U.S. patent application number 10/499298 was filed with the patent office on 2005-03-03 for efficient production of f(ab')2 fragments in mammalian cells.
Invention is credited to Bout, Abraham, Jones, David Halford Ashton.
Application Number | 20050048038 10/499298 |
Document ID | / |
Family ID | 19760784 |
Filed Date | 2005-03-03 |
United States Patent
Application |
20050048038 |
Kind Code |
A1 |
Jones, David Halford Ashton ;
et al. |
March 3, 2005 |
Efficient production of f(ab')2 fragments in mammalian cells
Abstract
The present invention provides immortalized eukaryotic cells and
methods useful for the production of immunologically active
bivalent antibody fragments, such as F(ab')2 fragments. The methods
and cells of the invention result in a desirable ratio of bivalent
to monovalent antibody fragments.
Inventors: |
Jones, David Halford Ashton;
(London, GB) ; Bout, Abraham; (Moerkapelle,
NL) |
Correspondence
Address: |
TRASK BRITT
P.O. BOX 2550
SALT LAKE CITY
UT
84110
US
|
Family ID: |
19760784 |
Appl. No.: |
10/499298 |
Filed: |
October 25, 2004 |
PCT Filed: |
December 17, 2002 |
PCT NO: |
PCT/NL02/00841 |
Current U.S.
Class: |
424/93.21 ;
435/368; 435/456 |
Current CPC
Class: |
C12N 2799/022 20130101;
C07K 16/18 20130101; C07K 2317/55 20130101; C12N 2800/108 20130101;
A61K 2039/505 20130101; C12N 2840/20 20130101; C07K 16/00 20130101;
C12N 15/85 20130101; C07K 2317/624 20130101 |
Class at
Publication: |
424/093.21 ;
435/456; 435/368 |
International
Class: |
A61K 048/00; C12N
005/08; C12N 015/861 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 17, 2001 |
NL |
PCTNL01/00917 |
Claims
1-24. (canceled)
25. An isolated mammalian cell comprising: a nucleic acid sequence
encoding an E1 region of adenovirus; and one or more nucleic acid
sequences capable of driving expression operably linked to one or
more sequences encoding one or more bivalent multimeric antibody
fragments lacking at least the C-terminal constant domain of the
heavy chain.
26. The isolated mammalian cell of claim 25, wherein the one or
more bivalent multimeric antibody fragments comprises a
F(ab').sub.2 fragment.
27. The isolated mammalian cell of claim 25, wherein the mammalian
cell is of human origin.
28. The isolated mammalian cell of claim 25, wherein the isolated
mammalian cell is a retinal cell.
29. The isolated mammalian cell of claim 27, wherein the mammalian
cell is a PER.C6.TM. cell containing the one or more nucleic acid
sequences capable of driving expression operably linked to the one
or more sequences encoding the one or more bivalent multimeric
antibody fragments lacking at least the C-terminal constant domain
of the heavy chain.
30. The isolated mammalian cell oflaim 25, wherein the one or more
sequences capable of driving expression comprise a cytomegalovirus
(CMV) promoter.
31. The isolated mammalian cell of claim 30, wherein the CMV
promoter comprise a CMV immediate early gene promoter/enhancer.
32. A mammalian cell comprising an isolated mammalian cell that
expresses and secretes both bivalent and monovalent antibody
fragments, wherein an elution volume ratio of secreted bivalent
antibody fragments to secreted monovalent antibody fragments
lacking at least the C-terminal constant domain of the heavy chain
is at least 1:3, as may be determined by gel filtration
chromatography and analysis of the ratio of an area under the
F(ab').sub.2 fragment elution peak relative to the F(ab') elution
peak.
33. The mammalian cell of claim 32, wherein the antigen binding
regions of the secreted bivalent antibody fragments are not linked
by a peptide bond.
34. The mammalian cell of claim 32, wherein the secreted bivalent
antibody fragments are immunologically active and is
post-translationally modified.
35. The mammalian cell of claim 25, wherein at least one of the one
or more nucleic acid sequences is inserted into the plasmid
designated pcDNA3002(Neo) as deposited at the ECACCC under
accession number 01121318
36. The proteinaceous molecule of claim 25, wherein at least one of
the one or more nucleic acid sequences encoding one or more
bivalent multimeric antibody fragments lacking at least the
C-terminal constant domain of the heavy chain comprises an element
selected from the group consisting of at least one of an intron,
secreation signal, nuclear localization sequence, proteolytic
processing site, glycosylation site, lipid attachment site,
sulfation site, site for disulfide bond formation, hydroxylation
site, and a phosphorylation site.
37. A proteinaceous molecule comprising a bivalent antibody
fragment, the proteinaceous molecule being produced by a process
comprising: providing a mammalian cell comprising: at least one
nucleic acid sequence encoding an E1 region of an adenovirus; and
at least one nucleic acid encoding at least one bivalent multimeric
antibody fragment, wherein the at least one nucleic acid encoding
at least one bivalent multimeric antibody fragment lacking at least
the C-terminal constant domain of the heavy chain is operably
linked to at least one promoter; culturing the mammalian cell;
expressing the at least one nucleic acid encoding at least one
bivalent multimeric antibody fragment to produce a proteinaceous
molecule; and purifying the proteinaceous molecule.
38. The proteinaceous molecule of claim 37, wherein culturing the
mammalian cell comprises culturing the mammalian cell in a media
lacking added serum proteins.
39. The proteinaceous molecule of claim 37, wherein the
proteinaceous molecule is secreted from the mammalian cell.
40. The proteinaceous molecule of claim 37, wherein the
proteinaceous molecule is immunologically active and is
post-translationally modified.
41. The proteinaceous molecule of claim 37, wherein the bivalent
antibody fragment's antigen binding regions are not linked by a
peptide bond.
42. The proteinaceous molecule of claim 37, wherein the bivalent
antibody fragment comprises an F(ab').sub.2 fragment.
43. The proteinaceous molecule of claim 37, where the proteinaceous
molecule is produced by a method essentially devoid of treating the
proteinaceous molecule with a protease.
44. The proteinaceous molecule of claim 37, wherein the mammalian
cell is of human origin.
45. The proteinaceous molecule of claim 44, wherein the mammalian
cell is of retinal cell origin.
46. The proteinaceous molecule of claim 45, wherein the mammalian
cell is a PER.C6.TM. cell containing the at least one nucleic acid
encoding at least one bivalent multimeric antibody fragment lacking
at least the C-terminal constant domain of the heavy chain.
47. The proteinaceous molecule of claim 37, wherein the at least
promoter comprises a cytomegalovirus (CMV) promoter.
48. The proteinaceous molecule of claim 47, wherein the CMV
promoter comprises the CMV immediate early gene
enhancer/promoter.
49. A composition comprising the proteinaceous molecule of claim 37
together with a pharmaceutically acceptable carrier.
50. A process for producing a proteinaceous molecule comprising a
bivalent antibody fragment, wherein the antigen binding regions of
the bivalent antibody fragment are not linked by a peptide bond,
the process comprising: providing a mammalian cell comprising: a
nucleic acid sequence encoding an E1 region of an adenovirus; one
or more nucleic acid sequences capable of driving expression
operably linked to one or more nucleotide sequences encoding one or
more bivalent multimeric antibody fragments lacking at least the
C-terminal constant domain of the heavy chain; culturing the
mammalian cell in a suitable medium; and expressing the one or more
nucleic acids to produce the one or more bivalent multimeric
antibody fragments.
51. The process of claim 50, further comprising purifying the
proteinaceous molecule.
52. The process of claim 50, further comprising secreting the
proteinaceous molecule from the mammalian cell.
53. The process of claim 50, wherein the proteinaceous molecule is
immunologically active and is post-translationally modified.
54. The process of claim 50, wherein the bivalent antibody fragment
comprises a F(ab').sub.2 fragment.
55. The process of claim 51, wherein the proteinaceous molecule is
produced by a process essentially devoid of treating the
proteinaceous molecule with a protease.
56. The process of claim 50, wherein the mammalian cell is of human
origin.
57. The process of claim 56, wherein the mammalian cell is a
retinal cell.
58. The process of claim 57, wherein the mammalian cell is a
PER.C6.TM. cell containing the one or more nucleic acid sequences
capable of driving expression operably linked to the one or more
nucleotide sequences encoding the one or more bivalent multimeric
antibody fragments.
59. The process of claim 50, wherein the one or more nucleic acid
sequences capable of driving expression comprise a nucleic acid
sequence from a cytomegalovirus (CMV) promoter.
60. The process of claim 59, wherein the CMV promoter comprises the
CMV immediate early gene enhancer/promoter.
61. The process of claim 50, wherein an elution volume ratio of the
proteinaceous molecule to monovalent antibody fragments produced by
the process is at least 1:3, as may be determined by gel filtration
chromatography and analysis of the ratio of an area under the
F(ab').sub.2 fragment elution peak relative to the F(ab') elution
peak.
62. The process of claim 50, wherein an elution volume ratio of the
proteinaceous molecule to monovalent antibody fragments produced by
the process is at least 3:1, as may be determined by gel filtration
chromatography and analysis of the ratio of an area under the
F(ab').sub.2 fragment elution peak relative to the F(ab') elution
peak.
63. The process of claim 50, wherein the one or more nucleotide
sequences encoding one or more bivalent multimeric antibody
fragments comprises an element selected from the group consisting
of at least one intron, secretion signal, and nuclear localization
sequence.
64. The process of claim 50, wherein the one or more bivalent
multimeric antibody fragments comprises an element selected from
the group consisting of at least one proteolytic processing site,
glycosylation site, lipid attachment site, sulfation site, site for
disulfide bond formation, hydroxylation site, and a phosphorylation
site
65. The process of claim 50, wherein the one or more bivalent
multimeric antibody fragments' antigen binding regions are linked
by at least one, but not more than 10 disulfide bonds.
