
diabetes insipius; eye cancers such as but not limited to ocular
melanoma such as iris melanoma, choroidal melanoma, and cilliary
body melanoma, and retinoblastoma; vaginal cancers such as squamous
cell carcinoma, adenocarcinoma, and melanoma; vulvar cancer such as
squamous cell carcinoma, melanoma, adenocarcinoma, basal cell
carcinoma, sarcoma, and Paget's disease; cervical cancers such as
but not limited to, squamous cell carcinoma, and adenocarcinoma;
uterine cancers such as but not limited to endometrial carcinoma
and uterine sarcoma; ovarian cancers such as but not limited to,
ovarian epithelial carcinoma, borderline tumor, germ cell tumor,
and stromal tumor; esophageal cancers such as but not limited to,
squamous cancer, adenocarcinoma, adenoid cyctic carcinoma,
mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma,
melanoma, plasmacytoma, verrucous carcinoma, and oat cell (small
cell) carcinoma; stomach cancers such as but not limited to,
adenocarcinoma, fungating (polypoid), ulcerating, superficial
spreading, diffusely spreading, malignant lymphoma, liposarcoma,
fibrosarcoma, and carcinosarcoma; colon cancers; rectal cancers;
liver cancers such as but not limited to hepatocellular carcinoma
and hepatoblastoma, gallbladder cancers such as adenocarcinoma;
cholangiocarcinomas such as but not limited to pappillary, nodular,
and diffuse; lung cancers such as non-small cell lung cancer,
squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma,
large-cell carcinoma and small-cell lung cancer; testicular cancers
such as but not limited to germinal tumor, seminoma, anaplastic,
classic (typical), spermatocytic, nonseminoma, embryonal carcinoma,
teratoma carcinoma, choriocarcinoma (yolk-sac tumor), prostate
cancers such as but not limited to, adenocarcinoma, leiomyosarcoma,
and rhabdomyosarcoma; penal cancers; oral cancers such as but not
limited to squamous cell carcinoma; basal cancers; salivary gland
cancers such as but not limited to adenocarcinoma, mucoepidermoid
carcinoma, and adenoidcystic carcinoma; pharynx cancers such as but
not limited to squamous cell cancer, and verrucous; skin cancers
such as but not limited to, basal cell carcinoma, squamous cell
carcinoma and melanoma, superficial spreading melanoma, nodular
melanoma, lentigo malignant melanoma, acral lentiginous melanoma;
kidney cancers such as but not limited to renal cell cancer,
adenocarcinoma, hypemephroma, fibrosarcoma, transitional cell
cancer (renal pelvis and/or uterer); Wilms' tumor; bladder cancers
such as but not limited to transitional cell carcinoma, squamous
cell cancer, adenocarcinoma, carcinosarcoma. In addition, cancers
include myxosarcoma, osteogenic sarcoma, endotheliosarcoma,
lymphangioendotheliosarcoma, mesothelioma, synovioma,
hemangioblastoma, epithelial carcinoma, cystadenocarcinoma,
bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland
carcinoma, papillary carcinoma and papillary adenocarcinomas (for a
review of such disorders, see Fishman et al., 1985, Medicine, 2d
Ed., J.B. Lippincott Co., Philadelphia and Murphy et al., 1997,
Informed Decisions: The Complete Book of Cancer Diagnosis,
Treatment, and Recovery, Viking Penguin, Penguin Books U.S.A.,
Inc., United States of America). It is also contemplated that
cancers caused by aberrations in apoptosis can also be treated by
the methods and compositions of the invention. Such cancers may
include, but not be limited to, follicular lymphomas, carcinomas
with p53 mutations, hormone dependent tumors of the breast,
prostate and ovary, and precancerous lesions such as familial
adenomatous polyposis, and myelodysplastic syndromes.
[0638] Wounds that can be treated by the methods encompassed by the
invention include, but are not limited to, sores, lesions, ulcers
and bedsores.
[0639] 4.8.1 Use of Antisense Oligonucleotides for Suppression of
Protein Complex Activity or Formation
[0640] In a specific embodiment of the present invention, the
activity and formation of a complex of the invention is inhibited
by use of antisense nucleic acids specific to a protein component
of the complex that is up-regulated in a subject. The present
invention provides the therapeutic or prophylactic use of nucleic
acids of at least six nucleotides that are antisense to a gene or
cDNA encoding a component protein, or a portion thereof. An
"antisense" nucleic acid as used herein refers to a nucleic acid
capable of hybridizing to a portion of a component protein RNA
(preferably mRNA) by virtue of some sequence complementarity. The
antisense nucleic acid may be complementary to a coding and/or
noncoding region of a component protein mRNA. Such antisense
nucleic acids that inhibit complex formation or activity have
utility as Therapeutics, and can be used in the treatment or
prevention of disorders as described supra.
[0641] The antisense nucleic acids of the invention can be
oligonucleotides that are double-stranded or single-stranded, RNA
or DNA, or a modification or derivative thereof, which can be
directly administered to a cell, or which can be produced
intracellularly by transcription of exogenous, introduced
sequences.
[0642] In another embodiment, the present invention is directed to
a method for inhibiting the expression of component protein nucleic
acid sequences, in a prokaryotic or eukaryotic cell, comprising
providing the cell with an effective amount of a composition
comprising an antisense nucleic acid of the component protein, or a
derivative thereof, of the invention.
[0643] The antisense nucleic acids are of at least six nucleotides
and are preferably oligonucleotides, ranging from 6 to about 200
nucleotides. In specific aspects, the oligonucleotide is at least
10 nucleotides, at least 15 nucleotides, at least 100 nucleotides,
or at least 200 nucleotides. The oligonucleotides can be DNA or RNA
or chimeric mixtures, or derivatives or modified versions thereof,
and either single-stranded or double-stranded. The oligonucleotide
can be modified at the base moiety, sugar moiety, or phosphate
backbone. The oligonucleotide may include other appending groups
such as peptides, agents facilitating transport across the cell
membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci.
U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci.
84:648-652; International Patent Publication No. WO 88/09810) or
blood-brain barrier (see, e.g., International Patent Publication
No. WO 89/10134), hybridization-triggered cleavage agents (see,
e.g., Krol et al., 1988, BioTechniques 6:958-976), or intercalating
agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549).
[0644] In a preferred aspect of the invention, an antisense
oligonucleotide is provided, preferably as single-stranded DNA. The
oligonucleotide may be modified at any position in its structure
with constituents generally known in the art.
[0645] The antisense oligonucleotides may comprise at least one
modified base moiety which is selected from the group including but
not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl)uracil- ,
5-carboxymethylaminomethyl-2-thio-uridine,
5-carboxymethylaminomethylura- cil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5N-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methyl-thio-N6-isopente- nyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0646] In another embodiment, the oligonucleotide comprises at
least one modified sugar moiety selected from the group including,
but not limited to, arabinose, 2-fluoroarabinose, xylulose, and
hexose.
[0647] In yet another embodiment, the oligonucleotide comprises at
least one modified phosphate backbone selected from the group
consisting of a phosphorothioate, a phosphorodithioate, a
phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal, or
an analog of the foregoing.
[0648] In yet another embodiment, the oligonucleotide is a
2-a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms
specific double-stranded hybrids with complementary RNA in which,
contrary to the usual B-units, the strands run parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).
[0649] The oligonucleotide may be conjugated to another molecule,
e.g., a peptide, hybridization-triggered cross-linking agent,
transport agent, hybridization-triggered cleavage agent, etc.
[0650] Oligonucleotides of the invention may be synthesized by
standard methods known in the art, e.g., by use of an automated DNA
synthesizer (such as are commercially avail-able from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligo-nucleotides may be synthesized by the method of Stein et al.
(1988, Nucl. Acids Res. 16:3209), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass
polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A.
85:7448-7451), etc.
[0651] In a specific embodiment, the antisense oligonucleotides
comprise catalytic RNAs, or ribozymes (see, e.g., International
Patent Publication No. WO 90/11364; Sarver et al., 1990, Science
247:1222-1225). In another embodiment, the oligonucleotide is a
2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res.
15:6131-6148), or a chimeric RNA-DNA analog (Inoue et al., 1987,
FEBS Lett. 215:327-330).
[0652] In an alternative embodiment, the antisense nucleic acids of
the invention are produced intracellularly by transcription from an
exogenous sequence. For example, a vector can be introduced in vivo
such that it is taken up by a cell, within which cell the vector or
a portion thereof is transcribed, producing an antisense nucleic
acid (RNA) of the invention. Such a vector would contain a sequence
encoding the component protein. Such a vector can remain episomal
or become chromosomally integrated, as long as it can be
transcribed to produce the desired antisense RNA. Such vectors can
be constructed by recombinant DNA technology methods standard in
the art. Vectors can be plasmid, viral, or others known in the art
to be capable of replication and expression in mammalian cells.
Expression of the sequences encoding the antisense RNAs can be by
any promoter known in the art to act in mammalian, preferably
human, cells. Such promoters can be inducible or constitutive. Such
promoters include, but are not limited to, the SV40 early promoter
region (Bemoist and Chambon, 1981, Nature 290:304-310), the
promoter contained in the 3' long terminal repeat of Rous sarcoma
virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes
thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad.
Sci. U.S.A. 78:1441-1445), the regulatory sequences of the
metallothionein gene (Brinster et al., 1982, Nature 296:39-42),
etc.
[0653] The antisense nucleic acids of the invention comprise a
sequence complementary to at least a portion of an RNA transcript
of a component protein gene, preferably a human gene. However,
absolute complementarity, although preferred, is not required. A
sequence "complementary to at least a portion of an RNA," as
referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a
stable duplex; in the case of double-stranded antisense nucleic
acids, a single strand of the duplex DNA may thus be tested, or
triplex formation may be assayed. The ability to hybridize will
depend on both the degree of complementarity and the length of the
antisense nucleic acid. Generally, the longer the hybridizing
nucleic acid, the more base mismatches with a component protein RNA
it may contain and still form a stable duplex (or triplex, as the
case may be). One skilled in the art can ascertain a tolerable
degree of mismatch by use of standard procedures to determine the
melting point of the hybridized complex.
[0654] The component protein antisense nucleic acids can be used to
treat (or prevent) disorders of a cell type that expresses, or
preferably overexpresses, a protein complex.
[0655] Cell types that express or overexpress component protein RNA
can be identified by various methods known in the art. Such methods
include, but are not limited to, hybridization with component
protein-specific nucleic acids (e.g., by Northern blot
hybridization, dot blot hybridization, or in situ hybridization),
or by observing the ability of RNA from the cell type to be
translated in vitro into the component protein by
immunohistochemistry, Western blot analysis, ELISA, etc. In a
preferred aspect, primary tissue from a patient can be assayed for
protein expression prior to treatment, e.g., by
immunocytochemistry, in situ hybridization, or any number of
methods to detect protein or mRNA expression.
[0656] Pharmaceutical compositions of the invention (see section
4.7), comprising an effective amount of a protein component
antisense nucleic acid in a pharmaceutically acceptable carrier can
be administered to a patient having a disease or disorder that is
of a type that expresses or overexpresses a protein complex of the
present invention.
[0657] The amount of antisense nucleic acid that will be effective
in the treatment of a particular disorder or condition will depend
on the nature of the disorder or condition, and can be determined
by standard clinical techniques. Where possible, it is desirable to
determine the antisense cytotoxicity in vitro, and then in useful
animal model systems, prior to testing and use in humans.
[0658] In a specific embodiment, pharmaceutical compositions
comprising antisense nucleic acids are administered via liposomes,
microparticles, or microcapsules. In various embodiments of the
invention, it may be useful to use such compositions to achieve
sustained release of the antisense nucleic acids. In a specific
embodiment, it may be desirable to utilize liposomes targeted via
antibodies to specific identifiable central nervous system cell
types (Leonetti et al., 1990, Proc. Natl. Acad. Sci. U.S.A.
87:2448-2451; Renneisen et al., 1990, J. Biol. Chem.
265:16337-16342).
[0659] 4.8.2 RNA Interference
[0660] In certain embodiments, an RNA interference (RNAi) molecule
is used to decrease the expression of a component of a complex of
the invention. RNA interference (RNAi) is the ability of
double-stranded RNA (dsRNA) to suppress the expression of a gene
corresponding to its own sequence (see, e.g., Cogoni and Macino,
2000, Genes Dev 10: 638-643, Guru, 2000, Nature 404, 804-808,
Hammond et al., 2001, Nature Rev Gen 2: 110-119, Shi, 2003, Trends
Genet. 19:9-12, U.S. Pat. No.6,506,559, each incorporated by
reference in their entireties herein). RNAi is also called
post-transcriptional gene silencing or PTGS. Without being bound by
theory, since the only RNA molecules normally found in the
cytoplasm of a cell are molecules of single-stranded mRNA, the cell
has enzymes that recognize and cut dsRNA into fragments containing
21-25 base pairs (approximately two turns of a double helix). The
antisense strand of the fragment separates enough from the sense
strand so that it hybridizes with the complementary sense sequence
on a molecule of endogenous cellular mRNA. This hybridization
triggers cutting of the mRNA in the double-stranded region, thus
destroying its ability to be translated into a polypeptide.
Introducing dsRNA corresponding to a particular gene thus knocks
out the cell's own expression of that gene in particular tissues
and/or at a chosen time.
[0661] The current models of the RNAi mechanism includes both
initiation and effector steps (Hutvagner and Zamore, 2002, Curr
Opin Genetics & Development 12:225-32; Hammond et al., 2001,
Nature Rev Gen 2: 110-9, each incorporated by reference in their
entireties herein). In the initiation step, input dsRNA is digested
into 21-23 nucleotide small interfering RNAs (siRNAs), which have
also been called "guide RNAs" (Sharp, 2001, Genes Dev 15: 485-490).
Evidence indicates that siRNAs are produced when the enzyme Dicer,
a member of the RNase III family of dsRNA-specific ribonucleases,
processively cleaves dsRNA (introduced directly or via a transgene
or virus) in an ATP-dependent, processive manner. Successive
cleavage events degrade the RNA to 19-21 base pair duplexes
(siRNAs), each with 2-nucleotide 3' overhangs (Bernstein et al.,
2001, Nature 409:363-366; Hutvagner and Zamore, 2002, Curr Opin
Genetics & Development 12:225-232). In the effector step, the
siRNA duplexes bind to a nuclease complex to form what is known as
the RNA-induced silencing complex, or RISC. An ATP-depending
unwinding of the siRNA duplex is required for activation of the
RISC. The active RISC then targets the homologous transcript by
base pairing interactions and cleaves the mRNA .about.12
nucleotides from the 3' terminus of the siRNA. Although the
mechanism of cleavage is at this date unclear, research indicates
that each RISC contains a single siRNA and an RNase that appears to
be distinct from Dicer (Hutvagner and Zamore, 2002, Curr Opin
Genetics & Development 12:225-232). Because of the remarkable
potency of RNAi in some organisms, an amplification step within the
RNAi pathway has also been proposed. Amplification could occur by
copying of the input dsRNAs, which would generate more siRNAs, or
by replication of the siRNAs themselves. Alternatively or in
addition, amplification could be effected by multiple turnover
events of the RISC.
[0662] Elbashir and colleagues (Elbashir et al., 2001, Nature
411:494-498; Elbashir et al., 2001, EMBO 20:6877-6888) have
suggested a procedure for designing siRNAs for inducing RNAi in
mammalian cells. Briefly, find a 21 nucleotide sequence in the mRNA
of interest that begins with an adenine-adenine (AA) dinucleotide
as a potential siRNA target site. This strategy for choosing siRNA
target sites is based on the observation that siRNAs with 3'
overhanging UU dinucleotides are the most effective. This is also
compatible with using RNA pol III to transcribe hairpin siRNAs
because RNA pol III terminates transcription at 4-6 nucleotide
poly(T) tracts creating RNA molecules with a short poly(U) tail.
Although siRNAs with other 3' terminal dinucleotide overhangs have
been shown to effectively induce RNAi, siRNAs with guanine residues
in the overhang are not recommended because of the potential for
the siRNA to be cleaved by RNase at single-stranded guanine
residues. In addition to beginning with an AA dinucleotide, the
siRNA target site should have a guanosine and cytidine residue
percentage within the range of 30-70%. The chosen siRNA target
sequence should then be subjected to a BLAST search against the EST
database to ensure that only the desired gene is targeted. Various
products are commercially available to aid in the preparation and
use of siRNA (e.g., Ambion, Inc., Austin, Tex.).
[0663] Double-stranded (ds) RNA can be used to interfere with gene
expression in mammals (Brummelkamp et al., Science 296:550-3,
Krichevsky and Kosik, 2002, PNAS 99:11926-9, Paddison et al., 2002,
PNAS 99:1443-8, Wianny & Zernicka-Goetz, 2000, Nature Cell
Biology 2:70-75, European Patent 1144623, International Patent
Publication Nos. WO 02/055693, WO 02/44321, WO 03/006,477; each
incorporated by reference in their entireties herein).
[0664] 4.8.3 Other Anti-Cancer and Wound Healing Therapies
[0665] The present invention provides methods of preventing,
treating, managing or ameliorating cancer or one or more symptoms
thereof, said methods comprising administering to a subject in need
thereof one or more compounds identified in accordance with the
methods of the invention and one or more therapies (e.g.,
prophylactic or therapeutic agents). Therapeutic or prophylactic
agents include, but are not limited to, peptides, polypeptides,
fusion proteins, nucleic acid molecules, small molecules, mimetic
agents, synthetic drugs, inorganic molecules, and organic
molecules.
[0666] Any therapy (e.g., chemotherapies, radiation therapies,
hormonal therapies, and/or biological therapies/immunotherapies)
which is known to be useful, or which has been used or is currently
being used for the prevention, treatment, management or
amelioration of cancer or one or more symptoms thereof can be used
in combination with a compound identified in accordance with the
methods of the invention. Examples of such agents (i.e.,
anti-cancer agents) include, but are not limited to, angiogenesis
inhibitors, topoisomerase inhibitors and immunomodulatory agents
(such as chemotherapeutic agents). Angiogenesis inhibitors (i.e.,
anti-angiogenic agents) include, but are not limited to,
angiostatin (plasminogen fragment); antiangiogenic antithrombin
III; angiozyme; ABT-627; Bay 12-9566; Benefm; Bevacizumab;
BMS-275291; cartilage-derived inhibitor (CDI); CAI; CD59 complement
fragment; CEP-7055; Col 3; combretastatin A-4; endostatin (collagen
XVIII fragment); fibronectin fragment; Gro-beta; Halofuginone;
Heparinases; Heparin hexasaccharide fragment; HMV833; human
chorionic gonadotropin (hCG); IM-862; Interferon alpha/beta/gamma;
Interferon inducible protein (IP-10); Interleukin-12; Kringle 5
(plasminogen fragment); Marimastat; Metalloproteinase inhibitors
(TIMPs); 2-methoxyestradiol; MMI 270 (CGS 27023A); MoAb IMC-1C11;
Neovastat; NM-3; Panzem; PI-88; Placental ribonuclease inhibitor;
plasminogen activator inhibitor; platelet factor-4 (PF4);
Prinomastat; Prolactin 16kD fragment; Proliferin-related protein
(PRP); PTK 787/ZK 222594; retinoids; solimastat; squalamine; SS
3304; SU 5416; SU6668; SU11248; tetrahydrocortisol-S;
tetrathiomolybdate; thalidomide; thrombospondin-1 (TSP-1); TNP-470;
transforming growth factor-beta; vasculostatin; vasostatin
(calreticulin fragment); ZD6126; ZD 6474; farnesyl transferase
inhibitors (FFI); and bisphosphonates. In a specific embodiment,
anti-angiogenic agents do not include antibodies or fragments
thereof that immunospecifically bind to integrin
.alpha..sub.v.beta..sub.- 3.
