U.S. patent application number 10/486608 was filed with the patent office on 2005-02-24 for antigen binding domains.
Invention is credited to Dooley, Helen, Flajnik, Martin, Porter, Andrew.
Application Number | 20050043519 10/486608 |
Document ID | / |
Family ID | 26246430 |
Filed Date | 2005-02-24 |
United States Patent
Application |
20050043519 |
Kind Code |
A1 |
Dooley, Helen ; et
al. |
February 24, 2005 |
Antigen binding domains
Abstract
A process for the production of an antigen specific antigen
binding domain using a transformed host containing an expressible
DNA sequence encoding the antigen specific antigen binding domain,
wherein the antigen specific antigen binding domain is derived from
a variable region of the immunoglobulin isotype NAR found in
fish.
Inventors: |
Dooley, Helen; (Baltimore,
MD) ; Porter, Andrew; (Blairs Aberdeen, GB) ;
Flajnik, Martin; (Baltimore, MD) |
Correspondence
Address: |
LICATLA & TYRRELL P.C.
66 E. MAIN STREET
MARLTON
NJ
08053
US
|
Family ID: |
26246430 |
Appl. No.: |
10/486608 |
Filed: |
September 1, 2004 |
PCT Filed: |
August 12, 2002 |
PCT NO: |
PCT/GB02/03714 |
Current U.S.
Class: |
530/388.4 ;
435/320.1; 435/326; 435/69.1; 536/23.53 |
Current CPC
Class: |
C07K 2317/565 20130101;
C07K 16/40 20130101; C07K 2317/20 20130101; C07K 16/005 20130101;
A61P 43/00 20180101; A61P 37/02 20180101; C07K 2317/56 20130101;
C07K 2317/569 20130101 |
Class at
Publication: |
530/388.4 ;
435/069.1; 435/320.1; 435/326; 536/023.53 |
International
Class: |
C07K 016/18; C07H
021/04; C12N 001/21 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 10, 2001 |
GB |
0119553.6 |
May 8, 2002 |
GB |
0210508.8 |
Claims
1. A process for the production of an antigen specific antigen
binding domain using a transformed host containing an expressible
DNA sequence encoding the antigen specific antigen binding domain,
wherein the antigen specific antigen binding domain is derived from
a variable region of the immunoglobulin isotype NAR found in a
species of Elasmobranchii subclass.
2. A process according to claim 1 wherein the transformed host is a
prokaryote or a lower eukaryote.
3. A process according to claim 2 wherein the prokaryote host is
Escherichia coli.
4. A process according to claim 1 wherein the expressible DNA
sequence is in the form of a phagemid vector.
5. A process according to claim 1 wherein the species of
Elasmobranchii subclass is a shark or a dog fish.
6. A process according to claim 5 wherein the shark is a nurse
shark.
7. A process according to claim 1 wherein the antigen specific
antigen binding domain has a specific specificity.
8. A process according to claim 1 wherein the antigen specific
antigen binding domain is monoclonal.
9. A process according to claim 7 wherein the specificity of the
antigen specific antigen binding domain is determined by an antigen
which is introduced into the chosen fish.
10. A process for the production of an antigen specific antigen
binding domain comprising the steps of: a) immunising a member of
the Elasmobranchii subclass with an antigen; b) isolating
lymphocytes from the member; c) isolating RNA from the lymphocytes;
d) amplifying DNA sequences encoding the antigen specific antigen
binding domain by PCR; e) cloning the amplified DNA into a display
vector; f) transforming a host to produce a library; g) selecting
the desired clones from the library; h) isolating and purifying the
antigen specific antigen binding domain from these clones; i)
cloning the DNA sequences encoding the antigen specific antigen
binding domain into an expression vector; j) transforming a host to
allow expression of the expression vector.
11. A process according to claim 10 wherein before step d) the cDNA
of the antigen specific antigen binding domain is generated.
12. A process according to claim 10 wherein restriction enzymes are
used to digest the amplified DNA sequences encoding the antigen
specific antigen binding domain.
13. A process according to claim 12 wherein the restriction enzymes
are NcoI and NotI.
14. A process according to claim 10 wherein the display vector is
any phagemid vector.
15. A process according to claim 14 wherein the display vector is
pHEN2.
16. A process according to claim 10 wherein the expression vector
is a soluble expression vector.
17. A process according to claim 16 wherein the soluble expression
vector is pIMS100.
18. An antigen specific antigen binding domain produced by the
process in claim 1.
19. A composition for the inhibition of protein activity comprising
antigen specific antigen binding domains derived from a variable
region of the immunoglobulin isotype NAR found in a species of
Elasmobranchii subclass.
20. A composition according to claim 19, wherein the antigen
specific antigen binding domain is produced by the process in claim
1.
21. A composition according to claim 19 whereby inhibition of
protein activity is in a concentration dependent manner.
22. A composition according to claim 19, contained in a
pharmaceutical carrier or diluent therefor.
23. An antigen specific antigen binding domain produced from a
variable region of NAR.
Description
[0001] The present invention relates to the production of antigen
specific antigen binding domains (single domain antibodies) from
fish, where the term fish encompasses both cartilaginous (subclass
Elasmobranchii) and bony fish(class Osteichthyes). By antigen
specific antigen binding domains we mean the variable region of a
Novel Antigen Receptor (NAR).
[0002] Antibodies, especially monoclonal antibodies, are useful in,
among other things, molecular diagnostics and therapeutics because
of their high affinity binding and specificity. However, although
it is now relatively simple to produce monoclonal antibodies using
animal models the production of human monoclonal antibodies remains
difficult. As will be appreciated, when monoclonal antibodies from
non-human models are introduced into humans, the body mounts an
immune response because the monoclonal antibody is foreign to the
human system.
[0003] Recently, it has been appreciated that the activity of the
monoclonal antibody can be retained while reducing the rejection
thereof in humans by producing single domain antibodies (sda) from
the variable chain of the relevant antibody. European patent
application number 89311731.7 discloses such single domain
antibodies and methods for the production thereof in mice.
[0004] Single domain antibodies are also important as they can
penetrate tissues taking with them any linked compounds. In
addition, they can bind within cavities on the surface of proteins,
for example within enzyme binding sites thus disrupting
function.
[0005] Single domain antibodies produced from Camelidae have been
shown to recognize protein cavities and as such have the ability to
inhibit enzymes (Lauwereys et al., EMBO 17 pp3512-3520 1998).
[0006] Although the small size of single domain antibodies produced
from Camelidae has allowed the recognition of protein cavities and
inhibition of enzyme activity, the range of possible targets may
still be relatively low, since many protein cavities may still be
too small to be penetrable by single domain antibodies derived from
Camelidae.
[0007] WO94/25591 and European patent application number 99200439.0
relate to the production of single domain antibodies from Camelidae
heavy chain antibodies. Single domain antibodies produced from
Camelidae heavy chain antibodies are more stable than mouse single
domain antibodies and can be produced in larger quantities.
However, as will be appreciated if, even the smaller members of the
Camelidae family, for example llama, are to be kept in humane
conditions they require significant areas of land to live upon.
[0008] An object of the present invention is to provide a process
for the production of antigen specific antigen binding domains
which seeks to alleviate the above problems.
[0009] A further object of the present invention is to provide a
composition comprising antigen specific antigen binding domains for
the inhibition of protein activity which seeks to alleviate the
above problems.
[0010] According to an aspect of the present invention there is
provided a process for the production of an antigen specific
antigen binding domain, using a transformed host containing an
expressible DNA sequence encoding the antigen specific antigen
binding domain, wherein the antigen specific antigen binding domain
is derived from a variable region of NAR found in fish.
[0011] It has been found that antigen specific antigen binding
domains produced from the variable region of NAR found in fish are
as stable as single domain antibodies produced from members of the
Camelidae family.
[0012] Further many more fish can be kept per unit area than
members of the Camelidae family.
[0013] The immunoglobulin isotype now known as NAR (Novel Antigen
Receptor), was discovered in the serum of the nurse shark
(Ginglymostoma cirratum) as a homodimeric heavy chain complex,
naturally lacking light chains (Greenberg et al., Nature 374
pp168-173 1995). However, before the present work by the inventors
identification of NAR as an antigen binding domain was not fully
appreciated neither was its ability to be raised against a specific
antigen.
[0014] Only mammals (humans, mice, rabbits, sheep, camels, llamas,
etc.) and some birds (chickens) were believed to be capable of
something approaching a secondary immune response such as affinity
maturation, antibody class switching etc. as a response to the
presence of foreign antigen. For example, teleost fish (bony),
which are much more advanced evolutionary than sharks, appear to
rely solely upon the production of a low affinity, non-specific IgM
type response (Watts et al., Aust Vet J 79 pp570-574 2001). A
defining characteristic of teleost IgM is their low affinity and
ability to non-specifically bind multiple antigens. IgM
neutralisation is through non-specific multiple binding, resulting
mainly in agglutination, etc. Neutralisation without complement is
usually associated with specific, high affinity binding and had not
until this invention been seen in fish species. The antigen
specific antigen binding domains of the present invention have been
shown to neutralise activity of an enzyme immunogen directly
without calling upon other components of the immune system.
[0015] The NAR variable (V) region conforms to the model of typical
Ig superfamily domains with the predicted canonical, intradomain
disulphide bond. However, whilst camelid VHH regions have up to 75%
sequence identity with other mammalian VH regions, the identity
between NAR V and conventional VH domains is as low as 25% (Roux et
al., Proceedings of the National Academy of Sciences. USA 95
pp11804-11809 1998).
[0016] Due to this low identity and lack of NAR sequences in the
Kabat database, the amino acids of NAR V regions have previously
been numbered sequentially (Roux et al., Proceedings of the
National Academy of Sciences. USA 95 pp11804-11809 1998). To enable
easy comparison of residues in different NAR V molecules, or NAR V
region sequences with those of other species during this work, a
numbering system was derived for NAR V region based upon that of
Kabat et al., (1991) (Sequences of Proteins of immunological
Interest, 5.sup.th Edition. National Institutes of Health,
Betheseda, USA). (Note: this numbering system is used in the
Figures attached hereto).
[0017] Immediately apparent from the alignment is the deletion of a
large portion of CDR2 (residues 54-65) giving the NAR V region its
characteristically small size (see, for example, FIG. 2A).
[0018] Initial sequence analysis allowed the classification of NAR
V domains into two closely related classes (type I or II), both
being constructed from one V, three D and one J segment. Type I
regions have non-canonical cys residues in Fr2 (C35) and Fr4
(C103), which likely form a domain-stabilising disulphide bond. In
longer NAR CDR3 loops additional cysteine residue pairs have been
observed and almost certainly form disulphide bridges within the
CDR, as is found in some cattle VH domains with an unusually long
CDR3.
[0019] Type II regions are very similar in overall structure to
type I but instead have non-canonical cysteine residues located in
Fr1 (C29) and CDR3, which are proposed to form a constraining
disulphide bond like that observed in camelid VHH domains. The
presence of cysteines within each NAR type is shown in schematic
form in FIG. 1.
[0020] Recently, an additional NAR type has been identified as the
predominant expressed form in nurse shark pups (Type III) but due
to its germline joined state displays no junctional diversity.
[0021] In type I and II NAR the DNA encoding the V region is
generated by the physical joining of DNA segments which are
spatially separate in the genome. This joining process occurs in
B-cells and helps generate the diversity of sequence seen for these
NAR types. For type III these DNA segments are already physically
joined in the DNA of all cells, hence the term germline joined.
