U.S. patent application number 10/873768 was filed with the patent office on 2005-02-24 for diagnosis and management of infection caused by chlamydia.
Invention is credited to Mitchell, William M., Stratton, Charles W..
Application Number | 20050042690 10/873768 |
Document ID | / |
Family ID | 33543667 |
Filed Date | 2005-02-24 |
United States Patent
Application |
20050042690 |
Kind Code |
A1 |
Mitchell, William M. ; et
al. |
February 24, 2005 |
Diagnosis and management of infection caused by chlamydia
Abstract
The present invention provides a unique approach for the
diagnosis and management of infections by Chlamydia species,
particularly C. pneumoniae. The invention is based, in part, upon
the discovery that a combination of agents directed toward the
various stages of the chlamydial life cycle is effective in
substantially reducing infection. Products comprising combination
of antichlamydial agents, novel compositions and pharmaceutical
packs are also described.
Inventors: |
Mitchell, William M.;
(Nashville, TN) ; Stratton, Charles W.;
(Nashville, TN) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Family ID: |
33543667 |
Appl. No.: |
10/873768 |
Filed: |
June 22, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10873768 |
Jun 22, 2004 |
|
|
|
09709201 |
Nov 8, 2000 |
|
|
|
6838552 |
|
|
|
|
09709201 |
Nov 8, 2000 |
|
|
|
09025521 |
Feb 18, 1998 |
|
|
|
09025521 |
Feb 18, 1998 |
|
|
|
08911593 |
Aug 14, 1997 |
|
|
|
60023921 |
Aug 14, 1996 |
|
|
|
Current U.S.
Class: |
435/7.2 |
Current CPC
Class: |
A61K 31/455 20130101;
C07K 14/295 20130101; A61K 45/06 20130101; A61K 2300/00 20130101;
A61K 31/455 20130101 |
Class at
Publication: |
435/007.2 |
International
Class: |
C12Q 001/70; G01N
033/53; G01N 033/567 |
Claims
1-67. (Canceled)
68. A method of detecting Chlamydia in a sample, said method
comprising: (a) providing an antibody that specifically binds to a
peptide having a sequence consisting essentially of SEQ ID NO: 101;
and (b) performing on a sample an antigen capture assay using said
antibody wherein binding of said antibody indicates the presence of
Chlamydia in said sample.
69. A method for detecting Chlamydia in a sample, said method
comprising the steps of: a) providing a sample; b) contacting said
sample with a peptide having a sequence consisting essentially of
SEQ ID NO: 101; and c) detecting the binding of an antibody in said
sample to said peptide, wherein binding of said antibody to said
peptide indicates the presence of Chlamydia in said sample.
70. A method for detecting the presence of Chlamydia in a sample,
said method comprising the steps of: a) immobilizing a sample onto
a substrate; b) providing an antibody that specifically binds to a
peptide having a sequence consisting essentially of SEQ ID NO: 101;
c) contacting said immobilized sample with said antibody wherein
said antibody becomes immobilized if said sample contains
Chlamydia; and d) detecting the presence of immobilized antibody,
wherein the presence of immobilized antibody indicates the presence
of Chlamydia in said sample.
71. The method of any of claims 68, 69, or 70, wherein said sample
is a bodily secretion, bodily fluid, or tissue specimen.
Description
RELATED APPLICATIONS
[0001] This application is a Continuation-in-Part of U.S.
application Ser. No. 08/911,593 filed on Aug. 14, 1997, which
claims the benefit of U.S. Provisional Application No. 60/023,921
filed on Aug. 14, 1996, the entire teachings of which are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Chlamydiae are obligate intracellular microorganisms which
parasitize eukaryotic cells and are ubiquitous throughout the
animal kingdom. Members of the chlamydial genus are considered
bacteria with a unique biphasic developmental cycle having distinct
morphological and functional forms. This developmental growth cycle
alternates between 1) intracellular life forms, of which two are
currently recognized, a metabolically-active, replicating organism
known as the reticulate body (RB) and a persistent, non-replicating
organism known as the cryptic phase; and 2) an extracellular life
form that is an infectious, metabolically-inactive form known as
the elementary body (EB).
[0003] EBs are small (300-400 nm) infectious, spore-like forms
which are metabolically inactive, non-replicating, and found most
often in the acellular milieu. EBs are resistant to a variety of
physical insults such as enzyme degradation, sonication and osmotic
pressure. This physical stability is thought to be a result of
extensive disulfide cross-linking of the cysteine-rich major outer
membrane protein (MOMP) (Bavoil et al., Infection and Immunity,
44:479-485 (1984); Hackstadt et al., Journal of Bacteriology,
161:25-31 (1985); Hatch et al., Journal of Bacteriology,
165:379-385 (1986); Peeling et al., Infection and Immunity,
57:3338-3344 (1989); J. C. A. Bardwell, Molecular Microbiology,
14:199-205 (1994); and T. P. Hatch, Journal of Bacteriology,
178:1-5 (1993)). Under oxidizing conditions in the acellular milieu
of the host, the outer membrane of EBs is relatively impermeable as
well as resistant to inactivation. EBs are thus well suited to
survive long enough outside of their hosts to be transmitted to a
new host in the form of a droplet nuclei (Theunissen et al.,
Applied Environmental Microbiology, 59:2589-2593 (1993)) or a
fomite (Fasley et al., The Journal of Infectious Diseases,
168:493-496 (1993)).
[0004] Infection by members of the genus Chlamydiae induces a
significant inflammatory response at the cellular level. For
example, genital lesions produced by Chlamydia trachomatis
frequently elicit a vigorous influx of lymphocytes, macrophages,
and plasma cells, suggesting the development of humoral and
cellular immunity. Yet, clinically, the initial infection is
frequently varied in symptomatology and may even be asymptomatic.
Once fully established, the Chlamydia are difficult to eradicate,
with frequent relapse following antibiotic therapy. Evidence also
indicates that the Chlamydia may become dormant and are then shed
in quantities too few to reliably detect by culture.
[0005] Chlamydia pneumoniae (hereinafter "C. pneumoniae") is the
most recent addition to the genus Chlamydia and is isolated from
humans and currently is recognized as causing approximately 10
percent of community acquired cases of pneumonia (Grayston et al.,
J. Inf. Dis. 161:618-625 (1990)). This newly recognized pathogen
commonly infects the upper and lower respiratory tract and is now
recognized as ubiquitous in humans. C. pneumoniae is the most
recent addition to the genus Chlamydiae and is well-accepted as a
human pathogen that may be difficult to eradicate by standard
antibiotic therapy (Hammerschlag et al., Clin. Infect. Dis.
14:178-182 (1992)). C. pneumoniae is known to persists as a silent
or mildly symptomatic pathogen, resulting in a chronic, persistent
infection (J. Schacter, In: Baun AL, eg. Microbiology of Chlamydia,
Boca Raton, Fla., CRC Press, 1988, pp. 153-165).
[0006] The current therapy for suspected/confirmed C. pneumoniae
infection is with a short course (e.g., 2-3 weeks) of a single
antibiotic. C. pneumoniae is susceptible in vitro to tetracyline,
erythromycin, clarithromycin, and fluoroquinolones such as
ofloxacin and sparfloxacin (Kuo et al., Antimicrob Agents Chemother
32:257-258 (1988); Welsh et al., Antimicrob Agents Chemother
36:291-294 (1992); Chirgwin et al., Antimicrob Agents Chemother
33:1634-1635 (1989); Hammerschlag et al., Antimicrob Agents
Chemother 36:682-683 (1992); Hammerschlag et al., Antimicrob Agents
Chemother 36:1573-1574); M. R. Hammerschlag, Antimicrob Agents
Chemother 38:1873-1878 (1994); M. R. Hammerschlag, Infect. Med. pp.
64-71 (1994)). Despite this demonstration of in vitro
susceptibility, C. pneumoniae infections may relapse following
antibiotic therapy with these agents. In vitro studies on the
persistence of Chlamydiae despite specific and appropriate
antibiotic therapy have suggested that the presence of antibiotics
promotes the formation of an intracellular, non-replicative state
(Beatty et al., Microbiol. Rev. 58:686-699 (1994)), typically
referred to as the latent or cryptic phase. This change can be
thought of as a stringent response and is seen also with nutrient
starvation and exposure to .gamma.-interferon. Removal of the
stressful influence allows the organism to resume replication.
Thus, in this way, the organism can escape current antibiotic
therapy used in clinical practice.
[0007] In view of the chronic and persistent nature of chlamydial
infections, there is a need for reliable, accurate methods for
diagnosis of pathogenic infection as well as therapeutic approaches
to manage the infection. Due to the highly infective nature of
Chlamydia EBs and their ability to reinfect cells, there is also a
need for antichlamydial therapy which totally eradicates this
pathogen, thereby preventing the long term sequelae of such chronic
infections.
SUMMARY OF THE INVENTION
[0008] The present invention provides a unique approach for the
diagnosis and management of infection by Chlamydia species,
particularly C. pneumoniae. The invention is based upon the
discovery that a combination of agents directed toward each of the
various stages of the chlamydial life cycle can successfully manage
infection and ultimately prevent reinfection/reactivation of the
pathogen. Accordingly, one embodiment of the invention pertains to
methods of treating infection by a Chlamydia species, comprising
administering to an individual in need thereof a combination of
antichlamydial agents, comprising at least two agents, each of
which is effective against a different phase of the chlamydial life
cycle. For example, the method can be carried out using agents
chosen from among the following groups: a) at least one agent
effective against the elementary body phase of the chlamydial life
cycle; b) at least one agent effective against the replicating
phase of the chlamydial life cycle; and c) at least one agent
effective against the cryptic phase of the chlamydial life cycle.
The chlamydial pathogen can be eliminated more rapidly when a
combination comprising agents directed against each phase of the
chlamydial life cycle is administered. For the purposes of this
invention, "cryptic phase" embraces any non-replicating,
intracellular form, of which there are a number of distinct stages,
including but not limited to intracellular EBs, EBs transforming
into RBs and vice versa, miniature RBs, non-replicating RBs and the
like.
[0009] The invention also pertains to novel combinations of
antichlamydial agents and to novel pharmaceutical compositions
comprising agents at least two antichlamydial agents, each of which
is effective against a different phase of the chlamydial life
cycle. For example, the agents can be selected from the group
consisting of: a) at least one agent effective against the
elementary body phase of the chlamydial life cycle; b) at least one
agent effective against the replicating phase of the chlamydial
life cycle; and c) at least one agent effective against cryptic
phase of the chlamydial life cycle. These compositions and
combinations of agents can further comprise one or a combination of
adjunct compounds, including anti-inflammatory agents,
immunosuppressive agents and vitamin C. Use of the combination of
antichlamydial agents or compositions thereof for the manufacture
of a medicament for the management of Chlamydia infection is also
described. In a particular embodiment, the agents can be assembled
individually, admixed or instructionally assembled.
[0010] The invention also pertains to a novel therapy comprising a
specific agent effective against the elementary body phase of the
chlamydial life cycle which, if used for a sufficient period of
time, allows active infection to be completed without the creation
of infectious EBs.
[0011] In order to facilitate patient compliance during a course of
therapy, the invention provides a means for packaging therapeutic
agents, described herein, for the management of Chlamydia
infection. For example, a pack can comprise at least two different
agents, each of which is effective against a different phase of the
chlamydial life cycle. These agents can be selected from the group
consisting of: a) at least one agent effective against the
elementary body phase of the chlamydial life cycle; b) at least one
agent effective against the replicating phase of the chlamydial
life cycle; and c) at least one agent effective against the cryptic
phase of the chlamydial life cycle. Optional adjunct compounds, as
mentioned previously, can likewise be present in the pack. A
preferred pack will comprise a plurality of agents that are
directed to at least two, but preferably to all, of the stages of
the chlamydial life cycle. The pack can provide a unit dosage of
the agents or can comprise a plurality of unit dosages, and may be
labeled with information, such as the mode and order of
administration (e.g., separate, simultaneous or sequential) of each
component contained therein.
[0012] The invention also encompasses a method for evaluating the
infection status of an individual and/or the progress of therapy in
an individual undergoing therapy for infection caused by Chlamydia.
The method comprises quantifying antibody titer or other measure to
the pathogen and comparing the measure to antibody measure
quantified at a time earlier in the therapy, whereby the difference
between the measures is indicative of the progress of the therapy.
The invention also pertains to a method for monitoring the course
of therapy for treating infection by Chlamydia, comprising
determining presence or absence of Chlamydia in an infected
individual at time intervals during course of therapy. In a
particular embodiment, this is determined by PCR assay or antigen
capture assay for pathogen DNA.
[0013] Detection of the presence of Chlamydia in a sample of
biological material taken from an individual thought to be infected
therewith is important in determining the course of therapy and the
agents to be used. This can be achieved by detecting the presence
of DNA encoding MOMP of Chlamydia or other chlamydial genes in the
individual. In one aspect of the invention, diseases associated
with Chlamydia infection, such as inflammatory diseases, autoimmune
diseases and diseases in which the individual is immunocompromised,
can be treated by managing (e.g., significantly reducing infection
or eradicating) the Chlamydia infection using the novel approach
described herein. Both clinical and serological
improvements/resolutions in patient status have been
demonstrated.
[0014] The invention also pertains to a susceptibility test for
identifying agent(s) capable of significantly reducing/eliminating
chlamydial infection. The method comprises preparing tissue culture
from cell lines; inoculating these cells with Chlamydia in the
absence of cycloheximide; allowing the Chlamydia to infect these
cells for several days; adding agent(s) to be tested, which
agent(s) is/are replaced as needed for the duration of incubation;
isolating chlamydial nucleic acid from the cells; and assessing the
presence or absence of chlamydial DNA using a suitable nucleotide
amplification assay, such as PCR. Preferably the presence or
absence of signal for amplified DNA encoding MOMP of Chlamydia or
other chlamydial protein is determined. Absence of a signal
indicates a reduction in the degree of infection below that which
is detectable by nucleic acid amplification techniques and strongly
suggests eradication of the microorganism. The susceptability tests
described herein are particularly useful as a drug screening tool
for assessing the activity of single agents or combinations of
agents against Chlamydia infection.
[0015] The unique and novel aspect of the susceptabilty test
described herewithin is that it measures the presence or absence of
chlamydial DNA and thus can detect cryptic forms and/or elementary
bodies both of which are infectious, yet are not replicating.
[0016] In one embodiment, a suitable nucleotide assay for
identifying agents effective against the cryptic form of chlamydia
comprises, in the presence of agent(s) to be tested, subjecting
cultured cells to protease/reducing agent (e.g., dithiotreitol
(DTT)) and protease digestion or guanidine isothiocyanate (also
known as guanidine thiocyanate) for a prescribed period of time;
extracting DNA from the treated solution; exposing DNA to
appropriate polymerase, dNTPs and primers for DNA amplification of
MOMP or other protein of the Chlamydia species; and determining the
presence or absence of amplified DNA by visualizing the ethidium
bromide treated DNA product by gel electrophoresis, for example. In
particular embodiments, the Chlamydia species is C. pneumoniae and
the appropriate primers are CHLMOMPDB2 and CHLMOMPCB2.
[0017] The invention further relates to a method of identifying
cells containing the cryptic form of a Chlamydia species by a
nucleic acid amplification technique (e.g., PCR) comprising
subjecting cultured cells to protease digestion; stopping protease
activity; exposing cells to appropriate heat-stable DNA polymerase,
dNTPs and labeled primers (e.g., 3'-biotin labeled, 5'-biotin
labeled) for amplification of DNA encoding MOMP of the Chlamydia
species; washing the cells; exposing the cells to a reporter
molecule (e.g., strepavidin-conjugated signal enzyme); exposing the
cells to an appropriate substrate for the reporter molecule (e.g.,
conjugated enzyme); and visualizing the amplified DNA encoding MOMP
by visualizing the product of the reaction.
[0018] A method of identifying cells containing the cryptic form of
Chlamydia comprises treating cultured cells, thought to be infected
with Chlamydia, with a disulfide reducing agent; subjecting
cultured cells to protease digestion; exposing cells to appropriate
polymerase, dNTPs and primers for DNA amplification of nucleic acid
encoding a chlamydial protein; exposing the cells to a reporter
molecule enzyme; exposing the cells to an appropriate substrate for
the reporter enzyme; and determining the presence of the cryptic
form of Chlamydia by visualizing the amplified DNA encoding a
chlamydial protein. Preferably the amplification technique is PCR
and the primers are CHLMOMPDB2 and CHLMOMPCB2 of Chlamydia
pneumoniae.
[0019] A similar method can be used as an assay for identifying an
agent which is effective against the cryptic form of Chlamydia.
Accordingly, the method comprises treating cultured cells grown in
the absence of cycloheximide, thought to be infected with
Chlamydia, with a disulfide reducing agent; allowing the chlamydia
to replicate; adding a test agent; subjecting cultured cells to
protease digestion; exposing cells to apprpriate polymerase, dNTPs
and primers for DNA amplification of a chlamydial protein; exposing
the cells to a reporter molecule enzyme; exposing the cells to an
appropriate substrate for the reporter enzyme; and determining the
presence of cryptic form of Chlamydia by visualizing the amplified
DNA encoding a chlamydial protein, such as MOMP.
[0020] Also described is a method of detecting chlamydial
elementary bodies in a sample comprising contacting the sample with
a disulfide reducing agent before using a DNA amplification
technique to detect chlamydial DNA in the sample.
[0021] The present invention pertains to methods for clearing
biological material infected with Chlamydia to produce
Chlamydia-free cell lines and animals, and to methods of
maintaining biological material, e.g, cell lines and animals, such
that they remain Chlamydia-free. According to the method, a
biological material is cleared from Chlamydia infection by
contacting the biological material with at least two agents, each
of which is effective against a different phase of the chlamydial
life cycle, until the biological material no longer tests positive
for Chlamydia. The agents can be selected from the group consisting
of a) agents effective against the cryptic phase of the chlamydial
life cycle; b) agents effective against the elementary body phase
of the chlamydial life cycle; and c) agents effective against the
replicating phase of the chlamydial life cycle. In one embodiment,
the agent effective against the elementary body phase is a
disulfide reducing agent. In another embodiment, the agent
effective against the cryptic phase is a nitroaromatic compound,
such as nitroimidazoles, nitrofluans, analogs, derivatives and
combinations thereof.
[0022] Biological material that has been cleared of Chlamydia
infection, according to the methods of this invention, are also
described. The biological material can be a continuous cell line
such as HeLa-CF, HL-CF, H-292-CF, HuEVEC-CF and McCoy-CF; wherein
"CF" is a shorthand annotation for "Chlamydia-free". Alternatively,
the biological material can be an animal, such as a mouse, rabbit
or other animal model, which is negative for Chlamydia.
[0023] The invention also pertains to methods of maintaining a
Chlamydia-free status in animals and cell lines which have been
cleared of Chlamydia infection by the methods of this invention, or
have never been infected, such as their Chlamydia-free offspring or
progeny. Cells or animals can be maintained as Chlamydia-free by
maintaining them on antibiotics and/or treating their nutrients and
environment to ensure that they are Chlamydia-free. Particularly, a
source of nutrients to be administered to Chlamydia-free cells or
animals can be treated to inactivate or remove any chlamydial
elementary bodies therefrom. This can be accomplished by exposing
the nutrients to gamma irradiation for a period of time and level
of exposure adequate to inactivate the elementary bodies. In
addition to, or alternatively, a source of nutrients can be passed
through a filtration system to physically remove the chlamydial
elementary bodies therefrom. Optionally, the source of nutrients
can be first treated with a disulfide reducing agent, such as
dithiothreitol, before the filtration step is performed. The filter
should be of adequate size such that objects larger than 0.5
microns are prevented from passing through.
[0024] The invention further pertains to a diagnostic kit or pack
comprising an assembly of materials selected from the group
consisting of antibiotics, reagents, Chlamydia-free cell lines, and
combinations thereof, or other materials that would be necessary to
perform any of the methods described herein.
[0025] The invention further relates to a method of detecting
viable Chlamydia in a biological material suspected of being
contaminated therewith, comprising culturing Chlamydia-free cells
or animals in the presence of biological material and then
determining the presence or absence of viable Chlamydia in the
culture.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIGS. 1A and 1B show a sequence alignment of various
Chlamydia MOMPs.
[0027] FIG. 2 shows the expressed thioredoxin fusion protein
containing a polyhistidine affinity chromatography site, an
enterokinase cleavage site, and the full length MOMP protein with
an alanine insertion after aal. Amino to carboxyl reads left to
right. Total amino acid content in the expressed protein is 530
residues.
[0028] FIG. 3 illustrates the constant and variable domain (VD) of
various Chlamydia species.
[0029] FIG. 4 illustrates the peptide amino acid sequences employed
for the construction of peptide based ELISAs with species
specificity for VD1.
[0030] FIG. 5 illustrates the peptides for VD2 which are used
similarly to the VD1 sequences.
DETAILED DESCRIPTION OF THE INVENTION
[0031] This invention describes specific antichlamydial agents that
are used singly or in combination to eliminate or interfere with
more than one of the distinct phases of the life cycle of Chlamydia
species. These chlamydial phases include the intracellular
metabolizing/replicating phase; the intracellular cryptic phase;
and the extracellular EB phase. Current concepts of susceptibility
testing for chlamydiae and antimicrobial therapy for their
associated infections address only one phase, the replicating
phase. Unless multiple phases of the life cycle are addressed by
antichlamydial therapy, the pathogen is likely to escape the
desired effects of the antimicrobial agent(s) used and cause
recurrent infection after reactivation from latency.
