U.S. patent application number 10/964536 was filed with the patent office on 2005-03-03 for methods of treatment with mini-dystrophin nucleic acid sequences.
Invention is credited to Chamberlain, Jeffrey S., Harper, Scott Q..
Application Number | 20050049219 10/964536 |
Document ID | / |
Family ID | 22899572 |
Filed Date | 2005-03-03 |
United States Patent
Application |
20050049219 |
Kind Code |
A1 |
Chamberlain, Jeffrey S. ; et
al. |
March 3, 2005 |
Methods of treatment with mini-dystrophin nucleic acid
sequences
Abstract
The present invention relates to compositions and methods for
expressing mini-dystrophin peptides. In particular, the present
invention provides compositions comprising nucleic acid sequences
that are shorter than wild-type dystrophin cDNA and that express
mini-dystrophin peptides that function in a similar manner as
wild-type dystrophin proteins. The present invention also provides
compositions comprising mini-dystrophin peptides, and methods for
expressing mini-dystrophin peptides in target cells.
Inventors: |
Chamberlain, Jeffrey S.;
(Seattle, WA) ; Harper, Scott Q.; (Iowa City,
IA) |
Correspondence
Address: |
MEDLEN & CARROLL, LLP
Suite 350
101 Howard Street
San Francisco
CA
94105
US
|
Family ID: |
22899572 |
Appl. No.: |
10/964536 |
Filed: |
October 13, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10964536 |
Oct 13, 2004 |
|
|
|
10149736 |
Nov 25, 2002 |
|
|
|
10149736 |
Nov 25, 2002 |
|
|
|
PCT/US01/31126 |
Oct 4, 2001 |
|
|
|
60238848 |
Oct 6, 2000 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
C07K 14/4708 20130101;
A61K 48/00 20130101; C12N 2799/022 20130101; A01K 2217/05
20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 048/00 |
Goverment Interests
[0002] This invention was made with Government support under
contract NIH R01AR40864-10. The government has certain rights in
this invention.
Claims
1-34. (cancelled).
35. A method comprising; a) providing; i) a vector comprising
nucleic acid which is less than 5.0 kb in length and which encodes
a mini-dystrophin peptide, wherein said mini-dystrophin peptide
comprises a spectrin-like repeat domain comprising 4 dystrophin
spectrin-like repeats, and wherein said mini-dystrophin peptide is
capable of increasing a diaphragm specific force value in a DMD
animal model by at least 20% of the wild type value; and ii) a
subject comprising target cells; and b) contacting said vector with
said subject under conditions such that said mini-dystrophin
peptide is expressed in said target cells.
36. The method of claim 35, wherein said vector comprises an
adeno-associated vector.
37. The method of claim 35, wherein said contacting is done by
means of injecting said vector into said subject.
38. The method of claim 35, wherein said mini-dystrophin peptide is
capable of increasing a diaphragm specific force value in a DMD
animal model by at least 30% of the wild type value.
39. The method of claim 35, wherein said dystrophin spectrin-like
repeats are human dystrophin spectrin-like repeats.
40. The method of claim 35, wherein said nucleic acid comprises an
actin-binding domain encoding sequence.
41. The method of claim 40, wherein said actin binding domain
comprises at least a portion of SEQ ID NO:6.
42. The method of claim 35, wherein said nucleic acid comprises a
.beta.-dystroglycan binding domain.
43. The method of claim 42, wherein said .beta.-dystroglycan
binding domain comprises at least a portion of a dystrophin hinge 4
encoding sequence, and at least a portion of a dystrophin
cysteine-rich domain encoding sequence.
44. The method of claim 35, wherein said spectrin-like repeat
encoding sequences are selected from the group consisting of SEQ ID
NOS:8-10, 12-27, and 29-33.
45. The method of claim 35, wherein said nucleic acid contains less
than 75% of a wild type dystrophin 5' untranslated region.
46. The method of claim 35, wherein said mini-dystrophin peptide
further comprises a substantially deleted dystrophin C-terminal
domain.
47. The method of claim 35, wherein said nucleic acid contains less
than 50% of a dystrophin 3' untranslated region.
48. The method of claim 35, wherein said mini-dystrophin peptide
further comprises dystrophin hinge region 1 and dystrophin hinge
region 4.
49. The method of claim 35, wherein said mini-dystrophin peptide
further comprises dystrophin hinge region 2 or dystrophin hinge
region 3.
50. The method of claim 35, wherein said nucleic acid comprises a
promoter.
51. The method of claim 50, wherein said promoter is an MCK
promoter.
52. The method of claim 35, wherein said 4 dystrophin spectrin-like
repeats are selected from the group consisting of: dystrophin
spectrin-like repeat number 1, dystrophin spectrin-like repeat
number 2, dystrophin spectrin-like repeat number 3, dystrophin
spectrin-like repeat number 22, dystrophin spectrin-like repeat
number 23, and dystrophin spectrin like repeat number 24.
Description
[0001] The present Application claims priority to U.S. Provisional
Application Ser. No. 60/238,848, filed Oct. 6, 2000, hereby
incorporated by reference.
FIELD OF THE INVENTION
[0003] The present invention relates to compositions and methods
for expressing mini-dystrophin peptides. In particular, the present
invention provides compositions comprising nucleic acid sequences
that are shorter than wild-type dystrophin cDNA and that express
mini-dystrophin peptides that function in a similar manner as
wild-type dystrophin proteins. The present invention also provides
compositions comprising mini-dystrophin peptides, and methods for
expressing mini-dystrophin peptides in target cells.
BACKGROUND OF THE INVENTION
[0004] Muscular dystrophy is a group of inherited disorders
characterized by progressive muscle weakness and loss of muscle
tissue. Muscular dystrophies includes many inherited disorders,
including Becker's muscular dystrophy and Duchenne's muscular
dystrophy, which are both caused by mutations in the dystrophin
gene. Both of the disorders have similar symptoms, although
Becker's muscular dystrophy is a slower progressing form of the
disease. Duchenne's muscular dystrophy is a rapidly progressive
form of muscular dystrophy.
[0005] Both disorders are characterized by progressive muscle
weakness of the legs and pelvis which is associated with a loss of
muscle mass (wasting). Muscle weakness also occurs in the arms,
neck, and other areas, but not as severely as in the lower half of
the body. Calf muscles initially enlarge (an attempt by the body to
compensate for loss of muscle strength), the enlarged muscle tissue
is eventually replaced by fat and connective tissue
(pseudohypertrophy). Muscle contractions occur in the legs and
heels, causing inability to use the muscles because of shortening
of muscle fibers and fibrosis of connective tissue. Bones develop
abnormally, causing skeletal deformities of the chest and other
areas. Cardiomyopathy occurs in almost all cases. Mental
retardation may accompany the disorder but it is not inevitable and
does not worsen as the disorder progresses. The cause of this
impairment is unknown. Becker's muscular dystrophy occurs in
approximately 3 out of 100,000 people. Symptoms usually appear in
men between the ages of 7 and 26. Women rarely develop symptoms.
There is no known cure for Becker's muscular dystrophy. Treatment
is aimed at control of symptoms to maximize the quality of life.
Activity is encouraged. Inactivity (such as bed rest) can worsen
the muscle disease. Physical therapy may be helpful to maintain
muscle strength. Orthopedic appliances such as braces and
wheelchairs may improve mobility and self-care. Becker's muscular
dystrophy results in slowly progressive disability. A normal life
span is possible; however, death usually occurs after age 40.
[0006] Duchenne's muscular dystrophy occurs in approximately 2 out
of 10,000 people. Symptoms usually appear in males 1 to 6 years
old. Females are carriers of the gene for this disorder but rarely
develop symptoms. There is no known cure for Duchenne's muscular
dystrophy. Treatment is aimed at control of symptoms to maximize
the quality of life. Activity is encouraged. Inactivity (such as
bed rest) can worsen the muscle disease. Physical therapy may be
helpful to maintain muscle strength and function. Orthopedic
appliances such as braces and wheelchairs may improve mobility and
the ability for self-care. Duchenne's muscular dystrophy results in
rapidly progressive disability. By age 10, braces may be required
for walking, and by age 12, most patients are confined to a
wheelchair. Bones develop abnormally, causing skeletal deformities
of the chest and other areas. Muscular weakness and skeletal
deformities contribute to frequent breathing disorders.
Cardiomyopathy occurs in almost all cases. Intellectual impairment
is common but is not inevitable and does not worsen as the disorder
progresses. Death usually occurs by age 15, typically from
respiratory (lung) disorders.
[0007] Although there are no available treatments for muscular
dystrophy, the usefulness of gene replacement as therapy for the
disease has been established in transgenic mouse models.
Unfortunately, progress toward therapy for human patients has been
limited by lack of a suitable technique for delivery of such
vectors to large masses of muscle cells. What is needed in the art
is a vector that can carry most of the dystrophin coding sequence,
that can be cheaply produced in large quantities, that can be
delivered to a large mass of muscle cells, and that provides stable
expression of dystrophin after delivery.
SUMMARY OF THE INVENTION
[0008] The present invention provides compositions and methods for
expressing mini-dystrophin peptides. In particular, the present
invention provides compositions comprising nucleic acid sequences
that are shorter than wild-type dystrophin cDNA and that express
mini-dystrophin peptides that function in a similar manner as
wild-type dystrophin proteins. The present invention also provides
compositions comprising mini-dystrophin peptides, and methods for
expressing mini-dystrophin peptides in target cells.
[0009] The present invention provides such shortened nucleic acid
sequences in a variety of ways. For example, the present invention
provides nucleic acids encoding only 4, 8, 10, 12, 14, 16, 18, 20
and 22 spectrin-like repeat encoding sequences (i.e. nucleic acids
encoding an exact number of spectrin-like repeats). As wild-type
dystrophin has 24 spectrin-like repeat encoding sequences,
providing nucleic acids encoding fewer numbers of repeats reduces
the size of the dystrophin gene (e.g. allowing the nucleic acid
sequence to fit into vectors with limited cloning capacity).
Another example of such shortened nucleic acid sequences are those
that lack at least a portion of the carboxy-terminal domain of
wild-type dystrophin nucleic acid. A further example of such
shortened nucleic acid sequences are those that lack at least a
portion of the 3' untranslated region, or 5' untranslated region,
or both. In certain embodiments, the present invention provides
compositions comprising the peptides expressed by the nucleic acid
sequences of the present invention.
[0010] In certain embodiments, the present invention provides
compositions comprising nucleic acid encoding a mini-dystrophin
peptide, wherein the mini-dystrophin peptide comprises a
spectrin-like repeat domain, and wherein the spectrin-like repeat
domain consists of n spectrin-like repeats, wherein n is an even
number less than 24. In particular embodiments, the present
invention provides nucleic acid encoding a mini-dystrophin peptide,
wherein the mini-dystrophin peptide comprises a spectrin-like
repeat domain comprising n spectrin-like repeats, wherein the
mini-dystrophin peptide contains no more than n spectrin-like
repeats, and wherein n is an even number that is less than 24 and
at least 4. In some embodiments, the present invention provides
nucleic acid encoding a mini-dystrophin peptide, wherein the
mini-dystrophin peptide comprises n spectrin-like repeats, wherein
the mini-dystrophin peptide contains no more than n spectrin-like
repeats, and wherein n is an even number that is less than 24 and
at least 4.
[0011] In some embodiments, n is 20 or less. In other embodiments,
n is 16 or less. In particular embodiments, n is 12 or less. In
additional embodiments, n is 8 or less. In preferred embodiments, n
is 4. In certain embodiments, n is selected from 4, 8, 10, 12, 14,
16, 18, 20 and 22. In some embodiments, the present invention
provides compositions comprising nucleic acid encoding a
mini-dystrophin peptide, wherein the mini-dystrophin peptide
comprises a spectrin-like repeat domain, and wherein the
spectrin-like repeat domain consists of n spectrin-like repeats,
wherein n is 4, 8, 12, 16, or 20. In certain embodiments, the
present invention provides the peptides encoded by the nucleic acid
sequences encoding the mini-dystrophin peptides.
[0012] In certain embodiments, the present invention provides
compositions comprising nucleic acid encoding a mini-dystrophin
peptide, wherein the mini-dystrophin peptide comprises i) a
spectrin-like repeat domain comprising 4 dystrophin spectrin-like
repeats, ii) an actin-binding domain, and iii) a
.beta.-dystroglycan binding domain; and wherein the mini-dystrophin
peptide contains no more than 4 dystrophin spectrin-like
repeats.
[0013] In some embodiments, the present invention provides
compositions comprising a mini-dystrophin peptide, wherein the
mini-dystrophin peptide comprises a spectrin-like repeat domain
comprising n spectrin-like repeats, wherein the mini-dystrophin
peptide contains no more than n spectrin-like repeats, and wherein
n is an even number that is less than 24 and at least 4. In
particular embodiments, the present invention provides a cell (or
cell line) containing the nucleic acid and peptide sequences of the
present invention.
[0014] In certain embodiments, the mini-dystrophin peptide is
capable of altering a measurable muscle value in a DMD animal model
by at least approximately 10% of the wild type value. In other
embodiments, the mini-dystrophin peptide is capable of altering a
measurable muscle value in a DMD animal model by at least
approximately 20% of the wild type value. In particular
embodiments, the mini-dystrophin peptide is capable of altering a
measurable muscle value in a DMD animal model by at least
approximately 30% of the wild type value. In preferred embodiments,
the mini-dystrophin peptide is capable of altering a measurable
muscle value in a DMD animal model to a level similar to the
wild-type value (e.g. .+-.4%). In certain embodiments, the nucleic
acid comprises at least 2, or at least 4, spectrin-like repeat
encoding sequences. In some embodiments, the spectrin-like repeat
encoding sequences are precise spectrin-like repeat encoding
sequences. In certain embodiments, the nucleic acid is less than 5
kilo-bases in length. In other embodiments, the nucleic acid is
less than 6 kilo-bases in length. In particular embodiments, the
nucleic acid comprises viral DNA (e.g. adenovirus DNA). In
preferred embodiments, the viral DNA comprises adeno-associated
viral DNA.
[0015] In certain embodiments, the present invention provides
compositions comprising nucleic acid encoding a mini-dystrophin
peptide, wherein the mini-dystrophin peptide comprises a
spectrin-like repeat domain, and wherein the spectrin-like repeat
domain consists of n spectrin-like repeats, wherein n is an even
number less than 24; and wherein the nucleic acid comprises an
actin-binding domain encoding sequence, a
.beta.-dystroglycan-binding domain encoding sequence, and at least
2, or at least 4, spectrin-like repeat encoding sequences. In some
embodiments, the nucleic acid comprises at least 4 spectrin-like
repeat encoding sequences.
[0016] In certain embodiments, the present invention provides
compositions comprising nucleic acid, wherein the nucleic acid
comprises at least 2 spectrin-like repeat encoding sequences, and
wherein the nucleic acid encodes a mini-dystrophin peptide
comprising a spectrin-like repeat domain, wherein the spectrin-like
repeat domain consists of n spectrin-like repeats, and wherein n is
an even number less than 24. In some embodiments, the nucleic acid
comprises at least 4 spectrin-like repeat encoding sequences.
[0017] In some embodiments, the nucleic acid comprises SEQ ID NO:39
(i.e. .DELTA.R4-R23). In other embodiments, the nucleic acid
comprises SEQ ID NO:40 (i.e. .DELTA.R2-R21). In certain
embodiments, the nucleic acid comprises SEQ ID NO:41 (i.e.
.DELTA.R2-R21+H3). In still other embodiments, the nucleic acid
comprises SEQ ID NO:42 (i.e. .DELTA.H2-R19).
[0018] In certain embodiments, the nucleic acid comprises an
expression vector (e.g. plasmid, virus, etc). In some embodiments,
the expression vector comprises viral DNA. In certain embodiments,
the viral DNA comprises adeno-viral DNA. In some embodiments, the
viral DNA comprises lentiviral DNA. In other embodiments, the viral
DNA comprises helper-dependent adeno-viral DNA. In preferred
embodiments, the viral DNA comprises adeno-associated viral DNA. In
some embodiments, the nucleic acid is inserted in a virus (e.g.
adeno-associated virus, adenovirus, helper-dependent
adeno-associated virus, lentivirus).
[0019] In certain embodiments, the nucleic acid comprises an
actin-binding domain encoding sequence. In particular embodiments,
the actin binding domain comprises at least a portion of SEQ ID
NO:6 (e.g. 5%, 10%, 20%, 40%, 50%, or 75% of SEQ ID NO:6). In other
embodiments, the actin binding domain comprises at least a portion
of a homolog or mutated version of SEQ ID NO:6 (e.g. 5%, 10%, 20%,
40%, 50%, or 75% of a SEQ ID NO:6 homolog or mutated version of SEQ
ID NO:6). In certain embodiments, the nucleic acid comprises a
.beta.-dystroglycan binding domain. In certain embodiments, the
.beta.-dystroglycan binding domain comprises at least a portion of
a dystrophin hinge 4 encoding sequence (e.g. the 3' 50% of SEQ ID
NO:34), and at least a portion of dystrophin cysteine-rich domain
encoding sequence (e.g. the 5' 75% of SEQ ID NO:35). In particular
embodiments, at least a portion of hinge 4 is the WW domain (SEQ ID
NO:45), or a homolog or mutation thereof.
[0020] In particular embodiments, the spectrin-like repeat encoding
sequences are selected from the group consisting of SEQ ID
NOS:8-10, 12-27, and 29-33. In some embodiments, the spectrin-like
repeat encoding sequences are selected from the group consisting of
SEQ ID NOS:8-10, 12-27, and 29-33, and homologs or mutations of SEQ
ID NOS:8-10, 12-27, and 29-33. In preferred embodiments, the
spectrin-like repeat encoding sequences are selected from the group
consisting of SEQ ID NOS:8-10 and 29-33. In some embodiments, the
spectrin-like repeat encoding sequences are identical (e.g. all the
sequences are SEQ ID NO:8). In preferred embodiments, the
spectrin-like repeat encoding sequences are all different (e.g. the
nucleic acid sequence has only 4 spectrin-like repeat encoding
sequences, and these 4 are: SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10,
and SEQ ID NO:33). In certain embodiments, nucleic acid sequence
comprises at least one spectrin-like repeat encoding sequence
selected from the group consisting of SEQ ID NOS:8-10, and at least
one spectrin-like repeat encoding sequence selected from the group
consisting of SEQ ID NOS:29-33.
[0021] In certain embodiments, the nucleic acid (or the resulting
peptide) comprises at least one dystrophin hinge region. In some
embodiments, the nucleic acid comprises at least one dystrophin
hinge region selected from hinge region 1, hinge region 2, hinge
region 3 and hinge region 4. In some embodiments, the nucleic acid
comprises at least one dystrophin hinge region selected from hinge
region 1, hinge region 2, and hinge region 3. In particular
embodiments, dystrophin hinge region 1 is SEQ ID NO:7, or a homolog
(See, e.g. FIG. 11), or a mutant version thereof. In particular
embodiments, dystrophin hinge region 2 is SEQ ID NO:11, or a
homolog (See, e.g. FIG. 11), or a mutant version thereof. In
certain embodiments, dystrophin hinge region 3 is SEQ ID NO:28, or
a homolog (See, e.g. FIG. 11), or a mutant version thereof. In
other embodiments, dystrophin hinge region 4 is SEQ ID NO:34, or a
homolog (See, e.g. FIG. 11), or a mutant version thereof.
[0022] In some embodiments, the nucleic acid comprises a sequence
encoding at least a portion of wild-type dystrophin C-terminal
protein. In other embodiments, the nucleic acid comprises at least
a portion of the 5' untranslated region. In particular embodiments,
the nucleic acid comprises at least a portion of the 3'
untranslated region. In different embodiments, the nucleic acid
sequence comprises regulatory sequences (e.g. MCK enhancer and
promoter elements). In particular embodiments, the nucleic acid
sequence is operably linked to regulatory sequences (e.g. MCK
enhancer and promoter elements). In certain embodiments, the
nucleic acid sequence comprises a mutant muscle-specific enhancer
region.