66. The process of claim 65, wherein the antigen binding regions
are linked by one or two disulfide bonds.
67. The process of claim 65, wherein the one or more bivalent
multimeric antibody fragments' antigen binding regions linked by at
least one, but not more than 10 disulfide bonds are not of IgG3
origin.
68. A method of obtaining an F(ab').sub.2 fragment, the method
comprising: introducing into a mammalian cell a nucleic acid
encoding a F(ab').sub.2 fragment, wherein the nucleic acid is
operably linked to a sequence that drives expression of the nucleic
acid; culturing the mammalian cell to produce the F(ab').sub.2
fragment, wherein an elution volume ratio of the F(ab').sub.2
fragment to a F(ab') produced by the process is at least 1:3, as
may be determined by gel filtration chromatography and analysis of
the ratio of an area under the F(ab').sub.2 fragment elution peak
relative to the F(ab') elution peak; and isolating the F(ab').sub.2
fragment, wherein the isolation is essentially devoid of treating
the F(ab').sub.2 fragment with a protease.
69. A vector comprising: a first nucleic acid having a
cytomegalovirus (CMV) promoter and a bovine growth hormone
polyadenylation signal operably linked to a first sequence encoding
a VH1, CH1 and hinge region; and a second nucleic acid having a CMV
immediate early gene enhancer/promoter and a bovine growth hormone
polyadenylation signal operably linked to a second sequence
encoding a VL and CL region.
70. The vector of claim 69, wherein the first nucleic acid
comprises an intron.
71. The vector of claim 69, wherein the second nucleic acid
comprises an intron.
72. A plasmid designated pcDNA3002(Neo) as deposited at the ECACCC
under accession number 01121318.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a national stage entry under 35 U.S.C.
.sctn. 371 of International Patent Application Number
PCT/NL02/00841, filed Dec. 17, 2002, published in English as
International publication WO 03/051927 A2 on Jun. 26, 2003, which
claims the benefit under 35 U.S.C. .sctn. 119 of International
Patent Application Number PCT/NL01/00917, filed Dec. 17, 2001.
TECHNICAL FIELD
[0002] The invention relates to the field of recombinant protein
production and, in particular, to production of immunologically
active antibody fragments in eukaryotic cells. The invention more,
in particular, relates to the production of F(ab').sub.2 fragments
in eukaryotic cells.
BACKGROUND OF THE INVENTION
[0003] Results of recent clinical trials have generated much
excitement and optimism for the potential benefits of fully human
antibodies in the diagnosis and treatment of disease. This success
is in part due to the technology of selecting antibodies against
novel targets from phage display libraries and also due to improved
production platforms.
[0004] One IgG molecule comprises two heavy chains and two light
chains. The heavy chains consist of (starting from the N-terminus):
a variable region, a constant region, a hinge region and two
additional constant regions (FIG. 1). The hinge region contains
cysteine residues that form disulphide bonds with a second heavy
chain to mediate dimerization of the protein. The number of
cysteine residues varies depending on the IgG sub-class: IgG1 has 2
cysteines that form disulphide bonds in the hinge. The light chains
consist of a variable region and a constant region; residues
C-terminal to the constant region form disulphide bonds with
residues immediately before the heavy chain hinge regions. Thus the
four chains are held together by multiple disulphide bonds as well
as other noncovalent interactions between the intimately paired
chains.
[0005] The structure of an antibody may be defined as distinct
domains: the Fc region which mediates effector functions and the
F(ab') region which binds antigen (George and Urch, 2000). The two
C-terminal constant domains of the heavy chains make up the Fc
region. A F(ab') fragment comprises the light chain and the
variable and first constant region of the heavy chain; a F(ab')2
fragment comprises two F(ab') fragments dimerized through the heavy
chain hinge region (FIG. 1).
[0006] Antibodies are under investigation as therapies for a wide
range of clinical problems including organ transplantation, cardiac
disease, infectious diseases, cancer, rheumatologic and autoimmune
disease, neurologic disorders, respiratory diseases, as well as
disorders with organs such as the blood, skin and digestive
tract.
[0007] One of the major focuses for antibody discovery and
development is in the field of cancer imaging and therapy (Carter,
2001). Antibodies may be used as naked molecules or they may be
labeled and so used as a magic bullet to deliver a cargo to the
tumor (Borrebaeck and Carlsson, 2001; Park and Smolen, 2001). A
number of naked antibodies are currently in the clinic. While it is
clear that they are able to reduce tumor load in patients, the
mechanism by which this occurs is unclear. Classically, these might
work by recruiting effector cells (via Fc receptors) or complement
to the target cell. More recently, it is becoming apparent that
they may also function by binding cell surface proteins and then
activating inappropriate signaling pathways or apoptotic signaling
pathways, leading to cell death (Tutt et al., 1998).
[0008] Antibodies are currently used in the clinic, both as intact
IgG molecules and as F(ab') and F(ab')2 fragments. When choosing an
antibody format, there are several important issues. They should
have a high antigen avidity and specificity, be sufficiently small
to penetrate tumor tissue and remain in the circulation long enough
to localize to tumors. In addition (particularly if they are
labeled with a radiolabel or other toxic moiety), they should be
cleared from the body at a rate which prevents non-specific
toxicity or high background.
[0009] F(ab').sub.2 fragments exhibit a number of benefits over
intact IgG related to the above points, which make them attractive
for imaging and therapy. First, these molecules have a shorter
half-life than an intact IgG, because they are more rapidly removed
from the circulation by the kidneys as a result of their lower
molecular weight, thus reducing potential toxicity (Behr et al.,
1995). Another advantage of the reduced size is that they may
penetrate tumor tissue and associated vasculature more readily
(Yokota et al, 1992). In this way, more cells of the tumor mass are
targeted.
[0010] There are also advantages due to the absence of the Fc
region of the molecule. The F(ab').sub.2 fragment does not induce
activation of immune responses, as the Fc region (which binds
complement and Fc receptors) is absent. This is of particular
relevance in imaging studies where only a snapshot of tumor
dispersion and size is required. F(ab').sub.2 fragments also do not
have the problem of non-specific binding to targets through the Fc
moiety, reducing background and non-specific labeling. The
advantages listed above may also apply in part to F(ab') fragments.
However, F(ab').sub.2 molecules are bivalent (as are intact IgGs)
and so should bind target molecules with higher avidity. F(ab')
fragments are monovalent and, as a result, generally exhibit lower
avidities. For these reasons, F(ab').sub.2 fragments are highly
desirable as clinical agents.
[0011] While these advantages of F(ab').sub.2 fragments are clear,
it has not proven as easy to make F(ab').sub.2 fragments. There are
several methods currently available. The classic method is to make
the intact IgG, then digest it with a protease, such as pepsin, to
remove the Fc region of the antibody. This presents the problem
that other regions of the molecule may be nicked by the protease
(including the antigen-binding region, resulting in the loss of
binding capacity of the antigen-binding region) and digestion may
not be complete. Further purification is then required to remove
the F(ab').sub.2 fragment from the non-digested antibody, the free
Fc domain and the protease.
[0012] An alternative method is to make F(ab') fragments in
bacteria and then dimerize the molecules to generate F(ab').sub.2
molecules (Willuda et al., 2001; Zapata et al., 1995; Humphreys et
al., 1998; U.S. Pat. No. 5,648,237). Dimerization may use specific
self-associating peptides (which may prove antigenic in vivo),
conjugation via chemical cross-linkers or in vitro
reduction/oxidation of F(ab')-hinge fragments. These methods
require additional purification steps and may produce unusual
molecules (such as two F(ab') fragments linked "head-to-tail" so
that the antigen-binding regions are at opposite ends of the new
molecule).
[0013] Another method for production of F(ab').sub.2 fragments is
to generate them directly in mammalian cells. While this might
appear straightforward, it has been observed that F(ab') fragments
are often produced in preference to F(ab').sub.2 fragments. One
report in which CHO cells were used for IgG4 F(ab').sub.2
production indicated that F(ab').sub.2 fragments accounted for only
10% of the protein produced, with F(ab') fragments accounting for
90% (King et al., 1992; King et al., 1994). The reason for this is
unclear. Another important cell line in the production of
monoclonal antibodies is SP2/0; an attempt to produce IgG1
F(ab').sub.2 fragments in this cell line yielded essentially only
monovalent products. Addition of an IgG3 hinge, which comprises 11
sulphur bridges instead of the two sulphur bridges present in an
IgG1 hinge, resulted in the production of 98% divalent product
(Leung et al., 1999). However, increased numbers of sulphur bridges
generally decreases production levels of the antibody fragments and
it is, therefore, preferable to have fewer sulphur bridges for
production on a large scale. A similar picture was seen upon
expression of F(ab').sub.2 fragments in COS cells (De Sutter et
al., 1992). Thus, despite these efforts, there is still a need for
improved production methods of F(ab').sub.2 fragments. PER.C6.TM.
is a human cell line and an example of an immortalized primary
eukaryotic host cell. It is able to grow in suspension culture in
serum-free medium, which, upon transfection with an appropriate
expression vector and selection of stable cell lines, is capable of
producing recombinant protein in abundance, as disclosed in WO
00/63403. In the '403 application, it has been disclosed that
PER.C6.TM. cells can express intact human IgG, but no specific data
have been provided for F(ab').sub.2 fragments.
[0014] In view of the above, there is still a need for a
recombinant expression platform which is capable of producing such
fragments in sufficient yield without some of the disadvantages
observed with the platforms of the prior art.
SUMMARY OF THE INVENTION
[0015] It is demonstrated herein that PER.C6.TM. cells, as an
example of eukaryotic immortalized primary cells, are capable of
more efficiently producing and secreting F(ab').sub.2 fragments
without the need to take special measures disclosed in the prior
art. The F(ab').sub.2 fragment so produced and secreted can bind
antigen as efficiently as can intact IgG, while the monovalent
F(ab') binds considerably less efficiently.