[0022] NAR possesses the cluster type genomic organisation usually
observed for Ig receptors in cartilaginous fish, but less than five
NAR loci are thought to exist, with only two or three being capable
of functional rearrangement and expression. The diversity observed
in the primary repertoire is generated through recombination
mechanisms and, although extensive (due to the presence of three D
segments), is localised to CDR3. On encounter with antigen this
repertoire is rapidly expanded by extensive mutation. The pattern
of mutation in NAR is unlike that observed in shark IgM, which
shows low levels of mutation and poor clustering to CDRs, but
rather bears the hallmarks of mammalian-like somatic mutation.
[0023] It has recently been found that NAR V is similar to VH, VL
and TCR V but distinct from all three, hence its "unique domain
architecture". The VH name has been used in the past because the
constant portion of NAR is a heavy chain but the V region is
actually more like VL/TCR V than VH (i.e. groups closer on a
phylogenetic tree). NAR V is not like the camel VHH domains which
are derived from bona fide heavy chain V regions. The antigen
binding domain of the NAR is closer to a VL domain naturally
lacking VH rather than the other way round.
[0024] The sequence alignment of NAR V and camel VHH clearly shows
the huge difference in sequence. If NAR V and camel VHH have the
same physical structure (which has been implied but not proven)
they achieve this using completely different amino acid sequences,
and one would not be able to amplify a NAR V region library using
camel VHH library primers. In addition, the ways in which the NAR V
and camel VHH gene repertoires are created during VDJ joining are
different due to the organisation of the immunoglobulin genes
(Schluter et al Immunol Today 18 pp543-549 1997).
[0025] Preferably the transformed host is a prokaryote or a lower
eukaryote.
[0026] There are many established prokaryote and lower eukaryote
hosts. These hosts are known to correctly express foreign
proteins.
[0027] Conveniently the prokaryote host is Escherichia coli.
[0028] In preferred embodiments the expressible DNA sequence is in
the form of a phagemid vector.
[0029] Phagemid expression has advantages over phage genome
expression in that it results in greater genetic stability and the
bacterial transformation efficiency is higher thus enabling the
construction of potentially larger and more diverse libraries.
[0030] To display antibody fragments on phage the gene encoding the
variable region of the antibody can be fused to that of a phage
surface protein, usually gene III or VIII. Gene III fusion is
favoured due to its limited copy number (3-5 copies) on the tip of
each phage, minimising possible avidity effects which are
undesirable when trying to isolate binders of high affinity. The
antibody fragment genes can be cloned directly into the phage
genome or fused to gene segments present within phagemid
plasmids.
[0031] Preferably the fish is a member of the Elasmobranchii
subclass, for example, a shark or a dogfish.
[0032] A greater number of smaller members of the Elasmobranchii
subclass can be kept in tanks which are smaller in unit area than
the grazing area required for the same number of members of the
Camelidae family. As the members of the Elasmobranchii subclass are
kept in tanks they can easily be caught for extraction of their
blood.
[0033] Conveniently the shark is a nurse shark, Ginglymostoma
cirratum.
[0034] Preferably the antigen specific antigen binding domain has a
specific specificity. Accordingly, the antigen specific antigen
binding domain can be targeted to a specific antigen(s).
[0035] Conveniently the antigen specific antigen binding domain is
monoclonal. In this connection, the antigen specific antigen
binding domain is raised to a single antigen.
[0036] In preferred embodiments the specificity of the antigen
specific antigen binding domain is determined by an antigen which
is introduced into the chosen fish.
[0037] According to a further aspect of the present invention there
is provided a process for the production of an antigen specific
antigen binding domain comprising the steps of:
[0038] a) immunising a fish with an antigen;
[0039] b) isolating lymphocytes from the fish;
[0040] c) isolating RNA for an antigen specific antigen binding
domain from the lymphocytes;
[0041] d) amplifying DNA sequences encoding the antigen specific
antigen binding domain by PCR;
[0042] e) cloning the amplified DNA into a display vector;
[0043] f) transforming a host to produce a library;
[0044] g) selecting the desired clones from the library;
[0045] h) isolating and purifying the antigen specific antigen
binding domain from these clones;
[0046] i) cloning the DNA sequences encoding the antigen specific
antigen binding domain into an expression vector;
[0047] j) transforming a host to allow expression of the expression
vector.
[0048] Screening of displayed libraries for specific binding sites
involves repeated cycles of selection with the desired antigen in
the process of biopanning. Generally during selection, the library
of phage displayed antigen binding domains is incubated with
immobilised antigen, unbound phage are washed out and bound phage
eluted. This selected population is expanded by bacterial infection
and put through further rounds of selection. As each phage
encapsulates the DNA encoding the V region it displays, there is a
functional linking of genotype and phenotype, reminiscent of
membrane bound immunoglobulin on the surface of B-cells. Such
cyclic panning has thus proven able to enrich for clones of high
affinity, much like in vivo antibody selection.
[0049] Preferably before step d) the cDNA of the antigen binding
domains is generated.
[0050] Conveniently restriction enzymes are used to digest the
amplified DNA sequences encoding the antigen specific antigen
binding domain. The restrictions enzymes can be chosen depending
upon, for example, the handle of the primers used in the above
process.
[0051] In preferred embodiments the restriction enzymes are NcoI
and NotI.
[0052] Conveniently the display vector is any phagemid vector, for
example, pHEN2.
[0053] Preferably the expression vector is a soluble expression
vector such as pIMS100.
[0054] The above vectors are merely examples of the vectors which
can be used. It is common general knowledge to those skilled in the
art which vectors can be used.
[0055] According to a further aspect of the present invention there
is provided an antigen specific antigen binding domain produced by
the process as defined above.
[0056] According to a yet further aspect of the present invention
there is provided a composition for the inhibition of protein
activity comprising antigen specific antigen binding domains
derived from a variable region of the immunoglobulin isotype NAR
found in fish.
[0057] Despite the fact that the NAR V region is 12 kDa which is
20% smaller than any 15 kDa single domain antibody derived from
Camelidae, it was still possible to alter protein activity
therewith. Size is a significant factor in the therapeutic
applications of antigen specific antigen binding domains and other
single domain antibodies, with therapeutic benefits of increased
tissue penetration, better access to protein clefts for
neutralisation via steric hindrance and reduced immunogenicity,
resulting from the use of antigen specific antigen binding domains
of the present invention.
[0058] Antigen specific antigen binding domains derived from NAR
therefore have a wider target population than single domain
antibodies derived from Camelidae by virtue of their smaller size.
The potential for immunogenicity is also reduced since in general
the smaller the size of a protein the less the immunogenicity.
[0059] Furthermore, although NAR sequences have, in work previous
to that of the inventors, been identified at the DNA level, there
has been no clue from the DNA evidence that a somatically maturable
repertoire, capable of selecting high affinity, specific binders
could be a characteristic of the NAR response. Hence, it is
unexpected to be able to generate an NAR library of antigen binding
domains derived from sharks and the selection from this of specific
and functional antigen specific antigen binding domains and their
corresponding receptor genes. Sequencing of these genes confirms
that an atypical (for fish and organisms of this evolutionary
lineage) somatically-maturable (showing mutation from the germ line
repertoire) response occurs within the NAR repertoire, driven by
the immunisation process. This has resulted in the selection of
highly specific, high affinity antigen binding domains capable of
antigen neutralisation in isolation and not the expected
non-specific, low affinity IgM like response typically found in
fish and sharks.
[0060] Further still, the inventors have been able to isolate NAR
antigen specific antigen binding domains and demonstrate for the
first time that the NAR V is able to fold and function in isolation
from the rest of the molecule (and in a non-shark environment),
that the antigen specific antigen binding domain matures from the
germ line genes to become specific for antigen (only possible with
a library derived from mRNA and not DNA) and that the antigen
specific antigen binding domain is able to bind specifically to the
immunising antigen. In summary, as described below, the inventors
have been able to immunize a shark and derive from this
immunization a specific, somatically matured antigen specific
antigen binding domain that is of high affinity and specific for
the immunogen. In addition, the antigen specific antigen binding
domain is able to neutralise the activity of the immunogen
directly, without calling upon other components of the immune
system. According to previous understandings, this should not have
been possible for a primitive species such as sharks.
[0061] Conveniently, a composition is provided wherein the antigen
specific antigen binding domain is a product of the process as
defined above.
[0062] Preferably inhibition of protein activity is in a
concentration dependent manner.
[0063] Preferably, the composition further comprises a
pharmaceutical carrier or diluent therefor.
[0064] Such pharmaceutical carriers are well known in the art.
[0065] According to a further aspect of the present invention,
there is provided an antigen specific antigen binding domain
produced from a variable region of NAR.
[0066] The invention will now be described, by way of illustrate on
only, with reference to the following examples and the accompanying
figures.
[0067] FIG. 1 shows the presence of cysteine amino acid residues
within each NAR type, and human, cattle and camel variable regions
for comparison. Canonical cysteines are shown by and non-canonical
cysteines are shown by .
[0068] FIGS. 2A, 2B and 2C show the amino acid translations of the
sequences obtained in the Examples (SEQ ID. 1 to 51). The sequences
are aligned against a typical type I and type II clone sequence
(top of each Figure with CDR's highlighted in bold) dashes indicate
identity to the type I clone and * indicates an in-frame stop
codon.
[0069] FIG. 3 shows NAR type I and II variable region amino acid
sequence alignment (SEQ 1 and 2). Germline sequence is given for
type I, whilst that given for type II is typical of those observed
from somatically mutated cDNA sequences (Roux et al., Proceedings
of the National Academy of Sciences. USA 95 pp11804-11809 1998).
Sequence identity is indicated by a dash and the CDR's of both
sequences are in bold. The numbering above the sequences was
generated by comparison of conserved residues (underlined) with
those of other species and is used to enable comparison of NAR V
region sequences.
[0070] FIG. 4 shows a variability plot for the 29 immune library
sequences identified in the Example (pre-selection and functional).
Variability at each position was calculated according to the method
of Wu & Kabat (1970) (Journal of Experimental Medicine 132
pp211-250). The canonical cysteine residues, C22 and 92, are marked
by an asterisk.
[0071] FIGS. 5A and B show polyclonal and monoclonal phage ELISA
results for selection on Hen egg white lysozyme (HEL) (FIG. 5A) and
Chicken ovalbumin (Ova) (FIG. 5B). Phage numbers were normalised
for each pan prior to polyclonal analysis.
[0072] Data presented is a mean of triplicate wells and
representative of at least three assays. Monoclonal results are
percentages obtained from 96 clones for each pan.
[0073] FIG. 6 shows the DNA (SEQ ID. 53 & 54) and encoded amino
acid sequence (SEQ ID. 52) of the .alpha.-HEL 5A7 clone. CDRs are
highlighted in bold.
[0074] FIG. 7 shows the DNA (SEQ ID. 56 & 57) and encoded amino
acid sequence (SEQ ID. 55) of the .alpha.-HEL 4F11 clone. CDRs are
highlighted in bold.
[0075] FIG. 8 shows the amino acid alignment of the two .alpha.-HEL
clones, 5A7 (SEQ ID. 52) and 4F11 (SEQ ID. 55), with a typical type
I clone (SEQ ID. 1). Sequences are numbered according to FIG. 3 for
ease of comparison, differences between the selected clones are
highlighted in underlined and CDR's are highlighted in bold, *
conserved residues in all sequences, : conserved substitutions, .
semi-conserved substitutions.