[0023] In particular embodiments, the nucleic acid has less than
75% of a wild type dystrophin 5' untranslated region. In other
embodiments, the nucleic acid has less than 50% or 20% or 1% (e.g.
0, 1, 2 nucleotides from a wild type dystrophin 5' untranslated
region). In particularly preferred embodiments, the nucleic acid
sequence does not contain any of the wild-type dystrophin 5'
untranslated region. In certain embodiments, the nucleic acid has
less than 75% of a wild type dystrophin 3' untranslated region. In
other embodiments, the nucleic acid has less than 50%, preferably
less than 40%, more preferably less than 35% of a wild type
dystrophin 3' untranslated region. In certain embodiments, the
nucleic acid does not contain a wild-type dystrophin 3'
untranslated region (or, in some embodiments, any type of 3'
untranslated region).
[0024] In particular embodiments, the mini-dystrophin peptide (e.g.
encoded by the nucleic acid of the present invention) comprises a
substantially deleted dystrophin C-terminal domain. In some
embodiments, the mini-dystrophin peptide comprises less than 40% of
wild type dystrophin C-terminal domain, preferably less than 30%,
more preferably less than 20%, even more preferably less than 1%,
and most preferably approximately 0% (e.g. 0, 1, 2, 3 or 4 amino
acids from the wild type dystrophin C-terminal domain). In some
embodiments, the nucleic acid sequence comprises at least one
intron sequence.
[0025] In some embodiments, the present invention provides methods
for expressing a mini-dystrophin peptide in a target cell,
comprising; a) providing; i) a vector comprising nucleic acid
encoding a mini-dystrophin peptide, wherein the mini-dystrophin
peptide comprises a spectrin-like repeat domain, and wherein the
spectrin-like repeat domain consists of n spectrin-like repeats,
wherein n is an even number less than 24, and ii) a target cell,
and b) contacting the vector with the target cell under conditions
such that the mini-dystrophin peptide is expressed in the target
cells. In certain embodiments, the contacting comprises
transfecting. In some embodiments, the contacting is performed
in-vitro. In particular embodiments, the contacting is done
in-vivo. In other embodiments, the target cell is a muscle cell. In
particular embodiments, the target cell further comprises a subject
(e.g. with Duchenne muscular dystrophy (DMD) or Becker muscular
dystrophy (BMD)). In preferred embodiment, the mini-dystrophin
peptide is expressed in the cells of a subject (e.g. such that
symptoms of DMD or BMD are reduced or eliminated).
[0026] In certain embodiments, the present invention provides
methods comprising; a) providing; i) a vector comprising nucleic
acid encoding a mini-dystrophin peptide, wherein the
mini-dystrophin peptide comprises a spectrin-like repeat domain
comprising n spectrin-like repeats, wherein the mini-dystrophin
peptide contains no more than n spectrin-like repeats, and wherein
n is an even number that is less than 24 and at least 4, and ii) a
subject comprising a target cells (e.g. a subject with symptoms of
a muscle disease, such as Muscular Dystrophy); and b) contacting
the vector with the subject under conditions such that the
mini-dystrophin peptide is expressed in the target cell (e.g. such
that the symptoms are reduced or eliminated). In preferred
embodiments, the nucleic acid encoding the mini-dystrophin peptide
is contained within an viral vector (e.g. adeno-associated viral
vector), and the contacting is done by means of injecting the viral
vector into the subject.
[0027] In particular embodiments, the present invention provides
compositions comprising nucleic acid, wherein the nucleic acid
encodes a mini-dystrophin peptide, and wherein the mini-dystrophin
peptide comprises a substantially deleted dystrophin C-terminal
domain. In some embodiments, the present invention provides the
peptides encoded by the nucleic acid of the present invention. In
certain embodiments, the substantially deleted dystrophin
C-terminal domain is less than 40% of a wild type dystrophin
C-terminal domain. In other embodiments, the substantially deleted
dystrophin C-terminal domain is less than 30%, 20%, or 1% of a wild
type dystrophin C-terminal domain. In preferred embodiments, the
substantially deleted dystrophin C-terminal domain is approximately
0% of a wild type dystrophin C-terminal domain. In certain
embodiments, the mini-dystrophin peptide does not contain any
portion of the wild type dystrophin C-terminal domain (i.e. it is
completely deleted).
[0028] In certain embodiments, the mini-dystrophin peptide is
capable of altering a measurable muscle value in a DMD animal model
by at least 10% of the wild type value. In other embodiments, the
mini-dystrophin peptide is capable of altering a measurable muscle
value in a DMD animal model by at least 20% of the wild type value.
In particular embodiments, the mini-dystrophin-peptide is capable
of altering a measurable muscle value in a DMD animal model by at
least 30% of the wild type value. In preferred embodiments, the
mini-dystrophin peptide is capable of altering a measurable muscle
value in a DMD animal model to a level similar to the wild-type
value (e.g. .+-.4%).
[0029] In certain embodiments, the nucleic acid comprises an
expression vector (e.g. plasmid, virus, etc). In some embodiments,
the expression vector comprises viral DNA. In certain embodiments,
the viral DNA comprises adeno-viral DNA. In some embodiments, the
viral DNA comprises lentiviral DNA. In other embodiments, the viral
DNA comprises helper-dependent adeno-viral DNA. In preferred
embodiments, the viral DNA comprises adeno-associated viral DNA. In
some embodiments, the nucleic acid is inserted in a virus (e.g.
adeno-associated virus, adenovirus, helper-dependent
adeno-associated virus, lentivirus).
[0030] In certain embodiments, the nucleic acid comprises an
actin-binding domain encoding sequence. In particular embodiments,
the actin binding domain comprises at least a portion of SEQ ID
NO:6 (e.g. 5%, 10%, 20%, 40%, 50%, or 75% of SEQ ID NO:6). In other
embodiments, the actin binding domain comprises at least a portion
of a homolog or mutated version of SEQ ID NO:6 (e.g. 5%, 10%, 20%,
40%, 50%, or 75% of a SEQ ID NO:6 homolog or mutated version of SEQ
ID NO:6). In certain embodiments, the nucleic acid comprises a
.beta.-dystroglycan binding domain. In certain embodiments, the
.beta.-dystroglycan binding domain comprises at least a portion of
a dystrophin hinge 4 encoding sequence (e.g. the 3' 50% of SEQ ID
NO:34), and at least a portion of dystrophin cysteine-rich domain
encoding sequence (e.g. the 5' 75% of SEQ ID NO:35). In particular
embodiments, at least a portion of hinge 4 is the WW domain (SEQ ID
NO:45), or a homolog or mutation thereof.
[0031] In certain embodiments, the nucleic acid comprises at least
one dystrophin hinge region. In some embodiments, the nucleic acid
comprises at least one dystrophin hinge region selected from hinge
region 1, hinge region 2, hinge region 3 and hinge region 4. In
some embodiments, the nucleic acid comprises at least one
dystrophin hinge region selected from hinge region 1, hinge region
2, and hinge region 3. In particular embodiments, dystrophin hinge
region 1 is SEQ ID NO:7, or a homolog (See, e.g. FIG. 11), or a
mutant version thereof. In particular embodiments, dystrophin hinge
region 2 is SEQ ID NO:11, or a homolog (See, e.g. FIG. 11), or a
mutant version thereof. In certain embodiments, dystrophin hinge
region 3 is SEQ ID NO:28, or a homolog (See, e.g. FIG. 11), or a
mutant version thereof. In other embodiments, dystrophin hinge
region 4 is SEQ ID NO:34, or a homolog (See, e.g. FIG. 11), or a
mutant version thereof.
[0032] In other embodiments, the nucleic acid comprises at least a
portion of the 5' untranslated region. In particular embodiments,
the nucleic acid comprises at least a portion of the 3'
untranslated region. In different embodiment, the nucleic acid
sequence comprises regulatory sequences (e.g. MCK enhancer and
promoter elements). In particular embodiments, the nucleic acid
sequence is operably linked to regulatory sequences (e.g. MCK
enhancer and promoter elements). In certain embodiments, the
nucleic acid sequence comprises a mutant muscle-specific enhancer
region.
[0033] In particular embodiments, the nucleic acid contains less
that 75% of a wild type dystrophin 5' untranslated region. In other
embodiments, the nucleic acid contains less than 50% or 20% or 1%
(e.g. 0, 1, 2 nucleotides from a wild type dystrophin 5'
untranslated region). In particularly preferred embodiments, the
nucleic acid sequence does not contain any of the wild-type
dystropllin 5' untranslated region. In certain embodiments, the
nucleic acid has less than 75% of a wild type dystrophin 3'
untranslated region. In other embodiments, the nucleic acid has
less than 50%, preferably less than 40%, more preferably less than
35% of a wild type dystrophin 3' untranslated region. In certain
embodiments, the nucleic acid does not contain a wild-type
dystrophin 3' untranslated region (or, in some embodiments, any
type of 3' untranslated region).
[0034] In some embodiments, the present invention provides methods
for expressing a mini-dystrophin peptide in a target cell,
comprising; a) providing; i) a vector comprising nucleic acid,
wherein the nucleic acid encodes a mini-dystrophin peptide
comprising a substantially deleted dystrophin C-terminal domain,
and ii) a target cell, and b) contacting the vector with the target
cell under conditions such that the mini-dystrophin peptide is
expressed in the target cells. In certain embodiments, the
contacting comprises transfecting. In other embodiments, the target
cell is a muscle cell.
[0035] In certain embodiments, the present invention provides
systems and kits with the mini-dystrophin nucleic acid and/or
peptide sequences described herein. In certain embodiments, the
systems and kits of the present invention comprise a nucleic acid
sequence encoding a mini-dystrophin peptide (and/or the
mini-dystrophin peptide) and one other component (e.g. an insert
component with written instructions for using the mini-dystrophin
nucleic acid, or a nucleic acid encoding a vector, or a component
for delivering the nucleic acid to a subject, cells for expressing
the mini-dystrophin peptide, a buffer, etc.). In certain
embodiments, the present invention provides a computer readable
medium (e.g. CD, hard drive, floppy disk, magnetic tape, etc.) that
contains the nucleic acid or amino acid sequences of the present
invention (e.g. a computer readable representation of the
nucleotide bases used to make a mini-dystrophin nucleic acid
sequence).
[0036] In some embodiments, the present invention provides
mini-dystrophin nucleic acid sequences for use as a medicament. In
other embodiments, the present invention provides mini-dystrophin
peptides for use as a medicament. In particular embodiments, the
present invention provides the use of mini-dystrophin nucleic acid
sequences for preparing a drug for a therapeutic application. In
additional embodiments, the present invention provides the use of
mini-dystrophin peptides for preparing a drug for a therapeutic
application. In some embodiments, the present invention provides
mini-dystrophin nucleic acid sequences for the preparation of a
composition for the treatment of a muscle disease (e.g. DMD). In
other embodiments, the present invention provides mini-dystrophin
peptides for the preparation of a composition for the treatment of
a muscle disease (e.g. DMD).
DESCRIPTION OF THE FIGURES
[0037] FIG. 1 shows the nucleic acid sequence for wild-type human
dystrophin cDNA.
[0038] FIG. 2 shows the nucleic acid sequence for wild-type mouse
dystrophin cDNA.
[0039] FIG. 3 shows the nucleic acid sequence for wild-type human
utrophin cDNA.
[0040] FIG. 4 shows the nucleic acid sequence for wild-type mouse
utrophin cDNA FIG. 5 shows various domains of the nucleic acid
sequence for wild-type human dystrophin cDNA.
[0041] FIG. 6 shows various domains of the nucleic acid sequence
for wild-type human dystrophin cDNA.
[0042] FIG. 7 shows various domains of the nucleic acid sequence
for wild-type human dystrophin cDNA.
[0043] FIG. 8 shows various domains of the nucleic acid sequence
for wild-type human dystrophin cDNA.
[0044] FIG. 9 shows various domains of the nucleic acid sequence
for wild-type human dystrophin cDNA.
[0045] FIG. 10 shows the 3' UTR domain nucleic acid sequence for
wild-type human dystrophin cDNA.
[0046] FIG. 11 shows a sequence alignment between wild-type human
dystrophin cDNA and wild-type mouse dystrophin cDNA. The various
domains in the human dystrophin sequence have spaces between them
with the ends highlighted in bold. In this regard, homologous
sequences for various domains in the mouse cDNA sequence are
seen.
[0047] FIG. 12 shows the nucleic acid sequence for .DELTA.R4-R23, a
nucleic acid sequence encoding a mini-dystrophin peptide.
[0048] FIG. 13 shows the nucleic acid sequence for .DELTA.R2-R21, a
nucleic acid sequence encoding a mini-dystrophin peptide.
[0049] FIG. 14 shows the nucleic acid sequence for
.DELTA.R2-R21+H3, a nucleic acid sequence encoding a
mini-dystrophin peptide.
[0050] FIG. 15 shows the nucleic acid sequence for .DELTA.H2-R19, a
nucleic acid sequence encoding a mini-dystrophin peptide.
[0051] FIG. 16 shows the complete cDNA sequence for human skeletal
muscle alpha actinin.
[0052] FIG. 17 shows the nucleic acid sequence for .DELTA.R9-R16, a
nucleic acid sequence encoding a mini-dystrophin peptide.
[0053] FIG. 18 shows the nucleic acid sequence for the WW
domain.
[0054] FIG. 19 shows various transgenic expression constructs
tested in Example 1.
[0055] FIG. 20 shows the contractile properties of EDL, soleus, and
diaphragm muscles in wild-type, mdx, and dystrophin .DELTA.71-78
mice.
[0056] FIG. 21 show the nucleic acid sequence for pBSX.
[0057] FIG. 22 shows a restriction map for pBSX.
[0058] FIG. 23 shows the `full-length` HDMD sequence.
[0059] FIG. 24 shows the cloning procedure for .DELTA.R4-R23.
[0060] FIG. 25 shows the cloning procedure for
.DELTA.R2-R21+H3.
[0061] FIG. 26 shows the cloning procedure for .DELTA.R2-R21.
[0062] FIG. 27 shows a schematic illustration of the domains
encoded by the truncated and full-length dystrophin sequences
tested in Example 5.
[0063] FIG. 28 is a graph showing the percentage of myofibers in
quadricep muscles of 3 month old mice that display
centrally-located nuclei in the indicated strains of transgenic
mice.
[0064] FIG. 29 shows graphs depicting the force generating capacity
in diaphragm (A) or EDL (B) muscles of the indicated strains of
dystrophin transgenic mdx mice and control mice.
[0065] FIG. 30 shows a graph depicting the force generating
capacity in EDL (A) or diaphragm (B) muscles of the indicated
strains of dystrophin transgenic mdx mice and control mice.
[0066] FIG. 31 is a graph showing the percentage of force
generating capacity lost after 1 or 2 lengthening contractions of
the tibialis anterior muscle of the indicated strains of dystrophin
transgenic mdx mice and control mice.
[0067] FIG. 32 is a graph showing the total distance run on a
treadmill by animals from the indicated strains of dystrophin
transgenic mdx mice and control mice.
[0068] FIG. 33 shows a graph depicting the total body mass (A) and
mass of the tibialis anterior muscle (B) of the indicated strains
of dystrophin transgenic mdx mice and control mice.
[0069] FIG. 34 is a schematic illustration of the structure of a
mini-dystrophin expression cassette inserted into an
adeno-associated viral vector.
[0070] FIG. 35 is a schematic illustration of the structure of
plasmid pTZ19R (top) and the sequence of the multiple cloning site
in the vector (bottom).
[0071] FIG. 36 shows the nucleic acid sequence of various MCK
enhancer regions (wild-type and mutant).
[0072] FIG. 37 shows the nucleic acid sequence of various MCK
promoter regions.
[0073] FIG. 38 shows a comparison between domains in dystrophin and
utrophin.
DEFINITIONS
[0074] To facilitate an understanding of the present invention, a
number of terms and phrases are defined below:
[0075] As used herein, the term "measurable muscle values" refers
to measurements of dystrophic symptoms (e.g. fibrosis, an increased
proportion of centrally located nuclei, reduced force generation by
skeletal muscle, etc.) in an animal. These measurements may be
taken, for example, to determine the wild-type value (i.e. the
value in a control animal), to determine the value in a DMD
(Duchenne muscular dystrophy) animal model (e.g. in an mdx mouse
model), and to determine the value in a DMD animal model expressing
the mini-dystrophin peptides of the present invention. Various
assays may be employed to determine measurable muscle values in an
animal including, but not limited to, assays measuring fibrosis,
phagocytic infiltration of muscle tissue, variation in myofiber
size, an increased proportion of myofibers with centrally located
nuclei, elevated serum levels of muscle pyruvate kinase,
contractile properties assays, DAP (dystrophin associated protein)
assays, susceptibility to contraction induced injuries and measured
force assays (See Examples 1 and 4).
[0076] As used herein, the term "mini-dystrophin peptide" refers to
a peptide that is smaller in size than the full-length wild-type
dystrophin peptide, and that is capable of altering (increasing or
decreasing) a measurable muscle value in a DMD animal model by at
least approximately 10% such that the value is closer to the
wild-type value (e.g. a mdx mouse has a measurable muscle value
that is 50% of the wild-type value, and this value is increased to
at least 60% of the wild-type value; or a mdx mouse has a
measurable muscle value that is 150% of the wild-type value, and
this value is decreased to at most 140% of the wild-type value). In
some embodiments, the mini-dystrophin-peptide is capable of
altering a measurable muscle value in a DMD animal model by at
least approximately 20% of the wild type value. In certain
embodiments, the mini-dystrophin-peptide is capable of altering a
measurable muscle value in a DMD animal model by at least
approximately 30% of the wild type value. In preferred embodiments,
the mini-dystrophin peptide is capable of altering a measurable
muscle value in a DMD animal model to a level similar to the
wild-type value (e.g. .+-.4%).
[0077] As used herein, the term "wild-type dystrophin cysteine-rich
domain" refers to a peptide encoded by the nucleic acid sequences
in SEQ ID NO:35 (e.g. in human), as well as wild type peptide
homologs encoded by nucleic acid homologs of SEQ ID NO:35 (See,
FIG. 11).
[0078] As used herein, the term "wild type dystrophin C-terminal
domain" refers to a peptide encoded by the nucleic acid sequences
in SEQ ID NO:36 (e.g. in human), as well as wild type peptide
homologs encoded by nucleic acid homologs of SEQ ID NO:36 (See,
FIG. 11).
[0079] As used herein, the term "mini-dystrophin peptide comprising
a substantially deleted dystrophin C-terminal domain" refers to a
mini-dystrophin peptide that has less than 45% of a wild type
dystrophin C-terminal domain. In some embodiments, the
mini-dystrophin peptide comprises less than 40% of wild type
dystrophin C-terminal domain, preferably less than 30%, more
preferably less than 20%, even more preferably less than 1%, and
most preferably approximately 0% (e.g. 0, 1, 2, 3 or 4 amino acids
from the wild type dystrophin C-terminal domain). The construction
of mini-dystrophin peptides with a substantially deleted dystrophin
C-terminal domain may be accomplished, for example, by deleting all
or a portion of SEQ ID NO:36 from human dystrophin SEQ ID NO:1
(See, e.g. Example 3C).
[0080] As used herein, the term "wild type dystrophin 5'
untranslated region" refers to the nucleic acid sequence at the
very 5' end of a wild type dystrophin nucleic acid sequence (e.g.
SEQ ID NOS:1 and 2) that immediately precedes the amino acid coding
regions. For example, for human dystrophin, SEQ ID NO:5 (the first
208 bases) is the 5' untranslated region (a homolog in mouse may be
seen in FIG. 11).