[0016] More in particular, it was found that the cell line
PER.C6.TM. and derivatives thereof, appear to be very suitable for
the production of bivalent fragments of Ig-molecules and wherein
the monovalent moieties making up the bivalent Ig-molecule fragment
are linked via one or more disulphide bonds. Thus, according to the
invention, an immortalized primary eukaryotic host cell is provided
comprising nucleic acid encoding an immunologically active bivalent
multimeric antibody fragment, and/or a precursor thereof,
functionally linked to sequences capable of driving expression of
the fragments in the host cell when the cell is cultured under
conditions allowing expression. The invention provides a host cell
comprising adenovirus E1 sequences and further comprising
recombinant nucleic acid encoding an immunologically active
bivalent multimeric antibody fragment, and/or a precursor thereof,
functionally linked to one or more sequences capable of driving
expression of the fragment in the host cell. According to one
preferred aspect of the invention, the immunologically active
bivalent multimeric antibody fragment comprises a F(ab').sub.2
fragment. The host cell is preferably a eukaryotic cell, more
preferably, a mammalian cell and, even more preferably, a human
cell. In certain embodiments, a host cell according to the
invention is derived from a retina cell, preferably a retina cell
from a human embryo. In certain embodiments, the host cell is
obtainable from a host cell chosen from the group consisting of 293
and PER.C6.TM. cells or progeny thereof. In the most preferred
aspect of the invention, the host cell provided is obtainable from
a PER.C6.TM. cell. According to a preferred embodiment of the
invention, the host cell comprises a nucleic acid sequence encoding
at least one E1 protein of an adenovirus or a homologue, fragment
and/or derivative thereof, wherein the homologue, fragment and/or
derivative thereof is functional in immortalizing a primary cell
when expressed in the cell. The invention also provides a
PER.C6.TM. cell comprising a nucleic acid encoding a F(ab').sub.2
fragment. In a preferred embodiment of the invention, the sequence
driving expression comprises a region from a CMV promoter and, more
preferably, the region of the CMV promoter comprises the CMV
immediate early gene enhancer/promoter from nucleotide -735 to +95.
In another aspect of the invention, the immunologically active
bivalent multimeric antibody fragment is capable of selectively
binding to activated vitronectin.
[0017] The invention also provides a host cell expressing and
secreting immunologically active bivalent and monovalent antibody
fragments, and/or precursors thereof, characterized in that the
ratio of secreted bivalent active antibody fragment to monovalent
active antibody fragment by the host cell is at least 1:3, wherein
the two antigen-binding regions of the bivalent active antibody
fragment are not linked by peptide bonds.
[0018] The invention also provides a method of making a host cell
capable of producing an immunologically active bivalent multimeric
antibody fragment, the method comprising: introducing into an
immortalized primary eukaryotic cell a nucleic acid sequence
comprising a sequence encoding the antibody fragment or precursor
thereof operably linked to a sequence capable of driving expression
of the sequence encoding the antibody fragments in the cell.
[0019] The invention also provides a method of producing an
immunologically active bivalent antibody fragment, comprising
culturing a host cell according to the invention. In one aspect,
the method further comprises isolating and/or purifying the
immunologically active bivalent antibody fragment.
[0020] The invention further provides a method of producing an
immunologically active bivalent antibody fragment, wherein the two
antigen-binding regions of the immunologically active bivalent
antibody fragment are not linked by a peptide bond, the method
comprising: a) providing a host cell comprising adenovirus E1
sequences, the host cell further comprising a recombinant nucleic
acid sequence comprising a sequence encoding the antibody fragment
or precursor thereof operably linked to a sequence capable of
driving expression of the sequence encoding the antibody fragment
in the host cell; b) culturing the host cell, whereby the antibody
fragment is secreted from the host cell, wherein the ratio of
secretion of immunologically active bivalent to immunologically
active monovalent antibody fragment is at least 1:3.
[0021] The invention also provides a method of producing an
immunologically active bivalent antibody fragment, wherein the two
antigen-binding regions of the immunologically active bivalent
antibody fragment are not linked by a peptide bond, the method
comprising: a) introducing into an immortalized primary eukaryotic
host cell a nucleic acid sequence comprising a sequence encoding
the antibody fragment or precursor thereof operably linked to a
sequence capable of driving expression of the sequence encoding the
antibody fragment in the host cell; b) culturing the host cell,
whereby the antibody fragment is secreted from the host cell,
wherein the ratio of secretion of immunologically active bivalent
to immunologically active monovalent antibody fragments is at least
1:3. According to another aspect of the invention, the method
further comprises: c) isolating and/or purifying the
immunologically active antibody fragment. In the method according
to the invention, the two antigen-binding regions of the
immunologically active bivalent antibody fragment preferably are
linked by one to ten sulphur bridges, more preferably, by one or
two sulphur bridges. In one preferred aspect, the region of the
immunologically active bivalent antibody fragment that is linked by
the sulphur bridges is not derived from an IgG3. In the method
according to the invention, the immunologically active bivalent
antibody fragment preferably comprises a F(ab').sub.2 fragment.
[0022] According to yet another embodiment of the methods according
to the invention, the host cell is a mammalian cell, more
preferably a human cell. In other embodiments, the host cell is
derived from a retina cell. In other embodiments, the host cell is
chosen from 293 and PER.C6.TM.. In the most preferred aspect of the
invention, the host cell is a PER.C6.TM. cell.
[0023] According to other preferred aspects of the invention, the
ratio of secretion of immunologically active bivalent to
immunologically active monovalent antibody fragments is at least
1:1, more preferably, at least 2:1, and still more preferably, at
least 3:1. The host cell according to the method of the invention
preferably comprises a sequence encoding at least one E1 protein of
an adenovirus or a functional homologue, fragment and/or derivative
thereof. In yet another embodiment of the method according to the
invention, an immunologically active bivalent antibody fragment is
capable of selectively binding to activated vitronectin.
[0024] The invention also provides a method for obtaining
F(ab').sub.2 fragments, the method comprising: a) introducing into
a eukaryotic cell a nucleic acid sequence encoding the fragment, or
precursor thereof, operably linked to sequences capable of driving
expression of the sequence encoding the fragment in the cell; b)
culturing the cell, whereby the fragment is secreted from the cell,
wherein the ratio of secretion of F(ab').sub.2 to F(ab') fragments
is at least 1:3; c) isolating and/or purifying the F(ab').sub.2
fragment; characterized in that the method is essentially devoid of
a protease step.
[0025] In one embodiment of the invention, the immunologically
active antibody fragment comprises an amino acid sequence that is
derived from or immunologically similar to an amino acid sequence
for a type of antibody fragment of the species from which the
mammalian cell is obtained or derived. An advantage is that the
produced antibody fragment can be post-translationally modified
according to the modification pattern of the species, thereby
allowing for a type of modification that is similar to the
"natural" situation. Preferably, the species is a human. It has
been observed that, particularly for human and other human-like
species such as monkeys, the ratio of produced (human or
human-like) dimeric versus monomeric antibody fragment is
particularly favorable when the immunologically active antibody
fragment comprises an amino acid sequence that is derived from, or
immunologically similar to, an amino acid sequence for a type of
antibody fragment of the corresponding species.
[0026] The invention also provides a F(ab').sub.2 fragment
obtainable by expression of the fragment in a cell derived from a
PER.C6.TM. cell.
[0027] The invention further provides a crude preparation of an
immunologically active antibody fragment obtainable by methods
according to the invention. In a preferred embodiment of the
invention, the immunologically active antibody fragment comprises a
F(ab').sub.2 and a F(ab') fragment. The invention also provides a
F(ab').sub.2 fragment obtainable by separating a F(ab').sub.2
fragment from F(ab') fragments in the crude preparation. In one
preferred embodiment, such F(ab').sub.2 fragments can selectively
bind to activated vitronectin. The invention also provides a
F(ab').sub.2 fragment that can selectively bind to activated
vitronectin.
[0028] The invention also provides a pharmaceutical composition
comprising an immunologically active antibody fragment according to
the invention.
[0029] The invention also provides a pharmaceutical composition
comprising a F(ab').sub.2 fragment according to the invention and a
pharmaceutically acceptable carrier.
[0030] In another aspect, the invention provides a composition
comprising immunologically active bivalent and monovalent antibody
fragments in a ratio of at least 1:3, wherein the fragments are
produced by a host cell according to the invention. In one
preferred embodiment, the ratio is at least 3:1.
[0031] The invention further provides a composition comprising
immunologically active bivalent and monovalent antibody fragments
in a ratio of at least 1:3, wherein the fragments are obtainable by
a method according to the invention.
[0032] The invention also provides a vector useful in a method
according to the invention, the vector comprising: a) DNA encoding
VH1, CH1 and hinge region of an antibody, comprising introns,
operably linked to a CMV promoter and a bovine growth hormone
polyadenylation signal; b) DNA encoding VL and CL regions of an
antibody, comprising an intron, operably linked to a CMV promoter
and a bovine growth hormone polyadenylation signal, wherein the CMV
promoter comprises nucleotides -735 to +95 from the CMV immediate
early gene enhancer/promoter.
[0033] In a preferred embodiment, the antibody binds to activated
vitronectin.
[0034] The invention also provides a plasmid designated
pcDNA3002(Neo) as deposited under number 01121318 at the ECACC on
Dec. 13, 2001.
DESCRIPTION OF THE FIGURES
[0035] FIG. 1. Intact IgG (left) and F(ab').sub.2 fragment of IgG
(right). Variable regions are pale, constant regions are dark.