[0076] FIG. 9 shows the DNA (SEQ ID. 59 & 60) and encoded amino
acid sequence (SEQ ID. 58) of the .alpha.-Ova 4H11 clone. CDRs are
highlighted in bold.
[0077] FIG. 10 shows the DNA (SEQ ID. 62 & 63) and encoded
amino acid sequence (SEQ ID. 61) of the .alpha.-Ova 3E4 clone. CDRs
are highlighted in bold.
[0078] FIG. 11 shows amino acid alignment of the two .alpha.-Ova
clones, 4H11 (SEQ ID. 58) and 3E4 (SEQ ID. 61), with a typical type
I clone (SEQ ID. 1). Sequences are numbered according to FIG. 3 for
ease of comparison, differences between the selected clones are
underlined and the CDR's are highlighted in bold. * conserved
residues in all sequences, : conserved substitutions, .
semi-conserved substitutions.
[0079] FIG. 12 shows binding analysis of .alpha.-HEL clone 5A7.
Serial dilutions of crude periplasmic release solution were applied
to an ELISA plate coated with each of the test proteins at 10
.mu.g/ml and blocked with Marvel. Data presented is a mean of
triplicate wells and representative of at least three repeat
assays.
[0080] FIG. 13 shows binding analysis of .alpha.-HEL clone 4F11.
Serial dilutions of crude periplasmic release solution were applied
to an ELISA plate coated with each of the test proteins at 10
.mu.g/ml and blocked with Marvel. Data presented is a mean of
triplicate wells and representative of at least three repeat
assays.
[0081] FIG. 14 shows binding analysis of .alpha.-Ova clone 4H11.
Serial dilutions of crude periplasmic release solution were applied
to an ELISA plate coated with each of the test proteins at 10
.mu.g/ml and blocked with Marvel. Data presented is a mean of
triplicate wells and representative of at least three repeat
assays.
[0082] FIG. 15 shows a comparison of the stability of the anti-HEL
clones 5A7 and 4F11 to irreversible thermal denaturation. Data
presented is a mean of triplicate wells and representative of at
least three repeat assays.
[0083] FIG. 16 shows a lysozyme enzymatic inhibition assay.
Purified HEL-5A7 NAR V region protein at a final concentration of
2500 nM (filled circle), 250 nM (open triangle) or 25 nM (filled
square) were pre-incubated with HEL prior to the introduction of M.
lysodeikticus bacterium. The control wells (open diamond) contained
buffer in place of HEL-5A7 protein. The data presented is an
average of 3 replicates and a typical data set from three repeat
experiments.
EXAMPLE
[0084] Bacterial Strains
[0085] The electroporation-competent strain E. coli XL1-Blue {recA1
endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F' proAB lacI.sup.q
Z.DELTA.M15 Tn10 (Tet.sup.r)]} (Stratagene Ltd.) was used to
prepare and pan the NAR V region phage display libraries.
[0086] PCR Materials
[0087] All custom oligonucleotides used throughout this work were
ordered from Sigma-Genosys Ltd., and were desalted and/or HPLC
purified. Library primer sequences were as follows (all 5' to
3'):
[0088] NAR F4 For1 ATA ATC AAG CTT GCG GCC GCA TTC ACA GTC ACG ACA
GTG CCA CCT C (SEQ ID. 64)
[0089] NAR F4 For2 ATA ATC AAG CTT GCG GCC GCA TTC ACA GTC ACG GCA
GTG CCA TCT C (SEQ ID. 65)
[0090] NAR F1 Rev ATA ATA AGG AAT TCC ATG GCT CGA GTG GAC CAA ACA
CCG (SEQ ID. 66)
[0091] All PCR reactions were performed on a Hybaid PCR sprint
block in Hybaid 0.2 ml thin-walled omnitubes.
[0092] Construction of NAR V Region Libraries for Phage Display
[0093] RNA Preparation
[0094] To enable production of the immune library, three nurse
sharks were immunised five times with Hen egg-white lysozyme (HEL)
(over a period of approximately 8 months). Blood samples were taken
from each shark following each immunisation, peripheral blood
lymphocytes isolated, and total RNA prepared for each bleed. The
RNA from bleeds 4 and 5 for each of the three sharks was pooled and
stored at -80.degree. C. until required for cDNA synthesis.
[0095] cDNA Synthesis and PCR Amplification
[0096] For cDNA synthesis, ready-to-go RT-PCR beads (200 .mu.M each
dNTP, 10 mM Tris-HCl buffer, 60 mM KCl, 1.5 mM MgCl.sub.2, M-MuLV
reverse transcriptase, RNAguard7, RNase/DNase free BSA and 2 U Taq
DNA polymerase) (APB Ltd.) were reconstituted in 45 .mu.l of DEPC
treated H.sub.2O by incubating on ice for 5 min or until the beads
were completely dissolved. To each tube 2 .mu.l of nurse shark tRNA
at 2 .mu.g/.mu.l and 2 .mu.l of NAR F4 For primer or F4 For2 primer
at 25 pM/.mu.l were added. Both of these primers are specific for
NAR framework region 4 and have a NotI site incorporated in the
handle to allow subsequent cloning into the phagemid vector. Tubes
were flicked gently to mix contents and incubated on a PCR block
pre-warmed to 46.degree. C. for 30 min. Following cDNA synthesis,
tubes were incubated at 95.degree. C. for 7 min to inactivate the
reverse transcriptase and denature the template.
[0097] To each tube 2 .mu.l of the common primer NAR F1 Rev at 25
pM/.mu.l, containing a NcoI site in its handle was added, tubes
were pre-heated to 95.degree. C. and 1 .mu.l of Taq DNA polymerase
at 1 U/.mu.l added to each prior to cycling 32 times at 95.degree.
C. for 2 min, 55.degree. C. for 1 min and 72.degree. C. for 1 min
30 s.
[0098] Following PCR amplification type I and type II, products
were PAGE purified on a 1.5% gel a strong band was visualised at
approximately 400 bp for both primer sets indicating successful
amplification of the NAR V region.
[0099] Cloning of NAR V Region into the Phagemid Vector pHEN2
[0100] PAGE-purified PCR product was digested with NcoI and NotI
restriction enzymes, at the sites incorporated by the handled
primers used for amplification, to allow cloning into the phagemid
vector pHEN2. Restricted DNA was purified on a 1.5% agarose gel and
the DNA excised and cleaned.
[0101] Plasmid DNA, harvested from an overnight culture of E. coli
XL1-Blue and phenol:chloroform treated, was similarly cut with NcoI
and NotI restriction enzymes. Double-cut vector was purified on a
0.7% agarose gel and DNA extracted. For library construction
digested vector was not treated with calf alkaline phosphatase.
[0102] To enable quantification, 2 .mu.l of suitably digested PCR
product and pHEN2 vector were run on a 1% agarose gel against 2
.mu.l of DNA marker VI (Boehringer Ltd.) and band intensities
evaluated by eye to judge relative amounts of DNA present.
Ligations were performed with equal amounts of vector and insert
DNA in the presence of 2.5 .mu.l of 10.times. ligase buffer and 1
.mu.l of T4 ligase. The final volume was made up to 25 .mu.l with
H.sub.2O and incubated overnight at 15.degree. C. For library
construction 30-40 such ligations were performed.
[0103] Following incubation overnight, ligation products were
pooled, phenol:chloroform cleaned and the resultant DNA pellet
reconstituted in approximately 100 .mu.l of 1:10 dilution of 10 mM
Tris-HCl, pH 8.5. DNA was then ready for transformation into
electroporation-competent cells.
[0104] Transformation of Electroporation-Competent Cells and
Evaluation of the Resultant Library
[0105] Ligated DNA was aliquotted into chilled electroporation
cuvettes and to each 40 .mu.l of freshly thawed
electroporation-competent XL1-Blue cells was added. Cells were
electroporated and resuspended in 100 .mu.l ice-cold 2.times.TY
media with 1% glucose (w/v) added. Dilutions at 10.sup.-2,
10.sup.-4 and 10.sup.-6 were performed for each transformation and
plated on TYE agar containing 100 .mu.g/ml ampicillin and 1-2%
glucose (w/v). The remaining bacterial suspension was plated
straight onto 140 mm petri-dishes containing TYE with ampicillin
and glucose (as above). All plates were grown overnight at
37.degree. C.
[0106] Following incubation overnight, colonies from the dilution
plates were counted to give an estimate of the final library size,
approximately 5.times.10.sup.6 members. Approximately 100
individual colonies were PCR screened using 1 .mu.l each of the
primers LMB3 (5' CAGGAAACAGCTATGAC 3') (SEQ ID.69) and pHEN seq (5'
CTATGCGGCCCCATTCA 3') (SEQ ID. 70) at 25 pM/.mu.l, 1 .mu.l of dNTPs
at 25 pM each, 2 .mu.l of 50 mM MgCl.sub.2, 5 .mu.l of 10.times.Taq
polymerase buffer, 1 .mu.l Taq polymerase (at 1 U/.mu.l) and 39
.mu.l Steripak H.sub.2O. PCR was undertaken as follows; 1 cycle at
95.degree. C. for 3 minutes (to lyse bacteria) and 20 cycles of
95.degree. C. for 1 min, 55.degree. C. for 1 min and 72.degree. C.
for 1 min. PCR product was run on a 1.5% agarose gel containing
EtBr against molecular weight marker VI (Boehringer Ltd.) to
evaluate the percentage of the library carrying NAR V region
insert. Using this method, 75% of the library was observed to be
carrying an insert approximating that expected for the NAR V
region, giving a functional library size of 3.75.times.10.sup.6
members. Fifty clones, established in this way to be carrying
correctly sized inserts, were then sequenced to evaluate library
diversity.
[0107] The encoded amino acid translations of the sequences
obtained are shown in FIGS. 2A, B and C.
[0108] Of the 50 clones sequenced, 6 were found to harbour one or
more stop codons encoded by an in-frame TGA codon within CDR3. In
the case of clones 13 and 19 the stop codon is probably a
consequence of the D3 and D2 segments (respectively) being utilised
in a non-preferred reading frame (Roux et al., Proceedings of the
National Academy of Sciences. USA 95 pp11804-11809 1998). The
reason for the stop codons in the other 5 clones is less distinct
but is likely due to somatic hypermutation within this region.
[0109] A further 15 clones carried frameshift mutations leading to
the production of non-sense or truncated proteins. For the majority
of these clones the frameshift occurred within CDR3, possibly as a
consequence of nucleotide addition or deletion during the
recombination process. For clones 14 and 41 the frameshift mutation
arose within Fr2 (position 41 according to FIG. 3) and Fr3
(position 67) respectively and are more likely due to polymerase
errors during library construction (the frameshift in clone 14
occurs immediately after a long poly-A tract in the DNA
sequence).
[0110] The sequence alignment and the variability plot of the 28
clones encoding functional inserts (FIGS. 2 and 4) show good
diversity, with each clone having a unique amino acid sequence.
Variability is seen to be focussed across CDR3 which, like clones
from a similarly constructed nave library, varied greatly in both
sequence and length. The immune nature of the library is important
as NAR V regions which bound to antigen could not be isolated from
a nave library (ie. without prior immunisation).