[0667] Specific examples of anti-cancer agents which can be used in
accordance with the methods of the invention include, but not
limited to: acivicin; aclarubicin; acodazole hydrochloride;
acronine; adozelesin; aldesleukin; altretamine; ambomycin;
ametantrone acetate; aminoglutethimide; amsacrine; anastrozole;
anthramycin; asparaginase; asperlin; azacitidine; azetepa;
azotomycin; batimastat; benzodepa; bicalutamide; bisantrene
hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate;
brequinar sodium; bropirimine; busulfan; cactinomycin; calusterone;
caracemide; carbetimer; carboplatin; carmustine; carubicin
hydrochloride; carzelesin; cedefingol; chlorambucil; cirolemycin;
cisplatin; cladribine; crisnatol mesylate; cyclophosphamide;
cytarabine; dacarbazine; dactinomycin; daunorubicin hydrochloride;
decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate;
diaziquone; docetaxel; doxorubicin; doxorubicin hydrochloride;
droloxifene; droloxifene citrate; dromostanolone propionate;
duazomycin; edatrexate; eflomithine hydrochloride; elsamitrucin;
enloplatin; enpromate; epipropidine; epirubicin hydrochloride;
erbulozole; esorubicin hydrochloride; estramustine; estramustine
phosphate sodium; etanidazole; etoposide; etoposide phosphate;
etoprine; fadrozole hydrochloride; fazarabine; fenretinide;
floxuridine; fludarabine phosphate; fluorouracil; flurocitabine;
fosquidone; fostriecin sodium; gemcitabine; gemcitabine
hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide;
ilmofosine; interleukin II (including recombinant interleukin II,
or rIL2), interferon alpha-2a; interferon alpha-2b; interferon
alpha-n1; interferon alpha-n3; interferon beta-I a; interferon
gamma-I b; iproplatin; irinotecan hydrochloride; lanreotide
acetate; letrozole; leuprolide acetate; liarozole hydrochloride;
lometrexol sodium; lomustine; losoxantrone hydrochloride;
masoprocol; maytansine; mechlorethamine hydrochloride; megestrol
acetate; melengestrol acetate; melphalan; menogaril;
mercaptopurine; methotrexate; methotrexate sodium; metoprine;
meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin;
mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone
hydrochloride; mycophenolic acid; nocodazole; nogalamycin;
ormaplatin; oxisuran; paclitaxel; pegaspargase; peliomycin;
pentamustine; peplomycin sulfate; perfosfamide; pipobroman;
piposulfan; piroxantrone hydrochloride; plicamycin; plomestane;
porfimer sodium; porfiromycin; prednimustine; procarbazine
hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin;
riboprine; rogletimide; safmgol; safingol hydrochloride; semustine;
simtrazene; sparfosate sodium; sparsomycin; spirogermanium
hydrochloride; spiromustine; spiroplatin; streptonigrin;
streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur;
teloxantrone hydrochloride; temoporfin; teniposide; teroxirone;
testolactone; thiamiprine; thioguanine; thiotepa; tiazofurin;
tirapazamine; toremifene citrate; trestolone acetate; triciribine
phosphate; trimetrexate; trimetrexate glucuronate; triptorelin;
tubulozole hydrochloride; uracil mustard; uredepa; vapreotide;
verteporfm; vinblastine sulfate; vincristine sulfate; vindesine;
vindesine sulfate; vinepidine sulfate; vinglycinate sulfate;
vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate;
vinzolidine sulfate; vorozole; zeniplatin; zinostatin; zorubicin
hydrochloride. Other anti-cancer drugs include, but are not limited
to: 20-epi-1,25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone;
aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin;
ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine;
aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole;
andrographolide; angiogenesis inhibitors; antagonist D; antagonist
G; antarelix; anti-dorsalizing morphogenetic protein-1;
antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston;
antisense oligonucleotides; aphidicolin glycinate; apoptosis gene
modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA;
arginine deaminase; asulacrine; atamestane; atrimustine;
axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin;
azatyrosine; baccatin III derivatives; balanol; batimastat; BCR/ABL
antagonists; benzochlorins; benzoylstaurosporine; beta lactam
derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF
inhibitor; bicalutamide; bisantrene; bisaziridinylspermine;
bisnafide; bistratene A; bizelesin; breflate; bropirimine;
budotitane; buthionine sulfoximine; calcipotriol; calphostin C;
camptothecin derivatives; canarypox IL-2; capecitabine;
carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN
700; cartilage derived inhibitor; carzelesin; casein kinase
inhibitors (ICOS); castanospermine; cecropin B; cetrorelix;
chlorlns; chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin;
cladribine; clomifene analogues; clotrimazole; collismycin A;
collismycin B; combretastatin A4; combretastatin analogue;
conagenin; crambescidin 816; crisnatol; cryptophycin 8;
cryptophycin A derivatives; curacin A; cyclopentanthraquinones;
cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor;
cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin;
dexamethasone; dexifosfamide; dexrazoxane; dexverapamil;
diaziquone; didemnin B; didox; diethylnorsperrnine;
dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl
spiromustine; docetaxel; docosanol; dolasetron; doxifluridine;
droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine;
edelfosine; edrecolomab; eflomithine; elemene; emitefur;
epirubicin; epristeride; estramustine analogue; estrogen agonists;
estrogen antagonists; etanidazole; etoposide phosphate; exemestane;
fadrozole; fazarabine; fenretinide; filgrastim; finasteride;
flavopiridol; flezelastine; fluasterone; fludarabine;
fluorodaunorunicin hydrochloride; forfenimex; formestane;
fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate;
galocitabine; ganirelix; gelatinase inhibitors; gemcitabine;
glutathione inhibitors; hepsulfam; heregulin; hexamethylene
bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene;
idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod;
immunostimulant peptides; insulin-like growth factor-1 receptor
inhibitor; interferon agonists; interferons; interleukins;
iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine;
isobengazole; isohomohalicondrin B; itasetron; jasplakinolide;
kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin;
lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia
inhibiting factor; leukocyte alpha interferon;
leuprolide+estrogen+progesterone; leuprorelin; levamisole;
liarozole; linear polyamine analogue; lipophilic disaccharide
peptide; lipophilic platinum compounds; lissoclinamide 7;
lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone;
lovastatin; loxoribine; lurtotecan; lutetium texaphyrin;
lysofylline; lytic peptides; maitansine; mannostatin A; marimastat;
masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase
inhibitors; menogaril; merbarone; meterelin; methioninase;
metoclopramide; MIF inhibitor; mifepristone; miltefosine;
mirimostim; mismatched double stranded RNA; mitoguazone;
mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast
growth factor-saporin; mitoxantrone; mofarotene; molgramostim;
monoclonal antibody, human chorionic gonadotrophin; monophosphoryl
lipid A+myobacterium cell wall sk; mopidamol; multiple drug
resistance gene inhibitor; multiple tumor suppressor 1-based
therapy; mustard anticancer agent; mycaperoxide B; mycobacterial
cell wall extract; myriaporone; N-acetyldinaline; N-substituted
benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin;
naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid;
neutral endopeptidase; nilutamide; nisamycin; nitric oxide
modulators; nitroxide antioxidant; nitrullyn; O6-benzylguanine;
octreotide; okicenone; oligonucleotides; onapristone; ondansetron;
ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone;
oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues;
paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic
acid; panaxytriol; panomifene; parabactin; pazelliptine;
pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin;
pentrozole; perflubron; perfosfamide; perillyl alcohol;
phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil;
pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A;
placetin B; plasminogen activator inhibitor; platinum complex;
platinum compounds; platinum-triamine complex; porfimer sodium;
porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2;
proteasome inhibitors; protein A-based immune modulator; protein
kinase C inhibitor; protein kinase C inhibitors, microalgal;
protein tyrosine phosphatase inhibitors; purine nucleoside
phosphorylase inhibitors; purpurins; pyrazoloacridine;
pyridoxylated hemoglobin polyoxyethylene conjugate; raf
antagonists; raltitrexed; ramosetron; ras farnesyl protein
transferase inhibitors; ras inhibitors; ras-GAP inhibitor;
retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin;
ribozymes; RII retinamide; rogletimide; rohitukine; romurtide;
roquinimex; rubiginone B1; ruboxyl; safingol; saintopin; SarCNU;
sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence
derived inhibitor 1; sense oligonucleotides; signal transduction
inhibitors; signal transduction modulators; single chain antigen
binding protein; sizofiran; sobuzoxane; sodium borocaptate; sodium
phenylacetate; solverol; somatomedin binding protein; sonermin;
sparfosic acid; spicamycin D; spiromustine; splenopentin;
spongistatin 1; squalamine; stem cell inhibitor; stem-cell division
inhibitors; stipiamide; stromelysin inhibitors; sulfinosine;
superactive vasoactive intestinal peptide antagonist; suradista;
suramin; swainsonine; synthetic glycosaminoglycans; tallimustine;
5-fluorouracil; leucovorin; tamoxifen methiodide; tauromustine;
tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase
inhibitors; temoporfin; temozolomide; teniposide;
tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline;
thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin
receptor agonist; thymotrinan; thyroid stimulating hormone; tin
ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin;
toremifene; totipotent stem cell factor; translation inhibitors;
tretinoin; triacetyluridine; triciribine; trimetrexate;
triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors;
tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived
growth inhibitory factor; urokinase receptor antagonists;
vapreotide; variolin B; vector system, erythrocyte gene therapy;
thalidomide; velaresol; veramine; verdins; verteporfm; vinorelbine;
vinxaltine; vorozole; zanoterone; zeniplatin; zilascorb; and
zinostatin stimalamer.
[0668] The invention also encompasses the administration of one or
more compounds identified in accordance with the methods of the
invention in combination with radiation therapy comprising the use
of x-rays, gamma rays and other sources of radiation to destroy the
cancer cells. In preferred embodiments, the radiation treatment is
administered as external beam radiation or teletherapy wherein the
radiation is directed from a remote source. In other preferred
embodiments, the radiation treatment is administered as internal
therapy or brachytherapy wherein a radiaoactive source is placed
inside the body close to cancer cells or a tumor mass.
[0669] Cancer therapies and their dosages, routes of administration
and recommended usage are known in the art and have been described
in such literature as the Physician's Desk Reference (56.sup.th
ed., 2002).
[0670] 4.9 Compositions and Methods of Administering Compounds
[0671] Compounds identified using the methods of the invention or a
pharmaceutically acceptable salt thereof, complexes of the
invention, components of complexes of the invention or nucleic
acids encoding components of a complex of the invention, antibodies
or fragment thereof that immunospecifically bind to a complex of
the invention or a component of a complex of the invention or
antisense oligonucleotides that interfere with the expression of a
component of a complex of the invention can be administered to a
patient, preferably a mammal, more preferably a human, suffering
from a proliferative disorder, a disorder characterized by,
associated with or caused by abnormal RNA-nucleolytic activity or a
condition associated with wound healing (e.g., sores, lesions,
ulcers and bedsores). In this section, compounds identified using
the methods of the invention or a pharmaceutically acceptable salt
thereof, complexes of the invention, components of complexes of the
invention or nucleic acids encoding components of a complex of the
invention, antibodies or fragment thereof that immunospecifically
bind to a complex of the invention or a component of a complex of
the invention or antisense oligonucleotides that interfere with the
expression of a component of a complex of the invention are
collectively referred to as compound to be used with the
therapeutic and prophylactic methods of the invention. In a
specific embodiment, a compound to be used with the therapeutic and
prophylactic methods of the invention is administered to a patient,
preferably a mammal, more preferably a human, as a preventative
measure against a proliferative disorder, a disorder characterized
by, associated with or caused by abnormal RNA-nucleolytic activity
or a condition associated with wound healing.
[0672] When administered to a patient, the compound to be used with
the therapeutic and prophylactic methods of the invention is
preferably administered as component of a composition that
optionally comprises a pharmaceutically acceptable vehicle. The
composition can be administered orally, or by any other convenient
route, for example, by infusion or bolus injection, by absorption
through epithelial or mucocutaneous linings (e.g., oral mucosa,
rectal, and intestinal mucosa, etc.) and may be administered
together with another biologically active agent. Administration can
be systemic or local. Various delivery systems are known, e.g.,
encapsulation in liposomes, microparticles, microcapsules,
capsules, etc., and can be used to administer the compound and
pharmaceutically acceptable salts thereof.
[0673] Methods of administration include but are not limited to
intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, intranasal, epidural, oral, sublingual, intranasal,
intracerebral, intravaginal, transdermal, rectally, by inhalation,
or topically, particularly to the ears, nose, eyes, or skin. The
mode of administration is left to the discretion of the
practitioner. In most instances, administration will result in the
release of the compound or a pharmaceutically acceptable salt
thereof into the bloodstream.
[0674] In specific embodiments, it may be desirable to administer
the compound to be used with the therapeutic and prophylactic
methods of the invention locally. This may be achieved, for
example, and not by way of limitation, by local infusion during
surgery, topical application, e.g., in conjunction with a wound
dressing after surgery, by injection, by means of a catheter, by
means of a suppository, or by means of an implant, said implant
being of a porous, non-porous, or gelatinous material, including
membranes, such as sialastic membranes, or fibers.
[0675] In certain embodiments, it may be desirable to introduce the
compound to be used with the therapeutic and prophylactic methods
of the invention into the central nervous system by any suitable
route, including intraventricular, intrathecal and epidural
injection. Intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir,
such as an Ommaya reservoir.
[0676] Pulmonary administration can also be employed, e.g., by use
of an inhaler or nebulizer, and formulation with an aerosolizing
agent, or via perfusion in a fluorocarbon or synthetic pulmonary
surfactant. In certain embodiments, the compound to be used with
the therapeutic and prophylactic methods of the invention can be
formulated as a suppository, with traditional binders and vehicles
such as triglycerides.
[0677] In another embodiment, the compound to be used with the
therapeutic and prophylactic methods of the invention can be
delivered in a vesicle, in particular a liposome (see Langer, 1990,
Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of
Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.),
Liss, N.Y., pp. 353-365 (1989); Lopez-Berestein, ibid., pp.
317-327; see generally ibid.).
[0678] In yet another embodiment, the compound to be used with the
therapeutic and prophylactic methods of the invention can be
delivered in a controlled release system (see, e.g., Goodson, in
Medical Applications of Controlled Release, supra, vol. 2, pp.
115-138 (1984)). Other controlled-release systems discussed in the
review by Langer, 1990, Science 249:1527-1533 may be used. In one
embodiment, a pump may be used (see Langer, supra; Sefton, 1987,
CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery
88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In another
embodiment, polymeric materials can be used (see Medical
Applications of Controlled Release, Langer and Wise (eds.), CRC
Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability,
Drug Product Design and Performance, Smolen and Ball (eds.), Wiley,
N.Y. (1984); Ranger and Peppas, 1983, J. Macromol. Sci. Rev.
Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190;
During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J.
Neurosurg. 71:105). In yet another embodiment, a controlled-release
system can be placed in proximity of a target RNA of the compound
or a pharmaceutically acceptable salt thereof, thus requiring only
a fraction of the systemic dose.
[0679] Compositions comprising the compound to be used with the
therapeutic and prophylactic methods of the invention ("compound
compositions") can additionally comprise a suitable amount of a
pharmaceutically acceptable vehicle so as to provide the form for
proper administration to the patient.
[0680] In a specific embodiment, the term "pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or
a state government or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, mammals, and
more particularly in humans. The term "vehicle" refers to a
diluent, adjuvant, excipient, or carrier with which a compound of
the invention is administered. Such pharmaceutical vehicles can be
liquids, such as water and oils, including those of petroleum,
animal, vegetable or synthetic origin, such as peanut oil, soybean
oil, mineral oil, sesame oil and the like. The pharmaceutical
vehicles can be saline, gum acacia, gelatin, starch paste, talc,
keratin, colloidal silica, urea, and the like. In addition,
auxiliary, stabilizing, thickening, lubricating and coloring agents
may be used. When administered to a patient, the pharmaceutically
acceptable vehicles are preferably sterile. Water is a preferred
vehicle when the compound of the invention is administered
intravenously. Saline solutions and aqueous dextrose and glycerol
solutions can also be employed as liquid vehicles, particularly for
injectable solutions. Suitable pharmaceutical vehicles also include
excipients such as starch, glucose, lactose, sucrose, gelatin,
malt, rice, flour, chalk, silica gel, sodium stearate, glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol,
propylene, glycol, water, ethanol and the like. Compound
compositions, if desired, can also contain minor amounts of wetting
or emulsifying agents, or pH buffering agents.
[0681] Compound compositions can take the form of solutions,
suspensions, emulsion, tablets, pills, pellets, capsules, capsules
containing liquids, powders, sustained-release formulations,
suppositories, emulsions, aerosols, sprays, suspensions, or any
other form suitable for use. In one embodiment, the
pharmaceutically acceptable vehicle is a capsule (see e.g., U.S.
Pat. No. 5,698,155). Other examples of suitable pharmaceutical
vehicles are described in Remington's Pharmaceutical Sciences,
Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, Pa., 19th ed.,
1995, pp. 1447 to 1676, incorporated herein by reference.
[0682] In a preferred embodiment, the compound to be used with the
therapeutic and prophylactic methods of the invention is formulated
in accordance with routine procedures as a pharmaceutical
composition adapted for oral administration to human beings.
Compositions for oral delivery may be in the form of tablets,
lozenges, aqueous or oily suspensions, granules, powders,
emulsions, capsules, syrups, or elixirs, for example. Orally
administered compositions may contain one or more agents, for
example, sweetening agents such as fructose, aspartame or
saccharin; flavoring agents such as peppermint, oil of wintergreen,
or cherry; coloring agents; and preserving agents, to provide a
pharmaceutically palatable preparation. Moreover, where in tablet
or pill form, the compositions can be coated to delay
disintegration and absorption in the gastrointestinal tract thereby
providing a sustained action over an extended period of time.
Selectively permeable membranes surrounding an osmotically active
driving compound are also suitable for orally administered
compositions. In these later platforms, fluid from the environment
surrounding the capsule is imbibed by the driving compound, which
swells to displace the agent or agent composition through an
aperture. These delivery platforms can provide an essentially zero
order delivery profile as opposed to the spiked profiles of
immediate release formulations. A time delay material such as
glycerol monostearate or glycerol stearate may also be used. Oral
compositions can include standard vehicles such as mannitol,
lactose, starch, magnesium stearate, sodium saccharine, cellulose,
magnesium carbonate, and the like. Such vehicles are preferably of
pharmaceutical grade. Typically, compositions for intravenous
administration comprise sterile isotonic aqueous buffer. Where
necessary, the compositions may also include a solubilizing
agent.
[0683] In another embodiment, the compound to be used with the
therapeutic and prophylactic methods of the invention can be
formulated for intravenous administration. Compositions for
intravenous administration may optionally include a local
anesthetic such as lignocaine to lessen pain at the site of the
injection. Generally, the ingredients are supplied either
separately or mixed together in unit dosage form, for example, as a
dry lyophilized powder or water-free concentrate in a hermetically
sealed container such as an ampoule or sachette indicating the
quantity of active agent. Where the compound to be used with the
therapeutic and prophylactic methods of the invention is to be
administered by infusion, it can be dispensed, for example, with an
infusion bottle containing sterile pharmaceutical grade water or
saline. Where the compound to be used with the therapeutic and
prophylactic methods of the invention is administered by injection,
an ampoule of sterile water for injection or saline can be provided
so that the ingredients may be mixed prior to administration.
[0684] The amount of a compound to be used with the therapeutic and
prophylactic methods of the invention that will be effective in the
treatment of a particular disease will depend on the nature of the
disease, and can be determined by standard clinical techniques. In
addition, in vitro or in vivo assays may optionally be employed to
help identify optimal dosage ranges. The precise dose to be
employed will also depend on the route of administration, and the
seriousness of the disease, and should be decided according to the
judgment of the practitioner and each patient's circumstances.