Disulphide bonds are marked in black;
[0036] FIG. 2. Expression vectors;
[0037] FIG. 3. Vectors for expression of intact IgG or F(ab').sub.2
fragment of IgG;
[0038] FIG. 4. Reducing SDS-PAGE of cell culture supernatant from
clones producing intact IgG and F(ab').sub.2 fragments:
1 A: clone 243 IgG B: clone 125 IgG C: clone 195 F(ab').sub.2 D:
clone 118 F(ab').sub.2;
[0039] FIG. 5. Gel filtration analysis and non-reducing SDS-PAGE of
purified samples of IgG and F(ab').sub.2 material. Elution times
are indicated above peaks;
[0040] FIG. 6. Additional example of gel filtration of F(ab').sub.2
material. Elution volumes are indicated above peaks; F(ab').sub.2
(72.89 mins) accounts for 76% of material; F(ab') (85.01 mins)
accounts for 22% of material;
[0041] FIG. 7. Antigen binding of intact IgG (clones 243 and 125),
F(ab').sub.2 and F(ab') (clones 118 and 195). F(ab') binds
vitronectin approximately 100 times less efficiently than does IgG
and F(ab').sub.2;
[0042] FIG. 8. Complete DNA sequence encoding the light chain of
the anti-vitronectin IgG1 (this sequence is identical in both
pVN18LcvHcv and pVN18LcvHcvHis);
[0043] FIG. 9. Complete DNA sequence encoding the complete heavy
chain of the anti-vitronectin IgG1; and
[0044] FIG. 10. Complete DNA sequence encoding the truncated
(F(ab').sub.2) heavy chain fragment of anti-vitronectin IgG 1, with
His-tag sequence underlined.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The invention provides a host cell comprising adenovirus E1
sequences and further comprising recombinant nucleic acid encoding
an immunologically active bivalent multimeric antibody fragment,
and/or a precursor thereof, functionally linked to one or more
sequences capable of driving expression of the fragment in the host
cell. Methods of producing an immunologically active bivalent
antibody fragment are also provided comprising culturing a host
cell according to the invention.
[0046] Host Cell, Immortalized Primary Cell
[0047] Host cells for recombinant protein production are known in
the art. In one aspect, the host cell of the invention comprises
adenovirus E1 sequences, preferably by comprising a nucleic acid
sequence encoding at least one E1 protein of an adenovirus or a
homologue, fragment and/or derivative thereof. These may be
functional in immortalizing a primary cell when expressed in the
cell. The E1 protein may comprise the E1A protein that functions in
transforming and immortalizing the host cell. Furthermore, the E1B
protein of adenovirus may be expressed, which can repress apoptosis
of the host cell. In one aspect, therefore, the host cell of the
invention comprises at least part of the E1 region of an
adenovirus, comprising E1A and E1B sequences in expressible
format.
[0048] Immortalized cells are known in the art and can, in
principle, grow indefinitely in contrast to primary cells that will
die after a limited number of cell divisions. Various tumor cell
lines known in the art including, but not limited to, cell lines,
such as Chinese hamster ovary (CHO), HeLa, or baby hamster kidney
(BHK). Hybridoma cell lines including NS0 and Sp2-0 are also
immortalized. A "primary cell," as meant herein, is a cell that is
not derived from a tumor. To be able to grow indefinitely, a
primary cell needs to be immortalized in some way. Immortalization
of primary cells can, for instance, be achieved by introduction of
the E1 region of an adenovirus in expressible form into the cells.
Other possible methods include introduction of human papillomavirus
(HPV) E6 and E7 sequences into the cells, introduction of SV40
T-antigen into the cells, mutation of endogenous p53 of the cells,
transfection with c-myc and a mutant p53 gene in the cells. A
preferred cell line for use as a host cell according to the present
invention, PER.C6.TM., was obtained as described, e.g., in U.S.
Pat. No. 5,994,128. As described in that patent, PER.C6.TM. cells
have been deposited at the ECACC under No. 96022940. Briefly, human
embryonic retinoblasts were immortalized by introduction of the E1
region comprising E1A and E1B of adenovirus, wherein the E1A gene
is driven by the human PGK promoter.
[0049] Immunologically Active
[0050] "Immunologically active," in accordance with the invention,
means capable of selectively binding to an antigen, wherein
selective binding is defined as binding with an affinity (Kd) of at
least 5.times.10.sup.4 liters/mole, more preferably,
5.times.10.sup.5, even more preferably, more than 5.times.10.sup.6,
still more preferably, 5.times.10.sup.7, or more. Typically,
monoclonal antibodies may have affinities which go up to 10.sup.10
liters per mole, or even higher.
[0051] Bivalent Multimeric Antibody Fragment
[0052] IgGs typically have two identical Fab regions, i.e., two
regions that bind antigen, and are, therefore, said to be bivalent.
An "antibody fragment," according to the invention, is meant to
define a molecule that retains the binding function but lacks the
region that mediates the effector functions. Accordingly, antibody
fragments according to the invention lack at least the C-terminal
constant domain of the heavy chain. More preferably, antibody
fragments according to the invention lack both the C-terminal
constant domains of the heavy chain (C2 and C3). A "bivalent
antibody fragment," according to the invention, is a fragment that
comprises two binding regions. Each binding region comprises a
light chain and a heavy chain fragment, which binding region may
exist as a dimer (i.e. the heavy chain fragment and the light chain
are bound to form a dimer) or as a monomer (e.g. in a single chain
format (scFv)). The bivalent antibody fragments according to the
invention are dimeric in the sense that the two binding regions
making up the bivalent antibody fragment are linked to each other,
although not via peptide bonds. The binding regions may dimerize in
different ways, e.g., through one or more cysteine-dependent
S-bridges (sulphur bridges), such as in the hinge regions directly
attached to the C1 region of the two heavy chains. At least two
independent antigen-binding sites may both bind the same or each
may bind different antigens.
[0053] "Monovalent antibody fragments," as meant in the present
invention, have only one antigen-binding site. One non-limiting
example of a monovalent antibody fragment is a F(ab') fragment. The
two binding regions may or may not be identical and may or may not
be monospecific, meaning that both binding regions recognize the
same epitope with the same affinity, whereas the former means it
may recognize the same epitope with different affinity or different
epitopes.
[0054] A "preferred bivalent dimeric antibody fragment," according
to the invention, is a F(ab').sub.2 fragment that consists of two
identical F(ab') fragments attached to each other through the heavy
chain hinge regions by one or usually two sulphur bridges (FIG.
1).
[0055] A Conjugated Antibody Fragment
[0056] The antibody fragments produced may be labeled or conjugated
with any moiety (radio- or fluorescent label, toxin, protein or
other agents) in the same way as intact antibodies may be labeled.
Labeling may also take the form of generation of a fusion protein
in the cell line. Thus, antibody fragments may also be conjugated
to other polypeptides, which conjugates or immunoconjugates are
meant to be included in this invention.
[0057] It is also possible to generate bispecific fragments, with
antigen-binding sites situated either N-terminal or C-terminal to
the hinge region.
[0058] Radiolabels may be used in both imaging and therapy. These
may be alpha particle emitters such as Bismuth212 or Astatine211
that have a very high energy but only a small range, making
bystander effects minimal. Beta particle emitters are more commonly
in use; these include Iodine131, Yttrium90 and Rhenium186, amongst
others. These have a lower particle energy but a greater range,
thus potentially causing bystander cell death in a tumor mass. In
addition, antibodies may be labeled with cytotoxic moieties that
kill the tumor cell upon internalization. An antibody linked to a
bacterial toxin, calicheamicin, is currently on the market
(Mylotarg; Carter, 2001). Other toxic moieties include
maytansinoids (TAPs; ImmunoGen), as well as immunoliposomes loaded
with chemotherapeutic agents, amongst others. Cargo may also be any
number of proteins, peptides, drugs or pro-drugs. It may also
consist of a moiety to which a subsequently introduced therapeutic
may bind.
[0059] There is also the potential to generate bispecific
antibodies: one antigen-binding domain can bind a tumor cell, the
other, a cell surface protein of an effector cell, thus inducing
killing of the target cell. Homodimerization of fragments may also
yield proteins with enhanced anti-tumor characteristics.
[0060] Antibody Fragment Precursor
[0061] Proteins can be encoded by precursor proteins that require
peritranslational and/or posttranslational modifications before the
mature protein form is reached. Nucleic acid-encoding precursor
forms of antibody fragments, as well as the encoded precursor
proteins themselves, including, but not limited to, preproteins
containing secretion signals and the like, are included in the
invention. The nucleic acid sequences encoding the fragments of
interest may or may not comprise introns. Similarly, it may be a
cDNA or cDNA-like nucleic acid, or a genomic fragment, or
combinations thereof.
[0062] Sequences Capable of Driving Expression
[0063] To obtain expression of nucleic acid sequences encoding
antibody fragments or precursors thereof, it is well known to those
skilled in the art that sequences capable of driving such
expression have to be functionally (also called operably) linked to
the nucleic acid sequences encoding the antibody fragments or
precursors thereof. "Functionally linked" is meant to describe that
the nucleic acid sequences encoding the antibody fragments or
precursors thereof are linked to the sequences capable of driving
expression such that these sequences can drive expression of the
antibodies or precursors thereof. Functionally linked includes, but
is not limited to, direct linkage. A non-limiting example of
functional linkage is, for instance, found in expression cassettes.
Sequences driving expression may include promoters, enhancers and
the like, and combinations thereof. These should obviously be
capable of functioning in the host cell, thereby driving expression
of the nucleic acid sequences that are functionally linked to them.
Promoters can be constitutive or regulated and can be obtained from
various sources, including viruses, procaryotic or eukaryotic
sources, or artificially designed. These nucleic acid sequences are
obtainable by standard techniques that are well known in the art.