[0111] Both NAR types were represented, with approximately 80%
being type I and 20% type II, however a number of clones proved
difficult to assign to an NAR type. For example, clone 33 has a
type II Fr1 but type I CDR3 and Fr4, whilst clones 06, 40 and 46
have a type I Fr1 and CDR3 but a type II Fr2 and Fr4. This finding
suggests the possibility that gene conversion may be occurring
between the NAR genes.
[0112] A number of other clones also show some atypical features
which were not observed with the naive library pre-selection
clones. Clones 24 and 36 are both assigned as type I on the basis
of other sequence characteristics but do not carry the pair of
cysteine residues normally observed in the type I CDR3. The clones
06, 40, 46 and 48 all encode an uneven number of cysteine residues.
As mentioned previously in the case of 06, this may be due to gene
conversion. Very few clones bearing an uneven number of cysteines
have been observed previously and so it is thought that the V
region must be under considerable pressure to maintain an even
number of cysteine residues, enabling formation of disulphide
bonds. The consequence of unpaired cysteines within the NAR V
region is, as yet, unknown but may be detrimental to domain
folding. If this is indeed the case then such clones will probably
be eliminated from the library during early pans due to their
toxicity to the expressing bacteria.
[0113] Clone 02 encodes 4 cysteine residues in its CDR3, giving
this V region a total of 8 cysteine residues and the potential to
form 4 disulphide bonds. Such type I domains carrying 4, or
occasionally 6 or more, cysteine residues have been previously
encountered. The ability to form these additional disulphide bonds,
combined with the small size of the NAR V region, may provide an
additional source for highly stable antibody fragments.
[0114] Colonies, which were not sequenced, were scraped from the
library plates with a sterile spreader into a final volume of 10 ml
2.times.TY medium containing 100 .mu.g/ml ampicillin and 2%
glucose. Cells were combined with sterile glycerol to 20% (v/v),
and following thorough mixing aliquotted as 500 .mu.l shots and
flash-frozen prior to storage at -80.degree. C.
[0115] Panning of NAR V Region Library against Protein Antigens
Growth of the Library
[0116] A single aliquot of library stock was added to 200 ml of
pre-warmed 2.times.TY medium containing ampicillin at 100 .mu.g/ml
and 1-2% glucose (w/v) and grown at 37.degree. C./250 rpm until log
phase (OD.sub.600 of 0.4-0.8) was reached. To a 50 ml sample taken
from the culture approximately 10.sup.15 of M13K07 helper phage
were added and the culture incubated at 37.degree. C. without
shaking to allow infection. Following incubation the culture was
spun at 3.5K rpm/4.degree. C. for 10 min and the cell pellet
re-suspended in 100 ml of 2.times.TY containing 100 .mu.g/ml
ampicillin, 50 .mu.g/ml kanamycin and 0.1-0.25% glucose and
incubated overnight at 30.degree. C./250 rpm to allow library
expression and rescue.
[0117] The overnight culture was spun at 12K rpm/4.degree. C. for
20 min, 80 ml of supernatant was removed and added to 20 ml of
PEG/NaCl, mixed well and incubated on ice for at least 1 h. The
precipitated phage was pelleted at 12K rpm/4.degree. C. and
re-suspended in 2 ml PBS. The phage suspension was spun at 13K rpm
for 10 min to remove any remaining bacterial debris and the phage
supernatant stored at 4.degree. C. The phage stock was titrated by
performing serial dilutions in PBS and the addition of 900 .mu.l of
a log phase culture to 100 .mu.l of each dilution. Following
incubation at 37.degree. C. for 30 min, 100 .mu.l of each dilution
was plated on TYE plates containing ampicillin at 100 .mu.g/ml and
1% glucose and incubated overnight at 37.degree. C. The phage titre
could be estimated by counting the resulting colonies.
[0118] Library Selection
[0119] Nunc Maxisorp Immuno test tubes (Gibco BRL, Life
technologies Ltd.) were coated with either HEL or Ova in 4 ml of
PBS overnight at 4.degree. C. The tube was then washed 3 times with
PBS before being blocked with 2% Marvel in PBS (MPBS) for 2 h at
room temperature, following which it was washed a further 3 times
with PBS. Selection was conducted by incubating the coated
immunotube for 1 h at room temperature with 1 ml of phage stock in
3 ml of 2% MPBS on an over-and-under tumbler. A further hour of
stationary incubation was allowed before the supernatant containing
unbound phage was discarded and bound phage eluted as described
below.
[0120] Elution and Rescue of Antigen-Bound Phage
[0121] Triethylamine Elution
[0122] Binding individuals of the antigen specific antigen binding
domain library, displayed on the phage strain M13K07, were eluted
using the alkali triethylamine.
[0123] Following incubation with phage the immunotube was washed 20
times with PBST, excess liquid drained off and 1 ml of 100 mM
triethylamine added. The tube was then rotated for a maximum of 10
min at room temperature to elute bound phage. Following incubation
the phage solution was neutralized by mixing with 500 .mu.l of 1 M
Tris-HCl. In this state the phage solution was stored at 4.degree.
C. for further use (or long-term at -20.degree. C. if glycerol
added at 15% v/v).
[0124] To 750 .mu.l of the triethylamine-eluted phage 10 ml of a
log phase bacterial culture was added and the culture incubated at
37.degree. C. without shaking for 30 min. Serial dilutions of the
culture were prepared in 2.times.TY and plated on TYE plates
containing 100 .mu.g/ml ampicillin and 2% glucose to allow the
number of rescued phage to be estimated. The remaining infected
culture was spun for 10 min at 13K rpm, re-suspended in 100 .mu.l
of 2.times.TY and plated on a 140 mm petri-dish containing TYE as
above. Plates were grown overnight at 37.degree. C.
[0125] Rescue of Selected Phage
[0126] After overnight growth, colonies were scraped from the large
petri-dishes into 2 ml of 2.times.TY medium with a sterile scraper
and the suspension mixed thoroughly. Following inoculation of 50 ml
2.times.TY containing 100 .mu.g/ml ampicillin and 1-2% glucose with
50 .mu.l of this suspension, 1 ml of the remaining bacteria was
mixed with 15% glycerol (v/v) and stored at -80.degree. C. as a
stock. The 50 ml culture was incubated at 37.degree. C./250 rpm
until the OD.sub.600 reached 0.4, whereupon 15 ml was removed,
added to approximately 10.sup.10 helper phage and incubated for 30
min at 37.degree. C. Following incubation the culture was spun at
3.5 K rpm for 10 min and the resultant cell pellet re-suspended in
2.times.TY containing 100 .mu.g/ml ampicillin, 50 .mu.g/ml
kanamycin and 0.1-0.25% glucose and incubated overnight at
30.degree. C./250 rpm.
[0127] The overnight culture was spun at 12K rpm for 10 min and 40
ml of supernatant added to 10 ml of PEG/NaCl, and mixed well prior
to incubation on ice for at least 1 h. The phage pellet was again
re-suspended in 2 ml of PBS and spun for 10 min at 13K rpm to
remove any remaining bacterial debris and the phage stored at
4.degree. C. for the short term.
[0128] Further rounds of selection were carried out with phage
rescued from the previous round of selection, as above, on antigen
coated immunotubes.
[0129] The immune library was subject to five rounds of panning
against the protein antigens Hen egg white lysozyme (HEL) and
Chicken ovalbumin (Ova), independently, using M13K07 helper phage
and triethylamine elution. A summary of the panning results are
given in Table 1.
[0130] In an attempt to minimize loss of clone diversity in early
rounds of selection the antigen coating density was kept constant
at 100 .mu.g/ml for pans 1 and 2. Following the first round of
panning approximately 10.sup.6 phage were eluted from both the HEL
and Ova coated immunotubes, increasing 10-fold following pan 2. For
pans 3 and 4 the antigen coating density was reduced for each pan
in an attempt to select higher affinity binders. Whilst the number
of phage eluted following HEL selection remained constant at
.about.10.sup.6 for both pans that for Ova selection dropped to
10.sup.3 in pan 3, rising back to 10.sup.6 following pan 4. For pan
5 the antigen coating concentration was further reduced and
selection was accompanied by a significant drop in the number of
phage eluted. Due to this reduction in the number of phage eluted
polyclonal and monoclonal phage ELISAs were conducted to determine
if enrichment of HEL or Ova binders was occurring (FIG. 5).
[0131] The binding of the HEL-selected polyclonal phage showed a
small increase in OD.sub.450 over pans 1 and 2, with a significant
increase following pan 3. A further small increase in signal
followed pan 4, but afterwards pan 5 dropped back to the level
observed for earlier pans. A similar pattern was observed for the
Ova-selected polyclonal phage with the highest binding being
obtained for phage rescued after pan 4, however in this instance
the OD.sub.450 values remain low (below 0.25) for all pans.
[0132] Monoclonal phage ELISAs show an increase in the number of
positive phage for both sets of selection over pans 1 to 4. In the
case of HEL selection this increase was from less than 1% to
approximately 80% following pan 4. For Ova selected clones the
numbers of positives was slightly lower but regardless increased
from less than 1% to approximately 66% after the fourth pan.
Following pan 5 the number of HEL-positive clones remained constant
at 80% but the number of Ova-positive monoclonals dropped back to
the levels observed in earlier pans (.about.10%).
[0133] The drop in the number of clones able to bind Ova after pan
5 indicates that for this pan the protein coating concentration has
been reduced such that the selection is too stringent and the
majority of clones are no longer able to bind. No such drop is
observed for the HEL-selected monoclonal assay, indicating that the
affinity of these clones for their antigen is probably higher. This
shows that the antigen specific antigen binding domains produced by
the sharks are very specific as the sharks were immunised with HEL
and only HEL binders could be isolated, Ova data shows no binders.
For this reason a selection of clones from pans 3 and 4 were
sequenced for Ova but from pans 4 and 5 for HEL.
1 TABLE 1 phage added coating density phage eluted Pan (.phi./ml)
.mu.g/ml (.phi./ml) Anti-Hel selection 1 >10.sup.12 100 105 2
>10.sup.12 100 106 3 >10.sup.12 50 106 4 >10.sup.12 1 106
5 >10.sup.12 0.1 103 Anti-Ova selection 1 >10.sup.12 100 105
2 >10.sup.12 100 106 3 >10.sup.12 50 103 4 >10.sup.12 1
105 5 >10.sup.12 0.1 103
[0134] Selection Analysis
[0135] Polyclonal Phage ELISA
[0136] A 96-well Immulon 4 ELISA plate (Dynatech Laboratories Ltd.)
was coated with 100 .mu.l of antigen at 10 .mu.g/ml for 1 h at
37.degree. C. Following three washes with PBST the wells were
blocked with 300 .mu.l of 2% MPBS (PBS with 2% w/v marvel added)
for a further hour at room temperature of overnight at 4.degree. C.
Wells were washed 3 times with PBST and to individual wells 10
.mu.l of PEG precipitated phage from each pan, in 100 .mu.l of 2%
MPBS, was added and the plate incubated for 1 h at room
temperature. The phage solution was discarded and the plate washed
with PBST 3 times. To each well 100 .mu.l of anti-M13 monoclonal
HRP conjugate (APB Ltd.), diluted 1 in 5000 in PBS, was added and
incubated at room temperature for 1 h. The plate was washed 5 times
with PBST and developed with 100 .mu.l per well of TMB substrate,
the reaction stopped with 50 .mu.l per well of 1 M H.sub.2SO.sub.4
and the plate read at 450 nm.