However, suitable dosage ranges for oral administration are
generally about 0.001 milligram to about 500 milligrams of a
compound or a pharmaceutically acceptable salt thereof per kilogram
body weight per day. In specific preferred embodiments of the
invention, the oral dose is about 0.01 milligram to about 100
milligrams per kilogram body weight per day, more preferably about
0.1 milligram to about 75 milligrams per kilogram body weight per
day, more preferably about 0.5 milligram to 5 milligrams per
kilogram body weight per day. The dosage amounts described herein
refer to total amounts administered; that is, if more than one
compound is administered, or if a compound is administered with a
therapeutic agent, then the preferred dosages correspond to the
total amount administered. Oral compositions preferably contain
about 10% to about 95% active ingredient by weight.
[0685] Suitable dosage ranges for intravenous (i.v.) administration
are about 0.01 milligram to about 100 milligrams per kilogram body
weight per day, about 0.1 milligram to about 35 milligrams per
kilogram body weight per day, and about 1 milligram to about 10
milligrams per kilogram body weight per day. Suitable dosage ranges
for intranasal administration are generally about 0.01 pg/kg body
weight per day to about 1 mg/kg body weight per day. Suppositories
generally contain about 0.01 milligram to about 50 milligrams of a
compound of the invention per kilogram body weight per day and
comprise active ingredient in the range of about 0.5% to about 10%
by weight.
[0686] Recommended dosages for intradermal, intramuscular,
intraperitoneal, subcutaneous, epidural, sublingual, intracerebral,
intravaginal, transdermal administration or administration by
inhalation are in the range of about 0.001 milligram to about 200
milligrams per kilogram of body weight per day. Suitable doses for
topical administration are in the range of about 0.001 milligram to
about 1 milligram, depending on the area of administration.
Effective doses may be extrapolated from dose-response curves
derived from in vitro or animal model test systems. Such animal
models and systems are well known in the art.
[0687] The compound and pharmaceutically acceptable salts thereof
are preferably assayed in vitro and in vivo, for the desired
therapeutic or prophylactic activity, prior to use in humans. For
example, in vitro assays can be used to determine whether it is
preferable to administer the compound, a pharmaceutically
acceptable salt thereof, and/or another therapeutic agent. Animal
model systems can be used to demonstrate safety and efficacy.
[0688] An exemplary doses of proteins, polypeptides, peptides,
fusion proteins and complexes encompassed by the invention is
0.0001 mg/kg to 100 mg/kg of the patient's body weight. Preferably,
the dosage administered to a patient is between 0.0001 mg/kg and 20
mg/kg, 0.0001 mg/kg and 10 mg/kg, 0.0001 mg/kg and 5 mg/kg, 0.0001
and 2 mg/kg, 0.0001 and 1 mg/kg, 0.0001 mg/kg and 0.75 mg/kg,
0.0001 mg/kg and 0.5 mg/kg, 0.0001 mg/kg and 0.25 mg/kg, 0.0001 and
0.15 mg/kg, 0.0001 and 0.10 mg/kg, 0.001 and 0.5 mg/kg, 0.01 and
0.25 mg/kg, 0.01 and 0.10 mg/kg or 0.1 and 10 mg/kg of the
patient's body weight.
[0689] 4.10 Diagnostic Methods of the Invention
[0690] In certain embodiments, the invention provides methods for
diagnosing the presence of a proliferative disorder in a subject.
In certain embodiments, a diagnostic method of the invention
comprises determining the amount of a complex of the invention in a
subject, wherein a decreased level of a complex of the invention in
the subject indicates the presence of a proliferative disorder or
an increased risk of developing a proliferative disorder. In other
embodiments, a diagnostic method of the invention comprises
determining the amount of a component of a complex (or a nucleic
acid encoding the component) of the invention in a subject, wherein
a decreased level of the component in the subject indicates the
presence of a proliferative disorder or an increased risk of
developing a proliferative disorder. In yet other embodiments, a
diagnostic method of the invention comprises determining the amount
of a component of a complex of the invention in the nuclei of cells
in a subject, wherein a increased level of the component in the
subject indicates the presence of a proliferative disorder or an
increased risk of developing a proliferative disorder.
[0691] A component of a complex, a nucleic acid encoding a
component of a complex of the invention can be detected and
quantified by any method known to the skilled artisan. Exemplary
methods include, but are not limited to, Western blot analysis,
radioimmunoassays, ELISA (enzyme linked immunosorbent assay),
"sandwich" immunoassays, immunoprecipitation assays, precipitin
reactions, gel diffusion precipitin reactions, immunodiffusion
assays, agglutination assays, complement-fixation assays,
immunoradiometric assays, fluorescent immunoassays, protein A
immunoassays for proteins and PCR (particularly RT-PCR) or Northern
blot analysis for nucleic acids.
[0692] The invention also provides methods for detecting,
diagnosing or monitoring a proliferative disorder or a disorder
associated with, characterized by or caused by abnormal pre-tRNA
processing and/or 3' end pre-mRNA processing utilizing an antibody
that immunospecifically binds to a complex of the invention or a
component thereof, or a compound identified in accordance with the
methods of the invention that specifically binds to a complex of
the invention or a component thereof. In a specific embodiment, the
invention provides a method for detecting, diagnosing or monitoring
a proliferative disorder or a disorder associated with,
characterized by or caused by increased pre-tRNA processing and/or
3' end pre-mRNA processing, said method comprising: (a) measuring
the level of a complex of the invention or a component thereof in
cells or a tissue sample of a subject (e.g., a subject with such a
disorder or suspected of having such disorder) using one or more
antibodies or fragments thereof that immunospecifically bind to the
complex or a component thereof, or a compound identified in
accordance with the methods of the invention that specifically
binds to the complex or a component thereof; and (b) comparing the
level of the complex or a component thereof with a control level,
e.g., levels in normal, noncancerous cells or tissue samples,
wherein an increase in the measured complex or component level in
measured in (a) relative to the control level of the complex or
component is indicates that the subject has a proliferative
disorder or a disorder associated with, characterized by or caused
by abnormal pre-tRNA processing and/or 3' end pre-mRNA
processing.
[0693] The invention provides methods for detecting, diagnosing or
monitoring a proliferative disorder or a disorder associated with,
characterized by or caused by abnormal pre-tRNA processing and/or
3' end pre-mRNA processing by comparing the RNA-nucleolytic
activity of a complex purified from cells or a tissue sample from a
subject with such a disorder or suspected of having such disorder
to the RNA-nucleolytic activity of a control, e.g., a complex
purified from normal, non-cancerous cells or a tissue sample, using
an assay well-known to one of skill in the art or described herein.
In a specific embodiment, the invention provides a method for
detecting, diagnosing or monitoring a proliferative disorder or a
disorder associated with, characterized by or caused by increased
RNA-nucleolytic activity (e.g., the pre-tRNA splicing endonuclease
activity, the 3' end pre-mRNA endonuclease activity, the pre-tRNA
cleavage activity of a complex of the invention, and/or the
pre-ribosomal RNA cleavage activity of a complex of the invention),
the method comprising (a) measuring the RNA-nucleolytic activity of
a complex of the invention purified from cells or a tissue sample
from a subject with such a disorder or suspected of having such
disorder to the RNA-nucleolytic activity of a control, e.g., a
complex purified from normal, non-cancerous, cells or a tissue
sample using an assay well-known to one of skill in the art or
described herein; and (b) comparing the RNA-nucleolytic activity of
the complex measured in (a) with the RNA-nucleolytic activity of a
control, e.g., a complex of the invention purified from normal,
non-cancerous, cells or a tissue sample, wherein an increase in the
RNA-nucleolytic activity in measured in (a) relative to the control
indicates that the subject has a proliferative disorder or a
disorder associated with, characterized by or caused by increased
pre-tRNA processing and/or 3' end pre-mRNA processing. In another
embodiment, the invention provides a method for detecting,
diagnosing or monitoring a disorder associated with, characterized
by or caused by decreased RNA-nucleolytic activity (e.g., the
pre-tRNA splicing endonuclease activity, the 3' end pre-mRNA
endonuclease activity, the pre-tRNA cleavage activity of a complex
of the invention, and/or the pre-ribosomal RNA cleavage activity of
a complex of the invention), the method comprising measuring the
RNA-nucleolytic activity of a complex of the invention purified
from cells or a tissue sample from a subject with such a disorder
or suspected of having such disorder to the RNA-nucleolytic
activity of a control, e.g., a complex of the invention purified
from normal, non-cancerous, cells or a tissue sample using an assay
well-known to one of skill in the art or described herein; (b)
comparing the RNA-nucleolytic activity of the complex measured in
(a) with the RNA-nucleolytic activity of a control, e.g., a complex
purified from normal, non-cancerous, cells or a tissue sample,
wherein a decrease in the RNA-nucleolytic activity in measured in
(a) relative to the control indicates that the subject has a
disorder associated with, characterized by or caused by decreased
pre-tRNA processing and/or 3' end pre-mRNA processing.
[0694] The invention provides methods for detecting, diagnosing or
monitoring a proliferative disorder or a disorder associated with,
characterized by or caused by abnormal pre-tRNA processing and/or
3' end pre-mRNA processing by comparing the structure of a complex
of the invention purified from cells or a tissue sample from a
subject (e.g., a subject with such a disorder or suspected of
having such a disorder) to the structure of a control, e.g., a
complex of the invention purified from normal, non-cancerous cells
or a tissue sample, using an assay well-known to one of skill in
the art (e.g., circular circular dichroism and nuclear magnetic
resonance).
5. EXAMPLE
[0695] The Example below describes a human endonuclease complex and
demonstrates a molecular connection between tRNA splicing and
pre-mRNA 3'-end formation.
[0696] Introduction
[0697] Maturation of cellular RNAs is critical for regulation of
normal cell growth and division. Mature eukaryotic RNAs are
generated from large precursors via a series of processing steps.
For example, nascent pre-mRNAs undergo splicing, capping, and
generation of 3' ends by endonucleolytic cleavage and
polyadenylation. The maturation of precursor transfer RNA
(pre-tRNA) requires several steps that include: 1) removal of both
the 5' leader by RNase P (Xiao et al., 2002; Frank and Pace, 1998)
and the 3' trailer by ELAC2 (Takaku et al., 2003); 2) addition of
the CCA trinucleotide to the 3' end; 3) numerous nucleotide
modifications (reviewed in Hopper and Phizicky, 2003). In addition,
several tRNAs contain introns that must be removed to produce a
mature tRNA molecule.
[0698] Intron-containing pre-tRNAs are found in a variety of
organisms from all three domains of life. In lower eukaryotes,
approximately 25% of all tRNA genes contain introns (Trotta et al.,
1997), whereas in humans only 6% of tRNA genes contain introns
(Lowe and Eddy, 1997). All eukaryotic tRNA introns are 14-60
nucleotides in length and interrupt the anticodon loop one
nucleotide 3' to the anticodon (Ogden et al., 1984). Among all
yeast pre-tRNAs, there is no sequence conservation at the splice
junctions, but the 3' splice site is invariably located in a bulged
loop (Baldi et al., 1992).
[0699] The removal of introns from pre-tRNA is an enzymatic
reaction that requires the activity of several different proteins
(reviewed in Abelson et al., 1998). These enzymes have been most
intensively investigated in Archaea and yeast. The first step is
carried out by an evolutionarily conserved tRNA splicing
endonuclease that recognizes and cleaves precursor tRNA at the 5'
and 3' splice sites (Trotta et al., 1997). In yeast, the 5' and 3'
exons are ligated by a tRNA ligase through a series of enzymatic
reactions that lead to joining of the two exons with a 2' phosphate
at the splice junction (Westaway et al., 1988; Phizicky et al.,
1986). This unusual tRNA intermediate is then processed by a 2'
phosphotransferase yielding a mature tRNA (Culver et al.,
1997).
[0700] Yeast tRNA splicing endonuclease is a heteromeric complex of
four subunits encoded by the SEN2, SEN34, SEN54 and SEN15 genes
(Rauhut et al., 1990; Trotta et al., 1997). All four subunits are
present at low levels and are essential for cell viability (Trotta
et al., 1997). The structure and function of the factors of the
yeast tRNA endonuclease complex has been suggested from a number of
experimental results. First, strong sequence conservation of the
yeast Sen2p and Sen34p to the homotetrameric archaeal enzyme
suggested that these two subunits each contained a distinct active
site for cleavage at the 5' and 3' sites. Consistent with this
view, a mutation in Sen2p resulted in a defect in cleavage of the
5' splice site (Ho et al., 1990), whereas a mutation in a conserved
histidine residue in Sen34p resulted in a defect in cleavage of the
3' splice site (Trotta et al., 1997). Second, two-hybrid analysis
demonstrated strong interaction between Sen2p and Sen54p and
between Sen34p and Sen15p (Trotta et al., 1997). Structural studies
with the homotetrameric archaeal tRNA endonuclease suggested that
the strong interaction between Sen2p-Sen54p and Sen34p-Sen15p are
mediated by a conserved carboxyl-terminal beta-sheet interaction
(Lykke-Andersen and Garrett, 1997; Li et al., 1998). Finally,
sequence alignment of heterologous subunits Sen54p and Sen15p to
the archaeal endonuclease revealed a conserved structural element
near the carboxyl-terminus required for dimerization of the two
yeast heterodimers, Sen54p-Sen2p and Sen15p-Sen34p (Lykke-Andersen
and Garrett, 1997; Li et al., 1998). Together, these results led to
a model for the configuration of the yeast tRNA splicing
endonuclease (Li et al., 1998; Abelson et al., 1998).
[0701] Preliminary studies suggest a common mechanism for tRNA
splicing throughout evolution. For example, extracts derived from
human cell lines were reported to carry out accurate tRNA splicing
under conditions in which the yeast tRNA splicing endonuclease is
active (Laski et al., 1983; Standring et al., 1981). Furthermore,
partially purified tRNA splicing endonuclease from Xenopus laevis
germinal vesicles was shown to recognize and accurately cleave
yeast pre-tRNA, forming two half-molecules and an intron
(Gandini-Attardi et al., 1990; Baldi et al., 1986; Otsuka et al.,
1981). Additionally, Xenopus and yeast enzymes appear to fix the
sites of cleavage by recognition of local structures at the
intron-exon boundaries (Baldi et al., 1992; Fabbri et al.,
1998).
[0702] Although there is evidence that the mechanism of tRNA
splicing is well conserved between yeast, archaea and higher
eukaryotes, the enzymes responsible for the maturation of pre-tRNA
in humans are unknown. The present example describes present the
isolation and characterization of human tRNA splicing endonuclease.
In addition, the present example describes the identification a
distinct endonuclease complex resulting from alternative splicing
of the SEN2 subunit. This complex differs from tRNA endonuclease
complex by protein composition and the ability to process pre-tRNA.
Furthermore, the endonuclease complex associates with factors
required for cleavage/polyadenylation of mRNAs, suggesting a
previously undiscovered biochemical link between pre-tRNA splicing
and formation of the 3' end of messenger RNAs.
[0703] 5.1 Subunits of the Human Endonuclease Complex
[0704] 5.1.1 Materials and Methods
[0705] 5.1.1.1 Generation of Stable Cell Lines that Express
HIS-FLAG-tagged Endonuclease Complex Subunits
[0706] Endonuclease complex subunits include the proteins Sen2
(80746), Sen34 (79042), Sen54 (283989), Sen15 (116461), and Clp1
(10978). The open reading frame of Sen2 was generated by PCR
amplification using specific primers (Forward:
cgggatcccgcagaagcagttttccatgccccaaagagg (SEQ ID NO:21); Reverse:
gctctagattaaagatcgtcttggtcactcctctctcg (SEQ ID NO:22)) and was
cloned into the HIS-FLAG-pcDNA3.1/Hygro vector containing a gene
that provides resistance to hygromycin. 293T cells that contain
other necessary components of the endonuclease complex were
transfected with HIS-FLAG-pcDNA3.1/Hygro plasmid encoding
His-Flag-Sen2 (His-Flag-Sen2 vector), and stable clones were
selected by resistance to hygromycin to generate cell lines
expressing His-Flag-Sen2. 293 cell lines expressing His-Flag-Sen34
and His-Flag-Sen15 were generated similarly. The open reading frame
of Sen34 was generated by PCR amplification using primers specific
for Sen34 (Forward: cgggatcccctggtggtggaggtggcgaacggccgctcc (SEQ ID
NO:23); Reverse: gctctagatgcaggctggcccattgcagggaggtgtag (SEQ ID
NO:24)) and was cloned into the HIS-FLAG-pcDNA3.1/Hygro vector to
create HIS-FLAG-Sen34 vector. 293T cells were transfected with the
HIS-FLAG-Sen34 vector, and stable clones were selected by
resistance to hygromycin to generate-cell-linese-xpressing
His-Flag-Sen34. The open reading frame of Sen15was generated by PCR
amplification using primers specific for Sen15 (Forward:
cgggatcccgaggagcgcggcgattccgagccga (SEQ ID NO:25); Reverse:
cgcgctagctcatcttctaagagaaatattctgagggtctggcag (SEQ ID NO:26)) and
was cloned into the HIS-FLAG-pcDNA3.1/Hygro vector to create
HIS-FLAG-Sen15 vector. 293T cells were transfected with the
HIS-FLAG-Sen15 vector, and stable clones were selected by
resistance to hygromycin to generate cell lines expressing
His-Flag-Sen15. The open reading frame of Sen54 was generated by
PCR amplification using primers specific for Sen54 (Forward:
atcgggatcccgagcccgagcccgagcccg (SEQ ID NO:27); Reverse:
gctctagatcagtgccccacatcctggggc (SEQ ID NO:28)) and was cloned into
the HIS-FLAG-pcDNA3.1/Hygro vector to create HIS-FLAG-Sen54 vector.
293T cells are transfected with the HIS-FLAG-Sen54 vector, and
stable clones are selected by resistance to hygromycin to generate
cell lines expressing His-Flag-Sen54. The open reading frame of
Clp1 was generated by PCR amplification using primers specific for
Clp1 (Forward: cgggatcccggagaagaggctaatgatgatgacaagaag (SEQ ID
NO:29); Reverse: gctctagactacttcagatccatgaaccggatatcc (SEQ ID
NO:30)) and was cloned into the HIS-FLAG-pcDNA3.1/Hygro vector to
create HIS-FLAG-Clp1 vector. 293T cells were transfected with the
HIS-FLAG-Clp1 vector, and stable clones were selected by resistance
to hygromycin to generate cell lines expressing His-Flag-Clp1.
[0707] 5.1.1.2 Purification of the Endonuclease Complex from a
Total Cell Extract Containing His-Flag-tagged Proteins.
[0708] Total cell extracts were prepared by resuspending cell
pellets in buffer B (250 mM NaCl; 30 mM Tris-HCl, pH 7.0; 1 mM
EDTA; 5% glycerol; 0.1% Triton X-100; Protease inhibitors (Roche,
Complete Protease Inhibitor Cocktail Tablets)). Cells were
sonicated 3 times for 10 seconds, followed by centrifugation at
15,000 g for 15 minutes. Supernatants were passed through a 0.2
.mu.m filter and added to anti-Flag beads (Sigma) pre-washed with
buffer B. Extracts were incubated with anti-Flag beads for 2 hours
at 4.degree. C. Supernatants were discarded and beads were washed 3
times for 10 minutes at 4.degree. C. with ten bed volumes of buffer
W (400 mM NaCl; 30 mM Tris-HCl, pH 7.0; 1 mM EDTA; 5% glycerol;
0.04% Triton X-100). Following two washes with ten bed volumes of
buffer N (200 mM NaCl; 40 mM Tris-HCl, pH 7.0; 2 mM MgCl.sub.2; 5%
glycerol; 0.05% triton X-100), bound proteins were eluted with
three bed volumes of buffer N containing 0.25 mg/ml 3.times.FLAG
peptide (Sigma) for 1 h at 4.degree. C. Following addition of NaCl
(fmal concentration of 480 mM), eluted proteins were added to
Ni-beads pre-washed with buffer NBW (500 mM NaCl; 40 mM Tris-HC, pH
7.0;2 mM MgCl.sub.2; 5% glycerol; 0.05% triton X-100) and incubated
for 1 hour at 4.degree. C. Supernatants were discarded and Ni-beads
were washed three times with ten bed volumes of buffer NB (200 mM
NaCl; 40 mM Tris-HCl, pH 7.0; 2 mM MgCl.sub.2; 5% glycerol; 0.05%
triton X-100, 15 mM imidazole) for 10 minutes at 4.degree. C. Bound
proteins were eluted with three bed volumes of buffer NE (200 mM
NaCl; 40 mM Tris-HCl, pH 7.0; 2 mM MgCl.sub.2; 5% glycerol; 0.05%
triton X-100, 250 mM imidazole), and equal amount of 80% glycerol
was added to eluted proteins. The proteins were stored at
-20.degree. C.