Expression of nucleic acids of interest may be from the natural
promoter or derivative thereof or from an entirely heterologous
promoter. Some well-known and much used promoters comprise
promoters derived from viruses, such as adenovirus, such as the
adenovirus E1A promoter, promoters derived from cytomegalovirus
(CMV), such as the CMV immediate early (1E) promoter, or derived
from eukaryotic cells, such as methallothionein (MT) promoters or
elongation factor 1.alpha. (EF-1.alpha.) promoters. Any promoter or
enhancer/promoter capable of driving expression of the sequence of
interest in the host cell is thus suitable in the invention. In one
preferred embodiment, the sequence capable of driving expression
comprises a region from a CMV promoter, more preferably the region
comprising nucleotides -735 to +95 of the CMV immediate early gene
enhancer/promoter (CMVlong in FIG. 2). This region comprises a very
strong enhancer (Boshart et al, 1985). It was found that this
CMVlong works particularly well, resulting in several fold higher
expression in comparison to the use of the shorter, regular CMV
promoter as present in, e.g., the pcDNA3.1 plasmids
(Invitrogen).
[0064] Culturing a cell is done to enable it to metabolize, grow
and/or divide. This can be accomplished by methods well known to
persons skilled in the art and includes, but is not limited to,
providing nutrients for the cell. The methods comprise growth
adhering to surfaces, growth in suspension, or combinations
thereof. Several culturing conditions can be optimized by methods
well known in the art to optimize protein production yields.
Culturing can be done, for instance, in dishes, roller bottles or
bioreactors, using batch, fed-batch, continuous systems, hollow
fiber or other methods, all meant to be included in the invention.
In order to achieve large-scale (continuous) production of
recombinant proteins through cell culture, it is preferred in the
art to have cells capable of growing in suspension and it is
preferred to have cells capable of being cultured in the absence of
animal- or human-derived serum or animal- or human-derived serum
components. Thus, isolation is easier and safety is enhanced due to
the absence of additional animal or human proteins derived from the
culture medium, while the system is also very reliable as synthetic
media are the best in reproducibility.
[0065] In a preferred embodiment of the invention, an
immunologically active bivalent multimeric antibody fragment is a
F(ab').sub.2 fragment. Expression of such fragments in eukaryotic
cells has thus far been found to be problematic, as mostly F(ab')
fragments were produced in the described systems. We provide here
an immortalized primary eukaryotic host cell that is capable of
expressing such F(ab').sub.2 fragments in a functional manner in
significant amounts.
[0066] Host cells obtainable from mentioned cells are derived from
the mentioned cells, for instance, by introducing nucleic acid
sequences into the mentioned cells. This can be achieved by any
method known in the art to introduce nucleic acid into cells, such
as, transfection, lipofection, electroporation, virus infection,
and the like. The method used for introducing nucleic acid
sequences in cells is not critical for the current invention.
Nucleic acid can be present in the cells extrachromosomally or
stably integrated in the genome of the cells. Cells are capable of
driving expression transiently, but preferably, the cells can drive
expression in a stable manner. Alternatively, expression can be
regulated.
[0067] According to a preferred aspect of the invention, the host
cell provided is a mammalian cell, more preferably, a human cell,
even more preferably, a human cell that is obtainable from the
group consisting of 293 cells and PER.C6.TM. cells. PER.C6.TM. is a
human cell line capable of expressing proteins in a highly
reproducible, upscalable manner, as disclosed in WO 00/63403. This
invention discloses that PER.C6.TM. cells are capable of producing
immunologically active bivalent multimeric antibody fragments when
a nucleic acid encoding such fragments functionally linked to
sequences capable of driving expression of the fragments is present
in the cells. Thus, according to one preferred aspect of the
invention, the host cell is obtainable from a PER.C6.TM. cell.
[0068] The host cells of the present invention can be immortalized
primary cells. Nucleic acid-encoding E1 protein of an adenovirus
can immortalize cells and host cells according to the invention may
be immortalized by the presence of the E1 nucleic acid sequence,
such as is the case, for instance, in PER.C6.TM. cells. Other
embryonic retinal cells, as well as amniocytes that have been
immortalized by E1, can be useful in the present invention.
Transformed human 293 cells (of embryonic kidney origin, cells also
known as HEK293 cells) also have been immortalized by the E1 region
from adenovirus (Graham et al., 1977), but PER.C6.TM. cells behave
better in handling than the 293 cells. PER.C6.TM. cells have been
characterized and documented extensively, while they behave
significantly better in upscaling, suspension growth and growth
factor independence. The fact that PER.C6.TM. cells can be brought
in suspension in a highly reproducible manner, makes it very
suitable for large-scale production.
[0069] Another advantage of the presence of a nucleic acid region
of adenovirus E1, as compared to cells lacking this sequence, is
that adenovirus E1A as a transcriptional activator is known to
enhance transcription from certain promoters, including the CMV IE
enhancer/promoter (Gorman et al., 1989; Olive et al., 1990). Thus,
when the recombinant protein to be expressed is under the control
of the CMV enhancer/promoter, as in one of the preferred
embodiments of the invention, expression levels of the recombinant
protein increase in cells comprising E1A. Therefore, one aspect of
the invention provides host cells comprising a nucleic acid
sequence encoding at least one E1 protein of an adenovirus or a
homologue, fragment and/or derivative thereof functional in
immortalizing a primary eukaryotic cell.
[0070] The immunologically active bivalent multimeric antibody
fragments can bind to any chosen antigen target. Methods to
identify such targets and discover antibodies or antibody fragments
to such targets are well known in the art. As an example, the
present invention discloses production of F(ab').sub.2 fragments
that selectively bind to activated vitronectin.
[0071] Preferably, antibodies or antibody fragments are of human
origin but, of course, antibody fragments or antibodies can be of
other origins as well.
[0072] An immunologically active bivalent antibody fragment,
exemplified by a F(ab').sub.2 fragment, can be produced in several
ways but, as discussed, there is still a need for improved
production methods of F(ab').sub.2 fragments. It would be
particularly useful if eukaryotic host cells and methods for
production of such fragment would be found that are characterized
in improved ratios of produced F(ab').sub.2 fragments over F(ab')
fragments, or generally improved ratios of immunologically active
bivalent over monovalent antibody fragments. Thus, the present
invention provides, for the first time, a host cell expressing and
secreting an immunologically active bivalent and monovalent
antibody fragment and/or precursor thereof, characterized in that
the ratio of secreted bivalent immunologically active antibody
fragment to monovalent immunologically active antibody fragment by
the host cell is at least 3:1, wherein the two antigen-binding
regions of the bivalent active antibody fragment are not linked by
peptide bonds. It will be understood by the skilled person that
higher ratios are preferable. An example where this ratio is even
higher than 3:1 is disclosed in the present invention.
[0073] According to the invention, it was shown that it is possible
to recombinantly produce bivalent multimeric antibody fragments and
monovalent antibody fragments in a ratio of at least 1:3. Use of a
hinge region that is derived from IgG3 in F(ab').sub.2 fragments
has been reported to result in better ratios of F(ab').sub.2 to
F(ab') fragments when compared to a hinge region derived from IgG1
(Leung et al., 1999). This is likely due to the high number of
sulphur bridges (11 potential sulphur bridges) linking the two
antibody-binding regions in an IgG3 hinge. However, increased
numbers of sulphur bridges generally decrease production levels of
the antibody fragments and it is, therefore, preferable to have
fewer sulphur bridges for production on a large scale. This
invention provides for a host cell and methods capable of
expressing immunologically active bivalent and monovalent antibody
fragments, of which the two antigen-binding regions are linked by
only few sulphur bridges, in a much better ratio than achieved with
the host cells and methods described till now.
[0074] Therefore, in another embodiment of the invention, the two
antigen-binding regions of the immunologically active bivalent and
monovalent antibody fragments are linked by one to ten sulphur
bridges, more preferably, by one or two sulphur bridges. According
to one preferred aspect, the immunologically active bivalent
fragments are F(ab').sub.2 fragments.
[0075] Culturing the cells of the invention can be done according
to a variety of ways generally known and described in the art.
Optimization of culturing conditions can be done to improve the
yields of produced antibody fragments and to improve the ratio of
secreted immunologically active bivalent multimeric to monovalent
antibody fragments. Such optimization may include, but is not
limited to, the growth media and additives, culturing temperature,
time of growth and production phases, culture dish or bioreactor
type and volume, and the like.
[0076] Preferably, growth media lacking animal- or human-derived
serum or animal- or human-derived serum components are used, such
as, ExCell 525 (JRH) medium. Defined culture media are highly
controllable and impose less safety issues and high
reproducibility. They also are highly beneficial for downstream
processing steps, when the desired proteins or protein fragments
are to be isolated.
[0077] In a preferred embodiment of the invention, the
immunologically active antibody fragments are isolated and/or
purified. Any step that improves the ratio of the desired product
to any byproducts can be used to achieve this and is meant to be
included in the invention. Many methods are known in the art for
isolating and/or purifying, and some non-limiting examples are
filtration, centrifugation, chromatography, including, for
instance, affinity-chromatography, hydrophobic interaction,
size-fractionation, anion-exchange, cation-exchange, and the like.
In the example, size-fractionation is performed to separate the
F(ab').sub.2 from the F(ab') fragments.
[0078] Immunologically active bivalent antibody fragments,
exemplified by F(ab').sub.2 fragments, can be produced by protease
(e.g. pepsin) digestion of complete antibodies but, as discussed,
this method has several disadvantages. Herein, a method is provided
that is capable of producing large quantities of functional
bivalent antibody fragments without the use of protease steps.
[0079] It is another aspect of the present invention to provide
F(ab').sub.2 fragments obtainable by expression of the fragments in
a cell derived from a PER.C6.TM. cell. Such F(ab').sub.2 fragments
are efficiently obtainable in high amounts.
