U.S. patent application number 10/926223 was filed with the patent office on 2005-03-03 for variants of glycoside hydrolases.
This patent application is currently assigned to Novozymes Biotech, Inc.. Invention is credited to Cherry, Joel, Harris, Paul, Jones, Aubrey, Teter, Sarah, Ward, Connie, Yi, Jung.
Application Number | 20050048619 10/926223 |
Document ID | / |
Family ID | 34392916 |
Filed Date | 2005-03-03 |
United States Patent
Application |
20050048619 |
Kind Code |
A1 |
Teter, Sarah ; et
al. |
March 3, 2005 |
Variants of glycoside hydrolases
Abstract
The present invention relates to variants of a parent glycoside
hydrolase, comprising a substitution at one or more positions
corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350,
373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further comprising a substitution at one or
more positions corresponding to positions 8, 22, 41, 49, 57, 113,
193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462
of amino acids 1 to 513 of SEQ ID NO: 2 a substitution at one or
more positions corresponding to positions 8, 22, 41, 49, 57, 113,
193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462
of amino acids 1 to 513 of SEQ ID NO: 2, wherein the variants have
glycoside hydrolase activity. The present invention also relates to
nucleotide sequences encoding the variant glycoside hydrolases and
to nucleic acid constructs, vectors, and host cells comprising the
nucleotide sequences.
Inventors: |
Teter, Sarah; (Davis,
CA) ; Cherry, Joel; (Davis, CA) ; Ward,
Connie; (Woodland, CA) ; Jones, Aubrey;
(Davis, CA) ; Harris, Paul; (Carnation, WA)
; Yi, Jung; (Sacramento, CA) |
Correspondence
Address: |
NOVOZYMES BIOTECH, INC.
1445 DREW AVE
DAVIS
CA
95616
US
|
Assignee: |
Novozymes Biotech, Inc.
Davis
CA
|
Family ID: |
34392916 |
Appl. No.: |
10/926223 |
Filed: |
August 25, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60497809 |
Aug 25, 2003 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/200; 435/320.1; 435/325; 536/23.2 |
Current CPC
Class: |
C11D 3/38645 20130101;
C12Y 302/01021 20130101; C12Y 302/01091 20130101; C12N 9/2437
20130101; Y02E 50/16 20130101; Y02E 50/10 20130101; C12N 9/2434
20130101; C12N 9/2445 20130101; C12P 7/10 20130101; C12P 19/02
20130101; C12P 19/14 20130101; C12Y 302/01176 20130101 |
Class at
Publication: |
435/069.1 ;
536/023.2; 435/200; 435/320.1; 435/325 |
International
Class: |
C07H 021/04; C12N
009/24; C12P 021/04 |
Goverment Interests
[0002] This invention was made with Government support under NREL
Subcontract No. ZCO-30017-02, Prime Contract DE-AC36-98GO10337
awarded by the Department of Energy. The government has certain
rights in this invention.
Claims
1. An isolated variant of a parent glycoside hydrolase, comprising
a substitution at one or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
comprising a substitution at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2, wherein the variant has glycoside hydrolase
activity.
2-135. (Canceled)
136. The variant of claim 1, which comprises one or more
substitutions selected from the group consisting of S21P, G94S,
G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L,
P227G, T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H,
T383A, P438L, T455A, G467S, and C486W of amino acids 1 to 513 of
SEQ ID NO: 2, and optionally further comprises one or more
substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A of amino acids 1 to 513 of SEQ ID NO: 2.
137-145. (Canceled).
146. The variant of claim 1, which is encoded by the nucleotide
sequence contained in NRRL B-30658, NRRL B-30659, NRRL B-30661,
NRRL B-30662, NRRL B-30663, NRRL B-30664, NRRL B-30665, NRRL
B-30666, NRRL B-30674, NRRL B-30675, NRRL B-30676, NRRL B-30677,
NRRL B-30678, NRRL B-30679, NRRL B-30680, NRRL B-30681, NRRL
B-30682, or NRRL B-30762.
147. An isolated nucleotide sequence encoding the variant of claim
1.
148. (Canceled).
149. An expression vector comprising the nucleotide sequence of
claim 147.
150. A host cell comprising the nucleotide sequence of claim
147.
151. A method for producing a variant, comprising (a) cultivating
the host cell of claim 150 under conditions suitable for production
of the variant; and (b) recovering the variant from the cultivation
medium.
152. An isolated polypeptide having glycoside hydrolase activity,
wherein the amino acid sequence of the polypeptide differs from SEQ
ID NO: 2 at one or more positions corresponding to positions 21,
94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486
of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
comprises a substitution at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2.
153-272. (Canceled)
273. The polypeptide of claim 152, which comprises one or more
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and T462A
of amino acids 1 to 513 of SEQ ID NO: 2.
274-277. (Canceled)
278. An isolated nucleotide sequence encoding the polypeptide of
claim 152-277.
279. (Canceled).
280. An expression vector comprising the nucleotide sequence of
claim 278.
281. A host cell comprising the nucleotide sequence of claim
278.
282. A method for producing a polypeptide having glycoside
hydrolase activity, comprising (a) cultivating the host cell of
claim 281 under conditions suitable for production of the variant;
and (b) recovering the variant from the cultivation medium.
283. A method for obtaining a variant of a parent glycoside
hydrolase, comprising: (a) introducing into the parent glycoside
hydrolase a substitution at one or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further introducing a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2, wherein the variant has
glycoside hydrolase activity; and (b) recovering the variant.
284-417. (Canceled)
418. The method of claim 283, wherein the variant comprises one or
more substitutions selected from the group consisting of S21P,
G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y,
P227L, P227G, T2461, Y247C, D259N, R251K, N301S, E337V, T350S,
N373H, T383A, P438L, T455A, G467S, and C486W of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further comprises one or more
substitutions selected from the group consisting of S8P, G22D,
T41I, N495, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A of amino acids 1 to 513 of SEQ ID NO: 2.
419-428. (Canceled)
429. An isolated polypeptide having cellobiohydrolase activity
comprising amino acids 1 to 513 of SEQ ID NO: 2.
430. An isolated nucleotide sequence encoding the polypeptide of
claim 429.
431. The nucleotide sequence of claim 430, which is contained in
pAJO52 that is contained in E. coli NRRL B-30683.
432. An expression vector comprising the nucleotide sequence of
claim 430.
433. A host cell comprising the nucleotide sequence of claim
430.
434. A method for producing a polypeptide having cellobiohydrolase
activity, comprising: (a) cultivating the host cell of claim 433
under conditions suitable for the expression of the polypeptide;
and (b) recovering the polypeptide from the cultivation medium of
amino acids 1 to 513 of SEQ ID NO: 2.
435. (Canceled).
436. A detergent composition comprising a variant of claim 1 and a
surfactant.
437. A method for degrading cellulose- and hemicellulose-containing
biomass, comprising treating the biomass with an effective amount
of a variant of claim 1 and recovering the degraded biomass.
438. (Cancelled).
439. A method for degrading cellulose- and hemicellulose-containing
biomass, comprising treating the biomass with a host cell of claim
150 and recovering the degraded biomass.
440. (Cancelled).
441. (Canceled).
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/497,809, filed Aug. 25, 2003, which application
is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates to variants of a glycoside
hydrolase having one or more improved properties relative to its
parent enzyme, nucleic acids encoding the variants, methods of
producing the variants, and methods of using the variants.
[0005] 2. Description of the Related Art
[0006] Cellulose is a polymer of the simple sugar glucose
covalently bonded by beta-1,4-linkages. Many microorganisms produce
enzymes that hydrolyze beta-linked glucans. These enzymes include
endoglucanases, cellobiohydrolases, and beta-glucosidases.
Endoglucanases digest the cellulose polymer at random locations,
opening it to attack by cellobiohydrolases. Cellobiohydrolases
sequentially release molecules of cellobiose from the ends of the
cellulose polymer. Cellobiose is a water-soluble beta-1,4-linked
dimer of glucose. Beta-glucosidases hydrolyze cellobiose to
glucose.
[0007] The conversion of cellulosic feedstocks into ethanol has the
advantages of the ready availability of large amounts of feedstock,
the desirability of avoiding burning or land filling the materials,
and the cleanliness of the ethanol fuel. Wood, agricultural
residues, herbaceous crops, and municipal solid wastes have been
considered as feedstocks for ethanol production. These materials
primarily consist of cellulose, hemicellulose, and lignin. Once the
cellulose is converted to glucose, the glucose is easily fermented
by yeast into ethanol.
[0008] St.ang.hlberg et al., 1996, J. Mol. Biol. 264: 337-349,
describe activity studies and crystal structures of catalytically
deficient mutants of cellobiohydrolase I from Trichoderma reesei.
Boer and Koivula, 2003, Eur. J. Biochem. 270: 841-848, disclose the
relationship between thermal stability and pH optimum studied with
wild-type and mutant Trichoderma reesei cellobiohydrolase
Cel7A.
[0009] WO 2004/016760 discloses variants of a Hypocrea jecorina
cellobiohydrolase.
[0010] It would be an advantage in the art to provide glycoside
hydrolase variants with improved properties for converting
cellulosic materials to monosaccharides, disaccharides, and
polysaccharides. Improved properties include altered
temperature-dependent activity profiles, thermostability, pH
activity, pH stability, substrate specificity, product specificity,
and chemical stability.
[0011] It is an object of the present invention to provide variants
of glycoside hydrolases with improved properties compared to its
parent enzyme.
SUMMARY OF THE INVENTION
[0012] The present invention relates to isolated variants of a
parent glycoside hydrolase, comprising a substitution at one or
more positions corresponding to positions 21, 94, 157, 205, 206,
247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further comprising a
substitution at one or more positions corresponding to positions 8,
22, 41, 49, 57, 113, 193, 196,226, 227, 246, 251, 255, 259, 301,
356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2,
wherein the variants have glycoside hydrolase activity.
[0013] The present invention also relates to isolated polypeptides
having glycoside hydrolase activity, wherein the amino acid
sequences of the polypeptides differ from amino acids 1 to 513 of
SEQ ID NO: 2 at one or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
differs at one or more positions corresponding to positions 8, 22,
41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356,
371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2.
[0014] The present invention also relates to isolated nucleotide
sequences encoding the variant glycoside hydrolases or polypeptides
having glycoside hydrolase activity and to nucleic acid constructs,
vectors, and host cells comprising the nucleotide sequences.
[0015] The present invention also relates to methods for producing
variants of a parent glycoside hydrolase or polypeptides having
glycoside hydrolase activity in a host cell.
[0016] The present invention also relates to methods for obtaining
a variant of a parent glycoside hydrolase, comprising:
[0017] (a) introducing a substitution at one or more positions
corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350,
373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further introducing a substitution at one or
more positions corresponding to positions 8, 22, 41, 49, 57, 113,
193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462
of amino acids 1 to 513 of SEQ ID NO: 2, wherein the variant has
glycoside hydrolase activity; and
[0018] (b) recovering the variant.
[0019] The present invention further relates to methods of using
the glycoside hydrolase variants in detergents and in the
conversion of cellulose to glucose.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1 shows a restriction map of pAJ052.
[0021] FIG. 2 shows a restriction map of pJC106.
[0022] FIG. 3 shows a restriction map of pAlLo1.
[0023] FIG. 4 shows a restriction map of pBANe10.
[0024] FIG. 5 shows a restriction map of pAlLo2.
[0025] FIG. 6 shows a restriction map of pCW026.
[0026] FIG. 7 shows a restriction map of pNP776G205R.
[0027] FIG. 8 shows a restriction map of pMJ04.
[0028] FIG. 9 shows a restriction map of pMJ06.
[0029] FIG. 10 shows a restriction map of pMJ09.
[0030] FIG. 11 shows a restriction map of pCW045.
[0031] FIG. 12 shows a restriction map of pSTM01.
[0032] FIG. 13 shows a restriction map of pSMK03.
[0033] FIG. 14 shows a restriction map of pEJG97.
[0034] FIG. 15 shows the genomic DNA sequence and the deduced amino
acid sequence of an Aspergillus fumigatus beta-glucosidase (SEQ ID
NOS: 56 and 57, respectively). The predicted signal peptide is
underlined and predicted introns are italicized.
[0035] FIG. 16 shows the thermal stability of Aspergillus fumigatus
beta-glucosidase at 50.degree. and 65.degree. C.
[0036] FIG. 17 shows the thermal stability of Aspergillus fumigatus
beta-glucosidase at 70.degree. C.
[0037] FIG. 18 shows the hydrolysis of cellobiose by Aspergillus
fumigatus beta-glucosidase at 65.degree. C.
[0038] FIG. 19 shows the time course profiles of PCS hydrolysis by
the parent Trichoderma reesei strain RutC30 and the strain
expressing variant 776-M57.
DETAILED DESCRIPTION OF THE INVENTION
[0039] The present invention relates to isolated variants of a
parent glycoside hydrolase, comprising a substitution at one or
more positions corresponding to positions 21, 94, 157, 205, 206,
247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further comprising a
substitution at one or more positions corresponding to positions 8,
22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301,
356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2,
wherein the variant has glycoside hydrolase activity.
[0040] Definitions
[0041] The term "glycoside hydrolase" is defined herein as
hydrolases described by Coutinho, P. M. and Henrissat, B., 1999,
Carbohydrate-active enzymes: an integrated database approach, in
"Recent Advances in Carbohydrate Bioengineering", H. J. Gilbert, G.
Davies, B. Henrissat and B. Svensson eds., The Royal Society of
Chemistry, Cambridge, pp. 3-12. Examples of glycoside hydrolases
include, but are not limited to, cellobiohydrolase, endoglucanase,
and exoglucanase. In a preferred embodiment, the glycoside
hydrolases belong to Family 7 as defined by Coutinho, P. M. and
Henrissat, B., 1999, supra.
[0042] The term "cellobiohydrolase" is defined herein as a
1,4-D-glucan cellobiohydrolase (E.C. 3.2.1.91) which catalyzes the
hydrolysis of 1,4-beta-D-glucosidic linkages in cellulose,
cellotetriose, or any beta-1,4-linked glucose containing polymer,
releasing cellobiose from the non-reducing ends of the chain. For
purposes of the present invention, cellobiohydrolase activity is
determined according to the procedures described by Lever et al.,
1972, Anal. Biochem. 47: 273-279 and by van Tilbeurgh et al., 1982,
FEBS Letters, 149: 152-156; van Tilbeurgh and Claeyssens, 1985,
FEBS Letters, 187: 283-288. In the present invention, the Lever et
al. method was employed to assess hydrolysis of cellulose in corn
stover, while the method of van Tilbeurgh et al. was used to
determine the cellobiohydrolase activity on a fluorescent
disaccharide derivative.
[0043] The term "endoglucanase" is defined herein as an
endo-1,4-(1,3;1,4)-beta-D-glucan 4-glucanohydrolase (E.C. No.
3.2.1.4) which catalyses endohydrolysis of 1,4-beta-D-glycosidic
linkages in cellulose, cellulose derivatives (such as carboxy
methyl cellulose and hydroxy ethyl cellulose), lichenin, beta-1,4
bonds in mixed beta-1,3 glucans such as cereal beta-D-glucans or
xyloglucans, and other plant material containing cellulosic
components. For purposes of the present invention, endoglucanase
activity is determined using carboxymethyl cellulose (CMC)
hydrolysis according to the procedure of Ghose, 1987, Pure and
Appl. Chem. 59: 257-268.
[0044] The term "exoglucanase" is defined herein as a
1,4-beta-D-glucan glucohydrolase (E.C. 3.2.1.74) which catalyzes
the hydrolysis of 1,4-linkages (O-glycosyl bonds) in
1,4-beta-D-glucans so as to remove successive glucose or cellobiose
units. For purposes of the present invention, exoglucanase activity
is determined according to the procedure described by Himmel et
al., 1986, J. Biol. Chem. 261: 12948-12955.
[0045] Variant: The term "variant" is defined herein as a glycoside
hydrolase comprising one or more alterations, such as
substitutions, insertions, deletions, and/or truncations of one or
more specific amino acid residues at one or more specific positions
in the polypeptide.
[0046] Wild-Type Enzyme: The term "wild-type" glycoside hydrolase
denotes a glycoside hydrolase expressed by a naturally occurring
microorganism, such as a yeast or a filamentous fungus found in
nature.
[0047] Parent Enzyme: The term "parent" glycoside hydrolase as used
herein means a glycoside hydrolase to which modifications, e.g.,
substitution(s), insertion(s), deletion(s), and/or truncation(s),
are made to produce the enzyme variants of the present invention.
This term also refers to the polypeptide with which a variant is
compared and aligned. The parent may be a naturally occurring (wild
type) polypeptide, or it may even be a variant thereof, prepared by
any suitable means. For instance, the parent protein may be a
variant of a naturally occurring polypeptide which has been
modified or altered in the amino acid sequence. A parent may also
be an allelic variant which is a polypeptide encoded by any of two
or more alternative forms of a gene occupying the same chromosomal
locus.
[0048] Shuffling: The term "shuffling" means recombination of
nucleotide sequence(s) between two or more homologous nucleotide
sequences resulting in recombined nucleotide sequences (i.e.,
nucleotide sequences having been subjected to a shuffling cycle)
having a number of nucleotides exchanged, in comparison to the
starting nucleotide sequences.
[0049] Randomized library: The term "randomized library", "variant
library", or "library" is defined herein as a library of variant
polypeptides. Diversity in the variant library can be generated via
mutagenesis of the genes encoding the variants at the DNA triplet
level, such that individual codons are variegated, e.g., by using
primers of partially randomized sequences in a PCR reaction.
Several techniques have been described, by which one can create a
diverse combinatorial library by variegating several nucleotide
positions in a gene and recombining them, for example, where these
positions are too far apart to be covered by a single (spiked or
doped) oligonucleotide primer. These techniques include the use of
in vivo recombination of the individually diversified gene segments
as described in WO 97/07205 on page 3, lines 8 to 29. They also
include the use of DNA shuffling techniques to create a library of
full length genes, wherein several gene segments are combined, and
wherein each segment may be diversified, e.g., by spiked
mutagenesis (Stemmer, 1994, Nature 370: 389-391; U.S. Pat. No.
5,811,238; U.S. Pat. No. 5,605,793; and U.S. Pat. No. 5,830,721).
One can use a gene encoding a protein "backbone" (wild type parent
polypeptide) as a template polynucleotide, and combine this with
one or more single or double-stranded oligonucleotides as described
in WO 98/41623 and WO 98/41622. The single-stranded
oligonucleotides can be partially randomized during synthesis. The
double-stranded oligonucleotides can be PCR products incorporating
diversity in a specific region. In both cases, one can dilute the
diversity with corresponding segments encoding the sequence of the
backbone protein in order to limit the average number of changes
that are introduced.
[0050] Recombination: The term "recombination" is defined herein as
a process wherein nucleic acids associate with each other in
regions of homology, leading to interstrand DNA exchange between
those sequences. For purposes of the present invention, homologous
recombination is determined according to the procedures summarized
by Paques and Haber, 1999, Microbiology and Molecular Biology
Reviews 63: 349-404. "Homologous recombination" is defined herein
as recombination in which no changes in the nucleotide sequences
occurs within the regions of homology relative to the input
nucleotide sequences. For perfect homologous recombination, the
regions should contain a sufficient number of nucleic acids, such
as 15 to 1,500 base pairs, preferably 100 to 1,500 base pairs, more
preferably 400 to 1,500 base pairs, and most preferably 800 to
1,500 base pairs, which are highly homologous with the
corresponding nucleic acid sequence to enhance the probability of
homologous recombination. The recombination may also occur by
non-homologous recombination. "Non-homologous recombination" is
defined herein as recombination where any mode of DNA repair
incorporating strand exchange results in a nucleotide sequence
different from any of the recombining sequences.
[0051] Improved property: The term "improved property" is defined
herein as a characteristic associated with a variant which is
improved compared to the parent glycoside hydrolase. Such improved
properties include, but are not limited to, altered
temperature-dependent activity profile, thermostability, pH
activity, pH stability, substrate specificity, product specificity,
and chemical stability.
[0052] Improved thermal activity: The term "improved thermal
activity" is defined herein as an alteration of the
temperature-dependent activity profile of a glycoside hydrolase
variant at a specific temperature relative to the
temperature-dependent activity profile of the parent glycoside
hydrolase. The thermal activity value provides a measure of the
enzyme's efficiency in performing catalysis of a hydrolysis
reaction over a range of temperatures. A glycoside hydrolase has a
specific temperature range wherein the protein is stable and
retains its enzymatic activity, but becomes less stable and thus
less active with increasing temperature. Furthermore, the initial
rate of a reaction catalyzed by a glycoside hydrolase can be
accelerated by an increase in temperature which is measured by
determining thermal activity of a variant. A more thermoactive
variant will lead to an increase in the rate of hydrolysis
decreasing the time required and/or decreasing the enzyme
concentration required for hydrolysis. Alternatively, a variant
with a reduced thermal activity will catalyze a hydrolysis reaction
at a temperature lower than the temperature optimum of the parent
enzyme defined by the temperature-dependent activity profile of the
parent.
[0053] Improved thermostability: The term "improved
thermostability" is defined herein as a variant enzyme displaying
retention of enzymatic activity after a period of incubation at
elevated temperature relative to the parent enzyme. Such a variant
may or may not display an altered thermal activity profile relative
to the parent. For example, a variant may have an improved ability
to refold following incubation at elevated temperature relative to
the parent.
[0054] In a preferred embodiment, the thermal activity of the
variant glycoside hydrolase is at least 1.5-fold, preferably at
least 2-fold, more preferably at least 5-fold, most preferably at
least 7-fold, and even most preferably at least 20-fold more
thermally active than the wild type variant when activity on
4-methylumbelliferyl beta-D-lactoside at 64.degree. C. or a higher
temperature is compared to activity at 50.degree. C., for 45
minutes at pH 5.0.
[0055] Improved product specificity: The term "improved product
specificity" is defined herein as a variant enzyme displaying an
altered product profile relative to the parent in which the altered
product profile improves the performance of the variant in a given
application relative to the parent. The term "product profile" is
defined herein as the chemical composition of the reaction products
produced by enzymatic hydrolysis.
[0056] Improved chemical stability: The term "improved chemical
stability" is defined herein as a variant enzyme displaying
retention of enzymatic activity after a period of incubation in the
presence of a chemical or chemicals, either naturally occurring or
synthetic, which reduce the enzymatic activity of the parent
enzyme. Improved chemical stability may also result in variants
better able to catalyze a reaction in the presence of such
chemicals.
[0057] Conventions for Designation of Variants
[0058] In the present invention, a specific numbering of amino acid
residue positions in the glycoside hydrolase variants is employed.
For example, by aligning the amino acid sequences of known
glycoside hydrolases, it is possible to designate an amino acid
position number to any amino acid residue in any glycoside
hydrolase enzyme.
[0059] Using the numbering system originating from the amino acid
sequence of the glycoside hydrolase disclosed in SEQ ID NO: 2,
aligned with the amino acid sequence of a number of other glycoside
hydrolases, it is possible to indicate the position of an amino
acid residue in a glycoside hydrolase in regions of structural
homology.
[0060] Multiple alignments of protein sequences may be made, for
example, using "ClustalW" (Thompson, J. D., Higgins, D. G. and
Gibson, T. J., 1994, CLUSTAL W: Improving the sensitivity of
progressive multiple sequence alignment through sequence weighting,
positions-specific gap penalties and weight matrix choice, Nucleic
Acids Research 22: 4673-4680). Multiple alignments of DNA sequences
may be done using the protein alignment as a template, replacing
the amino acids with the corresponding codon from the DNA
sequence.
[0061] Pairwise sequence comparison algorithms in common use are
adequate to detect similarities between protein sequences that have
not diverged beyond the point of approximately 20-30% sequence
identity (Doolittle, 1992, Protein Sci. 1: 191-200; Brenner et al.,
1998, Proc. Natl. Acad. Sci. USA 95, 6073-6078). However, truly
homologous proteins with the same fold and similar biological
function have often diverged to the point where traditional
sequence-based comparisons fail to detect their relationship
(Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Greater
sensitivity in sequence-based searching can be attained using
search programs that utilize probabilistic representations of
protein families (profiles) to search databases. For example, the
PSI-BLAST program generates profiles through an iterative database
search process and is capable of detecting remote homologs (Atschul
et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater
sensitivity can be achieved if the family or superfamily for the
protein of interest has one or more representatives in the protein
structure databases. Programs such as Gen THREADER (Jones 1999, J.
Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics
19: 874-881) utilize information from a variety of sources
(PSI-BLAST, secondary structure prediction, structural alignment
profiles, and solvation potentials) as input to a neural network
that predicts the structural fold for a query sequence. Similarly,
the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919, can
be used to align a sequence of unknown structure with the
superfamily models present in the SCOP database. These alignments
can in turn be used to generate homology models for the protein of
interest, and such models can be assessed for accuracy using a
variety of tools developed for that purpose.
[0062] For proteins of known structure, several tools and resources
are available for retrieving and generating structural alignments.
For example the SCOP superfamilies of proteins have been
structurally aligned, and those alignments are accessible and
downloadable. These alignments can be used to predict the
structurally and functionally corresponding amino acid residues in
proteins within the same structural superfamily. This information,
along with information derived from homology modeling and profile
searches, can be used to predict which residues to mutate when
moving mutations of interest from one protein to a close or remote
homolog.
[0063] In describing the various glycoside hydrolase variants of
the present invention, the nomenclature described below is adapted
for ease of reference. In all cases, the accepted IUPAC single
letter or triple letter amino acid abbreviation is employed.
[0064] Substitutions. For an amino acid substitution, the following
nomenclature is used: Original amino acid, position, substituted
amino acid. Accordingly, the substitution of threonine with alanine
at position 226 is designated as "Thr226Ala" or "T226A". Multiple
mutations are separated by addition marks ("+"), e.g.,
"Gly205Arg+Ser411Phe" or "G205R+S411F", representing mutations at
positions 205 and 411 substituting glycine (G) with arginine (R),
and serine (S) with phenylalanine (F), respectively.
[0065] Deletions. For an amino acid deletion, the following
nomenclature is used: Original amino acid, position*. Accordingly,
the deletion of glycine at position 195 is designated as "Gly195*"
or "G195*". Multiple deletions are separated by addition marks
("+"), e.g., "Gly195*+Ser411*" or "G195*+S411*".
[0066] Insertions. For an amino acid insertion, the following
nomenclature is used: Original amino acid, position, original amino
acid, new inserted amino acid. Accordingly the insertion of lysine
after glycine at position 195 is designated "Gly195GlyLys" or
"G195GK".
[0067] Multiple modifications. Variants comprising multiple
modifications are separated by addition marks ("+"), e.g.,
"Arg170Tyr+Gly195Glu" or "R170Y+G195E" representing modifications
at positions 170 and 195 substituting tyrosine and glutamic acid
for arginine and glycine, respectively.
[0068] Parent Glycoside Hydrolases
[0069] In the present invention, the parent glycoside hydrolase is
(a) a polypeptide comprising an amino acid sequence which has at
least 70% identity with amino acids 1 to 513 of SEQ ID NO: 2; or
(b) a polypeptide encoded by a nucleotide sequence which hybridizes
under at least low stringency conditions with nucleotides 52 to
1539 of SEQ ID NO: 1, or its complementary strand.
[0070] In a first aspect, the parent glycoside hydrolase comprises
an amino acid sequence which has a degree of identity to amino
acids 1 to 513 of SEQ ID NO: 2 of at least 70%, preferably at least
75%, more preferably at least 80%, more preferably at least 85%,
even more preferably at least 90%, most preferably at least 95%,
and even most preferably at least 97%, which have glycoside
hydrolase activity (hereinafter"homologous polypeptides"). For
purposes of the present invention, the degree of identity between
two amino acid sequences is determined by the Clustal method
(Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE.TM.
MEGALIGN.TM. software (DNASTAR, Inc., Madison, Wis.) with an
identity table and the following multiple alignment parameters: Gap
penalty of 10 and gap length penalty of 10. Pairwise alignment
parameters were Ktuple=1, gap penalty=3, windows=5, and
diagonals=5.
[0071] Substantially homologous parent glycoside hydrolases may
have one or more amino acid substitutions, deletions or additions.
These changes are preferably of a minor nature, that is
conservative amino acid substitutions as described above and other
substitutions that do not significantly affect the
three-dimensional folding or activity of the protein or
polypeptide; small deletions, typically of one to about 30 amino
acids; and small amino- or carboxyl-terminal extensions, such as an
amino-terminal methionine residue, a small linker peptide of up to
about 20-25 residues, or a small extension that facilitates
purification (an affinity tag), such as a poly-histidine tract, or
protein A (Nilsson et al., 1985, EMBO J. 4: 1075; Nilsson et al.,
1991, Methods Enzymol. 198: 3. See, also, in general, Ford et al.,
1991, Protein Expression and Purification 2: 95-107. Examples of
conservative modifications are within the group of basic amino
acids (arginine, lysine and histidine), acidic amino acids
(glutamic acid and aspartic acid), polar amino acids (glutamine and
asparagine), hydrophobic amino acids (leucine, isoleucine and
valine), aromatic amino acids (phenylalanine, tryptophan and
tyrosine), and small amino acids (glycine, alanine, serine,
threonine and methionine). Amino acid modifications, which do not
generally alter the specific activity are known in the art and are
described, for example, by H. Neurath and R. L. Hill, 1979, In, The
Proteins, Academic Press, New York. The most commonly occurring
exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr,
Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn,
Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly as well as the reverse
(Taylor, 1986, Journal of Theoretical Biology 119: 205-218.
[0072] Although the changes described above preferably are of a
minor nature, such changes may also be of a substantive nature such
as fusion of larger polypeptides of up to 300 amino acids or more
both as amino- or carboxyl-terminal extensions.
[0073] In addition to the 20 standard amino acids, non-standard
amino acids (such as 4-hydroxyproline, 6-N-methyl lysine,
2-aminoisobutyric acid, isovaline, and alpha-methyl serine) may be
substituted for amino acid residues of a wild-type glycoside
hydrolase. A limited number of non-conservative amino acids, amino
acids that are not encoded by the genetic code, and unnatural amino
acids may be substituted for amino acid residues. "Unnatural amino
acids" have been modified after protein synthesis, and/or have a
chemical structure in their side chain(s) different from that of
the standard amino acids. Unnatural amino acids can be chemically
synthesized, and preferably, are commercially available, and
include pipecolic acid, thiazolidine carboxylic acid,
dehydroproline, 3- and 4-methylproline, and
3,3-dimethylproline.
[0074] Preferably, the parent glycoside hydrolase comprises the
amino acid sequence of SEQ ID NO: 2; or an allelic variant thereof;
or a fragment thereof that has glycoside hydrolase activity. In a
preferred embodiment, the parent polypeptide comprises the amino
acid sequence of SEQ ID NO: 2. In another preferred embodiment, the
parent polypeptide comprises amino acids 1 to 513 of SEQ ID NO: 2;
or an allelic variant thereof; or a fragment thereof that has
glycoside hydrolase activity. In another preferred embodiment, the
parent polypeptide comprises amino acids 1 to 513 of SEQ ID NO: 2.
In another preferred embodiment, the parent polypeptide consists of
the amino acid sequence of SEQ ID NO: 2; or an allelic variant
thereof; or a fragment thereof that has glycoside hydrolase
activity. In another preferred embodiment, the parent polypeptide
consists of the amino acid sequence of SEQ ID NO: 2. In another
preferred embodiment, the parent polypeptide consists of amino
acids 1 to 513 of SEQ ID NO: 2 or an allelic variant thereof; or a
fragment thereof that has glycoside hydrolase activity. In another
preferred embodiment, the parent polypeptide is encoded by the
nucleotide sequence contained in plasmid pAJ052 which is contained
in Escherichia coli NRRL B-30683, wherein the nucleic acid sequence
encodes a polypeptide having glycoside hydrolase activity. In
another preferred embodiment, the parent polypeptide is encoded by
the mature polypeptide coding region contained in plasmid pAJ052
which is contained in Escherichia coli NRRL B-30683.
[0075] A fragment of SEQ ID NO: 2 is a polypeptide having one or
more amino acids deleted from the amino and/or carboxyl terminus of
this amino acid sequence. Preferably, a fragment contains at least
450 amino acid residues, more preferably at least 470 amino acid
residues, and most preferably at least 490 amino acid residues.
[0076] In a second aspect, the parent glycoside hydrolase is
encoded by a nucleotide sequence which hybridizes under low
stringency conditions, preferably medium stringency conditions,
more preferably medium-high stringency conditions, even more
preferably high stringency conditions, and most preferably very
high stringency conditions with a nucleotide probe which hybridizes
under the same conditions with (i) nucleotides 52 to 1539 of SEQ ID
NO: 1, (ii) the genomic nucleotide sequence comprising nucleotides
52 to 1539 of SEQ ID NO: 1, (iii) a subsequence of (i) or (ii), or
(iv) a complementary strand of (i), (ii), or (iii) (J. Sambrook, E.
F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory
Manual, 2d edition, Cold Spring Harbor, New York). The subsequence
of SEQ ID NO: 1 may be at least 100 contiguous nucleotides or
preferably at least 200 contiguous nucleotides. Moreover, the
subsequence may encode a polypeptide fragment which has glycoside
hydrolase activity.
[0077] A subsequence of SEQ ID NO: 1, or homologue thereof, is a
nucleotide sequence where one or more nucleotides have been deleted
from the 5'-and/or 3'-end. Preferably, a subsequence contains at
least 1350 nucleotides, more preferably at least 1410 nucleotides,
and most preferably at least 1470 nucleotides.
[0078] The parent polypeptide may also be an allelic variant of a
polypeptide that has glycoside hydrolase activity. An allelic
variant denotes any of two or more alternative forms of a gene
occupying the same chromosomal locus. Allelic variation arises
naturally through mutation, and may result in polymorphism within
populations. Gene mutations can be silent (no change in the encoded
polypeptide) or may encode polypeptides having altered amino acid
sequences. An allelic variant of a polypeptide is a polypeptide
encoded by an allelic variant of a gene.
[0079] The nucleotide sequence of SEQ ID NO: 1 or a subsequence
thereof, as well as the amino acid sequence of SEQ ID NO: 2, or a
fragment thereof, may be used to design nucleotide probes to
identify and clone DNA encoding parent polypeptides having
glycoside hydrolase activity from strains of different genera or
species according to methods well known in the art. In particular,
such probes can be used for hybridization with the genomic or cDNA
of the genus or species of interest, following standard Southern
blotting procedures, in order to identify and isolate the
corresponding gene therein. Such probes can be considerably shorter
than the entire sequence, but should be at least 15, preferably at
least 25, and more preferably at least 35 nucleotides in length.
Longer probes can also be used. Both DNA and RNA probes can be
used. The probes are typically labeled for detecting the
corresponding gene (for example, with .sup.32P, .sup.3H, .sup.35S,
biotin, or avidin).
[0080] A genomic DNA or cDNA library prepared from such other
organisms may be screened for DNA which hybridizes with the probes
described above and which encodes a parent polypeptide having
glycoside hydrolase activity. Genomic or other DNA from such other
organisms may be separated by agarose or polyacrylamide gel
electrophoresis, or other separation techniques. DNA from the
libraries or the separated DNA may be transferred to and
immobilized on nitrocellulose or other suitable carrier material.
In order to identify a clone or DNA which is homologous with SEQ ID
NO: 1, or a subsequence thereof, the carrier material is used in a
Southern blot. For purposes of the present invention, hybridization
indicates that the nucleotide sequence hybridizes to a labeled
nucleotide probe corresponding to the nucleotide sequence shown in
SEQ ID NO: 1, its complementary strand, or a subsequence thereof,
under low to very high stringency conditions. Molecules to which
the probe hybridizes can be detected using, for example, X-ray film
or any other detection means known in the art.
[0081] In a preferred embodiment, the nucleotide probe is a
nucleotide sequence which encodes the polypeptide of SEQ ID NO: 2,
or a subsequence thereof. In another preferred embodiment, the
nucleotide probe is SEQ ID NO: 1. In another preferred embodiment,
the nucleotide probe is nucleotides 52 to 1539 of SEQ ID NO: 1. In
another preferred embodiment, the nucleotide probe is the nucleic
acid sequence contained in plasmid pAJO52 which is contained in
Escherichia coli NRRL B-30683, wherein the nucleic acid sequence
encodes a polypeptide having glycoside hydrolase activity. In
another preferred embodiment, the nucleotide probe is the mature
polypeptide coding region contained in plasmid pAJ052 which is
contained in Escherichia coli NRRL B-30683.
[0082] For long probes of at least 100 nucleotides in length, low
to very high stringency conditions are defined as prehybridization
and hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200
.mu.g/ml sheared and denatured salmon sperm DNA, and either 25%
formamide for low stringencies, 35% formamide for medium and
medium-high stringencies, or 50% formamide for high and very high
stringencies, following standard Southern blotting procedures for
12 to 24 hours optimally.
[0083] For long probes of at least 100 nucleotides in length, the
carrier material is finally washed three times each for 15 minutes
using 2.times.SSC, 0.2% SDS preferably at least at least at
50.degree. C. (low stringency), more preferably at least at
55.degree. C. (medium stringency), more preferably at least at
60.degree. C. (medium-high stringency), most preferably at least at
65.degree. C. (high stringency), and even most preferably at least
at 70.degree. C. (very high stringency).
[0084] For short probes which are about 15 nucleotides to about 70
nucleotides in length, stringency conditions are defined as
prehybridization, hybridization, and washing post-hybridization at
about 5.degree. C. to about 10.degree. C. below the calculated
T.sub.m using the calculation according to Bolton and McCarthy
(1962, Proceedings of the National Academy of Sciences USA 48:1390)
in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40,
1.times. Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM
sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per
ml following standard Southern blotting procedures for 12 to 24
hours optimally.
[0085] For short probes which are about 15 nucleotides to about 70
nucleotides in length, the carrier material is washed once in
6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15
minutes using 6.times.SSC at 5.degree. C. to 10.degree. C. below
the calculated T.sub.m.
[0086] The parent glycoside hydrolase may be obtained from
microorganisms of any genus. For purposes of the present invention,
the term "obtained from" as used herein in connection with a given
source shall mean that the parent glycoside hydrolase encoded by a
nucleotide sequence is produced by the source or by a cell in which
the nucleotide sequence from the source has been inserted. In a
preferred embodiment, the parent glycoside hydrolase is secreted
extracellularly.
[0087] The parent glycoside hydrolase may be a fungal glycoside
hydrolase. In a preferred embodiment, the fungal glycoside
hydrolase is a yeast glycoside hydrolase such as a Candida,
Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or
Yarrowia glycoside hydrolase. In another preferred embodiment, the
fungal glycoside hydrolase is a filamentous fungal glycoside
hydrolase such as an Acremonium, Agaricus, Alternaria, Aspergillus,
Botryospaeria, Ceriporiopsis, Chaetomidium, Claviceps,
Cochliobolus, Coprinopsis, Coptotermes, Corynascus, Cryphonectria,
Diplodia, Exidia, Fusarium, Gibberella, Holomastigotoides,
Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe,
Melanocarpus, Meripilus, Myceliophthora, Neurospora, Penicillium,
Phanerochaete, Poitrasia, Pseudoplectania, Pseudotrichonympha,
Rhizomucor, Scytalidium, Talaromyces, Thermoascus, Thielavia,
Trichoderma, Trichophaea, Verticillium, Volvariella, or Xylaria
glycoside hydrolase.
[0088] In a more preferred embodiment, the parent glycoside
hydrolase is a Saccharomyces carlsbergensis, Saccharomyces
cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasil,
Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces
oviformis glycoside hydrolase.