[0137] Monoclonal Phage ELISA
[0138] Individual colonies growing on TYE plates were picked into
100 .mu.l 2.times.TY medium containing 100 .mu.g/ml ampicillin and
1-2% glucose on a sterile 96-well ELISA plate, for each of the
pans, and grown overnight at 37.degree. C./250 rpm. Following
growth, a 96-well transfer device was used to inoculate a fresh
96-well plate containing 200 .mu.l per well of 2.times.TY with 100
.mu.g/ml ampicillin and 1-2% glucose. Bacteria were grown for 2 h
at 37.degree. C./250 rpm. To the original overnight plate glycerol
was added to give a final concentration of 15% and the plates
stored at -80.degree. C. as a bacterial stock.
[0139] After the two hour incubation 25 .mu.l of 2.times.TY
containing 100 .mu.g/ml ampicillin, 1-2% glucose and 10.sup.10
helper phage were added to each well. The plate was then incubated
for a further hour at 37.degree. C./250 rpm before being spun at 2K
rpm for 10 min to pellet the bacteria. Supernatant was aspirated
from the plate and the resultant pellet re-suspended in 200 .mu.l
2.times.TY containing 100 .mu.g/ml ampicillin, 50 .mu.g/ml
kanamycin and glucose at 0.25% (w/v). The plate was then incubated
overnight at 30.degree. C./250 rpm.
[0140] The overnight plate was spun at 2K rpm for 10 min to give a
supernatant containing monoclonal phage supernatant. To suitably
coated and blocked plates, 50 .mu.l of this phage supernatant in 50
.mu.l of MPBS was added per well and the plate incubated at room
temperature for 1 h. Following incubation the plate was incubated
with anti-M13 HRP conjugated antibody and developed as normal.
[0141] Subcloning and Sequencing of Positive Monoclonal Phage
Clones
[0142] Following determination of individual clones giving a
positive signal for antigen binding, 5 ml of 2.times.TY containing
2% glucose and 100 .mu.g/ml ampicillin was inoculated from the
appropriate clone source. Taking into account the results of the
monoclonal phage ELISAs fifteen HEL-positive clones were picked at
random from pans 4 and 5, whilst those for Ova were picked from
pans 3 and 4. Following overnight incubation of the cultures at
37.degree. C./250 rpm plasmid was prepared as set out above. A 20
.mu.l sample of plasmid was then digested with the restriction
enzymes NcoI and NotI and the .about.400 bp fragment corresponding
to the NAR V region fragment PAGE purified and recovered. Purified
V region fragments were then ligated into similarly cut, alkaline
phosphatase treated and cleaned pIMS100 expression vector.
Following overnight incubation at 15.degree. C. the resultant
vector, harbouring the NAR V insert fused upstream of the HuCk
domain and 6His tail, was transformed into
electroporation-competent E. coli XL1-Blue cells. Colonies were
picked, grown as overnight cultures in 5 ml TB (containing 2%
glucose (v/v), 100 .mu.g/ml ampicillin, 25 .mu.g/ml tetracycline)
and glycerol stocks and plasmid prepared.
[0143] Inserts were sequenced from plasmid using the M13 reverse
(5' TTCACACAGGAAACAG 3') (SEQ ID. 67) and HuCk forward (5'
GAAGATGAAGACAGATGGTGC 3')(SEQ ID. 68) primer. Once sequence data
had been generated the clone was given a unique name to enable
identification.
[0144] On translation only two different sequences were obtained
from the 15 HEL-selected clones and two from the 15 Ova-selected
clones.
[0145] The clones 5A7 and 4F11 were chosen to represent the two
different amino acid sequences found within the HEL-selected
positive clones (FIGS. 6 and 7). The two clones are both
conventional NAR type I, and so are illustrated aligned against a
typical type I clone in FIG. 8. The two clones differ from one
another at only two positions (43 & 44), both lying within Fr2
and carry identical CDR3 regions.
[0146] The clones 4H11 and 3E4 were chosen to represent the two
different amino acid sequences found within the Ova-selected
positive clones (FIGS. 9 and 10). Again these clones were both
conventional NAR type I and as such are shown aligned against a
typical type I clone in FIG. 11. These clones differ at 6 amino
acids; three within Fr1 (positions 13, 14 & 30), two within Fr2
(positions 46 & 47) and one within CDR3 (position 101).
[0147] Expression of Antigen Binding Domains in E. coli
[0148] Large Scale Expression
[0149] A single colony of transformed E. coli was used to inoculate
5 ml LB containing 1% glucose (v/v), 12.5 .mu.g/ml tetracycline and
50 .mu.g/ml ampicillin and grown up at 37.degree. C. /250 rpm
overnight. This culture was used to seed 50 ml TB medium containing
1% glucose (v/v), 12.5 .mu.g/ml tetracycline and 50 .mu.g/ml
ampicillin in 250 ml baffled flasks, at 1% v/v. The 50 ml cultures
were grown over a period of 24 hours at 25.degree. C./250 rpm, with
one change of media after approximately 10 hours growth. Growth of
all the cultures was good with the overnight OD.sub.600 being in
the order of 10-20 OD units.
[0150] Overnight cultures were pelleted at 4 K rpm/4.degree. C. for
20 min. Pellets were resuspended in 50 ml fresh TB containing 50
.mu.g/ml ampicillin and given 1 h at 25.degree. C./250 rpm to
recover before induction with 1.5 mM IPTG for 3.5-4 h and release
of periplasmic contents.
[0151] Periplasmic Burst Release Method
[0152] The cell pellet resulting from centrifugation was
resuspended in 10% of the original culture volume of fractionation
buffer (100 ml 200 mM Tris-HCl, 20% sucrose, pH 7.5, 1 ml 100 mM
EDTA/L of culture). The suspension was incubated on ice with gentle
shaking for 15 min following which an equal volume of ice-cold
sterile H.sub.2O was added and incubation continued for a further
15 min (method modified from French et al., Enzyme & Microbial
Technology 19 pp332-338 1996). The suspension was spun at 13K
rpm/4.degree. C. for 20 min, the supernatant containing the
periplasmic fraction harvested and passed through a 0.22 .mu.m
filter (Sartorius Instruments Ltd.).
[0153] None of the cultures showed any sign of bacterial lysis
during the 4 h induction period and expression yields in the order
of 1 mg crude NAR protein per litre of culture were obtained. In
this example the protein expressed from the four selected clones
was IMAC purified via the 6His tail.
[0154] ELISA Analysis of Antigen Binding Domains
[0155] Antigen Binding ELISA
[0156] An Immulon 4 96-well flat bottomed ELISA plate was coated
with a suitable concentration of the desired antigen at 100 .mu.l
per well and the plate incubated at 37.degree. C. for 1 h. The
plate was washed 3 times with PBST prior to blocking with 200 .mu.l
per well of PBS containing 2% Marvel (w/v) for 1 h at 37.degree. C.
Wells were washed a further three times with PBST before addition
of samples.
[0157] A 1 in 5 dilution of crude periplasmic release solution was
prepared, added to the top wells of the plate at 200 .mu.l per well
and doubling dilutions in PBS performed. Plates were then incubated
at 4.degree. C. for 1 h. Each plate was washed a further 5 times
with PBST. Goat anti-HuCk peroxidase conjugate antibody was diluted
1:1000 in PBS and 100 .mu.l added to wells containing antigen
binding domains. Plates were incubated for 1 h at 4.degree. C. and
following 6 washes with PBST the ELISA was developed as described
previously and the plate read at 450 nm.
[0158] The HEL-selected clone 5A7 (FIG. 12) shows good binding to
HEL at the top dilution applied and as the sample is serially
diluted binding reduces accordingly. Limited binding to the highly
related protein turkey egg-white lysozyme (TEL) is observed at the
highest dilution but no binding is observed to the proteins Chicken
ovalbumin (Ova), Bovine serum albumin (BSA), Keyhole limpet
haemocyanin (KLH) or the blocking agent Marvel. An identical
pattern of protein binding is also observed for the HEL-selected
clone 4F11 (FIG. 13), which is not surprising considering the high
degree of amino acid sequence similarity between these two clones
(111/113 aa identical). The OD.sub.450 signals obtained for 3F11
are slightly higher than those for 5A7, but this may simply be due
to small differences in the amount of protein present in the
samples. The Ova-selected clone 4H11 (FIG. 14) showed no binding to
any of the proteins tested, including Ova, the antigen it was
selected against. To ensure that this was not simply a consequence
of there being too little protein present in the assay, a binding
assay was performed with undiluted periplasmic release solution. In
this instance some binding to all of the proteins was observed for
the wells containing the top dilutions of 4H11 protein. This
binding was immediately lost once the sample was diluted and so is
likely to be non-specific, no doubt resulting from very high
concentrations of protein being present. This data supported the
initial finding that the 4H11 clone does not bind significantly to
Ova. The 3E4 clone, like 4H11, does not show binding to the
proteins HEL, BSA, KLH, TEL or the blocking agent Marvel, however
low level binding is observed for this clone to the selection
antigen Ova. The pattern of binding by this clone to Ova is unusual
in that binding at the highest protein concentration is low and
shows no significant drop on dilution of the sample. When the
protein concentration was increased by repeating the assay with
undiluted periplasmic solution a similar pattern of binding was
observed, thus negating the possibility that the protein
concentration was initially too low. The reason for this unusual
binding is as yet unknown, but may be due to 3E4 binding only with
low affinity to Ova.
[0159] The distinct lack of NAR clones capable of binding antigen
in a library previously constructed from material from a naive
animal and the isolation of HEL-binding, but not Ova-binding
clones, from the library constructed from the HEL immunised animals
illustrates the highly specific nature of the NAR response
following antigen challenge. In other words, antigen specific
antigen binding domains with a specific specificity are
produced.
[0160] Stability Analysis of Selected Clones
[0161] As clones 5A7 and 4F11 were shown to be capable of binding
HEL in the antigen binding ELISA it was possible to test the
stability of these clones to thermal denaturation. Sub-saturating
dilutions of both of the clones, ascertained from the antigen
binding curves, were prepared and incubated at a range of
temperatures for 3 h prior to their addition to a HEL coated ELISA
plate. The samples were then incubated on the ELISA plate for an
hour at 4.degree. C. and binding detected with an anti-HuCk HRP
conjugated antibody. Stability of the antigen binding domains was
plotted as a percentage of that obtained for a control sample which
had not been heat treated (FIG. 15).
[0162] Both clone 5A7 and clone 4F11 show considerable resistance
to irreversible denaturation losing 50% functionality at
approximately 85.degree. C. and retaining approximately 30%
functionality after 3 h at 95.degree. C. This high stability is
probably a consequence of the additional, non-canonical cysteine
residues found within the NAR V domain. Both clones encode 6
cysteine residues and therefore are capable of forming 3
intradomain disulphide bonds, which (if formed) would contribute
greatly to the high stability of these domains. The shape of the
stability curves for both of the clones is almost identical and the
minor difference in stability between the clones may be simply due
to assay variability.
[0163] Repetition of this assay utilising an anti-His HRP
conjugated antibody to detect binding generated values which were
not significantly different to those obtained with the anti-HuCk
secondary antibody, indicating the drop in signal is caused by
reduced binding of the NAR V domains, due to denaturation, and not
simply reduced detection via the HuCk tag.