[0080] According to another aspect of the invention, a crude
preparation of an immunologically active antibody fragment is
provided, obtainable by methods according to the invention. A crude
preparation may include the culture medium used to culture the
cells and any preparation comprising the immunologically active
antibody fragments somewhere in the process of purifying the
desired material. In a preferred embodiment, the immunologically
active antibody fragments comprise F(ab').sub.2 and F(ab')
fragments. In another preferred aspect of the invention, the
F(ab').sub.2 fragments obtainable by separating the F(ab').sub.2
fragments from F(ab') fragments in the crude preparation are
provided. Separation can be done according to any method known in
the art including, but not limited to, size exclusion
chromatography, affinity chromatography, anion- and/or
cation-exchange, centrifugation, or filtration. It will be clear to
the skilled person that separation methods based on mass or size of
the fragments are particularly useful for this purpose.
[0081] Also included as an aspect of the invention, are
pharmaceutical compositions comprising an immunologically active
antibody fragment, preferably a F(ab').sub.2 fragment, according to
the invention. Pharmaceutical compositions may or may not include
carriers for administration of the desired material to humans or
animals. Such carriers may include, but are not limited to, salts,
sugars, proteins, or lipids. The administration of pharmaceutical
compositions may be done in a variety of ways, which are not
critical for the present invention. One non-limiting example for
the use of pharmaceutical compositions according to the present
invention comprises the administration of a F(ab').sub.2 fragment
with a desired specificity in the form of a pharmaceutical
composition to a human for imaging purposes, for instance, to
locate a tumor that is selectively bound by the F(ab').sub.2
fragment. Administration of F(ab').sub.2 fragment producible
according to the invention for therapeutic purposes is also
possible.
[0082] It is another aspect of the invention to provide a vector
useful in a method according to the invention. The vector will
comprise DNA encoding VH1, CH1 and hinge region of an antibody,
optionally comprising introns. VH1 is the variable region of the
heavy chain and CH1 is the first constant region of the heavy chain
as present in a complete IgG. The hinge region is situated just
behind the CH1 region and is generally the part where the two
antigen-binding sites of an antibody are linked via
cysteine-dependent sulphur bridges. The vector also will comprise
DNA encoding the VL and CL regions of an antibody, optionally
comprising an intron. VL and CL are the variable and constant
regions of the light chain, respectively.
[0083] A vector is a DNA sequence capable of replicating in host
cells and can, but need not, be a plasmid, phagemid, phage, yeast
artificial chromosome, and the like. It usually comprises at least
a sequence responsible for replicating the DNA in a host.
Preferably, the vector also comprises selectable marker DNA,
conferring to the host cell in which the vector is present the
ability to grow in the presence of a toxic substrate or in the
absence of an otherwise essential growth factor. Preferably, the
vector comprises replication signals for propagation in a microbial
host so it can easily be obtained in quantities that are practical.
The region comprising DNA encoding VH, CH1 and hinge region (heavy
chain fragment) may be of genomic origin or may be cDNA in which
artificial introns are optionally present. The same holds for the
region comprising DNA encoding VL and CL (light chain fragment).
DNA of the VH, CH and hinge, as well as for VL and CL, should be in
such a constellation that both a heavy and a light chain
transcription product is formed, which upon splicing, can be
translated into functional protein comprising a heavy and a light
chain fragment, respectively. DNA encoding precursors of the
fragments is meant to be included in the invention. The heavy and
light chain fragment-encoding DNA regions preferably encode human
antibody fragments. Other protein-encoding DNA such that an
immunofusion protein is encoded, may or may not be present. DNA
encoding the heavy chain fragment and DNA encoding the light chain
fragment can each be operably linked to a CMV promoter, such that
the CMV promoter is capable of driving transcription of the DNA in
a suitable cell described in the invention. The CMV promoter is a
strong promoter useful for driving expression of recombinant
proteins to high levels, for instance, as described in U.S. Pat.
No. 5,186,062. The CMV promoter as used herein comprises
nucleotides -735 to +95 of the major immediate early gene
enhancer/promoter, wherein the nucleotides are numbered relative to
the transcriptional start site. This region comprises the enhancer
and promoter of the CMV immediate early promoter and the person
skilled in the art may make substitutions, insertions and/or
deletions in this region, test the promoter for usefulness
according to methods known in the art, and use such a mutated CMV
enhancer/promoter according to the invention without departing from
the scope of the invention. The use of this promoter further has
the advantage that E1 sequences as present in host cells according
to the invention can augment transcription rates from this
promoter. Furthermore, both DNA encoding the heavy chain fragment
and the light chain fragment can be operably linked to a
polyadenylation signal, preferably from the bovine growth hormone
gene. Such a signal is useful for conferring good polyadenylation
of the transcripts, resulting in better translation and, hence, in
higher recombinant product yields (e.g., as disclosed in U.S. Pat.
No. 5,122,458). In the present invention, an example has been
reduced to practice where the antibody fragments encoded by the
vector can form F(ab').sub.2 fragments that selectively bind to
activated vitronectin. As known to the skilled person, the VH and
VL regions of the vector can encode any VH and VL region, which
determine the antigen specificity of the resulting antibody
fragments.
[0084] Methods to obtain DNA sequences encoding VH and VL
comprising regions of interest are known to those in the art. These
include, but are not limited to, obtaining such DNA from hybridoma
cells or, for instance, by phage display. The fragments can then be
cloned by standard techniques, either directly or via extra steps
into the vector of the invention. The vector provided in the
invention is particularly useful for use in the host cells of the
invention, as it was found that it can give rise to high expression
levels of the desired proteins.
[0085] The invention also provides a plasmid useful for expression
of recombinant proteins in host cells in general, plasmid
pcDNA3002(Neo) FIG. 2, deposited on December 13, 2001, at the
European Collection of Cell Cultures (ECACC) under number 01121318.
This plasmid has been found to be particularly useful for
expression of multiple proteins and dimeric proteins, including
immunoglobulins and fragments thereof, in the host cells of the
invention. The DNA encoding the protein(s) or fragments of interest
can be cloned behind the CMVlong promoters in this plasmid by
standard techniques well known to persons skilled in the art.
[0086] To illustrate the invention, the following examples are
provided, although not intended to limit the scope of the
invention. DNA encoding a complete antibody, as well as the
antibody fragments constituting a F(ab').sub.2 fragment directed
against activatedvitronectin, were cloned and expressed in
PER.C6.TM. cells. Expression was shown and, after purification, the
vitronectin-binding activity of the resulting proteins was
demonstrated.
EXAMPLE 1
Construction of Expression Vectors
[0087] An expression plasmid was generated that encodes both the
light and heavy chains of an IgG1 antibody that recognizes
activated vitronectin (as disclosed in EP 1130099). The DNA
encoding the antigen-binding region of this antibody was first
isolated from a scFv phage display library and a leader sequence
and constant regions were added prior to cloning into the
expression vector pcDNA3002(Neo) (FIG. 2). The expression vector
pcDNA3002(Neo) was deposited on Dec. 13, 2001, at the European
Collection of Cell Cultures (ECACC) under number 01121318. The
resulting plasmid is pVN18LcvHcv (FIG. 3), which was deposited on
Dec. 13, 2001, at the ECACC under number 01121320. In addition, a
plasmid was constructed that contains an intact light chain and a
heavy chain truncated immediately after the last translated codon
of the hinge region. This was followed by a sequence encoding a 6
Histidine tag and then a stop codon. This plasmid, pVN18LcvHcvHis,
can express a F(ab').sub.2 fragment (FIG. 3) and was deposited on
Dec. 13, 2001, at the ECACC under number 01121319. An additional
plasmid has also been generated for F(ab').sub.2 production that
does not contain a sequence encoding a His-tag. Procedures were
performed essentially as described in Sambrook and Russell,
2001.
[0088] Generation of pVN18LcvHcv and pVN18LcvHcvHis
[0089] Variable regions of the light and heavy chains of the
anti-vitronectin antibody were isolated from a phage display
library. These were separately cloned into vectors while also
adding leader (signal) sequences at the N-termini and constant
regions at the C-termini of the two chains, resulting in plasmids
VL VN18 and VH VN18 comprising the light and heavy chains,
respectively. The light chain of the anti-vitronectin IgG is a
kappa type of chain. This will be present in both expression
plasmids and so was inserted first into pcDNA3002 (Neo). Plasmid VL
VN18 was used as a template for PCR of the kappa light chain and to
include convenient restriction sites (for general molecular cloning
procedures, see, e.g., Sambrook and Russel, 2001).
[0090] Oligo E001: CCTGGCGCGCCACCATGGCATGCCCTGGCTTCCTGTGG (SEQ ID
NO:1).
[0091] This is homologous to the start of the translated sequence.
The start codon is in bold; the Kozak sequence is underlined; the
AscI site used for cloning is in italics.
[0092] Oligo E002: CCGGGTTAACTAACACTCTCCCCTGTTGAAGC (SEQ ID
NO:2).
[0093] This is homologous to the non-coding strand at the end of
the translated sequence. The stop codon is in bold; the HpaI site
used for cloning is in italics.
[0094] Using these oligonucleotides, the light chain was amplified
using Pwo polymerase as a 1.3 kb fragment, digested with AscI and
HpaI and ligated into pcDNA3002(Neo) digested with the same
enzymes. The resulting plasmid is pVN18Lcv (not shown).
[0095] Two forms of the heavy chain were then inserted into this
plasmid to generate either the intact IgG1 molecule or the
F(ab').sub.2 fragment. Plasmid VH VN18 was used as a template for
PCR amplification.
[0096] For production of the intact IgG1, the following
oligonucleotides were used:
[0097] E003: GGAGGATCCGCCACCATGGCATGCCCTGGCTTCCTGTGG (SEQ ID
NO:3).
[0098] This is homologous to the start of the translated sequence.
The start codon is in bold; the Kozak sequence is underlined; the
BamHI site used for cloning is in italics.