[0081] As used herein, the term "wild type dystrophin 3'
untranslated region" refers to the nucleic acid sequence at the
very 3' end of a wild type dystrophin nucleic acid sequence (e.g.
SEQ ID NOS:1 and 2) that immediately proceeds the amino acid coding
regions. For example, for human dystrophin, SEQ ID NO:38 (the last
2690 bases of the human dystrophin gene) is the 3' untranslated
region (a homolog in mouse may be seen in FIG. 11).
[0082] As used herein, the term "actin-binding domain encoding
sequence" refers to the portion of a dystrophin nucleic sequence
that encodes a peptide-domain capable of binding actin in vitro
(e.g. SEQ ID NO:6), as well as homologs (See, FIG. 11),
conservative mutations, and truncations of such sequences that
encode peptide-domains that are capable of binding actin in vivo.
Determining whether a particular nucleic acid sequence encodes a
peptide-domain (e.g. homolog, mutation, or truncation of SEQ ID
NO:6) that will bind actin in vitro may be performed, for example,
by screening the ability of the peptide-domain to bind actin in
vitro in a simple actin binding assay (See, Corrado et al., FEBS
Letters, 344:255-260 [1994], describing the expression of candidate
dystrophin peptides as fusion proteins, absorbing F-actin on to
microtiter plates, incubating the candidate peptides in the F-actin
coated microtiter plates, washing the plates, adding anti-fusion
protein rabbit antibody, and adding an anti-rabbit antibody
conjugated to a detectable marker).
[0083] As used herein, the term ".beta.-dystroglycan-binding domain
encoding sequence" refers to the portion of a dystrophin nucleic
sequence that encodes a peptide-domain capable of binding
.beta.-dystroglycan in vivo (e.g. SEQ ID NOs:34 and 35), as well as
homologs (See, FIG. 11), conservative mutations, and truncations of
such sequences that encode peptide-domains that are capable of
binding .beta.-dystroglycan in vivo. In preferred embodiments, the
.beta.-dystroglycan-binding domain encoding sequence includes at
least a portion of a hinge 4 encoding region (e.g. SEQ ID NO:45,
the WW domain) and at least a portion of a wild-type dystrophin
cysteine-rich domain (e.g. at least a portion of SEQ ID NO:35)
(See, e.g Jung et al., JBC, 270 (45):27305 [1995]). Determining
whether a particular nucleic acid sequence encodes a peptide-domain
(e.g. homolog, mutation, or truncation) that will bind
.beta.-dystroglycan in vivo may be performed, for example, by first
screening the ability of the peptide-domain to bind
.beta.-dystroglycan in vitro in a simple .beta.-dystroglycan
binding assay (See, Jung et al., pg 27306--constructing
peptide-domain dystrophin-GST fusion peptides and radioactively
labelled .beta.-dystroglycan, immobilizing the fusion proteins on
glutathione-agarose beads, incubating the beads with the
radioactively labelled .beta.-dystroglycan, pelleting the beads,
washing the beads, and resolving the sample on an
SDS-polyacrylamide gel, staining with Coomasie blue, exposing to
film, and quantifying the amount of radioactivity present). Nucleic
acid sequences found to express peptides capable of binding
.beta.-dystroglycan in such assays may then, for example, be tested
in vivo by transfecting a cell line (e.g., COS cells) with two
expression vectors, one expressing the dystroglycan peptide and the
other expressing the candidate peptide domain (as a fusion
protein). After culturing the cells, the protein is then extracted
and a co-immunoprecipitation is performed for one of the proteins,
followed by a Western blot for the other.
[0084] As used herein, the term "spectrin-like repeats" refers to
peptides composed of approximately 100 amino acids that are
responsible for the rod-like shape of many structural proteins
including, but not limited to, dystrophin, utrophin, fodrin,
alpha-actin, and spectrin, when the spectrin-like repeats are
present in multiple copies (e.g. dystrophin-24, utrophin-22,
alpha-actin-4, spectrin-16, etc). Spectrin-like repeats also refers
to mutations of these natural peptides, such as conservative
changes in amino acid sequence, as well as the addition or deletion
of up to 5 amino acids to/from the end of a spectrin-like repeat.
Spectrin-like repeats includes `precise spectrin-like repeats` (see
below). Examples of spectrin-like repeats include, but are not
limited to, peptides encoded by nucleic acid sequences found in
wild-type human dystrophin (e.g. SEQ ID NOS:8-10, 12-27, and
29-33).
[0085] As used herein, the term "spectrin-like repeat encoding
sequences" refers to nucleic acid sequences encoding spectrin-like
repeat peptides. This term includes natural and synthetic nucleic
acid sequences encoding the spectrin-like repeats (e.g. both the
naturally occurring and mutated spectrin-like repeat peptides).
Examples of spectrin-like repeat encoding sequences include, but
are not limited to, SEQ ID NOS:8-10, 12-27, and 29-33.
[0086] As used herein, the term "precise spectrin-like repeat
encoding sequences" refers to nucleic acid sequences encoding
spectrin-like repeat peptides with up to 1 additional amino acid
added to, or deleted from, the spectrin-like repeat. As used
herein, the term "spectrin-like repeat domain" refers to the region
in a mini-dystrophin peptide that contains the spectrin-like
repeats of the mini-dystrophin peptide.
[0087] The term "gene" refers to a DNA sequence that comprises
control and coding sequences necessary for the production of a
polypeptide or precursor thereof. The polypeptide can be encoded by
a full length coding sequence or by any portion of the coding
sequence so long as the desired enzymatic activity is retained. The
term "gene" encompasses both cDNA and genomic forms of a given
gene.
[0088] The tern "wild-type" refers to a gene, gene product, or
other sequence that has the characteristics of that gene or gene
product when isolated from a naturally occurring source. A
wild-type gene is that which is most frequently observed in a
population and is thus arbitrarily designated the "normal" or
"wild-type" form of the gene. In contrast, the term "modified" or
"mutant" refers to a gene, gene product, or other sequence that
displays modifications in sequence and or functional properties
(e.g. altered characteristics) when compared to the wild-type gene
or gene product. It is noted that naturally-occurring mutants can
be isolated; these are identified by the fact that they have
altered characteristics when compared to the wild-type gene or gene
product.
[0089] The term "oligonucleotide" as used herein is defined as a
molecule comprised of two or more deoxyribonucleotides or
ribonucleotide, usually more than three (3), and typically more
than ten (10) and up to one hundred (100) or more (although
preferably between twenty and thirty). The exact size will depend
on many factors, which in turn depends on the ultimate function or
use of the oligonucleotide. The oligonucleotide may be generated in
any manner, including chemical synthesis, DNA replication, reverse
transcription, or a combination thereof.
[0090] As used herein, the term "regulatory sequence" refers to a
genetic sequence or element that controls some aspect of the
expression of nucleic acid sequences. For example, a promoter is a
regulatory element that facilitates the initiation of transcription
of an operably linked coding region. Other regulatory elements are
enhancers, splicing signals, polyadenylation signals, termination
signals, etc. Examples include, but are not limited to, the 5' UTR
of the dystrophin gene (SEQ ID NO:5), MCK promoters and enhancers
(both wild type and mutant, See U.S. provisional app. Ser. No.
60/218,436, filed Jul. 14, 2000, and International Application
PCT/US01/22092, filed Jul. 13, 2001, both of which are hereby
incorporated by reference).
[0091] Transcriptional control signals in eucaryotes comprise
"promoter" and "enhancer" elements. Promoters and enhancers consist
of short arrays of DNA sequences that interact specifically with
cellular proteins involved in transcription. The present invention
contemplates modified enhancer regions.
[0092] The term "recombinant DNA vector" as used herein refers to
DNA sequences containing a desired coding sequence and appropriate
DNA sequences necessary for the expression of the operably linked
coding sequence in a particular host organism (e.g., mammal). DNA
sequences necessary for expression in procaryotes include a
promoter, optionally an operator sequence, a ribosome binding site
and possibly other sequences. Eukaryotic cells are known to utilize
promoters, polyadenlyation signals and enhancers.
[0093] The terms "in operable combination", "in operable order" and
"operably linked" as used herein refer to the linkage of nucleic
acid sequences in such a manner that a nucleic acid molecule
capable of directing the transcription of a given gene and/or the
synthesis of a desired protein molecule is produced. The term also
refers to the linkage of amino acid sequences in such a manner so
that a functional protein is produced.
[0094] "Hybridization" methods involve the annealing of a
complementary sequence to the target nucleic acid (the sequence to
be detected). The ability of two polymers of nucleic acid
containing complementary sequences to find each other and anneal
through base pairing interaction is a well-recognized
phenomenon.
[0095] The "complement" of a nucleic acid sequence as used herein
refers to an oligonucleotide which, when aligned with the nucleic
acid sequence such that the 5' end of one sequence is paired with
the 3' end of the other, is in "antiparallel association."
Complementarity need not be perfect; stable duplexes may contain
mismatched base pairs or unmatched bases. Those skilled in the art
of nucleic acid technology can determine duplex stability
empirically considering a number of variables including, for
example, the length of the oligonucleotide, base composition and
sequence of the oligonucleotide, ionic strength and incidence of
mismatched base pairs.
[0096] The term "homology" refers to a degree of complementarity.
There may be partial homology or complete homology (i.e.,
identity). A partially complementary sequence is one that at least
partially inhibits a completely complementary sequence from
hybridizing to a target nucleic acid is referred to using the
functional term "substantially homologous." The inhibition of
hybridization of the completely complementary sequence to the
target sequence may be examined using a hybridization assay
(Southern or Northern blot, solution hybridization and the like)
under conditions of low stringency. A substantially homologous
sequence or probe will compete for and inhibit the binding (i.e.,
the hybridization) of a completely homologous to a target under
conditions of low stringency. This is not to say that conditions of
low stringency are such that non-specific binding is permitted; low
stringency conditions require that the binding of two sequences to
one another be a specific (i.e., selective) interaction. The
absence of non-specific binding may be tested by the use of a
second target that lacks even a partial degree of complementarity
(e.g., less than about 30% identity); in the absence of
non-specific binding the probe will not hybridize to the second
non-complementary target.
[0097] As used herein the term "stringency" is used in reference to
the conditions of temperature, ionic strength, and the presence of
other compounds such as organic solvents, under which nucleic acid
hybridizations are conducted. Those skilled in the art will
recognize that "stringency" conditions may be altered by varying
the parameters just described either individually or in concert.
With "high stringency" conditions, nucleic acid base pairing will
occur only between nucleic acid fragments that have a high
frequency of complementary base sequences (e.g., hybridization
under "high stringency" conditions may occur between homologs with
about 85-100% identity, preferably about 70-100% identity). With
medium stringency conditions, nucleic acid base pairing will occur
between nucleic acids with an intermediate frequency of
complementary base sequences (e.g., hybridization under "medium
stringency" conditions may occur between homologs with about 50-70%
identity). Thus, conditions of "weak" or "low" stringency are often
required with nucleic acids that are derived from organisms that
are genetically diverse, as the frequency of complementary
sequences is usually less.
[0098] Low stringency conditions when used in reference to nucleic
acid hybridization comprise conditions equivalent to binding or
hybridization at 42.degree. C. in a solution consisting of
5.times.SSPE (43.8 g/l NaCL, 6.9 g/l NaH.sub.2PO.sub.4-H.sub.2O and
1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDA, 5.times.
Denhardt's reagent [50.times. Denhardt's contains per 500 ml: 5 g
Ficoll (Type 400, Pharmacia), 5 g BSA (Fraction V, Sigma)] and 100
.mu.g/ml denatured salmon sperm DNA followed by washing in solution
comprising 5.times.SSPE, 0.1% SDS at 42.degree. C. when a probe of
about 500 nucleotides in length is employed.
[0099] High stringency conditions when used in reference to nucleic
acid hybridization comprises conditions equivalent to binding or
hybridizing at 42.degree. C. in a solution consisting of
5.times.SSPE (43.8 g/l NaCL, 6.9 g/l NaH.sub.2PO.sub.4-H.sub.2O and
1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5.times.
Denhardt's reagent and 100 .mu.g/ml denatured salmon sperm DNA,
followed by washing in a solution comprising 0.1.times.SSPE, 1.0%
SDS at 42.degree. C. when a probe of about 500 nucleotides is
employed.
[0100] The art knows well that numerous equivalent conditions may
be employed to comprise low stringency conditions; factors such as
the length and nature (DNA, RNA, base composition) of the probe and
nature of the target (DNA, RNA, base composition, present in
solution or immobilized, etc.) and the concentration of the salts
and other components (e.g., the presence or absence of formamide,
dextran sulfate, polyethylene glycol) are considered and the
hybridization solution may be varied to generate conditions of low
stringency hybridization different from, but equivalent to, the
above listed conditions. In addition, the art knows conditions that
promote hybridization under conditions of high stringency (e.g.,
increasing the temperature of the hybridization and/or wash steps,
the use of formamide in the hybridization solution, etc.).
[0101] The term "transfection" as used herein refers to the
introduction of foreign DNA into eukaryotic cells. Transfection may
be accomplished by a variety of means known to the art including
calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated
transfection, polybrene-mediated transfection, electroporation,
microinjection, liposome fusion, lipofection, protoplast fusion,
retroviral infection, and biolistics.
[0102] The term "stable transfection" or "stably transfected"
refers to the introduction and integration of foreign DNA into the
genoine of the transfected cell. The term "stable transfectant"
refers to a cell which has stably integrated foreign DNA into the
genomic DNA.
[0103] As used herein, the terms "nucleic acid molecule encoding,"
"DNA sequence encoding," and "DNA encoding" refer to the order or
sequence of deoxyribonucleotides along a strand of deoxyribonucleic
acid. The order of these deoxyribonucleotides determines the order
of amino acids along the polypeptide (protein) chain. The DNA
sequence thus codes for the amino acid sequence.
[0104] As used herein, the terms "muscle cell" refers to a cell
derived from muscle tissue, including, but not limited to, cells
derived from skeletal muscle, smooth muscle (e.g. from the
digestive tract, urinary bladder, and blood vessels), and cardiac
muscle. The term includes muscle cells in vitro, ex vivo, and in
vivo. Thus, for example, an isolated cardiomyocyte would constitute
a muscle cell, as would a cell as it exists in muscle tissue
present in a subject in vivo. This term also encompasses both
terminally differentiated and nondifferentiated muscle cells, such
as myocytes, myotubes, myoblasts, cardiomyocytes, and
cardiomyoblasts.
[0105] As used herein, the term "muscle-specific" in reference to
an regulatory element (e.g. enhancer region, promoter region) means
that the transcriptional activity driven by these regions is mostly
in muscle cells or tissue (e.g. 20:1) compared to the activity
conferred by the regulatory sequences in other tissues. An assay to
determine the muscle-specificity of a regulatory region is provided
in Example 5 below (measuring beta-galactoside in muscle cells and
liver cells from a mouse transfected with an expression
vector).
[0106] As used herein, the term "mutant muscle-specific enhancer
region" refers to a wild-type muscle-specific enhancer region that
has been modified (e.g. deletion, insertion, addition,
substitution), and in particular, has been modified to contain an
additional MCK-R control element (See U.S. Prov. App. Ser. No.
60/218,436, hereby incorporated by reference, and section IV
below).
DESCRIPTION OF THE INVENTION
[0107] The present invention provides compositions and methods for
expressing mini-dystrophin peptides. In particular, the present
invention provides compositions comprising nucleic acid sequences
that are shorter than wild-type dystrophin cDNA and that express
mini-dystrophin peptides that function in a similar manner as
wild-type dystrophin proteins. The present invention also provides
compositions comprising mini-dystrophin peptides, and methods for
expressing mini-dystrophin peptides in target cells.
[0108] The present invention provides such shortened nucleic acid
sequences (and resulting peptides) in a variety of ways. For
example, the present invention provides nucleic acid encoding only
4, 8, 12, 16, and 20 spectrin-like repeat encoding sequences (i.e.
nucleic acid encoding an exact number of spectrin-like repeats that
are multiples of 4). As wild-type dystrophin has 24 spectrin-like
repeat encoding sequences, providing nucleic acid encoding fewer
numbers of repeats reduces the size of the dystrophin gene (e.g.
allowing the nucleic acid sequence to fit into vectors with limited
cloning capacity). Another example of such shortened nucleic acid
sequences are those that lack at least a portion of the
carboxy-terminal domain of wild-type dystrophin nucleic acid. A
further example of such shortened nucleic acid sequences are those
that lack at least a portion of the 3' untranslated region, or 5'
untranslated region, or both.
[0109] I. Dystrophin
[0110] A. Dystrophin Structure
[0111] In some embodiments, the present invention provides gene
constructs comprising spectrin-like repeats from human dystrophin.
Dystrophin is a 427 kDa cytoskeletal protein and is a member of the
spectrin/.alpha.actinin superfamily (See e.g., Blake et al., Brain
Pathology, 6:37 [1996]; Winder, J. Muscle Res. Cell. Motil., 18:617
[1997]; and Tinsley et al., PNAS, 91:8307 [1994]). The N-terminus
of dystrophin binds to actin, having a higher affinity for
non-muscle actin than for sarcomeric actin. Dystrophin is involved
in the submembraneous network of non-muscle actin underlying the
plasma membrane. Dystrophin is associated with an oligomeric,
membrane spanning complex of proteins and glycoproteins, the
dystrophin-associated protein complex (DPC). The N-terminus of
dystrophin has been shown in vitro to contain a functional
actin-binding domain. The C-terminus of dystrophin binds to the
cytoplasmic tail of .beta.-dystroglycan, and in concert with actin,
anchors dystrophin to the sarcolemma. Also bound to the C-terminus
of dystrophin are the cytoplasmic members of the DPC. Dystrophin
thereby provides a link between the actin-based cytoskeleton of the
muscle fiber and the extracellular matrix. It is this link that is
disrupted in muscular dystrophy.
[0112] The central rod domain of dystrophin is composed of a series
of 24 weakly repeating units of approximately 110 amino acids,
similar to those found in spectrin (i.e., spectrin-like repeats).
This domain constitutes the majority of dystrophin and gives
dystrophin a flexible rod-like structure. The rod-domain is
interrupted by four hinge regions that are rich in proline. It is
contemplated that the rod-domain provides a structural link between
member of the DPC. Table 1 shows an overview of the structural and
functional domains of human dystrophin.