[0709] 5.1.2 Results
[0710] 5.1.2.1 Identification of Subunits of the Pre-tRNA Human
Endonuclease Complex.
[0711] Yeast Sen2, Sen54 and Sen34 were blasted against the human
protein database. Alignments of the amino acid sequences of the
respective proteins are shown in FIG. 5, FIG. 6, and FIG. 7. To
identify new components of the human tRNA splicing complex, stable
cell lines expressing human His-Flag-Sen2 and His-Flag-Sen34 fusion
proteins were generated as described above. Polypeptides that
co-purify with His-Flag-Sen2 and His-Flag-Sen34 were isolated and
identified by gel electrophoresis. Extracts from untransfected 293T
cells were used as a negative control. As shown in FIG. 9, two new
proteins were found to be co-purifed with His-Flag-Sen2 and
His-Flag-Sen34. These were Sen15 and Clp1. To confirm that Sen15
and Clp1 are the subunits of the endonuclease complex, stable cell
lines expressing His-Flag-Sen15 and His-Flag-Clp1 proteins were
generated as described above. Proteins co-purified with
His-Flag-Sen15 and His-Flag-Clp1 were analyzed by SDS-PAGE followed
by a silver staining. As shown in FIG. 9, components of the
endonuclease complex, Sen2, Sen34, and Sen54 were co-purified with
His-Flag-Sen15 and His-Flag-Clp1, demonstrating that Cpl1 and Sen15
are the subunits of the human endonuclease complex.
[0712] 5.1.2.2 Proteins Co-purifying with Sen2, Sen34, Sen15 and
Clp1 have pre-tRNA Splicing Endonuclease Activity
[0713] The endonuclease complex was purified from stable cell lines
expressing His-Flag-Sen2 or His-Flag-Sen34 as described supra.
Yeast endonuclease was used as a positive control for endonuclease
activity (Trotta et al., 1997, Cell 89, 849-858). Cell extract
fractions that co-purify with His-Flag-Sen2 and His-Flag-Sen34 show
endonuclease activity, as demonstrated by cleavage of labeled
phenylalanine pre-tRNA at intron/exon borders (FIG. 10). The
generation of pre-tRNA substrate was performed according to Trotta
et al., 1997, Cell 89, 849-859. Similarly, fractions that co-purify
with His-Flag-Sen15 and His-Flag-Clp1 also show endonuclease
activity and pre-tRNA cleavage (FIG. 10), demonstrating that Sen2,
Sen34, Sen54, Sen15 and Clp1 are components of the pre-tRNA
splicing endonuclease complex.
[0714] 5.1.2.3 Human tRNA Splicing Endonuclease Subunits are
Localized in the Nucleus
[0715] The open reading frame of Sen2 was generated by PCR
amplification using specific primers
(cgggatccgcagaagcagttttccatgccccaaagagg (SEQ ID NO:21),
agaatagcggccgcttaaagatcgtcttggtcactcc (SEQ ID NO:3 1)) and was
cloned into the myc-pcDNA3 vector to create myc-Sen2 vector. The
open reading frame of Sen34 was generated by PCR amplification
using primers specific for Sen34
(cgggatccctggtggtggaggtggcgaacggccgctcc (SEQ ID NO:23),
gctctagatgcaggctggcccattgcagggaggtgtag (SEQ ID NO:24)) and was
cloned into the GFP-pcDNA3 vector to create GFP-Sen34 vector. To
examine the cellular distribution of tRNA splicing endonuclease
components, myc-Sen2 and GFP-Sen34 vectors were transiently
trasfected into Hela cells and and immunofluorecence was performed
as described previously (Choi and Dreyfuss, 1984, J. Cell. Biol.
99, 1997-2004). It was found that both myc-Sen2p and GFP-Sen34p
localize to the nucleus (FIG. 11). This nuclear localization
demonstrates that pre-tRNA splicing takes place in the nucleus.
[0716] 5.1.2.4 Sen2 Splice Variant is Expressed in Different
Tissues and Cell Lines.
[0717] It was found that human Sen2 is spliced into two different
variants (FIG. 12). The first splice form, Sen2WT, contains all 13
exons of the Sen2 gene. The second splice form contains an
alternate splicing of Exon 7 to Exon 9, bypassing Exon 8, to form
the novel splice variant Sen2.DELTA.Ex8. In order to determine the
presence of alternatively spliced variant of Sen2 in different
tissues, cDNA libraries obtained from different tissues (Clontech)
are examined by PCR using the primers located outside of exon 8:
(gagtacgtgctggtcgaggaagcg (SEQ ID NO:32), gagtcccactttgggctcccagcc
(SEQ ID NO:33)). As shown in FIG. 13, all examined tissues contain
both, Sen2WT and Sen2.DELTA.Ex8 variant. To further determine a
profile of Sen2.DELTA.Ex8 expression over a range of human tissues
and cancer cell lines, "BD MTE Human Multiple Tissue Expression
Array" (BD, Clontech) was hybridized with an oligonucleotide
specific for Exon 8 of Sen2 (gctctgggatgtttaagtatttac (SEQ ID
NO:34)). Hybridazation procedure was carried out according to the
manufacture's instruction (BD, Clontech, user manual PT3307-1)
[0718] 5.1.2.5 Fidelity and Accuracy of Pre-tRNA Cleavage Activity
of Complexes Containing Sen2.DELTA.Ex8 is Compromised
[0719] A purified complex from a stable cell line expressing
His-Flag-Sen2.DELTA.Ex8 was obtained as described, e.g., in section
5.1.1.2. Extracts from untransfected 293T cells were used as a
negative control, whereas 293T cells stably expressing
His-Flag-Sen2 or His-Flag-Sen34 were used as a positive control.
Yeast endonuclease was used as additional positive control for
endonuclease activity (Trotta et al., 1997, Cell 89:849-858). The
generation of pre-tRNA substrate was performed according to Trotta
et al., 1997, Cell 89:849-859. Cell extract fractions that
co-purify with His-Flag-Sen2.DELTA.Ex8 show reduced endonuclease
activity compared to fractions that co-purify with His-Flag-Sen2 or
His-Flag-Sen34 (FIG. 15), demonstrating that the fidelity and
accuracy of pre-tRNA cleavage activity complex containing
Sen2.DELTA.Ex8 is compromised. Fractions co-purifying with
His-Flag-Sen2.DELTA.Ex8 contain reduced levels of Sen34 and Sen15
proteins compared with levels of Sen34 and Sen15 proteins in
fractions that co-purify with His-Flag-Sen2 or His-Flag-Sen34 (FIG.
14), demonstrating that His-Flag-Sen2.DELTA.Ex8 has decreased
ability to bind Sen15 and Sen34.
[0720] 5.1.2.6 The Endonuclease Complexes are Associated with 3'
end Pre-mRNA Processing Machinery.
[0721] Complexes from stable cell lines expressing His-Flag-Sen2,
His-Flag-Sen2.DELTA.Ex8, His-Flag-Sen34, His-Flag-Clp1,
His-Flag-Sen15 were purified as described above (see, e.g., section
5.1.1.2). Proteins co-purified with His-Flag-Sen2,
His-Flag-Sen2.DELTA.Ex8, His-Flag-Sen34, His-Flag-Clp1,
His-Flag-Sen15 were analyzed by SDS-PAGE followed by a Western
blotting with antibodies against components of 3' end pre-mRNA
processing complex, such as CPSF30, Symplekin, CstF64. Y12 antibody
that recognizes pre-mRNA splicing SmB/B.varies. proteins was used a
a negative control. As shown in FIG. 17 all the examined components
of 3' end processing complex are associated with pre-tRNA
endonuclease complexes. His-Flag-Sen2.DELTA.Ex8 is strongly
associated with CPSF30, Symplekin, CstF64 suggsting that
Flag-Sen2.DELTA.Ex8 is largely involved in pre-mRNA processing,
whereas His-Flag-Sen2WT is weakly associated with 3' end processing
factors indicating that the wild type of Sen2 is mostly involved in
pre-tRNA splicing.
[0722] 5.2 Link Between Human tRNA Splicing and pre-mRNA 3'-end
Formation
[0723] 5.2.1 Materials and Methods
[0724] 5.2.1.1 Generation of Stable Cell Lines Expressing
His-Flag-tagged tRNA Splicing Endonuclease Complex Subunits
[0725] The open reading frames of HsSen2, HsSen2deltaEx8 and
HsSen34 were modified by the addition of a sequence encoding an
amino-terminal peptide tag consisting of eight histidine residues
and the Flag epitope. 293 cells were transfected with a plasmid
encoding His-Flag-HsSen2, His-Flag-HsSen2deltaEx8 or
His-Flag-HsSen34. Clones expressing the protein were selected by
hygromycin-resistance.
[0726] Human tRNA splicing endonuclease complex subunits include
the proteins HsSen2 (accession number NP.sub.--079541), HsSen34
(accession number NP.sub.--076980), HsSen54 (accession number
XP.sub.--208944), HsSen15 (accession number NM.sub.--052965), and
HsClp1 (accession number NM.sub.--006831). The open reading frames
of HsSen2, HsSen2deltaEx8, HsSen34, HsSen54, HsSen15, and HsClp1
were generated by PCR amplification using specific primers and
cloned into His-Flag-pcDNA3.1/Hygro vector. 293 cells were
transfected with His-Flag-pcDNA3.1/Hygro plasmid containing the
various tRNA splicing endonuclease complex subunit cDNAs in frame
with the histidine and flag epitopes, and stable clones were
selected by hygromycin-resistance.
[0727] 5.2.1.2 Purification of the Human Endonuclease Complex from
Total Cell Extract Containing His-Flag-tagged Complex Subunits
[0728] Total cell extracts were prepared by resuspending cell
pellets in buffer B (250 mM NaCl; 30 mM Tris-HCl, pH 7.0; 1 mM
EDTA; 5% glycerol; 0.1% Triton X-100; protease inhibitors (Roche,
Complete Protease Inhibitor Cocktail Tablets)). Cells were
sonicated 3 times for 10 seconds, followed by centrifugation at
15,000 g for 15 minutes. Supernatants were passed through a 0.2
micrometer filter and added to anti-Flag beads (Sigma) pre-washed
with buffer B. Extracts were incubated with anti-Flag beads for 2
hours at 4.degree. C. Supernatants were discarded and beads were
washed 3 times for 10 minutes at 4.degree. C. with ten bed volumes
of buffer W (400 mM NaCl; 30 mM Tris-HCl, pH 7.0; 1 mM EDTA; 5%
glycerol; 0.04% Triton X-100). Following two washes with ten bed
volumes of buffer N (200 mM NaCl; 40 mM Tris-HCl, pH 7.0; 2 mM
MgCl.sub.2; 5% glycerol; 0.05% Triton X-100), bound proteins were
eluted with three bed volumes of buffer N containing 0.25 mg/ml
3.times.Flag peptide (Sigma) for 1 h at 4.degree. C. Following
addition of NaCl (final concentration of 480 mM), eluted proteins
were added to Ni-beads pre-washed with buffer NBW (500 mM NaCl; 40
mM Tris-HCl, pH 7.0; 2 mM MgCl.sub.2; 5% glycerol; 0.05% triton
X-100) and incubated for 1 hour at 4.degree. C. Supernatants were
discarded and Ni-beads were washed three times with ten bed volumes
of buffer NB (200 mM NaCl; 40 mM Tris-HCl, pH 7.0; 2 mM MgCl.sub.2;
5% glycerol; 0.05% Triton X-100, 15 mM imidazole) for 10 minutes at
4.degree. C. Bound proteins were eluted with three bed volumes of
buffer NE (200 mM NaCl; 40 mM Tris-HCl, pH 7.0; 2 mM MgCl.sub.2; 5%
glycerol; 0.05% Triton X-100, 250 mM imidazole), and equal amount
of 80% glycerol was added to eluted proteins. The purified proteins
were stored at -20.degree. C.
[0729] 5.2.1.3 Immunofluorescence Microscopy
[0730] HeLa cells were grown on glass coverslips, then were briefly
washed with PBS, fixed in 2% formaldehyde/PBS for 20 minutes at
room temperature and permeabilized in 0.5% Triton X-100/PBS for 5
minutes at room temperature. Fixed cells were blocked in 3% bovine
serum albumin for 1 hour at room temperature. Immunofluorescence
staining was performed by incubating with anti-myc antibody diluted
in PBS containing 3% bovine serum albumin, followed by the specific
secondary antibody coupled to fluorescein isothiocyanate. All
incubations were carried out at room temperature. Images were
obtained using a Zeiss Axiovert 200 epi-fluorescence microscope and
captured using IPLab for windows v3.6 software.
[0731] 5.2.1.4 Mammalian Cell Culture, Antibodies
[0732] HeLa and 293 cells were cultured in Dulbecco's modified
Eagle's medium supplemented with 10% fetal bovine serum
(Invitrogen).
[0733] Antibodies used in these experiments were as follows:
anti--CstF64 (kindly provided by Dr. Wilusz), anti-myc (9E10)
(BD-Pharmigen), anti-Symplekin (BD-Pharmigen), Y12 (Abcam),
anti-Flag (Sigma), and anti-beta-actin (Oncogene).
[0734] 5.2.1.5 Analysis of Expression Profile of HsSen2deltaEx8
[0735] In order to determine the presence of the alternatively
spliced form of HsSen2 in different tissues, cDNA libraries
obtained from different tissues (Clontech) were examined by PCR
using the primers located outside of exon 8:
(5'-gagtacgtgctggtcgaggaagcg-3' (SEQ ID NO:35),
5'-gagtcccactttgggctcccagcc-3' (SEQ ID NO:36). To determine a
profile of HsSen2deltaEx8 expression over a range of human tissues
and cancer cell lines, "BD MTE Human Multiple Tissue Expression
Array" (BD, Clontech) was hybridized with an oligonucleotide
specific for Exon 8 of HsSen2 (5'-gctctgggatgtttaagtatttac-3' (SEQ
ID NO:37). Hybridization was carried out according to the
manufacturers' instruction (BD, Clontech).
[0736] 5.2.1.6 Endonuclease Assay
[0737] Yeast endonuclease was used as a positive control for
endonuclease activity. Purification of S. cerevisiae endonuclease
was performed according to Trotta et al., 1997. RNA products were
extracted with phenol/chloroform, separated on a 12% polyacrylamide
gel containing 8M urea, dried and exposed to film.
[0738] 5.2.1.7 Protein Sequencing
[0739] Bands of interest were excised from 10-14.5% SDS-PAGE
gradient gel and submitted to the protein sequencing facility at
the City of Hope (Duarte, Calif.) for in-gel trypsin digestion,
followed by peptide sequencing according to facility protocols.
[0740] 5.2.1.8 Depletion of HsSen2 with Small Interfering RNAs
(siRNA), Quantitative RT-PCR Analysis and Ribonuclease Protection
Assays (RPA).
[0741] Two 19-base oligonucleotides (sense and antisense)
corresponding to either exon 8 (siRNA-A) or exon 9 (siRNA-B) of the
open reading frame of SEN2 were designed using "siRNA Design
Guidelines" (Ambion). The oligonucleotides were annealed and cloned
into the pSilencer 2.0-U6 vector (Ambion). 293 cells were
transfected using Fugene 6 (Roche) with this vector encoding either
the SEN2 specific sequence (siRNA-A or siRNA-B) or an irregular
control sequence (Ambion). Five separate transfections were carried
out for each siRNA species. Pools of stably expressing cell lines
(designated A1-5 or B 1-5) were selected using 200 microgram/ml
hygromycin for thirty days followed by passage into 6-well dishes
for either: (a) transfection of His-Flag-HsSen2 or
His-Flag-HsSen2deltaEx8 followed in 3 days by addition of
2.times.SDS load-dye, fractionation by SDS-PAGE, and western blot
detection using anti-Flag Ab (Sigma; 1:500) or anti-actin Ab
(Oncogene; 1:2000); or (b) extraction of total RNA using Trizol
(Sigma) according to the manufacturers' protocol. Total RNA was
used for quantitative RT-PCR analysis. RNA (5-10 micrograms) was
treated with Dnasel followed by reverse transcription performed
using a RETROscript kit (Ambion). Quantative PCR was carried out
using a DNA Engine Opticon 2 (MJ Research) with the following
oligonucleotides: precursor tRNA.sup.Leu
(5'-gtcaggatggccgagtggtc-3' (SEQ ID NO:13);
5'-ccgaacacaggaagcagtaa-3' (SEQ ID NO: 14)); tRNA.sup.Ile
(5'-cggtacttataagacagtgc-3' (SEQ ID NO: 15),
5'-gctccaggtgaggcttgaac-3' (SEQ ID NO: 16)), 3' UTR of GAPDH
(5'-ccagcaagagcacaagag-3' (SEQ ID NO: 17);
5'-tgaggaggggagattcagt-3' (SEQ ID NO: 18)); sequence downstream of
the AAUAAA cleavage and polyadenylation signal of GAPDH
(5'-caggtggaggaagtcagg-3' (SEQ ID NO:19);
5'-ctaaccagtcagcgtcagag3'-(SEQ ID NO:20)). Quantitation was based
on normalization to 18s rRNA Amplicon.
[0742] Ten micrograms of total RNA from above was utilized in an
RPA assay using RPA III kit (Ambion) as per manufacturers'
protocol. Antisense riboprobe was derived from +1 to +204
downstream of the AAUAAA cleavage and polyadenylation site of the
GAPDH genomic DNA sequence and +4 to +247 of EFla genomic DNA
sequences. Hybridization temperature for EF1A was 44.degree. C. and
for GAPDH was 42.degree. C.
[0743] 5.2.2 Results
[0744] 5.2.2.1 Human Homologs of the Veast tRNA Splicing
Endonuclease Subunits
[0745] To identify human homologs of the tRNA splicing endonuclease
subunits, a BLAST search of the human protein database was
performed using protein sequences of all four subunits of the S.
cerevisiae tRNA splicing endonuclease. Human homologs for three
subunits, SEN54, SEN2 and SEN34 (FIG. 7A, 6A and B), but were
unable to identify a human homolog of yeast SEN15. Human Sen54
(HsSen54) has a predicted molecular mass of 58 kDa and amino acid
conservation between the yeast and human Sen54p was restricted to
the amino- and carboxyl-terminal regions of the protein (FIG. 7A).
Human Sen2 (HsSen2) is predicted to be 51 kDa, larger than its
yeast counterpart, and shows a high degree of similarity only in
the active-site domain (FIG. 6A). Conversely, the yeast and human
Sen34 (FIG. 6B) are highly homologous throughout the entire
protein. Importantly, sequence alignments between yeast and human
Sen2 and Sen34, the two subunits harboring the endonuclease active
sites (Trotta et al., 1997), demonstrate the highest degree of
similarity in the region corresponding to the active sites of Sen2
and Sen34. These findings indicate a remarkable conservation
between the yeast and human tRNA splicing endonuclease active-site
subunits.
[0746] 5.2.2.2 The Human Sen2 Transcript is Alternatively Spliced
to Form at Least Two Distinct Protein Products
[0747] To demonstrate that the putative human SEN2 and SEN34 genes
encode subunits of the tRNA splicing endonuclease complex the human
SEN2 and SEN34 cDNAs were isolated. Surprisingly, sequencing of
SEN2 clones produced by PCR amplification from human cDNA libraries
identified a variant that lacked 57 nucleotides. This deletion
corresponds precisely to exon 8 of the SEN2 genomic DNA sequence
(FIG. 12), demonstrating that this was an alternatively spliced
form of SEN2.