[0099] E004: GGATGGCTAGCTCATTTACCCGGAGACAGGGAGAG (SEQ ID NO:4).
[0100] This is homologous to the non-coding strand at the end of
the translated sequence. The stop codon is in bold; the NheI site
used for cloning is in italics.
[0101] Using these oligonucleotides, the heavy chain was amplified
using Pwo polymerase as a 2.2 kb fragment, digested with BamHI and
NheI and ligated into pVN18Lcv digested with the same enzymes. The
resulting plasmid is pVN18LcvHcv.
[0102] For generation of the His-tagged F(ab').sub.2 fragment, the
following oligonucleotides were used to PCR the heavy chain
fragment from VH VN 18:
[0103] E003: GGAGGATCCGCCACCATGGCATGCCCTGGCTTCCTGTGG (SEQ ID
NO:3).
[0104] This is homologous to the start of the translated sequence.
The start codon is in bold; the Kozak sequence is underlined; the
BamHI site used for cloning is in italics.
[0105] E005: GGATGGCTA GCTCAATGGTGATGGTGATGATGTGGGCACGGT
GGGCATGTGTGAGTT (SEQ ID NO:5).
[0106] This is homologous to the non-coding strand at the end of
the translated sequence. The stop codon is in bold; the NheI site
used for cloning is in italics and the sequence coding for six
histidine residues forming the His-tag is underlined. Thus, the
amino acid sequence at the terminus of the heavy chain is:
GluProLysSerCysAspLysThrHisThrCysProPro
CysProHisHisHisHisHisHisStop (SEQ ID NO:6).
[0107] Using these oligonucleotides, the heavy chain fragment was
amplified from plasmid VH VN18 as a 1.3 kb fragment using Pwo
polymerase, digested with BamHI and NheI and ligated into pVN18Lcv
digested with the same enzymes. The resulting plasmid is
pVN18LcvHcvHis.
[0108] The sequences of the antibody-encoding regions are shown in
FIGS. 8-10.
EXAMPLE 2
Transfection of PER.C6.TM. Cell Lines and Production of
F(ab').sub.2 Fragments
[0109] Cells were transfected with either pVN18LcvHcv or
pVN18LcvHcvHis by a lipofectamine-based method. In brief,
PER.C6.TM. cells were seeded at 3.5.times.10.sup.6 cells per 96 mm
tissue culture dish. For each dish, 2 .mu.g plasmid DNA was mixed
with 10 .mu.l lipofectamine (Gibco); this was added to the cells in
serum-free DMEM medium (total volume 7 ml) and incubated for 5
hours. This was then replaced with complete medium. The following
day (and for the ensuing 3 weeks), cells were grown in DMEM in the
presence of 0.5 mg/ml Geneticin (G418) to select for clones that
were stably transfected with the plasmid. Clones secreting high
levels of monoclonal into the cell culture supernatant were
selected by an ELISA assay. In brief, wells of a 96-well plate were
coated with antibody raised against Ig kappa light chain. After
blocking with a milk solution, samples were added to wells at
varying dilutions and incubated for 1 hour. After washing,
detection antibody (biotin-labeled anti-IgG) was applied for 30
minutes. After a further washing step, this was detected by
addition of streptavidin-horse radish peroxidase, followed by a
final wash and addition of substrate O-phenylene diamine
dihydrochloride. Antibody concentration was determined by comparing
optical density at 492 nm with that of a known antibody
standard.
[0110] The top producing clones from each transfection (IgG or
F(ab').sub.2) were selected for further analysis. These were:
[0111] Intact IgG: clones 125 and 243
[0112] F(ab').sub.2: clones 118 and 195
[0113] Production of antibody is performed in serum-free medium.
Thus, the adherent cells in tissue culture flasks were washed with
PBS, then ExCell 525 medium (JRH) was added and the cells incubated
further for 4 days to allow secreted antibody to accumulate in the
cell culture medium. A sample of the medium was electrophoresed on
reducing SDS-PAGE (FIG. 4). The heavy and light chains that
comprise the intact, secreted antibody are the predominant protein
species. The truncated heavy chain of the F(ab').sub.2 fragment is
present at a lower concentration than either the light chain or the
intact heavy chain of IgG. The material was then purified: intact
IgG was purified over a Protein A column and F(ab').sub.2 fragments
over a Protein L column (Protein L binds kappa light chains).
Purified material was dialyzed into PBS and then analyzed by gel
filtration on a HiLoad 16/60 Superdex 200 column. The results of
the gel filtration for clone 243 (intact IgG) and 118
(F(ab').sub.2) are shown in FIG. 5. The results are identical to
those seen for clone 125 (IgG) and clone 195 (F(ab').sub.2) for
which data is not shown. Intact IgG runs as a single peak with
elution time 67.18 (as expected for a protein of 150 kDa). The
F(ab').sub.2 fragment runs as two main peaks; elution times suggest
that the first is F(ab').sub.2 and the second is F(ab'). This was
confirmed by electrophoresis over non-reducing SDS-PAGE (FIG.
5).
[0114] Subsequent purifications indicated that the ratio of
F(ab').sub.2:F(ab') is often better. This is shown in FIG. 6, again
for clone 118, where the percentage of F(ab').sub.2 and F(ab') are
76% and 22%, respectively. Similar results were also obtained with
the constructs lacking a His-tag.
[0115] The efficiency of binding to antigen was determined for
intact IgG, F(ab').sub.2 and F(ab'). The antibody described above
was raised against activated vitronectin, thus, vitronectin was
purified in this form (Yatohgo et al., 1988) and bound to the wells
of a 96-well plate. Upon an ELISA analysis, the IgG and
F(ab').sub.2 material from two different clones bound equally
efficiently, whereas the F(ab') material bound the vitronectin
approximately 100-fold less efficiently FIG. 7). This indicates
that the F(ab').sub.2 produced by this method does indeed bind
antigen with equal avidity as the intact divalent IgG.
REFERENCES
[0116] Behr T., Becker W., Hannappel E., Goldenberg D. M., Wolf F.
(1995). Targeting of liver metastases of colorectal cancer with
IgG, F(ab').sub.2, and F(ab') anti-carcinoembryonic antigen
antibodies labeled with 99 mTc: the role of metabolism and
kinetics. Cancer Res. 55 (23 Suppl.), 5777s-5785s.
[0117] Borrebaeck C. A. K. and Carlsson R. (2001). Human
therapeutic antibodies. Curr. Op. Pharmacol. 1, 404-408.
[0118] Boshart W., Weber F., Jahn G., Dorsch-Hasler K.,
Fleckenstein B., Schaffner W. (1985). A very strong enhancer is
located upstream of an immediate early gene of human
cytomegalovirus. Cell 41, 521-530.
[0119] Carter P. (2001). Improving the efficacy of antibody-based
cancer therapies. Nature Reviews: Cancer 1, 118-129.
[0120] De Sutter K., Feys V., Van de Voorde A., Fiers W. (1992).
Production of functionally active murine and murine::human chimeric
F(ab').sub.2 fragments in COS-1 cells. Gene 113, 223-30.
[0121] George A. J. T. and Urch C. E. (2000). Diagnostic and
therapeutic antibodies. Pub. Humana Press.
[0122] Gorman C. M., Gies D., McCray G., Huang M. (1989). The human
cytomegalovirus major immediate early promoter can be
transactivated by adenovirus early proteins. Virology 171,
377-385.
[0123] Graham F. L., Smiley J., Russell W. C., Nairn R. (1977).
Characteristics of a human cell line transformed by DNA from
adenovirus type 5. J. Gen. Virol. 36, 59-72.
[0124] Humphreys D. P., Vetterlein O. M., Chapman A, P., King D.
J., Antoniw P., Suitters A. J., Reeks D. G., Parton T. A. H., King
L. M., Smith B. J., Lang V. and Stephens P. E. (1998). F(ab').sub.2
molecules made from Escherichia coli produced F(ab') with hinge
sequences conferring increased serum survival in an animal model.
J. Imm. Methods 217, 1-10.
[0125] King D. J., Adair J. R., Angal S., Low D. C., Proudfoot K.
A., Lloyd J. C., Bodmer M. W., Yarranton G. T. (1992). Expression,
purification and characterization of a mouse-human chimeric
antibody and chimeric F(ab') fragment. Biochem. J. 281, 317-23.
[0126] King D. J., Turner A., Farnsworth A. P., Adair J. R., Owens
R. J., Pedley R. B., Baldock D., Proudfoot K. A., Lawson A. D.,
Beeley N. R., et al. (1994). Improved tumor targeting with
chemically cross-linked recombinant antibody fragments. Cancer Res.
154, 6176-85.
[0127] Leung S., Qu Z., Hansen H., Shih L., Wang J., Losman M.,
Goldenberg D., Sharkey R. (1999). The effects of domain deletion,
glycosylation, and long IgG3 hinge on the biodistribution and serum
stability properties of a humanized IgG1 immunoglobulin, hLL2, and
its fragments. Clinical Cancer Research vol. 5, 3106s-3117s.
[0128] Olive D. M., Al-Mulla W., Simsek M., Zarban S., al-Nakib W.
(1990). The human cytomegalovirus immediate early enhancer-promoter
is responsive to activation by the adenovirus-5 13S E1A gene. Arch.
Virol. 112, 67-80.
[0129] Park J. W. and Smolen J. (2001). Monoclonal antibody
therapy. Adv. Prot. Chem. 56, 369-421.
[0130] Sambrook J. and Russell D. W. (2001). Molecular cloning: a
laboratory manual. Pub. Cold Spring Harbor Laboratory Press.
[0131] Tutt A. L., French R. R., Illidge T. M., Honeychurch J.,
McBride H. M., Penfold C. A., Fearon D. T., Parkhouse R. M. E.,
Klaus G. G. B. and Glennie M. J. (1998). Monoclonal antibody
therapy of B cell lymphoma: signaling activity on tumor cells
appears more important than recruitment of effectors. J. Immunol.