1TABLE 1 Full Length Human Dystrophin cDNA Nucleotides Feature SEQ
ID NO: 1-208 5' untranslated region SEQ ID NO: 5 209-211 Start
codon (ATG) -- 209-964 N terminus SEQ ID NO: 6 965-1219 Hinge 1 SEQ
ID NO: 7 1220-1546 Spectrin-like repeat No. 1 SEQ ID NO: 8
1547-1879 Spectrin-like repeat No. 2 SEQ ID NO: 9 1880-2212
Spectrin-like repeat No. 3 SEQ ID NO: 10 2213-2359 Hinge 2 SEQ ID
NO: 11 2360-2692 Spectrin-like repeat No. 4 SEQ ID NO: 12 2693-3019
Spectrin-like repeat No. 5 SEQ ID NO: 13 3020-3346 Spectrin-like
repeat No. 6 SEQ ID NO: 14 3347-3673 Spectrin-like repeat No. 7 SEQ
ID NO: 15 3674-4000 Spectrin-like repeat No. 8 SEQ ID NO: 16
4001-4312 Spectrin-like repeat No. 9 SEQ ID NO: 17 4313-4588
Spectrin-like repeat No. 10 SEQ ID NO: 18 4589-4915 Spectrin-like
repeat No. 11 SEQ ID NO: 19 4916-5239 Spectrin-like repeat No. 12
SEQ ID NO: 20 5340-5551 Spectrin-like repeat No. 13 SEQ ID NO: 21
5552-5833 Spectrin-like repeat No. 14 SEQ ID NO: 22 5834-6127
Spectrin-like repeat No. 15 SEQ ID NO: 23 6128-6187 20 amino acid
insert (not hinge) -- 6188-6514 Spectrin-like repeat No. 16 SEQ ID
NO: 24 6515-6835 Spectrin-like repeat No. 17 SEQ ID NO: 25
6836-7186 Spectrin-like repeat No. 18 SEQ ID NO: 26 7187-7489
Spectrin-like repeat No. 19 SEQ ID NO: 27 7490-7612 Hinge 3 SEQ ID
NO: 28 7613-7942 Spectrin-like repeat No. 20 SEQ ID NO: 29
7943-8269 Spectrin-like repeat No. 21 SEQ ID NO: 30 8270-8617
Spectrin-like repeat No. 22 SEQ ID NO: 31 8618-9004 Spectrin-like
repeat No. 23 SEQ ID NO: 32 9005-9328 Spectrin-like repeat No. 24
SEQ ID NO: 33 9329-9544 Hinge 4 SEQ ID NO: 34 9545-10431 Start of C
terminus SEQ ID NO: 35 10432-11254 Alternatively spliced exons
71-78 SEQ ID NO: 36 11255-11266 End of Coding Region SEQ ID NO: 37
11267-13957 3' untranslated region SEQ ID NO: 38 *Domain structure
based on Winder et al., Febs Letters, 369: 27-33 (1995)
[0113] B. Spectrin-Like Repeats
[0114] Spectrin-like repeats are about 100 amino acids long and are
found in a number of proteins, including the actin binding proteins
spectrin, fodrin, a-actinin, and dystrophin, but their function
remains unclear (Dhermy, 1991. Biol. Cell, 71:249-254). These
domains may be involved in connecting functional domains and/or
mediate protein-protein interactions. The many tandem,
spectrin-like motifs that comprise most of the mass of the proteins
in this superfamily are responsible for their similar flexible,
rod-like molecular shapes. Although these homologous motifs are
frequently called repeats or repetitive segments, adjacent segments
in each protein are only distantly related evolutionarily.
[0115] Spectrin is a cytoskeletal protein of red blood cells that
is associated with the cytoplasmic side of the lipid bilayer (See
e.g., Speicher and Ursitti, Current Biology, 4:154 [1994]).
Spectrin is a long-thin flexible rod-shaped protein that
constitutes about 25% of the membrane-associated protein mass.
Spectrin is composed of two large polypeptide chains,
.alpha.-spectrin (.about.240 kDa) and .beta.-spectrin (.about.220
kDa) and serves to cross-link short actin oligomers to form a
dynamic two-dimensional submembrane latticework. Spectrin isoforms
have been found in numerous cell types and have been implicated in
a variety of functions.
[0116] The recent determination of the crystal structure of a
single domain of spectrin provides insight into the structure
function of an entire class of large actin cross-linking proteins
(Yan et al., Science, 262:2027 [1993]). The domain is an example of
a spectrin-like repeat. Early analysis of spectrin-like repeats by
partial peptide sequence analysis demonstrated that most of the
antiparallel spectrin heterodimer is made up of homologous 106
residue motifs. Subsequent sequence analyses of cDNAs confirmed
that this small motif is the major building block for all spectrin
isoforms, as well as for the related actinins and dystrophins
(Matsudaira, Trends Biochem Sci, 16:87 [1991]).
[0117] Given their similar sequences, all spectrin motifs are
expected to have related, but not identical, three-dimensional
structures. The structure of a single Drosophila spectrin motif,
14, which has now been determined (Yan et al., Science, 262:2027
[1993]), should therefore provide insight into the overall
conformation of spectrins in particular and, to a more limited
extent, the other members of the spectrin superfamily. The
structure shows that the spectrin motif forms a three-helix bundle,
similar to the earliest conformational prediction based on the
analysis of multiple homologous motifs (Speicher and Marchesi,
Nature, 311:177 [1984]).
[0118] II. Variants and Homologs of Dystrophin
[0119] The present invention is not limited to the spectrin-like
repeat encoding sequences SEQ ID NOS:8-10, 12-27, and 29-33, but
specifically includes nucleic acid sequences capable of hybridizing
to the spectrin-like repeat encoding sequences SEQ ID NOS:8-10,
12-27, and 29-33, (e.g. capable of hybridizing under high stringent
conditions). Those skilled in the art know that different
hybridization stringencies may be desirable. For example, whereas
higher stringencies may be preferred to reduce or eliminate
non-specific binding between the spectrin-like repeat encoding
sequences SEQ ID NOS:8-10, 12-27, and 29-33, and other nucleic acid
sequences, lower stringencies may be preferred to detect a larger
number of nucleic acid sequences having different homologies to the
nucleotide sequence of SEQ ID NOS:8-10, 12-27, and 29-33.
[0120] Accordingly, in some embodiments, the dystrophin
spectrin-like repeats of the compositions of the present invention
(e.g., SEQ ID NOs:8-10, 12-27, and 29-33) are replaced with
different spectrin-like repeats, including, but not limited to,
variants, homologs, truncations, and additions of dystrophin
spectrin-like repeats. Candidate spectrin-like repeats are screened
for activity using any suitable assay, including, but not limited
to, those described below and in illustrative Examples 1 and 5.
[0121] A. Homologs
[0122] 1. Dystrophin From Other Species
[0123] In some embodiments, the spectrin-like repeats of the gene
constructs of the present invention are replaced with spectrin-like
repeats of dystrophin from other species (e.g., homologs of
dystrophin), including, but not limited to, those described herein.
Homologs of dystrophin have been identified in a variety of
organisms, including mouse (Genbank accession number M68859); dog
(Genbank accession number AF070485); and chicken (Genbank accession
number X13369). The spectrin-like repeats of the mouse dystrophin
gene were compared to the human gene (See FIG. 11) and were shown
to have significant homology. Similar comparisons can be generated
with homologs from other species, including but not limited to,
those described above, by using a variety of available computer
programs (e.g., BLAST, from NCBI). Candidate homologs can be
screened for biological activity using any suitable assay,
including, but not limited to, those described herein.
[0124] 2. Utrophin
[0125] In some embodiments, the spectrin-like repeats of the gene
constructs of the present invention are replaced with spectrin-like
repeats from another peptide (e.g., homologs of dystrophin). For
example, in some embodiments, spectrin-like repeats from the
utrophin protein (See e.g., Genbank accession number X69086; SEQ ID
NO:3; FIG. 3) are utilized. Utrophin is an autosomally-encoded
homolog of dystrophin and has been postulated that the proteins
play a similar physiological role (For a recent review, See e.g.,
Blake et al., Brain Pathology, 6:37 [1996]). Human utrophin shows
substantial homology to dystrophin, with the major difference
occurring in the rod domain, where utrophin lacks repeats 15 and 19
and two hinge regions (See e.g., Love et al., Nature 339:55 [1989];
Winder et al., FEBS Lett., 369:27 [1995]). Utrophin thus contains
22 spectrin-like repeats and two hinge regions. A comparison of the
rod domain of Utrophin and Dystrophin is shown in FIG. 38.
[0126] In addition, in some embodiments, spectrin-like repeats from
a homolog of utrophin are utilized. Homologs of utrophin have been
identified in a variety of organisms, including mouse (Genbank
accession number Y12229; SEQ ID NO:4; FIG. 4) and rat (Genbank
accession number AJ002967). The nucleic acid sequence of these or
additional homologs can be compared to the nucleic acid sequence of
human utrophin using any suitable methods, including, but not
limited to, those described above. Candidate spectrin-like repeats
from human utrophin or utrophin homologs can be screened for
biological activity using any suitable assay, including, but not
limited to, those described herein.
[0127] 3. Alpha-actinin
[0128] In some embodiments, spectrin-like repeats from Dystrophin
are replaced with spectrin-like repeats from alpha-actinin. The
microfilament protein alpha-actinin exists as a dimer. The
N-terminal regions of both polypeptides, arranged in antiparallel
orientation, comprise the actin-binding regions, while the
C-terminal, larger parts consist of four spectrin-like repeats that
interact to form a rod-like structure (See e.g., Winkler et al.,
Eur. J. Biochem., 248:193 [1997]). In some embodiments, human
alpha-actinin spectrin-like repeats are utilized (Genbank accession
number M86406; SEQ ID NO:87; FIG. 16). In other embodiments,
alpha-actinin homologs from other organisms are utilized (e.g.,
mouse (Genbank accession number AJ289242); Xenopus (Genbank
accession number BE576799), and rat (Genbank accession number
AFI90909).
[0129] B. Variants
[0130] Still other embodiments of the present invention provide
mutant or variant forms of spectrin-like repeats (i.e., muteins).
It is possible to modify the structure of a peptide having an
activity of spectrin-like repeats for such purposes as enhancing
therapeutic or prophylactic efficacy, or stability (e.g., ex vivo
shelf life, and/or resistance to proteolytic degradation in vivo).
Such modified peptides provide additional peptides having a desired
activity of the subject spectrin-like repeats as defined herein. A
modified peptide can be produced in which the amino acid sequence
has been altered, such as by amino acid substitution, deletion, or
addition.
[0131] Moreover, as described above, variant forms (e.g., mutants)
of the subject spectrin-like repeats are also contemplated as
finding use in the present invention. For example, it is
contemplated that an isolated replacement of a leucine with an
isoleucine or valine, an aspartate with a glutamate, a threonine
with a serine, or a similar replacement of an amino acid with a
structurally related amino acid (i.e., conservative mutations) will
not have a major effect on the biological activity of the resulting
molecule. Accordingly, some embodiments of the present invention
provide variants of spectrin-like repeats containing conservative
replacements. Conservative replacements are those that take place
within a family of amino acids that are related in their side
chains. Genetically encoded amino acids can be divided into four
families: (1) acidic (aspartate, glutamate); (2) basic (lysine,
arginine, histidine); (3) nonpolar (alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan); and
(4) uncharged polar (glycine, asparagine, glutamine, cysteine,
serine, threonine, tyrosine). Phenylalanine, tryptophan, and
tyrosine are sometimes classified jointly as aromatic amino acids.
In similar fashion, the amino acid repertoire can be grouped as (1)
acidic (aspartate, glutamate); (2) basic (lysine, arginine
histidine), (3) aliphatic (glycine, alanine, valine, leucine,
isoleucine, serine, threonine), with serine and threonine
optionally be grouped separately as aliphatic-hydroxyl; (4)
aromatic (phenylalanine, tyrosine, tryptophan); (5) amide
(asparagine, glutamine); and (6) sulfur-containing (cysteine and
methionine) (See e.g., Stryer (ed.), Biochemistry, 2nd ed, WH
Freeman and Co. [1981]). Whether a change in the amino acid
sequence of a peptide results in a functional homolog can be
readily determined by assessing the ability of the variant peptide
to function in a fashion similar to the wild-type protein. Peptides
in which more than one replacement has taken place can readily be
tested in the same manner.
[0132] The present invention further contemplates a method of
generating sets of combinatorial mutants of the present
spectrin-like repeats, as well as truncation mutants, and is
especially useful for identifying potential variant sequences
(i.e., homologs) that possess the biological activity of
spectrin-like repeats (e.g., a decrease in muscle necrosis). In
addition, screening such combinatorial libraries is used to
generate, for example, novel spectrin-like repeat homologs that
possess novel biological activities all together.
[0133] Therefore, in some embodiments of the present invention,
spectrin-like repeat homologs are engineered by the present method
to produce homologs with enhanced biological activity. In other
embodiments of the present invention, combinatorially-derived
homologs are generated which provide spectrin-like repeats that are
easier to express and transfer to host cells. Such spectrin-like
repeats, when expressed from recombinant DNA constructs, can be
used in therapeutic embodiments of the invention described
below.
[0134] Still other embodiments of the present invention provide
spectrin-like repeat homologs which have intracellular half-lives
dramatically different than the corresponding wild-type protein.
For example, the altered proteins comprising the spectrin-like
repeat homologs are rendered either more stable or less stable to
proteolytic degradation or other cellular process that result in
destruction of, or otherwise inactivate spectrin-like repeats. Such
homologs, and the genes that encode them, can be utilized to alter
the pharmaceutical activity of constructs expressing spectrin-like
repeats by modulating the half-life of the protein. For instance, a
short half-life can give rise to more transient biological effects.
As above, such proteins find use in pharmaceutical applications of
the present invention.
[0135] In some embodiments of the combinatorial mutagenesis
approach of the present invention, the amino acid sequences for a
population of spectrin-like repeat homologs are aligned, preferably
to promote the highest homology possible. Such a population of
variants can include, for example, spectrin-like repeat homologs
from one or more species, or spectrin-like repeat homologs from
different proteins of the same species (e.g., including, but not
limited to, those described above). Amino acids that appear at each
position of the aligned sequences are selected to create a
degenerate set of combinatorial sequences.
[0136] In a preferred embodiment of the present invention, the
combinatorial spectrin-like repeat library is produced by way of a
degenerate library of genes encoding a library of polypeptides that
each include at least a portion of candidate spectrin-like repeat
sequences. For example, a mixture of synthetic oligonucleotides is
enzymatically ligated into gene sequences such that the degenerate
set of candidate spectrin-like repeat sequences are expressible as
individual polypeptides, or alternatively, as a set of larger
fusion proteins (e.g., for phage display) containing the set of
spectrin-like repeat sequences therein.
[0137] There are many ways by which the library of potential
spectrin-like repeat homologs can be generated from a degenerate
oligonucleotide sequence. In some embodiments, chemical synthesis
of a degenerate gene sequence is carried out in an automatic DNA
synthesizer, and the synthetic genes are ligated into an
appropriate gene for expression. The purpose of a degenerate set of
genes is to provide, in one mixture, all of the sequences encoding
the desired set of potential spectrin-like repeat sequences. The
synthesis of degenerate oligonucleotides is well known in the art
(See e.g., Narang, Tetrahedron Lett., 39:3 9 [1983]; Itakura et
al., Recombinant DNA, in Walton (ed.), Proceedings of the 3rd
Cleveland Symposium on Macromolecules, Elsevier, Amsterdam, pp
273-289 [1981]; Itakura et al., Annu. Rev. Biochem., 53:323 [1984];
Itakura et al., Science 198:1056 [1984]; Ike et al., Nucl. Acid
Res., 11:477 [1983]). Such techniques have been employed in the
directed evolution of other proteins (See e.g., Scott et al.,
Science, 249:386-390 [1980]; Roberts et al., Proc. Natl. Acad. Sci.
USA, 89:2429-2433 [1992]; Devlin et al., Science, 249: 404-406
[1990]; Cwirla et al., Proc. Natl. Acad. Sci. USA, 87: 6378-6382
[1990]; as well as U.S. Pat. Nos. 5,223,409, 5,198,346, and
5,096,815, each of which is incorporated herein by reference).
[0138] A wide range of techniques are known in the art for
screening gene products of combinatorial libraries made by point
mutations, and for screening cDNA libraries for gene products
having a certain property. Such techniques are generally adaptable
for rapid screening of the gene libraries generated by the
combinatorial mutagenesis of spectrin-like repeat homologs. The
most widely used techniques for screening large gene libraries
typically comprise cloning the gene library into replicable
expression vectors, transforming appropriate cells with the
resulting library of vectors, and expressing the combinatorial
genes under conditions in which detection of a desired activity
facilitates relatively easy isolation of the vector encoding the
gene whose product was detected. Each of the illustrative assays
described below are amenable to high through-put analysis as
necessary to screen large numbers of degenerate sequences created
by combinatorial mutagenesis techniques.
[0139] Accordingly, in one embodiment of the present invention, the
candidate genes comprising altered spectrin-like repeats are
displayed on the surface of a cell or viral particle, and the
ability of particular cells or viral particles to bind to a another
member of the DPC complex (e.g., actin) is assayed. In other
embodiments of the present invention, the gene library is cloned
into the gene for a surface membrane protein of a bacterial cell,
and the resulting fusion protein detected by panning (WO 88/06630;
Fuchs et al., BioTechnol., 9:1370 [1991]; and Goward et al, TIBS
18:136 [1992]). In other embodiments of the present invention,
fluorescently labeled molecules that bind proteins comprising
spectrin like repeats (e.g., actin), can be used to score for
potentially functional spectrin-like repeat homologs. Cells are
visually inspected and separated under a fluorescence microscope,
or, where the morphology of the cell permits, separated by a
fluorescence-activated cell sorter.
[0140] In an alternate embodiment of the present invention, the
gene library is expressed as a fusion protein on the surface of a
viral particle. For example, foreign peptide sequences are
expressed on the surface of infectious phage in the filarnentous
phage system, thereby conferring two significant benefits. First,
since these phage can be applied to affinity matrices at very high
concentrations, a large number of phage can be screened at one
time. Second, since each infectious phage displays the
combinatorial gene product on its surface, if a particular phage is
recovered from an affinity matrix in low yield, the phage can be
amplified by another round of infection. The group of almost
identical E. coli filamentous phages M13, fd, and fl are most often
used in phage display libraries, as either of the phage gIII or
gVIII coat proteins can be used to generate fusion proteins without
disrupting the ultimate packaging of the viral particle (See e.g.,
WO 90/02909; WO 92/09690; Marks et al., J. Biol. Chem., 267:16007
[1992]; Griffths et al., EMBO J., 12:725 [1993]; Clackson et al.,
Nature, 352:624 [1991]; and Barbas et al., Proc. Natl. Acad. Sci.,
89:4457 [1992]).
[0141] In another embodiment of the present invention, the
recombinant phage antibody system (e.g., RPAS, Pharmacia Catalog
number 27-9400-01) is modified for use in expressing and screening
of spectrin-like repeat combinatorial libraries. The pCANTAB 5
phagemid of the RPAS kit contains the gene that encodes the phage
gIII coat protein. In some embodiments of the present invention,
the spectrin-like repeat combinatorial gene library is cloned into
the phagemid adjacent to the gIII signal sequence such that it is
expressed as a gIII fusion protein. In other embodiments of the
present invention, the phagemid is used to transform competent E.
coli TG1 cells after ligation. In still other embodiments of the
present invention, transformed cells are subsequently infected with
M13KO7 helper phage to rescue the phagemid and its candidate
spectrin-like repeat gene insert. The resulting recombinant phage
contain phagemid DNA encoding a specific candidate spectrin-like
repeat and display one or more copies of the corresponding fusion
coat protein. In some embodiments of the present invention, the
phage-displayed candidate proteins that are capable of, for
example, binding to actin, are selected or enriched by panning. The
bound phage is then isolated, and if the recombinant phage express
at least one copy of the wild type gIII coat protein, they will
retain their ability to infect E. coli. Thus, successive rounds of
reinfection of E. coli and panning will greatly enrich for
spectrin-like repeat homologs, which can then be screened for
further biological activities.
[0142] In light of the present disclosure, other forms of
mutagenesis generally applicable will be apparent to those skilled
in the art in addition to the aforementioned rational mutagenesis
based on conserved versus non-conserved residues. For example,
spectrin-like repeat homologs can be generated and screened using,
for example, alanine scanning mutagenesis and the like (Ruf et al.,
Biochem., 33:1565 [1994]; Wang et al., J. Biol. Chem., 269:3095
[1994]; Balint et al. Gene 137:109 [1993]; Grodberg et al., Eur. J.
Biochem., 218:597 [1993]; Nagashima et al., J. Biol. Chem.,
268:2888 [1993]; Lowman et al., Biochem., 30:10832 [1991]; and
Cunningham et al., Science, 244:1081 [1989]), by linker scanning
mutagenesis (Gustin el al., Virol., 193:653 [1993); Brown et al.,
Mol. Cell. Biol., 12:2644 [1992]; McKnight el al., Science,
232:316); or by saturation mutagenesis (Meyers el al., Science,
232:613 [1986]).