[0089] In another more preferred embodiment, the parent glycoside
hydrolase is an Acremonium cellulolyticus, Aspergillus aculeatus,
Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus,
Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans,
Aspergillus niger, Aspergillus oryzae, Fusarium bactridioides,
Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum,
Fusarium graminearum, Fusarium graminum, Fusarium heterosporum,
Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum,
Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum,
Fusarium solani, Fusarium sporotrichioides, Fusarium sulphureum,
Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum,
Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex
lacteus, Mucor miehel, Mycellophthora thermophila, Neurospora
crassa, Penicllium funiculosum, Penicillium purpurogenum,
Phanerochaete chrysosporium, Schizophyllum commune, Sclerotlum
rolfsii, Sporotrichum cellulophilum, Talaromyces emersonii,
Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii,
Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma
viride glycoside hydrolase.
[0090] In an even more preferred embodiment, the parent glycoside
hydrolase is a Trichoderma reesei glycoside hydrolase, and most
preferably the Trichoderma reesei cellobiohydrolase I of SEQ ID NO:
2 or the mature polypeptide thereof. In another most preferred
embodiment, the parent glycoside hydrolase is encoded by the
nucleotide sequence contained in plasmid pAJO52 which is contained
in Escherichia coli NRRL B-30683, wherein the nucleotide sequence
encodes a polypeptide having glycoside hydrolase activity. In
another most preferred embodiment, the parent glycoside hydrolase
is encoded by the mature polypeptide coding region contained in
plasmid pAJO52 which is contained in Escherichia coliNRRL
B-30683.
[0091] It will be understood that for the aforementioned species,
the invention encompasses both the perfect and imperfect states,
and other taxonomic equivalents, e.g., anamorphs, regardless of the
species name by which they are known. Those skilled in the art will
readily recognize the identity of appropriate equivalents.
[0092] Strains of these species are readily accessible to the
public in a number of culture collections, such as the American
Type Culture Collection (ATCC), Deutsche Sammlung von
Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor
Schimmelcultures (CBS), and Agricultural Research Service Patent
Culture Collection, Northern Regional Research Center (NRRL).
[0093] The parent glycoside hydrolase may also be identified and
obtained from other sources including microorganisms isolated from
nature (e.g., soil, composts, water, etc.) or DNA samples obtained
directly from natural materials (e.g., soil, composts, water, etc,)
using the above-mentioned probes. Techniques for isolating
microorganisms and DNA directly from natural habitats are well
known in the art. The nucleotide sequence encoding a glycoside
hydrolase may then be derived by similarly screening a genomic or
cDNA library of another microorganism or mixed DNA sample. Once a
nucleotide sequence encoding a glycoside hydrolase has been
detected with suitable probe(s) as described herein, the sequence
may be isolated or cloned by utilizing techniques which are known
to those of ordinary skill in the art (see, e.g., 3. Sambrook, E.
F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory
Manual, 2d edition, Cold Spring Harbor, New York).
[0094] As defined herein, an "isolated" glycoside hydrolase is a
polypeptide which is essentially free of other non-glycoside
hydrolase polypeptides, e.g., at least 20% pure, preferably at
least 40% pure, more preferably at least 60% pure, even more
preferably at least 80% pure, most preferably at least 90% pure,
and even most preferably at least 95% pure, as determined by
SDS-PAGE.
[0095] The parent glycoside hydrolase can also include fused
polypeptides or cleavable fusion polypeptides in which another
polypeptide is fused at the N-terminus or the C-terminus of the
polypeptide or fragment thereof. A fused polypeptide is produced by
fusing a nucleotide sequence (or a portion thereof) encoding
another polypeptide to a nucleotide sequence (or a portion thereof)
of the present invention. Techniques for producing fusion
polypeptides are known in the art, and include ligating the coding
sequences encoding the polypeptides so that they are in frame and
that expression of the fused polypeptide is under control of the
same promoter(s) and terminator. Fusion proteins may also be
constructed using intein technology in which fusions are created
post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583;
Dawson et al., 1994, Science266: 776-779).
[0096] Essential amino acids in the parent glycoside hydrolase can
be identified according to procedures known in the art, such as
site-directed mutagenesis or alanine-scanning mutagenesis
(Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter
technique, single alanine mutations are introduced at every residue
in the molecule, and the resultant mutant molecules are tested for
biological activity (i.e., glycoside hydrolase activity) to
identify amino acid residues that are critical to the activity of
the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271:
4699-4708. The active site of the enzyme or other biological
interaction can also be determined by physical analysis of
structure, as determined by such techniques as nuclear magnetic
resonance, crystallography, electron diffraction or photoaffinity
labeling, in conjunction with mutation of putative contact site
amino acids. See, for example, de Vos et al., 1992, Science 255:
306-312;
[0097] Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et
al., 1992, FEBS Lett. 309:59-64. The identities of essential amino
acids can also be inferred from analysis of identities with
polypeptides which are related to a polypeptide according to the
invention.
[0098] Single or multiple amino acid substitutions can be made and
tested using known methods of mutagenesis, recombination, and/or
shuffling, followed by a relevant screening procedure, such as
those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241:
53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86:
2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be
used include error-prone PCR, phage display (e.g., Lowman et al.,
1991, Biochem. 30:10832-10837; U.S. Pat. No. 5,223,409; WO
92/06204) and region-directed mutagenesis (Derbyshire et al., 1986,
Gene 46:145; Ner et al., 1988, DNA 7:127).
[0099] Plasmids
[0100] The plasmid or plasmids used for preparing glycoside
hydrolase variants may be any plasmid or vector that may be
subjected to recombinant DNA procedures. The plasmid comprising a
nucleotide sequence encoding a glycoside hydrolase may be prepared
by ligating the nucleotide sequence into a suitable plasmid, or by
any other suitable method. The plasmid preferably contains one or
more selectable markers described herein which permit easy
selection of transformed cells. The choice of plasmid will often
depend on the host cell into which it is to be introduced.
[0101] In the present invention, the plasmid may be an autonomously
replicating plasmid, i.e., a plasmid which exists as an
extrachromosomal entity, the replication of which is distinct from
chromosomal replication.
[0102] The plasmid replicator may be any plasmid replicator
mediating autonomous replication which functions in a cell. The
term "plasmid replicator" is defined herein as a sequence that
enables a plasmid or vector to replicate in vivo. Examples of a
plasmid replicator useful in a yeast cell are the 2 micron origin
of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and
the combination of ARS4 and CEN6. Examples of a plasmid replicator
useful in a filamentous fungal cell are AMA1 and ANS1 (Gems et al.,
1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research
15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and
construction of plasmids or vectors comprising the gene can be
accomplished according to the methods disclosed in WO 00/24883.
[0103] The linearizing of the plasmid(s) can be directed toward any
site within the plasmid. The plasmid(s) may be linearized by any
suitable methods known in the art, for example, digestion with one
or more restriction enzymes. The linearized ends of the plasmid may
be filled-in with nucleotides as described by Pompon et al., 1989,
Gene 83: 15-24. However, it is preferred not to fill in the
linearized ends as it might create a frameshift.
[0104] To facilitate the screening process, the plasmid is
preferably an expression vector in which the nucleotide sequence in
question is operably linked to additional segments required for
transcription of the DNA. In general, the expression vector is
derived from a plasmid, a cosmid or a bacteriophage, or may contain
elements of any or all of these. For purposes of the present
invention, the terms "plasmid" and "vector" are used
interchangeably.
[0105] DNA Fragments
[0106] A library of DNA fragments to be randomly combined (or
"shuffled") with homologous regions in the linearized plasmid(s) by
in vivo recombination may be prepared by any suitable method. For
example, the DNA fragment may be prepared by PCR amplification
(e.g., error-prone PCR) of a plasmid comprising the nucleotide
sequence, using specific primers, for example, as described in U.S.
Pat. No. 4,683,202 or Saiki et al., 1988, Science 239: 487-491. The
DNA fragment may also be isolated from a plasmid comprising the
desired nucleotide sequence by digestion with restriction enzymes,
followed by isolation using, for example, electrophoresis.
[0107] The DNA fragment may alternatively be prepared synthetically
by established standard methods, e.g., the phosphoamidite method
described by Beaucage and Caruthers, 1981, Tetrahedron Letters 22:
1859-1869, or the method described by Matthes et al., 1984, EMBO
Journal 3: 801-805. According to the phosphoamidite method,
oligonucleotides are synthesized in an automatic DNA synthesizer,
purified, annealed, ligated, and cloned into suitable plasmids.
[0108] The DNA fragment may also be of mixed synthetic and genomic,
mixed synthetic and cDNA, or mixed genomic and cDNA origins
prepared by ligating fragments of synthetic, genomic or cDNA
origin, the fragments corresponding to various parts of the entire
nucleotide sequence, in accordance with standard techniques.
[0109] The library of DNA fragments comprise one or more mutations
of the nucleotide sequence, wherein the fragments comprise at least
two regions, one or more regions which are homologous to the
5'-region or the 3'-region of the gap in the linearized nucleotide
sequence and/or plasmid sequence and one or more second regions
which are homologous to the 5'-region or the 3'-region of the DNA
fragments of the library.
[0110] The regions of the DNA fragment may be any sequence that is
homologous with the nucleotide sequence and/or plasmid
sequence.
[0111] In a preferred embodiment, the regions of the DNA fragment
are a 5'-region and/or a 3'-region that flank a gene that encodes a
glycoside hydrolase, or a 5'-region and/or a 3'-region of a gene
that encodes a glycoside hydrolase.
[0112] In another preferred embodiment, the DNA fragment or
fragments are prepared under conditions resulting in low, medium or
high random mutagenesis frequency. To obtain low mutagenesis
frequency the nucleotide sequence(s) (comprising the DNA
fragment(s)) may be prepared by a standard PCR amplification method
(U.S. Pat. No. 4,683,202 or Saiki et al., 1988, Science239:
487-491). A medium or high mutagenesis frequency may be obtained by
performing the PCR amplification under conditions which reduce the
fidelity of replication by a thermostable polymerase and increase
the misincorporation of nucleotides, for example, as described by
Deshler, 1992, GATA 9:103-106; Leung et al., 1989, BioTechniques 1:
11-15.
[0113] The PCR amplification may be combined with a mutagenesis
step using a suitable physical or chemical mutagenizing agent,
e.g., one which induces transitions, transversions, inversions,
scrambling, deletions, and/or insertions.
[0114] In a preferred embodiment, the DNA fragment(s) to be
shuffled preferably have a length of about 15 bp to 8 kb, more
preferably about 30 bp to 6 kb, even more preferably about 40 bp to
6 kb, even more preferably about 80 bp to 4 kb, and most preferably
about 100 bp to 2 kb, to be able to interact optimally with the
linearized plasmid.
[0115] Fungal Cells
[0116] The fungal cell, into which the mixture of plasmid/fragment
nucleotide sequences are to be introduced, may be any fungal cell
useful in the present invention. A "recombination fungal cell" is
defined herein as a cell capable of mediating shuffling of a number
of homologous nucleotide sequences.
[0117] In a preferred embodiment, the fungal recombination cell is
a yeast cell. In a more preferred embodiment, the yeast
recombination cell is a Candida, Hansenula, Kluyveromyces, Pichia,
Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
[0118] In a most preferred embodiment, the yeast recombination cell
is a Kluyveromyces lactis, Saccharomyces carlsbergensis,
Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces
douglasii, Saccharomyces kluyveri, Saccharomyces norbensis,
Saccharomyces oviformis, or Yarrowia lipolytica cell.
[0119] In another preferred embodiment, the fungal recombination
cell is a filamentous fungal cell. In a more preferred embodiment,
the filamentous fungal recombination cell is an Acremonium,
Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora,
Penicillium, Thielavia, Tolypocladium, or Trichoderma cell.
[0120] In a most preferred embodiment, the filamentous fungal
recombination cell is an Aspergillus awamori, Aspergillus foetidus,
Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or
Aspergillus oryzae cell. In another most preferred embodiment, the
filamentous fungal recombination cell is a Fusarium bactridioides,
Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum,
Fusarium graminearum, Fusarium graminum, Fusarium heterosporum,
Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum,
Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum,
Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum,
Fusarium trichothecioides, or Fusarium venenatum cell. In another
most preferred embodiment, the filamentous fungal recombination
cell is a Humicola insolens, Humicola lanuginosa, Mucor miehei,
Mycellophthora thermophila, Neurospora crassa, Penicllium
purpurogenum, Thielavia terrestris, Trichoderma harzianum,
Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma
reesei, or Trichoderma viride cell.
[0121] In another most preferred embodiment, the Aspergillus cell
is an Aspergillus oryzae cell.
[0122] In another most preferred embodiment, the Aspergillus cell
is an Aspergillus niger cell.
[0123] In another most preferred embodiment, the Fusarium venenatum
cell is Fusarium venenatum A3/5, which was originally deposited as
Fusarium graminearum ATCC 20334 and recently reclassified as
Fusarium venenatum by Yoder and Christianson, 1998, Fungal Genetics
and Biology 23: 62-80 and O'Donnell et al., 1998, Fungal Genetics
and Biology 23: 57-67; as well as taxonomic equivalents of Fusarium
venenatum regardless of the species name by which they are
currently known. In another most preferred embodiment, the Fusarium
venenatum cell is a morphological mutant of Fusarium venenatum A3/5
or Fusarium venenatum ATCC 20334, as disclosed in WO 97/26330.
[0124] Fungal cells may be transformed by a process involving
protoplast formation, transformation of the protoplasts, and
regeneration of the cell wall in a manner known per se. Suitable
procedures for transformation of Aspergillus and Trichoderma host
cells are described in EP 238 023 and Yelton et al., 1984,
Proceedings of the National Academy of Sciences USA 81: 1470-1474.
Suitable methods for transforming Fusarium species are described by
Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast
may be transformed using the procedures described by Becker and
Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to
Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume
194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983,
Journal of Bacteriology 153: 163; and Hinnen et al., 1978,
Proceedings of the National Academy of Sciences USA 75: 1920.
[0125] In vivo Recombination
[0126] A large number of variants or homologous genes can be
combined in one transformation to efficiently create gene chimeras
from the homologous genes. The shuffling of these genes, encoding
improved variants, wild type genes, or a combination thereof,
results in chimeras that can be expressed and followed by screening
to identify those chimeras with the optimal combination of
beneficial mutations. The process increases multi-fold the number
of further improved variants that can be obtained compared to a
process that uses only random mutagenesis (for a review, see
Kuchner and Arnold, 1997, TIBTech 15: 523-530). Random mutagenesis
introduces mutations into a target nucleotide sequence, creating
deleterious mutations much more frequently than beneficial ones. In
iterative rounds of such mutagenesis, deleterious mutations
accumulate more rapidly than beneficial ones, effectively masking
the identification of beneficial mutations during screening. The
random recombination between two or more homologous nucleotide
sequences that contain multiple single nucleotide changes in their
nucleotide sequences potentially allows all those nucleotide
changes contained in one variant to be separated from one another
and to be randomly combined instead with any mutations present on
other variants. This shuffling of mutations provides a means by
which mutations from different parent sequences can be combined
with each other randomly to increase the probability of combining
nucleotide changes in a single nucleotide sequence.
[0127] Mutagenesis/shuffling methods can be combined with
high-throughput, automated screening methods to detect activity of
cloned, mutagenized polypeptides expressed by host cells.
Mutagenized DNA molecules that encode active polypeptides can be
recovered from the host cells and rapidly sequenced using standard
methods in the art. These methods allow the rapid determination of
the importance of individual amino acid residues in a polypeptide
of interest, and can be applied to polypeptides of unknown
structure.
[0128] Efficient recombination of multiple overlapping fragments
using the in vivo recombination method is a means to generate
chimeras from variants or homologous genes. An overlap as small as
15 bp is sufficient for recombination, and may be utilized for very
easy domain shuffling of even distantly related genes. In domain
shuffling, larger blocks of non-homologous DNA are randomly
assorted by means of stretches of homology at their termini.
[0129] It is preferred that at least one shuffling cycle is a
backcrossing cycle with the initially used DNA fragment or
fragments, which may be the wild-type DNA fragment. This eliminates
non-essential mutations. Non-essential mutations may also be
eliminated by using wild-type DNA fragments as the initially used
input DNA material.
[0130] More than two nucleotide sequences can be shuffled at the
same time, and can be advantageous as a vast number of quite
different variants can be made rapidly without an abundance of
iterative procedures. When recombining many fragments from the same
region, multiple overlapping of the fragments will increase the
frequency of DNA interchange by itself, but it is also important to
have a relatively high number of random crossovers in overlapping
regions in order to recombine closely located
variants/differences.
[0131] An overlap as small as 15 bp between two fragments is
sufficient to obtain an efficient recombination. Therefore,
overlapping in the range from 15 to 5000 bp, preferably from 30 bp
to 500 bp, especially 30 bp to 100 bp is suitable in the present
invention.
[0132] In the present invention, preferably 2 or more overlapping
fragments, more preferably 2 to 50 overlapping fragments, and most
preferably 2 to 10 overlapping fragments may advantageously be used
as DNA fragments in a shuffling cycle.
[0133] Besides allowing creation of chimeric genes, employing
overlapping fragments is a useful method for domain shuffling by
creating small overlaps between DNA fragments from different
domains and screening for the best combination. For example, in the
case of three DNA fragments, the overlapping regions may be as
follows: the first end of the first fragment overlaps the first end
of the linearized plasmid, the first end of the second fragment
overlaps the second end of the first fragment, and the second end
of the second fragment overlaps the first end of the third
fragment, the first end of the third fragment overlaps (as stated
above) the second end of the second fragment, and the second end of
the third fragment overlaps the second end of the linearized
plasmid.
[0134] It is understood that when using two or more DNA fragments
as the starting material, it is preferred to have continuous
overlaps between the ends of the plasmid and the DNA fragments.
[0135] Even though it is preferred to shuffle homologous nucleotide
sequences in the form of DNA fragment(s) and linearized plasmid(s),
it is also possible to shuffle two or more linearized plasmids
comprising homologous nucleotide sequences encoding polypeptides.
However, in such a case, it is important to linearize the plasmids
at different sites.
[0136] In the present invention, two or more linearized plasmids
and one or more homologous DNA fragments can be used as the
starting material to be shuffled. The ratio between the linearized
plasmid(s) and homologous DNA fragment(s) preferably lie in the
range from 20:1 to 1:50, and more preferably from 2:1 to 1:10 (mol
plasmid:mol fragments) with the specific concentrations being from
1 pM to 10 M of the DNA.
[0137] The linearized plasmids may be gapped in such a way that the
overlap between the fragments is deleted in the plasmid. The repair
of the gap in the plasmid then requires that the fragments
recombine with one another in addition to recombining with the ends
of the gapped plasmid in order to reconstitute a circular,
autonomously replicating plasmid. In a preferred embodiment, the
linearization of the plasmid or vector creates a sufficient gap in
the coding sequence of the nucleotide sequence to force the
homologous recombination of the DNA fragments with the
corresponding regions of the nucleotide sequence, recreating a
circular replicating plasmid.
[0138] Variants
[0139] In the present invention, the isolated variants of a parent
glycoside hydrolase comprise a substitution at one or more
positions corresponding to positions 21, 94, 157, 205, 206, 247,
337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513
of SEQ ID NO: 2, and optionally further comprise a substitution at
one or more positions corresponding to positions 8, 22, 41, 49, 57,
113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411,
and 462 of amino acids 1 to 513 of SEQ ID NO: 2, wherein the
variants, having glycoside hydrolase activity, comprise amino acid
sequences which have a degree of identity of at least 70%,
preferably at least 75%, more preferably at least 80%, more
preferably at least 85%, even more preferably at least 90%, most
preferably at least 95%, and even most preferably at least 97% to
the amino acid sequence of the parent glycoside hydrolase. For
purposes of the present invention, the degree of identity between
two amino acid sequences is determined by the Clustal method
(Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE.TM.
MEGALIGN.TM. software (DNASTAR, Inc., Madison, Wis.) with an
identity table and the following multiple alignment parameters: Gap
penalty of 10 and gap length penalty of 10. Pairwise alignment
parameters were Ktuple=1, gap penalty=3, windows=5, and
diagonals=5.
[0140] As defined herein, an "isolated variant" of a parent
glycoside hydrolase is a polypeptide which is essentially free of
other non-glycoside hydrolase polypeptides, e.g., at least 20%
pure, preferably at least 40% pure, more preferably at least 60%
pure, even more preferably at least 80% pure, most preferably at
least 90% pure, and even most preferably at least 95% pure, as
determined by SDS-PAGE.
[0141] In a preferred embodiment, the number of amino acid
substitutions in the variants of the present invention comprise
preferably 33, more preferably 32, even more preferably 31, even
more preferably 30, even more preferably 29, even more preferably
28, even more preferably 27, even more preferably 26, even more
preferably 25, even more preferably 24, even more preferably 23,
even more preferably 22, even more preferably 21, even more
preferably 20, even more preferably 19, even more preferably 18,
even more preferably 17, even more preferably 16, even more
preferably 15, even more preferably 14, even more preferably 13,
even more preferably 12, even more preferably 11, even more
preferably 10, even more preferably 9, even more preferably 8, even
more preferably 7, even more preferably 6, even more preferably 5,
even more preferably 4, even more preferably 3, even more
preferably 2, and most preferably 1.
[0142] In a preferred embodiment, the variant of a parent glycoside
hydrolase comprises a substitution at one or more positions
corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350,
373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further comprises a substitution at one or
more positions corresponding to positions 8, 22, 41, 49, 57, 113,
193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the variant of a parent glycoside hydrolase comprises
substitutions at two or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
comprises a substitution at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In another preferred embodiment, the variant of a
parent glycoside hydrolase comprises substitutions at three or more
positions corresponding to positions 21, 94, 157, 205, 206, 247,
337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513
of SEQ ID NO: 2, and optionally further comprises a substitution at
one or more positions corresponding to positions 8, 22, 41, 49, 57,
113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411,
and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In another
preferred embodiment, the variant of a parent glycoside hydrolase
comprises substitutions at four or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further comprises a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the variant of a parent glycoside hydrolase comprises
substitutions at five or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
comprises a substitution at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In another preferred embodiment, the variant of a
parent glycoside hydrolase comprises substitutions at six or more
positions corresponding to positions 21, 94, 157, 205, 206, 247,
337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513
of SEQ ID NO: 2, and optionally further comprises a substitution at
one or more positions corresponding to positions 8, 22, 41, 49, 57,
113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411,
and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In another
preferred embodiment, the variant of a parent glycoside hydrolase
comprises substitutions at seven or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further comprises a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the variant of a parent glycoside hydrolase comprises
substitutions at eight or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
comprises a substitution at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In another preferred embodiment, the variant of a
parent glycoside hydrolase comprises substitutions at nine or more
positions corresponding to positions 21, 94, 157, 205, 206, 247,
337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513
of SEQ ID NO: 2, and optionally further comprises a substitution at
one or more positions corresponding to positions 8, 22, 41, 49, 57,
113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411,
and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In another
preferred embodiment, the variant of a parent glycoside hydrolase
comprises substitutions at ten or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further comprises a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the variant of a parent glycoside hydrolase comprises
substitutions at eleven or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further comprises a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the variant of a parent glycoside hydrolase comprises
substitutions at twelve or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further comprises a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the variant of a parent glycoside hydrolase comprises
substitutions at thirteen or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further comprises a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the variant of a parent glycoside hydrolase comprises
substitutions at positions corresponding at least to positions 21,
94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486
of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
comprises a substitution at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2.
[0143] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 21 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 21 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Pro as a substitution
at a position corresponding to position 21 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution S21P of amino acids 1 to 513 of SEQ ID
NO: 2.
[0144] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 94 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 94 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Ser as a substitution
at a position corresponding to position 94 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution G94S of amino acids 1 to 513 of SEQ ID
NO: 2. In another even more preferred embodiment, the variant
comprises Ala as a substitution at a position corresponding to
position 94 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitution
G94A of amino acids 1 to 513 of SEQ ID NO: 2. In another even more
preferred embodiment, the variant comprises Arg as a substitution
at a position corresponding to position 94 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution G94R of amino acids 1 to 513 of SEQ ID
NO: 2. In another even more preferred embodiment, the variant
comprises Gln as a substitution at a position corresponding to
position 94 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitution
G94Q of amino acids 1 to 513 of SEQ ID NO: 2.
[0145] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 157 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 157 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Arg as a substitution
at a position corresponding to position 157 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution K157R of amino acids 1 to 513 of SEQ ID
NO: 2.
[0146] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 205 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 205 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Arg as a substitution
at a position corresponding to position 205 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution G205R of amino acids 1 to 513 of SEQ ID
NO: 2.
[0147] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 206 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 206 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Tyr as a substitution
at a position corresponding to position 206 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution H206Y of amino acids 1 to 513 of SEQ ID
NO: 2.
[0148] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 247 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 247 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Cys as a substitution
at a position corresponding to position 247 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution Y247C of amino acids 1 to 513 of SEQ ID
NO: 2.
[0149] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 337 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 337 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Val as a substitution
at a position corresponding to position 337 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution E337V of amino acids 1 to 513 of SEQ ID
NO: 2.
[0150] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 350 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 350 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Ser as a substitution
at a position corresponding to position 350 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution T350S of amino acids 1 to 513 of SEQ ID
NO: 2.
[0151] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 373 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 373 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises His as a substitution
at a position corresponding to position 373 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution N373H of amino acids 1 to 513 of SEQ ID
NO: 2.
[0152] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 383 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 383 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Ala as a substitution
at a position corresponding to position 383 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution T383A of amino acids 1 to 513 of SEQ ID
NO: 2.
[0153] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 438 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 438 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Leu as a substitution
at a position corresponding to position 438 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution P438L of amino acids 1 to 513 of SEQ ID
NO: 2.
[0154] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 455 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 455 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Ala as a substitution
at a position corresponding to position 455 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution T455A of amino acids 1 to 513 of SEQ ID
NO: 2.
[0155] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 467 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 467 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Ser as a substitution
at a position corresponding to position 467 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution G4675 of amino acids 1 to 513 of SEQ ID
NO: 2.
[0156] In another preferred embodiment, the variant comprises a
substitution at a position corresponding to position 486 of amino
acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant comprises a substitution at a position
corresponding to position 486 of amino acids 1 to 513 of SEQ ID NO:
2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the variant comprises Trp as a substitution
at a position corresponding to position 486 of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitution C486W of amino acids 1 to 513 of SEQ ID
NO: 2.
[0157] In a preferred embodiment, the variant further comprises a
substitution at a position corresponding to position 8 of amino
acids 1 to 513 of SEQ ID NO: 2. In a more preferred embodiment, the
variant further comprises a substitution at a position
corresponding to position 8 of amino acids 1 to 513 of SEQ ID NO: 2
with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even more
preferred embodiment, the variant further comprises Pro as a
substitution at a position corresponding to position 8 of amino
acids 1 to 513 of SEQ ID NO: 2. In a most preferred embodiment, the
variant further comprises the substitution 58P of amino acids 1 to
513 of SEQ ID NO: 2.
[0158] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position 22
of amino acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant further comprises a substitution at a
position corresponding to position 22 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another
even more preferred embodiment, the variant further comprises Asp
as a substitution at a position corresponding to position 22 of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant further comprises the substitution G22D of
amino acids 1 to 513 of SEQ ID NO: 2.
[0159] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position 41
of amino acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant further comprises a substitution at a
position corresponding to position 41 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another
even more preferred embodiment, the variant further comprises Ile
as a substitution at a position corresponding to position 41 of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant further comprises the substitution T41I of
amino acids 1 to 513 of SEQ ID NO: 2.
[0160] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position 49
of amino acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant further comprises a substitution at a
position corresponding to position 49 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another
even more preferred embodiment, the variant further comprises Ser
as a substitution at a position corresponding to position 49 of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant further comprises the substitution N49S of
amino acids 1 to 513 of SEQ ID NO: 2.
[0161] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position 57
of amino acids 1 to 513 of SEQ ID NO: 2. In another more preferred
embodiment, the variant further comprises a substitution at a
position corresponding to position 57 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another
even more preferred embodiment, the variant further comprises Asn
as a substitution at a position corresponding to position 57 of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant further comprises the substitution S57N of
amino acids 1 to 513 of SEQ ID NO: 2.
[0162] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
113 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 113 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Asn as a substitution at a position corresponding to
position 113 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution S113N of amino acids 1 to 513 of SEQ ID NO: 2.
[0163] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
193 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 193 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Lys as a substitution at a position corresponding to
position 193 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution E193K of amino acids 1 to 513 of SEQ ID NO: 2.
[0164] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
196 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 196 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Pro as a substitution at a position corresponding to
position 196 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution 5196P of amino acids 1 to 513 of SEQ ID NO: 2. In
another even more preferred embodiment, the variant further
comprises Thr as a substitution at a position corresponding to
position 196 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution 5196T of amino acids 1 to 513 of SEQ ID NO: 2. In
another even more preferred embodiment, the variant further
comprises Phe as a substitution at a position corresponding to
position 196 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution S196F of amino acids 1 to 513 of SEQ ID NO: 2.
[0165] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
226 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 226 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Ala as a substitution at a position corresponding to
position 226 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution T226A of amino acids 1 to 513 of SEQ ID NO: 2.
[0166] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
227 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 227 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Ala as a substitution at a position corresponding to
position 227 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution P227A of amino acids 1 to 513 of SEQ ID NO: 2. In
another even more preferred embodiment, the variant further
comprises Leu as a substitution at a position corresponding to
position 227 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution P227L of amino acids 1 to 513 of SEQ ID NO: 2. In
another even more preferred embodiment, the variant further
comprises Gly as a substitution at a position corresponding to
position 227 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution P227G of amino acids 1 to 513 of SEQ ID NO: 2.
[0167] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
246 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 246 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Ile as a substitution at a position corresponding to
position 246 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution T246I of amino acids 1 to 513 of SEQ ID NO: 2.
[0168] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
251 of amino acids 1 to 513 of SEQ.ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 251 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Lys as a substitution at a position corresponding to
position 251 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution R251K of amino acids 1 to 513 of SEQ ID NO: 2.
[0169] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
255 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 255 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Pro as a substitution at a position corresponding to
position 255 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution T255P of amino acids 1 to 513 of SEQ ID NO: 2.
[0170] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
259 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 259 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Asn as a substitution at a position corresponding to
position 259 ofino acids 1 to 513 of SEQ ID NO: 2. In another most
preferred embodiment, the variant further comprises the
substitution D259N of amino acids 1 to 513 of SEQ ID NO: 2.
[0171] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
301 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 301 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Ser as a substitution at a position corresponding to
position 301 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution N301S of amino acids 1 to 513 of SEQ ID NO: 2.
[0172] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
356 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 356 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Ile as a substitution at a position corresponding to
position 356 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0173] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
371 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 371 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Cys as a substitution at a position corresponding to
position 371 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution Y371C of amino acids 1 to 513 of SEQ ID NO: 2.
[0174] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
411 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 411 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Phe as a substitution at a position corresponding to
position 411 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0175] In another preferred embodiment, the variant further
comprises a substitution at a position corresponding to position
462 of amino acids 1 to 513 of SEQ ID NO: 2. In another more
preferred embodiment, the variant further comprises a substitution
at a position corresponding to position 462 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
another even more preferred embodiment, the variant further
comprises Ala as a substitution at a position corresponding to
position 462 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant further comprises the
substitution T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0176] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 227 and 259
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 227 and 259 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Gly (or Ala or
Leu) and Asn as substitutions at positions corresponding to
positions 227 and 259, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions P227G (or P227A or P227L)+D259N of
amino acids 1 to 513 of SEQ ID NO: 2.
[0177] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 227 and 486
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 227 and 486 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ala (or Leu or
Gly) and Trp as substitutions at positions corresponding to
positions 227 and 486, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions P227A (or P227L or P227G)+C486W of
amino acids 1 to 513 of SEQ ID NO: 2.
[0178] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 301 and 337
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 301 and 337 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp; Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ser and Val as
substitutions at positions corresponding to positions 301 and 337,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
N301S +E337V of amino acids 1 to 513 of SEQ ID NO: 2.
[0179] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196 and 350
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196 and 350 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro (or Thr or
Phe) and Ser as substitutions at positions corresponding to
positions 196 and 350, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S196P (or S196T or S196F)+T350S of
amino acids 1 to 513 of SEQ ID NO: 2.
[0180] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 22 and 467 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 22 and 467 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asp and Ser as
substitutions at positions corresponding to positions 22 and 467,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the
substitutions-G22D+G467S of amino acids 1 to 513 of SEQ ID NO:
2.
[0181] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21 and 57 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21 and 57 of amino acids 1 to 513 of SEQ
ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro and Asn as
substitutions at positions corresponding to positions 21 and 57,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S21P+S57N of amino acids 1 to 513 of SEQ ID NO: 2.
[0182] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 205 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 205 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Phe as
substitutions at positions corresponding to positions 205 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
G205R+5411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0183] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 205 and 227
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 205 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Ala (or
Leu or Gly) as substitutions at positions corresponding to
positions 205 and 227, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions G205R+P227A (or P227L or P227G) of
amino acids 1 to 513 of SEQ ID NO: 2.
[0184] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 205 and 206
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 205 and 206 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Tyr as
substitutions at positions corresponding to positions 205 and 206,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
G205R+H206Y of amino acids 1 to 513 of SEQ ID NO: 2.
[0185] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 8 and 205 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 8 and 205 of amino acids 1 to 513 of SEQ
ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro and Arg as
substitutions at positions corresponding to positions 8 and 205,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S8P+G205R of amino acids 1 to 513 of SEQ ID NO: 2.
[0186] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 94 and 205 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 94 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ser (or Ala or Arg
or Gin) and Arg as substitutions at positions corresponding to
positions 94 and 205, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions G94S (or G94A or G94R or G94Q)+G205R of
amino acids 1 to 513 of SEQ ID NO: 2.
[0187] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196 and 205
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro (or Thr or
Phe) and Arg as substitutions at positions corresponding to
positions 196 and 205, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S196P (or S196T or S196F)+G205R of
amino acids 1 to 513 of SEQ ID NO: 2.
[0188] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 383 and 455
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 383 and 455 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ala and Ala as
substitutions at positions corresponding to positions 383 and 455,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
T383A+T455A of amino acids 1 to 513 of SEQ ID NO: 2.
[0189] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Phe as
substitutions at positions corresponding to positions 113 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S113N+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0190] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113 and 196
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113 and 196 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Thr (or
Pro or Phe) as substitutions at positions corresponding to
positions 113 and 196, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S113N+S196T (or S196P or S196F) of
amino acids 1 to 513 of SEQ ID NO: 2.
[0191] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113 and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Ala as
substitutions at positions corresponding to positions 113 and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S113N+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0192] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196 and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Thr (or Pro or
Phe) and Ala as substitutions at positions corresponding to
positions 196 and 462, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S196T (or S196P or S196F)+T462A of
amino acids 1 to 513 of SEQ ID NO: 2.
[0193] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196 and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 41 and 196 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprisesile and Phe (or Pro
or Thr) as substitutions at positions corresponding to positions 41
and 196, respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In
another most preferred embodiment, the variant comprises the
substitutions T41I+S196F (or S196P or S196T) of amino acids 1 to
513 of SEQ ID NO: 2.
[0194] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 94 and 226 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 94 and 226 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ala (or Ser or Arg
or Gin) and Ala as substitutions at positions corresponding to
positions 94 and 226, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions G94A (or G94S or G94R or G94Q)+T226A of
amino acids 1 to 513 of SEQ ID NO: 2.
[0195] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196, and
462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113, 196, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Thr
(or Pro or Phe), and Ala as substitutions at positions
corresponding to positions 113, 196, and 462, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S113N+S196T (or
S196P or S196F)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0196] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 157 and 205
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 157 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Arg as
substitutions at positions corresponding to positions 157 and 205,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
K157R+G205R of amino acids 1 to 513 of SEQ ID NO: 2.
[0197] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 157 and 255
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 157 and 255 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Pro as
substitutions at positions corresponding to positions 157 and 255,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
K157R+T255P of amino acids 1 to 513 of SEQ ID NO: 2.
[0198] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 205 and 255
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 205 and 255 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Pro as
substitutions at positions corresponding to positions 205 and 255,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
G205R+T255P of amino acids 1 to 513 of SEQ ID NO: 2.
[0199] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 157, 205, and
255 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 157, 205, and 255 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Arg, Arg,
and Pro as substitutions at positions corresponding to positions
157, 205, and 255, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the variant comprises
the substitutions K157R+G205R+T255P of amino acids 1 to 513 of SEQ
ID NO: 2.
[0200] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 41 and 193 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 41 and 193 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ile and Lys as
substitutions at positions corresponding to positions 41 and 193,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
T41I+E193K of amino acids 1 to 513 of SEQ ID NO: 2.
[0201] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 41 and 411 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 41 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ile and Phe as
substitutions at positions corresponding to positions 41 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
T41I+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0202] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 193 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 193 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Lys and Phe as
substitutions at positions corresponding to positions 193 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
E193K+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0203] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 41, 193, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 41, 193, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Ile, Lys, and
Phe as substitutions at positions corresponding to positions 41,
193, and 411, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions T41I+E193K+S411F of amino acids 1 to 513 of SEQ ID
NO: 2.
[0204] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 247 and 371
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 247 and 371 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Cys and Cys as
substitutions at positions corresponding to positions 247 and 371,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
Y247C+Y371C of amino acids 1 to 513 of SEQ ID NO: 2.
[0205] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 247 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 247 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Cys and Phe as
substitutions at positions corresponding to positions 247 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
Y247C+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0206] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 371 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 371 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Cys and Phe as
substitutions at positions corresponding to positions 371 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
Y371C+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0207] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 247, 371, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 247, 371, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Cys, Cys,
and Phe as substitutions at positions corresponding to positions
247, 371, and 411, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the variant comprises
the substitutions Y247C+Y371C+S411F of amino acids 1 to 513 of SEQ
ID NO: 2.
[0208] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113 and 227
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Ala (or
Leu or Gly) as substitutions at positions corresponding to
positions 113 and 227, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S113N+P227A (or P227L or P227G) of
amino acids 1 to 513 of SEQ ID NO: 2.
[0209] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196 and 227
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Thr (or Pro or
Phe) and Ala (or Leu or Gly) as substitutions at positions
corresponding to positions 196 and 227, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S196T (or S196P
or S196F)+P227A (or P227L or P227G) of amino acids 1 to 513 of SEQ
ID NO: 2.
[0210] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 227 and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 227 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ala (or Leu or
Gly) and Ala as substitutions at positions corresponding to
positions 227 and 462, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions P227A (or P227L or P227G)+T462A of
amino acids 1 to 513 of SEQ ID NO: 2.
[0211] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196, and
227 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 142, 196, and 227 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Thr
(or Pro or Phe), and Ala as substitutions at positions
corresponding to positions 142, 196, and 227, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2.
[0212] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 227, and
462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Ala
(or Leu or Gly), and Ala as substitutions at positions
corresponding to positions 113, 227, and 462, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S113N+P227A (or
P227L or P227G)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0213] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196, 227, and
462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Thr (or
Pro or Phe), Ala (or Leu or Gly), and Ala as substitutions at
positions corresponding to positions 196, 227, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S196T (or S196P or S196F)+P227A (or P227L or P227G)+T462A of amino
acids 1 to 513 ID NO: 2.
[0214] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196,
227, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 113, 196, 227, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Asn, Thr (or Pro or Phe), Ala (or Leu or Gly), and Ala as
substitutions at positions corresponding to positions 113, 196,
227, and 462, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S113N+S196T (or S196P or S196F)+P227A (or P227L or
P227G)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0215] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 49 and 113 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 49 and 113 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ser and Asn as
substitutions at positions corresponding to positions 49 and 113,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
N49S+S113N of amino acids 1 to 513 of SEQ ID NO: 2.