[0032] Diagnostic and therapeutic methods for the management of
Chlamydia infections are described in detail below. For the
purposes of this invention, "management of Chlamydia infection" is
defined as a substantial reduction in the presence of all
phases/forms of Chlamydia in the infected host by treating the host
in such a way as to minimize the sequellae of the infection.
Chlamydia infections can thus be managed by a unique approach
referred to herein as "combination therapy" which is defined for
the purpose of this application as the administration of multiple
agents which together are directed at least two but preferably each
of the multiple phases of the chlamydial life cycle, each agent
taken separately, simultaneously or sequentially over the course of
therapy. When used alone, these agents are unable to eliminate
chlamydial infection. The diagnostic methods and combination
therapies described below are generally applicable for infection
caused by any Chlamydia species, such as C. pneumoniae, C.
trachomatis, C. psittaci and C. pecorum. Infections in which the
causative agent is C. pneumoniae are emphasized.
[0033] Antichlamydial agents, which have been identified as
effective against Chlamydia by the susceptibility testing methods
described herein, can be used singly or in combination to manage
Chlamydia infection. For example, compounds identified as
anti-cryptic phase drugs, anti-EB phase drugs, anti-DNA-dependent
RNA polymerase drugs and nicotinic acid cogener drugs can be used
alone or in combination to eliminate, reduce or prevent one or more
of the distinct phases of the chlamydial life cycle. These
compounds have not heretofore been shown to have antichlamydial
activity.
[0034] Diagnosis of Chlamydia Infection
[0035] The invention pertains to methods for diagnosing the
presence of Chlamydia in a biological material, as well as to the
use of these methods to evaluate the serological status of an
individual undergoing antichlamydial combination therapy. For
purposes of this application, "biological material" includes, but
is not limited to, bodily secretions, bodily fluids and tissue
specimens. Examples of bodily secretions include cervical
secretions, trachial-bronchial secretions and pharyngeal
secretions. Suitable bodily fluids include blood, sweat, tears,
cerebral spinal system fluid, serum, urine, snyovial fluid and
saliva. Animals, cells and tissue specimens such as from a variety
of biopsies are embraced by this term.
[0036] In one embodiment, peptide-based assays are disclosed for
the detection of one or more immunoglobulins, such as IgG, IgM, IgA
and IgE, against antigenic determinants within the full length
recombinant MOMPs of various Chlamydia species. Detection of IgG
and/or IgM against antigenic determinants within the the full
length recombinant MOMP of C. pneumoniae is preferred. IgA
determinations are useful in the analysis of humoral responses to
Chlamydia in secretions from mucosal surfaces (e.g., lung, GI
tract, gerontourinary tract, etc.). Similarly, IgG determinations
are useful in the analysis of allergic manifestatins of disease.
Table 1 below provides the GenBank Accession numbers of various
MOMPs for Chlamydia species.
1 TABLE 1 GenBank Species Strain ID Accession No. C. trachomatis A
CTL/A M33636 C. trachomatis A CTL/A M58938 M33535 C. trachomatis A
CTL/A J03813 C. trachomatis B CTL/B M33636 C. trachomatis C CTL/L
M17343 M19128 C. trachomatis D CTL/D A27838 C. trachomatis E CTL/E
X52557 C. trachomatis F CTL/F X52080 M30501 C. trachomatis H CTL/H
X16007 C. trachomatis L1 CTL/L1 M36533 C. trachomatis L2 CTL/L2
M14738 M19126 C. trachomatis L3 CTL/L3 X55700 C. trachomatis Mouse
Pneumo CTL/MP X60678 C. pecorum Ovine CPC/OP Z18756 Polyarthritis
C. psittaci Strain 6BC CPS/6B X56980 C. psittaci Feline CPS/F
X61096 C. trachomatis Da CTL/DA X62921 S45921 C. pneumoniae TWAR
CPN/HU1 M64064 M34922 M64063 C. pneumoniae Horse CPN/EQ2 L04982 (?
C. pecorum) C. pneumoniae TWAR CPN/MS not assigned C. psittaci
Horse CPS/EQ1 L04982
[0037] For example, a biological material, such as a sample of
tissue and/or fluid, can be obtained from an individual and a
suitable assay can be used to assess the presence or amount of
chlamydial nucleic acids or proteins encoded thereby. Suitable
assays include immunological methods such as enzyme-linked
immunosorbent assays (ELISA), including luminescence assays (e.g.,
fluorescence and chemiluminescence), radioimmunoassay, and
immunohistology. Generally, a sample and antibody are combined
under conditions suitable for the formation of an antibody-protein
complex and the formation of antibody-protein complex is assessed
(directly or indirectly). In all of the diagnostic methods
described herein, the antibodies can be directly labeled with an
enzyme, fluorophore, radioisotope or luminescer. Alternatively,
antibodies can be covalently linked with a specific scavenger such
as biotin. Subsequent detection is by binding avidin or strepavidin
labeled with an indicator enzyme, flurophore, radioisotope, or
luminescer. In this regard, the step of detection would be by
enzyme reaction, fluorescence, radioactivity or luminescence
emission, respectively.
[0038] The antibody can be a polyclonal or monoclonal antibody,
such as anti-human monoclonal IgG or anti-human monoclonal IgM.
Examples of useful antibodies include mouse anti-human monoclonal
IgG that is not cross reactive to other immunoglobulins (Pharmagen;
Clone G18-145, Catalog No. 34162D); mouse anti-human monoclonal IgM
with no cross reactivity to other immunoglobulins (Pharmagen; Clone
G20-127, Catalog No. 34152D). Peptide-based immunoassays can be
developed which are Chlamydia specific or provide species
specificity, but not necessarily strain specificity within a
species, using monoclonal or polyclonal antibodies that are not
cross-reactive to antigenic determinants on MOMP of a chlamydial
species not of interest.
[0039] Recombinant-based immunological assays have been developed
to quantitate the presence of immunoglobulins against the Chlamydia
species. Full length recombinant Chlamydia MOMP can be synthesized
using an appropriate expression system, such as in E. coli or
Baculovirus. The expressed protein thus serves as the antigen for
suitable immunological methods, as discussed above. Protein-based
immunological techniques can be designed that are species- and
strain-specific for various Chlamydia.
[0040] Diagnosis of chlamydial infection can now be made with an
improved IgM/IgG C. pneumoniae method of quantitation using ELISA
techniques, Western blot confirmation of ELISA specificity and the
detection of the MOMP gene of C. pneumoniae in serum using specific
amplification primers that allow isolation of the entire gene for
analysis of expected strain-specific differences.
[0041] Any known techniques for nucleic acid (e.g., DNA and RNA)
amplification can be used with the assays described herein.
Preferred amplification techniques are the polymerase chain
reaction (PCR) methodologies which comprise solution PCR and in
situ PCR, to detect the presence or absence of unique genes of
Chlamydia. Species-specific assays for detecting Chlamydia can be
designed based upon the primers selected. Examples of suitable PCR
amplification primers are illustrated below in Table 2. Examples of
preferred primers are illustrated in Table 3.
2TABLE 2 Initial and Terminal Nucleotide Sequences of Chlamydial
MOMP Genes in which entire sequence is known SEQ ID GenBank
Accession No. ID Initial Fifty Nucleotides NO. M64064/M34922/M64063
CPNHU1 ATGAAAAAACTCTTAAAGTCGGCGTTATTA- TCCGCCGCATTTGCTGGTTC 1 None
CPNHU2.sup.a ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC 2
L04982 CPNEQ1 ATGAAAAAACTCTTGAAGTCGGCATTATTGTTTGCCGCTACGGGTTCCGC 3
L04982 CPNEQ2 ATGAAAAAACTCTTAAAGTCGGCGTTATTATCCGCCGCATTTGCTGGTTC 4
X56980 CPS/6B ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTAC- GGGTTCCGC
5 M36703 CPS/AB1 ATGAAAAAACTCTTGAAATCGGCATTATTGT-
TTGCCGCTACGGGTTCCGC 6 L39020 CPS/AB2
ATGAAAAAACTCTTGAAATCGGCATTATTGTTTGCCGCTACGGGTTCCGC 7 L25436
CPS/AV/C ATGAAAAAACTCTTGAAATCGGCATTATTATTTGCCGCTACGGGTTCCGC 8
X61096 CPS/F ATGAAAAAACTCTTAAAATCGGCATTATTATTTGCCGCTGCGGGTTCCG- C 9
M33636/N58938/J03813 CTL/A ATGAAAAAACTCTTGAAATCGGTATTA-
GTATTTGCCGCTTTGAGTTCTGC 10 M17343/M19128 CTL/C
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 11 X62921/S45921
CTL/DA ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 12 X52557
CTL/E ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTT- GAGTTCTGC 13
X52080/M30501 CTL/F ATGAAAAAACTCTTGAAATCGGTAT-
TAGTATTTGCCGCTTTGAGTTCTGC 14 X16007 CTL/H
ATGAAAAAACTCTTGAAATCGGTATTAGTATTTGCCGCTTTGAGTTCTGC 15 M36533 CTL/L1
ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTGAGTTCTGC 16 M14738/M19126
CTL/L2 ATGAAAAAACTCTTGAAATCGGTATTAGTGTTTGCCGCTTTG- AGTTCTGC 17
X55700 CTL/L3 ATGAAAAAACTCTTGAAATCGGTATTAGTGTT- TGCCGCTTTGAGTTCTGC
18 X60678 CTL/MP ATGAAAAAACTCTTGAAATCGGTATTAGCATTTGCCGTTTTGGGTTCTGC
19 SEQ Chlamydial ID Species Strain ID Terminal Fifty Nucleotides
NO. C. pneumoniae TWAR CPNHU1
GTTTAATTAACGAGAGAGCTGCTCACGTATCTGGTCAGTTCAGATTCTAA 20 C. pneumoniae
MS CPNHU2 GTTTAATTAACGAGAGAGCTGCTCACGTATCTGGTCAGTTCAGATTCTAA 21 C.
psittaci Horse CPNEQ1 CAACGTTAATCGACGCTGACAAATGGTCA-
ATCACTGGTGAAGCACGCTTA 22 C. pneumoniae Horse CPNEQ2
GTTTAATTAACGAGAGAGCTGCTCACATATCTGGTCAGTTCAGATTCTAA 23 C. psittaci
SBE CPS/6B AACGTTAATCGACGCTGACAAATGGTCAATCACTGGTGAAGCACGCTTAA 24 C.
psittaci Ewe CPS/AB1 AACGTTAATCGACGCTGACAAATGGTCAATCAC-
TGGTGAAGCACGCTTAA 25 abortion C. psittaci Bovine CPS/AB2
GCTTAATCAATGAAAGAGCCGCTCACATGAATGCTCAATTCAGATTCTAA 26 abortion C.
psittaci Avian CPS/AV/C
GCTTAATCAATGAAAGAGCTGCTCACATGAATGCTCAATTCAGATTCTAA 27 C. psittaci
Feline CPS/F GCTTAATCGACGAAAGAGCTGCTCACATTAATGCTCAATTCAGATTCTAA 28
C. trachomatis Hu/A CTL/A CGCAGTTACAGTTGAGACTCGCTTGATC-
GATGAGAGAGCAGCTCACGTAA 29 C. trachomatis Hu/C CTL/C
GCTTGATCGATGAGAGAGCAGGTCACGTAAATGCACAATTCCGGTTCTAA 30 C.
trachomatis Hu/Da CTL/DA
GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCT- AA 31 C.
trachomatis HU/E CTL/E CGCTTGATCGATGAGAGACTGCTCAC-
GTAAATGCACAATTCCGCTTCTAA 32 C. trachomatis Hu/F CTL/F
GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA 33 C.
trachomatis Hu/H CTL/H
GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCTAA 34 C.
trachomatis Hu/L1 CTL/L1 GCTTGATCGATGAGAGAGCTGCTCAC-
GTAAATGCACAATTCCGCTTCTAA 35 C. trachomatis Hu/L2 CTL/L2
GCTTGATCGATGAGAGAGCTGCTCACGTAAATGCACAATTCCGCTTCTAA 36 C.
trachamatis Hu/L3 CTL/L3
GCTTGATCGATGAGAGAGCAGCTCACGTAAATGCACAATTCCGCTTCT- AA 37 C.
trachomatis Mouse CTL/MP GCTTGATCGATGAAAGAGCAGCTC-
ACGTAAATGCTCAGTTCCGTTTCTAA 38 .sup.aSequence from a cerebral spinal
fluid of a patient with multiple sclerosis isolated by the
inventors. Sequence is identical to TWAR C. pneumoniae with
exception of a C/T mutation at NT 54 and a G/A mutation at NT 126.
.sup.bTerminator condon underlined
[0042]
3TABLE 3 Primers for PCR Amplification of Entire MOMP Gene.sup.a
SEQ Chlamydia ID Species Strain ID Sequence T.sub.m.sup.b NO. Plus
Strand Primer C. pneumoniae TWAR CHLMOMP ATGAAAAAAC 61.4.degree.
105 DB2 TCTTAAAGTC GGCGTTATTA TCCGCCGC C. trachomatis L2 CTMOMP
ATGAAAAAAC 61.2.degree. 106 L2DB TCTTGAAATC GGTATTAGTG TTTGCCGCTT
TGAG C. psittaci Feline PSOMP ATGAAAAAAC 62.1.degree. 107 FPN-D
TCTTAAAATC GGCATTATTA TTTGCCGCTG CGGG C. psittaci 6BC PSOMP
ATGAAAAAAC 63.0.degree. 108 6BC-b TCTTGAAATC GGCATTATTG TTTGCCGCTA
CGGG C. trachomatis Mouse CTMU ATGAAAAAAC 63.5.degree. 109 MOMP-D
TCTTGAAATC GGTATTAGCA TTTGCCGTTT TGGGTTCTGC Minus Strand Primer C.
pneumoniae TWAR CHLMOMP TTAGAATCTG 64.4.degree. 110 CB2 AACTGACCAG
ATACGTGAGC AGCTCTCTCG C. trachomatis L2 CTMOMP TTAGAAGCGG
61.5.degree. 111 L2CB AATTGTGCAT TTACGTGAGC AGCTC C. psittaci
Feline PSOMP TTAGAATCTG 62.2.degree. 112 FPN_C AATTGAGCAT
TAATGTGAGC AGCTCTTTCG TCG C. psittaci 6BC PSOMP TTAGAATCTG
63.4.degree. 113 GBC_C AATTGACCAT TCATGTGAGC AGCTCTTTCA TTGATTAAGC
G C. trachomatis Mouse CTMU TTAGAAACGG 63.2.degree. 114 MOMP_C
AACTGAGCAT TTACGTGAGC TGCTCTTTCA TC .sup.aAll primers amplify under
identical amplification conditions: 94.degree. C. for 1 min.,
58.degree. C. for 2 min., 74.degree. C. for 3 min., for 35 cycles
with 72.degree. C. for 10 min. extension of last cycle.
.sup.bMelting temperature in degrees Celsius of a nucleic acid
isomer based on the equation of Mermur and Doty (J. Mol. Biol. 5:
109-118, 1962) where T.sub.m = 81.5 + 16.6 log.sub.10
(Na.sup.+/K.sup.+) + 41 (GC) - 600/L where (Na.sup.+/K.sup.+) in
the molar cation concentration, GC in the mole fraction of GC and L
is the sequence fragment length. (Na.sup.+/K.sup.+) used for
computation was O.05 M.
[0043] Ligase chain reaction can also be carried out by the methods
of this invention; primers/probes therefor can be constructed using
ordinary skill. Amplification of the entire MOMP gene is useful for
mutational analysis and the production of recombinant MOMP. Shorter
primers can be used for specific amplification of most of the MOMP
genome with a modification of amplification protocol. For example,
a 22 bp negative strand primer of the sequence 5'-CAGATACGTG
AGCAGCTCTC TC-3' (CPNMOMPC; SEQ ID NO. 39) with a computed
T.sub.m=55.degree. plus a 25 bp positive strand primer of the
sequence 5'-CTCTTAAAGT CGGCGTTATT ATCCG-3' (CPNMOMPD; SEQ ID NO.
40) with a computed T.sub.m=53.9.degree. can be used as a primer
pair by adjusting the hybridization step in the amplification
protocol (Table 2) from 58.degree. C. to 50.degree. C. Similarly,
smaller regions of MOMP can be amplified by a large variety of
primer pairs for diagnostic purposes although the utility of strain
identification is reduced and amplification may be blocked if one
or both primer pairs hybridize to a region that has been mutated.
Extensive experience with the full length MOMP PCR amplification
indicates that mutational events within the CHLMOMPD32 and
CHLMOMPCB2 hybridization sites are rare or non-existent.
[0044] The nucleic acid amplification techniques described above
can be used to evaluate the course of antichlamydial therapy. The
continued absence of detectable chlamydial DNA encoding MOMP as a
function of antichlamydial therapy is indicative of clinical
management of the chlamydial infection. Serological improvement can
be based upon the current serological criteria for eradication of
chronic chlamydia reported below in Table 4.
4TABLE 4 Serological Criteria for Eradication of Chronic Chlamydia
pneumoniae Infection IgM .ltoreq.1:25 IgG Stable titer 1:100 PCR
Negative
[0045] Preferred PCR techniques are discussed in detail below in
the Example Section. In general, solution PCR is carried out on a
biological material by first pre-incubating the material in an
appropriate reducing agent that is capable of reducing the
disulfide bonds which maintain the integrity of the MOMP and other
surface proteins of the chlamydial elementary bodies, thereby
compromising the outer protective shell of the EBs and allowing
protease penetration. Suitable disulfide reducing agents include,
but are not limited to, dithiothreitol, succimer, glutathione,
DL-penicillamine, D-penicillamine disulfide, 2,2'-dimercaptoadipic
acid, 2,3-dimercapto-1-propone-sulfide acid. Appropriate
concentrations of these reducing agents can be readily determined
by the skilled artisan without undue experimentation using a 10
.mu.M concentration of dithiothreitol (the preferred reducing
agent) as a guideline. Failure to include a reducing agent in the
initial step may prevent DNA of EBs from being isolated in the
subsequent step. Data presented in Example 1 shows the effects of
various reducing agents on the susceptibility of EBs to proteinase
K digestion. The in vitro data shows that dithiothreitol is most
effective at opening EBs for protease digestion.
[0046] Once the outer shell of the EBs has been released, the
pre-incubated material is subjected to protein digestion using a
protease (e.g., proteinase K), or functionally equivalent enzyme.
The DNA is extracted and subjected to a nucleic acid amplification
technique, e.g., PCR. The entire gene or portion thereof containing
unique antigenic determinant(s) encoding MOMP or other suitable
gene can then be amplified using appropriate primers flanking the
gene to be amplified. For example, the gene or portion thereof can
be the gene encoding MOMP, OMP-B, GRO-ES, GRO-EL, DNAK, 16S RNA,
23S RNA, the gene encoding ribonuclease-P 76 kd attachment protein
or a KDO-transferase gene. In an alternative method, guanidine
thiocyanate, at preferably a concentration of 4M, or functionally
equivalent reducing denaturant may be substituted for the disulfide
reduction/protease steps.
[0047] The amplified DNA is then separated and identified by
standard electrophoretic techniques. DNA bands are identified using
ethidium bromide staining and UV light detection. PCR primers can
be designed to selectively amplify DNA encoding MOMP of a
particular Chlamydia species, such as the MOMP of C. pneumoniae, C.
pecorum, C. trachomatis, C. psittaci (See FIG. 1). Primers that are
from about 15-mer to about 40-mer can be designed for this
purpose.
[0048] For in situ PCR, the amplification primers are designed with
a reporter molecule conjugated to the 5'-terminus. Suitable
reporter molecules are well known and can be used herein. However,
biotin-labeled primers are preferred. For the MOMP gene, the
primers CHLMOMPDB2 and CHLMOMPCB2 have been engineered with a
biotin at the 5'-terminus. For in situ PCR, using biotin labels
incorporated at the 5'-terminus of the amplification primers, each
DNA chain amplification results in each double strand DNA
containing 2 molecules of biotin. Alternatively, other specific DNA
sequences can be used, although the above-described sequence is the
preferred embodiment since the large product produced (1.2 kb)
prevents diffusion that may be encountered with smaller DNA
amplifications. Similarly, other detection labels can be
incorporated (i.e., fluorescein, for example) at the 5'-end or
digoxigenin-dUTP (replacement for dTPP) can be incorporated within
the amplified DNA. Alternatively to labeling the product, specific
hybridization probes to constant regions of the amplified DNA can
be used to identify an amplified product. This latter method has
particular utility for the construction of automated laboratory
equipment for solution-based PCR. For example, strepavidin-coated
ELISA plates can be used to capture one or both strands of a biotin
5'-labeled DNA with detection by fluorescence of a fluorescein or
other incorporated fluorophore detection probe.
[0049] Clearing and Maintaining Chlamydia-Free Organisms
[0050] The present invention provides a unique approach for
creating and maintaining animals and cell lines which are free of
Chlamydia infection. Also described herein are methods for creating
nutrients and culture media that are suitable for use with animals
and cell lines that have been cleared of Chlamydia infection.