[0143] C. Truncations and Additions
[0144] In yet other embodiments of the present invention, the
spectrin-like repeats of human dystrophin are replaced by
truncation or additions of spectrin-like repeats from dystrophin or
another protein, including, but not limited to, those described
above. Accordingly, in some embodiments, amino acids are truncated
from either end of one or more of the spectrin-like repeats in a
given construct. The activity of truncation mutants is determined
using any suitable assay, including, but not limited to, those
disclosed herein.
[0145] In some embodiments, additional amino acids are added to
either or both ends of the spectrin-like repeats in a given
construct. In some embodiments, single amino acids are added and
the activity of the construct is determined. Amino acids may be
added to one or more of the spectrin-like repeats in a given
construct. The activity of spectrin-like repeats comprising
additional amino acids is determined using any suitable assay,
including, but not limited to, those disclosed herein.
[0146] III. Carboxy-Terminal Domain Truncated Dystrophin Genes
[0147] In some embodiments, the present invention provides
compositions comprising nucleic acid, wherein the nucleic acid
encodes a mini-dystrophin peptide, and wherein the mini-dystrophin
peptide comprises a substantially deleted dystrophin C-terminal
domain (e.g., 55% of the dystrophin C-terminal domain is missing).
In some embodiments, this type of truncation prevents the
mini-dystrophin peptide from binding both syntrophin and
dystrobrevin.
[0148] The dystrophin COOH-terminal domain is located adjacent to
the cysteine-rich domain, and contains an alternatively spliced
region and two coiled-coil motifs (Blake et al., Trends Biochem.
Sci., 20:133, 1995). The alternatively spliced region binds three
isoforms of syntrophin in muscle, while the coiled-coil motifs bind
numerous members of the dystrobrevin family (Sadoulet-Puccio et
al., PNAS, 94:12413, 1997). The dystrobrevins display significant
homology with the COOH-terminal region of dystrophin, and the
larger dystrobrevin isoforms also bind to the syntrophins. The
importance and functional significance of syntrophin and
dystrobrevin remains largely unknown, although they may be involved
in cell signaling pathways (Grady et al., Nat. Cell. Biol, 1:215,
1999).
[0149] Researchers have previously generated transgenic mdx mouse
strains expressing dystrophins deleted for either the syntrophin or
the dystrobrevin binding domain (Rafael et al., Hum. Mol. Genet.,
3:1725, 1994; and Rafael et al., J. Cell Biol., 134:93 1996). These
mice displayed normal muscle function and essentially normal
localization of syntrophin, dystrobrevin, and nNOS. Thus, while
dystrobrevin appears to protect muscle from damage (Grady et al.,
Nat. Cell. Biol, 1:215, 1999), removal of the dystrobrevin binding
site from dystrophin does not result in a dystrophy. Subsequent
studies revealed that syntrophin and dystrobrevin bind each other
in addition to dystrophin, so that removal of only one of the two
binding sites on dystrophin might not sever the link between
dystrophin, syntrophin and dystrobrevin. Surprisingly, the
transgenic mice according to the present invention (See Example 1)
displayed normal muscle function even though they lacked both the
syntrophin and dystrobrevin binding sites.
[0150] IV. MCK Regulatory Regions
[0151] In certain embodiments, nucleic acid encoding
mini-dystrophin peptides of the present invention are operably
linked to muscle creatine kinase gene (MCK) regulatory regions and
control elements, as well as mutated from of these regions and
elements (see See U.S. Provisional App. Ser. No. 60/218,436, filed
Jul. 14, 2000, and International Application PCT/US01/22092, filed
Jul. 13, 2001, both of which are hereby incorporated by reference).
In some embodiments, the nucleic acid encoding mini-dystrophin
peptides is operably linked to these sequences to provide muscle
specificity and reduced size such that the resulting construct is
able to fit into, for example, a viral vector (e.g.
adeno-associated virus). MCK gene regulatory regions (e.g.
promoters and enhancers) display striated muscle-specific activity
and have been characterized in vitro and in vivo. The major known
regulatory regions in the mouse MCK gene include a 206 base pair
muscle-specific enhancer located approximately 1.1 kb 5' of the
transcription start site in mouse (i.e. SEQ ID NO:87) and a 358
base pair proximal promoter (i.e. SEQ ID NO:93) [Shield, et al,
Mol. Cell. Biol., 16:5058 (1996)]. A larger MCK promoter region may
also be employed (e.g. SEQ ID NO:92), as well as smaller MCK
promoter regions (e.g. SEQ ID NO:94).
[0152] The 206 base pair MCK enhancer (SEQ ID NO:87) contains a
number of sequence motifs, including two classes of E-boxes (MCK-L
and MCK-R), CarG, and AT-rich sites. Similar E-box sequences are
found in the enhancers of the human, rat, and rabbit MCK genes
[See, Trask, et al., Nucleic Acids Res., 20:2313 (1 992)]. Mutation
may be made to this sequence by, for example, inserting an
additional MCK-R control element into a wild-type enhancer sequence
naturally containing one MCK-R control element (such that the
resulting sequence has at least two MCK-R control elements). For
example, the inserted MCK-R control element replaces the endogenous
MCK-L control element. The 206 base pair mouse enhancer (SEQ ID
NO:2) may be modified by replacing the left E-box (MCK-L) with a
right E-Box (MCK-R) to generate a mutant muscle-specific enhancer
region (e.g. to generate SEQ ID NO:88). A similar approximately 200
base pair wild type enhancer region in human may be modified by
replacing the left E-box with a MCK-R to generate a mutant
muscle-specific enhancer region (e.g. 2R human enhancer
regions).
[0153] Another modification that may be made to generate mutant
muscle-specific enhancer regions by inserting the S5 sequence
GAGCGGTTA (SEQ ID NO:95) into wild type mouse, human, and rat
enhancer sequence. Making such a modification to the mouse enhancer
SEQ ID NO:87, for example, generates S5 mutant muscle-specific
enhancer regions (e.g. SEQ ID NO:89). Another modification that may
be made, for example, to the wild type mouse enhancer is replacing
the left E-box (MCK-L) with a right E-Box (MCK-R), and also
inserting the 5S sequence, to generate 2R5S type sequences (e.g. in
mouse, SEQ ID NO:90). These mutant muscle-specific enhancer regions
may have additional sequences added to them or sequences that are
taken away. For example, the mutant muscle-specific enhancer
regions may have a portion of the sequence removed (e.g. the 3' 41
base pairs). Examples of such mutant truncation 2RS5 sequences in
mouse is SEQ ID NO:91 with the 3' 41 base pairs removed, generating
mutant truncated 2RS5 muscle-specific enhancer regions.
[0154] Any of these wild-type or mutant muscle-specific enhancer
regions described above may be further modified to produce
additional mutants. These additional mutants include, but are not
limited to, muscle-specific enhancer regions having deletions,
insertions or substitutions of different riucleotides or nucleotide
analogs so long as the transcriptional activity of the enhancer
region is maintained. Guidance in determining which and how many
nucleotide bases may be substituted, inserted or deleted without
abolishing the transcriptional activity may be found using computer
programs well known in the art, for example, DNAStar software or
GCG (Univ. of Wisconsin) or may be determined empirically using
assays provided by the present invention.
[0155] V. Expression Vectors
[0156] The present invention contemplates the use of expression
vectors with the compositions and methods of the present invention
(e.g. with the nucleic acid constructs encoding the mini-dystrophin
peptides). Vectors suitable for use with the methods and
compositions of the present invention, for example, should be able
to adequately package and carry the compositions and cassettes
described herein. A number of suitable vectors are known in the art
including, but are not limited to, the following: 1) Adenoviral
Vectors; 2) Second Generation Adenoviral Vectors; 3) Gutted
Adenoviral Vectors; 4) Adeno-Associated Virus Vectors; and 5)
Lentiviral Vectors.
[0157] Those skilled in the art will recognize and appreciate that
other vectors are suitable for use with methods and compositions of
the present invention. Indeed, the present invention is not
intended to be limited to the use of the recited vectors, as such,
alternative means for delivering the compositions of the present
invention are contemplated. For example, in various embodiments,
the compositions of the present invention are associated with
retrovirus vectors and herpes virus vectors, plasmids, cosmids,
artificial yeast chromosomes, mechanical, electrical, and chemical
transfection methods, and the like. Exemplary delivery approaches
are discussed below.
[0158] 1. Adenoviral Vectors
[0159] Self-propagating adenovirus (Ad) vectors have been
extensively utilized to deliver foreign genes to a great variety of
cell types in vitro and in vivo. "Self-propagating viruses" are
those which can be produced by transfection of a single piece of
DNA (the recombinant viral genome) into a single packaging cell
line to produce infectious virus; self-propagating viruses do not
require the use of helper virus for propagation. As with many
vectors, adenoviral vectors have limitations on the amount of
heterologous nucleic acid they are capable of delivering to cells.
For example, the capacity of adenovirus is approximately 8-10 kb,
the capacity of adeno-associated virus is approximately 4.8 kb, and
the capacity of lentivirus is approximately 8.9 kb. Thus, the
mutants of the present invention that provide shorter nucleic acid
sequences encoding the mini-dystrophin peptides (compared to full
length wild-type dystrophin (14 kb)), improve the carrying capacity
of such vectors.
[0160] 2. Second Generation Adenoviral Vectors
[0161] In an effort to address the viral replication problems
associated with first generation Ad vectors, so called "second
generation" Ad vectors have been developed. Second generation Ad
vectors delete the early regions of the Ad genome (E2A, E2B, and
E4). Highly modified second generation Ad vectors are less likely
to generate replication-competent virus during large-scale vector
preparation, and complete inhabitation of Ad genome replication
should abolish late gene replication. Host immune response against
late viral proteins is thus reduced [See Amalfitano ei al.,
"Production and Characterization of Improved Adenovirus Vectors
With the E1, E2b, and E3 Genes Deleted," J. Virol. 72:926-933
(1998)]. The elimination of E2A, E2B, and E4 genes from the Ad
genome also provide increased cloning capacity. The deletion of two
or more of these genes from the Ad genome allows for example, the
delivery of full length or cDNA dystrophin genes via Ad vectors
[Kumar-Singh et al, Hum. Mol. Genet., 5:913 (1996)].
[0162] 3. Gutted Adenoviral Vectors
[0163] "Gutted," or helper dependent, Ad vectors contain cis-acting
DNA sequences that direct adenoviral replication and packaging but
do not contain viral coding sequences [See Fisher et al.
"Recombinant Adenovirus Deleted of All Viral Genes for Gene Therapy
of Cystic Fibrosis," Virology 217:11-22 (1996) and Kochanek et al.
"A New Adenoviral Vector: Replacement of All Viral Coding Sequences
With 28 kb of DNA Independently Expressing Both Full-length
Dystrophin and Beta-galactosidase" Proc. Nal. Acad. Sci. USA
93:5731-5736 (1996)]. Gutted vectors are defective viruses produced
by replication in the presence of a helper virus, which provides
all of the necessary viral proteins in trans. Since gutted vectors
do not contain any viral genes, expression of viral proteins is not
possible.
[0164] Recent developments have advanced the field of gutted vector
production [See Hardy et al., "Construction of Adenovirus Vectors
Through Cre-lox Recombination," J. Virol. 71:1842-1849 (1997) and
Hartigan-O'Conner et al., "Improved Production of Gutted Adenovirus
in Cells Expressing Adenovirus Preterminal Protein and DNA
Polymerase," J. Virol. 73:7835-7841 (1999)]. Gutted Ad vectors are
able to maximally accommodate up to about 37 kb of exogenous DNA,
however, 28-30 kb is more typical. For example, a gutted Ad vector
can accommodate the full length dystrophin or cDNA, but also
expression cassettes or modulator proteins.
[0165] 4. Adeno-Associated Virus Vectors
[0166] In preferred embodiments, the nucleic acid encoding the
mini-dystrophin peptides of the present invention are inserted in
adeno-associated vectors (AAV vectors). AAV vectors evade a host's
immune response and achieve persistent gene expression through
avoidance of the antigenic presentation by the host's professional
APCs such as dendritic cells. Most AAV genomes in muscle tissue are
present in the form of large circular multimers. AAV's are only
able to carry about 5 kb of exogenous DNA. As such, the nucleic
acid of the present invention encoding the mini-dystrophin peptides
is well suited, in some embodiments, for insertion into these
vectors due the reduced size of the nucleic acid sequences.
[0167] The dystrophin expression cassettes of the present invention
(containing nucleic acid encoding mini-dystrophin peptides) may be
cloned into any of a variety of cis-acting plasmid vectors that
contain the adeno-associated virus inverted terminal repeats (ITRs)
to allow production of infectious virus. For example, one such
plasmid is the cis-acting plasmid (pCisAV) (Yan et al., PNAS,
97:6716-6721, 2000). This plasmid contains the AAV-ITRs separated
by a NotI cloning site. The ITR elements were derived from pSub201,
a recombinant plasmid from which an infectious adeno-associated
virus genome can be excised in vitro and used to study viral
replication. After ligation of the dystrophin expression cassette
(isolated as a NotI fragment from pCK6DysR4-23-71-78An) into
NotI-digested pCisAV, rAAV stocks are generated by cotransfection
of pCisAV. CK6DysR4-23-71-78An and pRep/Cap (Fisher, et al., J.
Virol. 70:520-532, 1996) together with coinfection of the
recombinant adenovirus Ad.CMVlacZ into 293 cells. Recombinant AAV
vector, for example, may then be purified on CsCl gradients as
described (Duan, et al., Virus Res. 48:41-56, 1997).
[0168] 5. Lentiviral Vectors
[0169] Vectors based on human or feline lentiviruses have emerged
as another vector useful for gene therapy applications.
Lentivirus-based vectors infect nondividing cells as part of their
normal life cycles, and are produced by expression of a
package-able vector construct in a cell line that expresses viral
proteins. The small size of lentiviral particles constrains the
amount of exogenous DNA they are able to carry to about 10 kb.
However, once again, the small size nucleic acid encoding the
mini-dystrophin peptides of the present invention allow such
vectors to be employed.
[0170] 6. Retroviruses
[0171] Vectors based on Moloney murine leukemia viruses (MMLV) and
other retroviruses have emerged as useful for gene therapy
applications. These vectors stably transduce actively dividing
cells as part of their normal life cycles, and integrate into host
cell chromosomes. Retroviruses may be employed with the
compositions of the present invention (e.g. gene therapy), for
example, in the context of infection and transduction of muscle
precursor cells such as myoblasts, satellite cells, or other muscle
stem cells.
[0172] Experimental
[0173] The following examples are provided in order to demonstrate
and further illustrate certain preferred embodiments and aspects of
the present invention and are not to be construed as limiting the
scope thereof.
[0174] In the experimental disclosure which follows, the following
abbreviations apply: N (normal); M (molar); mM (millimolar); .mu.M
(micromolar); mol (moles); mmol (millimoles); .mu.mol (micromoles);
nmol (nanomoles); pmol (picomoles); g (grams); mg (milligrams);
.mu.g (micrograms); ng (nanograms); l or L (liters); ml
(milliliters); .mu.l (microliters); cm (centimeters); mm
(millimeters); .mu.m (micrometers); nm (nanometers); .degree. C.
(degrees Centigrade); and Sigma (Sigma Chemical Co., St. Louis,
Mo.).
EXAMPLE 1
Carboxy-Terminal Domain Truncated Dystrophin Genes
[0175] This example describes the generation of carboxy-terminal
truncated dystrophin nucleic acid sequences. In particular, this
examples describes the construction of dystrophin nucleic acid
sequence with the entire carboxy-terminal domain deleted, and
testing of this sequence in a mouse model for DMD.
[0176] A. Methods
[0177] The bases encoding amino acids 3402-3675 (corresponding to
exons 71-78) were deleted from the full length murine dystrophin
cDNA (SEQ ID NO:2, accession No. M68859) by recombinant PCR,
leaving the last three amino acids (exon 79) of the dystrophin
protein unaltered. This dystrophin .DELTA.71-78 cDNA was cloned
into an expression vector containing bases -2139 to +239 of the
human -skeletal actin (HSA) promoter (Brennan, el al., J. Biol.
Chem. 268:719, 1993). A splice acceptor from the SV40 VP1 intron
(isolated as a 400 bp HindIII/XbaI fragment from pSVL; Amersham
Pharmacia Biotech) was inserted immediately 3' of the HSA fragment,
and the SV40 polyadenylation signal (isolated as a BamHI fragment
from pCMV.beta.; MacGregor and Caskey, Nuc. Acid. Res., 17:2365,
1989) was inserted 3' of the dystrophin cDNA. The excised
dystrophin .DELTA.71-78 expression cassette was injected into
wild-type C57B1/10.times.SJL/J F2 hybrid embryos, and F.sub.o mice
were screened by PCR. Five positive F.sub.o's were backcrossed onto
the C57B1/10mdx background, and the line with the most uniform
expression levels was selected for analysis. Also employed were
previously described transgenic mdx mice that express dystrophin
constructs deleted approximately for exons 71-74 (.DELTA.71-74) or
exons 75-78 (.DELTA.75-78), which remove amino acids 3402-3511 and
3528-3675, respectively, See Rafael et al., J. Cell Biol.,
134:93-102, 1996). Transgenic mdx line Dp71 expresses the Dp71
isoform of dystrophin in striated muscle (Cox et al., Nat. Genet.,
8:333-339, 1994).
[0178] i. Morphology Methods
[0179] Quadriceps, soleus, extensor digitorum longus (EDL),
tibialis anterior, and diaphragm muscles were removed from the
mice, frozen in liquid nitrogen cooled O.C.T. embedding medium
(Tissue-Tek), and cut into 7-.mu.m sections. After fixing in 3.7%
formaldehyde, sections were stained in hematoxylin and
eosin-phloxine. Stained sections were imaged with a Nikon E1000
microscope connected to a Spot-2 CCD camera. To determine the
percentage of fibers containing central nuclei, the number of
muscle fibers with centrally-located nuclei was divided by the
total number of muscle fibers.
[0180] ii. Evans Blue Assays
[0181] 4 month old control mice and .DELTA.71-78 mice were analyzed
after injection with Evans blue, as described previously (Straub et
al., J. Cell. Biol., 139:375-385, 1997). In brief, mice were tail
vein-injected with 150 .mu.l of a solution containing 10 mg/ml
Evans blue dye in PBS (150 mM NaCl, 50 mM Tris, pH 7.4). After 3
hours, the animals were euthanized and mouse tissues were either
fixed in 3.7% formaldehyde/0.5% glutaraldehyde to observe gross dye
uptake, or frozen unfixed in O.C.T. embedding medium. To examine
Evans blue uptake by individual fibers, 7-.mu.m-thick frozen
sections were fixed in cold acetone and analyzed by fluorescence
microscopy.
[0182] iii. Immunofluorescence Assays
[0183] Quadriceps and diaphragm muscles from C57B1/10, mdx, and
.DELTA.71-78 mice were removed, frozen in O.C.T. embedding medium,
and cut into 7-.mu.m sections. Immunofluorescence was performed
with previously described antibodies against dystrophin (NH.sub.2
terminus), .alpha.1-syntrophin (SYN17), .beta.1-syntrophin,
.alpha.-dystrobrevin-1 (DB670), .alpha.-dystrobrevin-2 (DB2), and
utrophin. After incubation with primary antibodies, cryosections
were incubated with an FITC-conjugated goat anti-rabbit secondary
antibody and fluorescent images were viewed on a Nikon E1000
microscope. Antibodies to .alpha.-sarcoglycan (Rabbit 98),
.beta.-sarcoglycan (Goat 26), .gamma.-sarcoglycan (Rabbit 245),
.delta.-sarcoglycan (Rabbit 215), sarcospan (Rabbit 235),
.alpha.-dystroglycan (Goat 20), .beta.-dystroglycan (AP 83), or
nNOS (Rabbit 200) have been described previously (Duclos el al., J.