[0216] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 49 and 227 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 49 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises-Ser and Ala (or
Leu or Gly) as substitutions at positions corresponding to
positions 49 and 227, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions N49S+P227A (or P227L or P227G) of amino
acids 1 to 513 of SEQ ID NO: 2.
[0217] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 49 and 438 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 49 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ser and Leu as
substitutions at positions corresponding to positions 49 and 438,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
N49S+P438L of amino acids 1 to 513 of SEQ ID NO: 2.
[0218] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113 and 438
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Leu as
substitutions at positions corresponding to positions 113 and 438,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S113N+P438L of amino acids 1 to 513 of SEQ ID NO: 2.
[0219] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 227 and 438
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 227 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ala (or Leu or
Gly) and Leu as substitutions at positions corresponding to
positions 227 and 438, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions P227A (or P227L or P227G)+P438L of
amino acids 1 to 513 of SEQ ID NO: 2.
[0220] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 49, 113, and
227 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 49, 113, and 227 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Ser, Asn, and
Ala (or Leu or Gly) as substitutions at positions corresponding to
positions 49, 113, and 227, respectively, of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions N49S+S113N+P227A (or P227L or P227G) of
amino acids 1 to 513 of SEQ ID NO: 2.
[0221] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 49, 227, and
438 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 49, 227, and 438 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Ser, Ala (or
Leu or Gly), and Leu as substitutions at positions corresponding to
positions 49, 227, and 438, respectively, of amino acids 1 to 513
of SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions N495 +P227A (or P227L or P227G)+P438L
of amino acids 1 to 513 of SEQ ID NO: 2.
[0222] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 227, and
438 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113, 227, and 438 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Ala
(or Leu or Gly), and Leu as substitutions at positions
corresponding to positions 113, 227, and 438, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S113N+P227A (or
P227L or P227G)+P438L of amino acids 1 to 513 of SEQ ID NO: 2.
[0223] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 49, 113, and
438 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 49, 113, and 438 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Ser, Asn, and
Leu as substitutions at positions corresponding to positions 49,
113, and 438, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions N49S+S113N+P438L of amino acids 1 to 513 of SEQ ID
NO: 2.
[0224] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 49, 113, 227,
and 438 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 49, 113, 227, and 438 of amino
acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the variant comprises
Ser, Asn, Ala (or Leu or Gly), and Leu as substitutions at
positions corresponding to positions 49, 113, 227, and 438,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
N49S+S113N+P227A (or P227L or P227G)+P438L of amino acids 1 to 513
of SEQ ID NO: 2.
[0225] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 157 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 157 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu; Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Phe as
substitutions at positions corresponding to positions 157 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
K157R+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0226] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 205 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 205 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Arg and Phe as
substitutions at positions corresponding to positions 205 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
G205R+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0227] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 255 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 255 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro and Phe as
substitutions at positions corresponding to positions 255 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
T255P+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0228] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 157, 255, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 157, 255, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, GIU, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Arg, Pro,
and Phe as substitutions at positions corresponding to positions
157, 255, and 411, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the variant comprises
the substitutions K157R+T255P+S411F of amino acids 1 to 513 of SEQ
ID NO: 2.
[0229] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 205, 255, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 205, 255, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Arg, Pro,
and Phe as substitutions at positions corresponding to positions
205, 255, and 411, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the variant comprises
the substitutions G205R+T255P+S411F of amino acids 1 to 513 of SEQ
ID NO: 2.
[0230] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 157, 205, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 157, 205, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Arg, Arg,
and Phe as substitutions at positions corresponding to positions
157, 205, and 411, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the variant comprises
the substitutions K157R+G205R+S411F of amino acids 1 to 513 of SEQ
ID NO: 2.
[0231] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 157, 205,
255, and 411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 157, 205, 255, and 411 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Arg, Arg, Pro, and Phe as substitutions at positions
corresponding to positions 157, 205, 255, and 411, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions K157R,
G205R+T255P+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0232] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Thr (or Pro or
Phe) and Phe as substitutions at positions corresponding to
positions 196 and 411, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S196T (or S196P or S196F)+S411F of
amino acids 1 to 513 of SEQ ID NO: 2.
[0233] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 227 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 227 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ala (or Leu or
Gly) and Phe as substitutions at positions corresponding to
positions 227 and 411, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions P227A (or P227L or P227G)+S411F of
amino acids 1 to 513 of SEQ ID NO: 2.
[0234] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 227, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113, 227, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Ala
(or Leu or Gly), and Phe as substitutions at positions
corresponding to positions 113, 227, and 411, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S113N+P227A (or
P227L or P227G)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0235] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196, 227, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196, 227, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Thr (or
Pro or Phe), Ala (or Leu or Gly), and Phe as substitutions at
positions corresponding to positions 196, 227, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S196T (or S196P or S196F)+P227A (or P227L or P227G)+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0236] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113, 196, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Thr
(or Pro or Phe), and Phe as substitutions at positions
corresponding to positions 113, 196, and 411, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S113N+S196T (or
S196P or S196F)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0237] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196,
227, and 411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 113, 196, 227, and 411 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Asn, Thr (or Pro or Phe), Ala (or Leu or Gly), and Phe as
substitutions at positions corresponding to positions 113, 196,
227, and 411, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S113N+S196T (or S196P or S196F)+P227A (or P227L or
P227G)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0238] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113 and 356
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr,-Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Ile as
substitutions at positions corresponding to positions 113 and 356,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S113N+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0239] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196 and 356
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Thr (or Pro or
Phe) and Ile as substitutions at positions corresponding to
positions 196 and 356, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S196T (or S196P or S196F)+T356I of
amino acids 1 to 513 of SEQ ID NO: 2.
[0240] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 227 and 356
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 227 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ala (or Leu or
Gly) and Ile as substitutions at positions corresponding to
positions 227 and 356, respectively, of amino acids 1 to 513 of SEQ
ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions P227A (or P227L or P227G)+T356I of
amino acids 1 to 513 of SEQ ID NO: 2.
[0241] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 356 and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 356 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser. Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ile and Ala as
substitutions at positions corresponding to positions 356 and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
T356I+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0242] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 227, and
356 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113, 227, and 356 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Ala
(or Leu or Gly), and Ile as substitutions at positions
corresponding to positions 113, 227, and 356, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S113N+P227A (or
P227L or P227G)+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0243] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196, 227, and
356 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196, 227, and 356 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Thr (or
Pro or Phe), Ala (or Leu or Gly), and Ile as substitutions at
positions corresponding to positions 196, 227, and 356,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S196T (or S196P or S196F)+P227A (or P227L or P227G)+T356I of amino
acids 1 to 513 of SEQ ID NO: 2.
[0244] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196, 227, and
462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Thr (or
Pro or Phe), Ala (or Leu or Gly), and Ala as substitutions at
positions corresponding to positions 196, 227, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S196T (or S196P or S196F)+P227A (or P227L or P227G)+T462A of amino
acids 1 to 513 of SEQ ID NO: 2.
[0245] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196, 356, and
462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 196, 356, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Thr (or
Pro or Phe), Ile, and Ala as substitutions at positions
corresponding to positions 196, 356, and 462, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions S196T (or S196P
or S196F)+T356I+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0246] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196, and
356 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 113, 196, and 356 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Asn, Thr
(or Pro or Phe), and Ile as substitutions at positions
corresponding to positions 113, 196, and 356, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another-most preferred
embodiment, the variant comprises the substitutions S113N+S196T (or
S196P or S196F)+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0247] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 227, 356, and
462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 227, 356, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Ala (or
Leu or Gly), Ile, and Ala as substitutions at positions
corresponding to positions 227, 356, and 462, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions P227A (or P227L
or P227G)+T356I+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0248] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196,
227, and 356 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 113, 196, 227, and 356 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Asn, Thr (or Pro or Phe), Ala (or Leu or Gly), and Ile as
substitutions at positions corresponding to positions 113, 196,
227, and 356 respectively, of amino acids 1 to 513 of SEQ ID NO: 2.
In another most preferred embodiment, the variant comprises the
substitutions S113N+S196T (or S196P or S196F)+P227A (or P227L or
P227G)+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0249] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 227,
356, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 113, 227, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Asn, Ala (or Leu or Gly), Ile, and Ala as substitutions
at positions corresponding to positions 113, 227, 356, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S113N+P227A (or P227L or P227G)+T356I+T462A of amino acids 1 to 513
of SEQ ID NO: 2.
[0250] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196,
356, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 113, 196, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Asn, Thr (or Pro or Phe), Ile, and Ala as substitutions
at positions corresponding to positions 113, 196, 356, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S113N+S196T (or S196P or S196F)+T356I+T462A of amino acids 1 to 513
of SEQ ID NO: 2.
[0251] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 196, 227,
356, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 196, 227, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Thr (or Pro or Phe), Ala (or Leu or Gly), Ile, and Ala as
substitutions at positions corresponding to positions 196, 227,
356, and 462, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S196T (or S196P or S196F)+P227A (or P227L or
P227G)+T356I+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0252] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 113, 196,
227, 356, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In a
more preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 113, 196, 227, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Asn, Thr (or Pro or Phe), Ala (or Leu or Gly), Ile, and
Ala as substitutions at positions corresponding to positions 113,
196, 227, 356, and 462, respectively, of amino acids 1 to 513 of
SEQ ID NO: 2. In another most preferred embodiment, the variant
comprises the substitutions S113N+S196T (or S196P or S196F)+P227A
(or P227L or P227G)+T356I+T462A of amino acids 1 to 513 of SEQ ID
NO: 2.
[0253] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21 and 246 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21 and 246 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro and Ile as
substitutions at positions corresponding to positions 21 and 246,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S21P+T246I of amino acids 1 to 513 of SEQ ID NO: 2.
[0254] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21 and 251 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro and Lys as
substitutions at positions corresponding to positions 21 and 251,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S21P+R251K of amino acids 1 to 513 of SEQ ID NO: 2.
[0255] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21 and 411 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Pro and Phe as
substitutions at positions corresponding to positions 21 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S21P+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0256] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 57 and 246 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 57 and 246 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Ile as
substitutions at positions corresponding to positions 57 and 246,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S57N+T246I of amino acids 1 to 513 of SEQ ID NO: 2.
[0257] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 57 and 251 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 57 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Lys as
substitutions at positions corresponding to positions 57 and 251,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S57N+R251K of amino acids 1 to 513 of SEQ ID NO: 2.
[0258] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 57 and 411 of
amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 57 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Asn and Phe as
substitutions at positions corresponding to positions 57 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
S57N+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0259] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 246 and 251
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 246 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ile and Lys as
substitutions at positions corresponding to positions 246 and 251,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
T246I+R251K of amino acids 1 to 513 of SEQ ID NO: 2.
[0260] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 246 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 246 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Ile and Phe as
substitutions at positions corresponding to positions 246 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
T246I+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0261] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 251 and 411
of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 251 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the variant comprises Lys and Phe as
substitutions at positions corresponding to positions 251 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the variant comprises the substitutions
R251K+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0262] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 57, and
246 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21, 57, and 246 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Pro, Asn, and
Ile as substitutions at positions corresponding to positions 21,
57, and 246, respectively, of amino acids 1 to 513 of SEQ ID NO: 2.
In another most preferred embodiment, the variant comprises the
substitutions S21P+S57N+T246I of amino acids 1 to 513 of SEQ ID
NO:2.
[0263] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 246, and
251 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21, 246, and 251 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Pro, Ile, and
Lys as substitutions at positions corresponding to positions 21,
246, and 251, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S21P+T246I+R251K of amino acids 1 to 513 of SEQ ID
NO: 2.
[0264] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 246, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21, 246, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Pro, Ile, and
Phe as substitutions at positions corresponding to positions 21,
246, and 411, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S21P+T2461+S411F of amino acids 1 to 513 of SEQ ID
NO: 2.
[0265] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 57, 246, and
251 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 57, 246, and 251 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Asn, Ile, and
Lys as substitutions at positions corresponding to positions 57,
246, and 251, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S57N+T246I+R251K of amino acids 1 to 513 of SEQ ID
NO: 2.
[0266] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 57, 246, and
411 of amino acids ito 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 57, 246, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Asn, Ile, and
Phe as substitutions at positions corresponding to positions 57,
246, and 411, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S57N+T246I+S411F of amino acids 1 to 513 of SEQ ID
NO: 2.
[0267] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 57, 251, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 57, 251, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Asn, Lys, and
Phe as substitutions at positions corresponding to positions 57,
251, and 411, respectively, of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the variant comprises the
substitutions S57N+R251K+S411F of amino acids 1 to 513 of SEQ ID
NO: 2.
[0268] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 57, and
251 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 21, 57, and 251 of amino acids 1 to 513
of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the variant comprises Pro, Asn, and
Lys as substitutions at positions corresponding to positions 21,
57, and 251, respectively, of amino acids 1 to 513 of SEQ ID NO: 2.
In another most preferred embodiment, the variant comprises the
substitutions S21P+S57N+R251K of amino acids 1 to 513 of SEQ ID NO:
2.
[0269] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 246, 251, and
411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more preferred
embodiment, the variant comprises substitutions at positions
corresponding to positions 246, 251, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In
an even more preferred embodiment, the variant comprises Ile, Lys,
and Phe as substitutions at positions corresponding to positions
246, 251, and 411, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the variant comprises
the substitutions T246I+R251K+S411F of amino acids 1 to 513 of SEQ
ID NO: 2.
[0270] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 57, 246,
and,251 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 21, 57, 246, and 251 of amino
acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the variant comprises
Pro, Asn, Ile, and Lys as substitutions at positions corresponding
to positions 21, 57, 246, and 251 respectively, of amino acids 1 to
513 of SEQ ID NO: 2. In another most preferred embodiment, the
variant comprises the substitutions S21P+S57N+T246I+R251K of amino
acids 1 to 513 of SEQ ID NO: 2.
[0271] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 246, 251,
and 411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 21, 246, 251, and 411 of amino
acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the variant comprises
Pro, Ile, Lys, and Phe as substitutions at positions corresponding
to positions 21, 246, 251, and 411, respectively, of amino acids 1
to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
variant comprises the substitutions S21P+T246I+R251K+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0272] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 57, 251,
and 411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 21, 57, 251, and 411 of amino
acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the variant comprises
Pro, Asn, Lys, and Phe as substitutions at positions corresponding
to positions 21, 57, 251, and 411, respectively, of amino acids 1
to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
variant comprises the substitutions S21P+S57N+R251K+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0273] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 57, 246, 251,
and 411 of amino acids 1 to,513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 57, 246, 251, and 411 of amino
acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the variant comprises
Asn, Ile, Lys, and Phe as substitutions at positions corresponding
to positions 57, 246, 251, and 411, respectively, of amino acids 1
to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
variant comprises the substitutions S57N+T246I+R251K+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0274] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 57, 246,
and 411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 21, 57, 246, and 411 of amino
acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the variant comprises
Pro, Asn, Ile, and Phe as substitutions at positions corresponding
to positions 21, 57, 246, and 411, respectively, of amino acids 1
to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
variant comprises the substitutions S21P+S57N+T246I+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0275] In another preferred embodiment, the variant comprises
substitutions at positions corresponding to positions 21, 57, 246,
251, and 411 of amino acids 1 to 513 of SEQ ID NO: 2. In a more
preferred embodiment, the variant comprises substitutions at
positions corresponding to positions 21, 57, 246, 251, and 411 of
amino acids 1 to 513 of SEQ ID NO: 2 with Ala, Arg, Pro, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the variant
comprises Pro, Asn, Ile, Lys, and Phe as substitutions at positions
corresponding to positions 21, 57, 246, 251, and 411, respectively,
of amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the variant comprises the substitutions
S21P+S57N+T246I+R251K+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0276] In another preferred embodiment, the variant comprises at
least one substitution selected from the group consisting of S21P,
G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y,
P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V, T350S,
N373H, T383A, P438L, T455A, G467S, and C486W of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further comprises one or more
substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T3561, Y371C,
S411F, and T462A.
[0277] In another preferred embodiment, the variant comprises at
least two substitutions selected from the group consisting of S21P,
G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y,
P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V, T350S,
N373H, T383A, P438L, T455A, G467S, and C486W of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further comprises one or more
substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0278] In another preferred embodiment, the variant comprises at
least three substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P.sub.438L, T455A, G467S, and C486W of amino
acids 1 to 513 of SEQ ID NO: 2, and optionally further comprises
one or more substitutions selected from the group consisting of
S8P, G22D, T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P,
T356I, Y371C, 5411F, and T462A.
[0279] In another preferred embodiment, the variant comprises at
least four substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G4675, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A. 30 In another preferred embodiment, the variant
comprises at least five substitutions selected from the group
consisting of S21P, G945, G94A, G94R, G94Q, K157R, E193K, S196P,
S196F, G205R, H206Y, P227L, P227G, T246I, Y247C, D259N, R251K,
N301S, E337V, T350S, N373H, T383A, P438L, T455A, G467S, and C486W
of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
comprises one or more substitutions selected from the group
consisting of S8P, G22D, T41S, N49S, S57N, S113N, S196T, T226A,
P227A, T255P, T356I, Y371C, S411F, and T462A.
[0280] In another preferred embodiment, the variant comprises at
least six substitutions selected from the group consisting of S21P,
G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y,
P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V, T350S,
N373H, T383A, P438L, T455A, G467S, and C486W of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further comprises one or more
substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0281] In another preferred embodiment, the variant comprises at
least seven substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0282] In another preferred embodiment, the variant comprises at
least eight substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0283] In another preferred embodiment, the variant comprises at
least nine substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0284] In another preferred embodiment, the variant comprises at
least ten substitutions selected from the group consisting of S21P,
G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y,
P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V, T350S,
N373H, T383A, P438L, T455A, G467S, and C486W of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further comprises one or more
substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0285] In another preferred embodiment, the variant comprises at
least eleven substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0286] In another preferred embodiment, the variant comprises at
least twelve substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0287] In another preferred embodiment, the variant comprises at
least thirteen substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0288] In another preferred embodiment, the variant comprises at
least fourteen substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, ZG94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T305S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0289] In another preferred embodiment, the variant comprises at
least fifteen substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0290] In another preferred embodiment, the variant comprises at
least sixteen substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0291] In another preferred embodiment, the variant comprises at
least seventeen substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0292] In another preferred embodiment, the variant comprises at
least eighteen substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0293] In another preferred embodiment, the variant comprises at
least nineteen substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0294] In another preferred embodiment, the variant comprises at
least twenty substitutions selected from the group consisting of
S21P, G94S, G94A, G94R, G94Q, K157R, E193K, S196P, S196F, G205R,
H206Y, P227L, P227G, T246I, Y247C, D259N, R251K, N301S, E337V,
T350S, N373H, T383A, P438L, T455A, G467S, and C486W of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further comprises one or
more substitutions selected from the group consisting of S8P, G22D,
T41I, N49S, S57N, S113N, S196T, T226A, P227A, T255P, T356I, Y371C,
S411F, and T462A.
[0295] In another preferred embodiment, the variant comprises
substitutions consisting of at least S21P, G94S, G94A, G94R, G94Q,
K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G, T246I,
Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A, P438L,
T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID NO: 2,
and optionally further comprises one or more substitutions selected
from the group consisting of S8P, G22D, T41I, N49S, S57N, S113N,
S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and T462A.
[0296] The variants of the present invention may further comprise
one or more deletions and/or insertions of the amino acid
sequence.
[0297] In a preferred embodiment, a variant of the present
invention consists of 341 to 350, 351 to 360, 361 to 370, 371 to
380, 381 to 390, 391 to 400, 401 to 410, 411 to 420, 421 to 430,
431 to 440, 441 to 450, 451 to 460, 461 to 470, 471 to 480, 481 to
490, 491 to 500, or 501 to 513 amino acids.
[0298] In another preferred embodiment, the variant comprising the
substitution T226A of amino acids 1 to 513 of SEQ ID NO: 2 is
encoded by the nucleotide sequence contained in E. coli NRRL
B-30657. In another preferred embodiment, the variant comprising
the substitutions S113N+S196T+T462A of amino acids 1 to 513 of SEQ
ID NO: 2 is encoded by the nucleotide sequence contained in E. coli
NRRL B-30658. In another preferred embodiment, the variant
comprising the substitutions G22D+G467S of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30659. In another preferred embodiment, the variant
comprising the substitutions S21P+S57N of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30661. In another preferred embodiment, the variant
comprising the substitutions K157R+G205R+T255P of amino acids 1 to
513 of SEQ ID NO: 2 is encoded by the nucleotide sequence contained
in E. coli NRRL B-30662. In another preferred embodiment, the
variant comprising the substitutions S196P+G205R of amino acids 1
to 513 of SEQ ID NO: 2 is encoded by the nucleotide sequence
contained in E. coli NRRL B-30663. In another preferred embodiment,
the variant comprising the substitutions S113N+S196T+P227A+T462A of
amino acids 1 to 513 of SEQ ID NO: 2 is encoded by the nucleotide
sequence contained in E. coli NRRL B-30664. In another preferred
embodiment, the variant comprising the substitutions
T41I+E193K+S411F of amino acids 1 to 513 of SEQ ID NO: 2 is encoded
by the nucleotide sequence contained in E. coli NRRL B-30665. In
another preferred embodiment, the variant comprising the
substitutions N49S+S113N+P227A+P438L of amino acids 1 to 513 of SEQ
ID NO: 2 is encode by the nucleotide sequence contained in E. coli
NRRL B-30666. In another preferred embodiment, the variant
comprising the substitutions N301S+E337V of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30674. In another preferred embodiment, the variant
comprising the substitutions S196P+T350S of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30675. In another preferred embodiment, the variant
comprising the substitutions G205R+H206Y of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30676. In another preferred embodiment, the variant
comprising the substitutions S8P+G205R of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30677. In another preferred embodiment, the variant
comprising the substitutions G94S+G205R of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30678. In another preferred embodiment, the variant
comprising the substitutions T383A+T455A of amino acids 1 to 513 of
SEQ ID NO: 2 is encoded by the nucleotide sequence contained in E.
coli NRRL B-30679. In another preferred embodiment, the variant
comprising the substitution N373H of amino acids 1 to 513 of SEQ ID
NO: 2 is encoded by the nucleotide sequence contained in E. coli
NRRL B-30680. In another preferred embodiment, the variant
comprising the substitutions Y247C+Y371C+S411F of amino acids 1 to
513 of SEQ ID NO: 2 is encoded by the nucleotide sequence contained
in E. coli NRRL B-30681. In another preferred embodiment, the
variant comprising the substitutions S21P+S57N+T246I+R251K+S411F of
amino acids 1 to 513 of SEQ ID NO: 2 is encoded by the nucleotide
sequence contained in E. coli NRRL B-30682. In another preferred
embodiment, the variant comprising the substitutions P227G+D259N of
amino acids 1 to 513 of SEQ ID NO: 2 is encoded by the nucleotide
sequence contained in E. coli NRRL B-30762.
[0299] The present invention also relates to methods for obtaining
a variant of a parent glycoside hydrolase, comprising: (a)
introducing into the parent glycoside hydrolase a substitution at
one or more positions corresponding to positions 21, 94, 157, 205,
206, 247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further introducing a
substitution at one or more positions corresponding to positions 8,
22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301,
356, 371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2,
wherein the variant has glycoside hydrolase activity; and (b)
recovering the variant.
[0300] Nucleotide Sequences
[0301] The present invention also relates to isolated nucleotide
sequences which encode variants of a parent glycoside hydrolase,
wherein the nucleotide sequences have been modified to encode the
variants described herein comprising a substitution at one or more
positions corresponding to positions 21, 94, 157, 205, 206, 247,
337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to 513
of SEQ ID NO: 2, and optionally further comprising a substitution
at one or more positions corresponding to positions 8, 22, 41, 49,
57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371,
411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2.
[0302] The term "isolated nucleotide sequence" as used herein
refers to a nucleotide sequence which is essentially free of other
nucleotide sequences, e.g., at least 20% pure, preferably at least
40% pure, more preferably at least 60% pure, even more preferably
at least 80%0 pure, and most preferably at least 90% pure as
determined by agarose electrophoresis.
[0303] In a preferred embodiment, the isolated nucleotide sequence
encoding the variant comprising the substitution T226A of amino
acids 1 to 513 of SEQ ID NO: 2 is contained in E. coli NRRL
B-30657. In another preferred embodiment, the isolated nucleotide
sequence encoding the variant comprising the substitutions
S113N+S196T+T462A of amino acids 1 to 513 of SEQ ID NO: 2 is
contained in E. coli NRRL B-30658. In another preferred embodiment,
the isolated nucleotide sequence encoding the variant comprising
the substitutions G22D+G467S of amino acids 1 to 513 of SEQ ID NO:
2 is contained in E. coli NRRL B-30659. In another preferred
embodiment, the isolated nucleotide sequence encoding the variant
comprising the substitutions S21P+S57N of amino acids 1 to 513 of
SEQ ID NO: 2 is contained in E. coli NRRL B-30661. In another
preferred embodiment, the isolated nucleotide sequence encoding the
variant comprising the substitutions K157R+G205R+T255P of amino
acids 1 to 513 of SEQ ID NO: 2 is contained in E. coli NRRL
B-30662. In another preferred embodiment, the isolated nucleotide
sequence encoding the variant comprising the substitutions
S196P+G205R of amino acids 1 to 513 of SEQ ID NO: 2 is contained in
E. coli NRRL B-30663. In another preferred embodiment, the isolated
nucleotide sequence encoding the variant comprising the
substitutions S113N+S196T+P227A+T462A of amino acids 1 to 513 of
SEQ ID NO: 2 is contained in E. coli NRRL B-30664. In another
preferred embodiment, the isolated nucleotide sequence encoding the
variant comprising the substitutions T41I+E193K+S411F of amino
acids 1 to 513 of SEQ ID NO: 2 is contained in E. coli NRRL
B-30665. In another preferred embodiment, the isolated nucleotide
sequence encoding the variant comprising the substitutions
N49S+S113N+P227A+P438L of amino acids 1 to 513 of SEQ ID NO: 2 is
contained in E. coli NRRL B-30666. In another preferred embodiment,
the variant comprising the substitutions N301S+E337V of amino acids
1 to 513 of SEQ ID NO: 2 is contained in E. coli NRRL B-30674. In
another preferred embodiment, the isolated nucleotide sequence
encoding the variant comprising the substitutions S196P+T350S of
amino acids 1 to 513 of SEQ ID NO: 2 is contained in E. coli NRRL
B-30675. In another preferred embodiment, the isolated nucleotide
sequence encoding the variant comprising the substitutions
G205R+H206Y of amino acids 1 to 513 of SEQ ID NO: 2 is contained in
E. coli NRRL B-30676. In another preferred embodiment, the isolated
nucleotide sequence encoding the variant comprising the
substitutions S8P+G205R of amino acids 1 to 513 of SEQ ID NO: 2 is
contained in E. coli NRRL B-30677. In another preferred embodiment,
the isolated nucleotide sequence encoding the variant comprising
the substitutions G94S+G205R of amino acids 1 to 513 of SEQ ID NO:
2 is contained in E. coli NRRL B-30678. In another preferred
embodiment, the isolated nucleotide sequence encoding the variant
comprising the substitutions T383A+T455A of amino acids 1 to 513 of
SEQ ID NO: 2 is contained in E. coli NRRL B-30679. In another
preferred embodiment, the isolated nucleotide sequence encoding the
variant comprising the substitution N373H of amino acids 1 to 513
of SEQ ID NO: 2 is contained in E. coli NRRL B-30680. In another
preferred embodiment, the isolated nucleotide sequence encoding the
variant comprising the substitutions Y247C+Y371C+S411F of amino
acids 1 to 513 of SEQ ID NO: 2 is contained in E. coli NRRL
B-30681. In another preferred embodiment, the isolated nucleotide
sequence encoding the variant comprising the substitutions
S21P+S57N+T246I+R251K+S411F of amino acids 1 to 513 of SEQ ID NO: 2
is contained in E. coli NRRL B-30682. In another preferred
embodiment, the isolated nucleotide sequence encoding the variant
comprising the substitutions P227G+D259N of amino acids 1 to 513 of
SEQ ID NO: 2 is contained in E. coli NRRL B-30762.
[0304] Nucleic Acid Constructs
[0305] The present invention also relates to nucleic acid
constructs comprising a nucleotide sequence encoding a glycoside
hydrolase variant of the present invention operably linked to one
or more control sequences which direct the expression of the coding
sequence in a suitable host cell under conditions compatible with
the control sequences. Expression will be understood to include any
step involved in the production of the variant including, but not
limited to, transcription, post-transcriptional modification,
translation, post-translational modification, and secretion.
"Nucleic acid construct" is defined herein as a nucleic acid
molecule, either single- or double-stranded, which is isolated from
a naturally occurring gene or which has been modified to contain
segments of nucleic acid combined and juxtaposed in a manner that
would not otherwise exist in nature. The term nucleic acid
construct is synonymous with the term expression cassette when the
nucleic acid construct contains all the control sequences required
for expression of a coding sequence of a variant of the present
invention. The term "coding sequence" is defined herein as a
nucleotide sequence which directly specifies the amino acid
sequence of its protein product. The boundaries of a genomic coding
sequence are generally determined by the ATG start codon, or
alternative start codons such as GTG and TTG, located just upstream
of the open reading frame at the 5'-end of the mRNA and a
transcription terminator sequence located just downstream of the
open reading frame at the 3'-end of the mRNA. A coding sequence can
include, but is not limited to, DNA, cDNA, and recombinant
nucleotide sequences.
[0306] An isolated nucleotide sequence encoding a glycoside
hydrolase variant of the present invention may be manipulated in a
variety of ways to provide for expression of the variant.
Manipulation of the nucleotide sequence prior to its insertion into
a vector may be desirable or necessary depending on the expression
vector. The techniques for modifying nucleotide sequences utilizing
recombinant DNA methods are well known in the art.
[0307] The term "control sequences" is defined herein to include
all components which are necessary or advantageous for the
expression of a glycoside hydrolase variant of the present
invention. Each control sequence may be native or foreign to the
nucleotide sequence encoding the variant. Such control sequences
include, but are not limited to, a leader, polyadenylation
sequence, propeptide sequence, promoter, signal peptide sequence,
and transcription terminator. At a minimum, the control sequences
include a promoter, and transcriptional and translational stop
signals. The control sequences may be provided with linkers for the
purpose of introducing specific restriction sites facilitating
ligation of the control sequences with the coding region of the
nucleotide sequence encoding a variant glycoside hydrolase of the
present invention. The term "operably linked" is defined herein as
a configuration in which a control sequence is appropriately placed
at a position relative to the coding sequence of the nucleotide
sequence such that the control sequence directs the expression of a
variant glycoside hydrolase.
[0308] The control sequence may be an appropriate promoter
sequence, which is recognized by a host cell for expression of the
nucleotide sequence. The promoter sequence contains transcriptional
control sequences which mediate the expression of the variant
glycoside hydrolase. The promoter may be any nucleic acid sequence
which shows transcriptional activity in the host cell of choice
including mutant, truncated, and hybrid promoters, and may be
obtained from genes encoding extracellular or intracellular
polypeptides either homologous or heterologous to the host
cell.
[0309] Examples of suitable promoters for directing the
transcription of the nucleic acid constructs of the present
invention in a filamentous fungal host cell are promoters obtained
from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor
miehei aspartic proteinase, Aspergillus niger neutral
alpha-amylase, Aspergillus niger acid stable alpha-amylase,
Aspergillus niger or Aspergillus awamori glucoamylase (glaA),
Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease,
Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans
acetamidase, Fusarium venenatum amyloglucosidase, Fusarium
oxysporum trypsin-like protease (WO 96/00787), Trichoderma reesei
beta-glucosidase, Trichoderma reesei cellobiohydrolase I,
Trichoderma reesei endoglucanase I, Trichoderma reesei
endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma
reesei endoglucanase IV, Trichoderma reesei endoglucanase V,
Trichoderma reesei xylanase I, Trichoderma reesei xylanase II,
Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter
(a hybrid of the promoters from the genes for Aspergillus niger
neutral alpha-amylase and Aspergillus oryzae triose phosphate
isomerase); equivalents thereof; and mutant, truncated, and hybrid
promoters thereof.
[0310] In a yeast host, useful promoters are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
(ADH1,ADH2/GAP), Saccharomyces cerevisiae triose phosphate
isomerase (TPI), Saccharomyces cerevisiae metallothionine (CUP1),
and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other
useful promoters for yeast host cells are described by Romanos et
al., 1992, Yeast8: 423-488.
[0311] The control sequence may also be a suitable transcription
terminator sequence, which is recognized by a host cell to
terminate transcription. The terminator sequence is operably linked
to the 3'-terminus of the nucleotide sequence encoding the variant
glycoside hydrolase. Any terminator which is functional in the host
cell of choice may be used in the present invention.
[0312] Preferred terminators for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase,
Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate
synthase, Aspergillus niger alpha-glucosidase, and Fusarium
oxysporum trypsin-like protease.
[0313] Preferred terminators for yeast host cells are obtained from
the genes for Saccharomyces cerevisiae enolase, Saccharomyces
cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae
glyceraldehyde-3-phosph- ate dehydrogenase. Other useful
terminators for yeast host cells are described by Romanos et al.,
1992, supra.
[0314] The control sequence may also be a suitable leader sequence,
a nontranslated region of an mRNA which is important for
translation by the host cell. The leader sequence is operably
linked to the 5'-terminus of the nucleotide sequence encoding the
variant glycoside hydrolase. Any leader sequence that is functional
in the host cell of choice may be used in the present
invention.
[0315] Preferred leaders for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase and
Aspergillus nidulans triose phosphate isomerase.
[0316] Suitable leaders for yeast host cells are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae
alpha-factor, and Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
(ADH2/GAP).
[0317] The control sequence may also be a polyadenylation sequence,
a sequence operably linked to the 3'-terminus of the
polypeptide-encoding sequence and which, when transcribed, is
recognized by the host cell as a signal to add polyadenosine
residues to transcribed mRNA. Any polyadenylation sequence which is
functional in the host cell of choice may be used in the present
invention.
[0318] Preferred polyadenylation sequences for filamentous fungal
host cells are obtained from the genes for Aspergillus oryzae TAKA
amylase, Aspergillus niger glucoamylase, Aspergillus nidulans
anthranilate synthase, Fusarium oxysporum trypsin-like protease,
and Aspergillus niger alpha-glucosidase.
[0319] Useful polyadenylation sequences for yeast host cells are
described by Guo and Sherman, 1995, Molecular Cellular Biology 15:
5983-5990.
[0320] The control sequence may also be a signal peptide coding
region that codes for an amino acid sequence linked to the amino
terminus of a variant glycoside hydrolase and directs the encoded
polypeptide into the cell's secretory pathway. The 5'-end of the
coding sequence of the nucleotide sequence may inherently contain a
signal peptide coding region naturally linked in translation
reading frame with the segment of the coding region which encodes
the secreted variant glycoside hydrolase. Alternatively, the 5'-end
of the coding sequence may contain a signal peptide coding region
which is foreign to the coding sequence. The foreign signal peptide
coding region may be required where the coding sequence does not
naturally contain a signal peptide coding region. Alternatively,
the foreign signal peptide coding region may simply replace the
natural signal peptide coding region in order to enhance secretion
of the variant glycoside hydrolase. However, any signal peptide
coding region which directs the expressed polypeptide into the
secretory pathway of a host cell of choice may be used in the
present invention.
[0321] Effective signal peptide coding regions for filamentous
fungal host cells are the signal peptide coding regions obtained
from the genes for Aspergillus oryzae TAKA amylase, Aspergillus
niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor
miehei aspartic proteinase, Humicola insolens Cel45A cellulase, and
Humicola lanuginosa lipase.
[0322] Useful signal peptides for yeast host cells are obtained
from the genes for Saccharomyces cerevisiae alpha-factor and
Saccharomyces cerevisiae invertase. Other useful signal peptide
coding regions are described by Romanos et al., 1992, supra.
[0323] The control sequence may also be a propeptide coding region
that codes for an amino acid sequence positioned at the amino
terminus of a variant glycoside hydrolase. The resultant
polypeptide is known as a proenzyme or propolypeptide (or a zymogen
in some cases). A propolypeptide is generally inactive and can be
converted to a mature active polypeptide by catalytic or
autocatalytic cleavage of the propeptide from the propolypeptide.
The propeptide coding region may be obtained from the genes for
Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic
proteinase, and Myceliophthora thermophila laccase (WO
95/33836).
[0324] Where both signal peptide and propeptide regions are present
at the amino terminus of a polypeptide, the propeptide region is
positioned next to the amino terminus of a polypeptide and the
signal peptide region is positioned next to the amino terminus of
the propeptide region.
[0325] It may also be desirable to add regulatory sequences which
allow the regulation of the expression of the variant glycoside
hydrolase relative to the growth of the host cell. Examples of
regulatory systems are those which cause the expression of the gene
to be turned on or off in response to a chemical or physical
stimulus, including the presence of a regulatory compound. In
yeast, the ADH2 system or GALL system may be used. In filamentous
fungi, the TAKA alpha-amylase promoter, Aspergillus niger
glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter
may be used as regulatory sequences. Other examples of regulatory
sequences are those which allow for gene amplification. In
eukaryotic systems, these include the dihydrofolate reductase gene
which is amplified in the presence of methotrexate, and the
metallothionein genes which are amplified with heavy metals. In
these cases, the nucleotide sequence encoding the variant glycoside
hydrolase would be operably linked with the regulatory
sequence.
[0326] Expression Vectors
[0327] The present invention also relates to recombinant expression
vectors comprising a nucleotide sequence encoding a variant
glycoside hydrolase of the present invention, a promoter, and
transcriptional and translational stop signals. The various
nucleotide and control sequences described above may be joined
together to produce a recombinant expression vector which may
include one or more convenient restriction sites to allow for
insertion or substitution of the nucleotide sequence encoding the
variant at such sites. Alternatively, the nucleotide sequence may
be expressed by inserting the nucleotide sequence or a nucleic acid
construct comprising the sequence into an appropriate vector for
expression. In creating the expression vector, the coding sequence
is located in the vector so that the coding sequence is operably
linked with the appropriate control sequences for expression.
[0328] The recombinant expression vector may be any vector (e.g., a
plasmid or virus) which can be conveniently subjected to
recombinant DNA procedures and can bring about the expression of
the nucleotide sequence. The choice-of the vector will typically
depend on the compatibility of the vector with the host cell into
which the vector is to be introduced. The vectors may be linear or
closed circular plasmids.
[0329] The vectors of the present invention preferably contain one
or more selectable markers which permit easy selection of
transformed cells. A selectable marker is a gene the product of
which provides for biocide or viral resistance, resistance to heavy
metals, prototrophy to auxotrophs, and the like. Suitable markers
for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and
URA3. Selectable markers for use in a filamentous fungal host cell
include, but are not limited to, amdS (acetamidase), argB
(ornithine carbamoyltransferase), bar (phosphinothricin
acetyltransferase), hph (hygromycin phosphotransferase),
niaD(nitrate reductase), pyrG(orotidine-5'-phosphate
decarboxylase), sC(sulfate adenyltransferase), and
trpC(anthranilate synthase), as well as equivalents thereof.
Preferred for use in an Aspergillus cell are the amdS and pyrG
genes of Aspergillus nidulans or Aspergillus oryzae and the bar
gene of Streptomyces hygroscopicus.
[0330] The vector may be an autonomously replicating vector, i.e.,
a vector which exists as an extrachromosomal entity, the
replication of which is distinct from chromosomal replication,
e.g., a plasmid, an extrachromosomal element, a minichromosome, or
an artificial chromosome. The vector may contain any means for
assuring self-replication. Alternatively, the vector may be one
which, when introduced into the host cell, is integrated into the
genome and replicated together with the chromosome(s) into which it
has been integrated. Furthermore, a single vector or plasmid or two
or more vectors or plasmids which together contain the total DNA to
be introduced into the genome of the host cell, or a transposon may
be used.