[0051] Attempts to culture isolates of C. pneumoniae from blood and
cerebrospinal fluid (CSF) have resulted in the discovery that the
continuous cell lines routinely used to cultivate C. pneumoniae are
cryptically infected with C. pneumoniae. These include not only in
house stocks of HeLa, HL, H-292, HuEVEC and McCoy cells, but also
stocks obtained from the American Type Culture Collection (ATCC),
The University of Washington Research Foundation for HL cells, as
well as a commercial supplier (Bartells) of H-292 and McCoy cells
for the clinical culture of Chlamydia. The presence of a cryptic
form of C. pneumoniae in these cells has been repeatedly
demonstrated by solution PCR amplifying the MOMP. In situ PCR in
HeLa cells against the MOMP demonstrates the MOMP genes to be
present in 100% of cells. Nevertheless, fluoroscenated mAb to LPS
in McCoy cells does not yield any indication of Chlamydia (i.e.,
reactive against all Chlamydia) while fluoroscenated mAb to C.
pneumoniae MOMP yields a generalized fluorescence throughout the
cytoplasm that can be confused with non-specific autofluorescence.
Infection with Chlamydia trachomatis (Bartells supply) yields the
typical inclusion body staining with the LPS mAb (i.e., cross
reactive with all species of Chlamydia) with no change in
cytoplasmic signal with anti-MOMP mAb against C. pneumoniae. These
findings (solution PCR, in situ PCR, mAb reactivity) were
interpreted as consistent with a cryptic (non-replicating)
infection by C. pneumoniae of cells commonly used to is culture the
organism. Further, virtually all rabbits and mice tested to date
have PCR signals for the C. pneumoniae MOMP gene.
[0052] This creates a currently unrecognized problem of major
significance for those clinical labs providing C. pneumoniae
culture services as well as investigators who now do not know
whether their results in animals or in cell culture will be
affected by cryptic chlamydial contamination. Clinical and research
laboratories currently have no way to determine whether an organism
is, in fact, Chlamydia-free.
[0053] This invention pertains to a method for clearing cells and
animals of C. pneumoniae and keeping them clear. Clearing them
entails contacting the infected organism with agents used singly or
in combination to eliminate or interfere with more than one of the
distinct phases of the life cycle of Chlamydia species. Keeping
them clear entails either maintaining them on antibiotics and/or
treating their nutrients and environment to ensure they are
Chlamydia-free. In a preferred embodiment, maintenance conditions
comprise a combination of isoniazid (INH) (1 .mu.g/ml),
metronidazole (1 .mu.g/ml), and dithiothreitol (10 .mu.M) in the
culture medium. Media changes are accomplished every 3 days or
twice per week. The cells can be removed from the protective
solution between 1 and 7 days before they are to be used for
culture or other purpose.
[0054] These techniques have now made it possible to create a
variety of Chlamydia-free (CF) organisms, including continuous cell
lines called HeLa-CF, HL-CF, H-292-CF, HuEVEC-CF, McCoy-CF, African
green monkey and other cell lines that are capable of supporting
chlamydial growth. Various CF strains of mice, rabbits and other
animal models for research use can be produced.
[0055] Because Chlamydia is highly infectious, organisms which have
been cleared of extracellular, replicating and cryptic infections
must be protected from exposure to viable EBs if the organisms are
to remain clear. The inventors have discovered that many of the
nutrients and other materials used to maintain continuous cell
lines are contaminated with viable Chlamydia EBs. For example,
every lot of fetal calf serum has tested positive for the Chlamydia
MOMP gene by PCR. Since extensive digestion is required for
isolation of the DNA, we have concluded it is bound in EBs. C.
pneumoniae can also be cultured directly from fetal calf serum.
Thus, it is necessary to inactivate EBs in these materials, such as
culture media and nutrients, used to maintain the Chlamydia-free
status of the organism. Collectively these materials are referred
to herein as "maintenance materials". In one embodiment, nutrients
and culture media are subjected to gamma irradiation to inactivate
Chlamydia therein. Preferably, the material should be irradiated
for a period of time sufficient to expose the material to at least
10,000 rads of gamma radiation. It is important for the material to
be contained in vessels that do not absorb high energy radiation.
The preferred vessel is plastic. In another embodiment, the
maintenance materials are treated with a disulfide reducing agent
(e.g., dithiothreitol (10 .mu.M) for about 30 minutes) and then the
treated maintenance materials are passed through a standard
submicron (e.g., about 0.45 microns) filtration system. The
reducing agent causes any EBs to expand to the size where a 0.45
micron filter will block their passage. Examples of suitable
disulfide reducing agents include, but are not limited to,
dithiothreitol, succimer, glutathione, DL-penicillamine,
D-penicillamine disulfide, 2,2'-dimercaptoadipic acid,
2,3-dimercapto-1-propone-sulfide acid. In yet another embodiment,
maintenance materials are treated with a disulfide reducing agent,
preferably dithiothreitol (e.g., about 10 .mu.M concentration),
before the materials are passed through a filtration system to
remove Chlamydia therefrom.
[0056] In order to insure that research tools, such as cell lines
and animals, remain Chlamydia-free, an assay has been designed to
evaluate whether an organism is Chlamydia-free. The method
comprises obtaining a sample of cells or tissue culture; culturing
the cells in the absence of cycloheximide and determining the
presence or absence of Chlamydia nucleic acid by a suitable
amplification technique, such as PCR. The absence of nucleic acid
amplification signal is indicative that the status of the organism
is Chlamydia-free.
[0057] Susceptability Testing for Evaluating Active Agents against
Various Forms of Chlamydia
[0058] This invention pertains to novel approaches for the
susceptibility testing of Chlamydia species that are necessitated
by the complex life cycle of the chlamydial pathogen as well as by
its diverse, extensive, and heretofore unappreciated ability to
cause chronic, cryptic, and persistent systemic infections that are
refractory to short duration therapy with conventional single
agents. The inventors have discovered that successful eradication
of chronic/systemic chlamydial infections can be predicted by using
the described unique methods for in vitro and in vivo
susceptibility testing.
[0059] The invention is based upon the discovery that current
susceptibility testing methods for Chlamydiae do not accurately
predict the ability of antimicrobial agents to successfully and
totally eradicate chronic chlamydial infections. This is because
the current susceptibility testing methods measure only replication
of chlamydia and ignores the well-known "cryptic phase" (28-33) in
which Chlamydiae are not actively replicating. Moreover, it has
also been discovered that the so-called "cryptic phase" of
Chlamydiae includes multiple and different phases. The following
are phases of the chlamydial life cycle in which the Chlamydiae are
not replicating: an initial intranuclear phase in which elementary
bodies (EBs) transition to reticulate bodies (RBs), an
intracytoplasmic phase in which there is a transition of the RB
phenotype to the EB phenotype, an intracytoplasmic phase with a
nonreplicating, but metabolizing RB, and
intracellular/extracellular EB phases in which there is neither
replication nor metabolsim. In order to assess the cumulative and
long term effect of antimicrobial therapy on these multiple life
phases, unique in vitro and in vivo susceptibility test methods
have been developed and are described herein.
[0060] The term "susceptibility" as used herein is intended to mean
a physiological response of an organism to an environmental or
chemical stimuli. The desired physiological response to stimuli is
one which adversely affects the pathogen's viability to replicate
or reside within the host cell and, ideally, would result in the
complete elimination (i.e., death) of that pathogen.
[0061] A. In Vitro Methodology
[0062] One aspect of the invention pertains to methods for
evaluating the susceptibility of the distinct phases and stages of
the life cycle of Chlamydia, to a particular s agent(s),
particularly the cryptic phase, since prior techniques have failed,
heretofore, to appreciate the need for drugs that can clear
infected cells of cryptic Chlamydia. A preferred drug screening
method which accomplished this objective utilizes tissue culture
cells, in the absence of cycloheximide in order to encourage
cryptic infection. Cryptic infection is uncommon in cells used in
standard cell culture susceptibility techniques because Chlamydia
in cycloheximide-paralyzed cells need not compete with the host
cell for metabolites and hence are encouraged to replicate.
[0063] The in vitro method uses standard tissue culture cells, but
without the addition of cycloheximide. Moreover, the chlamydiae are
allowed to replicate for several days prior to the addition of at
least one test agents. A "test agent" can be any compound to be
evaluated as an antichlamydial agent for its ability to
significantly reduce the presence of Chlamydia in living cells. For
example, a test agent can include, but is not limited to,
antibiotics, antimicrobial agents, antiparasitic agents,
antimalarial agent, disulfide reducing agents and antimycobacterial
agents. The test agent(s) is/are replaced when needed for the
duration of the incubation time (days to weeks) to ensure that the
test agent is present and has not been otherwise degraded.
Antimicrobial agent(s) (test agent) is then added to the
replicating cells. The antimicrobial agents/growth medium are
periodically replaced for the duration of the incubation time,
which is preferably weeks rather than days. Finally, the end point
after the prolonged incubation time is the complete absence of
chlamydial DNA, as determined by a nucleic acid amplification
technique, such as the polymerase chain reaction (PCR) methodology.
Standard nucleic acid amplification techniques (such as PCR) are
used to ascertain the presence or absence of signal for chlamydial
DNA encoding MOMP or other unique Chlamydia protein to determine
whether the test agent or combination of agents is/are effective in
reducing Chlamydia infection. The loss of signal (i.e., below the
detectable level of the nucleic acid amplification technique) in
cells with antibiotic(s) versus its presence in controls is an
indication of efficacy of the agent or combination of agents
against Chlamydia.
[0064] Accordingly, the susceptibility test of this invention can
be used to identify an agent or agents which are effective against
any particular species of Chlamydia and can be used to identify
agent(s) effective against the cryptic form of the pathogen, i.e.,
is capable of inhibiting or eliminating the cryptic form of the
pathogen. Agents that are effective against Chlamydia, as
ascertained by the susceptibility testing protocols described
herein, can be used as part of a therapy for the management of
Chlamydia infections. Suitable therapeutic protocols are described
in detail below, with a particular focus on targeting agents toward
specific stages of the chlamydial life cycle.
[0065] The methods described herein are unique because they
evaluate the activity of antimicrobial agents in the absence of
cycloheximide which provides a more clinically relevant
intracellular milieu. For example, any energy-dependent host cell
membrane pumps which might move antimicrobial agents in or out of
the cell are inactivated by the use of cycloheximide. The methods
described herein are unique because they utilize culture medium
which has previously been inactivated. The methods are also unique
because they measures the effect of a prolonged duration of
exposure to the antimicrobial agent(s) after the intracellular
infection by chlamydiae has become established. Finally, the method
is unique because it measures the presence/absence of chlamydial
DNA as the endpoint, for example by measuring PCR signal. By using
complete eradication of chlamydial DNA as an endpoint, the
susceptibility test confirms that all phases of Chlamydiae have
been eradicated as opposed to merely a temporary halt in
replication.
[0066] When PCR is the preferred methodology used to evaluate assay
endpoint, the PCR method can be enhanced by the unique application
of a reducing agent, such as dithiothreitol (DTT), in order to
uncoat chlamydial EBs and hence allow exposure of the DNA. In other
words, DTT permits the EB coating to rupture. By using an assay for
DNA in which EBs are specifically uncoated, the susceptibility test
endpoint assesses the presence or absence of EBs as well as the
presence or absence of both replicating and nonreplicating RBs.
Thus, this approach for chlamydial susceptibility testing allows
quantitative antimicrobial susceptibility assays of single and
combination agents in which the cumulative effect of the agent(s)
on the complete eradication of all life phases is measured.
Examples of results obtained with this in vitro method are
described below.
[0067] In one embodiment, a suitable nucleic acid assay for
identifying agents effective against the cryptic form of chlamydia
comprises, in the presence of agent(s) to be tested, subjecting
cultured cells to protease/reducing agent (e.g., dithiotreitol) and
protease digestion or guanidine isothiocyanate (also known as
guanidine thiocyanate) for a prescribed period of time; extracting
DNA from the treated solution; exposing DNA to appropriate
polymerase, dNTPs and primers for DNA amplification of MOMP or
other protein of the Chlamydia species; and determining the
presence or absence of amplified DNA by visualizing the ethidium
bromide treated DNA product by gel electrophoresis, for example. In
particular embodiments, the Chlamydia species is C. pneumoniae and
the appropriate primers are CHLMOMPDB2 and CHLMOMPCB2.
[0068] The invention further relates to a method of identifying
cells containing the cryptic form of a Chlamydia species by a
nucleic acid amplification technique (e.g., PCR) comprising
subjecting cultured cells to protease digestion; stopping protease
activity; exposing cells to appropriate heat-stable DNA polymerase,
dNTPs and labeled primers (e.g., 3'-biotin labeled, 5'-biotin
labeled) for amplification of DNA encoding MOMP of the Chlamydia
species; washing the cells; exposing the cells to a reporter
molecule (e.g., strepavidin-conjugated signal enzyme); exposing the
cells to an appropriate substrate for the reporter molecule (e.g.,
conjugated enzyme); and visualizing the amplified DNA encoding MOMP
by visualizing the product of the reaction.
[0069] The invention pertains to a method of identifying cells
containing the cryptic form of Chlamydia. The method comprises
treating cultured cells, thought to be infected with Chlamydia,
with a disulfide reducing agent; subjecting cultured cells to
protease digestion; exposing cells to appropriate polymerase, dNTPs
and primers for DNA amplification of nucleic acid encoding of a
chlamydial protein; exposing the cells to a reporter molecule
enzyme; exposing the cells to an appropriate substrate for the
reporter enzyme; and determining the presence of the cryptic form
of Chlamydia by visualizing the amplified DNA encoding a chlamydial
protein. Preferably the amplification technique is PCR and the
primers are CHLMOMPDB2 and CHLMOMPCB2 of Chlamydia pneumoniae.
[0070] A similar method can be used as an assay for identifying an
agent which is effective against the cryptic form of Chlamydia.
Accordingly, the method comprises treating cultured cells grown in
the absence of cycloheximide, thought to be infected with
Chlamydia, with a disulfide reducing agent; allowing the Chlamydia
to replicate; adding a test agent; subjecting cultured cells to
protease digestion; exposing cells to appropriate polymerase, dNTPs
and primers for DNA amplification of a gene encoding chlamydial
protein; exposing the cells to a reporter molecule enzyme; exposing
the cells to an appropriate substrate for the reporter enzyme; and
determining the presence of cryptic form of Chlamydia by
visualizing the amplified DNA encoding a chlamydial protein, such
as MOMP.
[0071] A detailed description of primers, PCR techniques and other
methodologies useful for the present invention are provided in U.S.
patent application Ser. No. ______ entitled "Identification of
Antigenic Peptide Sequences" (Attorney Docket No. VDB98-01), filed
concurrently herewith; the entire teachings of this application are
incorporated herein by reference.
[0072] B. In Vivo Methodology
[0073] In another aspect of the invention, the susceptibility test
can be used to evaluate the status of a human or animal undergoing
therapy for the management of Chlamydia infection. For example, a
biological material is isolated from the human or animal undergoing
combination therapy. The biological material is treated such that
the Chlamydia is isolated therefrom. This chlamydial isolate is
allowed to infect Chlamydia free cells. These infected cells are
then exposed to the combination of agents being used in the
individual undergoing combination therapy. Alternatively, the
individual's serum containing the antimicrobial agents can be added
to the infected cells as a "serum bactericidal test" for
intracellular chlamydial infection.
[0074] The in vivo method uses the murine model although other
animals such as rats or rabbits can be used. In this method, mice
(or any other animal) are inoculated intranasally with
2.times.10.sup.5 chlamydial EBs per ml. The inventors have
confirmed the work of Yang and colleagues (15) in which intranasal
inoculation of chlamydial EBs results in systemic dissemination
and, in particular, causes infection of the spleen. The inventors
have discovered that this systemic dissemination also results in
the presence of EBs in the blood of the mice. Therefore,
infectivity can be measured by blood culture or by serum/whole
blood PCR for chlamydial DNA. Systemic infection is also confirmed
and monitored by the presence of elevated IgM and IgG antibody
titers. After the systemic murine infection has been established,
antimicrobial agents are given to the mice. This is most easily
done by adding the antibiotics to the drinking water. The effect of
antichlamydial therapy is monitored by serum/whole blood PCR. When
the serum/PCR assay suggests eradication of chlamydiae from the
bloodstream, the mice are sacrificed and PCR for chlamydial DNA is
done on lung, heart, liver, and spleen homogenates. This method is
unique because it measures the complete eradication of all life
forms of chlamydiae in known murine target organs for chlamydial
infection. This in vivo susceptibility method has revealed, for
example, that antimicrobial therapy with the triple agents, INH,
metronidazole and penicillamine, can completely eradicate C.
pneumoniae from infected mice in four months. Moreover, following
complete eradication of chlamydial, multiple attempts to reinfect
these cured mice via intranasal inoculation have proven
unsuccessful. This suggests that effective therapy and complete
eradiaction results in the development of protective immunity, and
that effective therapy is therefore a way to create effective
immunity.
[0075] Performing PCR for chlamydial DNA on homogenates of other
organ systems can be used to determine the effectiveness of
particular antibiotic combinations in eradicating chlamydial
infection in those organ systems. Establishment of prior chlamydial
infection of those systems can be done by either biopsy or
antibody-enhanced radiological imaging. Alternatively, prior
infection can be determined statistically by performing PCR for
chlamydial DNA on homogenates of the same organ systems in a
similarly inoculated but untreated control population.
Organ-specific susceptibility is determined by comparing rates of
positive PCR assays in the control and treated is populations.
[0076] An alternative or complementary method of determining the
presence of cryptic chlamydial infections in an animal or cell
culture is to expose the culture to chlamydia-stimulating
compounds. Such compounds include (but are not limited to)
cycloheximide, corticosteriods (such as prednisone) and other
compounds which are known to stimulate reactivation of cryptic
intracellular infections, and disulfide reducing agents (such as
dithiotreitol) and other chemicals which cause EBs to turn into
RBs. Once the cryptic forms have entered a more active phase, they
can be detected using standard detection techniques such as visual
detection of inclusion bodies, immunochemical detection of
chlamydial antigen, or reverse transcriptase-PCR.
[0077] Antichlamydial Therapy Directed Toward the Initial Stage of
Chlamydia Infection
[0078] A number of effective agents that are specifically directed
toward the initial phase of chlamydial infection (i.e., transition
of the chlamydial EB to an RB) have been identified. This growth
phase, unlike that of the replicating chlamydial microorganism,
which uses host cell energy, involves electrons and electron
transfer proteins, as well as nitroreductases. Based upon this, it
has been shown that the initial phase of Chlamydia infection is
susceptible to the antimicrobial effects of nitroimidazoles,
nitrofurans and other agents directed against anaerobic metabolism
in bacteria.
[0079] Nitroimidazoles and nitrofurans are synthetic antimicrobial
agents that are grouped together because both are nitro
(NO.sub.2--) containing ringed structures and have similar
antimicrobial effects. These effects require degradation of the
agent within the microbial cell such that electrophilic radicals
are formed. These reactive electophilic intermediates then damage
nucleophilic protein sites including ribosomes, DNA and RNA.
Nitroimidazoles and nitrofurans currently are not considered to
possess antimicrobial activity against members of the Chlamydia
species. This lack of antimicrobial activity, however, is due to
the fact that conventional susceptibility testing methods only test
for effect on the replicating form of Chlamydia species.
[0080] Examples of suitable nitroimidazoles include, but are not
limited to, metronidazole, tinidazole, bamnidazole, benznidazole,
flunidazole, ipronidazole, misonidazole, moxnidazole, ronidazole,
sulnidazole, and their metabolites, analogs and derivatives
thereof. Metronidazole is most preferred. Examples of nitrofurans
that can be used include, but are not limited to, nitrofurantoin,
nitrofurazone, nifurtimox, nifuratel, nifuradene, nifurdazil,
nifurpirinol, nifuratrone, furazolidone, and their metabolites,
analogs and derivatives thereof. Nitrofurantoin is preferred within
the class of nitrofurans.
[0081] Throughout this application and for purposes of this
invention, "metabolites" are intended to embrace products of
cellular metabolism of a drug in the host (e.g., human or animal)
including, but not limited to, the activated forms of prodrugs. The
terms "analogs" and "derivatives" are intended to embrace isomers,
optically active compounds and any chemical or physical
modification of an agent, such that the modification results in an
agent having similar or increased, but not significantly deceased,
effectiveness against Chlamydia, compared to the effectiveness of
the parent agent from which the analog or derivative is obtained.
This comparison can be ascertained using the susceptability tests
described herein.
[0082] Cells to be treated can already be cryptically infected or
they can be subjected to stringent metabolic conditions which cause
or induce the replicating phase to enter the cryptic phase. Such
stringent conditions can include changing environmental/culturing
conditions in the instance where the infected cells are exposed to
.gamma.-interferon; or by exposing cells to conventional
antimicrobial agents (such as macrolides and tetracyclines) which
induce this cryptic phase of chlamydial infection in human host
cells.
[0083] Novel Antichlamydial Therapy Directed Toward the Replicating
Phase of Chlamydia Infection
[0084] A unique class of antichlamydial agents that is effective
against the replicating phase of Chlamydia (and possibly against
some stages of the cryptic stage) have been identified using the
susceptability tests described herein. This novel class of agents
comprises ethambutol and isonicotinic acid congeners which include
isoniazid (INH), isonicotinic acid (also known as niacin) nicotinic
acid, pyrazinamide, ethionamide, and aconiazide; where INH is most
preferred. Although these are currently considered effective only
for mycobacterial infections, due in part to currently available
susceptability testing methodologies, it has been discovered that
these agents, in combination with other antibiotics, are
particularly effective against Chlamydia. It is believed that the
isonicotinic acid congeners target the constitutive production of
catalase and peroxidase, which is a characteristic of
microorganisms, such as mycobacteria, that infect monocytes and
macrophages. Chlamydia can also successfully infect monocytes and
macrophages.