Cell. Biol., 142:1461, 1998). Cy3-conjugated secondary antibodies
were used and images were viewed on a Bio-Rad MRC-600 laser
scanning confocal microscope. All digitized images were captured
under the same conditions.
[0184] iv. Measurements of Contractile Properties Methods
[0185] Contractile properties of muscles from 6-month-old
.DELTA.71-78 transgenic mice were compared with those of C57B1/10
wild-type and mdx mice using methods described previously (Lynch et
al., Am. J. Physiol., 272:C2063, 1997). The samples included eight
muscles each from the EDL, soleus, and diaphragm. Mice were deeply
anesthetized with avertin and each muscle was isolated and
dissected free from the mouse. After removal of the limb muscles,
the mice were euthanized with the removal of the diaphragm muscle.
The muscles were immersed in a bath filled with oxygenated buffered
mammalian Ringer's solution (137 mM NaCl, 24 mM NaHCO.sub.3, 11 mM
glucose, 5 mM KCl, 2 mM CaCl.sub.2, 1 mM MgSO.sub.4, 1 mM
NaH.sub.2PO.sub.4, and 0.025 mM tubocurarine chloride, pH 7.4). For
each muscle, one tendon was tied to a servomotor and the other
tendon to a force transducer. Muscles were stretched from slack
length to the optimal length for force development and then
stimulated at a frequency that produced absolute isometric tetanic
force (mN). After the measurements of the contractile properties,
the muscles were removed from the bath, blotted and weighed to
determine muscle mass. Specific force (kN/m.sup.2) was calculated
by dividing absolute force by total fiber cross sectional area.
[0186] v. Muscle Membrane Isolation Methods
[0187] Muscle microsomes from 12-14 month-old C57B1/10, mdx,
.DELTA.71-78, .DELTA.71-74, .DELTA.75-78, and Dp71 mice were
prepared as described previously (Ohlendieck et al., J. Cell.
Biol., 112:135, 1991). In brief, skeletal muscle was homogenized in
7.5-vol homogenization buffer plus protease inhibitor Complete
(Boehringer). The homogenate was centrifuged at 14,000 g for 15 min
to remove cellular debris. The supernatant was filtered through
cheesecloth and spun at 142,000 g for 37 minutes to collect
microsomes. The microsome pellet was resuspended in KCl wash buffer
(0.6 M KCl, 0.3 M sucrose, 50 mM Tris-HCl, pH 7.4) plus protease
inhibitors and recentrifuged at 142,000 g for 37 minutes to obtain
KCl-washed microsomes. The final pellet was resuspended in 0.3 M
sucrose and 20 mM Tris-maleate, pH 7.0. Samples were quantified by
the Coomassie Plus Protein Assay Reagent (Pierce Chemical Co.) and
equivalent protein loading was verified by SDS-PAGE. KCl-washed
microsomes were analyzed by Western blot using antibodies against
.beta.2-syntrophin, pan syntrophin, nNOS (Transduction
Laboratories), .beta.-dystroglycan, .alpha.-sarcoglycan (Novocastra
Laboratories), and other proteins described above.
[0188] B. Results
[0189] i. Generation of Dystrophin .DELTA.71-78 Transgenic Mice
[0190] To test the function of a dystrophin protein lacking both
the syntrophin and dystrobrevin binding sites, we prepared a cDNA
expression vector deleted for the COOH-terminal domain
(corresponding to exons 71-78; See FIG. 19) as described above. The
structure of several dystrophin transgenic constructs previously
tested are also shown for comparison. Mice expressing the
dystrophin .DELTA.71-78 transgene were crossed onto the mdx
background and dystrophin levels were analyzed by Western blotting.
The expression of the dystrophin .DELTA.71-78 transgene in skeletal
muscle was determined to be 10-fold higher than endogenous
dystrophin. Immunofluorescent staining of quadriceps muscle using
an antibody against the NH.sub.2-terminus of dystrophin revealed
that the .DELTA.71-78 protein was localized to the sarcolemma,
similar to wild-type dystrophin. Dystrophin .DELTA.71-78 expression
was also found to be uniform in the diaphragm, EDL, and soleus
muscles, but the tibialis anterior muscle displayed a mosaic
expression pattern. The human skeletal muscle -actin promoter used
in this study was not expressed in either smooth or cardiac
muscle.
[0191] ii. Morphology of Dystrophin .DELTA.71-78 Mice Appears
Normal
[0192] We initially analyzed transgenic mdx mouse muscle tissues
for morphological signs of dystrophy. Hematoxylin and eosin-stained
limb and diaphragm skeletal muscle sections of dystrophin
.DELTA.71-78 mice revealed none of the signs of fibrosis, necrotic
fibers, or mononuclear cell infiltration that were apparent in
age-matched mdx controls. NMJs (neuromuscular junctions) of
transgenic mice stained with rhodamine-labeled-bungarotoxin
consistently appeared normal in contrast to the varying degrees of
postsynaptic folding observed in mdx NMJs. Mdx muscle fibers have
previously been shown to be highly permeable to the vital dye Evans
blue in vivo, reflecting damage to the dystrophic fiber sarcolemma
(Matsuda et al, J. Biochem. (Tokyo), 118:959, 1995). Skeletal
muscle fibers from dystrophin .DELTA.71-78 mice, like wild-type
animals, were found not to be permeable to Evans blue dye.
[0193] iii. Analysis of Centrally Nucleated Muscle Fibers
[0194] Another hallmark of dystrophy in mdx mice is the presence of
large numbers of centrally-nucleated muscle fibers, reflecting
cycles of fiber degeneration and regeneration (Torres and Duchen,
Brain, 110:269, 1987). To estimate the degree of myofiber
regeneration occurring in .DELTA.71-78 transgenic mice, centrally
nucleated fibers were counted from a variety of muscle groups in
age-matched wild-type, mdx, and .DELTA.71-78 mice (See, Table 2).
By 4 months of age, 71% of muscle fibers in mdx quadriceps muscles
contained central nuclei, whereas wild-type muscles had <1%.
Interestingly, 4 month old dystrophin .DELTA.71-78 quadriceps
muscles displayed 1% central nuclei, indicating that very little,
if any, regeneration was occurring. When 1-year-old mice were
compared, a modest increase in centrally nucleated fibers became
apparent. Quadriceps muscles from .DELTA.71-78 mice contained 10%
centrally nucleated fibers, although diaphragm muscles still
displayed <1%. EDL and soleus muscles displayed 5 and 8%
centrally nucleated fibers, respectively. For comparison,
1-year-old wild-type mice had <1% centrally nucleated fibers in
both limb and diaphragm muscles. Furthermore, 1-year-old mdx limb
muscles had 60% centrally nucleated fibers, whereas the diaphragm
had 35%.
2TABLE 2 Percentage of Centrally Nucleated Fibers in Mouse Skeletal
Muscles Line Age Quad Dia TA EDL Soleus C57/B110 4 <1 <1 ND
ND ND mdx 4 71 58 ND ND ND .DELTA.71-78 4 1 <1 ND ND ND C57/B110
12 <1 <1 <1 <1 <1 mdx 12 65 35 58 50 61 .DELTA.71-78
12 10 <1 ND 5 8 .DELTA.71-74 15 5 <1 <1 <1 ND
.DELTA.75-78 15 8 <1 4 2 7 Quad = quadriceps; Dia = diaphragm;
TA = tibialis anterior; Age is in months
[0195] Previous studies of transgenic mice expressing dystrophins
deleted for exons .DELTA.71-74 (.DELTA.71-74) or exons .DELTA.75-78
(.DELTA.75-78) revealed no increase in the numbers of centrally
nucleated fibers by 4 months of age (Rafael et al. 1996, see
above). To contrast these mice with the 71-78 transgenics, central
nuclei counts were performed on 15-month-old .DELTA.71-74 and 75-78
mice. It was determined that these animals had central nuclei
counts in between those of wild-type and .DELTA.71-78 mice. The
.DELTA.71-74 and .DELTA.75-78 mice had 5 and 8% centrally nucleated
fibers in quadriceps, respectively (Table 2).
[0196] iv. Contractile Properties
[0197] Compared with muscles of wild-type mice, those from mdx mice
displayed a significant amount of necrosis, fibrosis, and
infiltrating mononuclear cells. mdx skeletal muscles also displayed
a loss of specific force-generating capacities when muscles were
stimulated to contract in vitro, providing an extremely sensitive
and quantitative measurement of the dystrophic process (FIG. 20A).
In contrast, dystrophin .DELTA.71-78 mice had no major
abnormalities when subjected to the same analysis (FIG. 20 B).
Muscle mass for both EDL and diaphragm were not significantly
different between dystrophin .DELTA.71-78 and wild-type mice,
whereas dystrophin .DELTA.71-78 soleus muscles were slightly
hypertrophied. When stimulated to contract, all three muscle groups
displayed specific forces not significantly different from
wild-type (P<0.05). These results demonstrate that the
dystrophin .DELTA.71-78 protein has essentially the same functional
capacity as the full-length protein.
[0198] v. Localization of the DAP Complex in .DELTA.71-78 Mice
[0199] Immunofluorescent analysis of the peripheral DAP complex
revealed .alpha.1-syntrophin, .beta.1-syntrophin,
.alpha.-dystrobrevin-1, and .alpha.-dystrobrevin-2 to be localized
at the sarcolemma with dystrophin, despite the lack of syntrophin
and dystrobrevin binding sites in the transgene-encoded dystrophin.
.alpha.1-syntrophin levels were similar between wild-type and
.DELTA.71-78 mice. However, the levels of .beta.1-syntrophin were
elevated at the membrane in .DELTA.71-78 mice, particularly in
those fibers that normally express significant levels of this
isoform. .alpha.-dystrobrevin-1 was primarily located at the NMJ in
wild-type mice, and was exclusively located at the NMJs in mdx
mice. Surprisingly, in dystrophin .DELTA.71-78 mice, higher levels
of .alpha.-dystrobrevin-1 were observed at the sarcolemma than in
wild-type mice. The .DELTA.71-78 mice also displayed a slight
increase in utrophin localization along the sarcolemma, but this
increase was less than the increase in mdx fibers.
Immunofluorescent localization of the sarcoglycans, .alpha.- and
.beta.-dystroglycan, sarcospan, and nNOS in .DELTA.71-78 mice
revealed no differences in the expression of these proteins when
compared with wild-type mice. The proper localization of these
proteins to the sarcolemma indicated that membrane targeting of the
DAP complex components can proceed in the absence of the
COOH-terminal domain of dystrophin.
[0200] vi. DAP Complex Protein Levels
[0201] To examine the levels of the DAP complex members that
associate with dystrophin, muscle microsomes were prepared from
wild-type and dystrophin .DELTA.71-78 mice and analyzed by Western
blotting. This approach provides information on the relative
abundance of individual DAP complex members in muscles of separate
lines of mice. Slightly elevated levels of .beta.-dystroglycan were
detected in dystrophin .DELTA.71-78 mice, which we have previously
observed whenever dystrophin is overexpressed. Isoforms of
syntrophin and dystrobrevin were present at slightly different
levels when the dystrophin .DELTA.71-78 membranes were compared
with those from wild-type mice. .alpha.1-syntrophin and
.beta.2-syntrophin levels were lower than in wild-type mice,
whereas the level of .beta.1-syntrophin was elevated. Although
there was approximately the same amount of .alpha.-dystrobrevin-2,
there were elevated levels of .alpha.-dystrobrevin-1 in
.DELTA.71-78 microsomes. A reduction in nNOS was observed in
dystrophin .DELTA.71-78 muscle, indicating that nNOS binds weakly
to the DAP complex in .DELTA.71-78 mice. Levels of a-sarcoglycan
were similar in all lines tested, and provided an internal control
for protein loading.
[0202] Since some DAP complex members exhibited isoform changes in
.DELTA.71-78 mice, we examined purified microsomes from dystrophin
.DELTA.71-74 and .DELTA.75-78 mice. Transgenic mdx mice that
express the dystrophin isoform Dp71 in muscle were also included in
this study since these dystrophic mice have the DAP complex present
at the sarcolemma. .alpha.1-syntrophin levels were lower in all
four transgenic lines compared with wild-type mice. Surprisingly,
.beta.1-syntrophin was absent in .DELTA.71-74 microsomes but was
highly overexpressed in .DELTA.75-78 and Dp71 microsomes. The
.DELTA.71-74 microsomes had equivalent .beta.2-syntrophin levels
when compared with wild-type microsomes, but this isoform of
syntrophin was reduced in both .DELTA.75-78 and Dp71 microsomes. A
pan syntrophin antibody, which detects all three isoforms of
syntrophin, confirmed the upregulation of syntrophin in
.DELTA.75-78 and Dp71 microsomes. Similar to .DELTA.71-78,
.alpha.-dystrobrevin-1 was elevated in all dystrophin transgenic
microsome preparations. However, in comparison with wild-type,
.alpha.-dystrobrevin-2 was higher in .DELTA.71-74 and .DELTA.75-78,
but equal in Dp71 microsomes. Contrary to the .DELTA.71-78 mice,
deleting either exons 71-74 or 75-78 restored nNOS to wild-type
levels. However, Dp71 mice, which lack the NH.sub.2-terminal and
rod domains of dystrophin, did not retain nNOS in the microsome
fractions. Previous studies have also shown that utrophin is
upregulated in mdx and Dp71 mice (Ohlendieck et al., Neuron,
7:499-508, 1991). Therefore, utrophin levels were compared in all
transgenic lines and we found that .DELTA.71-78, .DELTA.71-74, and
.DELTA.75-78 mice do not have the elevated levels seen in mdx and
Dp71 mice.
EXAMPLE 2
Construction of .DELTA.R4-R23, .DELTA.R2-R21+H3, and
.DELTA.R2-R1
[0203] This example describes the construction of R4-R23
(micro-dys1), .DELTA.R2-R21+H3 (micro-dys3), and .DELTA.R2-R1
(micro-dys2), three sequences with 4 spectrin-like repeat encoding
sequences. The `full-length` human dystrophin cDNA that was started
with was actually a sequence slightly smaller than the true
full-length human dystrophin cDNA. In particular, the starting
sequence, called full-length HDMD (SEQ ID NO:47, see FIG. 23) is
the same as the wild-type human dystrophin in SEQ ID NO:1, except
the 3' 1861 base pairs are deleted (at an XbaI site), and the 39
base pair alternatively spliced exon 71 (bases 10432-10470) are
deleted. This sequence (SEQ ID NO:47) is originally in pBSX (SEQ ID
NO:46, See FIGS. 21 and 22).
[0204] A. Cloning .DELTA.R4-R23
[0205] The procedure used for cloning .DELTA.R4-R23 is outlined in
FIG. 24. Initially, three PCR reactions were performed (employing
Pfu polymerase) to create the deletion shown in FIG. 24. The
primers employed in the first reaction were 5' GAA CAA GAT TCA CAC
AAC TGG C 3' (SEQ ID NO:48), which anneals to 1954-1975 of the HDMD
clone, and 5' GTT CCT GGA GTC TTT CAA GAT CCA CAG TAA TCT GCC TC 3'
(SEQ ID NO:49), which is a reversed, tailed primer (the bold
sequence anneals to 2359-2341 of the HDMD clone, and the underlined
sequence anneals to 9023-9005 the HDMD clone. PCR was conducted
employing these primers, and a 425 bp PCR product was produced. The
first primer employed in the second reaction was 5' GAG GCA GAT TAC
TGT GGA TCT TGA AAG ACT CCA GGA AC 3' (SEQ ID NO:50), which is the
reverse complement primer of SEQ ID NO:49 (the bold-faced sequence
of SEQ ID NO:50) anneals to 234!-2359 of the HDMD clone in the
forward direction. The underlined sequence anneals to 9005-9023 of
the HDMD clone in the forward direction. The other primer employed
for the second reaction was 5' TGT TTG GCG AGA TGG CTC 3' (SEQ ID
NO:51) which anneals to 9413-9396 of HDMD in the reverse direction.
PCR was conducted employing these primers, and a 427 bp PCR product
was produced. The third reaction employed the products from steps 1
and 2 and the outside primers SEQ ID NO:48 and SEQ ID NO:51,
producing a 814 bp fragment by PCR. This fragment was then digested
with NcoI and HindIII to produce a 581 bp DNA fragment.
[0206] This 581 bp fragment was then cloned into a 5016 bp
NcoI+Hind III fragment from the HDMD clone. The 581 bp fragment
contained part of repeat 3, all of Hinge 2, and part of repeat 24.
The NcoI site used in the HDMD clone was located at 2055 bp. The
Hind III site was located at 9281 bp. The 5016 fragment contained
the pBSX cloning vector sequence, and the entire 5' UTR, the entire
N terminus, Hinge 1, Repeats 1, 2, and part of repeat 3 up to the
Ncol site of human dstrophin. Ligation of the 5016 bp fragment and
581 bp fragment (step 2) was then performed to created a 5597 bp
sequence.
[0207] Step 3 was then performed to clone a 2.9 kb HindIII fragment
containing part of repeat 24, the C terminus, and the 3' UTR (See
FIG. 24). The 5' HindIII site is located at 9281 bp of the HDMD
clone. The 3' HindIII site of this fragment is derived from pBSX
polylinker. This 2.9 kb fragment was cloned into the HindIII site
of the product of Step 2 to yield an 8.5 kb plasmid, composed of
the .DELTA.R4-R23 cDNA plus pBSX. The entire .DELTA.R4-R23 cDNA was
excised from pBSX with NotI and cloned into the NotI site of the
HSA expression vector (HSA promoter-VP1 intron-NotI site-tandem
SV40 poly adenylation site).
[0208] B. Cloning .DELTA.R2-R21+H3
[0209] The procedure used for cloning .DELTA.R2-R21+H3 is outlined
in FIG. 25. Initially, four PCR reactions were performed (employing
Pfu polymerase) to create the deletion shown in FIG. 25. The
primers employed in the first reaction were 5' GAT GTG GAA GTG GTG
AAA GAC 3 (SEQ ID NO:52), which anneals to 1319-1330 of the HDMD
clone, and 5' CCA ATA GTO GTC AGT CCA GGA GCA TGT AAA TTG CTT TG 3'
(SEQ ID NO:53), which is a reverse, tailed primer (the bold-faced
sequence anneals to 1546-1532 of the HDMD clone and the underlined
sequence anneals to 7512-7490 of the HDMD clone. PCR was conducted
with these primers and a 228 bp PCR product was produced. The first
primer employed in the second reaction was 5' CAA AGC AAT TTA CAT
GCT CCT GGA CTG ACC ACT ATT GG 3' (SEQ ID NO:54), which is the
reverse complement of SEQ ID NO:53 (the bold-faced sequence of SEQ
ID NO:54 anneals to 1532-1546 of the HDMD clone in the forward
direction, and the underlined sequence anneals to 7512-7490 of the
HDMD clone in the forward direction. The other primer employed in
the second reaction was 5' CTG TTG CAG TAA TCT ATG CTC CAA CAT CAA
GGA AGA TG 3' (SEQ ID NO:55), and the bold-faced sequence anneals
to 8287-8270 of the HDMD clone, and the underlined sequence anneals
to 7612-7593 of the HDMD clone as a reverse primer. PCR was
performed with these primers, and a 123 bp PCR product was
produced. The first primer employed in the third reaction was 5'
CAT CTT CCT TGA TGT TGG AGC ATA GAT TAC TGC AAC AG 3' (SEQ ID
NO:56), the underlined sequence anneals to 7593-7612 of the HDMD
clone in the forward direction, and the bold-faced sequence anneals
to 8270-8287. The second primer employed in the third reaction was
SEQ ID NO:51 (see above), which anneals to 9413-9396 in the reverse
direction. PCR was performed with these primers, and a 1143 bp
fragment was produced. The fourth reaction employed the products
from reactions 1, 2, and 3 as template, and the outside primers
(SEQ ID NO:52 and SEQ ID NO:51), and a 1494 bp fragment was
produced using Pfu polymerase.