[0331] The vectors of the present invention preferably contain an
element(s) that permits integration of the vector into the host
cell's genome or autonomous replication of the vector in the cell
independent of the genome.
[0332] For integration into the host cell genome, the vector may
rely on the nucleotide sequence encoding the variant or any other
element of the vector for integration of the vector into the genome
by homologous or nonhomologous recombination. Alternatively, the
vector may contain additional nucleic acid sequences for directing
integration by homologous recombination into the genome of the host
cell. The additional nucleic acid sequences enable the vector to be
integrated into the host cell genome at a precise location(s) in
the chromosome(s). To increase the likelihood of integration at a
precise location, the integrational elements should preferably
contain a sufficient number of nucleic acids, such as 100 to 10,000
base pairs, preferably 400 to 10,000 base pairs, and most
preferably 800 to 10,000 base pairs, which are highly homologous
with the corresponding target sequence to enhance the probability
of homologous recombination. The integrational elements may be any
sequence that is homologous with the target sequence in the genome
of the host cell. Furthermore, the integrational elements may be
non-encoding or encoding nucleic acid sequences. On the other hand,
the vector may be integrated into the genome of the host cell by
non-homologous recombination.
[0333] For autonomous replication, the vector may further comprise
an origin of replication enabling the vector to replicate
autonomously in the host cell in question. Examples of origins of
replication for use in a yeast host cell are the 2 micron origin of
replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the
combination of ARS4 and CEN6. The origin of replication may be one
having a mutation which makes functioning temperature-sensitive in
the host cell (see, e.g., Ehrlich, 1978, Proceedings of the
National Academy of Sciences USA 75: 1433). Examples of a plasmid
replicator useful in a filamentous fungal cell are AMA1 and ANS1
(Gems et al.,1991, Gene98:61-67; Cullen et al., 1987, Nucleic Acids
Research 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene
and construction of plasmids or vectors comprising the gene can be
accomplished according to the methods disclosed in WO 00/24883.
[0334] More than one copy of a nucleotide sequence of the present
invention may be inserted into the host cell to increase production
of a glycoside hydrolase variant. An increase in the copy number of
the nucleotide sequence can be-obtained by integrating at least one
additional copy of the sequence into the host cell genome or by
including an amplifiable selectable marker gene with the nucleotide
sequence where cells containing amplified copies of the selectable
marker gene, and thereby additional copies of the nucleotide
sequence, can be selected for by cultivating the cells in the
presence of the appropriate selectable agent.
[0335] The procedures used to ligate the elements described above
to construct the recombinant expression vectors of the present
invention are well known to one skilled in the art (see, e.g.,
Sambrook et al., 1989, supra) to obtain substantially pure
glycoside hydrolase variants.
[0336] Host Cells
[0337] The present invention also relates to recombinant host
cells, comprising a nucleotide sequence encoding a variant
glycoside hydrolase, which are advantageously used in the
recombinant production of the variant. A vector comprising a
nucleotide sequence of the present invention is introduced into a
host cell so that the vector is maintained as a chromosomal
integrant or as a self-replicating extra-chromosomal vector as
described earlier. The term "host cell" encompasses any progeny of
a parent cell that is not identical to the parent cell due to
mutations that occur during replication. The choice of a host cell
will to a large extent depend upon the gene encoding the variant
and its source.
[0338] The host cell may be any eukaryote, such as a mammalian,
insect, plant, or fungal cell.
[0339] The host cell may be any fungal cell. "Fungi" as used herein
includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and
Zygomycota (as defined by Hawksworth et al., In, Ainsworth and
Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB
International, University Press, Cambridge, UK) as well as the
Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and
all mitosporic fungi (Hawksworth et al., 1995, supra).
[0340] In a preferred embodiment, the fungal host cell is a yeast
cell. "Yeast" as used herein includes ascosporogenous yeast
(Endomycetales), basidiosporogenous yeast, and yeast belonging to
the Fungi Imperfecti (Blastomycetes). Since the classification of
yeast may change in the future, for the purposes of this invention,
yeast shall be defined as described in Biology and Activities of
Yeast (Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds,
Soc. App. Bacteriol. Symposium Series No. 9, 1980).
[0341] In a more preferred embodiment, the yeast host cell is a
Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces,
Schizosaccharomyces, or Yarrowia cell.
[0342] In a most preferred embodiment, the yeast host cell is a
Saccharomyces carlsbergensis, Saccharomyces cerevisiae,
Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces
kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell.
In another most preferred embodiment, the yeast host cell is a
Kluyveromyces lactis cell. In another most preferred embodiment,
the yeast host cell is a Yarrowia lipolytica cell.
[0343] In another preferred embodiment, the fungal host cell is a
filamentous fungal cell. "Filamentous fungi" include all
filamentous forms of the subdivision Eumycota and Oomycota (as
defined by Hawksworth et al., 1995, supra). The filamentous fungi
are generally characterized by a mycelial wall composed of chitin,
cellulose, glucan, chitosan, mannan, and other complex
polysaccharides. Vegetative growth is by hyphal elongation and
carbon catabolism is obligately aerobic. In contrast, vegetative
growth by yeasts such as Saccharomyces cerevisiae is by budding of
a unicellular thallus and carbon catabolism may be
fermentative.
[0344] In a more preferred embodiment, the filamentous fungal host
cell is, but not limited to, an Acremonium, Aspergillus, Fusarium,
Humicola, Mucor, Mycellophthora, Neurospora, Penicillium,
Thielavia, Tolypocladium, or Trichoderma cell.
[0345] In a most preferred embodiment, the filamentous fungal host
cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus
japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus
oryzae cell. In another most preferred embodiment, the filamentous
fungal host cell is a Fusarium bactridioides, Fusarium cerealis,
Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum,
Fusarium graminum, Fusarium heterosporum, Fusarium negundi,
Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium
sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides,
Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides,
or Fusarium venenatum cell. In an even most preferred embodiment,
the filamentous fungal host cell is a Fusarium venenatum (Nirenberg
sp. nov.) cell. In another most preferred embodiment, the
filamentous fungal host cell is a Humicola insolens, Humicola
lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora
crassa, Penicillium purpurogenum, Thielavia terrestris, Trichoderma
harzianum, Trichoderma koningii, Trichoderma longibrachiatum,
Trichoderma reesei, or Trichoderma viride cell. In another even
most preferred embodiment, the filamentous fungal host cell is
Trichoderma reesei RutC30.
[0346] Fungal cells may be transformed according to the procedures
described herein.
[0347] Methods of Production
[0348] The present invention also relates to methods for producing
a glycoside hydrolase variant, comprising:
[0349] (a) cultivating a host cell under conditions suitable for
the expression of the variant, wherein the host cell comprises a
nucleotide sequence which has been modified to encode the variant
comprising a substitution at one or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further comprising a substitution at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2, as described herein; and
[0350] (b) recovering the variant from the cultivation medium.
[0351] In the production methods of the present invention, the host
cells are cultivated in a nutrient medium suitable for production
of the glycoside hydrolase variant using methods known in the art.
For example, the cell may be cultivated by shake flask cultivation,
or small-scale or large-scale fermentation (including continuous,
batch, fed-batch, or solid state fermentations) in laboratory or
industrial fermentors performed in a suitable medium and under
conditions allowing the polypeptide to be expressed and/or
isolated. The cultivation takes place in a suitable nutrient medium
comprising carbon and nitrogen sources and inorganic salts, using
procedures known in the art. Suitable media are available from
commercial suppliers or may be prepared according to published
compositions (e.g., in catalogues of the American Type Culture
Collection). If the polypeptide is secreted into the nutrient
medium, the polypeptide can be recovered directly from the medium.
If the polypeptide is not secreted, it can be recovered from cell
lysates.
[0352] In an alternative embodiment, the glycoside hydrolase
variant is not recovered, but rather a host cell of the present
invention expressing a variant is used as a source of the
variant.
[0353] The glycoside hydrolase variant may be detected using
methods known in the art that are specific for the polypeptides.
These detection methods may include use of specific antibodies,
formation of an enzyme product, or disappearance of an enzyme
substrate. For example, an enzyme assay may be used to determine
the activity of the polypeptide as described herein in the
Examples.
[0354] The resulting glycoside hydrolase variant may be recovered
by methods known in the art. For example, the polypeptide may be
recovered from the nutrient medium by conventional procedures
including, but not limited to, collection, centrifugation,
filtration, extraction, spray-drying, evaporation, or
precipitation.
[0355] A glycoside hydrolase variant of the present invention may
be purified by a variety of procedures known in the art including,
but not limited to, chromatography (e.g., ion exchange, affinity,
hydrophobic, chromatofocusing, and size exclusion), electrophoretic
procedures (e.g., preparative isoelectric focusing), differential
solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or
extraction (see, e.g., Protein Purification, J.-C. Janson and Lars
Ryden, editors, VCH Publishers, New York, 1989) to obtain
substantially pure glycoside hydrolase variants.
[0356] Other Polypeptides Having Glycoside Hydrolase Activity
[0357] The present invention also relates to isolated polypeptides
having glycoside hydrolase activity, wherein the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at one or
more positions corresponding to positions 21, 94, 157, 205, 206,
247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further differs at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2.
[0358] In a preferred embodiment, the amino acid sequence of the
polypeptide differs from amino acids 1 to 513 of SEQ ID NO: 2 by
preferably 33 amino acids, more preferably 32 amino acids, even
more preferably 31 amino acids, even more preferably 30 amino
acids, even more preferably 29 amino acids, even more preferably 28
amino acids, even more preferably 27 amino acids, even more
preferably 26 amino acids, even more preferably 25 amino acids,
even more preferably 24 amino acids, even more preferably 23 amino
acids, even more preferably 22 amino acids, even more preferably 21
amino acids, even more preferably 20 amino acids, even more
preferably 19 amino acids, even more preferably 18 amino acids,
even more preferably 17 amino acids, even more preferably.16 amino
acids, even more preferably 15 amino acids, even more preferably 14
amino acids, even more preferably 13 amino acids, even more
preferably 12 amino acids, even more preferably 11 amino acids,
even more preferably 10 amino acids, even more preferably 9 amino
acids, even more preferably 8 amino acids, even more preferably 7
amino acids, even more preferably 6 amino acids, even more
preferably 5 amino acids, even more preferably 4 amino acids, even
more preferably 3 amino acids, even more preferably 2 amino acids,
and most preferably 1 amino acid.
[0359] In a preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 at one or more positions
corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350,
373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differs from SEQ ID NO: 2 at one or
more positions corresponding to positions 8, 22, 41, 49, 57, 113,
193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 at two or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
differs from SEQ ID NO: 2 at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In another preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at three or
more positions corresponding to positions 21, 94, 157, 205,
206,-247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids
1 to 513 of SEQ ID NO: 2, and optionally further differs from SEQ
ID NO: 2 at one or more positions corresponding to positions 8, 22,
41, 49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356,
371, 411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In
another preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 at four or more positions
corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350,
373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differs from SEQ ID NO: 2 at one or
more positions corresponding to positions 8, 22, 41, 49, 57, 113,
193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 at five or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
differs from SEQ ID NO: 2 at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In another preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at six or
more positions corresponding to positions 21, 94, 157, 205, 206,
247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further differs from SEQ ID NO:
2 at one or more positions corresponding to positions 8, 22, 41,
49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371,
411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In another
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 at seven or more positions corresponding
to positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438,
455, 467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further differs from SEQ ID NO: 2 at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 at eight or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
differs from SEQ ID NO: 2 at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In another preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at nine or
more positions corresponding to positions 21, 94, 157, 205, 206,
247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further differs from SEQ ID NO:
2 at one or more positions corresponding to positions 8, 22, 41,
49, 57, 113, 193, 196,;226, 227, 246, 251, 255, 259, 301, 356, 371,
411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In another
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 at ten or more positions corresponding to
positions 21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455,
467, and 486 of amino acids 1 to 513 of SEQ ID NO: 2, and
optionally further differs from SEQ ID NO: 2 at one or more
positions corresponding to positions 8, 22, 41, 49, 57, 113, 193,
196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 at eleven or more positions corresponding to positions
21, 94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and
486 of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
differs from SEQ ID NO: 2 at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In another preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at twelve or
more positions corresponding to positions 21, 94, 157, 205, 206,
247, 337, 350, 373, 383, 438, 455, 467, and 486 of amino acids 1 to
513 of SEQ ID NO: 2, and optionally further differs from SEQ ID NO:
2 at one or more positions corresponding to positions 8, 22, 41,
49, 57, 113, 193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371,
411, and 462 of amino acids 1 to 513 of SEQ ID NO: 2. In another
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 at thirteen or more positions
corresponding to positions 21, 94, 157, 205, 206, 247, 337, 350,
373, 383, 438, 455, 467, and 486 of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differs from SEQ ID NO: 2 at one or
more positions corresponding to positions 8, 22, 41, 49, 57, 113,
193, 196, 226, 227, 246, 251, 255, 259, 301, 356, 371, 411, and 462
of amino acids 1 to 513 of SEQ ID NO: 2. In another preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 at positions corresponding at least to positions 21,
94, 157, 205, 206, 247, 337, 350, 373, 383, 438, 455, 467, and 486
of amino acids 1 to 513 of SEQ ID NO: 2, and optionally further
differs from SEQ ID NO: 2 at one or more positions corresponding to
positions 8, 22, 41, 49, 57, 113, 193, 196, 226, 227, 246, 251,
255, 259, 301, 356, 371, 411, and 462 of amino acids 1 to 513 of
SEQ ID NO: 2.
[0360] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 21 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 21 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Pro at a position corresponding to
position 21 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S21P of amino acids 1 to
513 of SEQ ID NO: 2.
[0361] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 94 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 94 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Ser at a position corresponding to
position 94 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by G94S of amino acids 1 to
513 of.SEQ ID NO: 2. In another even more preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
Ala at a position corresponding to position 94 of amino acids 1 to
513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
G94A of amino acids 1 to 513 of SEQ ID NO: 2. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Arg at a position corresponding to
position 94 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by G94R of amino acids 1 to
513 of SEQ ID NO: 2. In another even more preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
Gin at a position corresponding to position 94 of amino acids 1 to
513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
G94Q of amino acids 1 to 513 of SEQ ID NO: 2.
[0362] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 157 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 157 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Arg at a position corresponding to
position 157 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by K157R of amino acids 1 to
513 of SEQ ID NO: 2.
[0363] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 205 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 205 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Arg at a position corresponding to
position 205 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by G205R of amino acids 1 to
513 of SEQ ID NO: 2.
[0364] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 206 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 206 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Tyr at a position corresponding to
position 206 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by H206Y of amino acids 1 to
513 of SEQ ID NO: 2.
[0365] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 247 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 247 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Cys at a position corresponding to
position 247 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Y247C of amino acids 1 to
513 of SEQ ID NO: 2.
[0366] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 337 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 337 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Val at a position corresponding to
position 337 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by E337V of amino acids 1 to
513 of SEQ ID NO: 2.
[0367] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 350 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 350 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Ser at a position corresponding to
position 350 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by T350S of amino acids 1 to
513 of SEQ ID NO: 2.
[0368] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 373 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 373 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by His at a position corresponding to
position 373 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by N373H of amino acids 1 to
513 of SEQ ID NO: 2.
[0369] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 383 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 383 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID. NO: 2 by Ala at a position corresponding to
position 383 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by T383A of amino acids 1 to
513 of SEQ ID NO: 2.
[0370] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 438 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 438 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Leu at a position corresponding to
position 438 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P438L of amino acids 1 to
513 of SEQ ID NO: 2.
[0371] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 455 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 455 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Ala at a position corresponding to
position 455 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by T455A of amino acids 1 to
513 of SEQ ID NO: 2.
[0372] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 467 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 467 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Ser at a position corresponding to
position 467 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by G467S of amino acids 1 to
513 of SEQ ID NO: 2.
[0373] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 486 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at a position
corresponding to position 486 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Trp at a position corresponding to
position 486 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by C486W of amino acids 1 to
513 of SEQ ID NO: 2.
[0374] In a preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 8 of amino acids 1 to 513 of SEQ ID NO:
2. In a more preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 8 of amino acids 1 to 513 of SEQ ID NO: 2
by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met,
Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even more preferred
embodiment, the amino acid sequence of the polypeptide further
differs from SEQ ID NO: 2 by Pro at a position corresponding to
position 8 of amino acids 1 to 513 of SEQ ID NO: 2. In a most
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by S8P of amino acids 1 to 513 of
SEQ ID NO: 2.
[0375] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 22 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 22 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Asp at a position
corresponding to position 22 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by G22D of amino
acids 1 to 513 of SEQ ID NO: 2.
[0376] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 41 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 41 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Ile at a position
corresponding to position 41 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by T41I of amino
acids 1 to 513 of SEQ ID NO: 2.
[0377] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 49 of amino acids 1 to 513 of SEQ ID
NO:
[0378] 2. In another more preferred embodiment, the amino acid
sequence of the polypeptide further differs from SEQ ID NO: 2 at a
position corresponding to position 49 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another
even more preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 by Ser at a position
corresponding to position 49 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by N49S of amino
acids 1 to 513 of SEQ ID NO: 2.
[0379] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 57 of amino acids 1 to 513 of SEQ ID
NO:
[0380] 2. In another more preferred embodiment, the amino acid
sequence of the polypeptide further differs from SEQ ID NO: 2 at a
position corresponding to position 57 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another
even more preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 by Asn at a position
corresponding to position 57 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by S57N of amino
acids 1 to 513 of SEQ ID NO: 2.
[0381] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 113 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 113 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO:2 by Asn at a position corresponding
to position 113 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 by S113N of amino
acids 1 to 513 of SEQ ID NO: 2.
[0382] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 193 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 193 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Lys at a position
corresponding to position 193 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by E193K of amino
acids 1 to 513 of SEQ ID NO:2.
[0383] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 196 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 196 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Pro at a position
corresponding to position 196 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by S196P of amino
acids 1 to 513 of SEQ ID NO: 2. In another even more preferred
embodiment, the amino acid sequence of the polypeptide further
differs from SEQ ID NO: 2 by Thr at a position corresponding to
position 196 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 by S196T of amino
acids 1 to 513 of SEQ ID NO: 2. In another even more preferred
embodiment, the amino acid sequence of the polypeptide further
differs from SEQ ID NO: 2 by Phe at a position corresponding to
position 196 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 by S196F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0384] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 226 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 226 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Ala at a position
corresponding to position 226 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by T226A of amino
acids 1 to 513 of SEQ ID NO: 2.
[0385] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 227 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 227 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Ala at a position
corresponding to position 227 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by P227A of amino
acids 1 to 513 of SEQ ID NO: 2. In another even more preferred
embodiment, the amino acid sequence of the polypeptide further
differs from SEQ ID NO: 2 by Leu at a position corresponding to
position 227 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 by P227L of amino
acids 1 to 513 of SEQ ID NO: 2. In another even more preferred
embodiment, the amino acid sequence of the polypeptide further
differs from SEQ ID NO: 2 by Gly at a position corresponding to
position 227 of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide further differs from SEQ ID NO: 2 by P227G of amino
acids 1 to 513 of SEQ ID NO: 2.
[0386] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 246 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 246 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Ile at a position
corresponding to position 246 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by T246I of amino
acids 1 to 513 of SEQ ID NO: 2.
[0387] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 251 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 251 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Lys at a position
corresponding to position 251 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by R251K of amino
acids 1 to 513 of SEQ ID NO:2.
[0388] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 255 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 255 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Pro at a position
corresponding to position 255 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by T255P of amino
acids 1 to 513 of SEQ ID NO:2.
[0389] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 259 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 259 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Asn at a position
corresponding to position 259 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by D259N of amino
acids 1 to 513 of SEQ ID NO: 2.
[0390] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 301 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 301 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Ser at a position
corresponding to position 301 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by N301S of amino
acids 1 to 513 of SEQ ID NO: 2.
[0391] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 356 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 356 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Ile at a position
corresponding to position 356 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by T356I of amino
acids 1 to 513 of SEQ ID NO: 2.
[0392] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 371 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 371 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Cys at a position
corresponding to position 371 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by Y371C of amino
acids 1 to 513 of SEQ ID NO: 2.
[0393] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 411 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 411 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Phe at a position
corresponding to position 411 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0394] In another preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 462 of amino acids 1 to 513 of SEQ ID NO:
2. In another more preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 at a position
corresponding to position 462 of amino acids 1 to 513 of SEQ ID NO:
2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys,
Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another even more
preferred embodiment, the amino acid sequence of the polypeptide
further differs from SEQ ID NO: 2 by Ala at a position
corresponding to position 462 of amino acids 1 to 513 of SEQ ID NO:
2. In another most preferred embodiment, the amino acid sequence of
the polypeptide further differs from SEQ ID NO: 2 by T462A of amino
acids 1 to 513 of SEQ ID NO: 2.
[0395] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 259 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 259 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Gly (or Ala or Leu) and
Asn at positions corresponding to positions 227 and 259,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P227G (or P227A or
P227L)+D259N of amino acids 1 to 513 of SEQ ID NO: 2.
[0396] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 486 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 486 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ala (or Leu or Gly) and
Trp at positions corresponding to positions 227 and 486,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P227A (or P227L or
P227G)+C486W of amino acids 1 to 513 of SEQ ID NO: 2.
[0397] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 301 and 337 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 301 and 337 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His; Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser and Val at positions
corresponding to positions 301 and 337, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by N301S+E337V of amino acids 1 to 513 of SEQ ID NO:
2.
[0398] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 350 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 350 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro (or Thr or Phe) and
Ser at positions corresponding to positions 196 and 350,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S196P (or S196T or
S196F)+T350S of amino acids 1 to 513 of SEQ ID NO: 2.
[0399] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 22 and 467 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 22 and 467 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asp and Ser at positions
corresponding to positions 22 and 467, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
G22D+G467S of amino acids 1 to 513 of SEQ ID NO: 2.
[0400] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 57 of amino acids 1 to 513 of SEQ
ID NO: 2. In a more preferred embodiment, the amino acid sequence
of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 57 of amino acids 1 to 513 of SEQ
ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu,
Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Pro and Asn at positions corresponding
to positions 21 and 57, respectively, of amino acids 1 to 513 of
SEQ ID NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by S21P+557N
of amino acids 1 to 513 of SEQ ID NO: 2.
[0401] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Phe at positions
corresponding to positions 205 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by G205R+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0402] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from 30 SEQ ID NO: 2 at positions
corresponding to positions 205 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Ala (or Leu or
Gly) at positions corresponding to positions 205 and 227,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by G205R+P227A (or P227L or
P227G) of amino acids 1 to 513 of SEQ ID NO: 2.
[0403] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 206 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 206 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Tyr at positions
corresponding to positions 205 and 206, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by G205R+H206Y of amino acids 1 to 513 of SEQ ID NO:
2.
[0404] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 8 and 205 of amino acids 1 to 513 of SEQ
ID NO: 2. In a more preferred embodiment, the amino acid sequence
of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 8 and 205 of amino acids 1 to 513 of SEQ
ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu,
Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even more
preferred embodiment, the amino acid sequence of the polypeptide
differs from SEQ ID NO: 2 by Pro and Arg at positions corresponding
to positions 8 and 205, respectively, of amino acids 1 to 513 of
SEQ ID NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by S8P+G205R
of amino acids 1 to 513 of SEQ ID NO: 2.
[0405] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 94 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 94 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser (or Ala or Arg or Gln)
and Arg at positions corresponding to positions 94 and 205,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by G94S (or G94A or G94R or
G94Q)+G205R of amino acids 1 to 513 of SEQ ID NO: 2.
[0406] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro (or Thr or Phe) and
Arg at positions corresponding to positions 196 and 205,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S196P (or S196T or
S196F)+G205R of amino acids 1 to 513 of SEQ ID NO: 2.
[0407] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 383 and 455 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 383 and 455 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ala and Ala at positions
corresponding to positions 383 and 455, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by T383A+T455A of amino acids 1 to 513 of SEQ ID NO:
2.
[0408] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Phe at positions
corresponding to positions 113 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S113N+S411F of amino acids 1 to. 513 of SEQ ID NO:
2.
[0409] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 196 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 196 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Thr (or Pro or
Phe) at positions corresponding to positions 113 and 196,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+S196T (or S196P or
S196F) of amino acids 1 to 513 of SEQ ID NO: 2.
[0410] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Ala at positions
corresponding to positions 113 and 462, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S113N+T462A of amino acids 1 to 513 of SEQ ID NO:
2.
[0411] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe) and
Ala at positions corresponding to positions 196 and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S196T (or S196P or
S196F)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0412] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 41 and 196 of amino acids 1 to 513 of
SEQ ID NO: 2 with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile and Phe (or Pro or
Thr) at positions corresponding to positions 41 and 196,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by T41I+S196F (or S196P or
S196T) of amino acids 1 to 513 of SEQ ID NO: 2.
[0413] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2at positions corresponding
to positions 94 and 226 of amino acids 1 to 513 of SEQ ID NO: 2. In
a more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 at positions corresponding to
positions 94 and 226 of amino acids 1 to 513 of SEQ ID NO: 2 with
Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met,
Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even more preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by Ala (or Ser or Arg or Gln) and Ala at positions
corresponding to positions 94 and 226, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
G94A (or G94S or G94R or G94Q)+T226A of amino acids 1 to 513 of SEQ
ID NO: 2.
[0414] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 462 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Thr (or Pro or Phe),
and Ala at positions corresponding to positions 113, 196, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+S196T (or S196P or
S196F)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0415] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157 and 205 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Arg at positions
corresponding to positions 157 and 205, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by K157R+G205R of amino acids 1 to 513 of SEQ ID NO:
2.
[0416] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157 and 255 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157 and 255 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Pro at positions
corresponding to positions 157 and 255, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by K157R+T255P of amino acids 1 to 513 of SEQ ID NO:
2.
[0417] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 255 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 255 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys,-Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Pro at positions
corresponding to positions 205 and 255, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by G205R+T255P of amino acids 1 to 513 of SEQ ID NO:
2.
[0418] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157, 205, and 255 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157, 205, and 255 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg, Arg, and Pro at
positions corresponding to positions 157, 205, and 255,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by K157R+G205R+T255P of amino
acids 1 to 513 of SEQ ID NO: 2.
[0419] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 41 and 193 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 41 and 193 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile and Lys at positions
corresponding to positions 41 and 193, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
T41I+E193K of amino acids 1 to 513 of SEQ ID NO: 2.
[0420] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 41 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 41 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile and Phe at positions
corresponding to positions 41 and 411, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
T41I+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0421] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 193 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 193 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Lys and Phe at positions
corresponding to positions 193 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by E193K+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0422] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 41, 193, and 411 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 41, 193, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile, Lys, and Phe at
positions corresponding to positions 41, 193, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by T41I+E193K+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0423] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 247 and 371 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO:2 at positions
corresponding to positions 247 and 371 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Cys and Cys at positions
corresponding to positions 247 and 371, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by Y247C+Y371C of amino acids 1 to 513 of SEQ ID NO:
2.
[0424] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 247 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 247 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Cys and Phe at positions
corresponding to positions 247 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by Y247C+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0425] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 371 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 371 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Cys and Phe at positions
corresponding to positions 371 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by Y371C+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0426] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 247, 371, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 247, 371, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Cys, Cys, and Phe at
positions corresponding to positions 247, 371, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Y247C+Y371C+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0427] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Ala (or Leu or
Gly) at positions corresponding to positions 113 and 227,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by 5113N+P227A (or P227L or
P227G) of amino acids 1 to 513 of SEQ ID NO: 2.
[0428] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe) and
Ala (or Leu or Gly) at positions corresponding to positions 196 and
227, respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In
another most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S196T (or S196P or
S196F)+P227A (or P227L or P227G) of amino acids 1 to 513 of SEQ ID
NO: 2.
[0429] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ala (or Leu or Gly) and
Ala at positions corresponding to positions 227 and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P227A (or P227L or
P227G)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0430] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 227 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 142, 196, and 227 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Thr (or Pro or Phe),
and Ala (or Leu or Gly) at positions corresponding to positions
142, 196, and 227, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by
S113N+S196T (or S196P or S196F)+P227A (or P227L or P227G) of amino
acids 1 to 513 of SEQ ID NO: 2.
[0431] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Ala (or Leu or Gly),
and Ala at positions corresponding to positions 113, 227, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+P227A (or P227L or
P227G)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0432] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe), Ala
(or Leu or Gly), and Ala at positions corresponding to positions
196, 227, and 462, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by S196T (or
S196P or S196F)+P227A (or P227L or P227G)+T462amino acids 1 to 513
of SEQ ID NO: 2.
[0433] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 462 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Thr (or Pro or Phe),
and Ala at positions corresponding to positions 113, 196, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+S196T (or S196P or
S196F)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0434] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, 227, and 462 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 113, 196, 227, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Asn, Thr
(or Pro or Phe), Ala (or Leu or Gly), and Ala at positions
corresponding to positions 113, 196, 227, and 462, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S113N+S196T (or S196P or S196F)+P227A (or P227L or
P227G)+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0435] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49 and 113 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49 and 113 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser and Asn at positions
corresponding to positions 49 and 113, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
N49S+S113N of amino acids 1 to 513 of SEQ ID NO: 2.
[0436] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49 and 227 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser and Ala (or Leu or
Gly) at positions corresponding to positions 49 and 227,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by N49S+P227A (or P227L or
P227G) of amino acids 1 to 513 of SEQ ID NO: 2.
[0437] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49 and 438 of amino acids 1 to 513 of
SEQ ID 25 NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser and Leu at positions
corresponding to positions 49 and 438, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
N49S+P438L of amino acids 1 to 513 of SEQ ID NO: 2.
[0438] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Leu at positions
corresponding to positions 113 and 438, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S113N+P438L of amino acids 1 to 513 of SEQ ID NO:
2.
[0439] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 438 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ala (or Leu or Gly) and
Leu at positions corresponding to positions 227 and 438,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P227A (or P227L or
P227G)+P438L of amino acids 1 to 513 of SEQ ID NO: 2.
[0440] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49, 113, and 227 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49, 113, and 227 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser, Asn, and Ala (or Leu
or Gly) at positions corresponding to positions 49, 113, and 227,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2.
[0441] In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by
N49S+S113N+P227A (or P227L or P227G) of amino acids 1 to 513 of SEQ
ID NO: 2.
[0442] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49, 227, and 438 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49, 227, and 438 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser, Ala (or Leu or Gly),
and Leu at positions corresponding to positions 49, 227, and 438,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by N49S+P227A (or P227L or
P227G)+P438L of amino acids 1 to 513 of SEQ ID NO: 2.
[0443] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 438 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 438 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Ala (or Leu or Gly),
and Leu at positions corresponding to positions 113, 227, and 438,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by 5113N+P227A (or P227L or
P227G)+P438L of amino acids 1 to 513 of SEQ ID NO: 2.
[0444] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49, 113, and 438 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49, 113, and 438 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ser, Asn, and Leu at
positions corresponding to positions 49, 113, and 438,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by N495+S113N+P438L of amino
acids 1 to 513 of SEQ ID NO: 2.
[0445] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 49, 113, 227, and 438 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 49, 113, 227, and 438 of amino
acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the amino acid sequence
of the polypeptide differs from SEQ ID NO: 2 by Ser, Asn, Ala (or
Leu or Gly), and Leu at positions corresponding to positions 49,
113, 227, and 438, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by N49S,
S113N+P227A (or P227L or P227G)+P438L of amino acids 1 to of SEQ ID
NO: 2.
[0446] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Phe at positions
corresponding to positions 157 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by K157R+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0447] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg and Phe at positions
corresponding to positions 205 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by G205R+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0448] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 255 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 255 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro and Phe at positions
corresponding to positions 255 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by T255P+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0449] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157, 255, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157, 255, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg, Pro, and Phe at
positions corresponding to positions 157, 255, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by K157R+T255P+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0450] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205, 255, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 205, 255, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg, Pro, and Phe at
positions corresponding to positions 205, 255, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by G205R+T255P+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0451] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157, 205, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157, 205, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Arg, Arg, and Phe at
positions corresponding to positions 157, 205, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by K157R+G205R+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0452] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 157, 205, 255, and 411 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 157, 205, 255, and 411 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Arg, Arg,
Pro, and Phe at positions corresponding to positions 157, 205, 255,
and 411, respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In
another most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by K157R, G205R+T255P+S411F
of amino acids 1 to 513 of SEQ ID NO: 2.
[0453] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe) and
Phe at positions corresponding to positions 196 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S196T (or S196P or
S196F)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0454] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ala (or Leu or Gly) and
Phe at positions corresponding to positions 227 and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P227A (or P227L or
P227G)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0455] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Ala (or Leu or Gly),
and Phe at positions corresponding to positions 113, 227, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+P227A (or P227L or
P227G)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0456] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe), Ala
(or Leu or Gly), and Phe at positions corresponding to positions
196, 227, and 411, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by S196T (or
S196P or S196F)+P227A (or P227L or P227G)+S411F of amino acids 1 to
513 of SEQ ID NO: 2.
[0457] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Thr (or Pro or Phe),
and Phe at positions corresponding to positions 113, 196, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+S196T (or S196P or
S196F)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0458] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, 227, and 411 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 113, 196, 227, and 411 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Asn, Thr
(or Pro or Phe), Ala (or Leu or Gly), and Phe at positions
corresponding to positions 113, 196, 227, and 411, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S113N+S196T (or S196P or S196F)+P227A (or P227L or
P227G)+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0459] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Ile at positions
corresponding to positions 113 and 356, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S113N+T356I of amino acids 1 to 513 of SEQ ID NO:
2.
[0460] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe) and
Ile at positions corresponding to positions 196 and 356,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S196T (or S196P or
S196F)+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0461] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227 and 356 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ala (or Leu or Gly) and
Ile at positions corresponding to positions 227 and 356,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P227A (or P227L or
P227G)+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0462] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 356 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 356 and 462 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile and Ala at positions
corresponding to positions 356 and 462, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by T356I+T462A of amino acids 1 to 513 of SEQ ID NO:
2.
[0463] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 356 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, and 356 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Ala (or Leu or Gly),
and Ile at positions corresponding to positions 113, 227, and 356,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+P227A (or P227L or
P227G)+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0464] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 356 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 356 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe), Ala
(or Leu or Gly), and Ile at positions corresponding to positions
196, 227, and 356, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by S196T (or
S196P or S196F)+P227A (or P227L or P227G)+T356amino acids 1 to 513
of SEQ ID NO: 2.
[0465] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe), Ala
(or Leu or Gly), and Ala at positions corresponding to positions
196, 227, and 462, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by S196T (or
S196P or S196F)+P227A (or P227L or P227G)+T462A of amino acids 1 to
513 of SEQ ID NO: 2.
[0466] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 356, and 462 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 356, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Thr (or Pro or Phe), Ile,
and Ala at positions corresponding to positions 196, 356, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S196T (or S196P or
S196F)+T356I+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0467] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 356 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, and 356 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Thr (or Pro or Phe),
and Ile at positions corresponding to positions 113, 196, and 356,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+S196T (or S196P or
S196F)+T356I of amino acids 1 to 513 of SEQ NO: 2.
[0468] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227, 356, and 462 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 227, 356, and 462 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ala (or Leu or Gly), Ile,
and Ala at positions corresponding to positions 227, 356, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by P227A (or P227L or
P227G)+T356I+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0469] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, 227, and 356 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 113, 196, 227, and 356 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Asn, Thr
(or Pro or Phe), Ala (or Leu or Gly), and Ile at positions
corresponding to positions 113, 196, 227, and 356 respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S113N+S196T (or S196P or S196F)+P227A (or P227L or
P227G)+T356I of amino acids 1 to 513 of SEQ ID NO: 2.
[0470] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 227, 356, and 462 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 113, 227, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Asn, Ala
(or Leu or Gly), Ile, and Ala at positions corresponding to
positions 113, 227, 356, and 462, respectively, of amino acids 1 to
513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S113N+P227A (or P227L or P227G)+T356I+T462A of amino acids 1 to 513
of SEQ ID NO: 2.
[0471] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, 356, and 462 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 113, 196, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Asn, Thr
(or Pro or Phe), Ile, and Ala at positions corresponding to
positions 113, 196, 356, and 462, respectively, of amino acids 1 to
513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S113N+S196T (or S196P or S196F)+T356I+T462A of amino acids 1 to 513
of SEQ ID NO: 2.
[0472] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 196, 227, 356, and 462 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 196, 227, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Thr (or
Pro or Phe), Ala (or Leu or Gly), Ile, and Ala at positions
corresponding to positions 196, 227, 356, and 462, respectively, of
amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S196T (or S196P or S196F)+P227A (or P227L or
P227G)+T356+T462A of amino acids 1 to 513 of SEQ ID NO: 2.
[0473] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 113, 196, 227, 356, and 462 of amino
acids 1 to 513 of SEQ ID NO: 2. In a more preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 113, 196, 227, 356, and 462 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Asn, Thr
(or Pro or Phe), Ala (or Leu or Gly), Ile, and Ala at positions
corresponding to positions 113, 196, 227, 356, and 462,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S113N+S196T (or S196P or
S196F)+P227A (or P227L or P227G)+T3561+T462A of amino acids 1 to
513 of SEQ ID NO: 2.
[0474] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 246 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 246 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro and Ile at positions
corresponding to positions 21 and 246, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S21P+T246I of amino acids 1 to 513 of SEQ ID NO: 2.
[0475] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro and Lys at positions
corresponding to positions 21 and 251, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S21P+R251K of amino acids 1 to 513 of SEQ ID NO: 2.
[0476] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro and Phe at positions
corresponding to positions 21 and 411, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S21P+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0477] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57 and 246 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57 and 246 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Ile at positions
corresponding to positions 57 and 246, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S57N+T246I of amino acids 1 to 513 of SEQ ID NO: 2.
[0478] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, 15 or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Lys at positions
corresponding to positions 57 and 251, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S57N+R251K of amino acids 1 to 513 of SEQ ID NO: 2.
[0479] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn and Phe at positions
corresponding to positions 57 and 411, respectively, of amino acids
1 to 513 of SEQ ID NO: 2. In another most preferred embodiment, the
amino acid sequence of the polypeptide differs from SEQ ID NO: 2 by
S57N+S411F of amino acids 1 to 513 of SEQ ID NO: 2.
[0480] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 246 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 246 and 251 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile and Lys at positions
corresponding to positions 246 and 251, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by T246I+R251K of amino acids 1 to 513 of SEQ ID NO:
2.
[0481] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 246 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 246 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile and Phe at positions
corresponding to positions 246 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by T246I+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0482] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 251 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 251 and 411 of amino acids 1 to 513 of
SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His, Ile,
Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an even
more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Lys and Phe at positions
corresponding to positions 251 and 411, respectively, of amino
acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by R251K+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0483] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, and 246 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, and 246 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro, Asn, and Ile at
positions corresponding to positions 21, 57, and 246, respectively,
of amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S21P+S57N+T246I of amino acids 1 to 513 of SEQ ID
NO: 2.
[0484] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from 5 SEQ ID NO: 2 at positions
corresponding to positions 21, 246, and 251 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 246, and 251 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro, Ile, and Lys at
positions corresponding to positions 21, 246, and 251,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S21P+T246I+R251K of amino
acids 1 to 513 of SEQ ID NO: 2.
[0485] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 246, and 411 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 246, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro, Ile, and Phe at
positions corresponding to positions 21, 246, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S21P+T246I+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0486] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57, 246, and 251 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57, 246, and 251 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Ile, and Lys at
positions corresponding to positions 57, 246, and 251,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S57N+T246I+R251K of amino
acids 1 to 513 of SEQ ID NO: 2.