[0748] PCR analysis of cDNA libraries obtained from different human
tissues using oligonucleotides flanking exon 8 and monitored the
presence of either full-length SEN2 or SEN2 lacking exon 8
(HsSen2deltaEx8) was performed. All tissues examined harbored both
isoforms of SEN2 (data not shown). Using a human multiple tissue
expression array, we profiled the expression of HsSen2 and
HsSen2deltaEx8 RNAs in human tissues and cancer cell lines.
Northern blot analysis was performed with oligonucleotides specific
for either SEN2 or SEN2deltaEx8. The results demonstrated that both
mRNAs are ubiquitously expressed at very low levels in all tissue
types (data not shown).
[0749] 5.2.2.3 The Human Endonuclease Forms Two Functionally
Distinct Isoforms
[0750] To determine whether the human homologs of the yeast
endonuclease subunits function as part of a tRNA splicing complex,
a method was developed for the purification of the endonuclease
complex from human cells (see Experimental Procedures). A stable
293 cell lines expressing His-Flag-tagged human homologs of the
active-site subunits, HsSen2 or HsSen34, as well as the
alternatively spliced subunit, HsSendeltaEx8 was generated.
Proteins from total cell extracts of the stable cell lines were
purified by affinity chromatography using anti-FLAG M2 affinity
resin followed by Ni-NTA agarose resin. Bound proteins were eluted
with imidazole and tested for ability to cleave yeast
pre-tRNA.sup.Phe. The results demonstrated that protein complexes
isolated from cells expressing either His-Flag-HsSen2 or
His-Flag-HsSen34 accurately cleaved pre-tRNA.sup.Phe to yield 5'
exon, 3' exon and intron (FIG. 15, lanes 4 and 5). The efficiency
of cleavage was similar to that of yeast tRNA splicing endonuclease
(FIG. 15, compare lane 4 and 5 with lane 2). Purification of
cleavage activity was dependent upon expression of an
epitope-tagged subunit, as proteins purified from untransfected 293
cells did not cleave pre-tRNA (FIG. 15, lane 1). Taken together,
these results clearly demonstrate that HsSen2 and HsSen34 are
orthologs of the yeast tRNA splicing endonuclease subunits and that
the enzyme for cleavage of pre-tRNA is evolutionarily
conserved.
[0751] The endonuclease complex harboring the
His-Flag-HsSen2deltaEx8 subunit was also purified from human cells
as described above. Surprisingly, the
His-Flag-HsSen2deltaEx8-containing complex retained the ability to
cleave precursor tRNA, but the fidelity and accuracy of cleavage
was severely compromised resulting in cleavage at only the 3'
splice site. Moreover, the HsSen2deltaEx8-containing complex was
unable to release the intron from the pre-tRNA (FIG. 15, lane 3).
In addition, there was a minor cleavage event within the intron of
tRNAP.sup.Phe resulting in two products migrating at approximately
53 and 42 nucleotide position (FIG. 15, lane 3, asterisks). This
minor cleavage product is not detected with other precursor tRNAs
(data not shown). Thus, pre-tRNA is the endogenous substrate for
the HsSen2-containing complex, but not for the
HsSen2deltaEx8-containing complex. This important observation
suggests that the gene for the human endonuclease subunit SEN2 can
encode two distinct active-site-containing proteins, each with
different RNA cleavage specificities.
[0752] 5.2.2.4 Localization of the Human tRNA Splicing Endonuclease
Subunits
[0753] The subcellular localization of the human tRNA splicing
endonuclease subunits was determined by microscopy. Constructs
encoding various epitope-tagged subunits of the human endonuclease
were transiently transfected into HeLa cells and analyzed by
immunofluorescence. The results demonstrated that both active-site
subunits, HsSen2 and HsSen34, as well as HsSen2deltaEx8, were
exclusively localized in the nucleus (FIG. 26). Interestingly, both
HsSen2deltaEx8 and HsSen34 were frequently found in nucleoli in
dot-like structures (FIG. 26, arrowheads).
[0754] 5.2.2.5 Identification of the Components of the Human
Endonuclease Complexes
[0755] The results described above identified two endonuclease
complexes with distinct RNA substrate specificities. To demonstrate
that these complexes may also have distinct subunits with different
functions the composition of both endonuclease isoforms was
analyzed by SDS-PAGE and silver staining.
[0756] This analysis identified an 18 kDa protein present in a
similar stoichiometry to other components in HsSen2 and HsSen34
complexes (FIG. 27A and 27B, band 1). The level of this protein was
drastically reduced in HsSen2deltaEx8 purified complexes (FIG.
27B). Peptides derived from this band matched an 18 kDa protein
encoded by a gene located on chromosome 1 (NP 443197). Amino acid
sequence alignment to yeast Sen15 revealed a previously unobserved
high degree of similarity to yeast Sen15p, strongly suggesting that
the protein is a human homolog of yeast Sen15p (FIG. 7B).
[0757] To confirm that HsSen15 is a subunit of the human tRNA
splicing endonuclease, stable cell lines expressing epitope-tagged
HsSen15 were generated and purified complexes were tested for
endonucleolytic activity as described above. As shown in FIG. 4D,
the results demonstrated that the His-Flag-HsSen15 complex
accurately cleaved precursor-tRNA.sup.Phe releasing the intron and
the 5' and 3' exons. The efficiency of cleavage was similar to that
of endonuclease purified from His-Flag-HsSen2 and His-Flag-HsSen34
cell lines (FIG. 15), demonstrating that HsSen15 is a component of
human tRNA splicing endonuclease. Taken together, these results
indicate that the human tRNA splicing endonuclease complex
containing HsSen2 has a simple protein composition comprised of
homologs to yeast tRNA splicing endonuclease.
[0758] Analysis of the protein composition of the three complexes,
HsSen2, HsSen34 and HsSen2deltaEx8, revealed two proteins in common
(FIG. 27A and 27B). As determined by mass spectrometry, one of
these proteins co-migrates with tagged HsSen2 and HsSen2deltaEx8
and represents the human homolog of the yeast Sen54 protein (FIG.
6A). The deletion of exon 8 did not effect the association of
HsSen2deltaEx8 with the HsSen54 subunit (FIG. 27B). A protein
complex purified via tagged HsSen54 (FIG. 27D) contains HsSen2,
HsSen34 and HsSen15 endonuclease subunits in stoichiometric
amounts. The His-Flag-HsSen54 complex accurately cleaves pre-tRNA
releasing intron and two exons. These results demonstrate that
HsSen54 is an intrinsic subunit of the human tRNA splicing
endonuclease.
[0759] In addition to the bands described above, it is evident from
silver-stained gel in FIG. 27D, that there is an excess of the
protein found in band 2. This band, present in endonuclease
complexes purified from all four tagged subunits (FIG. 27 panel A,
B and D), was identified by mass spectrometry. The results
identified this as the human Clp1 protein (HsClp1). This result was
surprising since HsClp1 was originally isolated as a component of
the cleavage factor I.sub.m (CF Ii.sub.m) known to be involved in
the cleavage of pre-mRNA in the cleavage/polyadenylation reaction
(de Vries et al., 2000).
[0760] 5.2.2.6 Endonuclease Complexes are Associated with Pre-mRNA
3'-end Processing Machinery
[0761] Identification of a pre-mRNA cleavage/polyadenylation
protein associated with the tRNA splicing endonuclease demonstrated
that the endonuclease complex are involved in multiple RNA
processing events. To show that HsClp 1 is a bonafide component of
the human tRNA splicing endonuclease, proteins purified with
His-Flag-HsClp1 were isolated and analyzed by SDS-PAGE and silver
staining. Remarkably, a protein pattern that was almost identical
to that of complexes purified by the tagged versions of HsSen2,
HsSen34 and HsSen15 was observed (FIG. 28A). This result clearly
demonstrates that HsClp1 is an integral component of the human tRNA
splicing endonuclease complex.
[0762] The complex purified with tagged-HsClp1 for tRNA
endonucleolytic activity was analyzed. As shown in FIG. 28B, the
purified complex accurately cleaved precursor-tRNA.sup.Phe
releasing the intron, and the 5' and 3' exons. The efficiency of
cleavage was similar to that of complexes purified with
His-FlagHsSen2 and His-Flag-HsSen34 (FIG. 15). Therefore, in
addition to its role in pre-mRNA 3'-end formation, HsClp1 is
associated with the human tRNA splicing endonuclease.
[0763] The results described above demonstrate that an endonuclease
that forms distinct complexes with diverse RNA endonuclease
activities had been identified. To identify the complexe(s) that
are involved in mRNA 3'-end formation, the presence of additional
components of pre-mRNA 3'-end processing machinery in the complexes
was demonstrated. Complexes purified using the different
epitope-tagged subunits of the endonuclease complexes were analyzed
by Western blotting using antibodies specific for Symplekin and
CstF64, components of the human pre-mRNA 3'-end processing complex.
Y12 antibody (known to recognize pre-mRNA splicing snRNP SiB/B'
proteins) was used as a negative control. Remarkably, the results
(FIG. 29) demonstrate that all examined components of the pre-mRNA
3'-end processing complex were associated with pre-tRNA
endonuclease complexes. Similar amounts of 3'-end complexes were
purified from all His-Flag-tagged tRNA endonuclease subunits. Since
the purification conditions were very stringent and utilized two
affinity chromatography steps (see experimental procedures), the
interaction between tRNA splicing endonuclease and pre-mRNA 3'-end
processing factors is quite robust. Immunoprecipitation under
standard salt conditions to more accurately determine the amount of
3'-end factors associated with the tRNA endonuclease was also
performed. It was shown that as much as 1% of the 3'-end processing
factors are associated with the tRNA endonuclease. Since
endonuclease is a very low abundance protein, this suggests that a
large portion of the tRNA splicing endonuclease is associated with
pre-mRNA 3'-end formation complexes within human cells.
Furthermore, His-Flag-HsSen2deltaEx8 and His-Flag-HsClp1 were able
to associate with a larger proportion of the 3'-end formation
complexes (FIG. 29, compare lane 8 and 11 to 7, 9, 10).
[0764] 5.2.2.7 Depletion of SEN2 Causes Defects in tRNA Splicing
and Pre-mRNA 3' end Formation
[0765] The results described above demonstrate a biochemical link
between tRNA splicing and pre-mRNA cleavage and polyadenylation.
One theory is that if one of the endonuclease complexes were
involved in mRNA 3' processing, then reduction in the amount of the
endonuclease would result in defects in both pre-tRNA splicing and
pre-mRNA 3'-end processing. To test this hypothesis the
intracellular level of HsSen2 and HsSen2deltaEx8 were depleted by
siRNA targeting. It was found that depletion of the SEN2 gene
products by approximately 50% (FIG. 30A) caused an increase in the
level of pre-tRNALeu and pre-tRNA le in comparison to a control
siRNA (FIG. 30B). This result is consistent with a role for HsSen2
in processing of pre-tRNA. Furthermore, using two independent
methods, quantitative RT-PCR and ribonuclease protection (RPA), a
dramatic increase in the level of GAPDH RNA containing extended
sequence 3' of the cleavage and polyadenylation signal was observed
(FIG. 30B-C). In addition, a similar increase in the level of EF1A
RNA containing 3'-extended sequence was observed (FIG. 30C, top
panel). These results were observed with several siRNAs that
targeted different regions of HsSen2/HsSen2deltaEx8, and thus are
attributable to knockdown of the SEN2 gene products and not an
off-target siRNA effect (FIG. 30; data not shown). Taken together,
this is strong evidence that the active-site subunit HsSen2 or its
spliced-variant HsSen2deltaEx8 are involved in processing of
pre-tRNA and pre-mRNA, linking two fundamental processes of RNA
maturation. Primers that were used in connection with the siRNA
experiments are shown in FIG. 30D.
[0766] 5.2.3 Discussion
[0767] All living organisms contain a population of precursor tRNAs
which are interrupted by introns. Therefore, intron removal from
pre-tRNAs (i.e. endonuclease cleavage) is a fundamental biological
process. Although intron removal from pre-tRNA has been studied in
detail in the yeast Saccharomyces cerevisiae, the machinery for
human pre-tRNA intron removal was previously unknown. The results
presented here defme the components of the human tRNA endonuclease
complex and raise the exciting possibility that the catalytic
subunits of the tRNA endonuclease can function in distinct RNA
processing events.
[0768] 5.2.3.1 Identification of the Human tRNA Splicing
Endonuclease Subunits
[0769] The protein composition, localization and function of the
human tRNA splicing endonuclease has been determined as described
herein. The enzyme was initially isolated using epitope-tagged
human homologs of the two active-site subunits of yeast tRNA
endonuclease. These purified complexes were demonstrated herein to
accurately processed precursor tRNA, cleaving at the 5' and 3'
splice sites to release the intron. This result strongly suggests
that HsSen2 and HsSen34 are the orthologs of the active-site
subunits of tRNA splicing endonuclease. The protein composition of
the tRNA splicing endonuclease was also identified as described
herein. The complex is comprised of orthologs of the yeast enzyme
subunits, Sen2p, Sen34p, Sen15p, and Sen54p. An unanticipated
result was the finding that HsClp1, a protein involved in pre-mRNA
3'-end processing, is also an integral member of the human tRNA
endonuclease complex.
[0770] 5.2.3.2 Model for the Human tRNA Splicing Endonuclease
[0771] A model of the architecture of yeast tRNA endonuclease was
based on the structure of archaeal endonuclease from M. jannaschii
(Li et al., 1998). The yeast enzyme was proposed to be a
heterotetramer composed of two dimers, Sen54p-Sen2p and
Sen34p-Sen15p, each containing a distinct active site.
Tetramerization is thought to occur by interaction of the acidic
residues within loop L10 of the Sen54p and Sen5p subunits, with a
polar groove formed between the amino- and carboxyl-terminal domain
of the active-site endonuclease subunits (Li et al., 1998). FIG. 1C
and 4C show that the most conserved regions of HsSen54 and HsSen15
are located in the carboxyl-terminal region of the proteins and
correspond exactly to yeast loop L10 and beta 9 sequences.
[0772] 5.2.3.3 Identification of an Alternatively Spliced Isoform
of HsSen2
[0773] Our investigation of the human endonuclease complex resulted
in the discovery of an alternatively spliced isoform of the SEN2
active-site subunit lacking exon 8. The amino acid sequence of exon
8 corresponds to a conserved alpha2-helix found in archaeal and
yeast endonucleases (FIG. 6A) and is a key structural element in
the formation of the tetrameric enzyme. The alpha2-helix serves to
orient the amino- and carboxyl-terminal domains of the active-site
subunit to allow formation of the polar groove into which the
conserved loop L10from a heterologous subunit can interact (FIG.
6A; Li et al., 1998; Bujnicki and Rychlewski, 2000; Lykke-Andersen
and Garrett, 1997). Thus, one theory is that omission of this
alpha2-helix in HsSen2deltaEx8 would alter the structure of this
active-site subunit resulting in an inability to stably interact
with loop L10 of the HsSen15/HsSen34 heterodimer. Consistent with
this theory, analysis of the composition of the HsSen2deltaEx8
complex revealed a significant reduction in the level of HsSen15
and HsSen34 protein compared to the purified HsSen2 complex (FIG.
27B). This observation provides additional support for the
structural model of the human and yeast tRNA splicing
endonucleases.
[0774] Furthermore, these results raise the intriguing possibility
that alteration of subunit interactions through alternative
splicing is a strategy used by higher eukaryotes to generate
multiple endonuclease complexes capable of different RNA processing
events. This theory is supported by the result that
HsSen2deltaEx8-containing endonuclease complex does not properly
cleave pre-tRNAs, although it does retain endonucleolytic activity
(FIG. 15, lane 3). Thus, it is likely that the HsSen2deltaEx8
complex is not a tRNA splicing endonuclease, but is responsible for
processing as yet unknown RNA substrates.
[0775] 5.2.3.4 Localization of the tRNA Splicing Endonuclease
[0776] In this study, it was shown that the active-site subunits
HsSen2 and HsSen34 localize exclusively to the nucleus, consistent
with previous results suggesting that tRNA maturation occurs in the
nucleus in higher eukaryotes. For example, RNase P was shown to
localize to the nucleoplasm with transient association in the
nucleolus in HeLa cells (Jacobson et al., 1997). Additionally,
human tRNA splicing endonuclease activity behaves a soluble nuclear
protein in HeLa cells (Laski et al., 1983; Standring et al., 1981).
Finally, in Xenopus laevis, intron-containing tRNAs are matured and
modified in the nucleus and the endonuclease is a soluble protein
found in the germinal vesicle of the oocyte (De Robertis and Olson,
1979; Otsuka et al., 1981; Mattoccia et al., 1979). In addition to
the localization of the endonuclease subunits, a large portion of
the tRNA splicing endonuclease is found associated with the
nuclear-localized proteins of the mRNA 3'-end formation machinery.
Taken together these data strongly support a model whereby tRNA
splicing occurs in the nucleus of higher eukaryotes. This is
consistent with the model for yeast tRNA splicing supported by
localization of the endonuclease to the nuclear membrane fraction
(Peebles et al., 1983; Rauhut et al., 1990) and immuno-localization
of the yeast tRNA splicing ligase, which joins the 5' and 3' exons
of tRNA after endonucleolytic cleavage, to the inner membrane of
the nuclear envelope (Clark and Abelson, 1987).
[0777] Recently two pieces of evidence have emerged suggesting that
tRNA splicing in yeast occurs in the cytoplasm. Yoshihisa and
colleagues demonstrated that a fraction of tRNA endonuclease is
found associated with the mitochondrial surface and that
temperature-sensitive mutations of the tRNA splicing endonuclease
accumulated intron-containing tRNA in the cytosol (Yoshihisa et
al., 2003). Furthermore, analysis of a genome-wide GFP-fusion
localization study indicated that GFP-tagged subunits of the
endonuclease, ySen2, ySen54 and ySen15 localize exclusively to the
mitochondria (Huh et al., 2003). In addition, a GFP-tagged fusion
to tRNA splicing ligase localizes throughout the cytoplasm. Taken
together, these observations are consistent with a model whereby
tRNA splicing occurs within the cytoplasm in yeast. This model
contrasts with the nuclear localization of the human enzyme that we
have presented in this paper. Thus, it appears as though tRNA
splicing localization may be regulated differently in yeast and
humans. Consistent with our findings in HeLa cells we also found
that GFP-tagged HsSen2 and HsSen34 localized to the nucleus in
primary neurons (data not shown).
[0778] The active-site subunits can localize in dot-like structures
within the nucleolus (FIG. 26, arrowheads). This suggests the
possibility that the tRNA splicing endonuclease may be transiently
localized in the nucleolus. In preliminary experiments, treatment
of HeLa cells with Actinomycin D altered the localization of
GFP-tagged HsSen2 or HsSen34 within the nucleus, leading to diffuse
localization in both the nucleoplasm and the nucleolus (data not
shown). This suggests that tRNA splicing endonuclease can cycle
between the nucleoplasm and the nucleolus. This observation may
have important implications for the regulation of the tRNA splicing
in higher eukaryotes.
[0779] 5.2.3.5 The Endonuclease Provides a Biochemical Link Between
tRNA Splicing and Pre-mRNA 3'-end Formation
[0780] The demonstration of a role for HsClp1 in splicing of tRNA
precursors is surprising and suggests a link between the processes
of tRNA splicing and mRNA 3'-end formation. Keller and co-workers
originally identified the HsClp1 protein as a component of CF
II.sub.m known to be involved in 3'-end processing of pre-mRNA (de
Vries et al., 2000). Generation of the 3' end of pre-mRNA is
thought to be a two-step reaction, whereby pre-mRNA is
endonucleolytically cleaved and subsequently polyadenylated to
yield a mature mRNA. The pre-mRNA 3'-end processing complex
consists of cleavage and polyadenylation specificity factor (CPSF),
cleavage stimulation factor (CstF), two cleavage factors, CF
I.sub.m and CF II.sub.m, and poly(A) polymerase (PAP) (reviewed in
Wahle and Ruegsegger, 1999; Calvo and Manley, 2003; Zhao et al.,
1999a). HsClp1 has been shown to be a subunit of CF II.sub.m and is
thought to act as a bridge, as it interacts with CF I.sub.m and
CPSF (de Vries et al 2000). In yeast, Clp1 has also been shown to
be involved in 3'-end processing (Minvielle-Sebastia and Keller,
1999).