[0085] Using INH to eradicate Chlamydia from macrophages and
monocytes subsequently assists these cells in their role of
fighting infection. However, these agents appear to be less
effective, in vitro, against the cryptic phase. Thus, ethambutol,
INH and other isonicotinic acid congeners ideally should be used in
combination with agents that target other phases of the chlamydial
life cycle. These isonicotinic acid congeners are nevertheless
excellent agents for the long term therapy of chronic/systemic
chlamydial infection generally, and in particular to chlamydial
infection of endothelial and smooth muscle cells in human blood
vessels.
[0086] INH and its congeners can be used to clear infection from
monocytes and/or macrophages. When monocytes and macrophages are
infected by Chlamydia, they become debilitated and cannot properly
or effectively fight infection. It is believed that, if the
chlamydial infection, per se, is cleared from these cells, then the
monocytes and macrophages can resume their critical roles fighting
chlamydial or other infection(s). Thus, patient responsiveness to
combination therapy can be optimized by the inclusion of
isonicotinic acid congeners. Accordingly, one aspect of the
invention provides a specific method for reempowering monocytes or
macrophages that have been compromised by a Chlamydia infection
and, in turn, comprise treating the infection in other sites. Such
compromised macrophages or monocytes can be activated by treating
the chlamydia infection by contacting the infected macrophages
and/or monocytes with an antichlamydial agent.
[0087] Therapy Directed Toward Elementary Bodies of Chlamydia
[0088] As discussed above, it has been discovered that adverse
conditions, such as limited nutrients, antimicrobial agents, and
the host immune response, produce a stringent response in
Chlamydia. Such adverse conditions are known to induce stringent
responses in other microorganisms (C. W. Stratton, In: Antibiotics
in Laboratory Medicine, Fourth Edition. Lorian V (ed) Williams
& Wilkins, Baltimore, pp 579-603 (1996)) and not surprisingly
induce a stringent response in Chlamydia. This stringent response
in Chlamydia alters the morphological state of the intracellular
microorganism and creates a dormant form, the intracellular EB,
which then can cryptically persist until its developmental cycle is
reactivated. Conversely, the host cell may lyse and allow the EBs
to reach the extracellular milieu. Thus, it is necessary to utilize
a combination of agents directed toward the various life stages of
Chlamydia and, in particular, against the elementary body for
successful management of infection.
[0089] During the unique chlamydial life cycle, it is known that
metabolically-inactive spore-like EBs are released into the
extracellular milieu. Although these released EBs are infectious,
they may not immediately infect nearby susceptible host cells until
appropriate conditions for EB infectivity are present. The result
of this delay in infection is the extracellular accumulation of
metabolically-inactive, yet infectious, EBs. This produces s a
second type of chlamydial persistance referred to herein as EB
"tissue/blood load". This term is similar in concept to HIV load
and is defined herein as the number of infectious EBs that reside
in the extracellular milieu. Direct microscopic visualization
techniques, tissue cell cultures, and polymerase chain reaction
test methods have demonstrated that infectious EBs are frequently
found in the blood of apparently healthy humans and animals. This
phenomenon is clearly of great clinical importance in chlamydial
infections as these metabolically-inactive EBs escape the action of
current antichlamydial therapy which is directed only against the
replicating intracellular forms of Chlamydia. The presence of
infectious extracellular EBs after the completion of short term,
anti-replicating phase therapy for chlamydial infections has been
shown to result in infection relapse. Thus, the duration and nature
of antichlamydial therapy required for management of chlamydial
infections is, in part, dictated by the extracellular load of EBs.
For purposes of this invention, short term therapy can be
approximately two to three weeks; long term therapy in contrast is
for multiple months.
[0090] As described in previous sections, it is also believed that
persistance of chlamydial infections, in part, may be due to the
presence of the cryptic form of Chlamydia within the cells. This
cryptic intracellular chlamydial form apparently can be activated
by certain host factors such as cortisone (Yang et al., Infection
and Immunity, 39:655-658 (1983); and Malinverni et al., The Journal
of Infectious Diseases, 172:593-594 (1995)). Antichlamydial therapy
for chronic Chlamydia infections must be continued until any
intracellular EBs or other intracellular cryptic forms have been
activated and extracellular EBs have infected host cells. This
reactivation/reinfection by chlamydial EBs clearly is undesirable
as it prolongs the therapy of chlamydial infections, as well as
increases the opportunity for antimicrobial resistance to
occur.
[0091] Physiochemical agents have been identified that can
inactivate chlamydial EBs in their respective hosts by reducing
disulfide bonds which maintain the integrity of the outer membrane
proteins of the EBs. For Chlamydia, disruption of the outer
membrane proteins of EBs thereby initiates the transition of the EB
form to the RB form. When this occurs in the acellular milieu where
there is no available energy source, the nascent RB perishes or
falls victim to the immune system. Thus, disulfide reducing agents
that can interfere with this process are suitable as compounds for
eliminating EBs.
[0092] One such class of disulfide reducing agents are
thiol-disulfide exchange agents. Examples of these include, but are
not limited to, 2,3-dimercaptosuccinic acid (DMSA; also referred to
herein as "succimer"); D,L,-.beta.,.beta.-dimethylcysteine (also
known as penicillamine); .beta.-lactam (e.g., penicillins,
penicillin G, ampicillin and amoxicillin, which produce
penicillamine as a degradation product), cycloserine,
dithiotreitol, mercaptoethylamine (e.g., mesna, cysteiamine,
dimercaptol), N-acetylcysteine, tiopronin, and glutathione. A
particularly effective extracellular antichlamydial agent within
this class is DMSA which is a chelating agent having four ionizable
hydrogens and two highly charged carboxyl groups which prevent its
relative passage through human cell membranes. DMSA thus remains in
the extracellular fluid where it can readily encounter
extracellular EBs. The two thiol (sulfhydryl) groups on the
succimer molecule (DMSA) are able to reduce disulfide bonds in the
MOMP of EBs located in the extracellular milieu.
[0093] Penicillamine can also be used as a disulfide reducing agent
to eliminate chlamydial EBs. However, the use of penicillamine may
cause undesirable side effects. Thus, as an alternative, those
.beta.-lactam agents which are metabolized or otherwise converted
to penicillamine-like agents in vivo (i.e., these agents possess a
reducing group) can be orally administered to the human or animal
as a means of providing a controlled release of penicillamine
derivatives, by acid hydrolysis of the penicillin, under
physiologic conditions. The in vivo production of penicillamine
from the degradation of penicillins undoubtedly accounts for the
known in vitro ability of penicillins to reduce or prevent the
development of infectious chlamydial EBs in cell cultures.
[0094] Currently Recognized Agents Active Against Chlamydia
Replication
[0095] As chlamydial RBs transform into EBs, they begin to utilize
active transcription of chlamydial DNA and translation of the
resulting mRNA. As such, these forms of Chlamydia are susceptible
to currently used antimicrobial agents. The antichlamydial
effectiveness of these agents can be significantly improved by
using them in combination with other agents directed at different
stages of Chlamydia life cycle, as discussed herein.
[0096] Classes of suitable antimicrobial agents include, but are
not limited to, rifamycins (also known as ansamacrolides),
quinolones, fluoroquinolones, chloramphenicol,
sulfonamides/sulfides, azalides, cycloserine, macrolides and
tetracyclines. Examples of these agents which are members of these
classes, as well as those which are preferred, are illustrated
below in Table 5.
5TABLE 5 Agents Effective Against the Replicating Phase of
Chlamydia Drug Class Examples Preferred Quinolones/ Ofloxacin
Levofloxacin Fluoroquinolones Levofloxacin Trovafloxacin
Sparfloxacin Norfloxacin Lomefloxacin Cinoxacin Enoxacin Nalidixic
Acid Fleroxacin Ciprofloxacin Sulfonamides Sulfamethoxazole
Sulfamethoxazole/ Trimethoprim Azalides Azithromycin Azithromycin
Macrolides Erythromycin Clarithromycin Clarithromycin Lincosamides
Lincomycin Clindamycin Tetracyclines Tetracycline Minocycline
Doxycycline Minocycline Methacycline Oxytetracyline Rifamycins
Rifampin Rifampin (Ansamacrolides) Rifabutin
[0097] All members of the Chlamydia species, including C.
pneumoniae, are considered to be inhibited, and some killed, by the
use of a single agent selected from currently used antimicrobial
agents such as those described above. However, using the new
susceptability test, the inventors have found complete eradication
of Chlamydia cannot be achieved by the use of any one of these
agents alone because none are efficacious against all phases of the
Chlamydia life cycle and appear to induce a stringent response in
Chlamydia causing the replicating phase to transform into cryptic
forms. This results in a persistent infection in vivo or in vitro
that can be demonstrated by PCR techniques which assess the
presence or absence of chlamydial DNA. Nevertheless, one or more of
these currently used agents, or a new agent directed against the
replicating phase of Chlamydia, should be included as one of the
chlamydial agents in a combination therapy in order to slow or halt
the transition of the EB to the RB as well as to inhibit chlamydial
replication.
[0098] Diseases Associated with Chlamydial Infection
[0099] An association has been discovered between chronic Chlamydia
infection of body fluids and/or tissues with several disease
syndromes of previously unknown etiology in humans which respond to
unique antichlamydial regimens described herein. To date, these
diseases include Multiple Sclerosis (MS), Rheumatoid Arthritis
(RA), Inflammatory Bowel Disease (IBD), Interstitial Cystitis (IC),
Fibromyalgia (FM), Autonomic nervous dysfunction (AND,
neural-mediated hypotension); Pyoderma Gangrenosum (PG), Chronic
Fatigue (CF) and Chronic Fatigue Syndrome (CFS). Other diseases are
under investigation. Correlation between Chlamydia infection and
these diseases has only recently been established as a result of
the diagnostic methodologies and combination therapies described
herein.
[0100] Based on this evidence, published evidence of an association
between atherosclerosis and Chlamydia (Grupta et al., Circulation
96:404-407 (1997)), and an understanding of the impact Chlamydia
infections have on infected cells and the immune systems, the
inventors have discovered a connection between Chlamydia and a
broad set of inflammatory, autoimmune, and immune deficiency
diseases. Thus, the invention describes methods for diagnosing
and/or treating disease associated with Chlamydia infection, such
as autoimmune diseases, inflammatory diseases and diseases that
occur in immunocompromised individuals by diagnosing and/or
treating the Chlamydia infection in an individual in need thereof,
using any of the assays or therapies described herein. Progress of
the treatment can be evaluated serologically, to determine the
presence or absence of Chlamydia using for example the diagnostic
methods provided herein, and this value can be compared to
serological values taken earlier in the therapy. Physical
improvement in the conditions and symptoms typically associated
with the disease to be treated should also be evaluated. Based upon
these evaluating factors, the physician can maintain or modify the
antichlamydial therapy accordingly. For example, the physician may
change an agent due to adverse side-effects caused by the agent,
ineffectiveness of the agent, or for other reason. When antibody
titers rise during treatment then alternate compounds should be
substituted in order to achieve the lower antibody titers that
demonstrate specific susceptability of the Chlamydia to the new
regimen. A replacement or substitution of one agent with another
agent that is effective against the same life stage of Chlamydia is
desirable.
[0101] The therapies described herein can thus be used for the
treatment of acute and chronic immune and autoimmune diseases when
demonstrated to have a Chlamydia load by the diagnostic procedures
described herein which include, but are not limited to, chronic
hepatitis, systemic lupus erythematosus, arthritis, thyroidosis,
scleroderma, diabetes mellitus, Graves' disease, Beschet's disease
and graft versus host disease (graft rejection). The therapies of
this invention can also be used to treat any disorders in which a
chlamydial species is a factor or co-factor.
[0102] Thus, the present invention can be used to treat a range of
disorders in addition to the above immune and autoimmune diseases
when demonstrated to be associated with Chlamydial infection by the
diagnostic procedures described herein; for example, various
infections, many of which produce inflammation as primary or
secondary symptoms, including, but not limited to, sepsis syndrome,
cachexia, circulatory collapse and shock resulting from acute or
chronic bacterial infection, acute and chronic parasitic and/or
infectious diseases from bacterial, viral or fungal sources, such
as a HIV, AIDS (including symptoms of cachexia, autoimmune
disorders, AIDS dementia complex and infections) can be treated, as
well as Wegners Granulomatosis.
[0103] Among the various inflammatory diseases, there are certain
features of the inflammatory process that are generally agreed to
be characteristic. These include fenestration of the
microvasculature, leakage of the elements of blood into the
interstitial spaces, and migration of leukocytes into the inflamed
tissue. On a macroscopic level, this is usually accompanied by the
familiar clinical signs of erythema, edema, tenderness
(hyperalgesia), and pain. Inflammatory diseases, such as chronic
inflammatory pathologies and vascular inflammatory pathologies,
including chronic inflammatory pathologies such as aneurysms,
hemorrhoids, sarcoidosis, chronic inflammatory bowel disease,
ulcerative colitis, and Crohn's disease and vascular inflammatory
pathologies, such as, but not limited to, disseminated
intravascular coagulation, atherosclerosis, and Kawasaki's
pathology are also suitable for treatment by methods described
herein. The invention can also be used to treat inflammatory
diseases such as coronary artery disease, hypertension, stroke,
asthma, chronic hepatitis, multiple sclerosis, peripheral
neuropathy, chronic or recurrent sore throat, laryngitis,
tracheobronchitis, chronic vascular headaches (including migraines,
cluster headaches and tension headaches) and pneumonia when
demonstrated to be pathogenically related to Chlamydia
infection.
[0104] Treatable disorders when associated with Chlamydia infection
also include, but are not limited to, neurodegenerative diseases,
including, but not limited to, demyelinating diseases, such as
multiple sclerosis and acute transverse myelitis; extrapyramidal
and cerebellar disorders, such as lesions of the corticospinal
system; disorders of the basal ganglia or cerebellar disorders;
hyperkinetic movement disorders such as Huntington's Chorea and
senile chorea; drug-induced movement disorders, such as those
induced by drugs which block CNS dopamine receptors; hypokinetic
movement disorders, such as Parkinson's disease; Progressive
supranucleo palsy; Cerebellar and Spinocerebellar Disorders, such
as astructural lesions of the cerebellum; spinocerebellar
degenerations (spinal ataxia, Friedreich's ataxia, cerebellar
cortical degenerations, multiple systems degenerations. (Mencel,
Dejerine-Thomas, Shi-Drager, and Machado Joseph)); and systemic
disorders (Refsum's disease, abetalipoprotemia, ataxia,
telangiectasia, and mitochondrial multi-system disorder);
demyelinating core disorders, such as multiple sclerosis, acute
transverse myelitis; disorders of the motor unit, such as
neurogenic muscular atrophies (anterior horn cell degeneration,
such as amyotrophic lateral sclerosis, infantile spinal muscular
atrophy and juvenile spinal muscular atrophy); Alzheimer's disease;
Down's Syndrome in middle age; Diffuse Lewy body disease; Senile
Dementia of Lewy body type; Wernicke-Korsakoff syndrome; chronic
alcoholism; Creutzfeldt-Jakob disease; Subacute sclerosing
panencephalitis, Hallerrorden-Spatz disease; and Dementia
pugilistica, or any subset thereof.
[0105] It is also recognized that malignant pathologies involving
tumors or other malignancies, such as, but not limited to leukemias
(acute, chronic myelocytic, chronic lymphocytic and/or
myelodyspastic syndrome); lymphomas (Hodgkin's and non-Hodgkin's
lymphomas, such as malignant lymphomas (Burkitt's lymphoma or
Mycosis fungoides)); carcinomas (such as colon carcinoma) and
metastases thereof; cancer-related angiogenesis; infantile
hemangiomas; alcohol-induced hepatitis. Ocular neovascularization,
psoriasis, duodenal ulcers, angiogenesis of the female reproductive
tract, can also be treated when demonstrated by the diagnostic
procedures described herein to be associated with Chlamydial
infection.
[0106] An immunocompromised individual is generally defined as a
person who exhibits an attenuated or reduced ability to mount a
normal cellular or humoral defense to challenge by infectious
agents, e.g., viruses, bacterial, fungi and protozoa. Persons
considered immunocompromised include malnourished patients,
patients undergoing surgery and bone narrow transplants, patients
undergoing chemotherapy or radiotherapy, neutropenic patients,
HIV-infected patients, trauma patients, burn patients, patients
with chronic or resistant infections such as those resulting from
myeloodysplastic syndrome, and the elderly, all of who may have
weakened immune systems. A protein malnourished individual is
generally defined as a person who has a serum albumin level of less
than about 3.2 grams per deciliter (g/dl) and/or unintentional
weight loss greater than 10% of usual body weight.
[0107] The course of therapy, serological results and clinical
improvements from compassionate antichlamydial therapy in patients
diagnosed with the diseases indicated were observed and are
reported in Example 5. The data provides evidence to establish that
treatment of Chlamydia infection results in the serological and
physical improvement of a disease state in the patient undergoing
combination therapy. These observations were consistent among a
variety of different diseases which fall within a generalized
disease class.
[0108] Other Diseases of Unknown Etiology with New Evidence for a
Chlamydia pneumoniae Etiology
[0109] Both C. trachomatis and C. psittaci exhibit a protean
disease complex dependent on different serovars. One known basis
for this diversity to date is the amino acid sequence of the MOMP.
FIG. 1 shows a sequence alignment of various Chlamydia MOMPs. Note
that the size and sequence are relatively homologous except for the
four variable regions that are responsible for the serovar
(serotype) basis of classification. Further, it has been discovered
that C. pneumoniae infects blood vessel endothelial cells from
which EBs are released in the blood stream. In addition,
macrophages are known targets for C. pneumoniae and may serve as
reservoirs and provide an additional mechanism of transmission. C.
pneumoniae is thus able to spread throughout the human body,
establishing infection in multiple sites and in multiple organ
systems. Infected sites may exist for an extended period without
inducing symptoms that are noticed by the patient or by an
examining physician. Sequence variability of MOMPs or other
chlamydial antigens may provide a basis for organ specificity while
other chlamydial proteins, such as the 60K and 70K heat shock
proteins or LPS, may influence immune response.
[0110] C. psittaci and C. pecorum are known to cause a host of
infections in economically significant animals. Thus, the teachings
of this invention are relevant to animals. Throughout this
application and for purposes of this invention, "patient" is
intended to embrace both humans and animals. Virtually all rabbits
and mice tested to date have PCR signals for C. pneumoniae. They
can be used as appropriate animal models for treatment using
specific combination antibiotics to improve therapy. (Banks et al.,
Ameri. J. of Obstetrics and Gynecology 138 (7Pt2):952-956 (1980));
(Moazed et al., Am. J. Pathol. 148(2):667-676 (1996)); (Masson et
al., Antimicrob. Agents Chemother. 39(9):1959-1964 (1995)); (Patton
et al., Antimicrob. Agents Chemother. 37(1):8-13 (1993)); (Stephens
et al., Infect. Immun. 35(2):680-684 (1982)); and (Fong et al., J.
Clin. Microbiol 35(1):48-52 (1997)).
[0111] Coupled with these developments are the recently developed
rabbit models of coronary artery disease, where rabbits exposed to
C. pneumoniae subsequently develop arterial plaques similar to
humans (Fong et al., J. Clin. Microbiol. 35:48-52 (1997)). Most
recently, a study at St. George's Hospital in London found that
roughly 3/4 of 213 heart attach victims have significant levels of
antibodies to C. pneumoniae antibody and that those that have such
antibodies achieve significantly lower rates of further adverse
cardiac events when treated with antibiotics (Gupta et al.,
Circulation 95:404-407 (1997)). Taken together, these three pieces
of evidence (the bacteria found in diseased tissue, inoculation
with the bacteria causes diseases, and treating for the bacteria
mitigates disease) make a case for a causal connection.
[0112] Adjunct Agents Used in Conjunction with the Combination
Therapy
[0113] In addition to the combination therapies discussed above,
other compounds can be co-administered to an individual undergoing
antichlamydial therapy for the management of chronic/systemic
infection. For example, it may be desirable to include one or a
combination of anti-inflammatory agents and/or immunosuppressive
agents to amelioriate side-effects that may arise in response to a
particular antichlamydial agent, e.g., Herxheimer reactions.
Initial loading with an anti-inflammatory steroid can be introduced
to minimize side-effects of the antichlamydial therapy in those
patients in which clinical judgment suggests the possibility of
serious inflammatory sequelae.
[0114] Suitable anti-inflammatory agents (steroidal and
nonsteroidal agents) include, but are not limited to, Prednisone,
Cortisone, Hydrocortisone and Naproxin. Preferably the
anti-inflammatory agent is a steroidal agent, such as Prednisone.
The amount and frequency of administration of these adjunct
compounds will depend upon patient health, age, clinical status and
other factors readily apparent to the medical professional.
[0115] Vitamin C (2 gms bid) has also been introduced based on the
report that Vitamin C (ascorbic acid) at moderate intracellular
concentrations stimulates replication of C. trachomatis (Wang et
al., J. Clin. Micro. 30:2551-2554 (1992)) as well as its potential
effect on biofilm charge and infectivity of the bacterium and
specifically the EB (Hancock, R. E. W., Annual Review in
Microbiology, 38:237-264 (1984)).