[0487] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57, 246, and 411 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57, 246, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Ile, and Phe at
positions corresponding to positions 57, 246, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S57N+T246I+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0488] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57, 251, and 411 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57, 251, and 411 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Asn, Lys, and Phe at
positions corresponding to positions 57, 251, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S57N+R251K+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0489] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, and 251 of amino acids 1 to 513
of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, and 251 of amino acids 1 to 513
of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro, Asn, and Lys at
positions corresponding to positions 21, 57, and 251, respectively,
of amino acids 1 to 513 of SEQ ID NO: 2. In another most preferred
embodiment, the amino acid sequence of the polypeptide differs from
SEQ ID NO: 2 by S21P+S57N+R251K of amino acids 1 to 513 of SEQ ID
NO: 2.
[0490] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 246, 251, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 246, 251, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Ile, Lys, and Phe at
positions corresponding to positions 246, 251, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by T246I+R251K+S411F of amino
acids 1 to 513 of SEQ ID NO: 2.
[0491] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, 246, and 251 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, 246, and 251 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro, Asn, Ile, and Lys at
positions corresponding to positions 21, 57, 246, and 251
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S21P+S57N+T246I+R251K of
amino acids 1 to 513 of SEQ ID NO: 2.
[0492] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 246, 251, and 411 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 21, 246, 251 and 411 of amino
acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the amino acid sequence
of the polypeptide differs from SEQ ID NO: 2 by Pro, Ile, Lys, and
Phe at positions corresponding to positions 21, 246, 251, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S21P+T246I+R251K+S411F of
amino acids 1 to 513 of SEQ ID NO: 2.
[0493] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, 251, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, 251, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro, Asn, Lys, and Phe at
positions corresponding to positions 21, 57, 251, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S21P+S57N+R251K+S411F of
amino acids 1 to 513 of SEQ ID NO: 2.
[0494] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 57, 246, 251, and 411 of amino acids 1
to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 57, 246, 251, and 411 of amino
acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln,
Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or
Val. In an even more preferred embodiment, the amino acid sequence
of the polypeptide differs from SEQ ID NO: 2 by Asn, Ile, Lys, and
Phe at positions corresponding to positions 57, 246, 251, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S57N+T246I+R251K+S411F of
amino acids 1 to 513 of SEQ ID NO: 2.
[0495] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21,57,246, and 411 of amino acids 1 to
513 of SEQ ID NO: 2. In a more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, 246, and 411 of amino acids 1 to
513 of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys, Gln, Glu, Gly, His,
Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In an
even more preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by Pro, Asn, Ile, and Phe at
positions corresponding to positions 21, 57, 246, and 411,
respectively, of amino acids 1 to 513 of SEQ ID NO: 2. In another
most preferred embodiment, the amino acid sequence of the
polypeptide differs from SEQ ID NO: 2 by S21P+S57N+T246I+S411F of
amino acids 1 to 513 of SEQ ID NO: 2.
[0496] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 at positions
corresponding to positions 21, 57, 246, 251, and 411 of amino acids
1 to 513 of SEQ ID NO: 2. In a more preferred embodiment, the amino
acid sequence of the polypeptide differs from SEQ ID NO: 2 at
positions corresponding to positions 21, 57, 246, 251, and 411 of
amino acids 1 to 513 of SEQ ID NO: 2 by Ala, Arg, Pro, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, or Val. In an even more preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by Pro, Asn,
Ile, Lys, and Phe at positions corresponding to positions 21,57,
246,251, and 411, respectively, of amino acids 1 to 513 of SEQ ID
NO: 2. In another most preferred embodiment, the amino acid
sequence of the polypeptide differs from SEQ ID NO: 2 by
S21P+S57N+T246I+R251K+S411F of amino acids 1 to 513 of SEQ ID NO:
2.
[0497] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least one
difference selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0498] In another preferred embodiment, the-amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least two
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0499] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least three
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, 5196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H,
T383A,P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ
ID NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N495, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0500] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least four
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N495, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0501] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least five
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, 5196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0502] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least six
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0503] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least seven
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0504] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least eight
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0505] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least nine
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0506] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least ten
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R,E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, AND
T462A.
[0507] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least eleven
differences selected from the group consisting of S21P, G94S, G94A,
G94R, .G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L,
P227G, T246I, Y247C, D259N, R251K, N301S, E337V,T3505,N373H,T383A,
P438L,T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID NO:
2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
5113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0508] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least twelve
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, 5196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0509] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least thirteen
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, 5196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N495, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0510] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least fourteen
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N495, 557N,
5113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0511] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least fifteen
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0512] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least sixteen
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0513] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least seventeen
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0514] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least eighteen
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0515] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least nineteen
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0516] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by at least twenty
differences selected from the group consisting of S21P, G94S, G94A,
G94R, G94Q, K157R, E193K, S196P, S196F, G205R, H206Y, P227L, P227G,
T246I, Y247C, D259N, R251K, N301S, E337V, T350S, N373H, T383A,
P438L, T455A, G467S, and C486W of amino acids 1 to 513 of SEQ ID
NO: 2, and optionally further differ by one or more differences
selected from the group consisting of S8P, G22D, T41I, N49S, S57N,
S113N, S196T, T226A, P227A, T255P, T356I, Y371C, S411F, and
T462A.
[0517] In another preferred embodiment, the amino acid sequence of
the polypeptide differs from SEQ ID NO: 2 by the differences
consisting of at least S21P, G94S, G94A, G94R, G94Q, K157R, E193K,
S196P, S196F, G205R, H206Y, P227L, P227G, T246I, Y247C, D259N,
R251K, N301S, E337V, T350S, N373H, T383A, P438L, T455A, G467S, and
C486W of amino acids 1 to 513 of SEQ ID NO: 2, and optionally
further differ by one or more differences selected from the group
consisting of S8P, G22D, T41I, N49S, S57N, S113N, S196T, T226A,
P227A, T255P, T356I, Y371C, S411F, and T462A.
[0518] In a preferred embodiment, the polypeptide consists of 341
to 350, 351 to 360, 361 to 370, 371 to 380, 381 to 390, 391 to 400,
401 to 410, 411 to 420, 421 to 430, 431 to 440, 441 to 450, 451 to
460, 461 to 470, 471 to 480, 481 to 490, 491 to 500, or 501 to 513
amino acids.
[0519] The isolated polypeptides have one or more improved
properties compared to the polypeptide of SEQ ID NO: 2, wherein the
improved properties are selected from the group consisting of
thermal activity, thermostability, pH activity, pH stability,
substrate specificity, product specificity, and chemical stability,
as described herein.
[0520] The present invention also relates to isolated nucleotide
sequences encoding such polypeptides, nucleic acid constructs,
expression vectors, and host cells comprising the nucleotide
sequences, and methods of producing the polypeptides having
glycoside hydrolase activity, according to the same disclosure
herein for glycoside hydrolase variants.
[0521] Cellobiohydrolase I and Nucleotide Sequences Thereof
[0522] The present invention also relates to an isolated
polypeptide having cellobiohydrolase I activity and to an isolated
nucleotide sequence encoding the polypeptide.
[0523] In a preferred embodiment, the isolated polypeptide having
cellobiohydrolase I activity comprises the amino acid sequence of
SEQ ID NO: 2 or an allelic variant thereof; or a fragment thereof
that has cellobiohydrolase I activity. In a more preferred
embodiment, the polypeptide of the present invention comprises the
amino acid sequence of SEQ ID NO: 2. In another preferred
embodiment, the polypeptide of the present invention comprises
amino acids 1 to 513 of SEQ ID NO: 2, or an allelic variant
thereof; or a fragment thereof that has cellobiohydrolase I
activity. In another preferred embodiment, the polypeptide of the
present invention comprises amino acids 1 to 513 of SEQ ID NO: 2.
In another preferred embodiment, the polypeptide of the present
invention consists of the amino acid sequence of SEQ ID NO: 2 or an
allelic variant thereof; or a fragment thereof that has
cellobiohydrolase I activity. In another preferred embodiment, the
polypeptide of the present invention consists of the amino acid
sequence of SEQ ID NO: 2. In another preferred embodiment, the
polypeptide consists of amino acids 1 to 513 of SEQ ID NO: 2 or an
allelic variant thereof; or a fragment thereof that has
cellobiohydrolase I activity. In another preferred embodiment, the
polypeptide consists of amino acids 1 to 513 of SEQ ID NO: 2.
[0524] In another preferred embodiment, the nucleotide sequence is
set forth in SEQ ID NO: 1. In another more preferred embodiment,
the nucleic acid sequence is the sequence contained in plasmid
pAO52 that is contained in Escherichia coli NRRL B-30683. In
another preferred embodiment, the nucleotide sequence is the mature
polypeptide coding region of SEQ ID NO: 1. In another more
preferred embodiment, the nucleotide sequence is the mature
polypeptide coding region contained in plasmid pAJO52 that is
contained in Escherichia coli NRRL B-30683. The present invention
also encompasses nucleotide sequences encoding a polypeptide having
the amino acid sequence of SEQ ID NO: 2, or the mature polypeptide
thereof, which differ from SEQ ID NO: 1 by virtue of the degeneracy
of the genetic code. The present invention also relates to
subsequences of SEQ ID NO: 1 which encode fragments of SEQ ID NO: 2
that have cellobiohydrolase I activity.
[0525] A fragment of SEQ ID NO: 2 is a polypeptide having one or
more amino acids deleted from the amino and/or carboxyl terminus of
this amino acid sequence. Preferably, a fragment contains at least
450 amino acid residues, more preferably at least 470 amino acid
residues, and most preferably at least 490 amino acid residues.
[0526] A subsequence of SEQ ID NO:1 is a nucleic acid sequence
encompassed by SEQ ID NO:1 except that one or more nucleotides from
the 5' and/or 3' end have been deleted. Preferably, a subsequence
contains at least 1350 nucleotides, more preferably at least 1410
nucleotides, and most preferably at least 1470 nucleotides.
[0527] The present invention also relates to mutant nucleic acid
sequences comprising at least one mutation in the mature
polypeptide coding sequence of SEQ ID NO: 1, in which the mutant
nucleic acid sequence encodes a polypeptide which consists of amino
acids 1 to 513 of SEQ ID NO: 2.
[0528] The present invention also relates to nucleic acid
constructs, expression vectors, and host cells comprising the
nucleotide sequence encoding the polypeptide having
cellobiohydrolase activity comprising amino acids 1 to 513 of SEQ
ID NO: 2. Nucleic acid constructs, expression vectors, and host
cells may be constructed as described herein.
[0529] The present invention further relates to methods for
producing the polypeptide having cellobiohydrolase activity,
comprising: (a) cultivating a strain, which in its wild-type form
is capable of producing the polypeptide, to produce the
polypeptide; and (b) recovering the polypeptide, according to the
methods described herein. Preferably, the strain is of the genus
Trichoderma, and more preferably Trichoderma reesei.
[0530] The present invention also relates to methods for producing
a polypeptide of the present invention comprising (a) cultivating a
host cell, comprising a nucleotide sequence encoding the
polypeptide, under conditions conducive for production of the
polypeptide; and (b) recovering the polypeptide, according to the
methods described herein.
[0531] Degradation of Biomass to Monosaccharides, Disaccharides,
and Polysaccharides
[0532] The glycoside hydrolase variants, polypeptides having
glycoside hydrolase activity, and host cells of the present
invention may be used in the production of monosaccharides,
disaccharides, and polysaccharides as chemical or fermentation
feedstocks from biomass for the production of ethanol, plastics, or
other products or intermediates. The glycoside variants and
polypeptides having glycoside hydrolase activity may be in the form
of a crude fermentation broth with or without the cells removed or
in the form of a semi-purified or purified enzyme preparation.
Alternatively, a host cell of the present invention may be used as
a source of the variant or polypeptide having glycoside hydrolase
activity in a fermentation process with the biomass.
[0533] Biomass can include, but is not limited to, wood resources,
municipal solid waste, wastepaper, and crop residues (see, for
example, Wiselogel et al., 1995, in Handbook on Bioethanol (Charles
E. Wyman, editor), pp.105-118, Taylor & Francis, Washington
D.C.; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd, 1990,
Applied Biochemistry and Biotechnology 24/25: 695-719; Mosier et
al., 1999, Recent Progress in Bioconversion of Lignocellulosics, in
Advances in Biochemical Engineering/Biotechnology, T. Scheper,
managing editor, Volume 65, pp.23-40, Springer-Verlag, N.Y.).
[0534] The predominant polysaccharide in the primary cell wall of
biomass is cellulose, the second most abundant is hemi-cellulose,
and the third is pectin. The secondary cell wall, produced after
the cell has stopped growing, also contains polysaccharides and is
strengthened through polymeric lignin covalently cross-linked to
hemicellulose. Cellulose is a homopolymer of anhydrocellobiose and
thus a linear beta-(1-4)-D-glucan, while hemicelluloses include a
variety of compounds, such as xylans, xyloglucans, arabinoxylans,
and mannans in complex branched structures with a spectrum of
substituents. Although generally polymorphous, cellulose is found
in plant tissue primarily as an insoluble crystalline matrix of
parallel glucan chains. Hemicelluloses usually hydrogen bond to
cellulose, as well as to other hemicelluloses, which helps
stabilize the cell wall matrix.
[0535] Three major classes of glycohydrolases are used to breakdown
cellulosic biomass:
[0536] (1) The "endo-1,4-beta-glucanases" or
1,4-beta-D-glucan-4-glucanohy- drolases (EC 3.2.1.4), which act
randomly on soluble and insoluble 1,4-beta-glucan substrates.
[0537] (2) The "exo-1,4-beta-D-glucanases" including both the
1,4-beta-D-glucan glucohydrolases (EC 3.2.1.74), which liberate
D-glucose from 1,4-beta-D-glucans and hydrolyze D-cellobiose
slowly, and cellobiohydrolases (1,4-beta-D-glucan
cellobiohydrolases, EC 3.2.1.91), which liberate D-cellobiose from
1,4-beta-glucans.
[0538] (3) The "beta-D-glucosidases" or beta-D-glucoside
glucohydrolases (EC 3.2.1.21), which act to release D-glucose units
from cellobiose and soluble cellodextrins, as well as an array of
glycosides.
[0539] These three classes of enzymes work together synergistically
resulting in efficient decrystallization and hydrolysis of native
cellulose from biomass to yield reducing sugars.
[0540] The glycoside hydrolase variants and polypeptides having
glycoside hydrolase activity of the present invention may be used
in conjunction with the above-noted enzymes to further degrade the
cellulose component of the biomass substrate, (see, for example,
Brigham et al., 1995, in Handbook on Bioethanol (Charles E. Wyman,
editor), pp.119-141, Taylor & Francis, Washington D.C.; Lee,
1997, Journal of Biotechnology 56: 1-24).
[0541] Ethanol can be produced by enzymatic degradation of biomass
and conversion of the released saccharides to ethanol. This kind of
ethanol is often referred to as bioethanol or biofuel. It can be
used as a fuel additive or extender in blends of from less than 1%
and up to 100% (a fuel substitute).
[0542] Detergent Compositions
[0543] The variants and polypeptides having glycoside hydrolase
activity of the present invention may be added to and thus become a
component of a detergent composition.
[0544] The detergent composition of the present invention may be,
for example, formulated as a hand or machine laundry detergent
composition including a laundry additive composition suitable for
pre-treatment of stained fabrics and a rinse added fabric softener
composition, or formulated as a detergent composition for use in
general household hard surface cleaning operations, or formulated
for hand or machine dishwashing operations.
[0545] In a specific aspect, the present invention provides a
detergent additive comprising the variants and polypeptides having
glycoside hydrolase activity of the present invention. The
detergent additive as well as the detergent composition may
comprise one or more other enzymes such as a protease, lipase,
cutinase, an amylase, carbohydrase, cellulase, pectinase,
mannanase, arabinase, galactanase, xylanase, oxidase, e.g., a
laccase, and/or peroxidase.
[0546] In general the properties of the enzymatic components should
be compatible with the selected detergent, (i.e., pH-optimum,
compatibility with other enzymatic and non-enzymatic ingredients,
etc.), and the enzymatic components should be present in effective
amounts.
[0547] Proteases: Suitable proteases include those of animal,
vegetable or microbial origin. Microbial origin is preferred.
Chemically modified or protein engineered mutants are included. The
protease may be a serine protease or a metalloprotease, preferably
an alkaline microbial protease or a trypsin-like protease. Examples
of alkaline proteases are subtilisins, especially those derived
from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg,
subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO
89/06279). Examples of trypsin-like proteases are trypsin (e.g., of
porcine or bovine origin) and the Fusarium protease described in WO
89/06270 and WO 94/25583.
[0548] Examples of useful proteases are the variants described in
WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially
the variants with substitutions in one or more of the following
positions: 27, 36, 57, 76, 87, 97, 101, 104, 120, 123, 167, 170,
194, 206, 218, 222, 224, 235 and 274.
[0549] Preferred commercially available protease enzymes include
Alcalase.TM., Savinase.TM., Primase.TM., Duralase.TM.,
Esperase.TM., and Kannase.TM. (Novozymes A/S), Maxatase.TM.,
Maxacal.TM., Maxapem.TM., Properase.TM., Purafect.TM., Purafect
OxP.TM., FN2.TM., and FN3.TM. (Genencor International Inc.).
[0550] Lipases: Suitable lipases include those of bacterial or
fungal origin. Chemically modified or protein engineered mutants
are included. Examples of useful lipases include lipases from
Humicola (synonym Thermomyces), e.g., from H. lanuginosa (T.
lanuginosus) as described in EP 258 068 and EP 305 216 or from H.
insolens as described in WO 96/13580, a Pseudomonas lipase, e.g.,
from P. alcaligenes or P. pseudoalcaligenes (EP 218 272), P.
cepacia (EP 331 376), P. stutzeri (GB 1,372,034), P. fluorescens,
Pseudomonas sp. strain SD 705 (WO 95/06720 and WO 96/27002), P.
wisconsinensis (WO 96/12012), a Bacillus lipase, e.g., from B.
subtilis (Dartois et al., 1993, Biochemica et Biophysica Acta,
1131, 253-360), B. stearothermophilus (JP 64/744992) or B. pumilus
(WO 91/16422).
[0551] Other examples are lipase variants such as those described
in WO 92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381,
WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO
97/04079 and WO 97/07202.
[0552] Preferred commercially available lipases include
Lipolase.TM. and Lipolase Ultra.TM. (Novozymes A/S).
[0553] Amylases: Suitable amylases (.alpha. and/or .beta.) include
those of bacterial or fungal origin. Chemically modified or protein
engineered mutants are included. Amylases include, for example,
.alpha.-amylases obtained from Bacillus, e.g., a special strain of
Bacillus licheniformis, described in more detail in GB
1,296,839.
[0554] Examples of useful amylases are the variants described in WO
94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially the
variants with substitutions in one or more of the following
positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181, 188,
190, 197, 202, 208, 209, 243, 264, 304, 305, 391, 408, and 444.
[0555] Commercially available amylases are Duramyl.TM.,
Termamyl.TM., Fungamyl.TM. and BAN.TM. (Novozymes A/S),
Rapidase.TM. and Purastar.TM. (from Genencor International
Inc.).
[0556] Cellulases: Suitable cellulases include those of bacterial
or fungal origin. Chemically modified or protein engineered mutants
are included. Suitable cellulases include cellulases from the
genera Bacillus, Pseudomonas, Humicola, Fusarium, Thielavia,
Acremonium, e.g., the fungal cellulases produced from Humicola
insolens, Myceliophthora thermophila and Fusarium oxysporum
disclosed in U.S. Pat. No. 4,435,307, U.S. Pat. No. 5,648,263, U.S.
Pat. No. 5,691,178, U.S. Pat. No. 5,776,757 and WO 89/09259.
[0557] Especially suitable cellulases are the alkaline or neutral
cellulases having colour care benefits. Examples of such cellulases
are cellulases described in EP 0 495 257, EP 0 531 372, WO
96/11262, WO 96/29397, WO 98/08940. Other examples are cellulase
variants such as those described in WO 94/07998, EP 0 531 315, U.S.
Pat. No. 5,457,046, U.S. Pat. No. 5,686,593, U.S. Pat. No.
5,763,254, WO 95/24471, WO 98/12307 and PCT/DK98/00299.
[0558] Commercially available cellulases include Celluzyme.TM., and
Carezyme.TM. (Novozymes A/S), Clazinase.TM., and Puradax HA.TM.
(Genencor International Inc.), and KAC-500(B).TM. (Kao
Corporation).
[0559] Peroxidases/Oxidases: Suitable peroxidases/oxidases include
those of plant, bacterial or fungal origin. Chemically modified or
protein engineered mutants are included. Examples of useful
peroxidases include peroxidases from Coprinus, e.g., from C.
cinereus, and variants thereof as those described in WO 93/24618,
WO 95/10602, and WO 98/15257.
[0560] Commercially available peroxidases include Guardzyme.TM.
(Novozymes A/S).
[0561] The enzymatic component(s) may be included in a detergent
composition by adding separate additives containing one or more
enzymes, or by adding a combined additive comprising all of these
enzymes. A detergent additive of the present invention, i.e., a
separate additive or a combined additive, can be formulated, for
example, as a granulate, liquid, slurry, etc. Preferred detergent
additive formulations are granulates, in particular non-dusting
granulates, liquids, in particular stabilized liquids, or
slurries.
[0562] Non-dusting granulates may be produced, e.g., as disclosed
in U.S. Pat. Nos. 4,106,991 and 4,661,452 and may optionally be
coated by methods known in the art. Examples of waxy coating
materials are poly(ethylene oxide) products (polyethyleneglycol;
PEG) with mean molar weights of 1000 to 20000; ethoxylated
nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated
fatty alcohols in which the alcohol contains from 12 to 20 carbon
atoms and in which there are 15 to 80 ethylene oxide units; fatty
alcohols; fatty acids; and mono- and di- and triglycerides of fatty
acids. Examples of film-forming coating materials suitable for
application by fluid bed techniques are given in GB 1483591. Liquid
enzyme preparations may, for instance, be stabilized by adding a
polyol such as propylene glycol, a sugar or sugar alcohol, lactic
acid or boric acid according to established methods. Protected
enzymes may be prepared according to the method disclosed in EP
238,216.
[0563] The detergent composition of the present invention may be in
any convenient form, e.g., a bar, a tablet, a powder, a granule, a
paste or a liquid. A liquid detergent may be aqueous, typically
containing up to 70% water and 0-30% organic solvent, or
non-aqueous.
[0564] The detergent composition comprises one or more surfactants,
which may be non-ionic including semi-polar and/or anionic and/or
cationic and/or zwitterionic. The surfactants are typically present
at a level of from 0.1% to 60% by weight.
[0565] When included therein the detergent will usually contain
from about 1% to about 40% of an anionic surfactant such as linear
alkylbenzenesulfonate, alpha-olefinsulfonate, alkyl sulfate (fatty
alcohol sulfate), alcohol ethoxysulfate, secondary alkanesulfonate,
alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid
or soap.
[0566] When included therein the detergent will usually contain
from about 0.2% to about 40% of a non-ionic surfactant such as
alcohol ethoxylate, nonylphenol ethoxylate, alkylpolyglycoside,
alkyldimethylamineoxide, ethoxylated fatty acid monoethanolamide,
fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or
N-acyl N-alkyl derivatives of glucosamine ("glucamides").
[0567] The detergent may contain 0-65 % of a detergent builder or
complexing agent such as zeolite, diphosphate, triphosphate,
phosphonate, carbonate, citrate, nitrilotriacetic acid,
ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic
acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered
silicates (e.g., SKS-6 from Hoechst).
[0568] The detergent may comprise one or more polymers. Examples
are carboxymethylcellulose, poly(vinylpyrrolidone), poly(ethylene
glycol), poly(vinyl alcohol), poly(vinylpyridine-N-oxide),
poly(vinylimidazole), polycarboxylates such as polyacrylates,
maleic/acrylic acid copolymers, and lauryl methacrylate/acrylic
acid copolymers.
[0569] The detergent may contain a bleaching system that may
comprise a H.sub.20.sub.2 source such as perborate or percarbonate
which may be combined with a peracid-forming bleach activator such
as tetraacetylethylenediamine or nonanoyloxybenzenesulfonate.
Alternatively, the bleaching system may comprise peroxyacids of,
for example, the amide, imide, or sulfone type.
[0570] The enzymatic component(s) of the detergent composition of
the present invention may be stabilized using conventional
stabilizing agents, e.g., a polyol such as propylene glycol or
glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a
boric acid derivative, e.g., an aromatic borate ester, or a phenyl
boronic acid derivative such as 4-formylphenyl boronic acid, and
the composition may be formulated as described in, for example, WO
92/19709 and WO 92/19708.
[0571] The detergent may also contain other conventional detergent
ingredients such as fabric conditioners including clays, foam
boosters, suds suppressors, anti-corrosion agents, soil-suspending
agents, anti-soil redeposition agents, dyes, bactericides, optical
brighteners, hydrotropes, tarnish inhibitors, or perfumes.
[0572] In the detergent compositions any enzymatic component, in
particular the variants and polypeptides having glycoside hydrolase
activity of the present invention, may be added in an amount
corresponding to 0.01-100 mg of enzyme protein per liter of wash
liquor, preferably 0.05-5 mg of enzyme protein per liter of wash
liquor, in particular 0.1-1 mg of enzyme protein per liter of wash
liquor.
[0573] The variants and polypeptides having glycoside hydrolase
activity of the present invention may additionally be incorporated
in the detergent formulations disclosed in WO 97/07202 which is
hereby incorporated as reference.
[0574] Plants
[0575] The present invention also relates to a transgenic plant,
plant part, or plant cell which has been transformed with a
nucleotide sequence encoding a variant or polypeptids having
glycoside hydrolase activity of the present invention so as to
express and produce the variant or polypeptide in recoverable
quantities. The variant or polypeptide may be recovered from the
plant or plant part. Alternatively, the plant or plant part
containing the variant or polypeptide may be used as such for
improving the quality of a food or feed, e.g., improving
nutritional value, palatability, and rheological properties, or to
destroy an antinutritive factor.
[0576] The transgenic plant can be dicotyledonous (a dicot) or
monocotyledonous (a monocot). Examples of monocot plants are
grasses, such as meadow grass (blue grass, Poa), forage grass such
as Festuca, Lolium, temperate grass, such as Agrostis, and cereals,
e.g., wheat, oats, rye, barley, rice, sorghum, and maize
(corn).
[0577] Examples of dicot plants are tobacco, legumes, such as
lupins, potato, sugar beet, pea, bean and soybean, and cruciferous
plants (family Brassicaceae), such as cauliflower, rape seed, and
the closely related model organism Arabidopsis thaliana.
[0578] Examples of plant parts are stem, callus, leaves, root,
fruits, seeds, and tubers as well as the individual tissues
comprising these parts, e.g., epidermis, mesophyll, parenchyme,
vascular tissues, meristems. Specific plant cell compartments, such
as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and
cytoplasm are also considered to be a plant part. Furthermore, any
plant cell, whatever the tissue origin, is considered to be a plant
part. Likewise, plant parts such as specific tissues and cells
isolated to facilitate the utilisation of the invention are also
considered plant parts, e.g., embryos, endosperms, aleurone and
seeds coats.
[0579] Also included within the scope of the present invention are
the progeny of such plants, plant parts, and plant cells.
[0580] The transgenic plant or plant cell expressing a variant or
polypeptide of the present invention may be constructed in
accordance with methods known in the art. In short, the plant or
plant cell is constructed by incorporating one or more expression
constructs encoding a variant or polypeptide of the present
invention into the plant host genome and propagating the resulting
modified plant or plant cell into a transgenic plant or plant
cell.
[0581] Conveniently, the expression construct is a nucleic acid
construct which comprises a nucleic acid sequence encoding a
variant or polypeptide of the present invention operably linked
with appropriate regulatory sequences required for expression of
the nucleic acid sequence in the plant or plant part of choice.
Furthermore, the expression construct may comprise a selectable
marker useful for identifying host cells into which the expression
construct has been integrated and DNA sequences necessary for
introduction of the construct into the plant in question (the
latter depends on the DNA introduction method to be used).
[0582] The choice of regulatory sequences, such as promoter and
terminator sequences and optionally signal or transit sequences, is
determined, for example, on the basis of when, where, and how the
variant or polypeptide is desired to be expressed. For example, the
expression of the gene encoding a variant or polypeptide of the
present invention may be constitutive or inducible, or may be
developmental, stage or tissue specific, and the gene product may
be targeted to a specific tissue or plant part such as seeds or
leaves. Regulatory sequences are, for example, described by Tague
et al., 1988, Plant Physiology 86: 506.
[0583] For constitutive expression, the 35S-CaMV, the maize
ubiquitin 1, and the rice actin 1 promoter may be used (Franck et
al., 1980, Cell21: 285-294, Christensen et al., 1992, Plant Mo.
Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165).
Organ-specific promoters may be, for example, a promoter from
storage sink tissues such as seeds, potato tubers, and fruits
(Edwards & Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or
from metabolic sink tissues such as meristems (Ito et al., 1994,
Plant Mol. Biol. 24: 863-878), a seed specific promoter such as the
glutelin, prolamin, globulin, or albumin promoter from rice (Wu et
al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia faba
promoter from the legumin B4 and the unknown seed protein gene from
Vicia faba (Conrad et al., 1998, Journal of Plant Physiology 152:
708-711), a promoter from a seed oil body protein (Chen et al.,
1998, Plant and Cell Physiology 39: 935-941), the storage protein
napA promoter from Brassica napus, or any other seed specific
promoter known in the art, e.g., as described in WO 91/14772.
Furthermore, the promoter may be a leaf specific promoter such as
the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant
Physiology 102: 991-1000, the chlorella virus adenine
methyltransferase gene promoter (Mitra and Higgins, 1994, Plant
Molecular Biology26: 85-93), or the aldP gene promoter from rice
(Kagaya et al., 1995, Molecular and General Genetics 248: 668-674),
or a wound inducible promoter such as the potato pin2 promoter (Xu
et al., 1993, Plant Molecular Biology 22: 573-588). Likewise, the
promoter may inducible by abiotic treatments such as temperature,
drought, or alterations in salinity or induced by exogenously
applied substances that activate the promoter, e.g., ethanol,
oestrogens, plant hormones such as ethylene, abscisic acid, and
gibberellic acid, and heavy metals.
[0584] A promoter enhancer element may also be used to achieve
higher expression of a polypeptide of the present invention in the
plant. For example, the promoter enhancer element may be an intron
which is placed between the promoter and the nucleotide sequence
encoding a polypeptide of the present invention. Xu et al., 1993,
supra, disclose the use of the first intron of the rice actin 1
gene to enhance expression.
[0585] The selectable marker gene and any other parts of the
expression construct may be chosen from those available in the
art.
[0586] The nucleic acid construct is incorporated into the plant
genome according to conventional techniques known in the art,
including Agrobacterium-mediated transformation, virus-mediated
transformation, microinjection, particle bombardment, biolistic
transformation, and electroporation (Gasser et al., 1990, Science
244: 1293; Potrykus, 1990, Bio/Technology8: 535; Shimamoto et al.,
1989, Nature 338: 274).
[0587] Presently, Agrobacterium tumefaciens-mediated gene transfer
is the method of choice for generating transgenic dicots (for a
review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology
19: 15-38) and can also be used for transforming monocots, although
other transformation methods are often used for these plants.
Presently, the method of choice for generating transgenic monocots
is particle bombardment (microscopic gold or tungsten particles
coated with the transforming DNA) of embryonic calli or developing
embryos (Christou, 1992, Plant Journal2: 275-281; Shimamoto, 1994,
Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992,
Bio/Technology 10: 667-674). An alternative method for
transformation of monocots is based on protoplast transformation as
described by Omirulleh et al., 1993, Plant Molecular Biology21:
415-428.
[0588] Following transformation, the transformants having
incorporated the expression construct are selected and regenerated
into whole plants according to methods well-known in the art. Often
the transformation procedure is designed for the selective
elimination of selection genes either during regeneration or in the
following generations by using, for example, co-transformation with
two separate T-DNA constructs or site specific excision of the
selection gene by a specific recombinase.
[0589] The present invention also relates to methods for producing
a variant or polypeptide of the present invention comprising (a)
cultivating a transgenic plant or a plant cell comprising a nucleic
acid sequence encoding a variant or polypeptide having glycoside
hydrolase activity of the present invention under conditions
conducive for production of the variant; and (b) recovering the
variant or polypeptide.
[0590] Other Uses
[0591] The glycoside hydrolase variants or polypeptides having
glycoside hydrolase activity of the present invention may also be
used in the treatment of textiles as biopolishing agents and for
reducing fuzz, pilling, texture modification, and stonewashing (N.
K. Lange, in P. Suominen, T. Reinikainen (Eds.), Trichoderma reesei
Cellulases and Other Hydrolases, Foundation for Biotechnical and
Industrial Fermentation research, Helsinki, 1993, pp. 263-272). In
addition, the described variants or polypeptides having glycoside
hydrolase activity may also be used in wood processing for
biopulping or debarking, paper manufacturing for fiber
modification, bleaching, and reduction of refining energy costs,
whitewater treatment, important to wastewater recycling,
lignocellulosic fiber recycling such as deinking and secondary
fiber processing, and wood residue utilization (S. D, Mansfield and
A. R. Esteghlalian in S. D, Mansfield and J. N. Saddler (Eds.),
Applications of Enzymes to Lignocellulosics, ACS Symposium Series
855, Washington, D.C., 2003, pp. 2-29).
[0592] The present invention is further described by the following
examples which should not be construed as limiting the scope of the
invention.
EXAMPLES
[0593] Strains
[0594] Trichoderma reesei RutC30 (ATCC 56765; Montenecourt and
Eveleigh, 1979, Adv. Chem. Ser. 181: 289-301) was derived from
Trichoderma reesei Qm6A (ATCC 13631; Mandels and Reese, 1957, J.
Bacteriol. 73: 269-278).
[0595] Aspergillus oryzae Jal250 strain (WO 99/61651) was used for
expression of the thermostable beta-glucosidase.
[0596] Saccharomyces cerevisiae YNG 344 (MAT.alpha., ura3-52,
leu-2.DELTA.2, pep4.DELTA.1, his4-539, cir.sup.0) was used to
generate libraries of mutagenized glycoside hydrolase (Cel7A).
[0597] Bacterial strains used to generate plasmids were Epicurian
coli XL-10 Gold ultracompetent cells, (Stratagene, Inc., La Jolla,
Calif.).
[0598] Media and Solutions
[0599] Yeast selection medium was composed per liter of 6.7 g of
yeast nitrogen base, 0.8 g of complete supplement mixture (CSM-URA,
Qbiogene, Inc., Carlsbad, Calif.; lacking uracil and containing 40
mg/ml of adenine), 5 g of casamino acid, and 20 g of Noble agar.
The medium also contained 50 mM succinate pH 5.0, 2% glucose, and
25 .mu.g of chloramphenicol per ml.
[0600] Yeast screening medium was composed per liter of 6.7 g of
yeast nitrogen base, 0.8 g of CSM-URA, 5 g of casamino acid, and 20
g of Noble agar. The medium also contained 50 mM succinate pH 5.0,
2% galactose, 0.1% glucose, and 25 .mu.g of chloramphenicol per
ml.
[0601] YPD medium was composed per liter of 10 g of yeast extract,
20 g of bacto peptone, and 40 ml of 50% glucose.
[0602] Cellulase-inducing media was composed per liter of 20 g of
Arbocel B800-natural cellulose fibers (J. Rettenmaier USA LP,
Schoolcraft, Mich.), 10 g of corn steep solids (Sigma Chemical Co.,
St. Louis, Mo.), 1.45 g of (NH.sub.4).sub.2SO.sub.4, 2.08 g of
KH.sub.2PO.sub.4, 0.28 g of CaCl.sub.2, 0.42 g of
MgSO.sub.4.7H.sub.2O, 0.42 ml of Trichoderma reesei trace metals
solution, and 2 drops of pluronic acid; pH to 6.0 with 10 N
NaoH.
[0603] Trichoderma reesei trace metals solution was composed per
liter of 216 g of FeCl.sub.3.6H.sub.2O, 58 g of
ZnSO.sub.4.7H.sub.2O, 27 g of MnSO.sub.4.H.sub.2O, 10 g of
CuSO.sub.4.5H.sub.2O, 2.4 g of H.sub.3BO.sub.3, and 336 g of citric
acid.
[0604] COVE selection plates were composed per liter of 342.3 g of
sucrose, 20 ml of COVE salt solution, 10 mM acetamide, 15 mM
CsCl.sub.2, and 25 g of Noble agar.
[0605] COVE2 plus uridine plates were composed per liter of 30 g of
sucrose, 20 ml COVE salt solution, 10 mM acetamide, 10 mM uridine,
and 25 g of Noble agar.
[0606] COVE salt solution was composed per liter of 26 g of KCl, 26
g of MgSO.sub.4.7H.sub.2O, 76 g of KH.sub.2PO.sub.4, and 50 ml of
COVE trace metals.
[0607] COVE trace metals solution was composed per liter of 0.04 g
of NaB.sub.4O.sub.7.10H.sub.2O, 0.4 g of CuSO.sub.4.5H.sub.2O, 1.2
g of FeSO.sub.4.7H.sub.2O, 0.7 g of MnSO.sub.4.H.sub.2O, 0.8 g of
Na.sub.2MoO.sub.2.2H.sub.2O, and 10 g of ZnSO.sub.4.7H.sub.2O.
[0608] PDA medium was composed per liter of 39 g potato dextrose
agar.
[0609] 1.times.SSC was composed per liter of 8.765 g sodium
chloride and 4.41 g sodium citrate.
[0610] PEG Buffer was composed per liter of 500 g of PEG 4000 (BDH,
Poole, England), 10 mM CaCl.sub.2, and 10 mM Tris-HCl pH 7.5
(filter sterilized).
[0611] STC was composed per liter of 1 M sorbitol, 10 mM
CaCl.sub.2, and 10 mM Tris-HCl pH 7.5, and was filter
sterilized.
[0612] Trichoderma reesei Inoculum Medium was composed per liter of
20 g of glucose, 10 g of corn steep solids (Sigma Chemical Co., St.
Louis, Mo.), 1.45 g of (NH.sub.4).sub.2SO.sub.4, 2.08 g of
KH.sub.2PO.sub.4, 0.28 g of CaCl.sub.2, 0.42 g of
MgSO.sub.4.7H.sub.2O, 0.42 ml of Trichoderma reesei trace metals
solution, and 2 drops of pluronic acid; final pH 5.0.
[0613] Trichoderma reesei Fermentation Medium was composed per
liter of 4 g of glucose, 10 g of corn steep solids, 30 g of Arbocel
B800-natural cellulose fibers (J. Rettenmaier USA LP, Schoolcraft,
Mich.), 3.8 g of (NH.sub.4).sub.2SO.sub.4, 2.8 g of
KH.sub.2PO.sub.4, 2.08 g of CaCl.sub.2, 1.63 g of
MgSO.sub.4.7H.sub.2O, 0.75 ml of Trichoderma reesei trace metals
solution, and 1.8 ml of pluronic acid.
[0614] Trichoderma reesei Feed Medium was composed per liter of 600
g of glucose, 20 g of Cellulose B800, 35.5 g of H.sub.3PO.sub.4,
and 5 ml of pluronic acid.
[0615] Aspergillus oryzae Inoculum Medium was composed per liter of
50 g of glucose, 2 g of MgSO.sub.4.7H.sub.2O, 10 g of
KH.sub.2PO.sub.4, 2 g of K.sub.2SO.sub.4, 2.08 g of CaCl.sub.2.2
H.sub.2O, 2 g of citric acid, 10 g of yeast extract, 0.5 g of AMG
trace metals, and 2 g of urea, final pH 6.0.