[0781] Several pieces of evidence have been previously reported
that are consistent with a link between tRNA processing and
pre-mRNA 3'-end formation. O'Connor and Peebles demonstrated that
yeast containing a conditional ptal allele were defective in the
processing of precursor tRNAs (O'Connor and Peebles, 1992).
Subsequently, Ptalp was identified as a component of the yeast
pre-mRNA 3'-end processing machinery (Preker et al., 1997; Zhao et
al., 1999b). The human homolog of PTA1, symplekin, was found to be
associated with cleavage stimulation factor (CstF) (Takagaki and
Manley, 2000; Zhao et al., 1999b). Additionally, pre-tRNA 3'-end
processing and pre-mRNA 3'-end formation have been genetically
linked in humans. Takaku et al., have shown that ELAC2 is the
enzyme responsible for 3'-end processing of precursor tRNA
transcripts (Takaku et al., 2003; Zhao et al., 1999b; Takaku et
al., 2003). Prior work showed that ELAC2 has a high degree of
similarity with CPSF73, a protein belonging to the pre-mRNA
cleavage and polyadenylation specificity factor (Simard et al.,
2002; Tavtigian et al., 2001), suggesting that CPSF73 may be an
endonuclease involved in pre-mRNA 3'-end processing. Thus, it is
possible that the machinery (ie., endonuclease) for these disparate
RNA processes, pre-tRNA splicing, pre-tRNA 3'-end maturation and
pre-mRNA 3'-end formation, all arose from a common ancestor. This
paradigm is supported by the notion that the tRNA splicing
endonuclease is an ancient RNA processing enzyme (Belfort and
Weiner, 1997; Trotta and Abelson, 1998).
[0782] This is the first demonstration of a biochemical link
between pre-tRNA processing and pre-mRNA 3'-end processing. It has
been shown herein that HsClp1 is a subunit of two distinct human
endonuclease complexes: an HsSen2 tRNA splicing endonuclease
complex and an endonuclease complex formed by the alternatively
spliced form of SEN2, HsSen2deltaEx8. Remarkably, the tRNA
endonuclease that co-purified with tagged-HsClp1 cleaves precursor
tRNA specifically at the 5' and 3' splice sites to release the
intron, suggesting that the HsClp1 protein is strongly associated
with the machinery for cleavage of precursor tRNAs in human
cells.
[0783] In addition, that the human endonuclease complexes was found
to associate with a subset of 3'-end processing factors that
include CPSF160, CPSF30, CstF64, symplekin, but not PAP and Sm
proteins (FIG. 29 and data not shown). This specific set of protein
components suggests that endonuclease complexes may be involved in
the cleavage of pre-mRNA, as opposed to splicing or
polyadenylation. Interestingly, the HsSen2deltaEx8 complex more
strongly associated with Symplekin, and CstF64 than the HsSen2
complex. The significance of the tighter association between
alternatively spliced SEN2 and pre-mRNA 3'-end processing is
unknown, but the altered substrate specificity in cleavage
reactions and the presence of pre-mRNA 3'-end processing factors in
purified fractions suggest that HsSen2deltaEx8 may be primarily
involved in processing of pre-mRNA. Consistent with this theory,
siRNA depletion of the products of the SEN2 gene resulted in
defects in 3'-end processing of endogenous mRNA transcripts,
causing the accumulation of end-extended products, as detected by
both quantitative RT-PCR and ribonuclease protection assays for
several different mRNA transcripts (FIG. 30A-C). As shown in FIG.
30, an attempt was made to distinguish the roles of wild-type Sen2
versus HsSen2deltaEx8 in processing pre-tRNA and pre-mRNA 3' ends
by specifically targeting wild-type HsSen2 with siRNA-A, but for
unknown reasons this siRNA caused the depletion of both versions of
SEN2.
[0784] Taken together, the SEN2 siRNA targeting results and the
evidence of a physical association between the two machineries
described above, support a model whereby tRNA splicing and pre-mRNA
3'-end formation are catalyzed by the same components of an
endonuclease complex in mammalian cells. This suggests that this
endonuclease complex functions in the formation of mRNA, tRNA, and
potentially other RNA substrates. The concept of coupling pre-tRNA
splicing to the formation of the 3' end of mRNAs is interesting
because it could allow cells to modulate the level of mature mRNA
by sensing the amount of pre-tRNA that is produced in response to
various growth conditions. This is the first example of regulating
translation efficiency by a complex that controls multiple RNA
processing activities in the cell.
[0785] References
[0786] Abelson, J., Trotta, C. R., and Li, H. (1998). tRNA
splicing. J Biol Chem 273, 12685-12688.
[0787] Baldi, M. I., Mattoccia, E., Bufardeci, E., Fabbri, S., and
Tocchini-Valentini, G. P. (1992). Participation of the intron in
the reaction catalyzed by the Xenopus tRNA splicing endonuclease.
Science 255, 1404-1408.
[0788] Baldi, M. I., Mattoccia, E., Ciafre, S., Attardi, D. G., and
Tocchini-Valentini, G. P. (1986). Binding and cleavage of pre-tRNA
by the Xenopus splicing endonuclease: two separable steps of the
intron excision reaction. Cell 47, 965-971.
[0789] Belfort, M., and Weiner, A. (1997). Another bridge between
kingdoms: tRNA splicing in archaea and eukaryotes. Cell 89,
1003-1006.
[0790] Bujnicki, J. M., and Rychlewski, L. (2000). Prediction of a
common fold for all four subunits of the yeast tRNA splicing
endonuclease: implications for the evolution of the EndA/Sen
family. FEBS Lett 486, 328-329.
[0791] Calvo, O., and Manley, J. L. (2003). Strange bedfellows:
polyadenylation factors at the promoter. Genes Dev 17,
1321-1327.
[0792] Clark, M. W., and Abelson, J. (1987). The subnuclear
localization of tRNA ligase in yeast. J Cell Biol 105,
1515-1526.
[0793] Culver, G. M., McCraith, S. M., Consaul, S. A., Stanford, D.
R., and Phizicky, E. M. (1997). A 2'-phosphotransferase implicated
in tRNA splicing is essential in Saccharomyces cerevisiae. J Biol
Chem 272, 13203-13210.
[0794] De Robertis, E. M., and Olson, M. V. (1979). Transcription
and processing of cloned yeast tyrosine tRNA genes microinjected
into frog oocytes. Nature 278, 137-143.
[0795] de Vries, H., Ruegsegger, U., Hubner, W., Friedlein, A.,
Langen, H., and Keller, W. (2000). Human pre-mRNA cleavage factor
II(m) contains homologs of yeast proteins and bridges two other
cleavage factors. EMBO J 19, 5895-5904.
[0796] Fabbri, S., Fruscoloni, P., Bufardeci, E., Di Nicola, N. E.,
Baldi, M. I., Attardi, D. G., Mattoccia, E., and
Tocchini-Valentini, G. P. (1998). Conservation of substrate
recognition mechanisms by tRNA splicing endonucleases. Science 280,
284-286.
[0797] Frank, D. N., and Pace, N. R. (1998). Ribonuclease P: unity
and diversity in a tRNA processing ribozyme. Annu Rev Biochem 67,
153-180.
[0798] Gandini-Attardi, D., Baldi, I. M., Mattoccia, E., and
Tocchini-Valentini, G. P. (1990). Transfer RNA splicing
endonuclease from Xenopus laevis. Methods Enzymol 181, 510-517.
[0799] Ho, C. K., Rauhut, R., Vijayraghavan, U., and Abelson, J.
(1990). Accumulation of pre-tRNA splicing `2/3` intermediates in a
Saccharomyces cerevisiae mutant. EMBO J 9, 1245-1252.
[0800] Hopper, A. K., and Phizicky, E. M. (2003). tRNA transfers to
the limelight. Genes Dev 17, 162-180.
[0801] Hu, P., Wu, S., and Hernandez, N. (2003). A minimal RNA
polymerase III transcription system from human cells reveals
positive and negative regulatory roles for CK2. Mol Cell 12,
699-709.
[0802] Huh, W. K., Falvo, J. V., Gerke, L. C., Carroll, A. S.,
Howson, R. W., Weissman, J. S., and O'Shea, E. K. (2003). Global
analysis of protein localization in budding yeast. Nature 425,
686-691.
[0803] Jacobson, M. R., Cao, L. G., Taneja, K., Singer, R. H.,
Wang, Y. L., and Pederson, T. (1997). Nuclear domains of the RNA
subunit of RNase P. J Cell Sci 110 (Pt 7), 829-837.
[0804] Laski, F. A., Fire, A. Z., RajBhandary, U. L., and Sharp, P.
A. (1983). Characterization of tRNA precursor splicing in mammalian
extracts. J Biol Chem 258, 11974-11980.
[0805] Li, H., Trotta, C. R., and Abelson, J. (1998). Crystal
structure and evolution of a transfer RNA splicing enzyme. Science
280, 279-284.
[0806] Lowe, T. M., and Eddy, S. R. (1997). tRNAscan-SE: a program
for improved detection of transfer RNA genes in genomic sequence.
Nucleic Acids Res 25, 955-964.
[0807] Lykke-Andersen, J., and Garrett, R. A. (1997). RNA-protein
interactions of an archaeal homotetrameric splicing
endoribonuclease with an exceptional evolutionary history. EMBO J
16, 6290-6300.
[0808] Mattoccia, E., Baldi, M. I., Carrara, G., Fruscoloni, P.,
Benedetti, P., and Tocchini-Valentini, G. P. (1979). Separation of
RNA transcription and processing activities from X. laevis germinal
vesicles. Cell 18, 643-648.
[0809] Minvielle-Sebastia, L., and Keller, W. (1999). mRNA
polyadenylation and its coupling to other RNA processing reactions
and to transcription. Curr Opin Cell Biol 11, 352-357.
[0810] O'Connor, J. P., and Peebles, C. L. (1992). PTA1, an
essential gene of Saccharomyces cerevisiae affecting pre-tRNA
processing. Mol Cell Biol 12, 3843-3856.
[0811] Ogden, R. C., Lee, M. C., and Knapp, G. (1984). Transfer RNA
splicing in Saccharomyces cerevisiae: defining the substrates.
Nucleic Acids Res 12, 9367-9382.
[0812] Otsuka, A., De Paolis, A., and Tocchini-Valentini, G. P.
(1981). Ribonuclease "XlaI," an activity from Xenopus laevis
oocytes that excises intervening sequences from yeast transfer
ribonucleic acid precursors. Mol Cell Biol 1, 269-280.
[0813] Peebles, C. L., Gegenheimer, P., and Abelson, J. (1983).
Precise excision of intervening sequences from precursor tRNAs by a
membrane-associated yeast endonuclease. Cell 32, 525-536.
[0814] Phizicky, E. M., Schwartz, R. C., and Abelson, J. (1986).
Saccharomyces cerevisiae tRNA ligase. Purification of the protein
and isolation of the structural gene. J Biol Chem 261,
2978-2986.
[0815] Preker, P. J., Ohnacker, M., Minvielle-Sebastia, L., and
Keller, W. (1997). A multisubunit 3'-end processing factor from
yeast containing poly(A) polymerase and homologues of the subunits
of mammalian cleavage and polyadenylation specificity factor. EMBO
J 16, 4727-4737.
[0816] Rauhut, R., Green, P. R., and Abelson, J. (1990). Yeast
tRNA-splicing endonuclease is a heterotrimeric enzyme. J Biol Chem
265, 18180-18184.
[0817] Sampson, J. R., and Saks, M. E. (1993). Contributions of
discrete tRNA(Ser) domains to aminoacylation by E.coli seryl-tRNA
synthetase: a kinetic analysis using model RNA substrates. Nucleic
Acids Res 21, 4467-4475.
[0818] Simard, J., Dumont, M., Soucy, P., and Labrie, F. (2002).
Perspective: prostate cancer susceptibility genes. Endocrinology
143, 2029-2040.
[0819] Standring, D. N., Venegas, A., and Rutter, W. J. (1981).
Yeast tRNA3Leu gene transcribed and spliced in a HeLa cell extract.
Proc Natl Acad Sci U S A 78, 5963-5967.
[0820] Takagaki, Y., and Manley, J. L. (2000). Complex protein
interactions within the human polyadenylation machinery identify a
novel component. Mol Cell Biol 20, 1515-1525.
[0821] Takaku, H., Minagawa, A., Takagi, M., and Nashimoto, M.
(2003). A candidate prostate cancer susceptibility gene encodes
tRNA 3' processing endoribonuclease. Nucleic Acids Res 31,
2272-2278.
[0822] Tavtigian, S. V., Simard, J., Teng, D. H., Abtin, V.,
Baumgard, M., Beck, A., Camp, N. J., Carillo, A. R., Chen, Y.,
Dayananth, P., Desrochers, M., Dumont, M., Farnham, J. M., Frank,
D., Frye, C., Ghaffari, S., Gupte, J. S., Hu, R., Iliev, D.,
Janecki, T., Kort, E. N., Laity, K.E., Leavitt, A., Leblanc, G.,
McArthur-Morrison, J., Pederson, A., Penn, B., Peterson, K. T.,
Reid, J. E., Richards, S., Schroeder, M., Smith, R., Snyder, S. C.,
Swedlund, B., Swensen, J., Thomas, A., Tranchant, M., Woodland, A.
M., Labrie, F., Skolnick, M. H., Neuhausen, S., Rommens, J.,
and
[0823] Cannon-Albright, L. A. (2001). A candidate prostate cancer
susceptibility gene at chromosome 17p. Nat Genet 27, 172-180.
[0824] Trotta, C. R. and Abelson, J. (1998). tRNA Splicing: An RNA
world add-on or an ancient reaction? In RNA World II, R. F.
Gesteland, T. R. Cech, and J. F. Atkins, eds. Cold Spring Harbor
Laboratory Press), pp. 561-584.
[0825] Trotta, C. R., Miao, F., Arn, E. A., Stevens, S. W., Ho, C.
K., Rauhut, R., and Abelson, J. N. (1997). The yeast tRNA splicing
endonuclease: a tetrameric enzyme with two active site subunits
homologous to the archaeal tRNA endonucleases. Cell 89,
849-858.
[0826] Wahle, E., and Ruegsegger, U. (1999). 3'-End processing of
pre-mRNA in eukaryotes. FEMS Microbiol Rev 23, 277-295.
[0827] Wallace, A. M., Dass, B., Ravnik, S. E., Tonk, V., Jenkins,
N. A., Gilbert, D. J., Copeland, N. G., and MacDonald, C. C.
(1999). Two distinct forms of the 64,000 Mr protein of the cleavage
stimulation factor are expressed in mouse male germ cells. Proc
Natl Acad Sci U S A 96, 6763-6768.
[0828] Westaway, S. K., Phizicky, E. M., and Abelson, J. (1988).
Structure and function of the yeast tRNA ligase gene. J Biol Chem
263, 3171-3176.
[0829] Xiao, S., Scott, F., Fierke, C. A., and Engelke, D. R.
(2002). Eukaryotic ribonuclease P: a plurality of ribonucleoprotein
enzymes. Annu Rev Biochem 71, 165-189.
[0830] Yoshihisa, T., Yunoki-Esaki, K., Ohshima, C., Tanaka, N.,
and Endo, T. (2003). Possibility of cytoplasmic pre-tRNA splicing:
the yeast tRNA splicing endonuclease mainly localizes on the
mitochondria. Mol Biol Cell 14, 3266-3279.
[0831] Zhao, J., Hyman, L., and Moore, C. (1999a). Formation of
mRNA 3' ends in eukaryotes: mechanism, regulation, and
interrelationships with other steps in mRNA synthesis. Microbiol
Mol Biol Rev 63, 405-445.
[0832] Zhao, J., Kessler, M., Helmling, S., O'Connor, J. P., and
Moore, C. (1999b). Pta1, a component of yeast CF II, is required
for both cleavage and poly(A) addition of mRNA precursor. Mol Cell
Biol 19, 7733-7740.
[0833] Equivalents:
[0834] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described will
become apparent to those skilled in the art from the foregoing
description and accompanying figures. Such modifications are
intended to fall within the scope of the appended claims.
[0835] Various publications are cited herein, the disclosures of
which are incorporated by reference in their entireties.