[0116] Modes of Administration
[0117] Based upon the ability of the combination therapy of this
invention to improve both the serological and physical status of a
patient undergoing treatment, pharmaceutical compositions or
preparations can be made comprising at least two different agents
chosen from the following groups: a) at least one agent effective
against elementary body phase of chlamydial life cycle (e.g.,
disulfide reducing agents); b) at least one agent effective against
replicating phase of chlamydial life cycle (e.g., antimycobacterial
agents); and c) at least one agent effective against cryptic phase
of chlamydial life cycle (e.g., anerobic bactericidal agents). As
discussed in greater detail below, the agents can be formulated in
a physiologically acceptable vehicle in a form which will be
dependent upon the method in which it is administered.
[0118] In another aspect, the invention pertains to a combination
of agents comprising at least two agents, each of which is
effective against a different phase of the chlamydial life cycle,
as previously discussed. The combination of antichlamydial can be
used in the management of chlamydial infection or prophylaxis
thereof to prevent recurrent infection. The combination of agents
can be in the form of an admixture, as a pack (discussed in detail
below) or individually, and/or by virtue of the instruction to
produce such a combination. It should be understood that
combination therapy can comprise multiple agents that are effective
within a particular phase of the chlamydial life cycle. The
combination of antichlamydial agents can further comprise
immunosuppressants, anti-inflammatory agents, vitamin C and
combinations thereof.
[0119] In a preferred embodiment, if only one antichlamydial agent
is elected to be used in an asymptomatic patient to reduce/prevent
chronic infection, this agent is a reducing agent, such as
penicillamine.
[0120] The novel therapeutic methods described herein can be used
to ameliorate conditions/symptoms associated with the disease
states described above, when the disease is onset or aggravated by
infection by Chlamydia. The agents of this invention can be
administered to animals including, but not limited to, fish,
amphibians, reptiles, avians and mammals including humans.
Compounds and agents described herein can be administered to an
individual using standard methods and modes which are typically
routine for the disease state.
[0121] Combination(s) of antichlamydial agents of this invention
can be used for the manufacture of a medicament for simultaneous,
separate or sequential use in managing chlamydial infection or
prophylaxis thereof. The agents can also be used for the
manufacture of a medicament for therapy of a disease associated
with chlamydia infection, such as autoimmune disease, inflammatory
disease, immunodeficiency disease.
[0122] The agents can be administered subcutaneously,
intravenously, parenterally, intraperitoneally, intradermally,
intramuscularly, topically, enteral (e.g., orally), rectally,
nasally, buccally, vaginally, by inhalation spray, by drug pump or
via an implanted reservoir in dosage formulations containing
conventional non-toxic, physiologically acceptable carriers or
vehicles. The preferred method of administration is by oral
delivery. The form in which it is administered (e.g., syrup,
elixir, capsule, tablet, solution, foams, emulsion, gel, sol) will
depend in part on the route by which it is administered. For
example, for mucosal (e.g., oral mucosa, rectal, intestinal mucosa,
bronchial mucosa) administration, via nose drops, aerosols,
inhalants, nebulizers, eye drops or suppositories can be used. The
compounds and agents of this invention can be administered together
with other biologically active agents.
[0123] In a specific embodiment, it may be desirable to administer
the agents of the invention locally to a localized area in need of
treatment; this may be achieved by, for example, and not by way of
limitation, local infusion during surgery, topical application
(e.g., for skin conditions such as psoriasis), transdermal patches,
by injection, by means of a catheter, by means of a suppository, or
by means of an implant, said implant being of a porous, non-porous,
or gelatinous material, including membranes, such as sialastic
membranes or fibers. For example, the agent can be injected into
the joints.
[0124] In a specific embodiment when it is desirable to direct the
drug to the central nervous system, techniques which can
opportunistically open the blood brain barrier for a time adequate
to deliver the drug there through can be used. For example, a
composition of 5% mannitose and water can be used. In another
embodiment, the agents can be delivered to a fetus through the
placenta since many of the agents are small enough to pass through
the placental barrier.
[0125] The present invention also provides pharmaceutical
compositions. Such compositions comprise a therapeutically (or
prophylactically) effective amount of the agent, and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The carrier and
composition can be sterile. The formulation should suit the mode of
administration.
[0126] Suitable pharmaceutically acceptable carriers include but
are not limited to water, salt solutions (e.g., NaCl), alcohols,
gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols,
gelatin, carbohydrates such as lactose, amylose or starch,
magnesium stearate, talc, silicic acid, viscous paraffin, perfume
oil, fatty acid esters, hydroxymethylcellulose, polyvinyl
pyrolidone, etc. The pharmaceutical preparations can be sterilized
and if desired, mixed with auxiliary agents, e.g., lubricants,
preservatives, stabilizers, wetting agents, emulsifiers, salts for
influencing osmotic pressure, buffers, coloring, flavoring and/or
aromatic substances and the like which do not deleteriously react
with the active compounds.
[0127] The composition, if desired, can also contain minor amounts
of wetting or emulsifying agents, or pH buffering agents. The
composition can be a liquid solution, suspension, emulsion, tablet,
pill, capsule, sustained release formulation, or powder. The
composition can be formulated as a suppository, with traditional
binders and carriers such as triglycerides. Oral formulation can
include standard carriers such as pharmaceutical grades of
mannitol, lactose, starch, magnesium stearate, polyvinyl
pyrollidone, sodium saccharine, cellulose, magnesium carbonate,
etc.
[0128] The composition can be formulated in accordance with the
routine procedures as a pharmaceutical composition adapted for
intravenous administration to human beings. Typically, compositions
for intravenous administration are solutions in sterile isotonic
aqueous buffer. Where necessary, the composition may also include a
solubilizing agent and a local anesthetic to ease pain at the site
of the injection. Generally, the ingredients are supplied either
separately or mixed together in unit dosage form, for example, as a
dry lyophilized powder or water free concentrate in a hermetically
sealed container such as an ampoule or sachette indicating the
quantity of active agent. Where the composition is to be
administered by infusion, it can be dispensed with an infusion
bottle containing sterile pharmaceutical grade water, saline or
dextrose/water. Where the composition is administered by injection,
an ampoule of sterile water for injection or saline can be provided
so that the ingredients may be mixed prior to administration.
[0129] For topical application, there are employed as nonsprayable
forms, viscous to semi-solid or solid forms comprising a carrier
compatible with topical application and having a dynamic viscosity
preferably greater than water. Suitable formulations include but
are not limited to solutions, suspensions, emulsions, creams,
ointments, powders, enemas, lotions, sols, liniments, salves,
aerosols, etc., which are, if desired, sterilized or mixed with
auxiliary agents, e.g., preservatives, stabilizers, wetting agents,
buffers or salts for influencing osmotic pressure, etc. The drug
may be incorporated into a cosmetic formulation. For topical
application, also suitable are sprayable aerosol preparations
wherein the active ingredient, preferably in combination with a
solid or liquid inert carrier material, is packaged in a squeeze
bottle or in admixture with a pressurized volatile, normally
gaseous propellant, e.g., pressurized air.
[0130] Agents described herein can be formulated as neutral or salt
forms. Pharmaceutically acceptable salts include those formed with
free amino groups such as those derived from hydrochloric,
phosphoric, acetic, oxalic, tartaric acids, etc., and those formed
with free carboxyl groups such as those derived from sodium,
potassium, ammonium, calcium, ferric hydroxides, isopropylamine,
triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
[0131] The amount of agents which will be effective in the
treatment of a particular disorder or condition will depend on the
nature of the disorder or condition, and can be determined by
standard clinical techniques. In addition, in vitro or in vivo
assays may optionally be employed to help identify optimal dosage
ranges. The precise dose to be employed in the formulation will
also depend on the route of administration, and the seriousness of
the disease or disorder, and should be decided according to the
judgment of the practitioner and each patient's circumstances.
Effective doses may be extrapolated from dose-response curves
derived from in vitro or animal model test systems.
[0132] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Optionally associated with such container(s) can be a notice in the
form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products,
which notice reflects approval by the agency of manufacture, use of
sale for human administration. The pack or kit can be labeled with
information regarding mode of administration, sequence of drug
administration (e.g., separately, sequentially or concurrently), or
the like. The pack or kit may also include means for reminding the
patient to take the therapy. The pack or kit can be a single unit
dosage of the combination therapy or it can be a plurality of unit
dosages. In particular, the agents can be separated, mixed together
in any combination, present in a single vial or tablet. Agents
assembled in a blister pack or other dispensing means is preferred.
For the purpose of this invention, unit dosage is intended to mean
a dosage that is dependent on the individual pharmacodynamics of
each agent and administered in FDA approved dosages in standard
time courses.
[0133] Diagnostic Reagents
[0134] The invention also provides a diagnostic reagent pack or kit
comprising one or more containers filled with one or more of the
ingredients used in the assays of the invention. Optionally
associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of diagnostic products, which notice reflects approval by
the aggency of manufacture, use of sale for human administration.
The pack or kit can be labeled with information regarding mode of
administration, sequence of execution (e.g., separately,
sequentially or concurrently), or the like. The pack or kit can be
a single unit assay or it can be a plurality of unit assays. In
particular, the agents can be separated, mixed together in any
combination, present in a single fial or tablet. For the purpose of
this invention, unit assays is intended to mean materials
sufficient to perform only a single assay.
[0135] The invention will be further illustrated by the following
non-limiting examples of diagnostic and therapeutic methods. All
percentages are by weight unless otherwise specified.
EXAMPLES
Example 1
Polymerase Chain Reaction (PCR) for the Full Length MOMP Gene of C.
pneumoniae and other Species of Chlamydia (Diagnostic)
[0136] a. Solution PCR
[0137] Serum, blood or tissue samples were pre-incubated in the
presence of 10 .mu.M dithiothreitol at room temperature for 2 hours
to reduce the disulfide bonds and facilitate release of the outer
shell of the elementary bodies. CSF and other body fluids are also
suitable for use as described. Other suitable reducing agents for
use in this step include, but are not limited to, succimer and
glutathione (e.g., including, but not limited to, glutathione
esters, other analogs and deriviatives). The failure to include a
reducing agent initially may result in a negative PCR signal
following the protease digestion step. Appropriate concentrations
of these reducing agents can be readily determined by the skilled
artisan without undue experimentation using the 10 .mu.M
concentration of dithiothreitol as a guideline. Alternatively,
guanidine isothiocyanate may be substituted for the disulfide
reduction/protease step. Table 6 shows the effect of various
reducing agents on susceptibility of EBs to proteinase K digestion
in order to allow DNA extraction for PCR amplification.
6TABLE 6 Effect of various reducing agents on susceptibility of EBs
to proteinase K digestion in order to allow DNA extraction for PCR
amplification. PCR PCR Reducing Agent Concentration Signal.sup.a
Reducing Agent Concentration Signal.sup.a Dithiothreitol 10 mM +
2,3-Dimercapto-1- 10 mM - 1 mM + Propone-sulfide acid 1 mM - 100
.mu.M + 100 .mu.M + 10 .mu.M + 10 .mu.M - 1 .mu.M + 1 .mu.M -
Succimer 10 mM - Meso-2,2'-Dimercapto 10 mM + 1 mM + adipic acid 1
mM + 100 .mu.M + 100 .mu.M + 10 .mu.M + 10 .mu.M + 1 .mu.M - 1
.mu.M - DL-Penicillamine 10 mM - Glutathione 10 mM - 1 mM - 1 mM
wk+ 100 .mu.M + 100 .mu.M - 10 .mu.M - 10 .mu.M +/- 1 .mu.M - 1
.mu.M +/- D-Penicillamine disulfide 10 mM + Control 0 - 1 mM - 100
.mu.M - 10 .mu.M - 1 .mu.M - .sup.aAll assays performed on control
serum #1154, which on repeated assay without reducing agents,
yields a negative PCR signal for the 1.2 kB MOMP gene of C.
pneumoniae. Analysis on agarose gel with ethidium bromide #
visualization under UV light.
[0138] Serum, blood, or tissue samples are lysed overnight at
37.degree. C. in the presence of SDS which inhibits DNAses and
proteinase K which digests protein (i.e., 2.times.cell lysis
buffer: 1% SDS, 0.2 M NaCl, 10 mM EDTA, 20 mM Tris-KCl, pH 7.5 plus
proteinase K to a final concentration of 20 mg/ml). Following
digestion, the lysate is extracted .times.1 with phenol followed by
chloroform extraction .times.2. DNA is precipitated from the final
aqueous phase by the addition of {fraction (1/10)} volume Na
acetate (3 M) and 2-2.5 volume of cold ethanol. The DNA is pelleted
by centrifugation and the DNA is resuspended in 10-20 ml water with
PCR amplification performed in the same microtube. The entire gene
of MOMP (1.2 kb) is amplified using the CHLMOMPDB2 coding strand
primer (5'-ATGAAAAAAC TCTTAAAGTC GGCGTTATTA TCCGCCGC; SEQ ID NO.
41) and the CHLMOMPCB2 complimentary strand primer (5'-TTAGAATCTG
AACTGACCAG ATACGTGAGC AGCTCTCTCG; SEQ ID NO. 42). Alternatively,
shortened primers can be used by making suitable modifications in
the primer:DNA hybridization temperature for PCR detection only.
The appropriate primer selection, however, may result in the
absence of signal if an unknown strain with mutations in one or
both primer binding regions is present. The frequency of positive
signals using the preferred primers which amplify the full length
MOMP gene suggests that mutations in these regions of C. pneumoniae
is rare. Standard conditions for this gene product in a 50-.mu.l
volume is 35 cycles with 1 second ramp times between steps of
94.degree. C. for 1 minute, 58.degree. C. for 2 minutes and
74.degree. C. for 3 minutes. The PCR reaction used 0.1 mM of each
primer in Vent buffer with 200 mM of each dNTP, and 1.0 U Vent DNA
polymerase. Amplified DNA is separated and identified by
electrophoresis in 1.2% agarose or 6% polyacrylamide gels run in
the TBE buffer (88 mM Tris-borate, 89 mM boric acid, 2 mM EDTA) at
120 volts for 1 hour. DNA bands are identified by ethidium bromide
staining and UV light detection. Product specificity has been
verified by restriction enzyme analysis of cleavage products as
well as DNA sequence analysis. Negative controls consist of
amplification of lysis buffer extracts. Extreme care must be
exercised to screen all components of the cell lysis and
amplification buffer components to exclude contaminant MOMP DNA
which are common contaminants in such lab and molecular biology
grade chemicals.
[0139] b. In situ PCR
[0140] This procedure identifies individual cells containing RB and
cryptic forms of C. pneumoniae. Cultured cells are adhered to glass
slides with formalin, or formalin fixed tissue sections embedded in
paraffin are adhered to glass slides and subjected to protease
digestion (i.e., pepsin, trypsin, chymotrypsin, or other specific
proteases). Each digestion time and pH (i.e., pepsin at pH 2.5 or
trypsin at pH 7-8, etc.) with a standard concentration of each
protease must be evaluated for each tissue type for optimal
digestion times. Protease activity is stopped by washing and/or pH
change and the target cells exposed to Taq polymerase, dNTPs, and
primers. For the MOMP gene the primers CHLMOMPDB2 and CHLMOMPCB2
have been engineered with a biotin at the 5'-terminus. For in situ
PCR, using biotin labels incorporated at the 5'-terminus of the
amplification primers, each DNA chain amplification results in each
double strand DNA containing 2 molecules of biotin. Standard
conditions of amplification are identical to solution PCR described
above. Following the end of the PCR cycle, the slides are washed
and exposed to strepavidin-.beta.-galactosidase (or other
strepavidin conjugated signal enzyme). Visualization of the
amplified MOMP gene is accomplished by bound enzyme hydrolysis of
soluble substrate yielding an insoluble product which can then be
visualized by standard light microscopy.
[0141] Alternatively, other specific DNA sequences, including
subsections of the full MOMP gene (e.g., subsections including gene
sequences for the peptides in FIG. 4) can be used, although the
above-described sequence is the preferred embodiment since the
large product produced (1.2 kb) prevents diffusion that may be
encountered with smaller DNA amplifications. Similarly, other
detection labels can be incorporated (i.e., fluorescein, for
example) at the 5'-end or dixoxigenin & UTP can be incorporated
within the amplified DNA. Alternatively to labeling the product,
specific hybridization probes to constant regions of the amplified
DNA can be used to identify an amplified product. This latter
method has particular utility for the construction of automated
laboratory equipment for solution-based PCR. For example,
strepavidin-coated ELISA plates can be used to capture one or both
strands of a biotin 5'-labeled DNA with detection by fluorescence
of a fluorescen or other incorporated fluorophore detection
probe.
Example 2
Enzyme Linked Immuno Sorbent Assay (ELISA; Diagnostic)
[0142] a. Recombinant MOMP-Based ELISA
[0143] The full length MOMP gene of C. pneumoniae was directionally
cloned into the pET expression plasmid at the NCOI and NOTI
restriction sites using primers to introduce these unique
restriction sites into the MOMP ends. Primer sequences are as
follows:
7 CPOMPDNCO (Coding strand): (SEQ ID NO. 43) 5' -AGCTTACCAT
GGCTAAAAAA CTCTTAAAGT CGGCGTTATT ATCCG-3' CPOMP_CNOT (complimentary
strand): (SEQ ID NO. 43) 5' -ATATGCGGCC GCTCATAGAA TCTGAACTGA
CCAGATACG-3'
[0144] The construction of the MOMP insert into the pET expression
vector (Novagen, Inc.) yields, on transformation of permissive E.
coli, an amino terminal thioredoxin fusion domain, a polyhistidine
for Ni.sup.+-affinity chromatography, a solubility sequence of
approximately 5 kD, and an endopeptidase cleavage site which yields
a full length MOMP with a modified amino terminal (as illustrated
in FIG. 2) containing an alanine insert between the amino terminal
methionine and the adjacent lysine. Either the full length
expressed recombinant fusion protein or the modified MOMP following
endopeptidase cleavage can be used as the antigen for a Chlamydia
species ELISA. Other expression systems in is E. coli or
Baculovirus can be used for synthesis of the MOMP protein as the
antigen in ELISA. The process is performed by non-covalent
attachment of 50 ng recombinant MOMP in each well (rows 1-11) of a
96 well microtiter plate (Immulon 4) in carbonate buffer at pH 9.5
with an overnight incubation at 4.degree. C. The plate is washed
with PBS, 0.15% Tween20.times.3 and is then blocked with PBS, 1%
BSA, 0.15% Tween, 20 at 300 ml per well for 1 hour at RT and then
washed .times.3 with PBS, 0.15% Tween20. Serum is serially diluted
in PBS in triplicate in a separate plate and 50 .mu.l of each well
transferred to corresponding wells of a MOMP ligand plate, and the
following sequence is followed: incubate at 37.degree. C. for 1
hour using a parafilm or other suitable cover to prevent
non-uniform evaporation. Wash with PBS, 1% FCS, 0.05%
NaN.sub.3.times.5. Incubate each well with a predetermined dilution
of biotin conjugated anti-human monoclonal IgG or monoclonal IgM.
Incubate at 37.degree. C. for 1 hour with cover. Wash (.times.3)
with PBS, 1% FCS, 0.05% NaN.sub.3. Follow with 50 .mu.l
strepavidin-alkaline phosphatase conjugate (1:200 in PBS, 1% BSA,
0.15% Tween20) for 1 hour at 37.degree. C. with cover. Wash
.times.3 with PBS, 1% CS (calf serum), 0.05% NaN.sub.3. Color is
developed with p-nitrophenyl phosphate in glycine buffer at pH 9.6.
The color yield is measured on a microtiter calorimeter using a 405
nm filter. The end point titer is the highest dilution of serum or
secretion yielding a color yield >3 SD over background (n=8).
Analysis is simplified by computer-generated end point antibody
titer or other antibody level measure identification and/or
quantity of specific antibody (IgG, IgM, or total Ig) in the test
sample using appropriate controls. Other strepavidin or avidin
enzyme conjugates can be substituted such as strepavidin peroxidase
or strepavidin-galactosidase with an approximate substitute
yielding a detectable color for quantitation.
[0145] b. Peptide-Based ELISA
[0146] The recombinant MOMP-based ELISA described above provides a
sensitive method for the quantitation of immunoglobulins against
the Chlamydia genus in serum, plasma, CSF, and other body fluids.
In order to provide ELISA assays that are species- and potentially
strain-specific for the various Chlamydia, two regions in the MOMP
have been identified which show minimal amino acid sequence
homologies and which are predicted by computer analysis
(Intelligenetics) to be excellent antigenic domains by virtue of
hydrophilicity and mobility on the solvent-accessible surface of
MOMP. FIG. 3 illustrates the constant and variable domain (VD) of
the various chlamydial species. The identified species-specific
antigenic domains are located in VD1 and VD2. FIG. 4 illustrates
the peptide amino acid sequences employed for the construction of
peptide based ELISAs with species specificity for VD1. FIG. 5
illustrates the peptides for VD2 which are used similarly to the
VD1 sequences. ELISA methodology parallels that described above for
the recombinant MOMP-based ELISA. In addition, a highly antigenic
domain (FIG. 6) common to all Chlamydia has been identified and was
developed as an alternative genus-specific ELISA for the Chlamydia.
Immunization of rabbits has verified the antigenicity of each
peptide to each peptide (Table 7). Monoclonal antibodies have
further verified the specificities and antigenicity of each peptide
(Table 7) as predicted by computer analysis of the
nucleotide-generated amino acid sequence of each species-specific
MOMP.