[0616] AMG trace metals is comprised per liter of 14.3 g of
ZnSO.sub.4.7H.sub.2O, 2.5 g of CuSO.sub.4.5H.sub.2O, 0.5 g of
NiCl.sub.2.6H.sub.2O, 13.8 g of FeSO.sub.4.7H.sub.2O, 8.5 g of
MnSO.sub.4.H.sub.2O, and 3 g of citric acid.
[0617] Aspergillus oryzae Fermentation Medium was composed per
liter of 2 g MgSO.sub.4.7H.sub.2O, 2 g of KH.sub.2PO.sub.4, 3 g of
K.sub.2SO.sub.4, 9 g of (NH4).sub.2 HPO.sub.4, 1 g of citric
acid.H.sub.2O, 10 g of yeast extract, 0.5 ml of AMG trace metals,
25 g of sucrose, and 0.55 mL of pluronic.
[0618] Aspergillus oryzae Feed Medium was composed per liter of 1 g
of citric acid.H.sub.2O, 320 g SatinSweet 65, and 5 g of
pluronic.
[0619] MDU2BP medium is composed per liter of 45 g of maltose, 1 g
of MgSO.sub.4.7H.sub.2O, 1 g of NaCl, 2 g of K.sub.2SO.sub.4, 12 g
of KH.sub.2PO.sub.4, 7 g of yeast extract, 2 g of urea, 0.5 ml of
AMG trace metals solution.
Example 1
Fermentation and Mycelial Tissue
[0620] Trichoderma reesei RutC30 was grown under cellulase inducing
standard conditions as described in the art (Mandels and Weber,
1969, Adv. Chem. Ser. 95: 391-413). Mycelial samples were harvested
by filtration through Whatman paper and quick-frozen in liquid
nitrogen. The samples were stored at -80.degree. C. until they were
disrupted for RNA extraction.
Example 2
Expressed Sequence Tags (EST) cDNA Library Construction
[0621] Total cellular RNA was extracted from the mycelial samples
described in Example 1 according to the method of Timberlake and
Barnard (1981, Cell 26: 29-37), and the RNA samples were analyzed
by Northern hybridization after blotting from 1%
formaldehyde-agarose gels (Davis etal., 1986, Basic Methods in
Molecular Biology, Elsevier Science Publishing Co., Inc., New
York). Polyadenylated mRNA fractions were isolated from total RNA
with an mRNA Separator Kit.TM. (Clontech Laboratories, Inc., Palo
Alto, Calif.) according to the manufacturer's instructions.
Double-stranded cDNA was synthesized using approximately 5 .mu.g of
poly(A)+ mRNA according to the method of Gubler and Hoffman (1983,
Gene25: 263-269), except a NotI-(dT)18 primer (Pharmacia Biotech,
Inc., Piscataway, N.J.) was used to initiate first strand
synthesis. The cDNA was treated with mung bean nuclease (Boehringer
Mannheim Corporation, Indianapolis, Ind.) and the ends were made
blunt with T4 DNA polymerase (New England Biolabs, Beverly,
Mass.).
[0622] BamH I/EcoR I adaptors were ligated to the blunt ends of the
cDNA. After digestion with NotI, the cDNA was size selected (ca.
0.7-4.5 kb) by 0.7% agarose gel electrophoresis using TAE buffer
(4.84 g of Tris Base, 1.14 ml of glacial acetic acid, and 2 ml of
0.5 M EDTA pH 8.0 per liter), and ligated with pYES2 (Invitrogen
Corporation, Carlsbad, Calif.) which had been cleaved with NotI
plus BamH I and dephosphorylated with calf-intestine alkaline
phosphatase (Boehringer Mannheim Corporation, Indianapolis, Ind.).
The ligation mixture was used to transform competent E. coli TOP10
cells (Invitrogen Corporation, Carlsbad, Calif.). Transformants
were selected on 2YT agar plates (Miller, 1992, A Short Course in
Bacterial Genetics. A Laboratory Manual and Handbook for
Escherichia coil and Related Bacteria, Cold Spring Harbor Press,
Cold Spring Harbor, N.Y.) supplemented with ampicillin at a final
concentration of 50 .mu.g per ml.
Example 3
Template Preparation and Nucleotide Sequencing of cDNA Clones
[0623] From the cDNA library described in Example 2, approximately
7000 transformant colonies were picked directly from the
transformation plates into 96-well microtiter dishes which
contained 100 .mu.l of 2YT broth supplemented with 50 .mu.g of
ampicillin per ml. The plates were incubated overnight at
37.degree. C. with shaking at 200 rpm. After incubation, 100 .mu.l
of sterile 50% glycerol was added to each well. The transformants
were replicated into secondary, deep-dish 96-well microculture
plates (Advanced Genetic Technologies Corporation, Gaithersburg,
Md.) containing 1 ml of Magnificent Broth.TM. (MacConnell Research,
San Diego, Calif.) supplemented with 50 .mu.g of ampicillin per ml
in each well. The primary microtiter plates were stored frozen at
-80.degree. C. The secondary deep-dish plates were incubated at
37.degree. C. overnight with vigorous agitation (300 rpm) on a
rotary shaker. To prevent spilling and cross-contamination, and to
allow sufficient aeration, each secondary culture plate was covered
with a polypropylene pad (Advanced Genetic Technologies
Corporation, Gaithersburg, Md.) and a plastic microtiter dish
cover.
[0624] DNA was isolated from each well using a 96-well Miniprep Kit
protocol of Advanced Genetic Technologies Corporation
(Gaithersburg, Md.) as modified by Utterback et al. (1995, Genome
Sci. Technol. 1: 1-8). Single-pass DNA sequencing (EST) was
performed with a Perkin-Elmer Applied Biosystems Model 377 XL
Automated DNA Sequencer (Perkin-Elmer/Applied Biosystems, Inc.,
Foster City, Calif.) using dye-terminator chemistry (Giesecke et
al., 1992, Journal of Virology Methods 38: 47-60) and a T7
sequencing primer: 5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO: 3)
Example 4
Analysis of DNA Sequence Data of cDNA Clones
[0625] Nucleotide sequence data were scrutinized for quality and
vector sequences and ambiguous base calls at the ends of the DNA
sequences were trimmed, and all sequences were compared to each
other with assistance of PHRED/PHRAP software (University of
Washington, Seattle, Wash.). The resulting contigs and singletons
were translated in six frames and searched against publicly
available protein databases using GeneMatcher.TM. software
(Paracel, Inc., Pasadena, Calif.) with a modified Smith-Waterman
algorithm using the BLOSUM 62 matrix.
Example 5
Identification of cDNA Clones Encoding a Family 7 Cellobiohydrolase
I (Cel7A)
[0626] Putative cDNA clones encoding a Family 7 cellobiohydrolase
(Cel7A) were identified by comparing the deduced amino acid
sequence of the assembled ESTs to protein sequences deposited in
publicly available databases such as Swissprot, Genpept, and PIR.
One clone, Trichoderma reesei EST Tr0221, was selected for
nucleotide sequence analysis which revealed an 1821 bp pYES2 insert
which contained a 1452 bp open reading-frame as shown in SEQ ID NO:
1 and a deduced amino acid sequence as shown in SEQ ID NO: 2. The
plasmid containing Trichoderma reesei Cel7A cellobiohydrolase I was
designated pTr0221.
Example 6
Construction of Saccharomyces cerevisiae Vectors for the Generation
of Primary and Shuffled Trichoderma reesei Cel7A Cellobiohydrolase
I Libraries
[0627] Two vectors were utilized in the generation of primary and
shuffled libraries, pJC106 (WO9510602) and pAJ052 (FIG. 1). Plasmid
pJC106 is a derivative of pYES2 (Invitrogen Inc., Carlsbad, Calif.)
but differs in that pJC106 has a full-length 2 micron replicon,
which replaces the partial 2 micron in pYES2, and contains the
Coprinus cinereus peroxidase (CIP) (Cherry et al., 1999, Nat.
Biotechnol. 4: 379-384) coding sequence, which is regulated by the
GAL1 promoter.
[0628] For pAJ052, a 1452 bp DNA fragment spanning from the ATG
start codon to the TAA stop codon of the Trichoderma reesei Cel 7A
coding sequence was PCR amplified from pTr0221 (Example 5) using
primers aGal.sub.--776.1 (sense) and aGal.sub.--776.1A (antisense)
shown below:
1 Primer aGal_776.1: 5'-TATACCTCTATACTTTAACGTCAAGGAGAAAAAAC-
TATAGGATCCACCATGTATCGGAAGTTGGCCG-3' (SEQ ID NO: 4) Primer
aGal_776.1A: 5'-CATAACTAATTACATGATGCGGCCCTCTAGATGCACATGACTCGAGTTAC-
AGGCACTGAGAGTAG-3' (SEQ ID NO: 5)
[0629] Primers aGal.sub.--776.1 and aGal.sub.--776.1A were designed
to contain a homologous GAL1 promoter (Glniger and Ptashne, 1988,
Proc. Natl. Acad. Sci., USA 85: 382-386) and the CYC1 terminator
sequence (Osbourne and Guarente, 1988, Genes Dev. 2: 766-772)
(underlined, respectively) of pJC106 for in vivo homologous
recombination of the PCR product and pJC106. Primers
aGal.sub.--776.1 and aGal.sub.--776.1A were also designed to
contain BamH I and Xho I restriction sites, respectively. Primer
aGal.sub.--776.1 was further designed to contain the yeast Kozak
sequence (ACC, -3 to -1 bp; Kozak, 1984, Nature 308: 241-246)
immediately upstream of the Trichoderma reesei cellobiohydrolase I
(Cel7A) gene ATG. The amplification reaction (50 .mu.l) was
composed of 1.times.PCR buffer (Applied Biosystems Inc., Foster
City, Calif.), 0.2 mM dNTPs, 3.2 pM primer aGal.sub.--776.1, 3.2 pM
primer aGal.sub.--776.1A, approximately 100 ng of pTr0221, and 2.5
units of Taq DNA Polymerase (Roche Applied Science, Manheim,
Germany). The reactions were incubated in an Eppendorf Mastercycler
5333 (Eppendorf E G, Hamburg, Germany) programmed for 1 cycle at
94.degree. C. for 3 minutes followed by 30 cycles each at
94.degree. C for 30 seconds, 55.degree. C. for 30 seconds, and
72.degree. C. for 90 seconds followed by 1 cycle at 72.degree. C.
for 5 minutes. The PCR product was then purified using a QIAquick
PCR Kit (QIAGEN Inc., Valencia, Calif.), according to the
manufacturer's instructions, and was then introduced into
Saccharomyces cerevisiae by in vivo recombination. To accomplish
the in vivo recombination, approximately 100 ng of pJC016, digested
with BamH I and Xho I, and approximately 500 ng of the purified PCR
fragment, were co-transformed into Saccharomyces cerevisiae YNG 344
following the YEASTMAKER yeast transformation protocol (Clontech
Laboratories Inc., Palo Alto, Calif.). The transformation was
plated onto yeast selection medium for colony growth at 30.degree.
C. for 4 days.
[0630] A single colony was selected and plasmid DNA was isolated
according to the protocol described by Kaiser and Auer, 1993,
BioTechniques 14: 552, which was subsequently transformed into E.
coli strain XL-10 (Stratagene Inc., La Jolla, Calif.) according to
the manufacturer's instructions. Plasmid derived from the
transformed E. coli strain was sequenced to verify the fidelity of
the PCR and recombination event.
Example 7
Generation of Primary Libraries of Mutagenized Cel7A
Cellobiohydrolase I in Saccharomyces cerevisiae
[0631] In an effort to identify regions of the Trichoderma reesei
Cel7A cellobiohydrolase I that are critical for protein
thermostability and improved high-temperature activity, the entire
wild-type Trichoderma reesei Cel7A cellobiohydrolase I gene was
mutagenized using error-prone PCR with homologous sequences to the
yeast expression vector pJC106 (FIG. 2), which can undergo in vivo
recombination between homologous domains of distinct fragments,
generating circular, replicating plasmids from a combination of
linearized vector and PCR products.
[0632] PCR products for gap repair were generated using one of the
following template/primer combinations:
[0633] 1) Primer aGal.sub.--776.1 and primer aGal.sub.--776.la,
shown below, were used in the error-prone PCR amplification of the
Cel7A cellobiohydrolase I gene from pTR0221 to generate mutagenized
sequences.
[0634] 2) Primer yes2term and primer CiPpcrdwn, shown below, were
used in the error-prone PCR amplification of the Cel7A
cellobiohydrolase I gene from pAJ052 to generate mutagenized
sequences.
[0635] 3) Primer cJC106.1a and primer CiPpcrdwn, shown below, were
also used in the error-prone PCR amplification of the Cel7A
cellobiohydrolase I gene from pAJ052 to generate mutagenized
sequences.
[0636] The fragments were cloned into pJC106 for expression of the
Cel7A cellobiohydrolase I variants in yeast.
2 Primer aGal_776.1: 5'-TATACCTCTATACTTTAACGTCAAGGAGAAAAAA-
CTATAGGATCCACCATGTATCGGAAGTTGGCCG-3' (SEQ ID NO: 6) Primer
aGal_776.1a: 5'-CATAACTAATTACATGATGCGGCCCTCTAGATGCACATGACTCGAGTTAC-
AGGCACTGAGAGTAG-3' (SEQ ID NO: 7) Primer yes2term:
5'-GGCGTGAATGTAAGCGTGAC-3' (SEQ ID NO: 8) Primer CiPpcrdwn:
5'-CTGGGGTAATTAATCAGCGAAGCGATGA-3' (SEQ ID NO: 9) Primer cJC106.1a:
5'-GCGTACACGCGTCTGTACA-3' (SEQ ID NO: 10)
[0637] The error-prone PCR amplifications (50 .mu.l) were composed
of 1.times.PCR buffer with MgCl.sub.2, 0.2 mM dATP, 0.2 mM dGTP,
0.1 mM dCTP and 0.1 mM dTTP, 50 pmol of sense and antisense primer,
0.05 mM to 0.6 mM MnCl.sub.2, and 10-50 ng of plasmid DNA (in some
cases pTR0221, in other cases pAJ052). The reactions were incubated
using a MJ Research thermocycler (MJ Research, Inc. Boston, Mass.)
programmed for one cycle at 95.degree. C. for 3 minutes after which
2.5 units of Amplitaq (Perkin Elmer, Foster City, Calif.) were
added followed by 30 cycles each at 95.degree. C. for 60 seconds,
55.degree. C. for 60 seconds, and 72.degree. C. for 90 seconds. The
reactions were then incubated at 72.degree. C. for a 5 minute
extension. An aliquot of each PCR product was run on a 0.7% agarose
gel using TAE buffer, as previously described, generating expected
bands of approximately 1680 to 2030 bp. PCR reactions were purified
using a MiniElute PCR Purification Kit (QIAGEN, Valencia, Calif.)
eluted into 50 .mu.l of EB buffer (QIAGEN, Valencia, Calif.).
[0638] Plasmid pJC106 was gapped by digestion with BamH I and Xho
I, and then gel purified using a Qiaquick Minielute column (QIAGEN,
Inc., Valencia, Calif.). The digestion was verified by
fractionating an aliquot of the digestion on a 0.8% agarose gel
using TAE buffer and staining with ethidium bromide where expected
fragments of 10771 bp (gapped) and 1030 bp (from the Coprinus
cinereus peroxidase gene) were obtained.
[0639] The PCR reactions were mixed at approximately a 3 to 1 ratio
with the gapped pJC106 vector for cotransformation into
Saccharomyces cerevisiae YNG344 competent cells. The co-transformed
fragments, amplified using primers aGal.sub.--776.1 and
aGal.sub.--776. la, contained at least 67 bp of 5' and 66 bp of 3'
homologous DNA, amplified using yes2term and CiPpcrdwn contained at
least 293 bp of 5' and 41 bp of 3' homologous DNA, and amplified
using cJC106.1a and CiPpcrdwn contained at least 293 bp of 5' and
190 bp of 3' homologous DNA at the ends to facilitate gap repair of
the expressed plasmid. Competent cells of Saccharomyces cerevisiae
YNG 344 were prepared prior to each transformation following the
YEASTMAKER Yeast Transformation Protocol with the following
modifications: (1) The volume of yeast culture used to inoculate
the overnight incubation (16-20 hours) was between 100-1,000 .mu.l;
(2) recovery of cells upon transformation was performed in YPD
medium for 45 minutes at 30.degree. C.; and (3) the transformation
mixture was aliquoted for plating onto yeast selection medium
plates and frozen at -80.degree. C. in a controlled rate freezer
(Nalge Nunc International, Rochester, N.Y.).
Example 8
Construction of pAlLo1 and pAlLo2 Aspergillus oryzae Expression
Vectors
[0640] As a backbone vector for cloning several of the Cel7A
cellobiohydrolase variants, two Aspergillus oryzae expression
vectors were constructed. Vector pAlLo1 was constructed by
modifying pBANe6 (U.S. Pat. No. 6,461,837), which comprises the
Aspergillus oryzae alpha-amylase promoter (TAKA promoter),
Aspergillus niger amyloglucosidase terminator sequence (AMG
terminator), and Aspergillus nidulans acetamidase gene (amdS).
Modification of pBANe6 was performed by first eliminating three Nco
I restriction sites at positions 2051, 2722, and 3397 bp from the
amdS selection marker by site-directed mutagenesis. All changes
were designed to be "silent" leaving the actual protein sequence of
the amds gene product unchanged. Removal of these three sites was
performed simultaneously with a GeneEditor Site-Directed
Mutagenesis Kit (Promega, Madison, Wis.) according to the
manufacturer's instructions using the following primers (underlined
nucleotide represents the changed base):
3 Primer AMDS3NcoMut (2050): 5'-GTGCCCCATGATACGCCTCCGG-3' (SEQ ID
NO: 11) Primer AMDS2NcoMut (2721): 5'-GAGTCGTATTTCCAAGGCTCCTGACC-3'
(SEQ ID NO: 12) Primer AMDS1NcoMut (3396):
5'-GGAGGCCATGAAGTGGACCAACGG-3' (SEQ ID NO: 13)
[0641] A plasmid comprising all three expected sequence changes was
then submitted to site-directed mutagenesis, using a QuickChange
Mutagenesis Kit (Stratagene, La Jolla, Calif.), to eliminate the
Nco I restriction site at the end of the AMG terminator at position
1643. The following primers (underlined nucleotide represents the
changed base) were used for mutagenesis: Sense Primer to mutagenize
the Aspergillus niger AMG terminator sequence:
5'CACCGTGAAAGCCATG{umlaut over (C)}TCTTTCCTTCGTGTAGAAGACCAGACAG-3'
(SEQ ID NO: 14) Antisense Primer to mutagenize the Aspergillus
niger AMG terminator sequence: 5'-CTGGTCTTCTACACGAAGGAAAGA{umlaut
over (G)}ACATGGCTTTCAGGTGTCTG-3' (SEQ ID NO: 15)
[0642] The last step in the modification of pBANe6 was the addition
of a new Nco I restriction site at the beginning of the polylinker
using a QuickChange Mutagenesis Kit and the following primers
(underlined nucleotides represent the changed bases) to yield
pAlLo1 (FIG. 3). Sense Primer to mutagenize the Aspergillus oryzae
TAKA promoter: 5'-CTATATACACAACTGGATTTA{umlaut over
(CCA)}TGGGCCCGCGGCCGCAGATC-3' (SEQ ID NO: 16) Antisense Primer to
mutagenize the A. oryzae TAKA promoter:
5'-GATCTGCGGCCGCGGGCCCA{umlaut over (TGG)}TAAATCCAGTTGTGTATATAG-3'
(SEQ ID NO: 17)
[0643] The amdS gene of pAlLo1 was swapped with the Aspergillus
nidulans pyrG gene. Plasmid pBANe10 (FIG. 4) was used as a source
for the pyrG gene as a selection marker. Analysis of the sequence
of pBANe10 showed that the pyrG marker was contained within an Nsi
I restriction fragment and does not contain either Nco I or Pac I
restriction sites. Since the amdS was also flanked by NsiI
restriction sites, the strategy to switch the selection marker was
a simple swap of NsiI restriction fragments.
[0644] Plasmid DNA from pAlLo1 and pBANe10 were digested with the
restriction enzyme NsiI and the products purified by 0.7% agarose
gel electrophoresis using TAE buffer. The Nsi I fragment from
pBANe10 containing the pyrG gene was ligated to the backbone of
pAlLo1 to replace the original NsiI DNA fragment containing the
amdS gene. Recombinant clones were analyzed by restriction enzyme
digestion to determine insert orientation. A clone with the pyrG
gene transcribed in the counterclockwise direction was selected.
The new plasmid was designated pAlLo2 (FIG. 5).
Example 9
Rational Design of Improved Cel7A Cellobiohydrolase I Variant G205R
and Generation of G205R Primary Libraries in Saccharomyces
cerevisiae
[0645] The Trichoderma reesei Cel7A cellobiohydrolase I protein
sequence (SEQ ID NO: 2) was compared to other proteins of the same
enzyme family. Sequences included a Cel7A cellobiohydrolase I from
Chaetomium thermophilum (WO 03/000941), Humicola insolens (WO
95/02675), and Neurospora crassa (SWISSPROT: P38676a close
phylogenetic relative of Chaetomium thermophilum). Multiple
alignments of the Cel7A cellobiohydrolase I protein sequences from
Chaetomium thermophilum, Humicola insolens, Trichoderma reesei, and
Neurospora crassa were made, using ClustaIX software version 1.81,
(National Center for Biotechnology Information, NIH Bethesda, Md.)
(Thompson et al, 1994, Nucleic Acids Res 22: 4673-4680; Thompson et
al, 1997, Nucleic Acids Res 25: 4876-4882), using the Gonnet matrix
with default gap penalty parameters. Regions that appeared poorly
aligned were iteratively realigned, sometimes using an alternative
matrix (Blosum) and/or variable gap parameters. Homology models for
publicly available Cel7A cellobiohydrolase I sequences were
generated using the automated SwissModel service SwissModel service
(Biozentrum, Basel, Switzerland). The homology model for the Cel7A
cellobiohydrolase I from Humicola insolens was generated by using
the Insight II programs (Accelrys, San Diego Calif.). The program
DeepView (Guex and Peitsch, 1997, Electrophoresis 18: 2714-2723)
was used to introduce virtual mutations and for all other structure
manipulations and energy minimization. The reference structure used
for the Cel7A cellobiohydrolase I from Trichoderma reesei was PDB:
7CEL (Divne et al, 1994, Science 265: 524-528; Stahlberg et al,
1996, 264:337-349). Based on the comparisons, potential mutations
for Trichoderma reesei cellobiohydrolase I were prioritized based
upon the likelihood that they would create a new stabilizing
interaction (ion pair and/or H-bond) and also the probability of
occurrence in the sequences and structures of Cel7A
cellobiohydrolase I of the thermophilic fungi Chaetomium
thermophilum and Humicola insolens, and their absence in the
mesophilic fungus Neurospora crassa.
[0646] One of the amino acid substitutions suggested was a change
from glycine at position 205 to arginine. The G205R variant was
rationally designed to introduce ion-pairing with E190 and E239. To
generate the G205R substitution, the Trichoderma reesei Cel7A
cellobiohydrolase I gene was subcloned into the Aspergillus oryzae
vector pAlLo02 digested with Nco I and PacI to form a perfect
junction with the ATG of the gene and the Aspergillus oryzae
alpha-amylase promoter and the Aspergillus niger amyloglucosidase
terminator sequence. Subcloning of the Cel7A cellobiohydrolase I
gene into pAlLo2 was accomplished by designing two primers, shown
below, that allowed cloning into the Nco I and PacI sites. Primer
cTR0221.7: 5'-GCAACATGTATCGGAAGTTGGC-3' (SEQ ID NO: 18)
incorporated a BspLU II site, which was compatible to the Nco I
site in pAlLo2, to the 5'-end of the Cel7A cellobiohydrolase I
gene, and primer cTR0221.7a: 5'-AATTAATTTTACAGGCACTGAG-3' (SEQ ID
NO: 19) incorporated a BspLU II site at the-3'end.
[0647] Amplification of the Cel7A cellobiohydrolase I gene was
accomplished using 1.times.Tgo Polymerase Reaction buffer
(Boehringer Mannheim Co, Indianapolis, Ind.), 25 ng of pTR0221, 0.2
mM each of dATP, dGTP, dCTP, and dTTP, 50 pmole of each primer
(cTR0221.7 and cTR0221.7a), and 1 unit of Tgo polymerase
(Boehringer Mannheim Co, Indianapolis, Ind.). The reactions were
incubated using a MJ Research Thermocycler programmed for one cycle
at 95.degree. C. for 5 minutes, followed by 35 cycles each at
94.degree. C. for 60 seconds, 55.degree. C. for 45 seconds, and
72.degree. C. for 2 minutes. The reactions were then incubated at
72.degree. C. for a 5 minute extension. An aliquot of each PCR
product was run on a 0.7% agarose gel using TAE buffer generating
expected bands of approximately 1545 bp. The 1545 bp PCR product
was subcloned using a TOPO Blunt PCR4 Cloning Kit (Invitrogen,
Carlsbad, Calif.). The resulting plasmid was digested with BspLU II
and PacI and fractionated on a 0.7% agarose gel using TAE buffer
generating an expected 1.5 kb coding sequence, which was excised
and gel purified using an Amicon Ultra-free DA column (Millipore,
Billerica, Mass.). The resulting fragment was subsequently ligated
into pAlLo2, which was digested similarly, to generate the
expression vector designated pCW026 (FIG. 6) containing the
Trichoderma reesei Cel7A cellobiohydrolase I gene.
[0648] Working from the starting plasmid pCW026, the G205R variant
was obtained by mutating a guanosine to cytidine at base 664 of the
coding sequence of Cel7A cellobiohydrolase I, using a Quick Change
Site Directed Mutagenesis Kit (Stratagene, La Jolla, Calif.) with
pCW026 as the template. Primers used to incorporate this mutation
were primer G205R.1 and primer G205R.1a shown below:
4 (SEQ ID NO: 20) G205R.1: 5'-GAACACGGGCATTGGACGACACGGAAGCTGCTG-3'
(SEQ ID NO: 21) G205R.1a:
5'-CAGCAGCTTCCGTGTCGTCCAATGCCCGTGTTC-3'
[0649] The resulting expression vector was designated pNP776G205R
(FIG. 7).
Example 10
Screening of Cel7A Cellobiohydrolase I Libraries
[0650] Primary Cel7A cellobiohydrolase I libraries were spread on
agar yeast selection medium in Genetix QTrays (22.times.22 cm Petri
dishes, Genetics Ltd., Hampshire, United Kingdom) and incubated for
5 days at 30.degree. C. Using a Genetix QPix (Genetix Ltd.,
Hampshire, United Kingdom), colonies were picked into 96-well
plates containing yeast selection medium. Plates were incubated for
5-8 days at 30.degree. C. Using an ORCA robot (Beckman Coulter,
Fullerton, Calif.), the growth plates were transported to a Biomek
Fx (Beckman Coulter, Fullerton, Calif.) and broth samples were
removed from the growth plate and aliquoted into two 96-well
polycarbonate v-bottom plates. The cellobiohydrolase I substrate
4-methylumbelliferyl-beta-D-lactoside (MUL, Marker Gene Tech. Inc.,
Eugene, Oreg.) was added to each V-bottom 96-well plate to a final
concentration of 0.2, 0.1, or 0.05 mg of
4-methylumbelliferyl-beta-D-lactoside per ml, 0.1 M succinate pH
5.0, and 0.01% Tween-20. Assay plates were transferred to a
temperature-controlled incubator, where one plate was incubated at
50.degree. C. for 45 minutes, and another was incubated at a
pre-determined temperature, between 62.degree. C. and 65.degree. C.
for 45 minutes. After this incubation, the plates were cooled to
4.degree. C. for 1 minute, and then transferred to the Biomek Fx
where assays were quenched by addition of Tris-Cl, pH 9.5 to a
final concentration of 0.75 M. Quenched reaction samples were
diluted in water, and fluorescence of 4-methyl-umbelliferyl
liberated by Cel7A cellobiohydrolase I hydrolysis of
4-methylumbelliferyl-beta-D-lacto- side was measured using a BMG
FLUOStar Galaxy fluorometer (Offenburg, Germany) (excitation 360
nm, emission 460 nm). The ratio of the fluorescence from the plate
treated at high temperature ("high temperature activity") was
compared to fluorescence from the same samples incubated at
50.degree. C. ("low temperature activity"), using Microsoft Excel
(Microsoft Corporation, Redmond, Wash.) to determine the relative
thermal activity ratio for each variant. Based on the thermal
activity ratios, screening of libraries constructed in Example 7
and Example 9 generated the variants listed in Table 1. Table 1
shows the degree of improvement for novel Cel7A cellobiohydrolase I
variants as measured by assessing the thermal activity ratio of
activity at 64.degree. C. relative to activity at 50.degree. C. For
mutants obtained in the primary screen, improvements range from
2.60-fold higher to 10.20-fold improvement relative to the wild
type enzyme. For mutants obtained from shuffling, the improvement
observed was 12.40-fold to 19.20-fold better thermal activity than
the wild type enzyme.
5TABLE 1 Cel7A variants with improved thermal stability and thermal
activity. "Fold Improvement" indicates relative improvement in
thermal activity ratio, measured at 64.degree. C./50.degree. C.
Cel7A Fold Variant Amino Acid Substitutions* Improvement Wild type
none 1 G205R G205R 2.60 776-M1 T226A 6.20 776-M3 P227A, C486W 7.80
776-M4 S113N, S196T, T462A 6.00 776-M21 N301S, E337V 4.00 776-M22
S196P,T350S 1.60 776-M23 G22D, G467S 1.40 776-M26 S21P, S57N 3.80
776-M27 S411F 7.60 776-M30 T41I 2.60 776-M32 K157R, G205R, T255P
5.20 776-M35 G205R, S411F 8.40 776-M40 G205R, P227A 10.20 776-M41
G205R, H206Y 3.40 776-M42 S8P, G205R 4.60 776-M52 G94S, G205R 4.00
776-M53 S196P, G205R 4.80 776-M57 S113N, S196T, P227A, T462A 14.60
776-M65 S57N 5.00 776-M71 T383A, T455A 2.60 776-M73 N373H 4.80
776-M101 S113N, S411F 12.40 776-M108 T41I, E193K, S411F 15.60
776-M109 N49S, S113N, P227A, P438L 15.00 776-M124 Y247C, Y371C,
S411F 17.40 776-M125 S21P, S57N, T246I, R251K, S411F 18.00 776-M192
K157R, G205R, T255P, S411F 15.00 776-M216 S113N, S196T, P227A,
S411F 17.80 776-M252 S113N, S196T, P227A, T356I, T462A 19.20
*Numbering uses the first residue of the mature Cel7A enzyme as
position 1.
Example 11
DNA Sequencing of Variants
[0651] To determine the sequence of the Cel7A cellobiohydrolase I
variants derived from the libraries of Examples 7 and 9, plasmid
DNA was isolated. Each variant was streaked onto agar yeast
selection medium and incubated for 3-5 days at 30.degree. C. Eight
colonies were isolated and inoculated into 1 ml of yeast screening
medium, and grown for 5-8 days at 30.degree. C. The agar plates
were re-grown at 30.degree. C. for 3-5 days. Culture broth from the
single colonies of each variant was assayed for improved thermal
activity of the produced cellobiohydrolase I variant as described
in Example 10 to determine which had improved thermal activity
ratios relative to wild type (wt) Cel7A cellobiohydrolase I.
Plasmid was rescued from the colonies which produced
cellobiohydrolase I variants with improved thermal activity as
described by Kaiser and Auer, 1993, BioTechniques 14: 552, using E.
coli strain XL-10 (Stratagene Inc., La Jolla, Calif.).
[0652] DNA sequencing was performed using an ABI 3700 sequencer
(Applied Biosystems, Foster City, Calif.) using dye terminator
chemistry (Giesecke et al., 1992, Journal of Virol. Methods 38:
47-60). Plasmid DNA for sequencing was prepared using a BioRobot
9604 (QIAGEN, Valencia, Calif.). The entire coding region for each
Trichoderma reesei Cel7A cellobiohydrolase I variant was sequenced
using 0.5 .mu.l of plasmid DNA and 3.2 pmol of the following
primers:
6 cTr0221.1: 5'-CTTCTTGGCCACAGCTCGTG-3' (SEQ ID NO: 22) cTr0221.2:
5'-GGCTTTGTCACCCAGTCTGC-3' (SEQ ID NO: 23) cTr0221.3:
5'-CGTCATCCAACAACGCGAAC-3' (SEQ ID NO: 24) cTr0221.4:
5'-TTCGAGACGTCGGGTGCCAT-3' (SEQ ID NO: 25) cTr0221.4:
5'-CGCGGAAGCTGCTCCACCAG-3' (SEQ ID NO: 26) cTr0221.1A:
5'-AATGGAGAGGCTGTTACCGC-3' (SEQ ID NO: 27)
[0653] Sequence trace files were edited and assembled using Vector
NTI Contig Express (Informax, Inc., Bethesda, Md.).
Example 12
Generation of Error Prone Libraries using Variant Cel7A
Cellobiohydrolase I Genes as Templates
[0654] Random mutagenesis of several of the improved variants was
performed. Plasmid DNA was used that had been rescued from yeast as
described in Example 10, and error-prone PCR was performed as
described in Example 7. In addition, the G205R variant was
mutagenized by using pNP776G205R as a template in error-prone PCR.
The following primers were used to generate mutagenized
sequences:
7 Primer aGal_776.1: 5'TATACCTCTATACTTTAACGTCAAGGAGAAAAAAC-
TATAGGATCCACCATGTATCGGAAGTTGGCCG-3' (SEQ ID NO: 28) Primer
aGal_776.1a: 5'CATAACTAATTACATGATGCGGCCCTCTAGATGCACATGACTCGAGTTACA-
GGCACTGAGAGTAG-3' (SEQ ID NO: 29)
[0655] The error-prone PCR amplifications were analyzed on 0.7%
agarose gels using TAE buffer and transformed with gapped p]C106
vector into Saccharomy cescerevisiae as described in Example 7.
[0656] Variants 76-M35, 776-M40, 776-M41, 776-M42, 776-M52, and
776-M53 were obtained from screening libraries created by
error-prone amplification of the G205R template. Variant 776-252
was derived from a library created by mutagenic amplification of
variant 776-M57. DNA from these variants was rescued and sequenced
as described in Example 10.
Example 13
Shuffled Libraries of Cel7A Cellobiohydrolase I
[0657] To shuffle the Cel7A cellobiohydrolase I variants derived
from mutagenesis of wild type Cel7A cellobiohydrolase I and G205R
templates, plasmid DNA was isolated from the variants as described
in Example 10. The Cel7A cellobiohydrolase I genes were amplified
from the variants using the following primers:
8 Primer CiPpcrdwn: 5'-CTGGGGTAATTAATCAGCGAAGCGATGA-3' (SEQ ID NO:
30) Primer cJC106.1A: 5'-GCGTACACGCGTCTGTACA-3' (SEQ ID NO: 31)
[0658] Each amplification reaction (50 .mu.l) was composed of
1.times.PCR buffer, 0.2 mM dNTPs, 3.2 pM primer aGal.sub.--776.1,
3.2 pM primer aGal.sub.--776.1A, approximately 100 ng of pTr0221,
and 2.5 units of Taq DNA polymerase. The reactions were incubated
in an Eppendorf Mastercycler 5333 programmed for 1 cycle at
94.degree. C. for 3 minutes followed by 30 cycles each at
94.degree. C. for 30 seconds, 55.degree. C. for 30 seconds, and
72.degree. C. for 90 seconds (5 minute final extension). PCR
products were then purified using a QIAquick PCR Kit according to
the manufacturer's instructions.
[0659] For shuffling of the Cel7A cellobiohydrolase I variants, PCR
products from the amplified variant genes were combined with
approximately 50 ng of p]C016 digested with BamH I and Xho I, and
100-200 ng of the assorted PCR fragments were co-transformed into
Saccharomyces cerevisiae YNG 344 following the YEASTMAKER yeast
transformation protocol to generate shuffled libraries, as
described in Example 7. A large number of shuffled libraries were
generated. The total number of variants included in a single
library ranged from two to ten. The percentage of active variants
in these libraries ranged from 87% to 94%, based on 50.degree. C.
activity determined in the 4-methylumbelliferyl-beta-D-lact- oside
assay described in Example 9. Since the Taq DNA polymerase used has
low proofreading activity, the process of shuffling may have
introduced new mutations in the Cel7A cellobiohydrolase I coding
sequence.
[0660] Colonies from the shuffled libraries were picked and
screened as described in Example 9, using a comparison of the
64.degree. C. activity to the 50.degree. C. activity using
4-methylumbelliferyl-beta-D-lactoside as substrate to assess the
degree of improved thermal stability and thermal activity of each
variant.
[0661] Screening of the shuffled libraries resulted in the
isolation of improved variants, designated 776-M57, 776-M101,
776-M108, 776-M109, 776-M124, 776-M125, 776-M192, and 776-M216. DNA
from these variants was rescued and sequenced as described in
Example 10. Some of the substitutions identified by DNA sequencing
of variants 776-M57, 776-M101, 776-M108, 776-M109, 776-M124,
776-M125, 776-M192, and 776-M216 contain substitutions previously
identified by sequencing the mutants from error-prone libraries.
For example, 776-M57 contained the S113N mutation that was also
found in one parent (776-M4) of the shuffled library from which it
was derived. Likewise, 776-M101 contained S411F, a substitution
found in one of the parents (776-M27) of the shuffled library from
which it was obtained. Other substitutions found in the variants
derived from shuffled libraries, including N49S, E193K, R251K,
T246I, Y247C, Y371C, and P438L, were not observed in the sequenced
variants that comprised the parent variants for the corresponding
shuffled libraries. These mutations may have been introduced by a
PCR-mediated mutagenesis event during amplification of the variant
DNA during construction of the shuffled libraries.