161, 3176-3185.
[0132] Willuda J., Kubetzko S., Waibel R., Schubiger P. A.,
Zangemeister-Wittke U., Pluckthun A. (2001). Tumor targeting of
mono-, di-, and tetravalent anti-A185(HER-2) miniantibodies
multimerized by self-associating peptides. J. Biol. Chem. 276,
14385-92.
[0133] Yokota T., Milenic D. E., Whitlow M., Schlom J. (1992).
Rapid tumor penetration of a single-chain Fv and comparison with
other immunoglobulin forms. Cancer Res. 52, 3402-3408.
[0134] Zapata G., Ridgway J. B., Mordenti J., Osaka G., Wong W. L.,
Bennett G. L., Carter P. (1995). Engineering linear F(ab').sub.2
fragments for efficient production in Escherichia coli and enhanced
antiproliferative activity. Protein Eng. 8, 1057-6.sub.2.
Sequence CWU 1
1
9 1 38 DNA Artificial Sequence Oligo E001 1 cctggcgcgc caccatggca
tgccctggct tcctgtgg 38 2 32 DNA Artificial Sequence Oligo E002 2
ccgggttaac taacactctc ccctgttgaa gc 32 3 39 DNA Artificial Sequence
Oligo E003 3 ggaggatccg ccaccatggc atgccctggc ttcctgtgg 39 4 35 DNA
Artificial Sequence Oligo E004 4 ggatggctag ctcatttacc cggagacagg
gagag 35 5 57 DNA Artificial Sequence Oligo E005 5 ggatggctag
ctcaatggtg atggtgatga tgtgggcacg gtgggcatgt gtgagtt 57 6 21 PRT
Artificial Sequence amino acid sequence at the terminus of the
heavy chain 6 Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro
Cys Pro His 1 5 10 15 His His His His His 20 7 910 DNA Artificial
Sequence Light chain of anti-vitronectin IgG1 7 atggcatgcc
ctggcttcct gtgggcactt gtgatctcca cctgtcttga attttccatg 60
gctgaaattg agctcaccca gtctccatcc tccctgtctg catctgtagg agacagagtc
120 accatcactt gccgggcaag tcagagcatt agcagctatt taaattggta
tcagcagaaa 180 ccagggaaag cccctaagct cctgatctat gctgcatcca
gtttacaaag tggggtccca 240 tcaaggttca gtggcagtgg atctgggaca
gatttcactc tcaccatcag cagtctgcaa 300 cctgaagatt ttgcaactta
ctactgtcag cagaggaggg ctatgcctac gaagttcggc 360 ggagggacca
aggtggagat caaacgtaag tgcactttgc ggccgctagg aagaaactca 420
aaacatcaag attttaaata cgcttcttgg tctccttgct ataattatct gggataagca
480 tgctgttttc tgtctgtccc taacatgccc tgtgattatc cgcaaacaac
acacccaagg 540 gcagaacttt gttacttaaa caccatcctg tttgcttctt
tcctcaggaa ctgtggctgc 600 accatctgtc ttcatcttcc cgccatctga
tgagcagttg aaatctggaa ctgcctctgt 660 tgtgtgcctg ctgaataact
tctatcccag agaggccaaa gtacagtgga aggtggataa 720 cgccctccaa
tcgggtaact cccaggagag tgtcacagag caggacagca aggacagcac 780
ctacagcctc agcagcaccc tgacgctgag caaagcagac tacgagaaac acaaagtcta
840 cgcctgcgaa gtcacccatc agggcctgag ctcgcccgtc acaaagagct
tcaacagggg 900 agagtgttag 910 8 2143 DNA Artificial Sequence
Complete heavy chain of anti-vitronectin IgG1 8 atggcatgcc
ctggcttcct gtgggcactt gtgatctcca cctgtcttga attttccatg 60
gccgaggtgc agctggtgga gtctggggga ggcttggtac agcctggggg gtccctgaga
120 ctctcctgtg cagcctctgg attcaccttt agcagctatg ccatgagctg
ggtccgccag 180 gctccaggga aggggctgga gtgggtctca gctattagtg
gcagtggtgg tagcacatac 240 tacgcagact ccgtgaaggg ccggttcacc
atctccagag acaattccaa gaacacgctg 300 tatctgcaaa tgaacagcct
gagggccgag gacacggccg tgtattactg tgcaagagac 360 gaccggccta
gggagttgga ctcctggggc caaggtaccc tggtcaccgt ctcgacaggt 420
gagtgcggcc gcgagcccag acactggacg ctgaacctcg cggacagtta agaacccagg
480 ggcctctgcg ccctgggccc agctctgtcc cacaccgcgg tcacatggca
ccacctctct 540 tgcagcctcc accaagggcc catcggtctt ccccctggca
ccctcctcca agagcacctc 600 tgggggcaca gcggccctgg gctgcctggt
caaggactac ttccccgaac cggtgacggt 660 gtcgtggaac tcaggcgccc
tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc 720 ctcaggactc
tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca 780
gacctacatc tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agagagttgg
840 tgagaggcca gcacagggag ggagggtgtc tgctggaagc caggctcagc
gctcctgcct 900 ggacgcatcc cggctatgca gtcccagtcc agggcagcaa
ggcaggcccc gtctgcctct 960 tcacccggag gcctctgccc gccccactca
tgctcaggga gagggtcttc tggctttttc 1020 cccaggctct gggcaggcac
aggctaggtg cccctaaccc aggccctgca cacaaagggg 1080 caggtgctgg
gctcagacct gccaagagcc atatccggga ggaccctgcc cctgacctaa 1140
gcccacccca aaggccaaac tctccactcc ctcagctcgg acaccttctc tcctcccaga
1200 ttccagtaac tcccaatctt ctctctgcag agcccaaatc ttgtgacaaa
actcacacat 1260 gcccaccgtg cccaggtaag ccagcccagg cctcgccctc
cagctcaagg cgggacaggt 1320 gccctagagt agcctgcatc cagggacagg
ccccagccgg gtgctgacac gtccacctcc 1380 atctcttcct cagcacctga
actcctgggg ggaccgtcag tcttcctctt ccccccaaaa 1440 cccaaggaca
ccctcatgat ctcccggacc cctgaggtca catgcgtggt ggtggacgtg 1500
agccacgaag accctgaggt caagttcaac tggtacgtgg acggcgtgga ggtgcataat
1560 gccaagacaa agccgcggga ggagcagtac aacagcacgt accgtgtggt
cagcgtcctc 1620 accgtcctgc accaggactg gctgaatggc aaggagtaca
agtgcaaggt ctccaacaaa 1680 gccctcccag cccccatcga gaaaaccatc
tccaaagcca aaggtgggac ccgtggggtg 1740 cgagggccac atggacagag
gccggctcgg cccaccctct gccctgagag tgaccgctgt 1800 accaacctct
gtccctacag ggcagccccg agaaccacag gtgtacaccc tgcccccatc 1860
ccgggaggag atgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc
1920 cagcgacatc gccgtggagt gggagagcaa tgggcagccg gagaacaact
acaagaccac 1980 gcctcccgtg ctggactccg acggctcctt cttcctctat
agcaagctca ccgtggacaa 2040 gagcaggtgg cagcagggga acgtcttctc
atgctccgtg atgcatgagg ctctgcacaa 2100 ccactacacg cagaagagcc
tctccctgtc cccgggtaaa tga 2143 9 1295 DNA Artificial Sequence
Truncated heavy chain of anti-vitronectin IgG1 with His-tag
sequence 9 atggcatgcc ctggcttcct gtgggcactt gtgatctcca cctgtcttga
attttccatg 60 gccgaggtgc agctggtgga gtctggggga ggcttggtac
agcctggggg gtccctgaga 120 ctctcctgtg cagcctctgg attcaccttt
agcagctatg ccatgagctg ggtccgccag 180 gctccaggga aggggctgga
gtgggtctca gctattagtg gcagtggtgg tagcacatac 240 tacgcagact
ccgtgaaggg ccggttcacc atctccagag acaattccaa gaacacgctg 300
tatctgcaaa tgaacagcct gagggccgag gacacggccg tgtattactg tgcaagagac
360 gaccggccta gggagttgga ctcctggggc caaggtaccc tggtcaccgt
ctcgacaggt 420 gagtgcggcc gcgagcccag acactggacg ctgaacctcg
cggacagtta agaacccagg 480 ggcctctgcg ccctgggccc agctctgtcc
cacaccgcgg tcacatggca ccacctctct 540 tgcagcctcc accaagggcc
catcggtctt ccccctggca ccctcctcca agagcacctc 600 tgggggcaca
gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt 660
gtcgtggaac tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc
720 ctcaggactc tactccctca gcagcgtggt gaccgtgccc tccagcagct
tgggcaccca 780 gacctacatc tgcaacgtga atcacaagcc cagcaacacc
aaggtggaca agagagttgg 840 tgagaggcca gcacagggag ggagggtgtc
tgctggaagc caggctcagc gctcctgcct 900 ggacgcatcc cggctatgca
gtcccagtcc agggcagcaa ggcaggcccc gtctgcctct 960 tcacccggag
gcctctgccc gccccactca tgctcaggga gagggtcttc tggctttttc 1020
cccaggctct gggcaggcac aggctaggtg cccctaaccc aggccctgca cacaaagggg
1080 caggtgctgg gctcagacct gccaagagcc atatccggga ggaccctgcc
cctgacctaa 1140 gcccacccca aaggccaaac tctccactcc ctcagctcgg
acaccttctc tcctcccaga 1200 ttccagtaac tcccaatctt ctctctgcag
agcccaaatc ttgtgacaaa actcacacat 1260 gcccaccgtg cccacatcat
caccatcacc attga 1295
* * * * *