8TABLE 7 Antigenic Responses To Peptides From 4 Species Of
Chlamydiae Identified By Hydrophilicity And Peptide Movement As
Highly Antigenic Chlamydiae Titer.sup.a Species Peptide.sup.b Pre
Post c. pneumoniae 90-105 100 >3200 c. trachomatis L2 91-106 800
>3200 c. psittaci 92-106 400 >3200 c. trachomatis (mouse)
89-105 0 >3200 c. pneumoniae 158-171 25 >3200 c. trachomatis
L2 159-175 200 >3200 c. psittaci 160-172 100 >3200 c.
trachomatis (mouse) 158-171 800 >3200 c. pneumoniae 342-354 200
>3200 c. trachomatis L2 342-354 100 >3200 c. psittaci
ND.sup.c c. trachomatis (mouse) ND.sup.c .sup.aReciprocal titer
.sup.bImmunogenic peptide and ELISA antigen of specific amino acid
sequence against the indicated pre-immunization and
post-immunization rabbit serum .sup.cND, not done
[0147] Table 8 illustrates reciprocal titers of a polyclonal and
monoclonal antibody against C. trachomatis cross-reactive against
C. pneumoniae peptide encompassing amino acids 342-354 and a
recombinant full length MOMP from C. pneumoniae.
9TABLE 8 Reciprocal titers of a polyclonal and a monoclonal
antibody against C. trachomatis cross-reactive against C.
pneumoniae peptide encompassing amino acids 342-354 and a
recombinant full length MOMP from C. pneumoniae Titer.sup.a Antigen
Polyclonal Ab.sup.b Monoclonal Ab.sup.c CPN Momp.sup.d 400 0 CPN
90-105.sup.e 50 0 CPN 158-171.sup.f 50 0 CPN 342-354.sup.g >3200
1600 .sup.aReciprocal titer .sup.bPolyclonal goat Ab from Chemicon
Inc. against MOMP of C. trachomatis .sup.cMonoclonal Ab (ICN, Inc.)
against MOMP of C. trachomatis .sup.dC. pneumoniae recombinant MOMP
.sup.eAmino acid peptide 90-105 of C. pneumoniae .sup.fAmino acid
peptide 158-171 of C. pneumoniae .sup.gAmino acid peptide 342-354
of C. pneumoniae
Example 3
Detection Assay Methods (Diagnostic)
[0148] a. Immunoglobulin (Ig) Assay
[0149] C. pneumoniae EBs were grown in primary human umbilical vein
endothelial cells (HuEVEC; early passage), HeLa 199, or a suitable
alternative in the presence of 1 .mu.g/ml cycloheximide at
35.degree. C. under 5% CO.sub.2. Permissive cells were lysed at 3
days, thereby liberating EBs. The latter were harvested from
infection flasks, sonicated, and cellular debris were removed after
sonication by a low speed centrifugation (.about.600.times.g) for 5
minutes. EBs were pelleted by high speed centrifugation
(30,000.times.g) for 30 minutes at 4.degree. C. The EB pellet was
washed with PBS .times.1 and was reconstituted in 2 ml PBS per four
25-cm.sup.2 culture flask and sonicated at maximum power for 20
seconds and a 0.5 cycle time using a Braun-Sonic U sonicator. EB
protein concentration was determined by the Bradford method and the
sonicated infectious EB suspension was rendered non-infectious by
the addition of 37% formaldehyde to a final 10% formaldehyde
concentration with constant agitation during addition.
Formalin-treated EBs were added to 96-well plates at 50 .mu.l per
well containing 50 ng EB (total of 5 .mu.g/plate) and air dried.
The plate was washed with PBS-0.15% Tween20 .times.3 and was then
blocked with PBS-1% BSA-0.15% Tween20 at 300 .mu.l per well for 1
hour at room temperature and then washed .times.3 with PBS-0.15%
Tween20. Serum was serially diluted in PBS in duplicate in a
separate plate and 50 .mu.l of each well transferred to
corresponding wells of a MOMP ligand plate and the following
sequence was followed: incubate at 37.degree. C. for 1 hour using a
parafilm cover; wash with PBS-1% FCS-0.05% NaN3 .times.5; incubate
each well with a predetermined dilution of biotin-conjugated,
antihuman monoclonal IgG or monoclonal IgM; incubate at 37.degree.
C. for 1 hour with cover; wash (.times.3) with PBS, 1% FCS, 0.05%
NaN3; follow with 50 .mu.l strepavidin-alkaline phosphatase
conjugate (1:200 in PBS-1% BSA-0.15% Tween20) for 1 hour at
37.degree. C. with cover; and wash .times.3 with PBS, 1% CS, 0.05%
NaN3. Color was developed with p-nitrophenyl phosphate in glycine
buffer at pH 9.6. The color yield was measured on a Flow microtiter
calorimeter using a 405 nm filter. End point titer was the highest
dilution of serum or secretion yielding a color yield >3 SD over
background (n=8).
[0150] b. Western Blot
[0151] Western blots were prepared by SDS-PAGE of C. pneumoniae EBs
(non-formalin fixed) harvested from infected HuEVEC or HeLa cell
lysates, electrophoresed under standard SDS-PAGE conditions, and
transferred to nitrocellulose achieved with an active diffusion
transfer. Albumin-blocked strips were prepared from nitrocellulose
sheets and incubated 1 hour with 1.2 ml of a 1:40 dilution of test
serum. Detection was achieved with an alkaline
phosphatase-conjugated, mouse anti-human antibody, and developed
with 5-bromo-4-chloro-3'-indolyphosphate p-toluidine/nitro-blue
tetrazolium chloride (BCIP/NBT, Pierce Chemical Company).
Polyclonal animal anti-human antibodies can alternatively be
used.
[0152] c. Antigen Capture Assay for Chlamydial MOMP
[0153] The peptides described in FIGS. 3-5 were conjugated via
disulfide bonding to keyhole limpet hemocyanin (KLH) by standard
methods (Bernatowicz et al., Anal. Biochem. 155 (1):95-102 (1986)).
The peptide conjugates in alum were used to generate polyclonal
and/or monoclonal antibodies to the species-specific domains of
MOMP which is used as a capture antibody in 96 well microtiter
plates. Final configuration can follow a number of alternative
routes to yield quantitation of MOMP in body fluids. The favored
configuration utilizes biotin labeled recombinant MOMP in a
competition assay with strepavidin/alkaline phosphatase generated
color development based on the quantity of biotinylated recombinant
MOMP displaced by unlabeled MOMP in body fluids.
Example 4
In vitro Antimicrobial Susceptibility Testing for C. pneumoniae
[0154] Tissue culture cells containing cryptic phase C. pneumoniae
(H-292, HeLa, HEL, HuEVEC, McCoy, etc.) are plated at subconfluency
in a 96-well microtiter plate (flasks or plates or other
configurations can be alternatively used) and cultured in the
presence of various antibiotics (singly and in combination) with
the medium changed daily. Analysis of chlamydiacidal activity is
carried out by assessing loss of solution PCR signal, or relative
activity can be quantified by dilution titer of the starting
material using the absence of PCR signal as the endpoint titer
(i.e., last dilution to yield specific PCR signal).
[0155] Two week exposure of single agents including the
fluoroquinolone, ofloxacin, and the macrolide, clarithromycin, at 1
.mu.g/ml failed to clear HeLa cells in culture of a detectable PCR
signal for the MOMP gene of Chlamydia pneumoniae. In contrast,
triple agents consisting of isoniazid (INH), metronidazole, and
penicillamine (1 .mu.g/ml each) resulted in no detectable PCR
signal (Table 9). None of these agents, effective in the triple
combination, is currently recognized as an antichlamydial
agent.
[0156] Table 10 provides the results of an expanded study of
antimicrobial susceptibilities at two different concentrations of
antimicrobial agents, used alone and in combination, when exposed
to the antimicrobial agents for two weeks. In addition to the
agents already mentioned, minocycline, doxycycline, rifampin and
sulfamethoxizole/trimethoprim, at all concentrations tested, failed
to clear the PCR signal for chlamydial MOMP. Only the triple
combination of isoniazid, metronidazole and penicillamine cleared
the PCR signal. The triple combination was effective at both low
and high concentrations. Table 10 also demonstrates the effect of a
4 week exposure with the same expanded series of antimicrobial
agents alone and in combination. A number of triple combinations of
antimicrobial agents resulted in cell cultures in which the PCR
signal for the chlamydial MOMP gene could not be detected.
10TABLE 9 Susceptibility to Antibiotics for Cryptic Chlamydia
pneumoniae Cultured in HeLa Cells.sup.a Antibiotic Conc (.mu.g/ml)
PCR.sup.b Ofloxacin 1 positive Clarithromycin 1 positive INH 1
positive Metronidazole 1 positive Penicillamine 1/1 positive INH +
Metronidazole + Penicillamine 1/1/4 negative Control 0 positive
.sup.aCultured in the presence of the indicated antibiotic(s), but
with no cycloheximide. Media changes at 48-72 hours. .sup.bAnalysis
following 2 week exposure to antimicrobial agents.
[0157]
11TABLE 10 Susceptibility to Antibiotics for Cryptic Chlamydia
pneumoniae Cultured in HeLa Cells.sup.a by PCR Conc Antibiotic
(.mu.g/ml) PCR 2 week PCR 4 week Minocycline 1 pos pos Doxycycline
1 pos pos Isoniazide 1 pos pos TMP/SMZ.sup.b 100 pos pos
Minocycline + Metronidazole + penicillamine 1/1/4 pos pos
Doxycyclin + Metronidazole + penicillamine 1/1/4 pos neg Isoniazid
+ Metronidazole + penicillamine 1/1/4 neg neg TMP/SMZ +
Metronidazole + penicillamine 100/1/4 pos neg Metronidazole 0.25
pos pos Clarithromycin 0.25 pos pos Rifampin 0.25 pos pos Ofloxacin
0.25 pos pos Minocycline 0.25 pos pos Doxycycline 0.25 pos pos
TMP/SMZ + Metronidazole 25/0.25 pos pos Ofloxacin + Metronidazole
0.25/0.25 pos pos Rifampin + Metronidazole + penicillamine
0.25/0.25/4 pos pos Rifampin + Metronidazole + Ofloxacin
0.25/0.25/0.25 pos pos Clarithromycin + Metronidazole +
penicillamine 0.25/0.25/1 pos neg Doxycycline + Metronidazole +
penicillamine 0.25/0.25/1 pos pos Minocycline + Metronidazole +
penicillamine 0.25/0.25/1 pos neg Isoniazid + Metronidazole +
penicillamine 0.25/0.25/1 neg neg TMP/SMZ 25 pos pos Rifampin +
Metronidazole 0.25/0.25 pos pos None 0 pos pos .sup.aCultured in
the presence of the indicated antibiotics, but with no
cycloheximide. Media changes at 48-72 hours. pos = positive; neg =
negative .sup.bTMP/SMZ = trimethoprim/sulfamethoxazole
[0158] Response to Antibiotic Therapy
[0159] Table 11 illustrates typical responses to combination
antibiotic therapy in a variety of patients with diagnostic
evidence of an active infection by C. pneumoniae. Unlike typical
immune responses to infection with infectious agents, most of the
included patients have not only detectable IgM titers against the
chlamydial genus but in many cases very high IgM titers. With
specific therapy over time the IgM titers generally fall, with a
rise in IgG titer (as expected). Correct methods of defecting
antibodies against C. pneumoniae (Indirect immunofluoresence, IMF)
are incapable of accurately identifying high ISM titers against C.
pneumoniae. Moreover, current procedures are genus specific and not
species specific as are peptide-based ELISAs. With clearing of the
pathogen, the IgG titers fall. Concomitant with combination
antibiotic therapy, there is generally an improvement of patient
symptoms associated with the specific diagnosis indicative of
evidence of an active chlamydial infection.
12TABLE 11 Serological and PCR Responses to Combination Antibiotic
Therapy Titer Months of Combination Patient Diagnosis.sup.a IgM IgG
Antibiotic Therapy PCR Status PH FM 800 800 6 months + Asymptomatic
3200 1600 + 800 200 wk+ BL MS 2000 500 9 months + Dramatic 400 3200
wk+ Improvement MM CFS/AND 3200 800 1 month + Improvement; 400 1600
+ Relapse (non- compliant) PM CFS 2000 25 6 months + Asymptomatic
400 800 wk+ AM IBD 800 0 6 months wk+ 90% 3200 400 + Improvement FO
MS 800 3200 10 months st+ Improvement 800 800 + in speeds and 400
800 wk+ bowl continence 400 800 + WM CF 25 25 Pre-illness serum wk+
Asymptomatic 1000 25 <--Antibiotics start st+ 50 800 + 50 1600
wk+ 50 400 - HM CF 2000 100 6 months + Asymptomatic 3200 3200 + 200
800 wk+ CN CFS 3200 800 8 months + 75% 800 800 wk+ Improvement AN
MS/CFS 400 400 wk+ Strength .Arrow-up bold. 200 3200 st+ Fatigue
.dwnarw. JS CFS 2000 2000 5 months st+ Asymptomatic (severe) 2000
2000 + 200 800 - AG IBD 3200 400 9 months + Improvement 800 400 +
in joint Sx 800 800 + 800 400 - AT CF 3200 3200 9 months +
Asymptomatic 1600 1600 + 1600 1600 + 800 800 + 400 400 + LH RA 3200
1600 6 months wk+ Improvement 800 400 wk+ 200 50 + HS MS 2000 400 5
months + Improvement 3200 800 + 50 200 - ST CFS/FM >1000 100 7
months wk+ Asymptomatic 1000 100 wk+ 400 100 + 800 3200 + 100 100 +
RV CF 1000 100 10 months + Asymptomatic 400 1600 + 400 400 -
.sup.aCF = Chronic Fatigue < 6 months CFS = Chronic Fatigue
Syndrome FM = Fibromyalgia IBD = Inflammatory Bowel Disease MS =
Multiple Sclerosis AND = Autonomic nervous dysfunction
(neural-mediated hypotension) RA = Rheumatoid Arthritis IgM
>> IgG .fwdarw. immune tolerance to the antigen IgG >>
IgM .fwdarw. successful immune control of the antigen
[0160] Although the foregoing description is directed toward
Chlamydia, it is merely for exemplary purposes and is not intended
to limit the invention thereto. The invention therefore is relevant
for other to obligate intracellular pathogens. For example,
pathogens that must be in an intracellular location in order to
replicate, include but are not limited to prions, viruses,
Chlamydiae spp., Mycoplasma spp., Ehrilichia spp., Rickettsia spp.,
Bartinella spp., Borrelia spp., Toxoplasma gondii, Leishmania spp.
and Trypanosomes (e.g., Malaria). Additionally, included are
pathogens that are able to survive in an intracellular location and
can find a physiologic advantage to do so, for example, Legionella
spp., Salmonella spp., Listeria spp., Histoplasma spp., Yersinia
spp. and Mycobacteria spp. Intracellular pathogens that are able to
utilize selective intracellular locations to enhance survivability
and/or pathogenics, are embraced in this invention and include but
are not limited to Neisseria spp., Staphylococcus spp., Hemophilus
spp., Escherichia coli, Candida spp. and Torulopsis spp.
[0161] Equivalents
[0162] While this invention has been particularly shown and
described with references to preferred embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
spirit and scope of the invention as defined by the appended
claims. Those skilled in the art will recognize or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
specifically herein. Such equivalents are intended to be
encompassed in the scope of the claims.