[0164] Inhibition of Protein Activity
[0165] The ability of HEL-5A7 to inhibit the enzymatic activity of
HEL was tested by mixing 12.5 .mu.l of HEL with 12.5 .mu.l of
purified HEL-5A7 protein in a sterile 96 well tissue culture plate,
to give a final HEL concentration of 10 .mu.g/ml and HEL-5A7
concentrations of 2500 nM, 250 nM and 25 nM. The control well was
set up with buffer replacing HEL-5A7. A sample of freeze dried
Micrococcus lysodeikticus was reconstituted in 0.1 M
phosphate/citrate buffer (pH 5.8) containing 0.09% NaCl, mixed
thoroughly and 175 .mu.l added to the prepared wells. The plate was
read over a period of 30 min (at 1 min intervals) at 450 nm.
Enzymatic activity was plotted as percentage initial absorbance
against time for each sample.
[0166] The introduction of HEL-5A7 protein to the assay reduced the
rate of cell lysis in a concentration dependent manner with respect
to the control (FIG. 16). With HEL-5A7 protein at a final
concentration of 2500 nM the rate of cell lysis
(9.3.times.10.sup.-3 OD units/min) is almost halved when compared
to the control (17.times.10.sup.-3 OD units/min) indicating that
the HEL-5A7 region binds within or adjacent to the lysozyme active
site cavity. A similarly prepared antigen specific antigen binding
domain raised against an unrelated antigen showed no effect upon
the rate of cell lysis when introduced to the assay at the same
concentrations.
[0167] It will be understood that the embodiment illustrated shows
one application of the invention only for the purposes of
illustration. In practice the invention may be applied to many
different configurations, the detailed embodiments being
straightforward for those skilled in the art to implement.
Sequence CWU 1
1
70 1 116 PRT Ginglymostoma cirratum 1 Ala Arg Val Asp Gln Thr Pro
Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn
Cys Val Leu Arg Asp Ala Ser Tyr Gly Leu Gly 20 25 30 Ser Thr Cys
Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile
Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55
60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr
65 70 75 80 Tyr Arg Cys Gly Val Ser Pro Trp Gly Trp Gly Arg Ser Cys
Asp Tyr 85 90 95 Pro Ser Cys Ala Gln Arg Pro Tyr Ala Ala Cys Gly
Asp Gly Thr Ala 100 105 110 Val Thr Val Asn 115 2 114 PRT
Ginglymostoma cirratum 2 Ala Arg Val Asp Gln Thr Pro Gln Glu Ile
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Ser Ile Asn Cys Val Leu
Arg Asp Asp Ser Cys Ala Leu Pro 20 25 30 Ser Thr Tyr Trp Asn Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Thr 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Ser Gly Thr 65 70 75 80
Tyr Arg Cys Lys Val Tyr Arg Lys Asn Trp Ala Tyr Asp Cys Gly Leu 85
90 95 Glu Glu Leu Asp Trp Ile Tyr Val Tyr Gly Gly Gly Thr Val Val
Thr 100 105 110 Val Asn 3 115 PRT Ginglymostoma cirratum 3 Ala Arg
Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15
Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20
25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu
Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser
Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val
Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Ser Thr Trp Cys
Arg Thr Cys Cys Asp Tyr Glu 85 90 95 Thr Gly Leu Cys Ser Ala Tyr
Ala Ala Cys Gly Asp Gly Thr Ala Val 100 105 110 Thr Val Asn 115 4
109 PRT Ginglymostoma cirratum 4 Ala Arg Val Asp Gln Thr Pro Arg
Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys
Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp
Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser
Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60
Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65
70 75 80 Tyr Arg Cys Gly Gly Ser Trp Glu Pro Val Thr Gly Cys Ala
Val Asn 85 90 95 Tyr Ala Ala Cys Gly Asp Gly Thr Ala Val Thr Val
Asn 100 105 5 127 PRT Ginglymostoma cirratum 5 Ala Arg Val Asp Gln
Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr
Ile Asn Cys Val Leu Arg Asp Ala Asn Tyr Ala Leu Gly 20 25 30 Ser
Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40
45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys
50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly
Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Cys Thr Val Met Ser Leu Ile
Phe His Leu Asp 85 90 95 Arg Ile Leu Ser Asn Leu Leu Ser Asn Thr
Asp Asp Leu Ile Asp Cys 100 105 110 Asp Asn Tyr Ala Ala Cys Gly Asp
Gly Thr Ala Val Thr Val Asn 115 120 125 6 111 PRT Ginglymostoma
cirratum 6 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr
Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser
Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly
Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val
Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile
Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly
Glu Pro Leu Val Trp Ser Glu Leu His Ala Cys Ser 85 90 95 Ser Pro
Tyr Ala Ala Cys Gly Asp Gly Thr Ala Val Thr Val Asn 100 105 110 7
112 PRT Ginglymostoma cirratum 7 Ala Arg Val Asp Gln Thr Pro Arg
Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys
Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp
Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser
Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60
Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65
70 75 80 Tyr Arg Cys Gly Leu Asn Pro Thr Leu Leu Leu Leu Cys Ser
Cys Gly 85 90 95 Ser Ser Ile Tyr Ala Ala Cys Gly Asp Gly Thr Ala
Val Thr Val Asn 100 105 110 8 114 PRT Ginglymostoma cirratum 8 Ala
Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10
15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly
20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu
Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn
Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr
Val Ile Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Leu Gln Leu Val
Trp Ile Pro Pro Leu Leu Arg Leu 85 90 95 Gly Gly Ala Leu Pro Tyr
Gly Ala Cys Gly Glu Gly Thr Ala Val Thr 100 105 110 Val Asn 9 103
PRT Ginglymostoma cirratum 9 Ala Arg Val Asp Gln Thr Pro Arg Ser
Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val
Leu Arg Asp Ser Asn Cys Val Phe Ser 20 25 30 Arg Thr Tyr Trp Tyr
Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Asn 35 40 45 Ile Ser Lys
Gly Gly Arg Trp Ser Ile Cys Asn Asn Pro His Gln Arg 50 55 60 Ile
Lys Val Leu Phe Phe Gly Asn Gly Ser Met Ser Arg Lys Cys His 65 70
75 80 Val Ser Met Arg Gly Arg Tyr Thr Pro Glu Asp Asn Asn Leu Gly
Asp 85 90 95 Gly Thr Ala Val Thr Val Asn 100 10 111 PRT
Ginglymostoma cirratum 10 Ala Arg Val Asp Gln Thr Pro Gln Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Thr Glu Thr Tyr Ser Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Pro Gly Ile Ala Gly Gly Ser Gly Cys Ala Leu 85
90 95 Leu Thr Leu Cys Cys Met Arg Arg Trp His Cys Arg Thr Val Asn
100 105 110 11 105 PRT Ginglymostoma cirratum 11 Ala Arg Val Asp
Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu
Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30
Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35
40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser
Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp
Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Trp Trp Glu Leu Leu Arg
Gly Ala Leu Tyr Met 85 90 95 Leu His Ala Asp Met Ala Leu Pro Leu
100 105 12 116 PRT Ginglymostoma cirratum 12 Ala Arg Val Asp Gln
Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr
Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser
Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40
45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys
50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly
Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Trp Ile Ala Gly Val Asp Tyr
Asp Tyr Ser Leu 85 90 95 Ala Val Leu Leu Ser Ser Thr Ser Met Ala
Met Leu His Ala Glu Met 100 105 110 Ala Leu Pro Leu 115 13 105 PRT
Ginglymostoma cirratum 13 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Glu Ala His Pro Leu Arg Ser Ser Val Thr Thr Met 85
90 95 Leu His Ala Glu Met Ala Leu Pro Leu 100 105 14 114 PRT
Ginglymostoma cirratum 14 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Val Phe Leu Ala Asp Ser Trp Cys Gly Ser Val 85
90 95 Val Thr Ser Cys Ala Leu Pro Pro Met Leu His Ala Glu Met Ala
Leu 100 105 110 Pro Leu 15 104 PRT Ginglymostoma cirratum 15 Ala
Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10
15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly
20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu
Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn
Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr
Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Ile Trp Arg Cys
Ser Leu Cys Leu Gly Cys Met Leu 85 90 95 His Ala Glu Met Ala Leu
Pro Leu 100 16 109 PRT Ginglymostoma cirratum 16 Ala Arg Val Asp
Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu
Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30
Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35
40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser
Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp
Gly Gly Thr 65 70 75 80 Leu Arg Cys Gly Ile Met Val Cys Cys Asp Ser
Phe Gly Ser Val Leu 85 90 95 Tyr Arg Arg Glu Leu His Ala Glu Met
Ala Leu Pro Leu 100 105 17 112 PRT Ginglymostoma cirratum 17 Ala
Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10
15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly
20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu
Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn
Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr
Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Cys Arg Thr
Trp Gly Ser Arg Cys Asp Leu Ala 85 90 95 His Val Leu Leu Gly Cys
Met Arg Arg Trp His Cys Arg Asp Cys Glu 100 105 110 18 105 PRT
Ginglymostoma cirratum 18 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Ala Gly Ile Leu Val Glu Gly Ser Arg Gly Cys Met 85
90 95 Arg Arg Trp His Cys Arg Asp Cys Glu 100 105 19 108 PRT
Ginglymostoma cirratum 19 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Arg Arg Ile Leu Val Trp Met Leu Leu Thr Val 85
90 95 Cys Cys Met Arg Arg Trp His Cys Arg Asp Cys Glu 100 105 20
109 PRT Ginglymostoma cirratum 20 Ala Arg Val Asp Gln Thr Pro Arg
Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys
Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp
Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser
Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60
Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65
70 75 80 Tyr Arg Cys Gly Val Gly Val Trp Ile Cys Asp Glu Thr Leu
Ser Cys 85 90 95 Ala Leu Asp Arg Ala Ala Cys Gly Asp Gly Thr Ala
Leu 100 105 21 108 PRT Ginglymostoma cirratum 21 Ala Arg Val Asp
Gln Thr Pro Lys Thr Ile Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu
Thr Ile Asn Cys Val Leu Ser Asp Thr Ser Cys Ala Trp Asp 20 25 30
Ser Thr Tyr Trp Tyr Arg Lys Lys Leu Asp Ser Thr Asn Glu Glu Ser 35
40 45 Thr Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Glu Ser
Thr 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp
Ser Gly Thr 65 70 75 80 Tyr Arg Cys Arg Ala Tyr Pro Gly Leu Leu Tyr
Cys Gly Tyr His Gly 85 90 95 Ala Leu Ile Trp Arg Trp His Cys Arg
Asp Cys Glu 100 105 22 102 PRT Ginglymostoma cirratum 22 Ala Arg
Val Asp Gln Thr Pro Gln Thr Ile Thr Lys Glu Thr Gly Glu 1
5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ser Asn Cys Ala Leu
Ser 20 25 30 Ser Thr Tyr Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn
Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val
Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu
Thr Val Glu Asp Ser Gly Thr 65 70 75 80 Tyr Arg Cys Lys Val Gly Tyr
Ile Gly Gly Leu Gly Val Met Tyr Thr 85 90 95 Glu Val Ala Leu Ser
Leu 100 23 111 PRT Ginglymostoma cirratum 23 Ala Arg Val Asp Gln
Thr Pro Gln Thr Ile Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr
Ile Tyr Cys Val Leu Gln Asp Ser Ile Cys Gly Leu Ser 20 25 30 Ser
Thr Tyr Trp Tyr Arg Lys Arg Ser Gly Ser Pro Asn Glu Leu Ser 35 40
45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys
50 55 60 Ser Phe Ser Leu Arg Ile Asn Gly Leu Thr Val Leu Asp Ser
Ala Gly 65 70 75 80 Gly Thr Pro Leu Cys Lys Leu Val Pro Asn Gln Leu
Ala Pro Asp Leu 85 90 95 Thr Phe Arg Thr Thr Leu Met Tyr Thr Glu
Met Ala Leu Pro Leu 100 105 110 24 108 PRT Ginglymostoma cirratum
24 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu
1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala
Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ile Gly Leu Asn
Lys Arg Gly Glu 35 40 45 His Ile Glu Arg Trp Thr Ile Cys Asn Ser
Gln Arg Ile Lys Val Val 50 55 60 Leu Phe Phe Glu Asn Ser Asn Ser
Arg Arg Trp His Val Ser Leu Arg 65 70 75 80 Cys Leu Asp Arg Leu Gly
Ala Val Thr Thr Tyr Arg Cys Ala Leu Pro 85 90 95 Arg Gly Met Leu
His Ala Glu Met Ala Leu Pro Leu 100 105 25 109 PRT Ginglymostoma
cirratum 25 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr
Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser
Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly
Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val
Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile
Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly
Val Trp Gly Gln Leu His Val Arg Cys Ala Leu Gly 85 90 95 Asp Ala
Ala Cys Gly Asp Gly Thr Ala Val Thr Val Asn 100 105 26 113 PRT
Ginglymostoma cirratum 26 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Pro Asp Ser Trp Trp Arg Phe Ala Val Val Cys 85
90 95 Ala Leu Glu Pro Asp Ala Ala Cys Gly Asp Gly Thr Ala Val Thr
Val 100 105 110 Asn 27 111 PRT Ginglymostoma cirratum 27 Ala Arg
Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15
Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20
25 30 Ser Thr Tyr Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu
Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser
Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val
Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Cys Pro His Phe
Ser Trp Cys Arg Leu His Glu 85 90 95 Gln Cys Ala Leu Ala Gly Gly
Asp Gly Thr Ala Val Thr Val Asn 100 105 110 28 117 PRT
Ginglymostoma cirratum 28 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn His Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Cys Asp Ser Ser Ile Ala Val Val Ala Gly Cys 85
90 95 Gly Tyr Cys Leu Cys Thr Leu Val His Ser Val Cys Gly Asp Gly
Thr 100 105 110 Ala Val Thr Val Asn 115 29 109 PRT Ginglymostoma
cirratum 29 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr
Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser
Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly
Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val
Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile
Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly
Ala Arg Ala Gly Gly Pro Phe Leu Cys Ser Cys Val 85 90 95 Tyr Ala
Ala Cys Gly Asp Gly Thr Ala Val Thr Val Asn 100 105 30 115 PRT
Ginglymostoma cirratum 30 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Pro Val Gly Arg Ser Cys Asp Tyr Pro Gln Leu 85
90 95 Cys Ser Trp Gly Leu Asn Tyr Ala Ala Cys Gly Asp Gly Thr Ala
Val 100 105 110 Thr Val Asn 115 31 113 PRT Ginglymostoma cirratum
31 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu
1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala
Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Gly
Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr
Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp
Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Ser
Thr Ala Gly Val Asp Cys Asp Tyr Thr Cys 85 90 95 Ala Leu Trp Asp
Tyr Ala Ala Cys Gly Asp Gly Thr Ala Val Thr Val 100 105 110 Asn 32
117 PRT Ginglymostoma cirratum 32 Ala Arg Val Asp Gln Thr Pro Arg
Ser Val Thr Lys Glu Ala Gly Glu 1 5 10 15 Ser Leu Ala Ile Asn Cys
Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp
Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser
Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60
Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65
70 75 80 Tyr Arg Cys Gly Val Ser His Ala Val Ala Gly Gly Val Cys
Asp Tyr 85 90 95 Ser Ser Gly Leu Cys Ser Trp Ser Tyr Ala Ala Cys
Gly Asp Gly Thr 100 105 110 Ala Val Thr Val Asn 115 33 111 PRT
Ginglymostoma cirratum 33 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Ser Trp Ala Tyr Ser Cys Asp Tyr Leu Cys Ser 85
90 95 Asp Glu Tyr Ala Ala Cys Gly Asp Gly Thr Ala Val Thr Val Asn
100 105 110 34 114 PRT Ginglymostoma cirratum 34 Ala Arg Val Asp
Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu
Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30
Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35
40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser
Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp
Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Ser Leu Gly Ala Arg Tyr
Ser Cys Asp Tyr Asn 85 90 95 Pro Cys Ser Ser Gly Tyr Ala Ala Cys
Gly Gly Gly Thr Val Val Thr 100 105 110 Val Asn 35 113 PRT
Ginglymostoma cirratum 35 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Pro Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Arg Ile Phe Leu Tyr Ser Cys Asp Tyr Ala Cys 85
90 95 Ala Leu Asp Gly Tyr Ala Ala Cys Gly Asp Gly Thr Ala Val Thr
Val 100 105 110 Asn 36 113 PRT Ginglymostoma cirratum 36 Ala Arg
Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15
Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20
25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu
Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser
Gly Ser Lys 50 55 60 Ser Phe Ser Leu Thr Ile Asn Asp Leu Thr Val
Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Ala Arg Pro Val Gly
Ser Cys Asp Tyr Asp Leu Cys 85 90 95 Ser Phe Arg Pro Tyr Ala Ala
Cys Gly Asp Gly Thr Ala Val Thr Val 100 105 110 Asn 37 115 PRT
Ginglymostoma cirratum 37 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Glu Leu Val Trp Gly Tyr His Ser Cys Asp Tyr 85
90 95 Asp Met Cys Ser Phe Arg Tyr Ala Ala Cys Gly Asp Gly Thr Ala
Val 100 105 110 Thr Val Asn 115 38 115 PRT Ginglymostoma cirratum
38 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu
1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala
Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr
Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr
Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp
Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Ser
Leu Val Trp Ile Gly Tyr Ile Ala Val Thr 85 90 95 Thr Leu Asp Val
Leu Leu Arg Ala Ala Cys Gly Asp Gly Thr Ala Val 100 105 110 Thr Val
Asn 115 39 114 PRT Ginglymostoma cirratum 39 Ala Arg Val Asp Gln
Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr
Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser
Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40
45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys
50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly
Gly Thr 65 70 75 80 Tyr Arg Cys Gly Leu Ala Tyr Thr Gly Arg Cys Gly
Phe Cys Ala Leu 85 90 95 Asp Arg Leu Arg Lys Tyr Ala Asp Cys Gly
Asp Gly Thr Ala Val Thr 100 105 110 Val Asn 40 120 PRT
Ginglymostoma cirratum 40 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Val Cys His Arg Ile Ala Gly Val Glu Ile Ala Val 85
90 95 Thr Gln Val Cys Ala Leu Asn Arg Met Tyr Asn Tyr Ala Ala Cys
Gly 100 105 110 Asp Gly Thr Ala Val Thr Val Asn 115 120 41 114 PRT
Ginglymostoma cirratum 41 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Ile Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Gln Leu Glu Trp Ser Pro Ala Val Thr Thr Ser Pro 85
90 95 Ala Val Leu Ser Arg His Ala Ala Cys Gly Asp Gly Thr Ala Val
Thr 100 105 110 Val Asn 42 114 PRT Ginglymostoma cirratum 42 Ala
Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10
15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly
20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu
Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn
Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr
Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Val Ser Val Tyr
Ser Trp Cys Pro Thr Val Thr Gly 85 90 95 Met Val Cys Ser
Pro Tyr Ala Ala Cys Gly Gly Gly Thr Val Val Thr 100 105 110 Val Asn
43 114 PRT Ginglymostoma cirratum 43 Ala Arg Val Asp Gln Thr Pro
Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn
Cys Val Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys
Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile
Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55
60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr
65 70 75 80 Tyr Arg Cys Gly Val Gly Gly Ala Tyr Ser Cys Val Thr Thr
Tyr Arg 85 90 95 Gly Cys Ala Leu Tyr Tyr Ala Ala Cys Gly Asp Gly
Thr Ala Val Thr 100 105 110 Val Asn 44 113 PRT Ginglymostoma
cirratum 44 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr
Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Arg Arg Asp Ala Thr
Ser Val Leu Gly 20 25 30 Ala Thr Cys Trp Tyr Arg Lys Lys Ser Gly
Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val
Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile
Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Ala
Val Ser Ser Ile Ala Ile Arg Cys Asp His Ala Glu 85 90 95 Leu Cys
Ser Arg Tyr Gly Ala Cys Gly Asp Gly Thr Ala Val Thr Val 100 105 110
Asn 45 114 PRT Ginglymostoma cirratum 45 Ala Arg Val Asp Gln Thr
Pro Arg Ser Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile
Asn Cys Val Leu Arg Asp Ser Asn Cys Ala Leu Ser 20 25 30 Ser Thr
Tyr Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45
Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50
55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly
Thr 65 70 75 80 Tyr Arg Cys Gly Val Ala Ala Ala Thr Ile Gln Tyr Ser
Cys Asp Arg 85 90 95 Leu Cys Ser Trp Asp Phe Ala Val Cys Gly Asp
Gly Thr Ala Val Thr 100 105 110 Val Asn 46 110 PRT Ginglymostoma
cirratum 46 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr
Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Ser
Tyr Phe Val Gly 20 25 30 Ser Thr Cys Trp Trp Ala Ile Lys Gln Gly
Ser Thr Asn Thr Glu Thr 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val
Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile
Asn Gly Leu Lys Val Glu Asp Ser Trp Thr 65 70 75 80 Tyr Arg Cys Lys
Ala Tyr Thr Glu Pro Lys Thr Arg Arg Leu Ile Lys 85 90 95 Cys Cys
Arg Glu Tyr Gly Asp Gly Thr Ala Val Thr Val Asn 100 105 110 47 112
PRT Ginglymostoma cirratum 47 Ala Arg Val Asp Gln Thr Pro Arg Ser
Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val
Leu Arg Asp Lys Asp Cys Ala Glu Ser 20 25 30 Ser Ala Ser Trp Tyr
Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys
Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser
Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Ser Gly Thr 65 70
75 80 Tyr Arg Cys Lys Val Pro Ser Arg Tyr Ser Tyr Asp Cys Val Arg
Phe 85 90 95 Glu Leu Ile Asp Asp Val Tyr Gly Asp Gly Thr Ala Val
Thr Val Asn 100 105 110 48 108 PRT Ginglymostoma cirratum 48 Ala
Arg Val Asp Gln Thr Pro Lys Thr Val Thr Lys Glu Thr Gly Glu 1 5 10
15 Ser Leu Thr Ile Asn Cys Val Leu Ser Asp Thr Ser Cys Ala Trp Asp
20 25 30 Ser Thr Tyr Trp Tyr Arg Lys Lys Leu Gly Ser Thr Asn Glu
Glu Ser 35 40 45 Thr Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn
Ser Glu Ser Thr 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr
Val Glu Asp Ser Gly Thr 65 70 75 80 Tyr Arg Cys Arg Ala Glu Leu Tyr
Cys Gly Ala Glu Leu Asp Ser Phe 85 90 95 Asp Glu Tyr Gly Asp Gly
Thr Ala Val Thr Val Asn 100 105 49 104 PRT Ginglymostoma cirratum
49 Ala Arg Val Asp Gln Thr Pro Gln Thr Ile Thr Lys Glu Thr Gly Glu
1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ser Asn Cys Ala
Leu Ser 20 25 30 Ser Thr Tyr Trp Tyr Arg Lys Lys Ser Gly Ser Thr
Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr
Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp
Leu Thr Val Glu Asp Ser Gly Thr 65 70 75 80 Tyr Arg Cys Lys Val Ser
Arg Cys Ser Thr Asn Leu Ile Gly Tyr Gly 85 90 95 Gly Gly Thr Val
Val Thr Val Asn 100 50 108 PRT Ginglymostoma cirratum 50 Ala Arg
Val Asp Gln Thr Pro Gln Thr Ile Thr Lys Glu Thr Gly Glu 1 5 10 15
Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ser Asn Cys Ala Leu Ser 20
25 30 Ser Thr Tyr Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn Glu Glu
Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val Asn Ser
Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu Thr Val
Glu Asp Ser Gly Thr 65 70 75 80 Tyr Ala Cys Lys Ala Glu Gly Met Asp
Arg Glu Ile Arg Leu Asn Cys 85 90 95 Val Ile Tyr Gly Gly Gly Thr
Val Val Thr Val Asn 100 105 51 113 PRT Ginglymostoma cirratum 51
Ala Arg Val Asp Gln Thr Pro Gln Thr Ile Thr Lys Glu Thr Gly Asp 1 5
10 15 Thr Leu Thr Ile Asn Cys Val Leu Arg Asp Ser Asn Cys Ala Leu
Ser 20 25 30 Asp Met Tyr Trp Ser Arg Lys Lys Ser Gly Ser Thr His
Glu Glu Asn 35 40 45 Ile Ala Lys Glu Gly Arg Tyr Val Glu Thr Phe
Asn Arg Ala Ser Lys 50 55 60 Ser Ser Ser Leu Arg Ile Asn Asp Leu
Thr Val Ala Asp Ser Gly Thr 65 70 75 80 Tyr Arg Cys Arg Leu Asp Leu
Val Cys Asp Glu Thr Ala Tyr Gln Asp 85 90 95 Glu Leu Glu Phe Asp
Asp Ile Tyr Gly Asp Gly Thr Ala Val Thr Val 100 105 110 Asn 52 113
PRT Ginglymostoma cirratum 52 Ala Arg Val Asp Gln Thr Pro Arg Ser
Val Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val
Leu Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr
Arg Lys Lys Ser Gly Glu Gly Asn Glu Glu Ser 35 40 45 Ile Ser Lys
Gly Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser
Phe Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70
75 80 Tyr Arg Cys Gly Leu Gly Val Ala Gly Gly Tyr Cys Asp Tyr Ala
Leu 85 90 95 Cys Ser Ser Arg Tyr Ala Glu Cys Gly Asp Gly Thr Ala
Val Thr Val 100 105 110 Asn 53 339 DNA Ginglymostoma cirratum 53
gctcgagtgg accaaacacc gagatcagta acaaaggaga cgggcgaatc actgaccatc
60 aactgtgtcc tacgagatgc gagctatgca ttgggcagca cgtgctggta
tcgaaaaaaa 120 tcgggcgaag gaaacgagga gagcatatcg aaaggtggac
gatatgttga aacagttaac 180 agcggatcaa agtccttttc tttgagaatt
aatgatctaa cagttgaaga cggtggcacg 240 tatcgttgcg gtctcggggt
agctggaggg tactgtgact acgctctgtg ctcttcccgc 300 tatgctgaat
gcggagatgg cactgccgtg actgtgaat 339 54 339 DNA Ginglymostoma
cirratum 54 cgagctcacc tggtttgtgg ctctagtcat tgtttcctct gcccgcttag
tgactggtag 60 ttgacacagg atgctctacg ctcgatacgt aacccgtcgt
gcacgaccat agcttttttt 120 acgccgcttc ctttgctcct ctcgtatagc
tttccacctg ctatacaact ttgtcaattg 180 tcgcctagtt tcaggaaaag
aaactcttaa ttactagatt gtcaacttct gccaccgtgc 240 atagcaacgc
cagagcccca tcgacctccc atgacactga tgcgagacac gagaagggcg 300
atacgactta cgcctctacc gtgacggcac tgacactta 339 55 113 PRT
Ginglymostoma cirratum 55 Ala Arg Val Asp Gln Thr Pro Arg Ser Val
Thr Lys Glu Thr Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu
Arg Asp Ala Ser Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg
Lys Lys Ser Gly Ser Thr Asn Glu Glu Ser 35 40 45 Ile Ser Lys Gly
Gly Arg Tyr Val Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe
Ser Leu Arg Ile Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80
Tyr Arg Cys Gly Leu Gly Val Ala Gly Gly Tyr Cys Asp Tyr Ala Leu 85
90 95 Cys Ser Ser Arg Tyr Ala Glu Cys Gly Asp Gly Thr Ala Val Thr
Val 100 105 110 Asn 56 339 DNA Ginglymostoma cirratum 56 gctcgagtgg
accaaacacc gagatcagta acaaaggaga cgggcgaatc actgaccatc 60
aactgtgtcc tacgagatgc gagctatgca ttgggcagca cgtgctggta tcgaaaaaaa
120 tcgggctcaa caaacgagga gagcatatcg aaaggtggac gatatgttga
aacagttaac 180 agcggatcaa agtccttttc tttgagaatt aatgatctaa
cagttgaaga cggtggcacg 240 tatcgttgcg gtctcggggt agctggaggg
tactgtgact acgctctgtg ctcttcccgc 300 tatgctgaat gcggagatgg
cactgccgtg actgtgaat 339 57 339 DNA Ginglymostoma cirratum 57
cgagctcacc tggtttgtgg ctctagtcat tgtttcctct gcccgcttag tgactggtag
60 ttgacacagg atgctctacg ctcgatacgt aacccgtcgt gcacgaccat
agcttttttt 120 agcccgagtt gtttgctcct ctcgtatagc tttccacctg
ctatacaact ttgtcaattg 180 tcgcctagtt tcaggaaaag aaactcttaa
ttactagatt gtcaacttct gccaccgtgc 240 atagcaacgc cagagcccca
tcgacctccc atgacactga tgcgagacac gagaagggcg 300 atacgactta
cgcctctacc gtgacggcac tgacactta 339 58 114 PRT Ginglymostoma
cirratum 58 Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Glu Thr
Gly Glu 1 5 10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Asn
Tyr Ala Leu Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly
Ser Thr Asn Trp Asp Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val
Glu Thr Val Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile
Asn Asp Leu Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly
Arg Glu Gly Arg Tyr His Met Asp Ser Cys Asp Tyr 85 90 95 Ser Arg
Cys Arg Tyr Tyr Ala Ala Cys Gly Asp Gly Thr Ala Val Thr 100 105 110
Val Asn 59 341 DNA Ginglymostoma cirratum 59 gctcgagtgg accaaacacg
agatcagtaa caaaggagac gggcgaatca ctgaccatca 60 actgtgtcct
acgagatgcg aactatgcat tgggcagcac gtgttggtat cgaaaaaaat 120
cgggctcaac aaactgggac agcatatcga aaggtggacg atatgttgaa acagttaaca
180 gcggatcaaa gtccttttct ttgagaatta atgatctaac agttgaagac
ggtggcacgt 240 atcgttgcgg tcgagagggc cggtatcata tggatagctg
tgactacagt cggtgtcgct 300 actatgctgc atgcggagat ggcactgccg
tgactgtgaa t 341 60 342 DNA Ginglymostoma cirratum 60 cgagctcacc
tggtttgtgg ctctagtcat tgtttcctct gcccgcttag tgactggtag 60
ttgacacagg atgctctacg cttgatacgt aacccgtcgt gcacaaccat agcttttttt
120 agcccgagtt gtttgaccct gtcgtatagc tttccacctg ctatacaact
ttgtcaattg 180 tcgcctagtt tcaggaaaag aaactcttaa ttactagatt
gtcaacttct gccaccgtgc 240 atagcaacgc cagctctccc ggccatagta
tacctatcga cactgatgtc agccacagcg 300 atgatacgac gtacgcctct
accgtgacgg cactgacact ta 342 61 114 PRT Ginglymostoma cirratum 61
Ala Arg Val Asp Gln Thr Pro Arg Ser Val Thr Lys Val Ala Gly Glu 1 5
10 15 Ser Leu Thr Ile Asn Cys Val Leu Arg Asp Ala Asn Tyr Pro Leu
Gly 20 25 30 Ser Thr Cys Trp Tyr Arg Lys Lys Ser Gly Ser Thr Asn
Glu Glu Ser 35 40 45 Ile Ser Lys Gly Gly Arg Tyr Val Glu Thr Val
Asn Ser Gly Ser Lys 50 55 60 Ser Phe Ser Leu Arg Ile Asn Asp Leu
Thr Val Glu Asp Gly Gly Thr 65 70 75 80 Tyr Arg Cys Gly Arg Glu Gly
Arg Tyr His Met Asp Ser Cys Asp Tyr 85 90 95 Ser Arg Cys Arg Tyr
Tyr Gly Ala Cys Gly Asp Gly Thr Ala Val Thr 100 105 110 Val Asn 62
342 DNA Ginglymostoma cirratum 62 gctcgagtgg accaaacacc gagatcagta
acaaaggttg cgggcgaatc actgaccatc 60 aactgtgtcc tacgagatgc
gaactaccca ttgggcagta cgtgctggta tcgaaaaaaa 120 tcgggctcaa
caaacgagga gagcatatcg aaaggtggac gatatgttga aacagttaac 180
agcggatcaa agtccttttc tttgagaatt aatgatctaa cagttgaaga cggtggcacg
240 tatcgttgcg gaagagaggg ccggtatcat atggatagct gtgactacag
tcggtgtcgc 300 tactatggtg catgcggaga tggcactgcc gtgactgtga at 342
63 342 DNA Ginglymostoma cirratum 63 cgagctcacc tggtttgtgg
ctctagtcat tgtttccaac gcccgcttag tgactggtag 60 ttgacacagg
atgctctacg cttgatgggt aacccgtcat gcacgaccat agcttttttt 120
agcccgagtt gtttgctcct ctcgtatagc tttccacctg ctatacaact ttgtcaattg
180 tcgcctagtt tcaggaaaag aaactcttaa ttactagatt gtcaacttct
gccaccgtgc 240 atagcaacgc cttctctccc ggccatagta tacctatcga
cactgatgtc agccacagcg 300 atgataccac gtacgcctct accgtgacgg
cactgacact ta 342 64 46 DNA Ginglymostoma cirratum 64 ataatcaagc
ttgcggccgc attcacagtc acgacagtgc cacctc 46 65 46 DNA Ginglymostoma
cirratum 65 ataatcaagc ttgcggccgc attcacagtc acggcagtgc catctc 46
66 39 DNA Ginglymostoma cirratum 66 ataataagga attccatggc
tcgagtggac caaacaccg 39 67 16 DNA Artificial sequence M13 reverse
primer 67 ttcacacagg aaacag 16 68 21 DNA Artificial sequence HuCk
forward primer 68 gaagatgaag acagatggtg c 21 69 17 PRT Artificial
sequence LMB3 primer 69 Cys Ala Gly Gly Ala Ala Ala Cys Ala Gly Cys
Thr Ala Thr Gly Ala 1 5 10 15 Cys 70 17 PRT Artificial sequence
pHEN primer 70 Cys Thr Ala Thr Gly Cys Gly Gly Cys Cys Cys Cys Ala
Thr Thr Cys 1 5 10 15 Ala
* * * * *