Example 14
Site-Specific Saturation Mutagenesis
[0662] To screen for the optimal substitution for improved thermal
activity at specific positions in Cel7A cellobiohydrolase I,
site-specific randomization was performed. Amino acids G94, S196,
and P227 were randomized by substitution of the wild-type codon
with NN (G/C) using megaprimer PCR (Landt, et al., 1990 Gene 96:
125-128). Randomization at the three positions was performed using
the following primers:
[0663] Randomization at position 94:
9 (SEQ ID NO: 32) Primer aTrCBHI.2:
5'-GCGGTAACAGCCTCTCCATTNNSTTTGTCAC-3' (SEQ ID NO: 33) Primer
aTrCBHI.2a: 5'-CTGCGCAGACTGGGTGACAAASNNAATGGAGAG-3' (SEQ ID NO: 34)
Randomization at position 196: Primer aTrCBHI.3:
5'-CCATCTCCGAGGCTCTTACCNNSCACCCTTGC-3' (SEQ ID NO: 35) Primer
aTrCBHI.3a: 5'-GGCCGACAGTCGTGCAAGGGTGSNNGGTAAGAG-3' (SEQ ID NO: 36)
Randomization at position 227: Primer aTrCBHIR.1:
5'-GAGGGCTGGGAGCCGTCANNSAACAACGCG-3' (SEQ ID NO: 37) Primer
aTrCBHI.1bA: 5'-CCAATGCCCGTGTTCGCGTTGTTSNNTGACGGC-3- '
[0664] Each amplification reaction (50 .mu.l) was composed of
1.times.PCR buffer, 0.2 mM dNTPs, 3.2 pM of the sense primer, 3.2
pM of the antisense primer, approximately 100 ng of pTr0221, and
2.5 units of Taq DNA Polymerase. The reactions were incubated in an
Eppendorf Mastercycler 5333 programmed for 1 cycle at 95.degree. C.
for 3 minutes followed by 30 cycles each at 95.degree. C. for 30
seconds, 55.degree. C. for 60 seconds, and 72.degree. C. for 90
seconds (5 minute final extension). PCR products were then purified
using a QIAquick PCR Kit according to the manufacturer's
instructions. Each PCR fragment generated for the individual site
mutations served as megaprimers for the overlap extension
amplification reaction to generate a complete cellobiohydrolase I
gene fragment, with indicated site-specific mutations, for library
generation. The first 5 rounds of the amplification reaction was
composed of 1.times.PCR buffer, 0.2 mM dNTPs, 100 ng of the sense
(5') megaprimer, 100 ng of the antisense (3') megaprimer, and 2.5
units of Taq DNA Polymerase. The reactions were incubated in an
Eppendorf Mastercycler 5333 programmed for 1 cycle at 95.degree. C.
for 3 minutes followed by 5 cycles each at 95.degree. C. for 30
seconds, 55.degree. C. for 60 seconds, and 72.degree. C. for 90
seconds. To this reaction, 50 pmol of primer aGal776.1 and
aGal776.1A were added to amplify the newly generated site
randomized fragment generated in the previous 5 cycle reaction. The
reactions after the addition of the new primers were incubated in
an Eppendorf Mastercycler 5333 programmed for 30 cycles each at
95.degree. C. for 30 seconds, 55.degree. C. for 60 seconds, and
72.degree. C. for 90 seconds (5 m The resulting PCR fragments were
then purified using a QIAquick PCR Kit according to the
manufacturer's instructions. The final PCR fragment was then
transformed directly into yeast together with BamH I and Xho
I-gapped pJC106 plasmid (Example 6).
[0665] Since the Taq DNA polymerase used has low proofreading
activity, the process of saturation mutagenesis may have introduced
new mutations in the coding sequence in addition to the designed
changes at positions 94, 196, and 227. Libraries containing
site-specific randomized amino acids were screened as described in
Example 10. As shown in Table 2, a number of substitutions that
improved the thermal activity ratio at 63.degree. C./50.degree. C.
relative to wild type were discovered in addition to the
substitutions identified by screening randomly-mutagenized
libraries. For example, variant 776-M3 was obtained from screening
a primary library, where a proline at position 227 was converted to
an alanine. In screening the site-specific randomized library at
this position, we indentified substitutions to leucine and to
glycine as well as alanine.
[0666] In addition to uncovering the amino acid substitutions at
positions 227, 94, and 196, which confer improved thermal stability
and activity, a second site mutation was identified that could
improve thermal activity. Specifically, the substitution D259N was
identified in variant 776-M273 as shown in Table 2.
10TABLE 2 Cel7A variants with improved thermal stability containing
substitutions at positions 227, 94, and 196. "Fold Improvement"
indicates relative improvement in thermal activity ratio, measured
at 63.degree. C./50.degree. C. Fold- Im- Cel7A Amino Acid prove-
Variant Substitutions* ment Library Type Wild type none 1 none
776-M3 P227A, 2.67 primary C486W 776-M259 P227L 1.50 Site-specific
randomization at 227 776-M273 P227G, D259N 3.00 Site-specific
randomization at 227 776-M274 P227A 2.67 Site-specific
randomization at 227 776-M275 P227L 2.00 Site-specific
randomization at 227 776-M52 G94S, G205R 2.00 primary 776-M268
G94A, T226A 2.67 Site-specific randomization at 94 776-M264 G94R
2.07 Site-specific randomization at 94 776-M266 G94Q 2.17
Site-specific randomization at 94 776-M269 G94A 2.03 Site-specific
randomization at 94 776-M53 S196P, G205R 1.50 primary 776-M4 S113N,
S196T, n.a. primary T462A 776-M261 S196P 1.33 Site-specific
randomization at 196 776-M263 T41I, S196F 1.67 Site-specific
randomization at 196 *Numbering uses the first residue of the
mature Cel7A enzyme as position 1.
Example 15
Construction of pMJ04, pMJ06, and pMJ09 Expression Vectors
[0667] Expression vector pMJ04 was constructed by PCR amplifying
the Trichoderma reesei cellobiohydrolase 1 gene (cbh1) terminator
from Trichoderma reesei RutC30 genomic DNA using primers 993429
(antisense) and 993428 (sense) shown below. The antisense primer
was engineered to have a Pac I site at the 5'-end and a Spe I site
at the 3'-end of the sense primer. Primer 993429 (antisense):
5'-AACGTTAATTAAGGAATCGTTTTGTGTTT- -3' (SEQ ID NO: 38) Primer 993428
(sense): 5'-AGTACTAGTAGCTCCGTGGCGAAAGCCT- G-3' (SEQ ID NO: 39)
[0668] Trichoderma reesei RutC30 genomic DNA was isolated using a
DNeasy Plant Maxi Kit (QIAGEN, Valencia, Calif.). The amplification
reactions (50 .mu.l) were composed of 1.times.ThermoPol Reaction
Buffer (New England Biolabs, Beverly, Mass.), 0.3 mM dNTPs, 100 ng
of Trichoderma reesei RutC30 genomic DNA, 0.3 .mu.M primer 993429,
0.3 .mu.M primer 993428, and 2 units of Vent polymerase (New
England Biolabs, Beverly, Mass.). The reactions were incubated in
an Eppendorf Mastercycler 5333 programmed as follows: 5 cycles each
for 30 seconds at 94.degree. C., 30 seconds at 50.degree. C., and
60 seconds at 72.degree. C., followed by 25 cycles each for 30
seconds at 94.degree. C., 30 seconds at 65.degree. C., and 120
seconds at 72.degree. C. (5 minute final extension). The reaction
products were isolated on a 1.0% agarose gel using TAE buffer where
a 229 bp product band was excised from the gel and purified using a
QIAquick Gel Extraction Kit (QIAGEN, Valencia, Calif.) according to
the manufacturer's instructions.
[0669] The resulting PCR fragment was digested with Pac I and Spe I
and ligated into pAlLo01 (Example 8) digested with the same
restriction enzymes using a Rapid Ligation Kit (Roche,
Indianapolis, Ind.) to generate pMJ04 (FIG. 8).
[0670] Expression vector pMJ06 was constructed by PCR amplifying
the Trichoderma reesei Cel7A cellobiohydrolase 1 gene (cbh1)
promoter from Trichoderma reesei RutC30 genomic DNA using primers
993696 (antisense) and 993695 (sense) shown below. The antisense
primer was engineered to have a Sal I site at the 5'-end of the
sense primer and an Nco I site at the 5'-end of the antisense
primer.
11 Primer 993695 (sense): 5'-ACTAGTCGACCGAATGTAGGATTGTT-3' (SEQ ID
NO: 40) Primer 993696 (antisense): 5'-TGACCATGGTGCGCAGTCC-3' (SEQ
ID NO: 41)
[0671] The amplification reactions (50 .mu.l) were composed of
1.times. ThermoPol Reaction Buffer, 0.3 mM dNTPs, 100 ng of
Trichoderma reesei RutC30 genomic DNA (which was prepared using a
DNeasy Plant Maxi Kit, 0.3 .mu.M primer 993696, 0.3 .mu.M primer
993695, and 2 units of Vent polymerase. The reactions were
incubated in an Eppendorf Mastercycler 5333 programmed as follows:
30 cycles each for 30 seconds at 94.degree. C., 30 seconds at
55.degree. C., and 60 seconds at 72.degree. C. (15 minute final
extention). The reaction products were isolated on a 1.0% agarose
gel using TAE buffer where a 988 bp product band was excised from
the gel and purified using a QIAquick Gel Extraction Kit according
to the manufacturer's instructions.
[0672] The resulting PCR fragment was digested with Nco I and Sal I
and ligated into pMJ04 digested with the same restriction enzymes
using a Rapid Ligation Kit to generate pMJ06 (FIG. 9).
[0673] Expression vector pMJ09 was constructed by PCR amplifying
the Trichoderma reesei Cel7A cellobiohydrolase 1 gene (cbh1)
terminator from Trichoderma reesei RutC30 genomic DNA using primers
993843 (antisense) and 99344 (sense) shown below. The antisense
primer was engineered to have a Pac I and a Spe I sites at the
5'-end and a Pvu I site at the 5'-end of the sense primer.
12 Primer 993844 (sense): 5'-CGATCGTCTCCCTATGGGTCATTACC-3' (SEQ ID
NO: 42) Primer 993843 (antisense):
5'-ACTAGTTAATTAAGCTCCGTGGCGAAAG-3' (SEQ ID NO: 43)
[0674] The amplification reactions (50 .mu.l) were composed of
1.times. ThermoPol Reaction Buffer, 0.3 mM dNTPs, 100 ng
Trichoderma reesei RutC30 genomic DNA (which was extracted using a
DNeasy Plant Maxi Kit), 0.3 .mu.M primer 993844, 0.3 .mu.M primer
993843, and 2 units of Vent polymerase. The reactions were
incubated in an Eppendorf Mastercycler 5333 programmed as follows:
30 cycles each for 30 seconds at 94.degree. C., 30 seconds at
55.degree. C., and 60 seconds at 72.degree. C. (15 minute final
extension). The reaction products were isolated on a 1.0% agarose
gel using TAE buffer where a 473 bp product band was excised from
the gel and purified using a QIAquick Gel Extraction Kit according
to the manufacturer's instructions.
[0675] The resulting PCR fragment was digested with Pvu I and Spe I
and ligated into pMJ06 digested with Pac I and Spe I using a Rapid
Ligation Kit to generate pMJ09 (FIG. 10).
Example 16
Construction of pCW045 for Expression of Variant 776-M57 in
Trichoderma reesei
[0676] Variant 776-M57 was subcloned into the Trichoderma reesei
expression vector pMJ09 using an In-Fusion PCR Cloning Kit (BD
Biosciences, Clonetech, Palo Alto, Calif.). PCR amplification of
the variants was performed using Platinum Pfx DNA Polymerase
(Invitrogen, Carlsbad, Calif.). Amplifications were composed of
1.times.Pfx amplification buffer, 0.3 mM each dCTP, dATP, dTTP, and
dGTP; 1 mM MgSO.sub.4, 1 pmol of primer IF-F1, 1 pmol of primer
IF-R1, 50-100 ng of DNA template 776-57, and 1 unit of Pfx
polymerase. The reactions were incubated using a MJ Research
Thermocycler programmed for one cycle at 95.degree. C. for 3
minutes followed by 30 cycles each at 95.degree. C. for 15 seconds,
55.degree. C. for 30 seconds, and 68.degree. C. for 2 minutes 30
seconds. The reactions were then incubated at 72.degree. C. for a 7
minute extension.
13 Primer IF-F1: 5'-CGCGGACTGCGCACCATGTATCGGAAGTT (SEQ ID NO: 44)
G-3' Primer IF-R1: 5'-CGCCACGGAGCTTAATTACAGGCACTGAG (SEQ ID NO: 45)
A-3'
[0677] An aliquot of each PCR product was run on a 0.7% agarose gel
using TAE buffer, as previously described, generating expected
bands of approximately 1.575 kb. PCR reactions were purified using
a MinElute PCR Purification Kit and eluting the DNA into 50 .mu.l
of EB buffer. The yield of each purified PCR product was estimated
to be 125 ng per microliter by visualization on a 0.7% agarose gel
using TAE buffer.
[0678] Plasmid pMJ09 digested with Pac I and blunted at the Nco I
site was purified using a Qiaquick Minielute Column Kit (QIAGEN,
Valencia, Calif.). The plasmid had a concentration of 100 ng per
microliter. The concentration was verified by visualization on a
0.7% agarose gel using TAE buffer. Cloning of the 776-M57 PCR
product described above and the digested pMJ09 vector was
accomplished by using the In-Fusion PCR Cloning Kit (BD
Biosciences, Clonetech, Palo Alto, Calif.). The resulting
Trichoderma reesei expression vector containing variant 776-M57 was
designated pCW045 (FIG. 11).
Example 17
Expression Cel7A Cellobiohydrolase I in Trichoderma reesei as the
Sole Cellobiohydrolase I
[0679] In order to evaluate the 776-M57 variant as the sole
cellobhiohydrolase I following expression in the native host, a
Trichoderma reesei strain was constructed wherein the
cellobiohydrolase I Cel7A gene, cbh1, had been disrupted. A
disruption cassette was constructed using the hygromycin resistance
gene (hph) from Escherichia coli as a selectable marker. The hph
marker was flanked by homologous cbh1 sequence in order to target
the native cbh1 gene.
[0680] Amplification of the genomic cbhI gene was done using the
polymerase chain reaction method with PWO Polymerase (Roche Applied
Science, Manheim, Germany). The reactions were incubated in an
Eppendorf Mastercycler 5333. Amplifications were composed of
1.times.PWO amplification buffer, 0.3 mM each of dCTP, dATP, dTTP,
and dGTP, 1 mM MgSO.sub.4, 1 pmol each of primer cbh1 N-term and
cbh1 C-term described below, and 50-100 ng of DNA template.
Amplifications utilized an initial denaturation of 2 minutes at
95.degree. C. followed by 35 cycles of a 1 minute denaturation, 2
minute annealing at 55.degree. C. and a 2 minute extension at
68.degree. C.
14 Primer cbh1 N-term: 5'-GCC TTC GGC CTT TGG GTG TA-3' (SEQ ID NO:
46) Primer cbh1 C-term: 5'-GAG CGG CGA TTC TAC GGG TT-3' (SEQ ID
NO: 47)
[0681] The 2.3 kb PCR fragment was cloned using the Zero Blunt TOPO
PCR Cloning Kit (Invitrogen Corporation, Carlsbad, Calif.) and
propagated in E. coli Top10 cells (Invitrogen Corporation,
Carlsbad, Calif.). The resulting construct was a 5.8 kb plasmid
designated pSTM01 (FIG. 12).
[0682] The hph gene was amplified from the PHT1 plasmid (Cummings,
et al., 1999, Curr. Genet. 30 36: 371-382) using the polymerase
chain reaction method with PWO Polymerase. The reactions were
incubated in an Eppendorf Mastercycler 5333, and were composed of
1.times.PWO amplification buffer, 0.3 mM each of dCTP, dATP, dTTP,
and dGTP, 1 mM MgSO.sub.4, 1 pmol each of primer hph N-term and hph
C-term described below, and 50-100 ng of DNA template. The
amplifications utilized an initial denaturation of 2 minutes at
95.degree. C. followed by 35 cycles of a 1 minute denaturation, 2
minute annealing at 55.degree. C. and a 2 minute extension at
68.degree. C.
15 Primer hph N-term: 5'-GCC GCG GCA CGC GCC ACA CGG AAA (SEQ ID
NO: 48) AT-3' Primer hph C-term: 5'-GAC CGG TCG CAA AAT GAC AAA TAG
(SEQ ID NO: 49) AAG-3'
[0683] To generate the cbh1 disruption cassette, pSTM01 was
digested with Mlu I and BstE II to create a 1.1 kb gap in the cbhI
coding sequence. T4 DNA polymerase (New. England Biolabs, Beverly,
Mass.) was then used to fill in and generate blunt ends in the
digested plasmid. The T4 reaction was incubated for 20 minutes at
15.degree. C. followed by a heat inactivation for 15 minutes at
65.degree. C. The entire reaction mix was fractionated on a 1%
agarose gel using TAE buffer, and the major band was excised and
eluted from the gel using a Qiaquick Gel Extraction Kit. The 1.7 kb
hph gene was then inserted into the gapped pSTM01 vector using a
Rapid DNA Ligation Kit and transformed into One Shot E. coli
competent cells (Invitrogen Corporation, Carlsbad, Calif.). The
resulting plasmid was designated pSMKO3 (FIG. 13).
[0684] Using pSMKO3 as a template, cbhI DNA was amplified using PCR
primers flanking the hph gene. A 2.7 kb fragment was amplified from
pSMKO3 using the following primers:
16 Primer pSMK03-F1: 5'-GCTCCGGGCAAATGCAAA GTG TG-3' (SEQ ID NO:
50) Primer pSMK03-R1: 5'-AGCAGGCCGCATCTCCAGTGAAAG-3' (SEQ ID NO:
51)
[0685] The amplification was performed using the polymerase chain
reaction method with PWO Polymerase. The reactions were incubated
in an Eppendorf Mastercycler 5333, and were composed of 1.times.PWO
amplification buffer, 0.3 mM each of dCTP, dATP, dTTP, and dGTP, 1
mM MgSO.sub.4, 1 pmol each of primer KO N-term and KO C-term
described above, and 50-100 ng of DNA template. Amplifications
utilized an initial denaturation of 2 minutes at 95.degree. C.
followed by 35 cycles of a 1 minute denaturation, 2 minute
annealing at 55.degree. C., and a 2 minute extension at 68.degree.
C. The resulting DNA fragment contained 639 kb of the
cbhIpromoter/gene sequence, the 1.7 kb of the hph coding region,
and 659 bases of the cbhI gene/terminator sequence.
[0686] Protoplasts of Trichoderma reesei RutC30 were prepared for
transformation by the following method. Shake flasks containing 25
ml of YPD medium were inoculated with 5.times.10.sup.7 conidia.
Following an overnight (approximately 18 hours) incubation at
34.degree. C. (150 rpm), the mycelia were collected by filtration
through sterile Miracloth.TM. (Calbiochem, San Diego, Calif.) and
transferred to 20 mg/ml Glucanex (Novozymes A/S, Bagsvaerd,
Denmark) and 1.6 mg/ml chitinase (Sigma-Aldrich, St. Louis, Mo.) in
25 ml of 1 M sorbitol. Digestions were typically 25-40 minutes with
gentle shaking (80-100 rpm) at 34.degree. C. The protoplasts were
then filtered through a gauze filter and washed with ice cold 1 M
sorbitol and then centrifuged at 400.times.g for 8 minutes.
Protoplasts were washed twice with 25 ml of 1 M sorbitol and twice
with 25 ml of 1 M sorbitol, 50 mM Tris-HCl pH 8.0, 50 mM
CaCl.sub.2. Protoplasts were then counted using a haemacytometer
and resuspended in a solution composed of 7 parts of 1 M sorbitol,
50 mM Tris-HCl pH 8.0, 50 mM CaCl.sub.2 and 2 parts of 50%
PEG-4000, 50 mM Tris-HCl pH 8.0, 50 mM CaCl.sub.2 at a
concentration of 1.times.10.sup.8 protoplasts/ml. Protoplasts were
either used immediately or stored at -80.degree. C. in a controlled
rate freezer (Nalge Nunc International, Rochester, N.Y.) until
transformation.
[0687] Transformation of the protoplasts was performed
using.sub.--5 .mu.g of linear DNA and 5 .mu.l of heparin (5 mg/ml),
which were mixed and incubated on ice for 5 minutes. One hundered
microliters of protoplasts were then added and the mixture was
incubated for 15 minutes on ice. Five hundred microliters of 50%
PEG-4000, 50 mM Tris-HCl pH 8.0, 50 mM CaCl.sub.2 was then added
and incubated at room temperature for 15 minutes. One milliliter of
50% PEG-4000, 50 mM Tris-HCI pH 8.0, 50 mM CaCl.sub.2 was added to
the mixture and incubated at 34.degree. C. for 20 minutes.
Following the incubation at 34.degree. C., 2 ml of 1 M sorbitol, 50
mM Tris-HCl pH 8.0, 50 mM CaCl.sub.2 was added. The contents were
gently mixed before spreading 350 .mu.l of the protoplast mixture
on PDA plates. The plates were incubated at 29.degree. C. for
approximately 18 hours before overlaying with 100 .mu.g/ml
hygromycin B (Roche Applied Science, Manheim, Germany) in PDA
medium. Transformants appeared within 3 days of the hygromycin
overlay. Transformants were then subcultured to PDA plates
containing 100 .mu.g/ml hygromycin B. Transformants that grew on
the secondary plates were then used for inoculation into cellulase
inducing medium (CIM).
[0688] Strains were screened for cellobiohydrolase I disruption by
the following method. Transformants were grown in
cellulase-inducing medium in 24-well tissue culture plates
(Corning, Acton, Mass.) for 3 days at 34.degree. C. Ten microliters
of culture broth was added to 10 .mu.l of 2.times. sample buffer
plus 1% beta-mercaptoethanol and run on an 8-16% Tris-glycine
acrylamide gel (NUPAGE Novex Gels Invitrogen Corporation, Carlsbad,
Calif.) using NuPAGE.RTM. MES SDS Running Buffer(NUPAGE Novex Gels
Invitrogen Corporation, Carlsbad, Calif.). Potential knockouts were
selected based on the absence of a cellobiohydrolase I Cel7A
protein band in comparison to the parent strain.
[0689] To confirm deletion of the cbh1 gene in candidate strains
that had been selected by SDS-PAGE analysis, Southern analysis was
performed to assess whether the cbh1 gene had been disrupted.
Mycelia were grown overnight in shake flasks containing 25 ml of
YPD medium. The mycelia were then harvested, filtered, and ground
using a mortar and pestle with liquid nitrogen. Genomic DNA was
isolated using a DNeasy Plant Maxi Kit. One microgram of DNA was
digested either with Hind III or Nde I and run on a 0.8% agarose
gel in TAE buffer. The DNA was fragmented in the gel by treating
with 0.25 M HCl, denatured with 0.5 M NaOH, 1.5 M NaCl, and
neutralized with 1 M Tris, pH 8.0; 1.5 M NaCl for subsequent
transfer in 10.times.SSC to Nytran Plus membrane (Schleicher &
Schuell BioScience, GmbH, Dassel, Germany). The DNA was
UV-crosslinked to the membrane and prehybridized for 1 hour at
60.degree. C. in 20 ml of DIG Easy Hyb (Roche Applied Science,
Manheim, Germany).
[0690] Two probes were prepared for Southern analysis. A 1.7 kb
hygromycin probe was amplified from pSMK03, using polymerase chain
reaction and the following primers:
17 Primer cpht-p: 5'-GCACGCGCCACACGGAAAAT-3' (SEQ ID NO: 52) Primer
cpht-t: 5'-CGCAAAATGACAAATAGAAG-- 3' (SEQ ID NO: 53)
[0691] In addition, a 2.1 kb cellobiohydrolase I probe was
amplified from pSTM01 by PCR using the primers pSMK03-F1 and
pSMK03-R1. Probes were prepared with a PCR DIG Probe Synthesis Kit
(Roche Applied Science, Manheim, Germany). The PCR DIG Probe
Synthesis mix and PCR buffer with magnesium were used at 1.times..
Expand High Fidelity Polymerase (Roche Applied Science, Manheim,
Germany) was added at 0.75 .mu.l per reaction. One pmol each of
primers and 50-100 ng of DNA template were used per reaction. Prior
to use the probe was denatured by boiling for 5 minutes and then
added to the hybridization buffer.
[0692] The denatured probe was added directly to the DIG Easy Hyb
buffer and hybridization was overnight at 65.degree. C. Following
the post hybridization washes (twice in 2.times.SSC, once in
0.4.times.SSC, 60.degree. C., 10 minutes each), chemiluminescent
detection using the DIG detection system and CPD-Star (Roche
Applied Science, Manheim, Germany) was done. The DIG-labeled DNA
Molecular Weight Marker III Kit (Roche Applied Science, Manheim,
Germany) was used as the source of standard markers.
[0693] Southern analysis indicated that the presence of a single
hph intergration within the cbh1gene for a specific transformant.
This cellobiohydrolase I gene deletion strain was designated
Trichoderma reesei SaMe013.
[0694] Plasmid pCW045, containing the cellobiohydrolase I variant
776-M57 behind the cbh1 promoter, was introduced into Trichoderma
reesei SaMe013 by PEG-mediated transformation (Penttila et al.,
1987, Gene 61: 155-164). The plasmid contains the Aspergillus
nidulans amdS gene to enable transformants to grow on acetamide as
the sole nitrogen source. Trichoderma reesei RutC30 was cultivated
at 27.degree. C and 90 rpm in 25 ml of YPD medium supplemented with
10 mM uridine for 17 hours. Mycelia were collected by filtration
using Millipore's Vacuum Driven Disposable Filtration System
(Millipore, Bedford, Mass.) and washed twice with deionized water
and twice with 1.2 M sorbitol. Protoplasts were generated by
suspending the washed mycelia in 20 ml of 1.2 M sorbitol containing
15 mg of Glucanex per ml and 0.36 units of chitinase per ml and
incubating for 15-25 minutes at 34.degree. C. with gentle shaking
at 90 rpm. Protoplasts were collected by centrifuging for 7 minutes
at 400.times.g and washed twice with ice cold 1.2 M sorbitol. The
protoplasts were counted using a hemacytometer and re-suspended in
STC to a final concentration of 1.times.10.sup.8 protoplasts per
ml. Excess protoplasts were stored in a Cryo 1.degree. C. Freezing
Container (Nalgene, Rochester, N.Y.) at -80.degree. C.
[0695] Approximately 1 .mu.g of Pme I digested pCW045 was added to
100 .mu.l of protoplast solution and mixed gently, followed by 260
.mu.l of PEG buffer, mixed, and incubated at room temperature for
30 minutes. STC (3 ml) was then added, mixed and the transformation
solution was plated onto COVE plates using Aspergillus nidulans
amdS selection. The plates were incubated at 28.degree. C. for 5-7
days. Transformants were sub-cultured onto COVE2 plus uridine
plates and grown at 28.degree. C. for 7 days.
[0696] The Trichoderma reesei transformants were cultivated in 125
ml baffled shake flasks containing 25 ml of cellulase-inducing
media at pH 6.0 inoculated with spores of the transformants and
incubated at 28.degree. C. and 200 rpm for 7 days. Trichoderma
reesei RutC30 was run as a control. Culture broth samples were
removed at day 7. SDS-PAGE was carried out using Criterion Tris-HCl
(8-16% polyacrylamide) gels (BioRad, Hercules, Calif.) with the
Criterion SDS-PAGE System (BioRad, Hercules, Calif.). Five .mu.l of
day 7 supernatants were suspended in 5 .mu.l of 2.times. Sample
Buffer (BioRad, Hercules, Calif.) and heated in the presence of 1%
beta-mercaptoethanol for 5 minutes. The supernatant samples were
loaded onto a polyacrylamide gel and subjected to electrophoresis
with 1.times. Tris/Glycine/SDS as running buffer (BioRad, Hercules,
Calif.). The resulting gel was stained with Bio-Safe Coomassie
Stain (BioRad, Hercules, Calif.). Candidate transformants were
evaluated for their ability to express the variant Cel7A
cellobiohydrolase I 776-M57 at levels that were apparently
equivalent to levels observed in the Trichoderma reesei parent
strain. A single transformant was selected on this basis for larger
scale production in fermentation.
[0697] Fermentation was performed using the strain expressing
cellobiohydrolase I variant 776-M57, and the Trichoderma reesei
RutC30 (host strain) was run as a control. Spores of Trichoderma
reesei RutC30 were inoculated into 500 ml shake flasks, containing
100 ml of Trichoderma Inoculum Medium. The flasks were placed into
an orbital shaker at 28.degree. C. for approximately 48 hours at
which time 50 ml of the culture was inoculated into 1.8 liters of
Trichoderma Fermentation Medium in a 2 liter fermentation vessel.
The fermentations were run at pH 5.0, 28.degree. C., with minimum
dissolved oxygen at 25% at a 1.0 VVM air flow and an agitation of
1100. Trichoderma Feed Medium was administrated into the
fermentation vessel at 18 hours with a feed rate of 3.6 g/hour for
33 hours and then 7.2 g/hour. The fermentations ran for 165 hours
at which time the final fermentation broths were centrifuged and
the supernatants stored at -20.degree. C.
Example 18
Identification of a Glycosyl Hydrolase Family GH3A Gene in the
Genomic Sequence of Aspergillus fumigatus
[0698] A tblastn search (Altschul et al., 1997, Nucleic Acids Res.
25: 3389-3402) of the Aspergillus fumigatus partial genome sequence
(The Institute for Genomic Research, Rockville, Md.) was carried
out using as query a beta-glucosidase protein sequence from
Aspergillus aculeatus (Accession No. P48825). Several genes were
identified as putative Family GH3A homologs based upon a high
degree of similarity to the query sequence at the amino acid level.
One genomic region of approximately 3000 bp with greater than 70%
identity to the query sequence at the amino acid level was chosen
for further study.
Example 19
Aspergillus fumigatus Genomic DNA Extraction
[0699] Aspergillus fumigatus was grown in 250 ml of potato dextrose
medium in a baffled shake flask at 37.degree. C. and 240 rpm.
Mycelia were harvested by filtration, washed twice in TE (10 mM
Tris-1 mM EDTA) and frozen under liquid nitrogen. Frozen mycelia
were ground, by mortar and pestle, to a fine powder, which was
resuspended in pH 8.0 buffer containing 10 mM Tris, 100 mM EDTA, 1%
Triton X-100, 0.5 M guanidine-HCl, and 200 mM NaCl. DNase free
RNase A was added at a concentration of 20 mg/liter and the lysate
was incubated at 37.degree. C. for 30 minutes. Cellular debris was
removed by centrifugation, and DNA was isolated by using a Qiagen
Maxi 500 column (QIAGEN Inc., Valencia, Calif.). The columns were
equilibrated in 10 ml of QBT washed with 30 ml of QC, and eluted
with 15 ml of QF (all buffers from QIAGEN Inc., Valencia, Calif.).
DNA was precipitated in isopropanol, washed in 70% ethanol, and
recovered by centrifugation. The DNA was resuspended in TE
buffer.
Example 20
Cloning of the Family GH3A Beta-Glucosidase Gene and Construction
of an Aspergillus oryzae Expression Vector
[0700] Two synthetic oligonucleotide primers shown below were
designed to PCR amplify a Aspergillus fumigatus gene encoding a
putative Family GH3A beta-glucosidase from the genomic DNA prepared
in Example 19. An InFusion Cloning Kit (BD Biosciences, Palo Alto,
Calif.) was used to clone the fragment directly into the expression
vector, pAILo2 (Example 8; FIG. 5).
18 Forward primer: 5'-ACTGGATTTACCATGAGATTCGGTTGGCTC (SEQ ID NO:
54) G-3' Reverse primer: 5'-AGTCACCTCTAGTTACTAGTAGACACGGGG (SEQ ID
NO: 55) C-3'
[0701] Bold letters represent coding sequence. The remaining
sequence contains sequence identity compared with the insertion
sites of pAlLo2 (FIG. 5).
[0702] Fifty picomoles of each of the primers above were used in a
PCR reaction containing 100 ng of Aspergillus fumigatus genomic
DNA, 1.times.Pfx Amplification Buffer (Invitrogen, Carlsbad,
Calif.), 1.5 .mu.l of 10 mM blend of dATP, dTTP, dGTP, and dCTP,
2.5 units of Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad,
Calif.), 1 .mu.l of 50 mM MgSO.sub.4 and 2.5 .mu.l of 10.times.pCRx
Enhancer solution (Invitrogen, Carlsbad, Calif.) in a final volume
of 50 .mu.l. The amplification conditions were one cycle at
94.degree. C. for 2 minutes; 30 cycles each at 94.degree. C. for 15
seconds, 55.degree. C. for 30 seconds, and 68.degree. C. for 3
minutes. The heat block then went to a 4.degree. C. soak cycle.
[0703] The reaction products were isolated on a 1.0% agarose gel
using 40 mM Tris base-20 mM sodium acetate-1 mM disodium EDTA (TAE)
buffer where a 3 kb product band was excised from the gel and
purified using a QIAquick Gel Extraction Kit (QIAGEN, Valencia,
Calif.) according to the manufacturer's instructions.
[0704] The fragment was then cloned into the pAILo2 expression
vector using an Infusion Cloning Kit. The vector was digested with
restriction endonucleases Nco I and Pac I (using conditions
specified by the manufacturer). The fragment was purified by gel
electrophoresis and Qiaquick gel purification. The gene fragment
and the cut vector were ligated together in a reaction resulting in
the expression plasmid pEJG97 (FIG. 14) in which transcription of
the Family GH3A beta-glucosidase gene was under the control of the
NA2-tpi promoter. The reaction (50 .mu.l) was composed of 1.times.
InFusion Buffer (BD Biosciences, Palo Alto, Calif.), 1.times.BSA
(BD Biosciences, Palo Alto, Calif.), 1 .mu.l of Infusion enzyme
(diluted 1:10) (BD Biosciences, Palo Alto, Calif.), 150 ng of
pAlLo2 digested with NcoI and PacI, and 50 ng of the Aspergillus
fumigatus beta-glucosidase purified PCR product. The reaction was
incubated at room temperature for 30 minutes. One .mu.l of the
reaction was used to transform E. coil XL10 Solopac Gold cells
(Stratagene, La Jolla, Calif.). An E. coil transformant containing
the pEJG97 plasmid was detected by restriction digestion and
plasmid DNA was prepared using a BioRobot 9600 (QIAGEN, Inc.,
Valencia, Calif.)
Example 21
Characterization of the Aspergillus fumigatus Genomic Sequence
Encoding a Family GH3A Beta-Glucosidase
[0705] DNA sequencing of the Aspergillus fumigatus beta-glucosidase
gene from pEJG97 was performed with a Perkin-Elmer Applied
Biosystems Model 377 XL Automated DNA Sequencer
(Perkin-Elmer/Applied Biosystems, Inc., Foster City, Calif.) using
dye-terminator chemistry (Giesecke et al., 1992, Journal of
Virology Methods 38: 47-60) and primer walking strategy. Nucleotide
sequence data were scrutinized for quality and all sequences were
compared to each other with assistance of PHRED/PHRAP software
(University of Washington, Seattle, Wash.).
[0706] A gene model for the Aspergillus fumigatus sequence was
constructed based on similarity to homologous genes from
Aspergillus aculeatus, Aspergillus niger, and Aspergillus kawachii.
The nucleotide sequence (SEQ ID NO: 56) and deduced amino acid
sequence (SEQ ID NO: 57) are shown in FIG. 15. The genomic fragment
encodes a polypeptide of 863 amino acids, interrupted by 8 introns
of 62, 55, 58, 63, 58, 58, 63 and 51 bp. The %G+C content of the
gene is 54.3%. Using the SignalP software program (Nielsen et al.,
1997, Protein Engineering 10: 1-6), a signal peptide of 19 residues
was predicted. The predicted mature protein contains 844 amino
acids with a molecular mass of 91.7 kDa.
[0707] A comparative alignment of beta-glucosidase sequences was
determined using the Clustal W method (Higgins, 1989, CABIOS 5:
151-153) using the LASERGENE.TM. MEGALIGN.TM. software (DNASTAR,
Inc., Madison, Wis.) with an identity table and the following
multiple alignment parameters: Gap penalty of 10 and gap length
penalty of 10. Pairwise alignment parameters were Ktuple=1, gap
penalty=3, windows=5, and diagonals=5. The alignment showed that
the deduced amino acid sequence of the Aspergillus fumigatus
beta-glucosidase gene shared 78%, 76%, and 76% identity to the
deduced amino acid sequences of the Aspergillus aculeatus
(accession number P48825), Aspergillus niger (O00089), and
Aspergillus kawachii (P87076) beta-glucosidases.
Example 22
Expression of the Aspergillus fumigatus Family GH3A
Beta-Glucosidase Gene in Aspergillus oryzae JAL250
[0708] Aspergillus oryzae Jal250 protoplasts were prepared
according to the method of Christensen et al., 1988, Bio/Technology
6: 1419-1422. Five .mu.g of pEJG97 (as well as pAlLo2 as a vector
control) was used to transform Aspergillus oryzae JAL250.
[0709] The transformation of Aspergillus oryzae Jal250 with pEJG97
yielded about 100 transformants. Ten transformants were isolated to
individual PDA plates.
[0710] Confluent PDA plates of five of the ten transformants were
washed with 5 ml of 0.01% Tween 20 and inoculated separately into
25 ml of MDU2BP medium in 125 ml glass shake flasks and incubated
at 34.degree. C., 250 rpm. Five days after incubation, 0.5 .mu.l of
supernatant from each culture was analyzed using 8-16% Tris-Glycine
SDS-PAGE gels (Invitrogen, Carlsbad, Calif.) according to the
manufacturer's instructions. SDS-PAGE profiles of the cultures
showed that one of the transformants (designated transformant 1)
had a major band of approximately 130 kDa.
[0711] A confluent plate of transformant 1 (grown on PDA) was
washed with 10 ml of 0.01% Tween 20 and inoculated into a 2 liter
Fernbach containing 400 ml of MDU2BP medium to generate broth for
characterization of the enzyme. The flask was harvested on day 5
and filtered using a 0.22 .mu.m GP Express plus Membrane
(Millipore, Bedford, Mass.).
[0712] A single transformant of pEJG97 in Aspergillus oryzae was
grown in a fermentation tank. Spores of Aspergillus oryzae were
inoculated into 500 ml shake flasks, containing 100 ml of Inoculum
Medium. The flasks were placed into an orbital shaker at 34.degree.
C., at 200 rpm for approximately 24 hours at which time 50 ml of
the culture was inoculated into 1.8 liters of Fermentation Medium
in a 2 liter fermentation vessel. The fermentations were run at pH
7.0, 34.degree. C., with minimum dissolved oxygen at 25% at a 1.0
VVM air flow and an agitation of 1100. Feed Medium was
administrated into the fermentation vessel at the dissolved oxygen
spike with a feed rate of 4 g/hour. The fermentations ran for 164
hours at which time the final fermentation broths were centrifuged
and the supernatants stored at -20.degree. C.
Example 23
Characterization of Aspergillus fumigatus Beta-Glucosidase
[0713] A 3 ml aliquot of the Aspergillus fumigatus
beta-glucosidase, obtained as described in Example 22, was desalted
using a BioRad Econo-Pac 10DG desalting column (BioRad, Hercules,
Calif.), resulting in approx. 4 ml of desalted broth in 100 mM
sodium citrate pH 5.0. The desalted broth was then concentrated to
approximately 180 .mu.l using an Amicon Centricon Plus-20
(Biomax-5, 5 kDa cutoff, PES membrane) and diluted with 100 mM
sodium citrate pH 5.0 to a final volume of approximately 500 pl.
BCA assay (Smith et al., 1985, Anal. Biochem. 150: 76-85) of the
desalted, concentrated broth showed a concentration of 1.00 mg of
protein per ml. A second aliquot was also desalted to obtain more
material, which yielded similar results.
[0714] SDS-PAGE (BioRad Criterion 7.5% Tris-HCl) of the
concentrated desalted samples showed a major band at approx. 130
kD. The major band at 130 kD was cut out of the gel and submitted
to N-terminal amino acid sequencing.
[0715] The Aspergillus fumigatus beta-glucosidase from the
desalted/concentrated broth was evaluated for thermal stability at
50.degree., 65.degree., and 70.degree. C. Assay conditions at
50.degree. and 65.degree. C. were: 100 mM sodium citrate pH 5.0,
0.01% Tween-20, 4 mM p-nitrophenyl-beta-D-glucopyranoside,
[protein].sub.AfumGH3A=6.9.times- .10.sup.-6 mg/ml, incubated at
50.degree. and 65.degree. C. Aliquots were taken at 0.5, 1, 2, 3,
3.75, and 24 hours. To each aliquot was added 1 M sodium carbonate
pH 10.0, and the p-nitrophenyl anion concentration was determined
from the absorbance at 405 nm. At 70.degree. C., the assay
conditions were: 100 mM sodium citrate (pH 5.0), 0.01% Tween-20, 4
mM p-nitrophenyl-beta-D-glucopyranoside,
[protein]=5.6.times.10.sup.-6 mg/ml. Aliquots were taken at 0.25,
0.5, 1, 2, 4, and 5 hours. To each aliquot was added 1 M sodium
carbonate pH 10.0, and the p-nitrophenyl anion concentration was
determined from the absorbance at 405 nm. Note that each of the
above protein concentrations refers to total protein concentration
in the assay, as they were all assayed as broths rather than
purified enzymes.