Sequence CWU 1
1
114 1 50 DNA Homo sapiens 1 atgaaaaaac tcttaaagtc ggcgttatta
tccgccgcat ttgctggttc 50 2 50 DNA Homo sapiens 2 atgaaaaaac
tcttaaagtc ggcgttatta tccgccgcat ttgctggttc 50 3 50 DNA Homo
sapiens 3 atgaaaaaac tcttgaagtc ggcattattg tttgccgcta cgggttccgc 50
4 50 DNA Homo sapiens 4 atgaaaaaac tcttaaagtc ggcgttatta tccgccgcat
ttgctggttc 50 5 50 DNA Homo sapiens 5 atgaaaaaac tcttgaaatc
ggcattattg tttgccgcta cgggttccgc 50 6 50 DNA Homo sapiens 6
atgaaaaaac tcttgaaatc ggcattattg tttgccgcta cgggttccgc 50 7 50 DNA
Homo sapiens 7 atgaaaaaac tcttgaaatc ggcattattg tttgccgcta
cgggttccgc 50 8 50 DNA Homo sapiens 8 atgaaaaaac tcttgaaatc
ggcattatta tttgccgcta cgggttccgc 50 9 50 DNA Homo sapiens 9
atgaaaaaac tcttaaaatc ggcattatta tttgccgctg cgggttccgc 50 10 50 DNA
Homo sapiens 10 atgaaaaaac tcttgaaatc ggtattagta tttgccgctt
tgagttctgc 50 11 50 DNA Homo sapiens 11 atgaaaaaac tcttgaaatc
ggtattagta tttgccgctt tgagttctgc 50 12 50 DNA Homo sapiens 12
atgaaaaaac tcttgaaatc ggtattagta tttgccgctt tgagttctgc 50 13 50 DNA
Homo sapiens 13 atgaaaaaac tcttgaaatc ggtattagta tttgccgctt
tgagttctgc 50 14 50 DNA Homo sapiens 14 atgaaaaaac tcttgaaatc
ggtattagta tttgccgctt tgagttctgc 50 15 50 DNA Homo sapiens 15
atgaaaaaac tcttgaaatc ggtattagta tttgccgctt tgagttctgc 50 16 50 DNA
Homo sapiens 16 atgaaaaaac tcttgaaatc ggtattagtg tttgccgctt
tgagttctgc 50 17 50 DNA Homo sapiens 17 atgaaaaaac tcttgaaatc
ggtattagtg tttgccgctt tgagttctgc 50 18 50 DNA Homo sapiens 18
atgaaaaaac tcttgaaatc ggtattagtg tttgccgctt tgagttctgc 50 19 50 DNA
Homo sapiens 19 atgaaaaaac tcttgaaatc ggtattagca tttgccgttt
tgggttctgc 50 20 50 DNA Homo sapiens 20 gtttaattaa cgagagagct
gctcacgtat ctggtcagtt cagattctaa 50 21 50 DNA Homo sapiens 21
gtttaattaa cgagagagct gctcacgtat ctggtcagtt cagattctaa 50 22 50 DNA
Homo sapiens 22 caacgttaat cgacgctgac aaatggtcaa tcactggtga
agcacgctta 50 23 50 DNA Homo sapiens 23 gtttaattaa cgagagagct
gctcacatat ctggtcagtt cagattctaa 50 24 50 DNA Homo sapiens 24
aacgttaatc gacgctgaca aatggtcaat cactggtgaa gcacgcttaa 50 25 50 DNA
Homo sapiens 25 aacgttaatc gacgctgaca aatggtcaat cactggtgaa
gcacgcttaa 50 26 50 DNA Homo sapiens 26 gcttaatcaa tgaaagagcc
gctcacatga atgctcaatt cagattctaa 50 27 50 DNA Homo sapiens 27
gcttaatcaa tgaaagagct gctcacatga atgctcaatt cagattctaa 50 28 50 DNA
Homo sapiens 28 gcttaatcga cgaaagagct gctcacatta atgctcaatt
cagattctaa 50 29 50 DNA Homo sapiens 29 cgcagttaca gttgagactc
gcttgatcga tgagagagca gctcacgtaa 50 30 50 DNA Homo sapiens 30
gcttgatcga tgagagagca ggtcacgtaa atgcacaatt ccggttctaa 50 31 50 DNA
Homo sapiens 31 gcttgatcga tgagagagca gctcacgtaa atgcacaatt
ccgcttctaa 50 32 50 DNA Homo sapiens 32 cgcttgatcg atgagagact
gctcacgtaa atgcacaatt ccgcttctaa 50 33 50 DNA Homo sapiens 33
gcttgatcga tgagagagct gctcacgtaa atgcacaatt ccgcttctaa 50 34 50 DNA
Homo sapiens 34 gcttgatcga tgagagagca gctcacgtaa atgcacaatt
ccgcttctaa 50 35 50 DNA Homo sapiens 35 gcttgatcga tgagagagct
gctcacgtaa atgcacaatt ccgcttctaa 50 36 49 DNA Homo sapiens 36
cttgatcgat gagagagctg ctcacgtaaa tgcacaattc cgcttctaa 49 37 50 DNA
Homo sapiens 37 gcttgatcga tgagagagca gctcacgtaa atgcacaatt
ccgcttctaa 50 38 50 DNA Homo sapiens 38 gcttgatcga tgaaagagca
gctcacgtaa atgctcagtt ccgtttctaa 50 39 22 DNA Homo sapiens 39
cagatacgtg agcagctctc tc 22 40 25 DNA Homo sapiens 40 ctcttaaagt
cggcgttatt atccg 25 41 38 DNA Homo sapiens 41 atgaaaaaac tcttaaagtc
ggcgttatta tccgccgc 38 42 40 DNA Homo sapiens 42 ttagaatctg
aactgaccag atacgtgagc agctctctcg 40 43 45 DNA Homo sapiens 43
agcttaccat ggctaaaaaa ctcttaaagt cggcgttatt atccg 45 44 39 DNA Homo
sapiens 44 atatgcggcc gctcatagaa tctgaactga ccagatacg 39 45 100 PRT
Homo sapiens 45 Met Lys Lys Leu Leu Lys Ser Val Leu Val Phe Ala Ala
Leu Ser Ser 1 5 10 15 Ala Ser Ser Leu Gln Ala Leu Pro Val Gly Asn
Pro Ala Glu Pro Ser 20 25 30 Leu Met Ile Asp Gly Ile Leu Trp Glu
Gly Phe Gly Gly Asp Pro Cys 35 40 45 Asp Pro Cys Thr Thr Trp Cys
Asp Ala Ile Ser Met Arg Met Gly Tyr 50 55 60 Tyr Gly Asp Phe Val
Phe Asp Arg Val Leu Gln Thr Asp Val Asn Lys 65 70 75 80 Glu Phe Gln
Met Gly Ala Lys Pro Thr Thr Ala Thr Gly Asn Ala Ala 85 90 95 Ala
Pro Ser Thr 100 46 100 PRT Homo sapiens 46 Met Lys Lys Leu Leu Lys
Ser Val Leu Val Phe Ala Ala Leu Ser Ser 1 5 10 15 Ala Ser Ser Leu
Gln Ala Leu Pro Val Gly Asn Pro Ala Glu Pro Ser 20 25 30 Leu Met
Ile Asp Gly Ile Leu Trp Glu Gly Phe Gly Gly Asp Pro Cys 35 40 45
Asp Pro Cys Thr Thr Trp Cys Asp Ala Ile Ser Met Ile Met Gly Tyr 50
55 60 Tyr Gly Asp Phe Val Phe Asp Arg Val Leu Lys Thr Asp Val Asn
Lys 65 70 75 80 Glu Phe Gln Met Gly Ala Lys Pro Thr Thr Thr Thr Gly
Asn Ala Ala 85 90 95 Ala Pro Ser Thr 100 47 100 PRT Homo sapiens 47
Met Lys Lys Leu Leu Lys Ser Val Leu Val Phe Ala Ala Leu Ser Ser 1 5
10 15 Ala Ser Ser Leu Gln Ala Leu Pro Val Gly Asn Pro Ala Glu Pro
Ser 20 25 30 Leu Met Ile Asp Gly Ile Leu Trp Glu Gly Phe Gly Gly
Asp Pro Cys 35 40 45 Asp Pro Cys Thr Thr Trp Cys Asp Ala Ile Ser
Met Arg Met Gly Tyr 50 55 60 Tyr Gly Asp Phe Val Phe Asp Arg Val
Leu Glu Thr Asp Val Asn Lys 65 70 75 80 Glu Phe His Met Gly Ala Lys
Pro Thr Thr Asp Thr Gly Asn Ser Ala 85 90 95 Ala Pro Leu Thr 100 48
100 PRT Homo sapiens 48 Met Lys Lys Leu Leu Lys Ser Val Leu Val Phe
Ala Ala Leu Ser Ser 1 5 10 15 Ala Ser Ser Leu Gln Ala Leu Pro Val
Gly Asn Pro Ala Glu Pro Ser 20 25 30 Leu Met Ile Asp Gly Ile Leu
Trp Glu Gly Phe Gly Gly Asp Pro Cys 35 40 45 Asp Pro Cys Thr Thr
Trp Cys Asp Ala Ile Ser Met Ile Met Gly Tyr 50 55 60 Tyr Gly Asp
Phe Val Phe Asp Arg Val Leu Lys Thr Asp Val Asn Lys 65 70 75 80 Glu
Phe His Met Gly Asp Lys Pro Thr Ser Thr Thr Gly Asn Ala Thr 85 90
95 Ala Pro Thr Thr 100 49 100 PRT Homo sapiens 49 Met Lys Lys Leu
Leu Lys Ser Val Leu Val Phe Ala Ala Leu Ser Ser 1 5 10 15 Ala Ser
Ser Leu Gln Ala Leu Pro Val Gly Asn Pro Ala Glu Pro Ser 20 25 30
Leu Met Ile Asp Gly Ile Leu Trp Glu Gly Phe Gly Gly Asp Pro Cys 35
40 45 Asp Pro Cys Thr Thr Trp Cys Asp Ala Ile Ser Met Ile Met Gly
Tyr 50 55 60 Tyr Gly Asp Phe Val Phe Asp Arg Val Leu Lys Thr Asp
Val Asn Lys 65 70 75 80 Glu Phe His Met Gly Asp Lys Pro Thr Ala Thr
Thr Gly Asn Ala Ala 85 90 95 Ala Pro Ser Thr 100 50 101 PRT Homo
sapiens 50 Met Lys Lys Leu Leu Lys Ser Val Leu Val Phe Ala Ala Leu
Ser Ser 1 5 10 15 Ala Ser Ser Leu Gln Ala Leu Pro Val Gly Asn Pro
Ala Glu Pro Ser 20 25 30 Leu Met Ile Asp Gly Ile Leu Trp Glu Gly
Phe Gly Gly Asp Pro Cys 35 40 45 Asp Pro Cys Thr Thr Trp Cys Asp
Ala Ile Ser Met Ile Met Gly Tyr 50 55 60 Tyr Gly Asp Phe Val Phe
Asp Arg Val Leu Lys Thr Asp Val Asn Lys 65 70 75 80 Glu Phe Lys Met
Gly Glu Ala Leu Ala Gly Ser Thr Gly Asn Thr Thr 85 90 95 Ser Thr
Leu Ser Lys 100 51 103 PRT Homo sapiens 51 Met Lys Lys Leu Leu Lys
Ser Val Leu Val Phe Ala Ala Leu Ser Ser 1 5 10 15 Ala Ser Ser Leu
Gln Ala Leu Pro Val Gly Asn Pro Ala Glu Pro Ser 20 25 30 Leu Met
Ile Asp Gly Ile Leu Trp Glu Gly Phe Gly Gly Asp Pro Cys 35 40 45
Asp Pro Cys Thr Thr Trp Cys Asp Ala Ile Ser Met Val Met Gly Tyr 50
55 60 Tyr Gly Asp Phe Val Phe Asp Arg Val Leu Lys Thr Asp Val Asn
Lys 65 70 75 80 Glu Phe Gln Met Gly Ala Ala Pro Thr Thr Ser Asp Val
Ala Ala Gly 85 90 95 Leu Gln Asn Asp Pro Thr Ile 100 52 102 PRT
Homo sapiens 52 Met Lys Lys Leu Leu Lys Ser Val Leu Val Phe Ala Ala
Leu Ser Ser 1 5 10 15 Ala Ser Ser Leu Gln Ala Leu Pro Val Gly Asn
Pro Ala Glu Pro Ser 20 25 30 Leu Met Ile Asp Gly Ile Leu Trp Glu
Gly Phe Gly Gly Asp Pro Cys 35 40 45 Asp Pro Cys Thr Thr Trp Cys
Asp Ala Ile Ser Met Arg Met Gly Tyr 50 55 60 Tyr Gly Asp Phe Val
Phe Asp Arg Val Leu Lys Thr Asp Val Asn Lys 65 70 75 80 Glu Phe Gln
Met Gly Ala Ala Pro Thr Thr Arg Asp Val Ala Gly Leu 85 90 95 Glu
Lys Asp Pro Val Val 100 53 97 PRT Homo sapiens 53 Met Lys Lys Leu
Leu Lys Ser Val Leu Val Phe Ala Ala Leu Ser Ser 1 5 10 15 Ala Ser
Ser Leu Gln Ala Leu Pro Val Gly Asn Pro Ala Glu Pro Ser 20 25 30
Leu Met Ile Asp Gly Ile Leu Trp Glu Gly Phe Gly Gly Asp Pro Cys 35
40 45 Ala Pro Cys Thr Thr Trp Cys Asp Ala Ile Ser Met Val Met Gly
Tyr 50 55 60 Tyr Gly Asp Phe Val Phe Asp Arg Val Leu Lys Thr Asp
Val Asn Lys 65 70 75 80 Glu Phe Gln Met Gly Ala Ala Pro Thr Thr Asn
Asp Ala Ala Pro Lys 85 90 95 Thr 54 102 PRT Homo sapiens 54 Met Lys
Lys Leu Leu Lys Ser Val Leu Val Phe Ala Ala Leu Ser Ser 1 5 10 15
Ala Ser Ser Leu Gln Ala Leu Pro Val Gly Asn Pro Ala Glu Pro Ser 20
25 30 Leu Met Ile Asp Gly Ile Leu Trp Glu Gly Phe Gly Gly Asp Pro
Cys 35 40 45 Asp Pro Cys Thr Thr Trp Cys Asp Ala Ile Ser Met Val
Met Gly Tyr 50 55 60 Tyr Gly Asp Phe Val Phe Asp Arg Val Leu Lys
Thr Asp Val Asn Lys 65 70 75 80 Glu Phe Gln Met Gly Ala Glu Pro Thr
Thr Ser Asp Thr Ala Gly Leu 85 90 95 Ser Asn Asp Pro Thr Thr 100 55
100 PRT Homo sapiens 55 Met Lys Lys Leu Leu Lys Ser Val Ala Val Phe
Val Ala Gly Ser Ser 1 5 10 15 Ala Ser Ser Leu His Ala Leu Pro Val
Gly Asn Pro Ala Glu Pro Ser 20 25 30 Leu Met Ile Asp Gly Ile Leu
Trp Glu Gly Phe Gly Gly Asp Pro Cys 35 40 45 Asp Pro Cys Thr Thr
Trp Cys Asp Ala Ile Ser Met Arg Met Gly Leu 50 55 60 Tyr Leu Asp
Phe Val Phe Asp Arg Val Leu Lys Thr Asp Val Asn Lys 65 70 75 80 Gln
Phe Glu Met Gly Ala Ala Pro Thr Gly Asp Ala Asp Leu Thr Thr 85 90
95 Ala Pro Thr Pro 100 56 99 PRT Homo sapiens 56 Met Lys Lys Leu
Leu Lys Ala Val Leu Ala Phe Ala Phe Ala Gly Ser 1 5 10 15 Val Gly
Ser Leu Gln Ala Leu Pro Val Gly Asn Pro Ala Ser Asp Ser 20 25 30
Leu Leu Ile Asp Gly Thr Ile Trp Glu Gly Ala Ala Gly Asp Pro Cys 35
40 45 Asp Pro Ala Thr Thr Trp Cys Asp Ala Ile Ser Leu Arg Ala Gly
Phe 50 55 60 Tyr Gly Asp Phe Val Tyr Asp Ile Val Leu Lys Val Asp
Ala Pro Lys 65 70 75 80 Thr Phe Ser Met Gly Ala Lys Pro Thr Thr Thr
Gly Asn Gly Ser Ala 85 90 95 Ala Ala Asn 57 100 PRT Homo sapiens 57
Cys Thr Ala Arg Glu Asn Pro Ala Tyr Gly Arg His Met Gln Asp Ala 1 5
10 15 Glu Met Phe Thr Asn Ala Ala Tyr Met Ala Leu Ile Asn Trp Asp
Arg 20 25 30 Phe Asp Val Phe Cys Thr Leu Gly Ala Thr Ser Gly Tyr
Leu Lys Gly 35 40 45 Asn Ser Ala Ser Phe Asn Leu Val Gly Leu Phe
Gly Asp Asn Glu Asn 50 55 60 His Ala Thr Val Ser Asp Ser Lys Leu
Val Pro Asn Met Ser Leu Asp 65 70 75 80 Gln Ser Val Val Glu Leu Tyr
Thr Asp Thr Thr Phe Ala Trp Ser Ala 85 90 95 Gly Ala Arg Ala 100 58
65 PRT Homo spiens 58 Leu Thr Ala Arg Glu Asn Pro Ala Tyr Gly Arg
His Met Gln Asp Ala 1 5 10 15 Glu Met Phe Thr Asn Cys Ala Tyr Met
Ala Leu Ile Asn Trp Asp Arg 20 25 30 Phe Asp Val Phe Cys Thr Leu
Gly Ala Ser Ser Gly Tyr Leu Lys Gly 35 40 45 Asn Ser Ala Ser Phe
Asn Leu Val Gly Leu Phe Gly Asn Asn Glu Asn 50 55 60 Gln 65 59 134
PRT Homo sapiens 59 Cys Thr Ala Arg Glu Asn Pro Ala Tyr Gly Arg His
Met Gln Asp Ala 1 5 10 15 Glu Met Phe Thr Asn Cys Ala Tyr Met Ala
Leu Ile Asn Trp Asp Arg 20 25 30 Phe Asp Val Phe Cys Thr Leu Gly
Ala Thr Ser Gly Tyr Leu Lys Gly 35 40 45 Asn Ser Ala Ser Phe Asn
Leu Val Gly Leu Phe Gly Asp Asn Glu Asn 50 55 60 Gln Lys Thr Val
Lys Ala Glu Ser Val Pro Asn Met Ser Phe Asp Gln 65 70 75 80 Ser Val
Val Glu Leu Tyr Thr Asp Thr Thr Phe Ala Trp Ser Val Gly 85 90 95
Ala Arg Ala Thr Lys Val Ser Asn Gly Thr Phe Val Pro Asn Met Ser 100
105 110 Leu Asp Gln Ser Val Val Glu Leu Tyr Thr Asp Thr Ala Phe Ala
Trp 115 120 125 Ser Val Gly Ala Arg Ala 130 60 99 PRT Homo sapiens
60 Leu Thr Ala Arg Glu Asn Pro Ala Tyr Gly Arg His Met Gln Asp Ala
1 5 10 15 Glu Met Phe Thr Asn Cys Ala Tyr Met Ala Leu Ile Asn Trp
Asp Arg 20 25 30 Phe Asp Val Phe Cys Thr Leu Gly Ala Ser Ser Gly
Tyr Leu Lys Gly 35 40 45 Asn Ser Ala Ser Phe Asn Leu Val Gly Leu
Phe Gly Asp Asn Glu Asn 50 55 60 Gln Ser Thr Val Lys Thr Asn Ser
Val Pro Asn Met Ser Leu Asp Gln 65 70 75 80 Ser Val Val Glu Leu Tyr
Thr Asp Thr Ala Phe Ser Trp Ser Val Gly 85 90 95 Ala Arg Ala 61 99
PRT Homo sapiens 61 Cys Thr Ala Arg Glu Asn Pro Ala Tyr Gly Arg His
Met Gln Asp Ala 1 5 10 15 Glu Met Phe Thr Asn Ala Ala Tyr Met Ala
Leu Ile Asn Trp Asp Arg 20 25 30 Phe Asp Val Phe Cys Thr Leu Gly
Ala Thr Ser Gly Tyr Leu Lys Gly 35 40 45 Asn Ser Ala Ser Phe Asn
Leu Val Gly Leu Phe Gly Asp Asn Glu Asn 50 55 60 Gln Ser Thr Val
Lys Lys Asp Ala Val Pro Asn Met Ser Phe Asp Gln 65 70 75 80 Ser Val
Val Glu Leu Tyr Thr Asp Thr Thr Phe Ala Trp Ser Val Gly 85 90 95
Ala Arg Ala 62 99 PRT Homo sapiens 62 Leu Val Glu Arg Thr Asn Pro
Ala Tyr Gly Lys His Met Gln Asp Ala 1 5 10 15 Glu Met Phe Thr Asn
Cys Ala Tyr Thr Ala Leu Ile Asn Trp Asp Arg 20 25 30 Phe Asp Val
Phe Cys Thr Leu Gly Ala Thr Ser Gly Tyr Leu Lys Gly 35 40 45 Asn
Ser Ala Ser Phe Asn Leu Val Gly Leu Phe Gly Asp Gly Val Asn 50 55
60 Ala Thr Lys Pro Ala Ala Asp Ser Ile Pro Asn Val Gln Leu Asn Gln
65 70 75 80 Ser Val Val Glu Leu
Tyr Thr Asp Thr Thr Phe Ala Trp Ser Val Gly 85 90 95 Ala Arg Ala 63
100 PRT Homo sapiens 63 Asn Val Ala Arg Pro Asn Pro Ala Tyr Gly Lys
His Met Gln Asp Ala 1 5 10 15 Glu Met Phe Thr Asn Ala Ala Tyr Met
Ala Leu Ile Asn Trp Asp Arg 20 25 30 Phe Asp Val Phe Cys Thr Leu
Gly Ala Thr Thr Gly Tyr Leu Lys Gly 35 40 45 Asn Ser Ala Ser Phe
Asn Leu Val Gly Leu Phe Gly Thr Lys Thr Gln 50 55 60 Ser Ser Ser
Phe Asn Thr Ala Lys Leu Ile Pro Asn Thr Ala Leu Asp 65 70 75 80 Gln
Ser Val Val Glu Leu Tyr Ile Asn Thr Thr Phe Ala Trp Ser Val 85 90
95 Gly Ala Arg Ala 100 64 100 PRT Homo sapiens 64 Asn Val Ala Arg
Pro Asn Pro Ala Tyr Gly Lys His Met Gln Asp Ala 1 5 10 15 Glu Met
Phe Thr Asn Ala Ala Tyr Met Ala Leu Ile Asn Trp Asp Arg 20 25 30
Phe Asp Val Phe Cys Thr Leu Gly Ala Thr Thr Gly Tyr Leu Lys Gly 35
40 45 Asn Ser Ala Ser Phe Asn Leu Val Gly Leu Phe Gly Thr Lys Thr
Gln 50 55 60 Ser Ser Gly Phe Asp Thr Ala Asn Ile Val Pro Asn Thr
Ala Leu Asn 65 70 75 80 Gln Ala Val Val Glu Leu Tyr Thr Asp Thr Thr
Phe Ala Trp Ser Val 85 90 95 Gly Ala Arg Ala 100 65 100 PRT Homo
sapiens 65 Asn Val Ala Arg Pro Asn Pro Ala Tyr Gly Lys His Met Gln
Asp Ala 1 5 10 15 Glu Met Phe Thr Asn Ala Ala Tyr Met Ala Leu Ile
Asn Trp Asp Arg 20 25 30 Phe Asp Val Phe Cys Thr Leu Gly Ala Thr
Thr Gly Tyr Leu Lys Gly 35 40 45 Asn Ser Ala Ser Phe Asn Leu Val
Gly Leu Phe Gly Thr Lys Thr Lys 50 55 60 Ser Ser Asp Phe Asn Thr
Ala Lys Leu Val Pro Asn Ile Ala Leu Asn 65 70 75 80 Arg Ala Val Val
Glu Leu Tyr Thr Asp Thr Thr Phe Ala Trp Ser Val 85 90 95 Gly Ala