[0210] This 1494 bp fragment was then digested with Munl and
HindIII to produce a 1270 bp band and cloned into a 4320 bp
MunI+HindIII fragment from the HDMD clone. The 1270 bp fragment
contained the part of repeat 1, all of hinge 3, repeat 22, repeat
23, and part of repeat 24. The 4320 bp fragment contained the 5'
UTR of HDMD, the N terminus, Hinge 1, and part of repeat 1 and
pBSX. The MunI site in HDMD is located at base 1409. The HindIII
site is at 9281 bp. Ligation of the 4320 bp fragment and the 1270
bp fragment was then performed (See FIG. 25) and a 4490 bp fragment
was produced. Step 3 was performed as describe above for
.DELTA.R4-R23 to generate .DELTA.R2-R21 +H3.
[0211] C. Cloning .DELTA.R2-R21
[0212] The cloning of .DELTA.R2-R21 was performed essentially the
same way as for .DELTA.R2-R21+H3, with the exception of the
recombinant PCR reaction to assemble the rod domain deletion (See,
FIG. 26). All other steps are the same. Three PCR reactions were
performed (using Pfu polymerase) to create the deletion. The
primers employed in the first reaction were SEQ ID NO:52 (see
above), and 5' CTG TTG CAG TAA TCT ATG ATG TAA ATT GCT TTG 3' (SEQ
ID NO:57), the underlined sequence anneals to 8287-8270 of the HDMD
clone in the reverse direction, and the bold-faced sequence anneals
to 1546-1532 of the HDMD clone in the reverse direction. PCR was
performed with these primers, and a 250 bp product was obtained.
The first primer employed in the second reaction was 5' CAA AGC AAT
TTA CAT CAT AGA TTA CTG CAA CAG 3' (SEQ ID NO:58), which is is the
reverse complement of SEQ ID NO:57 (the bold-faced sequence of SEQ
ID NO:58 anneals to 1532-1546 of the HDMD clone in the forward
direction, and the underlined sequence anneals to 8270-8287 of the
HDMD clone in the forward direction. The other primer employed in
the second reaction was SEQ ID NO:51, which anneals to 9413-9396 in
the reverse direction. PCR was performed with these primers and a
1143 bp product was obtained. The third reaction employed the
products from reactions 1 and 2 (as template) and the outside
primers (SEQ ID NO:52 and SEQ ID NO:51), and a 1383 bp fragment was
produced. This fragment was then digested with Munl and HindIII to
produce an 1147 bp fragment containing part of repeat 1, repeat 22,
repeat 23, and part of repeat 24. This was then cloned into the
same MunI+HindIII HDMD fragment described for the .DELTA.R2-R21+H3
clone and all other steps thereafter were the same.
EXAMPLE 3
.DELTA.R4-R23 Deletions
[0213] This example describes the construction of 5' UTR, 3' UTR,
and C-terminal deletions of .DELTA.R4-R23 (making it even smaller),
as well as the addition of polyadenylation and promoter sequences.
This example also describes the alteration of the Kozak sequence
(to become more like that of consensus).
[0214] A. Deletion of the 3' UTR
[0215] In order to delete the 3' UTR, the following two primers
were employed 5' TCT CTC CAA GAT CAC CTC G 3' (SEQ ID NO:64), which
anneals to 9117-9134 of the HDMD full length clone, and 5' ATG AAG
CTT GCG GCC GCA TGC GGG AAT CAG GAG TTG 3' (SEQ ID NO:65) (the
underlined site is a HindIII site that was included in this primer
and the bold-faced type is a NotI site). SEQ ID NO:65 is a reverse
primer that anneals to 11340-11322 of HDMD in the 3' UTR. These
primers cause the deletion of 707 bp of the 3' UTR from the XbaI
cloning site located at 12057 to the end of this primer (SEQ ID
NO:65), leaving 113 bp of native 3' UTR, and introducing NotI and
HindIII cloning sites. The PCR product obtained using the primers
corresponding to SEQ ID NOS:64 and 65 on the p.DELTA.R4-R23 clone
was named Hdys.DELTA.3'UTR and was saved for use as a template to
generate a further deletion of exons 71-78 (see part C below).
[0216] B. Deletion of 5' UTR and Alteration of Kozak Sequence
[0217] A portion of the 5' UTR was deleted (and the Kozak sequence
was altered in the same step). The `step 2` clone from cloning of
.DELTA.R4-R23 was utilized (this was the the product of ligating
the step 1 PCR product into the 5016 bp NcoI and HindIII fragment
from the HDMD full-length clone, and this clone contained pBSX
backbone plus the 5' UTR, N terminus, Hinge 1, Repeats 1, 2, 3,
Hinge 2, and part of repeat 24. There is an MunI site located in
the first repeat at nucleotide 1409 of the HDMD cDNA. In addition,
there is a NotI site that is polylinker derived at the 5' end of
the clone. These two sites were employed, MunI+NotI, to clone a new
fragment containing a truncated 5' UTR and an altered Kozak
sequence as follows. PCR was performed, using Pfu polymerase using
the following primers. The first primer was 5' TAG CGG CCG CGG TTT
TTT TTA TCG CTG CCT TGA TAT ACA CTT TCC ACC ATG CTT TGG TGG GAA GAA
GTA G 3' (SEQ ID NO:59). We created a Notl site (underlined) in
this. primer so the product could be cloned back into the NotI site
from the polylinker. The sequence immediately 3' to this NotI site
corresponds to the dystrophin 5' UTR sequence (the original Kozak
sequence was changed with this primer, from TCAAAATGC, changed to
CCACCATGC. The second primer was 5' TTT TCC TGT TCC AAT CAG C 3'
(SEQ ID NO:60) which anneals to sequence 1441-1423 of HDMD full
length clone. The final product of this reaction was 1270 bp and
was digested with NotI+MunI to produce a 1233 bp fragment that was
then cloned into the NotI (polylinker)+MunI site in Repeat 1 of the
"Step 2" clones (described above for .DELTA.R4-23). This new clone
was named pHDMD5' Kozak.
[0218] C. Deletion of Exons 71-78 (C-Terminal)
[0219] Using three PCR reactions, a 71-78 deletion was created. We
used the HindIII fragment containing the 3'UTR that was generated
by digestion of the HDMD full-length dystrophin cDNA with HindIII
as the vector to clone the 71-78 fragment into the HindIII site.
The primer employed for the first reaction were 5' GGC TTC CTA CAT
TGT GTC AGT TTC CAT GTT GTC CCC 3' (SEQ ID NO:66), and 5' TCT CTC
CAA GAT CAC CTC 3' (SEQ ID NO:67) anneals to 9117-9134 of HDMD. PCR
was performed employing these primers and a 1334 bp product was
produced. The primers for the second reaction were SEQ ID NO:65,
and 5' GGG GAC AAC ATG GAA ACT GAC ACA ATG TAG GAA GCC 3' (SEQ ID
NO:68), where the bold-face sequence anneals to exon 70 at
10415-10431 in the forward direction, and the underlined sequence
anneals to 11216-11233 in the forward direction. PCR was performed
and a 150 bp fragment was generated. The product of reactions 1 and
2 were used as template and the outside primers SEQ ID NO:65 and
SEQ ID NO:67 were used to prime the reaction which generated the
complete 71-78 C terminus (1484 bp). This product was digested with
HindIII to produce a 1319 bp fragment and was cloned into the
HindIII site of pTZ19R (See FIG. 35). This new clone was named
pTZ-HDMD-H3.DELTA.71-78.DELTA.3.
[0220] D. Cloning of the SV40 pA Sequence into the Not I site
[0221] The next step was the cloning of the SV 40 pA sequence:
5'GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGA
ATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATT
TGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCAT
TTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTCGGATC3' (SEQ ID NO:71)
into the NotI site of the 3' HindIII fragment that now contains the
3' UTR and 71-78. A PCR reaction was performed on the template pHSA
with a reverse primer 5' AGC GGC CGC AAA AAA CCT CCC ACA CCT CC 3'
(SEQ ID NO:69, containing a regenerating NotI site--underlined) and
5' TAC GGC CGA TCC AGA CAT GAT AAG ATA C 3' (SEQ ID NO:70,
containing a destroying EagI site, in bold). All other sequence
(besides the NotI and EagI sites) is SV40 pA. This PCR reaction
generated a 195 bp product+cloning sites=209 bp. We then cloned
this fragment into the NotI site of pTZ-HDMD-H3.DELTA.71-78.DELTA.3
generated by PCR in the 3' UTR clone. The upstream (5'--most) NotI
site in this clone was destroyed by EagI ligation. This new clone
was named pTZ-HDMD-H33'A.
[0222] E. Cloning of CK6 Promoter into NotI Site
[0223] The CK6 promoter--5'
GGT-ACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGG- GACACCCGAG
ATGCCTGGTTATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCCAACACCT
GCTGCCTGAGCCTGAGCGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTG
TACACCATGGAGGAGAAGCTCGCTCTAAAAATAACCCTGTCCCTGGTGGGCC
CAATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCA
GGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGCG
AAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAG
TGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAG
CTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGC
TCATCTGCTCTCAGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACAC
CCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC
GGGGATCCTCTAGACC-3' (SEQ ID NO:61) was amplified using two tailed
primers: 5' AGC GGC CGC GGT ACT ACG GGT CTA GG 3' Forward (SEQ ID
NO:62), and 5' ATC GGC CGT CTA GAG GAT CCC CGT GAC C 3' Reverse
(SEQ ID NO:63). The underlined sequence is a NotI site added to the
end of this primer. The remaining sequence is CK6 sequence. The
bold-faced type is an EagI site added to the end of this primer.
The remaining sequence is from CK6. The CK6 promoter was amplified
this way so we could add the NotI and EagI sites (so the entire
cassette could be excised when put back together with NotI). This
PCR product was therefore digested with NotI and EagI and ligated
into the Noti site of pHDMD5'Kozak. This new clone was named
pCK6HDMD5'Kozak. NotI and EagI produce compatible cohesive sites,
but when EagI ligates to NotI, it destroys the site. So we placed
the EagI site at the 3' end, so that when the final construct was
cut with NotI, the entire expression cassette could be excised
intact. The same strategy was employed at the 3' end when placing
the SV40 poly A sequence into the 3' Not I site.
[0224] F. Re-Ligating the 5' and 3' Ends.
[0225] This step was performed as described above in the
micro-dystrophin transgene constructs. We reconstituted the same
cloning sites but with modifications in the fragments, so the
modified 3' end, isolated as a HindIII fragment from clone
pTZ-HDMD-H33'A (example 3 part D), was able to be cloned into the
HindIII site of pCK6HDMD5'Kozak (example 3, part E). This final
clone, named pCK6R4-R23Kozak.DELTA.3', contains a truncated
dystrophin expression cassette that can be excised in its entirety
by digestion with NotI. This excised expression cassette can then
be used for a variety of purposes. One such purpose is to clone the
cassette into a plasmid containing the inverted terminal repeats
from adeno-associated virus. By cloning the dystrophin expression
cassette HDMD-H33'A into a cloning site between the two ITRs of
AAV, a recombinant AAV vector could be produced.
EXAMPLE 4
Construction of Reduced Repeat Dystrophin Constructs
[0226] This example describes the construction of .DELTA.H2-R19 (an
8 spectrih-like-repeat sequence), p.DELTA.R9RI6 (a 16
spectrin-like-repeat sequence), p.DELTA.R1R24 (a zero
spectrin-like-repeat sequence), p.DELTA.H2-H3 (an 8 spectrin-like
repeat sequence), and .DELTA.H2-R19,R20 (a 7 spectrin-like repeat
sequence). One starting plasmid was pHBMD, a human dystrophin cDNA
(full-length HDMD, SEQ ID NO:47) with a further deletion of the
sequences encoded by exons 17-48. The cDNA was cloned into the
commercially available plasmid vector pTZ19r (MBI Fermentas;
Genbank accession number Y14835, See FIG. 35), into which an
EcoRI-SalI adapter (prepared by self-annealing of the
oligonucleotide 5'-AATTCGTCGACG-3', SEQ ID NO:83) had been ligated
into the the EcoRI site. Base number 1 of the cDNA is immediately
3' of the adapter sequence, and the cDNA ends at the XbaI site at
base 12,100 of SEQ ID NO:1. This XbaI site had been ligated into
the XbaI site of the plasmid ptZ19r. Another starting plasmid is
pBSX (SEQ ID NO:46), a modified version of pBluescript KSII+
(Stratagene) which is used to make pBSXA (pBSX into which the SV40
polyadenylation signal (pA) was added). This pA sequence was
excised as a 206 bp fragment from pCMV.beta. (Clonetech),
blunt-ended with DNA polymerase I, and ligated into the blunt-ended
KpnI site of pBSX.
[0227] Another starting plasmid is pCK3, which is pBSX with the 3.3
kb mouse muscle creatine kinase enhancer plus promoter attached to
the minx intron (See, Hauser et al., Mol Ther., 2:16-25, 2000).
Another staring plasmid is pHDSK, which is pHBMD digested with
KpnI, to remove the dystrophin sequences 3' of the internal KpnI
site (base 7,616 of the human dystrophin cDNA sequence, SEQ ID
NO:1). A further starting vector is p44.1, which is pBluescript KS-
(Stratagene) carrying a human dystrophin cDNA fragment spanning the
EcoRI site at base 7,002 to the EcoRI site at base 7,875 of the
full-length human dystrophin cDNA sequence, cloned into the EcoRI
site of the vector. Another plasmid employed was p30-2, pBluescribe
(Stratagene) containing a fragment from the full-length human
dystrophin cDNA spanning bases 1,455 to the EcoRI site at base
2,647, cloned into the EcoRI site of the vector. An additional
vector employed was p30-1, pBluescribe (Stratagene) containing an
EcoRI fragment from the full-length human dystrophin cDNA spanning
bases 2,647 to 4,558, cloned into the EcoRI site of the vector. An
further plasmid employed is p47-4, pBluescript KS- (Stratagene)
carrying the human dystrophin cDNA EcoR1 fragment spanning bases
4,452 to 7,002 of the full-length cDNA sequence, cloned into the
EcoRI site of the vector. Another plasmid is p9-7, pBluescribe
(Stratagene) containing bases 1-1,538 of the full-length human
dystrophin cDNA. Base 1 is attached to a linker of the sequence 5'
GAATTC-3' and cloned into the EcoRI site of the vector. Base 1,538
is blunt-end cloned into the PstI site of the vector, which had
been destroyed by fill-in with T4 DNA polymerase. Another vector
employed is p63-1, pBluescript KS- (Stratagene) carrying the human
dystrophin cDNA EcoRI fragment spanning bases 7,875 to the 3' end
of the full-length cDNA, cloned into the EcoRI site of the vector
(the 3' end of the cDNA is ligated to a linker of the sequence
5'-GAATTC-3').
[0228] Initially, the MCK promoter plus enhancer and the minx
intron were excised from pCK3 by digestion with EagI, yielding a
3.5 kb fragment that was ligated into EagI-digested pBSXA to make
pBSXACK3. Truncated dystrophin cDNAs, derived from pHBMD,
containing various deletions of dystrophin domains were prepared as
described below. The cDNA inserts were excised from the plasmid
backbone with SalI, and ligated into pBSXACK3 at the SalI site,
which is located between the minx intron and the pA sequence, such
that the 3' end of the cDNA was adjacent to the pA sequence. The
isolation of the truncated cDNAs is described below.
pBSXACK3-truncated dystrophin plasmids were digested with BssHII to
release the expression vectors, which were gel purified and used to
generate transgenic mice.
[0229] Isolation of .DELTA.H2R19
[0230] A PCR product was generated by amplification of plasmid
p30-2 with primers 5'-TGTGCTGCAAGGCGATTAAGTTGG-3' (SEQ ID NO:72)
and 5'-GAGCTAGGTCAGGCTGCTGTGAAATCTGTGC-3' (SEQ ID NO:75). Primer
SEQ ID NO:75 overlaps the end of repeat 3 and the beginning of
hinge 3. Primer SEQ ID NO:72 corresponds to a sequence in the
plasmid vector adjacent to the cloning site. A second PCR product
was generated by amplification of plasmid p44-1 using primers
5'-CCAGGCTTTACACTTTATGCTTCC-3' (SEQ ID NO:73) and
5'-GCACAGATTTCACAGCAGCCTGACCTAGCTC-3' (SEQ ID NO:74). Primer SEQ ID
NO:74 is the reverse complement of primer SEQ ID NO:75. Primer SEQ
ID NO:73 corresponds to a sequence in the plasmid vector adjacent
to the cloning site. The PCR products were then purified by agarose
gel electorphoreses, and quantified. A recombinant PCR product was
then prepared by mixing together 10 ng of each of the first two PCR
products, then re-PCR amplifying using only primers SEQ ID NO:72
and SEQ ID NO:73. This recombinant PCR product was then digested
with NheI and KpnI, and ligated into NheI and KpnI digested
pH.DELTA.SK to generate plasmid pHBMD.DELTA.H2 (NheI-cuts at cDNA
base 1,519, and KpnI cuts at base 7,616 of the full-length human
dystrophin cDNA sequence). pHBMD.DELTA.H2 was then digested with
KpnI and XbaI, and ligated to the KpnI-XbaI fragment from pHBMD
(this latter fragment contains the full-length human dystrophin
cDNA bases 7,616 to 12,100) to obtain plasmid p.DELTA.H2R19.
[0231] Isolation of p.DELTA.R9R16
[0232] Plasmid p44-1 was digested with EcoRI and Asp718 to excise a
610 bp cDNA insert, that was ligated into pBSX digested with EcoRI
and Asp718, yielding pBSX44AE. pBSX44AE was digested with EcoRI and
Xbal, and ligated to the NheI-EcoRI cDNA-containing fragment from
p30-2, yielding pBSX44AE/30-2NE. Plasmid pBSX44AE/30-2NE was
linearized by digestion with EcoRI, into which was ligated the
EcoRI-digested recombinant PCR product .DELTA.R9-R16. This latter
recombinant PCR product was generated as follows. Plasmid p30-1 was
amplified with primers SEQ ID NO:72 and
5'-CCATTTCTCAACAGATCTTCCAAAGTCTTG-3' (SEQ ID NO:77), and plasmid
p47-4 was amplified by PCR with primers SEQ ID NO:73 and
5'-CAAGACTTTGGAAGATCTGTTGAGAAATGG-3 (SEQ ID NO:76). A recombinant
PCR product (.DELTA.R9-R16) was then prepared by mixing together 10
ng of each of the first two PCR products, then re-PCR amplifying
using only primers SEQ ID NO:72 and SEQ ID NO:73. This recombinant
PCR product was then digested with EcoRI, and ligated into EcoRI
digested pBSX44AE/30-2NE to generate plasmid pR9R16int. Plasmid
pR9R16int was digested with NcoI and Asp718, and the 3 kb cDNA
fragment was isolated and ligated into NcoI and Asp718 digested
pHASK to generate p.DELTA.R9R16.
[0233] Isolation of p.DELTA.R1R24
[0234] Plasmid p9-7 was PCR amplified with PCR primers
5'-AGTGTGGTTTGCCAGCAGTC (SEQ ID NO:80) and
5'-CAAAGTCCCTGTGGGCGTCTTCAGGAG- CTTCC-3' (SEQ ID NO:79). Plasmid
p63-1 was PCR amplified with primers 5'
GGAAGCTCCTGAAGACGCCCACAGGGACTTTG-3' (SEQ ID NO:78) and
5'-TGGTTGATATAGTAGGGCAC-3' (SEQ ID NO:81). A recombinant PCR
product (.DELTA.R1-R24) was then prepared by mixing together 10 ng
of each of the first two PCR products, then re-PCR amplifying using
only primers SEQ ID NO:80 and SEQ ID NO:81. This recombinant PCR
product was then digested with SexAI and PpuMI, and ligated into
SexAI and PpuMI digested pHBMD to generate plasmid
p.DELTA.R1R24.