[0716] The results are shown in FIGS. 16 and 17. Thermal stability
was defined as linear reaction kinetics for a given time interval,
within a reasonable percent conversion (<15%) to p-nitrophenyl
anion. The Aspergillus fumigatus beta-glucosidase appeared to be
stable at least 24 hours at 50.degree. C., although there were no
time points between 4 hours and 24 hours. At 65.degree. C. it
appeared to be stable at least 3.75 hours, but afterward the
stability gradually decreased with a 65% conversion to
p-nitrophenyl anion at 24 hours. This conversion was quite high, so
some of the observed decrease in rate may have been due to
depletion of substrate and/or product inhibition in addition to
possible thermal inactivation. At 70.degree. C. it appeared to be
stable for 1 hour, and reasonably stable to 2 hours.
[0717] Broth containing Family GH3A beta-glucosidase from
Aspergillus fumigatus, obtained as described in Example 22, was
first desalted (BioRad Econo-Pac 10DG column) and concentrated
(Centricon Plus-20, Biomax-5, 5 kD cut-off), to a concentration of
0.92 mg/ml (BCA assay). Then, it was incubated at 0.037 and 0.0092
.mu.g/ml total protein with 10 mM cellobiose in 100 mM sodium
citrate pH 5.0 plus 0.01% Tween-20 at 65.degree. C. Aliquots were
taken at 0.5, 1, 2, 3, 4, 6, and 19 hours. Aliquots were boiled 6
minutes to terminate the reaction, and the glucose concentration
determined using the Trinder assay (Sigma Chemical Co., St. Louis,
Mo.) and external glucose standards. Results are shown in FIG. 18.
The beta-glucosidase appeared to maintain 90% of its activity to 6
hours, and 65% to 19 hours at 65.degree. C. at the lower protein
loading (0.0092 .mu.g/ml). The beta-glucosidase appeared to be
reasonably stable up to 6 hours at 65.degree. C.
Example 24
Assay of Cel7A Variant 776-M57 in Combination with Trichoderma
cellulases
[0718] Pretreated corn stover (PCS) was obtained from U.S.
Department of Energy National Renewable Energy Laboratory (NREL).
The water-insoluble solids in PCS include: 56.5% cellulose, 4.6%
hemicellulose, and 28.4% lignin. Pretreatment conditions were: corn
stover, 1.4% (wt/vol) sulfuric acid, 165.degree. C., 107 p.s.i.,
for 8 minutes. Prior to assay, PCS was washed with a large volume
of distilled deionized water on a glass filter. PCS was then milled
using a coffee grinder to reduce particle size, then washed further
with water on a 22 .mu.m Millipore filter (6P Express Membrane,
Stericup, Millipore, Billerica, Mass.). The washed PCS was
resuspended in deionized water to make a 20 mg/ml suspension, and
stored at 4.degree. C.
[0719] Trichoderma reesei fermentation broths were filtered (0.4
.mu.m Membrane, Stericup, Millipore, Billerica, Mass.), and protein
content was assayed by BCA assay (Pierce Biotech., Inc., Rockford,
Ill.). The thermostable beta-glucosidase from Aspergillus fumigatus
was used in the PCS assays. The Aspergillus fumigatus
beta-glucosidase was prepared as described in Example 22.
Fermentation broths of the heterologously expressed Aspergillus
fumigatus beta-glucosidase were filtered (0.4 .mu.m Membrane,
Stericup, Millipore, Billerica, Mass.), and protein content was
assayed by BCA assay (Pierce, Biotech., Inc., Rockford, Ill.). PCS
assays were carried out in a volume of 1.0 ml. Assays included 10
mg of PCS per ml, 50 mM sodium acetate buffer (pH 5.0), 8.5 mg of
total fermentation broth protein per gram of cellulose, and 0.27 mg
of Aspergillus fumigatus beta-glucosidase fermentation broth.
Assays were maintained at 55.degree. C. and at 60.degree. C. in
sealed assay tubes (ImmunoWare Microtubes, Pierece Biotech., Inc.,
Rockford, Ill.) for 5 days with intermittent inversion of assay
tubes.
[0720] Approximately every 24 hours, time points were taken from
the PCS reactions. Ten microliter aliquots were removed from the
assay tubes into 90 .mu.l of alkaline quench mixture (0.102 M
Na.sub.2CO.sub.3 plus 0.058 M NaHCO.sub.3). Dilution of the
quenched samples to one-eighth or one-sixteenth of the starting
concentration was performed. The concentration of reducing sugars
in samples produced by degradation of PCS was determined by
p-hydroxybenzoic acid hydrazide (PHBAH) assay (Lever, 1972, Anal
Biochem 47: 273-279) using 2 parts of 1.25% PHBAH in alkaline
quench mixture added to 3 parts of the quenched assay solution.
This solution was then heated for 10 minutes at 95.degree. C.,
samples were then diluted into water, and absorbance was measured
at 405 nm using a UltraMark Plate Reader (Bio-Rad, Hercules,
Calif.). The absorbance at 405 nm was converted into glucose
equivalents using a glucose standard curve. Finally, the degree of
cellulose conversion was calculated, using the initial
concentration of cellulose, and a weight gain factor in converting
cellulose to glucose. The degree of cellulose conversion to
reducing sugar (RS yield, %) was calculated using the following
equation: 1 RS Yield ( % ) = RS ( m g / m l ) * 100 * 162 / ( 5.65
( m g / m l ) * 180 ) = RS ( m g / m l ) * 100 / ( 5.65 ( m g / m l
) * 1.111 )
[0721] FIG. 19 shows the time course profiles of PCS hydrolysis by
the parent Trichoderma reesei strain, and the strain which
expresses variant 776-M57 in place of the wild type Cel7A
cellobiohydrolase I. It is apparent that the strain containing the
variant outperforms the parent under these conditions.
Deposit of Biological Materials
[0722] The following biological materials have been deposited under
the terms of the Budapest Treaty with the Agricultural Research
Service Patent Culture Collection, Northern Regional Research
Center, 1815 University Street, Peoria, Ill., 61604, and given the
following accession numbers:
19 Deposit Accession Number Date of Deposit pAJO52 NRRL B-30683
Jul. 29, 2003 776-M1 NRRL B-30657 May 22, 2003 776-M4 NRRL B-30658
May 22, 2003 776-M23 NRRL B-30659 May 22, 2003 776-M26 NRRL B-30661
May 22, 2003 776-M32 NRRL B-30662 May 22, 2003 776-M53 NRRL B-30663
May 22, 2003 776-M57 NRRL B-30664 May 22, 2003 776-M108 NRRL
B-30665 May 22, 2003 776-M109 NRRL B-30666 May 22, 2003 776-M21
NRRL B-30674 Jul. 28, 2003 776-M22 NRRL B-30675 Jul. 28, 2003
776-M41 NRRL B-30676 Jul. 28, 2003 776-M42 NRRL B-30677 Jul. 28,
2003 776-M52 NRRL B-30678 Jul. 28, 2003 776-M71 NRRL B-30679 Jul.
28, 2003 776-M73 NRRL B-30680 Jul. 28, 2003 776-M124 NRRL B-30681
Jul. 28, 2003 776-M125 NRRL B-30682 Jul. 28, 2003 776-M273 NRRL
B-30762 Aug. 25, 2004
[0723] The strains have been deposited under conditions that assure
that access to the cultures will be available during the pendency
of this patent application to one determined by the Commissioner of
Patents and Trademarks to be entitled thereto under 37 C.F.R.
.sctn.1.14 and 35 U.S.C. .sctn.122. The deposits represent
substantially pure cultures of the deposited strains. The deposits
are available as required by foreign patent laws in countries
wherein counterparts of the subject application, or its progeny are
filed. However, it should be understood that the availability of a
deposit does not constitute a license to practice the subject
invention in derogation of patent rights granted by governmental
action.
[0724] The invention described and claimed herein is not to be
limited in scope by the specific embodiments herein disclosed,
since these embodiments are intended as illustrations of several
aspects of the invention. Any equivalent embodiments are intended
to be within the scope of this invention. Indeed, various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description. Such modifications are also
intended to fall within the scope of the appended claims. In the
case of conflict, the present disclosure including definitions will
control.
[0725] Various references are cited herein, the disclosures of
which are incorporated by reference in their entireties.
Sequence CWU 1
1
57 1 1545 DNA Trichoderma reesei CDS (1)..(1539) sig_peptide
(1)..(51) mat_peptide (52)..() 1 atg tat cgg aag ttg gcc gtc atc
tcg gcc ttc ttg gcc aca gct cgt 48 Met Tyr Arg Lys Leu Ala Val Ile
Ser Ala Phe Leu Ala Thr Ala Arg -15 -10 -5 gct cag tcg gcc tgc act
ctc caa tcg gag act cac ccg cct ctg aca 96 Ala Gln Ser Ala Cys Thr
Leu Gln Ser Glu Thr His Pro Pro Leu Thr -1 1 5 10 15 tgg cag aaa
tgc tcg tct ggt ggc acg tgc act caa cag aca ggc tcc 144 Trp Gln Lys
Cys Ser Ser Gly Gly Thr Cys Thr Gln Gln Thr Gly Ser 20 25 30 gtg
gtc atc gac gcc aac tgg cgc tgg act cac gct acg aac agc agc 192 Val
Val Ile Asp Ala Asn Trp Arg Trp Thr His Ala Thr Asn Ser Ser 35 40
45 acg aac tgc tac gat ggc aac act tgg agc tcg acc cta tgt cct gac
240 Thr Asn Cys Tyr Asp Gly Asn Thr Trp Ser Ser Thr Leu Cys Pro Asp
50 55 60 aac gag acc tgc gcg aag aac tgc tgt ctg gac ggt gcc gcc
tac gcg 288 Asn Glu Thr Cys Ala Lys Asn Cys Cys Leu Asp Gly Ala Ala
Tyr Ala 65 70 75 tcc acg tac gga gtt acc acg agc ggt aac agc ctc
tcc att ggc ttt 336 Ser Thr Tyr Gly Val Thr Thr Ser Gly Asn Ser Leu
Ser Ile Gly Phe 80 85 90 95 gtc acc cag tct gcg cag aag aac gtt ggc
gct cgc ctt tac ctt atg 384 Val Thr Gln Ser Ala Gln Lys Asn Val Gly
Ala Arg Leu Tyr Leu Met 100 105 110 gcg agc gac acg acc tac cag gaa
ttc acc ctg ctt ggc aac gag ttc 432 Ala Ser Asp Thr Thr Tyr Gln Glu
Phe Thr Leu Leu Gly Asn Glu Phe 115 120 125 tct ttc gat gtt gat gtt
tcg cag ctg ccg tgc ggc ttg aac gga gct 480 Ser Phe Asp Val Asp Val
Ser Gln Leu Pro Cys Gly Leu Asn Gly Ala 130 135 140 ctc tac ttc gtg
tcc atg gac gcg gat ggt ggc gtg agc aag tat ccc 528 Leu Tyr Phe Val
Ser Met Asp Ala Asp Gly Gly Val Ser Lys Tyr Pro 145 150 155 acc aac
acc gct ggc gcc aag tac ggc acg ggg tac tgt gac agc cag 576 Thr Asn
Thr Ala Gly Ala Lys Tyr Gly Thr Gly Tyr Cys Asp Ser Gln 160 165 170
175 tgt ccc cgc gat ctg aag ttc atc aat ggc cag gcc aac gtt gag ggc
624 Cys Pro Arg Asp Leu Lys Phe Ile Asn Gly Gln Ala Asn Val Glu Gly
180 185 190 tgg gag ccg tca tcc aac aac gcg aac acg ggc att gga gga
cac gga 672 Trp Glu Pro Ser Ser Asn Asn Ala Asn Thr Gly Ile Gly Gly
His Gly 195 200 205 agc tgc tgc tct gag atg gat atc tgg gag gcc aac
tcc atc tcc gag 720 Ser Cys Cys Ser Glu Met Asp Ile Trp Glu Ala Asn
Ser Ile Ser Glu 210 215 220 gct ctt acc ccc cac cct tgc acg act gtc
ggc cag gag atc tgc gag 768 Ala Leu Thr Pro His Pro Cys Thr Thr Val
Gly Gln Glu Ile Cys Glu 225 230 235 ggt gat ggg tgc ggc gga act tac
tcc gat aac aga tat ggc ggc act 816 Gly Asp Gly Cys Gly Gly Thr Tyr
Ser Asp Asn Arg Tyr Gly Gly Thr 240 245 250 255 tgc gat ccc gat ggc
tgc gac tgg aac cca tac cgc ctg ggc aac acc 864 Cys Asp Pro Asp Gly
Cys Asp Trp Asn Pro Tyr Arg Leu Gly Asn Thr 260 265 270 agc ttc tac
ggc cct ggc tca agc ttt acc ctc gat acc acc aag aaa 912 Ser Phe Tyr
Gly Pro Gly Ser Ser Phe Thr Leu Asp Thr Thr Lys Lys 275 280 285 ttg
acc gtt gtc acc cag ttc gag acg tcg ggt gcc atc aac cga tac 960 Leu
Thr Val Val Thr Gln Phe Glu Thr Ser Gly Ala Ile Asn Arg Tyr 290 295
300 tat gtc cag aat ggc gtc act ttc cag cag ccc aac gcc gag ctt ggt
1008 Tyr Val Gln Asn Gly Val Thr Phe Gln Gln Pro Asn Ala Glu Leu
Gly 305 310 315 agt tac tct ggc aac gag ctc aac gat gat tac tgc aca
gct gag gag 1056 Ser Tyr Ser Gly Asn Glu Leu Asn Asp Asp Tyr Cys
Thr Ala Glu Glu 320 325 330 335 gca gaa ttc ggc gga tcc tct ttc tca
gac aag ggc ggc ctg act cag 1104 Ala Glu Phe Gly Gly Ser Ser Phe
Ser Asp Lys Gly Gly Leu Thr Gln 340 345 350 ttc aag aag gct acc tct
ggc ggc atg gtt ctg gtc atg agt ctg tgg 1152 Phe Lys Lys Ala Thr
Ser Gly Gly Met Val Leu Val Met Ser Leu Trp 355 360 365 gat gat tac
tac gcc aac atg ctg tgg ctg gac tcc acc tac ccg aca 1200 Asp Asp
Tyr Tyr Ala Asn Met Leu Trp Leu Asp Ser Thr Tyr Pro Thr 370 375 380
aac gag acc tcc tcc aca ccc ggt gcc gtg cgc gga agc tgc tcc acc
1248 Asn Glu Thr Ser Ser Thr Pro Gly Ala Val Arg Gly Ser Cys Ser
Thr 385 390 395 agc tcc ggt gtc cct gct cag gtc gaa tct cag tct ccc
aac gcc aag 1296 Ser Ser Gly Val Pro Ala Gln Val Glu Ser Gln Ser
Pro Asn Ala Lys 400 405 410 415 gtc acc ttc tcc aac atc aag ttc gga
ccc att ggc agc acc ggc aac 1344 Val Thr Phe Ser Asn Ile Lys Phe
Gly Pro Ile Gly Ser Thr Gly Asn 420 425 430 cct agc ggc ggc aac cct
ccc ggc gga aac ccg cct ggc acc acc acc 1392 Pro Ser Gly Gly Asn
Pro Pro Gly Gly Asn Pro Pro Gly Thr Thr Thr 435 440 445 acc cgc cgc
cca gcc act acc act gga agc tct ccc gga cct acc cag 1440 Thr Arg
Arg Pro Ala Thr Thr Thr Gly Ser Ser Pro Gly Pro Thr Gln 450 455 460
tct cac tac ggc cag tgc ggc ggt att ggc tac agc ggc ccc acg gtc
1488 Ser His Tyr Gly Gln Cys Gly Gly Ile Gly Tyr Ser Gly Pro Thr
Val 465 470 475 tgc gcc agc ggc aca act tgc cag gtc ctg aac cct tac
tac tct cag 1536 Cys Ala Ser Gly Thr Thr Cys Gln Val Leu Asn Pro
Tyr Tyr Ser Gln 480 485 490 495 tgc ctgtaa 1545 Cys 2 513 PRT
Trichoderma reesei 2 Met Tyr Arg Lys Leu Ala Val Ile Ser Ala Phe
Leu Ala Thr Ala Arg -15 -10 -5 Ala Gln Ser Ala Cys Thr Leu Gln Ser
Glu Thr His Pro Pro Leu Thr -1 1 5 10 15 Trp Gln Lys Cys Ser Ser
Gly Gly Thr Cys Thr Gln Gln Thr Gly Ser 20 25 30 Val Val Ile Asp
Ala Asn Trp Arg Trp Thr His Ala Thr Asn Ser Ser 35 40 45 Thr Asn
Cys Tyr Asp Gly Asn Thr Trp Ser Ser Thr Leu Cys Pro Asp 50 55 60
Asn Glu Thr Cys Ala Lys Asn Cys Cys Leu Asp Gly Ala Ala Tyr Ala 65
70 75 Ser Thr Tyr Gly Val Thr Thr Ser Gly Asn Ser Leu Ser Ile Gly
Phe 80 85 90 95 Val Thr Gln Ser Ala Gln Lys Asn Val Gly Ala Arg Leu
Tyr Leu Met 100 105 110 Ala Ser Asp Thr Thr Tyr Gln Glu Phe Thr Leu
Leu Gly Asn Glu Phe 115 120 125 Ser Phe Asp Val Asp Val Ser Gln Leu
Pro Cys Gly Leu Asn Gly Ala 130 135 140 Leu Tyr Phe Val Ser Met Asp
Ala Asp Gly Gly Val Ser Lys Tyr Pro 145 150 155 Thr Asn Thr Ala Gly
Ala Lys Tyr Gly Thr Gly Tyr Cys Asp Ser Gln 160 165 170 175 Cys Pro
Arg Asp Leu Lys Phe Ile Asn Gly Gln Ala Asn Val Glu Gly 180 185 190
Trp Glu Pro Ser Ser Asn Asn Ala Asn Thr Gly Ile Gly Gly His Gly 195
200 205 Ser Cys Cys Ser Glu Met Asp Ile Trp Glu Ala Asn Ser Ile Ser
Glu 210 215 220 Ala Leu Thr Pro His Pro Cys Thr Thr Val Gly Gln Glu
Ile Cys Glu 225 230 235 Gly Asp Gly Cys Gly Gly Thr Tyr Ser Asp Asn
Arg Tyr Gly Gly Thr 240 245 250 255 Cys Asp Pro Asp Gly Cys Asp Trp
Asn Pro Tyr Arg Leu Gly Asn Thr 260 265 270 Ser Phe Tyr Gly Pro Gly
Ser Ser Phe Thr Leu Asp Thr Thr Lys Lys 275 280 285 Leu Thr Val Val
Thr Gln Phe Glu Thr Ser Gly Ala Ile Asn Arg Tyr 290 295 300 Tyr Val
Gln Asn Gly Val Thr Phe Gln Gln Pro Asn Ala Glu Leu Gly 305 310 315
Ser Tyr Ser Gly Asn Glu Leu Asn Asp Asp Tyr Cys Thr Ala Glu Glu 320
325 330 335 Ala Glu Phe Gly Gly Ser Ser Phe Ser Asp Lys Gly Gly Leu
Thr Gln 340 345 350 Phe Lys Lys Ala Thr Ser Gly Gly Met Val Leu Val
Met Ser Leu Trp 355 360 365 Asp Asp Tyr Tyr Ala Asn Met Leu Trp Leu
Asp Ser Thr Tyr Pro Thr 370 375 380 Asn Glu Thr Ser Ser Thr Pro Gly
Ala Val Arg Gly Ser Cys Ser Thr 385 390 395 Ser Ser Gly Val Pro Ala
Gln Val Glu Ser Gln Ser Pro Asn Ala Lys 400 405 410 415 Val Thr Phe
Ser Asn Ile Lys Phe Gly Pro Ile Gly Ser Thr Gly Asn 420 425 430 Pro
Ser Gly Gly Asn Pro Pro Gly Gly Asn Pro Pro Gly Thr Thr Thr 435 440
445 Thr Arg Arg Pro Ala Thr Thr Thr Gly Ser Ser Pro Gly Pro Thr Gln
450 455 460 Ser His Tyr Gly Gln Cys Gly Gly Ile Gly Tyr Ser Gly Pro
Thr Val 465 470 475 Cys Ala Ser Gly Thr Thr Cys Gln Val Leu Asn Pro
Tyr Tyr Ser Gln 480 485 490 495 Cys 3 20 DNA E. coli 3 taatacgact
cactataggg 20 4 67 DNA Trichoderma reesei 4 tatacctcta tactttaacg
tcaaggagaa aaaactatag gatccaccat gtatcggaag 60 ttggccg 67 5 65 DNA
Trichoderma reesei 5 cataactaat tacatgatgc ggccctctag atgcacatga
ctcgagttac aggcactgag 60 agtag 65 6 67 DNA Saccharomyces cerevisiae
6 tatacctcta tactttaacg tcaaggagaa aaaactatag gatccaccat gtatcggaag
60 ttggccg 67 7 65 DNA Saccharomyces cerevisiae 7 cataactaat
tacatgatgc ggccctctag atgcacatga ctcgagttac aggcactgag 60 agtag 65
8 20 DNA Saccharomyces cerevisiae 8 ggcgtgaatg taagcgtgac 20 9 28
DNA Saccharomyces cerevisiae 9 ctggggtaat taatcagcga agcgatga 28 10
19 DNA Saccharomyces cerevisiae 10 gcgtacacgc gtctgtaca 19 11 22
DNA Aspergillus nidulans 11 gtgccccatg atacgcctcc gg 22 12 26 DNA
Aspergillus nidulans 12 gagtcgtatt tccaaggctc ctgacc 26 13 24 DNA
Aspergillus nidulans 13 ggaggccatg aagtggacca acgg 24 14 45 DNA
Aspergillus niger 14 caccgtgaaa gccatgctct ttccttcgtg tagaagacca
gacag 45 15 45 DNA Aspergillus niger 15 ctggtcttct acacgaagga
aagagcatgg ctttcacggt gtctg 45 16 44 DNA Aspergillus oryzae 16
ctatatacac aactggattt accatgggcc cgcggccgca gatc 44 17 44 DNA
Aspergillus oryzae 17 gatctgcggc cgcgggccca tggtaaatcc agttgtgtat
atag 44 18 22 DNA Trichoderma reesei 18 gcaacatgta tcggaagttg gc 22
19 22 DNA Trichoderma reesei 19 aattaatttt acaggcactg ag 22 20 33
DNA Trichoderma reesei 20 gaacacgggc attggacgac acggaagctg ctg 33
21 33 DNA Trichoderma reesei 21 cagcagcttc cgtgtcgtcc aatgcccgtg
ttc 33 22 20 DNA Trichoderma reesei 22 cttcttggcc acagctcgtg 20 23
20 DNA Trichoderma reesei 23 ggctttgtca cccagtctgc 20 24 20 DNA
Trichoderma reesei 24 cgtcatccaa caacgcgaac 20 25 20 DNA
Trichoderma reesei 25 ttcgagacgt cgggtgccat 20 26 20 DNA
Trichoderma reesei 26 cgcggaagct gctccaccag 20 27 20 DNA
Trichoderma reesei 27 aatggagagg ctgttaccgc 20 28 67 DNA
Saccharomyces cerevisiae 28 tatacctcta tactttaacg tcaaggagaa
aaaactatag gatccaccat gtatcggaag 60 ttggccg 67 29 65 DNA
Saccharomyces cerevisiae 29 cataactaat tacatgatgc ggccctctag
atgcacatga ctcgagttac aggcactgag 60 agtag 65 30 28 DNA
Saccharomyces cerevisiae 30 ctggggtaat taatcagcga agcgatga 28 31 19
DNA Saccharomyces cerevisiae 31 gcgtacacgc gtctgtaca 19 32 31 DNA
Trichoderma reesei misc_feature (21)..(21) N= A,C, G,OR T 32
gcggtaacag cctctccatt nnstttgtca c 31 33 33 DNA Trichoderma reesei
misc_feature (23)..(24) N= A, C, G, OR T 33 ctgcgcagac tgggtgacaa
asnnaatgga gag 33 34 32 DNA Trichoderma reesei misc_feature
(21)..(22) N= A, C, G, OR T 34 ccatctccga ggctcttacc nnscaccctt gc
32 35 33 DNA Trichoderma reesei misc_feature (24)..(25) N= A, C, G,
OR T 35 ggccgacagt cgtgcaaggg tgsnnggtaa gag 33 36 30 DNA
Trichoderma reesei misc_feature (19)..(20) N= A, C, G, OR T 36
gagggctggg agccgtcann saacaacgcg 30 37 33 DNA Trichoderma reesei
misc_feature (25)..(26) N= A, C, G, OR T 37 ccaatgcccg tgttcgcgtt
gttsnntgac ggc 33 38 29 DNA Trichoderma reesei 38 aacgttaatt
aaggaatcgt tttgtgttt 29 39 29 DNA Trichoderma reesei 39 agtactagta
gctccgtggc gaaagcctg 29 40 26 DNA Trichoderma reesei 40 actagtcgac
cgaatgtagg attgtt 26 41 19 DNA Trichoderma reesei 41 tgaccatggt
gcgcagtcc 19 42 26 DNA Trichoderma reesei 42 cgatcgtctc cctatgggtc
attacc 26 43 28 DNA Trichoderma reesei 43 actagttaat taagctccgt
ggcgaaag 28 44 30 DNA Trichoderma reesei 44 cgcggactgc gcaccatgta
tcggaagttg 30 45 30 DNA Trichoderma reesei 45 cgccacggag cttaattaca
ggcactgaga 30 46 20 DNA Trichoderma reesei 46 gccttcggcc tttgggtgta
20 47 20 DNA Trichoderma reesei 47 gagcggcgat tctacgggtt 20 48 26
DNA Escherichia coli 48 gccgcggcac gcgccacacg gaaaat 26 49 27 DNA
Escherichia coli 49 gaccggtcgc aaaatgacaa atagaag 27 50 23 DNA
Trichoderma reesei 50 gctccgggca aatgcaaagt gtg 23 51 24 DNA
Trichoderma reesei 51 agcaggccgc atctccagtg aaag 24 52 20 DNA
Escherichia coli 52 gcacgcgcca cacggaaaat 20 53 20 DNA Escherichia
coli 53 cgcaaaatga caaatagaag 20 54 31 DNA Aspergillus fumigatus 54
actggattta ccatgagatt cggttggctc g 31 55 31 DNA Aspergillus
fumigatus 55 agtcacctct agttactagt agacacgggg c 31 56 3060 DNA
Aspergillus fumigatus 56 atgagattcg gttggctcga ggtggccgct
ctgacggccg cttctgtagc caatgcccag 60 gtttgtgatg ctttcccgtc
attgtttcgg atatagttga caatagtcat ggaaataatc 120 aggaattggc
tttctctcca ccattctacc cttcgccttg ggctgatggc cagggagagt 180
gggcagatgc ccatcgacgc gccgtcgaga tcgtttctca gatgacactg gcggagaagg
240 ttaaccttac aacgggtact gggtgggttg cgactttttt gttgacagtg
agctttcttc 300 actgaccatc tacacagatg ggaaatggac cgatgcgtcg
gtcaaaccgg cagcgttccc 360 aggtaagctt gcaattctgc aacaacgtgc
aagtgtagtt gctaaaacgc ggtggtgcag 420 acttggtatc aactggggtc
tttgtggcca ggattcccct ttgggtatcc gtttctgtga 480 gctatacccg
cggagtcttt cagtccttgt attatgtgct gatgattgtc tctgtatagc 540
tgacctcaac tccgccttcc ctgctggtac taatgtcgcc gcgacatggg acaagacact
600 cgcctacctt cgtggcaagg ccatgggtga ggaattcaac gacaagggcg
tggacatttt 660 gctggggcct gctgctggtc ctctcggcaa atacccggac
ggcggcagaa tctgggaagg 720 cttctctcct gatccggttc tcactggtgt
acttttcgcc gaaactatca agggtatcca 780 agacgcgggt gtgattgcta
ctgccaagca ttacattctg aatgaacagg agcatttccg 840 acaggttggc
gaggcccagg gatatggtta caacatcacg gagacgatca gctccaacgt 900
ggatgacaag accatgcacg agttgtacct ttggtgagta gttgacactg caaatgagga
960 ccttgattga tttgactgac ctggaatgca ggccctttgc agatgctgtg
cgcggtaaga 1020 ttttccgtag acttgacctc gcgacgaaga aatcgctgac
gaaccatcgt agctggcgtt 1080 ggcgctgtca tgtgttccta caatcaaatc
aacaacagct acggttgtca aaacagtcaa 1140 actctcaaca agctcctcaa
ggctgagctg ggcttccaag gcttcgtcat gagtgactgg 1200 agcgctcacc
acagcggtgt cggcgctgcc ctcgctgggt tggatatgtc gatgcctgga 1260
gacatttcct tcgacgacgg actctccttc tggggcacga acctaactgt cagtgttctt
1320 aacggcaccg
ttccagcctg gcgtgtcgat gacatggctg ttcgtatcat gaccgcgtac 1380
tacaaggttg gtcgtgaccg tcttcgtatt ccccctaact tcagctcctg gacccgggat
1440 gagtacggct gggagcattc tgctgtctcc gagggagcct ggaccaaggt
gaacgacttc 1500 gtcaatgtgc agcgcagtca ctctcagatc atccgtgaga
ttggtgccgc tagtacagtg 1560 ctcttgaaga acacgggtgc tcttcctttg
accggcaagg aggttaaagt gggtgttctc 1620 ggtgaagacg ctggttccaa
cccgtggggt gctaacggct gccccgaccg cggctgtgat 1680 aacggcactc
ttgctatggc ctggggtagt ggtactgcca acttccctta ccttgtcacc 1740
cccgagcagg ctatccagcg agaggtcatc agcaacggcg gcaatgtctt tgctgtgact
1800 gataacgggg ctctcagcca gatggcagat gttgcatctc aatccaggtg
agtgcgggct 1860 cttagaaaaa gaacgttctc tgaatgaagt tttttaacca
ttgcgaacag cgtgtctttg 1920 gtgtttgtca acgccgactc tggagagggt
ttcatcagtg tcgacggcaa cgagggtgac 1980 cgcaaaaatc tcactctgtg
gaagaacggc gaggccgtca ttgacactgt tgtcagccac 2040 tgcaacaaca
cgattgtggt tattcacagt gttgggcccg tcttgatcga ccggtggtat 2100
gataacccca acgtcactgc catcatctgg gccggcttgc ccggtcagga gagtggcaac
2160 tccctggtcg acgtgctcta tggccgcgtc aaccccagcg ccaagacccc
gttcacctgg 2220 ggcaagactc gggagtctta cggggctccc ttgctcaccg
agcctaacaa tggcaatggt 2280 gctccccagg atgatttcaa cgagggcgtc
ttcattgact accgtcactt tgacaagcgc 2340 aatgagaccc ccatttatga
gtttggccat ggcttgagct acaccacctt tggttactct 2400 caccttcggg
ttcaggccct caatagttcg agttcggcat atgtcccgac tagcggagag 2460
accaagcctg cgccaaccta tggtgagatc ggtagtgccg ccgactacct gtatcccgag
2520 ggtctcaaaa gaattaccaa gtttatttac ccttggctca actcgaccga
cctcgaggat 2580 tcttctgacg acccgaacta cggctgggag gactcggagt
acattcccga aggcgctagg 2640 gatgggtctc ctcaacccct cctgaaggct
ggcggcgctc ctggtggtaa ccctaccctt 2700 tatcaggatc ttgttagggt
gtcggccacc ataaccaaca ctggtaacgt cgccggttat 2760 gaagtccctc
aattggtgag tgacccgcat gttccttgcg ttgcaatttg gctaactcgc 2820
ttctagtatg tttcactggg cggaccgaac gagcctcggg tcgttctgcg caagttcgac
2880 cgaatcttcc tggctcctgg ggagcaaaag gtttggacca cgactcttaa
ccgtcgtgat 2940 ctcgccaatt gggatgtgga ggctcaggac tgggtcatca
caaagtaccc caagaaagtg 3000 cacgtcggca gctcctcgcg taagctgcct
ctgagagcgc ctctgccccg tgtctactag 3060 57 863 PRT Aspergillus
fumigatus 57 Met Arg Phe Gly Trp Leu Glu Val Ala Ala Leu Thr Ala
Ala Ser Val 1 5 10 15 Ala Asn Ala Gln Glu Leu Ala Phe Ser Pro Pro
Phe Tyr Pro Ser Pro 20 25 30 Trp Ala Asp Gly Gln Gly Glu Trp Ala
Asp Ala His Arg Arg Ala Val 35 40 45 Glu Ile Val Ser Gln Met Thr
Leu Ala Glu Lys Val Asn Leu Thr Thr 50 55 60 Gly Thr Gly Trp Glu
Met Asp Arg Cys Val Gly Gln Thr Gly Ser Val 65 70 75 80 Pro Arg Leu
Gly Ile Asn Trp Gly Leu Cys Gly Gln Asp Ser Pro Leu 85 90 95 Gly
Ile Arg Phe Ser Asp Leu Asn Ser Ala Phe Pro Ala Gly Thr Asn 100 105
110 Val Ala Ala Thr Trp Asp Lys Thr Leu Ala Tyr Leu Arg Gly Lys Ala
115 120 125 Met Gly Glu Glu Phe Asn Asp Lys Gly Val Asp Ile Leu Leu
Gly Pro 130 135 140 Ala Ala Gly Pro Leu Gly Lys Tyr Pro Asp Gly Gly
Arg Ile Trp Glu 145 150 155 160 Gly Phe Ser Pro Asp Pro Val Leu Thr
Gly Val Leu Phe Ala Glu Thr 165 170 175 Ile Lys Gly Ile Gln Asp Ala
Gly Val Ile Ala Thr Ala Lys His Tyr 180 185 190 Ile Leu Asn Glu Gln
Glu His Phe Arg Gln Val Gly Glu Ala Gln Gly 195 200 205 Tyr Gly Tyr
Asn Ile Thr Glu Thr Ile Ser Ser Asn Val Asp Asp Lys 210 215 220 Thr
Met His Glu Leu Tyr Leu Trp Pro Phe Ala Asp Ala Val Arg Ala 225 230
235 240 Gly Val Gly Ala Val Met Cys Ser Tyr Asn Gln Ile Asn Asn Ser
Tyr 245 250 255 Gly Cys Gln Asn Ser Gln Thr Leu Asn Lys Leu Leu Lys
Ala Glu Leu 260 265 270 Gly Phe Gln Gly Phe Val Met Ser Asp Trp Ser
Ala His His Ser Gly 275 280 285 Val Gly Ala Ala Leu Ala Gly Leu Asp
Met Ser Met Pro Gly Asp Ile 290 295 300 Ser Phe Asp Asp Gly Leu Ser
Phe Trp Gly Thr Asn Leu Thr Val Ser 305 310 315 320 Val Leu Asn Gly
Thr Val Pro Ala Trp Arg Val Asp Asp Met Ala Val 325 330 335 Arg Ile
Met Thr Ala Tyr Tyr Lys Val Gly Arg Asp Arg Leu Arg Ile 340 345 350
Pro Pro Asn Phe Ser Ser Trp Thr Arg Asp Glu Tyr Gly Trp Glu His 355
360 365 Ser Ala Val Ser Glu Gly Ala Trp Thr Lys Val Asn Asp Phe Val
Asn 370 375 380 Val Gln Arg Ser His Ser Gln Ile Ile Arg Glu Ile Gly
Ala Ala Ser 385 390 395 400 Thr Val Leu Leu Lys Asn Thr Gly Ala Leu
Pro Leu Thr Gly Lys Glu 405 410 415 Val Lys Val Gly Val Leu Gly Glu
Asp Ala Gly Ser Asn Pro Trp Gly 420 425 430 Ala Asn Gly Cys Pro Asp
Arg Gly Cys Asp Asn Gly Thr Leu Ala Met 435 440 445 Ala Trp Gly Ser
Gly Thr Ala Asn Phe Pro Tyr Leu Val Thr Pro Glu 450 455 460 Gln Ala
Ile Gln Arg Glu Val Ile Ser Asn Gly Gly Asn Val Phe Ala 465 470 475
480 Val Thr Asp Asn Gly Ala Leu Ser Gln Met Ala Asp Val Ala Ser Gln
485 490 495 Ser Ser Val Ser Leu Val Phe Val Asn Ala Asp Ser Gly Glu
Gly Phe 500 505 510 Ile Ser Val Asp Gly Asn Glu Gly Asp Arg Lys Asn
Leu Thr Leu Trp 515 520 525 Lys Asn Gly Glu Ala Val Ile Asp Thr Val
Val Ser His Cys Asn Asn 530 535 540 Thr Ile Val Val Ile His Ser Val
Gly Pro Val Leu Ile Asp Arg Trp 545 550 555 560 Tyr Asp Asn Pro Asn
Val Thr Ala Ile Ile Trp Ala Gly Leu Pro Gly 565 570 575 Gln Glu Ser
Gly Asn Ser Leu Val Asp Val Leu Tyr Gly Arg Val Asn 580 585 590 Pro
Ser Ala Lys Thr Pro Phe Thr Trp Gly Lys Thr Arg Glu Ser Tyr 595 600
605 Gly Ala Pro Leu Leu Thr Glu Pro Asn Asn Gly Asn Gly Ala Pro Gln
610 615 620 Asp Asp Phe Asn Glu Gly Val Phe Ile Asp Tyr Arg His Phe
Asp Lys 625 630 635 640 Arg Asn Glu Thr Pro Ile Tyr Glu Phe Gly His
Gly Leu Ser Tyr Thr 645 650 655 Thr Phe Gly Tyr Ser His Leu Arg Val
Gln Ala Leu Asn Ser Ser Ser 660 665 670 Ser Ala Tyr Val Pro Thr Ser
Gly Glu Thr Lys Pro Ala Pro Thr Tyr 675 680 685 Gly Glu Ile Gly Ser
Ala Ala Asp Tyr Leu Tyr Pro Glu Gly Leu Lys 690 695 700 Arg Ile Thr
Lys Phe Ile Tyr Pro Trp Leu Asn Ser Thr Asp Leu Glu 705 710 715 720
Asp Ser Ser Asp Asp Pro Asn Tyr Gly Trp Glu Asp Ser Glu Tyr Ile 725
730 735 Pro Glu Gly Ala Arg Asp Gly Ser Pro Gln Pro Leu Leu Lys Ala
Gly 740 745 750 Gly Ala Pro Gly Gly Asn Pro Thr Leu Tyr Gln Asp Leu
Val Arg Val 755 760 765 Ser Ala Thr Ile Thr Asn Thr Gly Asn Val Ala
Gly Tyr Glu Val Pro 770 775 780 Gln Leu Tyr Val Ser Leu Gly Gly Pro
Asn Glu Pro Arg Val Val Leu 785 790 795 800 Arg Lys Phe Asp Arg Ile
Phe Leu Ala Pro Gly Glu Gln Lys Val Trp 805 810 815 Thr Thr Thr Leu
Asn Arg Arg Asp Leu Ala Asn Trp Asp Val Glu Ala 820 825 830 Gln Asp
Trp Val Ile Thr Lys Tyr Pro Lys Lys Val His Val Gly Ser 835 840 845
Ser Ser Arg Lys Leu Pro Leu Arg Ala Pro Leu Pro Arg Val Tyr 850 855
860
* * * * *