Sequence CWU 1
1
37 1 2373 DNA Homo sapeins 1 gggcgaggaa agcgcggccc tttccgagtt
tggtgttttg cagcgaaagg aaatctcgct 60 cttccgaaag tcctccaggg
cgagagagga aagggcctag gtactgtgct ggggtcgcac 120 agccggccga
gacagtgccg ggacggggag ccaggcttcc gagtgcgccc ggtcactgac 180
tcctccgcgc tttcctcgtg cgcctgcagc ccttggttct tggaaacgcc ggcgccttgt
240 tcagggctgg tggggctggg gcgcaaggtg cagctgacaa tgcccgagag
gagccgcagc 300 ctctggtgga gttcggtcgg gtgtgggggt agtcaaggaa
agaagcaaag ggaatacctc 360 ctctgaaaaa tggcagaagc agttttccat
gccccaaaga ggaaaagaag agtgtatgag 420 acttacgagt ctccattgcc
aatccctttt ggtcaggacc atggtcctct gaaagaattc 480 aagatattcc
gtgctgaaat gattaacaac aatgtgattg tgaggaatgc ggaggacatt 540
gagcagctct atgggaaagg ttattttgga aaaggtattc tttcaagaag ccgtccaagc
600 ttcacaattt cagatcctaa actggttgct aaatggaaag atatgaagac
aaacatgcct 660 atcatcacat caaagaggta tcagcatagt gttgagtggg
cagcagagct gatgcgtaga 720 caggggcagg atgagagtac agtgcgcaga
atcctcaagg attacacgaa accgcttgag 780 catcctcctg tgaaaaggaa
tgaagaggct caagtgcatg acaagcttaa ctctggaatg 840 gtttccaaca
tggaaggcac agcaggggga gagagacctt ctgtggtaaa cggggactct 900
ggaaagtcag gtggtgtggg tgatccccgt gagccattag gctgcctgca ggagggctct
960 ggctgccacc caacaacaga gagctttgag aaaagcgtgc gagaggatgc
ctcacctctg 1020 ccccatgtct gttgctgcaa acaagatgct ctcatcctcc
agcgtggcct tcatcatgaa 1080 gacggcagcc agcacatcgg cctcctgcat
cctggggaca gagggcctga ccatgagtac 1140 gtgctggtcg aggaagcgga
gtgtgccatg agcgagaggg aggctgcccc aaatgaggaa 1200 ttggtgcaaa
gaaacaggtt aatatgcaga agaaatccat ataggatctt tgagtatttg 1260
caactcagcc tagaagaggc ctttttcttg gtctatgctc tgggatgttt aagtatttac
1320 tatgagaagg agcctttaac gatagtgaag ctctggaaag ctttcactgt
agttcagccc 1380 acgttcagaa ccacctacat ggcctaccat tactttcgaa
gcaagggctg ggtgcccaaa 1440 gtgggactca agtacgggac agatttactg
ctatatcgga aaggccctcc attttaccat 1500 gcaagttatt ctgtcattat
cgagctagtt gatgaccatt ttgaaggctc tctccgcagg 1560 cctctcagtt
ggaagtccct ggctgccttg agcagagttt ccgttaatgt ctctaaggaa 1620
cttatgctgt gctatttgat taaaccctct actatgactg acaaggaaat ggagtcacca
1680 gaatgtatga aaaggattaa agttcaggag gtgattctga gtcgatgggt
ttcttcacga 1740 gagaggagtg accaagacga tctttaacaa ttcaacctca
aatttctaat ttcaccaaca 1800 actatttatt gagggctagg taaaaagttc
tttttgttgt aatcgtccat taattcataa 1860 gttttaaagg gcatggtgct
cccagcacca gaaaactatc agtgttttta aagataaatt 1920 acacaaggga
ggagaaagat ccctgtgcta ggacaacaga ttctatactt gcgttggcct 1980
ctaactcccc catccagagc ctcctgcctc tggcgtcagt tttttccctc atccactcac
2040 tggggagatt ggactagagg agtcctgaga ggacacttcc aacaagagac
atttattctc 2100 tgattttacc tgaaaatggt agtagtttac atttatacag
tacagtttat gaagcacttt 2160 catacgcagg catctcttgt tacctacatc
taagctgttc ccgaaagagt gttacagaac 2220 acaacagtat tgtacaatat
tcgataagca tatcttcact gcacttgtta taaaaatgag 2280 tggtgaaata
atgtttggag acataatgaa agcgattaac atttggcaaa atataataaa 2340
gcctttttgt aattggtgaa aaaaaaaaaa aaa 2373 2 465 PRT Homo sapiens 2
Met Ala Glu Ala Val Phe His Ala Pro Lys Arg Lys Arg Arg Val Tyr 1 5
10 15 Glu Thr Tyr Glu Ser Pro Leu Pro Ile Pro Phe Gly Gln Asp His
Gly 20 25 30 Pro Leu Lys Glu Phe Lys Ile Phe Arg Ala Glu Met Ile
Asn Asn Asn 35 40 45 Val Ile Val Arg Asn Ala Glu Asp Ile Glu Gln
Leu Tyr Gly Lys Gly 50 55 60 Tyr Phe Gly Lys Gly Ile Leu Ser Arg
Ser Arg Pro Ser Phe Thr Ile 65 70 75 80 Ser Asp Pro Lys Leu Val Ala
Lys Trp Lys Asp Met Lys Thr Asn Met 85 90 95 Pro Ile Ile Thr Ser
Lys Arg Tyr Gln His Ser Val Glu Trp Ala Ala 100 105 110 Glu Leu Met
Arg Arg Gln Gly Gln Asp Glu Ser Thr Val Arg Arg Ile 115 120 125 Leu
Lys Asp Tyr Thr Lys Pro Leu Glu His Pro Pro Val Lys Arg Asn 130 135
140 Glu Glu Ala Gln Val His Asp Lys Leu Asn Ser Gly Met Val Ser Asn
145 150 155 160 Met Glu Gly Thr Ala Gly Gly Glu Arg Pro Ser Val Val
Asn Gly Asp 165 170 175 Ser Gly Lys Ser Gly Gly Val Gly Asp Pro Arg
Glu Pro Leu Gly Cys 180 185 190 Leu Gln Glu Gly Ser Gly Cys His Pro
Thr Thr Glu Ser Phe Glu Lys 195 200 205 Ser Val Arg Glu Asp Ala Ser
Pro Leu Pro His Val Cys Cys Cys Lys 210 215 220 Gln Asp Ala Leu Ile
Leu Gln Arg Gly Leu His His Glu Asp Gly Ser 225 230 235 240 Gln His
Ile Gly Leu Leu His Pro Gly Asp Arg Gly Pro Asp His Glu 245 250 255
Tyr Val Leu Val Glu Glu Ala Glu Cys Ala Met Ser Glu Arg Glu Ala 260
265 270 Ala Pro Asn Glu Glu Leu Val Gln Arg Asn Arg Leu Ile Cys Arg
Arg 275 280 285 Asn Pro Tyr Arg Ile Phe Glu Tyr Leu Gln Leu Ser Leu
Glu Glu Ala 290 295 300 Phe Phe Leu Val Tyr Ala Leu Gly Cys Leu Ser
Ile Tyr Tyr Glu Lys 305 310 315 320 Glu Pro Leu Thr Ile Val Lys Leu
Trp Lys Ala Phe Thr Val Val Gln 325 330 335 Pro Thr Phe Arg Thr Thr
Tyr Met Ala Tyr His Tyr Phe Arg Ser Lys 340 345 350 Gly Trp Val Pro
Lys Val Gly Leu Lys Tyr Gly Thr Asp Leu Leu Leu 355 360 365 Tyr Arg
Lys Gly Pro Pro Phe Tyr His Ala Ser Tyr Ser Val Ile Ile 370 375 380
Glu Leu Val Asp Asp His Phe Glu Gly Ser Leu Arg Arg Pro Leu Ser 385
390 395 400 Trp Lys Ser Leu Ala Ala Leu Ser Arg Val Ser Val Asn Val
Ser Lys 405 410 415 Glu Leu Met Leu Cys Tyr Leu Ile Lys Pro Ser Thr
Met Thr Asp Lys 420 425 430 Glu Met Glu Ser Pro Glu Cys Met Lys Arg
Ile Lys Val Gln Glu Val 435 440 445 Ile Leu Ser Arg Trp Val Ser Ser
Arg Glu Arg Ser Asp Gln Asp Asp 450 455 460 Leu 465 3 1943 DNA Homo
sapiens 3 agcgtggggt gcgggtcgtg gtgcaccacg ggagcgccgc accggccggc
atggaggagc 60 gcggcgattc cgagccgacc cccggctgca gcggcctggg
tccgggcggt gttcgcggct 120 ttggcgacgg cggtggagct ccttcgtggg
cccctgagga cgcctggatg ggcactcacc 180 ctaagtatct agaaatgatg
gaattagata taggagatgc cacccaagtt tatgtagcgt 240 tcttggttta
cctggacctc atggaaagca aaagctggca tgaagtaaac tgtgtaggat 300
taccagaact ccagctcatc tgccttgttg gtactgagat agaaggggag gggttacaga
360 ctgtggtgcc tacccccatc actgcttccc tcagccataa caggataagg
gagatcttga 420 aggcatctcg aaagttgcaa ggtgatccag atttgccgat
gtcttttact ttggccatag 480 tggagtctga ttctacaata gtctattata
aacttactga tggatttatg ctgccagacc 540 ctcagaatat ttctcttaga
agatgacatc catgtttcct gatgcttgtt ttattcatac 600 aagattggat
ttgagaccca tcagactgct tcatctttta tctcagaaat agggttgacg 660
tacatagtga gggttgactt ccccattcca taaggttttc attctgaaga gtaaaacttc
720 cccaggtaga agactttctc cttcttaaaa aatatagggt gatttcttta
aaactttgtt 780 atctagagac agtttaatta cagttatata caggtttatg
cctaggatgt attcagatgg 840 gtgggacctg tgtgctgctt ttgtcatccc
acactcaaag ttgtctcttt gtttcttgct 900 gccactgcca gctcattgtt
gagactgcca tttctttctc ttactcagct ctccccagtg 960 ccttttggcc
actgcagcta ccgtagaatg gcattttata tgtaccttgt cacccacttc 1020
tgtttacttt ttcctctcca gtaaaaagta aaagatttct ttcaattggt cttcccattg
1080 cagttactgt tatttctctt ttttggttaa ctttaaatca aaactcaaaa
tatgttcatc 1140 cagagtgtgt cttaagtaac ttacgtgtct taagtaacag
ggaccagaga catgttacct 1200 acaagagttc tgggctatcc ttttcattct
tatcacatat catagcttga atattacaac 1260 agtgtgggag agaatcaacc
gtaaaaatgt cttcattaat tagacccagt tattccactt 1320 ttgttaatgt
ctctcaaatt gtacaaagta taaaaaatta tatgcacaaa gatgttccaa 1380
gtgacattac ttttagtagc ccaaattata aaccacttta aagtttgggg taaagattgg
1440 caaacttttt ctataaaggg ccagaaagta actattttag gtttttaaac
ctactgtctc 1500 tgtcataact tgtcaacact gctgtatgaa gcacaaaagc
agccatagac aatacataaa 1560 caatacgggc gtggctttgt tccagtaaaa
ctttgtttac aaatgtggtg ccatagtttg 1620 tcatccctgg gtctaggaaa
tagtcaataa acagatatat acaaatgata cataatgtac 1680 ttattaaaaa
ttagtaatga atattattaa aaacatgaaa atattacctt aagtaaaaat 1740
tgcaagacgg aaaagtgtat aagtgggtgt aatcatggct gaaataacag accaagcata
1800 tgataaaaag ataacaaagt aaatcaaatt actaactggt tatagtggga
taggaggcag 1860 aaaatggatg actttgtctt ttctcaatgt ttttatttgt
attttataat aaaaatgttt 1920 taaaattaaa aaaaaaaaaa aaa 1943 4 171 PRT
Homo sapiens 4 Met Glu Glu Arg Gly Asp Ser Glu Pro Thr Pro Gly Cys
Ser Gly Leu 1 5 10 15 Gly Pro Gly Gly Val Arg Gly Phe Gly Asp Gly
Gly Gly Ala Pro Ser 20 25 30 Trp Ala Pro Glu Asp Ala Trp Met Gly
Thr His Pro Lys Tyr Leu Glu 35 40 45 Met Met Glu Leu Asp Ile Gly
Asp Ala Thr Gln Val Tyr Val Ala Phe 50 55 60 Leu Val Tyr Leu Asp
Leu Met Glu Ser Lys Ser Trp His Glu Val Asn 65 70 75 80 Cys Val Gly
Leu Pro Glu Leu Gln Leu Ile Cys Leu Val Gly Thr Glu 85 90 95 Ile
Glu Gly Glu Gly Leu Gln Thr Val Val Pro Thr Pro Ile Thr Ala 100 105
110 Ser Leu Ser His Asn Arg Ile Arg Glu Ile Leu Lys Ala Ser Arg Lys
115 120 125 Leu Gln Gly Asp Pro Asp Leu Pro Met Ser Phe Thr Leu Ala
Ile Val 130 135 140 Glu Ser Asp Ser Thr Ile Val Tyr Tyr Lys Leu Thr
Asp Gly Phe Met 145 150 155 160 Leu Pro Asp Pro Gln Asn Ile Ser Leu
Arg Arg 165 170 5 1364 DNA Homo sapiens 5 cacctcgact gcgaattact
gtttatgagg tgactcgctg gttctatcgg tggacagtgg 60 gacattctga
agggaggcaa ggaggcggac tgagcgctcc caattgggga ggatgctggt 120
ggtggaggtg gcgaacggcc gctccctggt gtggggagcc gaggcggtgc aggccctccg
180 ggagcgcctg ggtgtggggg gccgcacggt aggcgccctg ccccgcgggc
cccgccagaa 240 ctcgcgcctg ggcctcccgc tgctgctgat gcccgaagag
gcgcggctct tggccgagat 300 cggcgccgtg actctggtca gcgccccgcg
tccagactct cggcaccaca gcctggccct 360 gacatccttc aagcgccagc
aagaggagag cttccaggag cagagcgcct tggcagctga 420 ggcccgggag
acccgtcgtc aggaggtcct ggagaagatt acggagggcc aggctgctaa 480
gaagcagaaa ctagaacagg cttcaggggc cagctcaagc caggaggccg gctcgagcca
540 ggctgccaaa gaggatgaga ccagtgatgg ccaggcttcg ggagagcagg
aggaagctgg 600 cccctcgtct tcccaagcag gaccctcaaa tggggtagcc
cccttgccca gatctgctct 660 ccttgtccag ctggccactg ccaggcctcg
accggtcaag gccaggcccc tggactggcg 720 tgtccagtct aaagactggc
cccacgccgg ccgccctgcc cacgagctgc gctacagtat 780 ctacagagac
ctgtgggagc gaggcttctt cctcagtgcg gctggcaagt tcggaggtga 840
cttcctggtc tatcctggtg accccctccg cttccacgcc cattatatcg ctcagtgctg
900 ggcccctgag gacacctccc actccaagac ctggttgctg ctgggcgcct
tggaaccagc 960 gtcagaaaga ccctgctcct ctgttctccg cagcctgatg
gtaaggtggt ctacacctcc 1020 ctgcaatggg ccagcctgca gtgaactcca
gagacctagg ggatgtggct gtgtcggcag 1080 caagagcctt tctggatgtt
ccccagctct tctctgggag tctagaacat cctcctacct 1140 ttctccgcgg
ttagtttttg attccaggtt ttcgaacact acatcttttt tatgttcttc 1200
cttgtttcaa agcacttatt ggctgtgttt ttgtagttac ctattttcac actgtgagct
1260 tcccgagaat ggggcctggg tttgattcat ctgttttcta cagggtttaa
gtctcaggag 1320 gtctcaataa acttggtata taaatgttaa aaaaaaaaaa aaaa
1364 6 390 PRT Homo sapiens 6 Met Leu Val Val Glu Val Ala Asn Gly
Arg Ser Leu Val Trp Gly Ala 1 5 10 15 Glu Ala Val Gln Ala Leu Arg
Glu Arg Leu Gly Val Gly Gly Arg Thr 20 25 30 Val Gly Ala Leu Pro
Arg Gly Pro Arg Gln Asn Ser Arg Leu Gly Leu 35 40 45 Pro Leu Leu
Leu Met Pro Glu Glu Ala Arg Leu Leu Ala Glu Ile Gly 50 55 60 Ala
Val Thr Leu Val Ser Ala Pro Arg Pro Asp Ser Arg His His Ser 65 70
75 80 Leu Ala Leu Thr Ser Phe Lys Arg Gln Gln Glu Glu Ser Phe Gln
Glu 85 90 95 Gln Ser Ala Leu Ala Ala Glu Ala Arg Glu Thr Arg Arg
Gln Glu Val 100 105 110 Leu Glu Lys Ile Thr Glu Gly Gln Ala Ala Lys
Lys Gln Lys Leu Glu 115 120 125 Gln Ala Ser Gly Ala Ser Ser Ser Gln
Glu Ala Gly Ser Ser Gln Ala 130 135 140 Ala Lys Glu Asp Glu Thr Ser
Asp Gly Gln Ala Ser Gly Glu Gln Glu 145 150 155 160 Glu Ala Gly Pro
Ser Ser Ser Gln Ala Gly Pro Ser Asn Gly Val Ala 165 170 175 Pro Leu
Pro Arg Ser Ala Leu Leu Val Gln Leu Ala Thr Ala Arg Pro 180 185 190
Arg Pro Val Lys Ala Arg Pro Leu Asp Trp Arg Val Gln Ser Lys Asp 195
200 205 Trp Pro His Ala Gly Arg Pro Ala His Glu Leu Arg Tyr Ser Ile
Tyr 210 215 220 Arg Asp Leu Trp Glu Arg Gly Phe Phe Leu Ser Ala Ala
Gly Lys Phe 225 230 235 240 Gly Gly Asp Phe Leu Val Tyr Pro Gly Asp
Pro Leu Arg Phe His Ala 245 250 255 His Tyr Ile Ala Gln Cys Trp Ala
Pro Glu Asp Thr Ser His Ser Lys 260 265 270 Thr Trp Leu Leu Leu Gly
Ala Leu Glu Pro Ala Ser Glu Arg Pro Cys 275 280 285 Ser Ser Val Leu
Arg Ser Leu Met Val Arg Trp Ser Thr Pro Pro Cys 290 295 300 Asn Gly
Pro Ala Cys Ser Glu Leu Gln Arg Pro Arg Gly Cys Gly Cys 305 310 315
320 Val Gly Ser Lys Ser Leu Ser Gly Cys Ser Pro Ala Leu Leu Trp Glu
325 330 335 Ser Arg Thr Ser Ser Tyr Leu Ser Pro Arg Leu Val Phe Asp
Ser Arg 340 345 350 Phe Ser Asn Thr Thr Ser Phe Leu Cys Ser Ser Leu
Phe Gln Ser Thr 355 360 365 Tyr Trp Leu Cys Phe Cys Ser Tyr Leu Phe
Ser His Cys Glu Leu Pro 370 375 380 Glu Asn Gly Ala Trp Val 385 390
7 1932 DNA Homo sapiens 7 ggatggagcc cgatcccgag cccgcggccg
tggaggttcc cgcggggcgc gtgctcagcg 60 cccgggagct cttcgccgcc
cgctcgcggt cgcagaagct gccccagcgc tcgcatggcc 120 ccaaggactt
tctgcccgac ggctcggcag ctcaggccga gcggctgcgc cggtgccggg 180
aagagctctg gcagctgctg gcagagcagc gcgtggagcg cctgggcagc ttggtggctg
240 ccgagtggag gccagaagag ggcttcgtgg agttgaagtc tcccgcgggc
aaattctggc 300 agaccatggg cttctcagag cagggccggc agcgccttca
cccggaagag gccttgtatc 360 ttctggagtg tggctccatc cacctcttcc
accaagacct gccactgtct atccaggaag 420 cttaccagct gctgctgacc
gaccacactg tgaccttcct gcagtaccag gtcttcagcc 480 acctgaagag
gttgggttat gtggttcgac gattccaacc aagctctgtc ctgtccccgt 540
atgagaggca gcttaacctg gatgccagcg tgcagcactt ggaggatgga gatggcaaga
600 gaaagaggag cagctccagc cctcggtcca ttaataagaa ggccaaggcc
ctggacaact 660 ccctgcaacc caagagtctg gcagcctcca gcccacctcc
ctgcagccag cccagccaat 720 gcccagagga gaaaccccag gagtcaagcc
ccatgaaggg cccagggggc ccctttcagc 780 ttctggggtc cctgggcccc
agccctggcc cggccaggga gggggtgggg tgcagctggg 840 agagtggcag
agccgagaac ggagtcacgg gagccggtaa gcggcgctgg aacttcgagc 900
agatctcctt ccccaacatg gcttcagaca gccgccacac ccttctgcgc gccccagccc
960 cagagctgct cccggccaac gtggctgggc gggagacaga cgctgagtcc
tggtgccaga 1020 agctgaacca gcgcaaggag aacctctcca ggcgggaacg
ggagcaccac gcggaggccg 1080 cgcagttcca ggaagatgtc aacgccgatc
ccgaggtgca gcgctgctcc agctggcggg 1140 agtacaagga gctgctgcag
cggcggcagg tgcagaggag ccagcgccgg gcccctcacc 1200 tgtggggcca
gcccgtcacc ccgctgctga gtcctggcca ggccagctcc ccagccgtgg 1260
tccttcagca tatctctgtg ctgcagacaa cacaccttcc tgatggaggt gtccggctgt
1320 tggagaagtc tgggggcttg gaaatcatct ttgatgttta ccaggccgac
gctgtggcca 1380 cattccgaaa gaataaccct ggcaaaccct atgcccggat
gtgcattagt ggatttgatg 1440 agcctgtccc agacctctgc agcctcaagc
ggttgtctta ccagagtggg gatgtccctc 1500 tgatctttgc cctggtggat