[0235] Isolation of p.DELTA.H2-H3
[0236] This clone was prepared exactly as p.DELTA.H2-R19, except
that primer 5'-CAGATTTCACAGGCTGCTCTGGCAGATTTC-3' (SEQ ID NO:82) was
used in place of primer SEQ ID NO:74, and primer
5'-GAAATCTGCCAGAGCAGCCTGTGAAATCT- G-3' (SEQ ID NO:84) was used in
place of primer SEQ ID NO:75.
[0237] Isolation of .DELTA.H2-R19,R20
[0238] This clone was generated from clone p.DELTA.H2R19 as
follows. Plasmid p44-1 was amplified with primers SEQ ID NO:72 and
5'-TGAATCCTTTAACATAGGTACCTCCAACAT-3' (SEQ ID NO:85). Plasmid 63-1
was amplified with primers 5'-ATGTTGGAGGTACCTATGTTAAAGGATTCA-3'
(SEQ ID NO:86) and SEQ ID NO:81. The PCR products were then
purified by agarose gel electorphoreses, and quantified. A
recombinant PCR product was then prepared by mixing together 10 ng
of each of the first two PCR products, then re-PCR amplifying using
only primers SEQ ID NO:72 and SEQ ID NO:81. This product was
digested with Asp718 and BstXI, and ligated into Asp718 and BstXI
digested pHBMD generating clone pBMD.DELTA.R20. The Asp718-XbaI
cDNA-containing fragment from pBMD.DELTA.R20 was isolated and
ligated into Asp718 and XbaI digested p.DELTA.H2R19 to generate
p.DELTA.H2-R19,R20.
EXAMPLE 5
Testing Truncated Dystrophin in mdx Mice
[0239] This example describes the generation of transgenic mdx mice
expressing truncated dystrophin cDNA (see above), and testing these
mice in various ways to determine various measurable muscle values.
A variety of dystrophin expression cassettes (FIG. 27) were used to
generate transgenic mice to test their functional capacity in
alleviating muscular dystrophy on the dystrophin null mdx
background. FIG. 27 depicts the truncated dystrophin cDNA sequences
tested, all of which were linked to an regulatory regions, a minx
intron, and the SV40 polyadenylation sequence (the 4-repeat
constructs employed the HSA actin promoter, See Crawford et al., J.
Cell. Biol., 150:1399, 2000; and the remaining sequences employed
an MCK enhancer and promoter, see Niwa et al., Genes Dev. 4:1552,
1990). Each of these constructs was released by digestion from
plasmid hosts, were gel purified, and used to generate transgenic
mice.
[0240] Excised expression cassettes injected into wild type
C57B1/10.times.SJL/J F2 hybrid embryos, and F.sup.0 mice were
screened by PCR analysis of DNA isolated from tail snips. Positive
F.sup.0 mice were backcrossed onto the C57B1/10mdx background, and
individual mouse lines were tested for dystrophin expression by
immunofluorescent analysis with dystrophin antibodies for of
expression in skeletal muscle fibers. Lines that displayed uniform
expression of dystrophin in muscle fibers were selected for further
analysis. These lines were further backcrossed onto the mdx mouse
background before analysis of dystrophin expression, muscle
function and morphology.
[0241] A. Truncated Dystrophin cDNAs are Expressed at Various
Levels in Muscles of Transgenic mdx Mice.
[0242] Muscle extracts were analyzed by western (immuno) blot
analysis to determine the amount of dystrophin made in different
muscles of the transgenic mdx mice. For these studies, total
protein was extracted from the quadriceps and diaphragm muscles of
control and transgenic mice, and protein concentrations were
determined using the Coomassie Plus Protein Assay Reagent (Pierce).
One hundred micrograms of each sample was electrophoresed on a 6%
polyacrylamide/SDS gel (29.7:0.3/acryl:bis), transferred for 2
hours at 75 volts onto Biotrace Nitrocellulose (Gelman Science) in
1.times.Tris-Glycine, 20% methanol, 0.05% SDS, using a wet-transfer
apparatus (Hoefer). Membranes were blocked in 10% non-fat dry milk,
1% normal goat serum, and 0.1% Tween-20, and hybridized with DYS1
(Novacastra) at a 1/1000 dilution for 2 hours at room temperature,
washed, and then probed with horse radish peroxidase conjugated
anti-mouse antibodies at a 1/2,000 dilution (Cappel). Blots were
developed using the ECL chemiluminescence system (Amersham). All
incubations contained 1% normal goat serum and 0.1% Tween-20. The
results of the western blot indicated that R9-R16 was poorly
expressed in this line of mice, especially in the diaphragm, and
that H2-H3 was very poorly expressed in the diaphragm.
[0243] B. Truncated Dystrophin cDNAs Confer Various Degrees of
Protection on Muscles of Transgenic mdx Mice.
[0244] Various muscle groups from the different lines of transgenic
mice expressing truncated dystrophins were examined for
morphological abnormalities, and for expression of dystrophin by
indirect immunofluorescence (IF) in individual fibers. IF analysis
was performed as follows. Skeletal muscle was removed from control
and transgenic animals, cut into strips, embedded in Tissue-tek OCT
mounting media (Miles, Inc.), and frozen quickly in liquid
nitrogen-cooled isopentane. Seven micrometer sections were blocked
with 1% gelatin in KPBS for 15 minutes, washed in KPBS+0.2% gelatin
(KPBSG), and incubated for 2 hours in KPBSG+1% normal goat serum
with affinity-purified dystrophin antibody 18-4 (Cox el al.,
Nature, 364:725-729, 1993) at a dilution of 1/1000. After washing,
the slides were incubated for 1 hour with either biotin-labeled
goat anti-rabbit polyclonal antibodies (Pierce), washed again, and
incubated with FITC (fluorescein isothiocynate)-conjugated
streptavidin. After a final wash, Vectashield (Vector Laboratories,
Inc.) with DAPI was applied and sections were photographed through
a dual bandpass filter under 40.times. magnification using a Nikon
E1000 microscope.
[0245] Morphological analysis of the muscles was performed as
follows. Muscle groups from among the following types were chosen
for analysis: Quadriceps (Quad), soleus, extensor digitorum longus
(EDL), tibialis anterior (TA), and diaphragm muscles. Selected
muscles were removed from mice, frozen in liquid nitrogen cooled
O.C.T. embedding medium (Tissue-Tek), and cut into 7 .mu.m
sections. After fixing in 3.7% formaldehyde, sections were stained
in hematoxylin and eosin-phloxine. Stained sections were imaged
with a Nikon E1000 microscope and photographed.
[0246] The results of this analysis show that micro-dystrophin
expression (.DELTA.R4R23 transgene) in the diaphragm prevents the
onset of muscular dystrophy in mdx mice. In particular,
micro-dystrophin transgenic and wild-type C57B/10 diaphragm
sections stained with hematoxylin and eosin (H&E) show
morphologically healthy muscle without areas of fibrosis, necrosis,
mononuclear cell infiltration, or centrally located nuclei.
Conversely, the mdx diaphragm displays a high level of dystrophic
morphology by H&E. Also, immuno-fluorescence, using
anti-dystrophin polyclonal primary antisera, demonstrates that
micro-dystrophin transgenes are expressed at the sarcolemmal
membrane in a similar fashion to that of wild-type dystrophin,
while mdx mice do not express dystrophin.
[0247] H & E staining also shows that truncated dystrophins
with 8 or 16 spectrin-like repeats have varying abilities to
prevent dystrophy in the diaphragm of transgenic mdx mice. The
H2R19 maintains normal muscle morphology that is not different from
wild-type C57B1/10 muscle. The .DELTA.H2R19 muscle displays a very
low percentage of centrally nucleated fibers, while the
.DELTA.H2-R19,R20 and .DELTA.R9-16 constructs display percentages
intermediate between .DELTA.H2-R19 and mdx (see FIG. 28). The mdx
diaphragm had a large number of centrally nucleated fibers, many
necrotic fibers, and large areas of mono-nuclear cell infiltration
and fibrosis.
[0248] The results also show that quadriceps muscle fibers
expressing micro-dystrophin transgene (.DELTA.R4R23 transgene)
display normal morphology and exclude Evans Blue Dye.
Micro-dystrophin transgenic mdx or C57B1/10 quadriceps sections
stained with hematoxylin and eosin (H&E) display
morphologically healthy muscle without areas of necrosis, fibrosis,
mononuclear cell infiltration, or centrally-located nuclei, as
opposed to sections of mdx muscle. The high abundance of central
nuclei and mononuclear immune cell infiltration are evidence of
muscle cell necrosis. Immunofluorescence results indicate that
micro-dystrophins display a subsarcolemmal expression pattern like
that of wild-type dystrophin, while mdx mice do not express
dystrophin. Evans Blue Dye (EBD) uptake is an indication of a
damaged myofiber. For analysis of EBD uptake, mice were tail vein
injected with 150 .mu.l of a solution containing 10 mg/ml Evans
blue dye in PBS (150 mM NaCl, 50 mM Tris pH 7.4). After three
hours, the animals were euthanized and mouse tissues were either
fixed in 3.7% formaldehyde/0.5% glutaraldehyde to observe gross dye
uptake, or frozen unfixed in O.C.T. embedding medium. To examine
Evans blue uptake by individual fibers, 7 .mu.m thick frozen
sections were fixed in cold acetone and analyzed by fluorescence
microscopy. The results of this testing indicate that fibers
expressing micro-dystrophin or wild-type dystrophin exclude EBD,
and that damaged mdx muscle cell membranes are permeable to Evans
Blue dye.
[0249] A hallmark of dystrophy in mdx mice is the presence of large
numbers of centrally-nucleated muscle fibers, reflecting cycles of
fiber degeneration and regeneration. To estimate the degree of
myofiber regeneration occurring in the transgenic mice,
centrally-nucleated fibers were counted from quadriceps muscles in
age-matched wild-type, mdx, and transgenic mdx mice (FIG. 28). To
determine the percentage of fibers containing central nuclei, the
number of muscle fibers with centrally-located nuclei was divided
by the total number of muscle fibers.
[0250] Expression of 8 or 4 repeat micro-dystrophin transgenes on
the mdx background significantly reduces the percentage of fibers
with centrally-located nuclei to wild-type or near wild-type levels
(FIG. 28). Dystrophin molecules with zero repeats are unable to
correct the mdx phenotype by this assay. The best constructs were
observed to be the 8 repeat H2-R19 and the 4 repeat R2-R23
constructs. Greater percentages of centrally nucleated fibers were
observed in mice expression the exon 17-48 deletion, the 4 repeat
R2R21 construct, the 7 repeat H2R19,R20 construct, the 16 repeat
R9R16 construct, and the zero repeat R1R24 construct (FIG. 28). The
results from the R9R16 construct likely do not reflect the full
functional capacity of the 16 repeat dystrophin since this line of
mice expressed very low levels of the truncated dystrophin protein.
All other muscles expressed levels of dystrophin that have been
shown to be capable of preventing dystrophy if the expressed
protein is functional (Phelps et al., Hum Mol Genet; 4:1251-1258,
1995).
[0251] The functional capacity of the truncated dystrophins was
also assessed by measuring muscle contractile properties in the
transgenic mdx mice. Contractile properties of muscles from
transgenic mice were compared with those of C57B1/10 wild type and
mdx mice. The samples included 4-8 muscles each from the tibialis
anterior (TA), extensor digitorum longus (EDL) or diaphragm. Mice
were deeply anesthetized with avertin and each muscle was isolated
and dissected free from the mouse. After removal of the limb
muscles, the mice were euthanized with the removal of the diaphragm
muscle. The muscles were immersed in a bath filled with oxygenated
buffered mammalian Ringer's solution (137 mM NaCl, 24 mM
NaHCO.sub.3, 11 mM glucose, 5 mM KCl, 2 mM CaCl.sub.2.sub., 1 mM
MgSO.sub.4, 1 mM NaH.sub.2PO.sub.4, and 0.025 mM tubocurarine
chloride, pH 7.4). For each muscle, one tendon was tied to a
servomotor and the other tendon to a force transducer. Muscles were
stretched from slack length to the optimal length for force
development and then stimulated at a frequency that produced
absolute isometric tetanic force (mN). Following the measurements
of the contractile properties, the muscles were removed from the
bath, blotted and weighed to determine muscle mass. Specific force
(kN/m2) was calculated by dividing absolute force by total fiber
cross sectional area.
[0252] FIG. 29 shows that the 8 repeat dystrophin encoded by H2-R19
supports normal force development in both the diaphragm (FIG. 29a)
and EDL muscle (FIG. 29b). In contrast, previous studies showed
that the exon 17-48 construct, which encodes a dystrophin with 8.25
spectrin-like repeats, supports only 90-95% of normal force
development in the diaphragm (Phelps et al., Hum Mol Genet,
4:1251-1258, 1995). The 8 repeat dystrophin lacking a central hinge
(H2-H3), and the 7 repeat dystrophin (H2-R19,R20) both fail to
support significant force generation compared with dystrophic mdx
muscles. The results from the R9-R16 construct likely do not
reflect the full functional capacity of the 16 repeat dystrophin,
since this line of mice expressed very low levels of the truncated
dystrophin.
[0253] FIG. 30 shows that the micro-dystrophin transgenic mdr mice
develop less specific force than do C57B1/10 mice in the TA, but
near wild-type levels in the diaphragm. Micro-dys 1 and -2 refer to
transgenes .DELTA.R4-R23, and .DELTA.R2-R21, respectively. FIG. 30A
shows that C57B1/10 mice display significantly higher specific
force than both transgenic lines and mdx mice in the tibialis
anterior (TA) muscle. Data are presented as mean.+-.standard error
of the means (s.e.m.) with each bar representing 6 to 8 TA muscles.
ANOVA statistical testing was performed. (* indicates significance
from C57B1/10, p<0.01; s indicates significance from C57B1/10,
p<0.05). FIG. 30B shows that mice expressing Micro-dys I develop
wild type levels of specific force in the diaphragm, while mice
expressing Micro-dys 2 develop .about.22% less specific force by
the same assay when compared with C57B1/10. Both lines of mice
develop more specific force than mdx mice in the diaphragm. Data
are presented as the percentage of wild type.
[0254] Dystrophic mice are susceptible to contraction-induced
injury (Petrof, ei al., Proc. Nail. Acad Sci. USA. 90:3710-3714,
1993). In this part of the example tested whether the 4 repeat
dystrophin clones would protect muscles of transgenic mdr mice from
contraction induced injuries. To test contraction-induced injury,
an experimental protocol consisting of two muscle stretches was
performed in live, anesthetized animals. The distal tendon of the
TA was cut and secured to the lever arm of a servomotor that
monitors position and force produced by the muscle. Stimulation
voltage and optimal muscle length (L.sub.0) for force production
were determined. The muscle was maximally stimulated and then
stretched 40% greater than L.sub.0 (LC1) for 300 milliseconds. A
second lengthening contraction was performed 10 seconds later
(LC2). The maximum force that the muscle was able to produce after
each stretch was measured and expressed as a percentage of the
force produced before stretch. Mdr mice expressing
micro-dystrophins were significantly protected from the dramatic
force deficit produced after a lengthening contraction compared
with mdx mice (FIG. 31). Micro-dys 1 and -2 refer to transgenes
.DELTA.R4-R23, and .DELTA.R2-R21, respectively. Furthermore, there
was no significant difference between either micro-dystrophin
construct studied in this assay and C57B1/10 mice following the
second, most damaging lengthening contraction. Data are presented
as means.+-.s.e.m. with each bar representing between 6 and 8 TA
muscles from 9-11 week old mice.
[0255] C. Truncated 4 Repeat Dystrophin cDNAs Restore the Ability
to Run Long Distances to mdx Mice.
[0256] We have observed that mdx mice are not able to run for long
distances on a treadmill, as compared to wild-type mice (see
below). Therefore, mice expressing four repeat dystrophins were
compared with wild-type and mdx mice for ability to run for
extended times on a treadmill. The exercising protocol utilized a
six lane, enclosed treadmill with a shock grid to allow forced
running at a controlled rate. C57B1/10, C57B1/6.times.SJL F1, mdx
or transgenic mdx mice were run at a 15 degree downward angle to
induce damaging eccentric muscle contractions. Mice were given a 15
minute acclimation period prior to exercise, and then ran at 10
meters/minute with a subsequent 5 m/min increase in rate every 10
minutes until exhaustion. Exhaustion was determined to be the time
at which a mouse spent more than 5 seconds sitting on the shock
grid without attempting a re-entry to the treadmill. As shown in
FIG. 32, both lines of four repeat transgenic mice ran
significantly farther than mdx mice. Micro-dys 1 and -2 refer to
transgenes .DELTA.R4-R23, and .DELTA.R2-R21, respectively.
Micro-dystrophin transgenic mice are a genetic mixture of
C57B1/6.times.SJL, and C57BV10 strains, and ran an intermediate
distance between the two wild-type lines. Data are presented as
means.+-.s.e.m. ANOVA statistical analyses were performed. (*
indicates values significantly different from mdx line, p<0.01;
s indicates values significantly different from mdx line,
p<0.05).
[0257] D. Micro-Dystrophin Transgenic mdr Mice do not Display
Hypertrophy
[0258] As a way to measure the functional capacity of the
four-repeat dystrophins, we weighed both whole mice and dissected
tibialis anterior muscles from age matched transgenic and control
mice. The results shown in FIG. 33 show that the micro-dystrophin
transgenic mdx mice do not display the muscle hypertrophy normally
observed in mdx mice. FIG. 33A shows that three month old
micro-dystrophin transgenic mdr mice weighed significantly less
than age-matched mdx control mice. FIG. 11B shows that tibialis
anterior (TA) muscle masses in mdx mice were significantly higher
than control muscle masses in C57B1/10 and in both lines of mdx
mice expressing different micro-dystrophin transgenes. Data are
presented as means.+-.s.e.m. with each bar representing between 3
and 4 mice. ANOVA statistical analyses were performed (* indicates
difference from mdx line, p<0.01; Y indicates difference from
C57B1/10 line, p<0.01; s indicates difference from C57B1/10
line, p<0.05). Micro-dys 1 and -2 refer to transgenes
.DELTA.R4-R23, and .DELTA.R2-R21, respectively.
EXAMPLE 6
[0259] Mini-Dystrophin-Containing Adeno-Associated Viral
Vectors
[0260] This example describes a construct that could be made in
order to allow adeno-associated virus to express a mini-dystrophin
peptide in a target muscle cells. FIG. 34 shows a schematic
illustration of a plasmid vector containing the adeno-associated
virus inverted terminal repeats (AAV-ITRs), the muscle promoter
plus enhancer fragment known as CK6 (SEQ ID NO:61, the
.DELTA.R2-R21 four repeat dystrophin cDNA (SEQ ID NO:40) with a
further deletion of sequences encoded on exons 71-78, plus a 195
base pair SV40 polyadenylation signal that would have a total
insert size of approximately 4.7 kb. The cloning capacity of
adeno-associated viral vectors is approximately 4.9 kb. As such,
the construct could be efficiently packaged into AAV viral
particles (e.g. this plasmid construct could be used to transfect
cells such that AAV expressing mini-dystrophin peptide is
expressed). These AAV then, for example, may be administered to a
subject with DMD or BMD (i.e. gene therapy to correct a muscle
deficiency in a subject).
[0261] All publications and patents mentioned in the above
specification are herein incorporated by reference. Various
modifications and variations of the described method and system of
the invention will be apparent to those skilled in the art without
departing from the scope and spirit of the invention. Although the
invention has been described in connection with specific preferred
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention which are obvious to those skilled in material science,
chemistry, and molecular biology or related fields are intended to
be within the scope of the following claims.
* * * * *