catggtgaca tctccttcta cagcttcagg gacttcacgt 1560 tgccccagga
tgtggggcac tgacctcaca gctctgcaga ggatggagct tgctccgggg 1620
gaccgggact gtctgttctc agggaccatc tcggctgcct cctgtaccca gactctaacc
1680 tgtagcttca gaggccagtc tgggccttgg ccctgggtgt ctgatactca
cagagtgaaa 1740 ctgtgaccct ctcccttccc tgctgccttg cagtgacccc
tctggaactc aggactcgat 1800 tttaaggacc caggaggtgg ggcagaagag
aggactgtgt gcctttaacg agagggtgcc 1860 tgcttcgtgc tataaagcca
aagccattaa aaatagattt cttttaaaaa aaaaaaaaaa 1920 aaaaaaaaaa aa 1932
8 526 PRT Homo sapiens 8 Met Glu Pro Asp Pro Glu Pro Ala Ala Val
Glu Val Pro Ala Gly Arg 1 5 10 15 Val Leu Ser Ala Arg Glu Leu Phe
Ala Ala Arg Ser Arg Ser Gln Lys 20 25 30 Leu Pro Gln Arg Ser His
Gly Pro Lys Asp Phe Leu Pro Asp Gly Ser 35 40 45 Ala Ala Gln Ala
Glu Arg Leu Arg Arg Cys Arg Glu Glu Leu Trp Gln 50 55 60 Leu Leu
Ala Glu Gln Arg Val Glu Arg Leu Gly Ser Leu Val Ala Ala 65 70 75 80
Glu Trp Arg Pro Glu Glu Gly Phe Val Glu Leu Lys Ser Pro Ala Gly 85
90 95 Lys Phe Trp Gln Thr Met Gly Phe Ser Glu Gln Gly Arg Gln Arg
Leu 100 105 110 His Pro Glu Glu Ala Leu Tyr Leu Leu Glu Cys Gly Ser
Ile His Leu 115 120 125 Phe His Gln Asp Leu Pro Leu Ser Ile Gln Glu
Ala Tyr Gln Leu Leu 130
135 140 Leu Thr Asp His Thr Val Thr Phe Leu Gln Tyr Gln Val Phe Ser
His 145 150 155 160 Leu Lys Arg Leu Gly Tyr Val Val Arg Arg Phe Gln
Pro Ser Ser Val 165 170 175 Leu Ser Pro Tyr Glu Arg Gln Leu Asn Leu
Asp Ala Ser Val Gln His 180 185 190 Leu Glu Asp Gly Asp Gly Lys Arg
Lys Arg Ser Ser Ser Ser Pro Arg 195 200 205 Ser Ile Asn Lys Lys Ala
Lys Ala Leu Asp Asn Ser Leu Gln Pro Lys 210 215 220 Ser Leu Ala Ala
Ser Ser Pro Pro Pro Cys Ser Gln Pro Ser Gln Cys 225 230 235 240 Pro
Glu Glu Lys Pro Gln Glu Ser Ser Pro Met Lys Gly Pro Gly Gly 245 250
255 Pro Phe Gln Leu Leu Gly Ser Leu Gly Pro Ser Pro Gly Pro Ala Arg
260 265 270 Glu Gly Val Gly Cys Ser Trp Glu Ser Gly Arg Ala Glu Asn
Gly Val 275 280 285 Thr Gly Ala Gly Lys Arg Arg Trp Asn Phe Glu Gln
Ile Ser Phe Pro 290 295 300 Asn Met Ala Ser Asp Ser Arg His Thr Leu
Leu Arg Ala Pro Ala Pro 305 310 315 320 Glu Leu Leu Pro Ala Asn Val
Ala Gly Arg Glu Thr Asp Ala Glu Ser 325 330 335 Trp Cys Gln Lys Leu
Asn Gln Arg Lys Glu Asn Leu Ser Arg Arg Glu 340 345 350 Arg Glu His
His Ala Glu Ala Ala Gln Phe Gln Glu Asp Val Asn Ala 355 360 365 Asp
Pro Glu Val Gln Arg Cys Ser Ser Trp Arg Glu Tyr Lys Glu Leu 370 375
380 Leu Gln Arg Arg Gln Val Gln Arg Ser Gln Arg Arg Ala Pro His Leu
385 390 395 400 Trp Gly Gln Pro Val Thr Pro Leu Leu Ser Pro Gly Gln
Ala Ser Ser 405 410 415 Pro Ala Val Val Leu Gln His Ile Ser Val Leu
Gln Thr Thr His Leu 420 425 430 Pro Asp Gly Gly Val Arg Leu Leu Glu
Lys Ser Gly Gly Leu Glu Ile 435 440 445 Ile Phe Asp Val Tyr Gln Ala
Asp Ala Val Ala Thr Phe Arg Lys Asn 450 455 460 Asn Pro Gly Lys Pro
Tyr Ala Arg Met Cys Ile Ser Gly Phe Asp Glu 465 470 475 480 Pro Val
Pro Asp Leu Cys Ser Leu Lys Arg Leu Ser Tyr Gln Ser Gly 485 490 495
Asp Val Pro Leu Ile Phe Ala Leu Val Asp His Gly Asp Ile Ser Phe 500
505 510 Tyr Ser Phe Arg Asp Phe Thr Leu Pro Gln Asp Val Gly His 515
520 525 9 1852 DNA Homo sapiens 9 gggcacgagg ccggcgtggg tccgggcaag
aaccgcttgt agtttggttt aaattctgca 60 cgggaggacc ttctgagttt
acctgttggg ctcctggctg cgcaggcaca gcagctacac 120 agaagagatg
ggagaagagg ctaatgatga caagaagcca accactaaat ttgaactaga 180
gcgagaaaca gaacttcgct ttgaggtgga ggcatctcag tcagttcagt tggagttgtt
240 gactggcatg gcagagatct ttggcacaga gctgacccga aacaagaaat
tcacctttga 300 tgctggtgcc aaggtggctg ttttcacttg gcatggctgt
tctgtgcaac tgagcggccg 360 cactgaggtg gcttatgtct ccaaggacac
tcctatgttg ctttacctca acactcacac 420 agccttggaa cagatgcgga
ggcaagcgga aaaggaagaa gagcgaggtc cccgagtgat 480 ggtagtgggc
cccactgatg tgggcaagtc tacagtgtgt cgccttctgc tcaactacgc 540
agtgcgtttg ggccgccgtc ccacttatgt ggagctggat gtgggccagg gttctgtgtc
600 catccctggt accatggggg ccctctacat cgagcggcct gcagatgtcg
aagagggttt 660 ctctatccag gcccctctgg tgtatcattt tggttccacc
actcctggca ctaacatcaa 720 gctttataat aagattacat ctcgtttagc
agatgtgttc aaccaaaggt gtgaggtgaa 780 ccgaagggca tctgtgagtg
gctgtgtcat taacacctgt ggctgggtca agggctctgg 840 ttaccaggct
ctggtgcatg cagcctcagc ttttgaggtg gatgtcgttg ttgttctgga 900
tcaagaacga ctgtacaatg aactgaaacg ggacctcccc cactttgtac gcactgtgct
960 gctccctaaa tctgggggtg tggtggagcg ctccaaggac ttccggcggg
aatgtaggga 1020 tgagcgtatc cgtgagtatt tttatggatt ccgaggctgt
ttctatcccc atgccttcaa 1080 tgtcaaattt tcagatgtga aaatctacaa
agttggggca cccaccatcc cagactcctg 1140 tttacctttg ggcatgtctc
aagaggataa tcagctcaag ctagtacctg tcactcctgg 1200 gcgagatatg
gtgcaccacc tactgagtgt tagcactgcc gagggtacag aggagaacct 1260
gtccgagaca agtgtagctg gcttcattgt ggtgaccagt gtggacctgg agcatcaggt
1320 gtttactgtt ctgtctccag cccctcgccc actgcctaag aacttccttc
tcatcatgga 1380 tatccggttc atggatctga agtagagatc agcaggaagc
cttgctgcct gggacataga 1440 gatcatctgg ccacccctag aggcagatgg
gctgagataa aagactgttg gggccacctg 1500 accagtaaac tgtggactag
tagaaagttc atattctacc tctaaaaaca ggtagtggta 1560 acctgactct
tctaatcttg aaccaaaagg aaaaccatga gactgtaatt ggtttcttag 1620
accacctaag atgccacttt gaattctcta agaccctgga gaattgcatt tctttcactg
1680 tgctactatg tggtttttaa aaaatcaatg ctttatattc catatgtggt
tcttacccat 1740 ttatctagga tgaaagtgtg aattagaggg actccttcca
ataaagttca aacttaaaaa 1800 aaatcatttt aataaatatt tttgccatat
cataaaaaaa aaaaaaaaaa aa 1852 10 425 PRT Homo sapiens 10 Met Gly
Glu Glu Ala Asn Asp Asp Lys Lys Pro Thr Thr Lys Phe Glu 1 5 10 15
Leu Glu Arg Glu Thr Glu Leu Arg Phe Glu Val Glu Ala Ser Gln Ser 20
25 30 Val Gln Leu Glu Leu Leu Thr Gly Met Ala Glu Ile Phe Gly Thr
Glu 35 40 45 Leu Thr Arg Asn Lys Lys Phe Thr Phe Asp Ala Gly Ala
Lys Val Ala 50 55 60 Val Phe Thr Trp His Gly Cys Ser Val Gln Leu
Ser Gly Arg Thr Glu 65 70 75 80 Val Ala Tyr Val Ser Lys Asp Thr Pro
Met Leu Leu Tyr Leu Asn Thr 85 90 95 His Thr Ala Leu Glu Gln Met
Arg Arg Gln Ala Glu Lys Glu Glu Glu 100 105 110 Arg Gly Pro Arg Val
Met Val Val Gly Pro Thr Asp Val Gly Lys Ser 115 120 125 Thr Val Cys
Arg Leu Leu Leu Asn Tyr Ala Val Arg Leu Gly Arg Arg 130 135 140 Pro
Thr Tyr Val Glu Leu Asp Val Gly Gln Gly Ser Val Ser Ile Pro 145 150
155 160 Gly Thr Met Gly Ala Leu Tyr Ile Glu Arg Pro Ala Asp Val Glu
Glu 165 170 175 Gly Phe Ser Ile Gln Ala Pro Leu Val Tyr His Phe Gly
Ser Thr Thr 180 185 190 Pro Gly Thr Asn Ile Lys Leu Tyr Asn Lys Ile
Thr Ser Arg Leu Ala 195 200 205 Asp Val Phe Asn Gln Arg Cys Glu Val
Asn Arg Arg Ala Ser Val Ser 210 215 220 Gly Cys Val Ile Asn Thr Cys
Gly Trp Val Lys Gly Ser Gly Tyr Gln 225 230 235 240 Ala Leu Val His
Ala Ala Ser Ala Phe Glu Val Asp Val Val Val Val 245 250 255 Leu Asp
Gln Glu Arg Leu Tyr Asn Glu Leu Lys Arg Asp Leu Pro His 260 265 270
Phe Val Arg Thr Val Leu Leu Pro Lys Ser Gly Gly Val Val Glu Arg 275
280 285 Ser Lys Asp Phe Arg Arg Glu Cys Arg Asp Glu Arg Ile Arg Glu
Tyr 290 295 300 Phe Tyr Gly Phe Arg Gly Cys Phe Tyr Pro His Ala Phe
Asn Val Lys 305 310 315 320 Phe Ser Asp Val Lys Ile Tyr Lys Val Gly
Ala Pro Thr Ile Pro Asp 325 330 335 Ser Cys Leu Pro Leu Gly Met Ser
Gln Glu Asp Asn Gln Leu Lys Leu 340 345 350 Val Pro Val Thr Pro Gly
Arg Asp Met Val His His Leu Leu Ser Val 355 360 365 Ser Thr Ala Glu
Gly Thr Glu Glu Asn Leu Ser Glu Thr Ser Val Ala 370 375 380 Gly Phe
Ile Val Val Thr Ser Val Asp Leu Glu His Gln Val Phe Thr 385 390 395
400 Val Leu Ser Pro Ala Pro Arg Pro Leu Pro Lys Asn Phe Leu Leu Ile
405 410 415 Met Asp Ile Arg Phe Met Asp Leu Lys 420 425 11 1347 DNA
Homo sapiens 11 atggcagaag cagttttcca tgccccaaag aggaaaagaa
gagtgtatga gacttacgag 60 tctccattgc caatcccttt tggtcaggac
catggtcctc tgaaagaatt caagatattc 120 cgtgctgaaa tgattaacaa
caatgtgatt gtgaggaatg cggaggacat tgagcagctc 180 tatgggaaag
gttattttgg aaaaggtatt ctttcaagaa gccgtccaag cttcacaatt 240
tcagatccta aactggttgc taaatggaaa gatatgaaga caaacatgcc tatcatcaca
300 tcaaagaggt atcagcatag tgttgagtgg gcagcagagc tgatgcgtag
acaggggcag 360 gatgagagta cagtgcgcag aatcctcaag gattacacga
aaccgcttga gcatcctcct 420 gtgaaaagga atgaagaggc tcaagtgcat
gacaagctta actctggaat ggtttccaac 480 atggaaggca cagcaggggg
agagagacct tctgtggtaa acggggactc tggaaagtca 540 ggtggtgtgg
gtgatccccg tgagccatta ggctgcctgc aggagggctc tggctgccac 600
ccaacaacag agagctttga gaaaagcgtg cgagaggatg cctcacctct gccccatgtc
660 tgttgctgca aacaagatgc tctcatcctc cagcgtggcc ttcatcatga
agacggcagc 720 cagcacatcg gcctcctgca tcctggggac agagggcctg
accatgagta cgtgctggtc 780 gaggaagcgg agtgtgccat gagcgagagg
gaggctgccc caaatgagga attggtgcaa 840 agaaacaggt taatatgcag
aagaaatcca tataggatct ttgagtattt gcaactcagc 900 ctagaagagg
agcctttaac gatagtgaag ctctggaaag ctttcactgt agttcagccc 960
acgttcagaa ccacctacat ggcctaccat tactttcgaa gcaagggctg ggtgcccaaa
1020 gtgggactca agtacgggac agatttactg ctatatcgga aaggccctcc
attttaccat 1080 gcaagttatt ctgtcattat cgagctagtt gatgaccatt
ttgaaggctc tctccgcagg 1140 cctctcagtt ggaagtccct ggctgccttg
agcagagttt ccgttaatgt ctctaaggaa 1200 cttatgctgt gctatttgat
taaaccctct actatgactg acaaggaaat ggagtcacca 1260 gaatgtatga
aaaggattaa agttcaggag gtgattctga gtcgatgggt ttcttcacga 1320
gagaggagtg accaagacga tctttaa 1347 12 448 PRT Homo sapiens 12 Met
Ala Glu Ala Val Phe His Ala Pro Lys Arg Lys Arg Arg Val Tyr 1 5 10
15 Glu Thr Tyr Glu Ser Pro Leu Pro Ile Pro Phe Gly Gln Asp His Gly
20 25 30 Pro Leu Lys Glu Phe Lys Ile Phe Arg Ala Glu Met Ile Asn
Asn Asn 35 40 45 Val Ile Val Arg Asn Ala Glu Asp Ile Glu Gln Leu
Tyr Gly Lys Gly 50 55 60 Tyr Phe Gly Lys Gly Ile Leu Ser Arg Ser
Arg Pro Ser Phe Thr Ile 65 70 75 80 Ser Asp Pro Lys Leu Val Ala Lys
Trp Lys Asp Met Lys Thr Asn Met 85 90 95 Pro Ile Ile Thr Ser Lys
Arg Tyr Gln His Ser Val Glu Trp Ala Ala 100 105 110 Glu Leu Met Arg
Arg Gln Gly Gln Asp Glu Ser Thr Val Arg Arg Ile 115 120 125 8Leu
Lys Asp Tyr Thr Lys Pro Leu Glu His Pro Pro Val Lys Arg Asn 130 135
140 G lu Glu Ala Gln Val His Asp Lys Leu Asn Ser Gly Met Val Ser
Asn 145 150 155 160 Met Glu Gly Thr Ala Gly Gly Glu Arg Pro Ser Val
Val Asn Gly Asp 165 170 175 Ser Gly Lys Ser Gly Gly Val Gly Asp Pro
Arg Glu Pro Leu Gly Cys 180 185 190 Leu Gln Glu Gly Ser Gly Cys His
Pro Thr Thr Glu Ser Phe Glu Lys 195 200 205 Ser Val Arg Glu Asp Ala
Ser Pro Leu Pro His Val Cys Cys Cys Lys 210 215 220 Gln Asp Ala Leu
Ile Leu Gln Arg Gly Leu His His Glu Asp Gly Ser 225 230 235 240 Gln
His Ile Gly Leu Leu His Pro Gly Asp Arg Gly Pro Asp His Glu 245 250
255 Tyr Val Leu Val Glu Glu Ala Glu Cys Ala Met Ser Glu Arg Glu Ala
260 265 270 Ala Pro Asn Glu Glu Leu Val Gln Arg Asn Arg Leu Ile Cys
Arg Arg 275 280 285 Asn Pro Tyr Arg Ile Phe Glu Tyr Leu Gln Leu Ser
Leu Glu Glu Glu 290 295 300 Pro Leu Thr Ile Val Lys Leu Trp Lys Ala
Phe Thr Val Val Gln Pro 305 310 315 320 Thr Phe Arg Thr Thr Tyr Met
Ala Tyr His Tyr Phe Arg Ser Lys Gly 325 330 335 Trp Val Pro Lys Val
Gly Leu Lys Tyr Gly Thr Asp Leu Leu Leu Tyr 340 345 350 Arg Lys Gly
Pro Pro Phe Tyr His Ala Ser Tyr Ser Val Ile Ile Glu 355 360 365 Leu
Val Asp Asp His Phe Glu Gly Ser Leu Arg Arg Pro Leu Ser Trp 370 375
380 Lys Ser Leu Ala Ala Leu Ser Arg Val Ser Val Asn Val Ser Lys Glu
385 390 395 400 Leu Met Leu Cys Tyr Leu Ile Lys Pro Ser Thr Met Thr
Asp Lys Glu 405 410 415 Met Glu Ser Pro Glu Cys Met Lys Arg Ile Lys
Val Gln Glu Val Ile 420 425 430 Leu Ser Arg Trp Val Ser Ser Arg Glu
Arg Ser Asp Gln Asp Asp Leu 435 440 445 13 20 DNA artificial
description of artificial sequence primer 13 gtcaggatgg ccgagtggtc
20 14 20 DNA artificial description of artificial sequence primer
14 ccgaacacag gaagcagtaa 20 15 20 DNA artificial description of
artificial sequence primer 15 cggtacttat aagacagtgc 20 16 20 DNA
artificial description of artificial sequence primer 16 gctccaggtg
aggcttgaac 20 17 18 DNA artificial description of artificial
sequence primer 17 ccagcaagag cacaagag 18 18 19 DNA artificial
description of artificial sequence primer 18 tgaggagggg agattcagt
19 19 18 DNA artificial description of artificial sequence primer
19 caggtggagg aagtcagg 18 20 20 DNA artificial description of
artificial sequence primer 20 ctaaccagtc agcgtcagag 20 21 39 DNA
artificial description of artificial sequence primer 21 cgggatcccg
cagaagcagt tttccatgcc ccaaagagg 39 22 38 DNA artificial description
of artificial sequence primer 22 gctctagatt aaagatcgtc ttggtcactc
ctctctcg 38 23 39 DNA artificial description of artificial sequence
primer 23 cgggatcccc tggtggtgga ggtggcgaac ggccgctcc 39 24 38 DNA
artificial description of artificial sequence primer 24 gctctagatg
caggctggcc cattgcaggg aggtgtag 38 25 34 DNA artificial description
of artificial sequence primer 25 cgggatcccg aggagcgcgg cgattccgag
ccga 34 26 45 DNA artificial description of artificial sequence
primer 26 cgcgctagct catcttctaa gagaaatatt ctgagggtct ggcag 45 27
30 DNA artificial description of artificial sequence primer 27
atcgggatcc cgagcccgag cccgagcccg 30 28 30 DNA artificial
description of artificial sequence primer 28 gctctagatc agtgccccac
atcctggggc 30 29 39 DNA artificial description of artificial
sequence primer 29 cgggatcccg gagaagaggc taatgatgat gacaagaag 39 30
36 DNA artificial description of artificial sequence primer 30
gctctagact acttcagatc catgaaccgg atatcc 36 31 37 DNA artificial
description of artificial sequence primer 31 agaatagcgg ccgcttaaag
atcgtcttgg tcactcc 37 32 24 DNA artificial description of
artificial sequence primer 32 gagtacgtgc tggtcgagga agcg 24 33 24
DNA artificial description of artificial sequence primer 33
gagtcccact ttgggctccc agcc 24 34 24 DNA artificial description of
artificial sequence primer 34 gctctgggat gtttaagtat ttac 24 35 24
DNA artificial description of artificial sequence primer 35
gagtacgtgc tggtcgagga agcg 24 36 24 DNA artificial description of
artificial sequence primer 36 gagtcccact ttgggctccc agcc 24 37 24
DNA artificial description of artificial sequence primer 37
gctctgggat gtttaagtat ttac 24
* * * * *