Arg Ala 100 66 100 PRT Homo sapiens 66 Asn Val Ala Arg Pro Asn Pro
Ala Tyr Gly Lys His Met Gln Asp Ala 1 5 10 15 Glu Met Phe Thr Asn
Ala Ala Tyr Met Ala Leu Ile Asn Trp Asp Arg 20 25 30 Phe Asp Val
Phe Cys Thr Leu Gly Ala Thr Thr Gly Tyr Leu Lys Gly 35 40 45 Asn
Ser Ala Ser Phe Asn Leu Val Gly Leu Phe Gly Thr Lys Thr Gln 50 55
60 Ser Thr Asn Phe Asn Thr Ala Lys Leu Val Pro Asn Thr Ala Leu Asn
65 70 75 80 Gln Ala Val Val Glu Leu Tyr Thr Asp Thr Thr Phe Ala Trp
Ser Val 85 90 95 Gly Ala Arg Ala 100 67 96 PRT Homo sapiens 67 Ala
Ser Arg Glu Asn Pro Ala Tyr Gly Lys His Met Gln Asp Ala Glu 1 5 10
15 Met Phe Thr Asn Ala Ala Tyr Met Ala Leu Ile Asn Trp Asp Arg Phe
20 25 30 Asp Val Phe Cys Thr Leu Gly Ala Thr Ser Gly Tyr Leu Lys
Gly Asn 35 40 45 Ser Ala Ala Phe Asn Leu Val Gly Leu Phe Gly Arg
Asp Glu Thr Ala 50 55 60 Val Ala Ala Asp Asp Ile Pro Asn Val Ser
Leu Ser Gln Ala Val Val 65 70 75 80 Glu Leu Tyr Thr Asp Thr Ala Phe
Ala Trp Ser Val Gly Ala Arg Ala 85 90 95 68 100 PRT Homo sapiens 68
Tyr Thr Thr Ala Val Asp Arg Pro Asn Pro Ala Tyr Asn Lys His Leu 1 5
10 15 His Asp Ala Glu Trp Phe Thr Asn Ala Gly Ile Phe Ala Leu Ile
Asn 20 25 30 Trp Asp Arg Phe Asp Val Phe Cys Thr Leu Gly Ala Ser
Asn Gly Ile 35 40 45 Arg Lys Gly Asn Ser Thr Ala Phe Asn Leu Val
Gly Leu Phe Gly Val 50 55 60 Lys Gly Thr Thr Val Asn Ala Asn Glu
Leu Pro Asn Val Ser Leu Ser 65 70 75 80 Asn Gly Val Val Glu Leu Tyr
Thr Asp Thr Ser Phe Ser Trp Ser Val 85 90 95 Gly Ala Arg Ala 100 69
100 PRT Homo sapiens 69 Ala Leu Trp Glu Cys Gly Cys Ala Thr Leu Gly
Ala Ser Phe Gln Tyr 1 5 10 15 Ala Gln Ser Lys Pro Lys Val Glu Glu
Leu Asn Val Leu Cys Asn Ala 20 25 30 Ala Glu Phe Thr Ile Asn Lys
Pro Lys Gly Tyr Val Gly Gln Glu Phe 35 40 45 Pro Leu Asp Leu Lys
Ala Gly Thr Asp Gly Val Thr Gly Thr Lys Asp 50 55 60 Ala Ser Ile
Asp Tyr His Glu Trp Gln Ala Ser Leu Ala Leu Ser Tyr 65 70 75 80 Arg
Leu Asn Met Phe Thr Pro Tyr Ile Gly Val Lys Trp Ser Arg Ala 85 90
95 Ser Phe Asp Ala 100 70 100 PRT Homo sapiens 70 Ala Leu Trp Glu
Cys Gly Cys Ala Thr Leu Gly Ala Ser Phe Gln Tyr 1 5 10 15 Ala Gln
Ser Lys Pro Lys Val Glu Glu Leu Asn Val Leu Cys Asn Ala 20 25 30
Ala Glu Phe Thr Ile Asn Lys Pro Lys Gly Tyr Val Gly Lys Glu Leu 35
40 45 Pro Leu Asp Leu Thr Ala Gly Thr Asp Ala Ala Thr Gly Thr Lys
Asp 50 55 60 Ala Ser Ile Asp Tyr His Glu Trp Gln Ala Ser Leu Ala
Leu Ser Tyr 65 70 75 80 Arg Leu Asn Met Phe Thr Pro Tyr Ile Gly Val
Lys Trp Ser Arg Ala 85 90 95 Ser Phe Asp Ala 100 71 100 PRT Homo
sapiens 71 Ala Leu Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala Ser Phe
Gln Tyr 1 5 10 15 Ala Gln Ser Lys Pro Lys Val Glu Glu Leu Asn Val
Leu Cys Asn Ala 20 25 30 Ala Glu Phe Thr Ile Asn Lys Pro Lys Gly
Tyr Val Gly Lys Glu Phe 35 40 45 Pro Leu Asp Leu Thr Ala Gly Thr
Asp Ala Ala Thr Gly Thr Lys Asp 50 55 60 Ala Ser Ile Asp Tyr His
Glu Trp Gln Ala Ser Leu Ala Leu Ser Tyr 65 70 75 80 Arg Leu Asn Met
Phe Thr Pro Tyr Ile Gly Val Lys Trp Ser Arg Ala 85 90 95 Ser Phe
Asp Ala 100 72 100 PRT Homo sapiens 72 Ala Leu Trp Glu Cys Gly Cys
Ala Thr Leu Gly Ala Ser Phe Gln Tyr 1 5 10 15 Ala Gln Ser Lys Pro
Lys Val Glu Glu Leu Asn Val Leu Cys Asn Ala 20 25 30 Ala Glu Phe
Thr Ile Asn Lys Pro Lys Gly Tyr Val Gly Gln Glu Phe 35 40 45 Pro
Leu Ala Leu Ile Ala Gly Thr Asp Ala Ala Thr Gly Thr Lys Asp 50 55
60 Ala Ser Ile Asp Tyr His Glu Trp Gln Ala Ser Leu Ala Leu Ser Tyr
65 70 75 80 Arg Leu Asn Met Phe Thr Pro Tyr Ile Gly Val Lys Trp Ser
Arg Ala 85 90 95 Ser Phe Asp Ala 100 73 100 PRT Homo sapiens 73 Ala
Leu Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala Ser Phe Gln Tyr 1 5 10
15 Ala Gln Ser Lys Pro Lys Val Glu Glu Leu Asn Val Leu Cys Asn Ala
20 25 30 Ala Glu Phe Thr Ile Asn Lys Pro Lys Gly Tyr Val Gly Lys
Glu Phe 35 40 45 Pro Leu Asp Leu Thr Ala Gly Thr Asp Ala Ala Thr
Gly Thr Lys Asp 50 55 60 Ala Ser Ile Asp Tyr His Glu Trp Gln Ala
Ser Leu Ala Leu Ser Tyr 65 70 75 80 Arg Leu Asn Met Phe Thr Pro Tyr
Ile Gly Val Lys Trp Ser Arg Ala 85 90 95 Ser Phe Asp Ala 100 74 100
PRT Homo sapiens 74 Ala Leu Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala
Ser Phe Gln Tyr 1 5 10 15 Ala Gln Ser Lys Pro Lys Ile Glu Glu Leu
Asn Val Leu Cys Asn Ala 20 25 30 Ala Glu Phe Thr Ile Asn Lys Pro
Lys Gly Tyr Val Gly Lys Glu Phe 35 40 45 Pro Leu Asp Leu Thr Ala
Gly Thr Asp Ala Ala Thr Gly Thr Lys Asp 50 55 60 Ala Ser Ile Asp
Tyr His Glu Trp Gln Ala Ser Leu Ser Leu Ser Tyr 65 70 75 80 Arg Leu
Asn Met Phe Thr Pro Tyr Ile Gly Val Lys Trp Ser Arg Ala 85 90 95
Ser Phe Asp Ser 100 75 100 PRT Homo sapiens 75 Ala Leu Trp Glu Cys
Gly Cys Ala Thr Leu Gly Ala Ser Phe Gln Tyr 1 5 10 15 Ala Gln Ser
Lys Pro Lys Val Glu Glu Leu Asn Val Leu Cys Asn Ala 20 25 30 Ser
Glu Phe Thr Ile Asn Lys Pro Lys Gly Tyr Val Gly Ala Glu Phe 35 40
45 Pro Leu Asn Ile Thr Ala Gly Thr Glu Ala Ala Thr Gly Thr Lys Asp
50 55 60 Ala Ser Ile Asp Tyr His Glu Trp Gln Ala Ser Leu Ala Leu
Ser Tyr 65 70 75 80 Arg Leu Asn Met Phe Thr Pro Tyr Ile Gly Val Lys
Trp Ser Arg Val 85 90 95 Ser Phe Asp Ala 100 76 100 PRT Homo
sapiens 76 Ala Leu Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala Ser Phe
Gln Tyr 1 5 10 15 Ala Gln Ser Lys Pro Lys Val Glu Glu Leu Asn Val
Leu Cys Asn Ala 20 25 30 Ser Glu Phe Thr Ile Asn Lys Pro Lys Gly
Tyr Val Gly Ala Glu Phe 35 40 45 Pro Leu Asp Ile Thr Ala Gly Thr
Glu Ala Ala Thr Gly Thr Lys Asp 50 55 60 Ala Ser Ile Asp Tyr His
Glu Trp Gln Ala Ser Leu Ala Leu Ser Tyr 65 70 75 80 Arg Leu Asn Met
Phe Thr Pro Tyr Ile Gly Val Lys Trp Ser Arg Val 85 90 95 Ser Phe
Asp Ala 100 77 100 PRT Homo sapiens 77 Ala Leu Trp Glu Cys Gly Cys
Ala Thr Leu Gly Ala Ser Phe Gln Tyr 1 5 10 15 Ala Gln Ser Lys Pro
Lys Val Glu Glu Leu Asn Val Leu Cys Asn Ala 20 25 30 Ser Glu Phe
Thr Ile Asn Lys Pro Lys Gly Tyr Val Gly Ala Glu Phe 35 40 45 Pro
Leu Asp Ile Thr Ala Gly Thr Glu Ala Ala Thr Gly Thr Lys Asp 50 55
60 Ala Ser Ile Asp Tyr His Glu Trp Gln Ala Ser Leu Ala Leu Ser Tyr
65 70 75 80 Arg Leu Asn Met Phe Thr Pro Tyr Ile Gly Val Lys Trp Ser
Arg Val 85 90 95 Ser Phe Asp Ala 100 78 100 PRT Homo sapiens 78 Ala
Leu Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala Ser Phe Gln Tyr 1 5 10
15 Ala Gln Ser Lys Pro Lys Val Glu Glu Leu Asn Val Leu Cys Asp Ala
20 25 30 Ser Glu Phe Thr Ile Asn Lys Pro Lys Gly Tyr Val Gly Ala
Glu Phe 35 40 45 Pro Leu Asp Ile Thr Ala Gly Thr Glu Ala Ala Thr
Gly Thr Lys Asp 50 55 60 Ala Ser Ile Asp Tyr His Glu Trp Gln Ala
Ser Leu Ala Leu Ser Tyr 65 70 75 80 Arg Leu Asn Met Phe Thr Pro Tyr
Ile Gly Val Lys Trp Ser Arg Val 85 90 95 Ser Phe Asp Ala 100 79 100
PRT Homo sapiens 79 Ala Leu Trp Glu Cys Gly Cys Ala Thr Leu Gly Ala
Ser Phe Gln Tyr 1 5 10 15 Ala Gln Ser Lys Pro Lys Val Glu Glu Leu
Asn Val Leu Cys Asn Ala 20 25 30 Ala Glu Phe Thr Ile Asn Lys Pro
Lys Gly Tyr Val Gly Gln Glu Phe 35 40 45 Pro Leu Asn Ile Lys Ala
Gly Thr Val Ser Ala Thr Asp Thr Lys Asp 50 55 60 Ala Ser Ile Asp
Tyr His Glu Trp Gln Ala Ser Leu Ala Leu Ser Tyr 65 70 75 80 Arg Leu
Asn Met Phe Thr Pro Tyr Ile Gly Val Lys Trp Ser Arg Ala 85 90 95
Ser Phe Asp Ala 100 80 100 PRT Homo sapiens 80 Gly Leu Trp Glu Cys
Gly Cys Ala Thr Leu Gly Glu Ser Phe Gln Tyr 1 5 10 15 Ala Gln Ser
Lys Pro Lys Val Glu Glu Leu Asn Val Ile Cys Asn Val 20 25 30 Ser
Gln Phe Ser Val Asn Lys Pro Lys Gly Tyr Lys Gly Val Ala Phe 35 40
45 Pro Leu Pro Thr Asp Ala Gly Val Ala Thr Ala Thr Gly Thr Lys Ser
50 55 60 Ala Thr Ile Asn Tyr His Glu Trp Gln Val Gly Ala Ser Leu
Ser Tyr 65 70 75 80 Arg Leu Asn Ser Leu Val Pro Tyr Ile Gly Val Gln
Trp Ser Arg Ala 85 90 95 Thr Phe Asp Ala 100 81 94 PRT Homo sapiens
81 Asp Thr Ile Arg Ile Ala Gln Pro Lys Ser Ala Thr Thr Val Phe Asp
1 5 10 15 Val Thr Thr Leu Asn Pro Thr Ile Ala Gly Ala Gly Asp Val
Lys Ala 20 25 30 Ser Ala Glu Gly Gln Leu Gly Asp Thr Met Gln Ile
Val Ser Leu Gln 35 40 45 Leu Asn Lys Met Lys Ser Arg Lys Ser Cys
Gly Ile Ala Val Gly Thr 50 55 60 Thr Ile Val Asp Ala Asp Lys Tyr
Ala Val Thr Val Glu Thr Arg Leu 65 70 75 80 Ile Asp Glu Arg Ala Ala
His Val Asn Ala Gln Phe Arg Phe 85 90 82 92 PRT Homo sapiens 82 Asp
Thr Ile Arg Ile Ala Gln Pro Lys Ser Ala Glu Thr Ile Phe Asp 1 5 10
15 Val Thr Thr Leu Asn Pro Thr Ile Ala Gly Ala Gly Asp Val Lys Thr
20 25 30 Ser Ala Glu Gly Gln Leu Gly Asp Thr Met Gln Ile Val Ser
Leu Gln 35 40 45 Leu Asn Met Lys Ser Arg Lys Cys Gly Ile Ala Val
Gly Thr Thr Ile 50 55 60 Val Asp Ala Asp Lys Tyr Ala Ile Thr Val
Glu Thr Arg Leu Ile Asp 65 70 75 80 Glu Arg Ala Ala His Val Asn Ala
Gln Phe Arg Phe 85 90 83 94 PRT Homo sapiens 83 Asp Thr Ile Arg Ile
Ala Gln Pro Lys Ser Ala Thr Ala Ile Phe Asp 1 5 10 15 Thr Thr Thr
Leu Asn Pro Thr Ile Ala Gly Ala Gly Asp Val Lys Thr 20 25 30 Gly
Thr Glu Gly Gln Leu Gly Asp Thr Met Gln Ile Val Ser Leu Gln 35 40
45 Leu Asn Lys Met Lys Ser Arg Lys Ser Cys Gly Ile Ala Val Gly Thr
50 55 60 Thr Ile Val Asp Ala Asp Lys Tyr Ala Val Thr Val Glu Thr
Arg Leu 65 70 75 80 Ile Asp Glu Arg Ala Ala His Val Asn Ala Gln Phe
Arg Phe 85 90 84 94 PRT Homo sapiens 84 Asp Thr Ile Arg Ile Ala Gln
Pro Lys Ser Ala Thr Ala Ile Phe Asp 1 5 10 15 Thr Thr Thr Leu Asn
Pro Thr Ile Ala Gly Ala Gly Asp Val Lys Ala 20 25 30 Ser Ala Glu
Gly Gln Leu Gly Asp Thr Met Gln Ile Val Ser Leu Gln 35 40 45 Leu
Asn Lys Met Lys Ser Arg Lys Ser Cys Gly Ile Ala Val Gly Thr 50 55
60 Thr Ile Val Asp Ala Asp Lys Tyr Ala Val Thr Val Glu Thr Arg Leu
65 70 75 80 Ile Asp Glu Arg Ala Ala His Val Asn Ala Gln Phe Arg Phe
85 90 85 94 PRT Homo sapiens 85 Asp Thr Ile Arg Ile Ala Gln Pro Lys
Leu Ala Thr Ala Ile Phe Asp 1 5 10 15 Thr Thr Thr Leu Asn Pro Thr
Ile Ala Gly Ala Gly Asp Glu Lys Ala 20 25 30 Asn Ala Glu Gly Gln
Leu Gly Asp Thr Met Gln Ile Val Ser Leu Gln 35 40 45 Leu Asn Lys
Met Lys Ser Arg Lys Ser Cys Gly Ile Ala Val Gly Thr 50 55 60 Thr
Ile Val Asp Ala Asp Lys Tyr Ala Val Thr Val Glu Thr Arg Leu 65 70
75 80 Ile Asp Glu Arg Ala Ala His Val Asn Ala Gln Phe Arg Phe 85 90
86 95 PRT Homo sapiens 86 Asp Thr Ile Arg Ile Ala Gln Pro Arg Leu
Val Thr Pro Val Val Asp 1 5 10 15 Ile Thr Thr Leu Asn Pro Thr Ile
Ala Gly Ala Cys Asp Ser Lys Ala 20 25 30 Gly Asn Thr Glu Gly Gln
Ile Ser Asp Thr Met Gln Ile Val Ser Leu 35 40 45 Gln Leu Asn Lys
Met Lys Ser Arg Lys Ser Cys Gly Ile Ala Val Gly 50 55 60 Thr Thr
Ile Val Asp Ala Asp Lys Tyr Ala Val Thr Val Glu Thr Arg 65 70 75 80
Leu Ile Asp Glu Arg
Ala Ala His Val Asn Ala Gln Phe Arg Phe 85 90 95 87 95 PRT Homo
sapiens 87 Asp Thr Ile Arg Ile Ala Gln Pro Lys Leu Ala Glu Ala Ile
Leu Asp 1 5 10 15 Val Thr Thr Leu Asn Arg Thr Thr Ala Gly Lys Gly
Ser Val Val Ser 20 25 30 Ala Gly Thr Asp Asn Glu Leu Ala Asp Thr
Met Gln Ile Val Ser Leu 35 40 45 Gln Leu Asn Lys Met Lys Ser Arg
Lys Ser Cys Gly Ile Ala Val Gly 50 55 60 Thr Thr Ile Val Asp Ala
Asp Lys Tyr Ala Val Thr Val Glu Ala Arg 65 70 75 80 Leu Ile Asp Glu
Arg Ala Ala His Val Asn Ala Gln Phe Arg Phe 85 90 95 88 94 PRT Homo
sapiens 88 Asp Thr Ile Arg Ile Ala Gln Pro Lys Leu Ala Lys Pro Val
Leu Asp 1 5 10 15 Thr Thr Thr Leu Asn Pro Thr Ile Ala Gly Lys Gly
Thr Val Val Ser 20 25 30 Ser Ala Glu Asn Glu Leu Ala Asp Thr Met
Gln Ile Val Ser Leu Gln 35 40 45 Leu Asn Lys Met Lys Ser Arg Lys
Ser Cys Gly Ile Ala Val Gly Thr 50 55 60 Thr Ile Val Asp Ala Asp
Lys Tyr Ala Val Thr Val Glu Thr Arg Leu 65 70 75 80 Ile Asp Glu Arg
Ala Ala His Val Asn Ala Gln Phe Arg Phe 85 90 89 94 PRT Homo
sapiens 89 Asp Thr Ile Arg Ile Ala Gln Pro Lys Leu Ala Glu Ala Ile
Leu Asp 1 5 10 15 Val Thr Thr Leu Asn Pro Thr Ile Ala Gly Lys Gly
Thr Val Val Ala 20 25 30 Ser Gly Ser Asp Asn Asp Leu Ala Asp Thr
Met Gln Ile Val Ser Leu 35 40 45 Gln Leu Asn Lys Met Lys Ser Arg
Lys Ser Cys Gly Ile Ala Val Gly 50 55 60 Thr Thr Ile Val Asp Ala
Asp Lys Tyr Ala Val Thr Val Glu Thr Arg 65 70 75 80 Leu Ile Asp Glu
Arg Ala Ala His Val Asn Ala Gln Phe Arg 85 90 90 95 PRT Homo
sapiens 90 Asp Thr Ile Arg Ile Ala Gln Pro Lys Leu Ala Glu Ala Val
Leu Asp 1 5 10 15 Val Thr Thr Leu Asn Pro Thr Ile Ala Gly Lys Gly
Ser Val Val Ala 20 25 30 Ser Gly Ser Glu Asn Glu Leu Ala Asp Thr
Met Gln Ile Val Ser Leu 35 40 45 Gln Leu Asn Lys Met Lys Ser Arg
Lys Ser Cys Gly Ile Ala Val Gly 50 55 60 Thr Thr Ile Val Asp Ala
Asp Lys Tyr Ala Val Thr Val Glu Thr Arg 65 70 75 80 Leu Ile Asp Glu
Arg Ala Ala His Val Asn Ala Gln Phe Arg Phe 85 90 95 91 91 PRT Homo
sapiens 91 Asp Thr Ile Arg Ile Ala Gln Pro Lys Leu Glu Thr Ser Ile
Leu Lys 1 5 10 15 Met Thr Thr Trp Asn Pro Thr Ile Ser Gly Ser Gly
Ile Asp Val Asp 20 25 30 Thr Lys Ile Thr Asp Thr Leu Gln Ile Val
Ser Leu Gln Leu Asn Lys 35 40 45 Met Lys Ser Arg Lys Ser Cys Leu
Ile Ala Ile Gly Thr Thr Ile Val 50 55 60 Asp Ala Asp Lys Tyr Ala
Val Thr Val Glu Thr Arg Leu Ile Asp Glu 65 70 75 80 Arg Ala Ala His
Val Asn Ala Gln Phe Arg Phe 85 90 92 93 PRT Homo sapiens 92 Asp Asn
Ile Arg Ile Ala Gln Pro Lys Leu Pro Thr Ala Val Leu Asn 1 5 10 15
Leu Thr Ala Trp Asn Pro Ser Leu Leu Gly Asn Ala Thr Ala Leu Ser 20
25 30 Thr Thr Asp Ser Phe Ser Asp Phe Met Gln Ile Val Ser Cys Gln
Ile 35 40 45 Asn Lys Phe Lys Ser Arg Lys Ala Cys Val Thr Ala Val
Ala Thr Leu 50 55 60 Ile Val Asp Ala Asp Lys Trp Ser Leu Thr Ala
Glu Ala Arg Leu Asn 65 70 75 80 Asp Glu Arg Ala Ala His Ser Gly Ala
Gln Phe Arg Phe 85 90 93 17 PRT Homo sapiens 93 Cys Thr Gly Ser Ala
Ala Ala Asn Tyr Thr Thr Ala Val Asp Arg Pro 1 5 10 15 Asn 94 18 PRT
Homo sapiens 94 Cys Thr Gly Asp Ala Asp Leu Thr Thr Ala Pro Thr Pro
Ala Ser Arg 1 5 10 15 Glu Asn 95 19 PRT Homo sapiens 95 Cys Thr Thr
Ala Thr Gly Asn Ala Ala Ala Pro Ser Thr Cys Thr Ala 1 5 10 15 Arg
Glu Asn 96 17 PRT Homo sapiens 96 Cys Ala Ser Gly Thr Ala Ser Asn
Thr Thr Val Ala Ala Asp Arg Ser 1 5 10 15 Asn 97 15 PRT Homo
sapiens 97 Cys Phe Gly Val Lys Gly Thr Thr Val Asn Ala Asn Glu Lys
Pro 1 5 10 15 98 15 PRT Homo sapiens 98 Cys Phe Gly Arg Asp Glu Thr
Ala Val Ala Ala Asp Asp Ile Pro 1 5 10 15 99 18 PRT Homo sapiens 99
Cys Phe Gly Asp Asn Glu Asn His Ala Thr Val Ser Asp Ser Lys Leu 1 5
10 15 Val Pro 100 14 PRT Homo sapiens 100 Cys Ile Gly Leu Ala Gly
Thr Asp Phe Ala Asn Gln Arg Pro 1 5 10 101 13 PRT Homo sapiens 101
Cys Gln Ile Asn Lys Phe Lys Ser Arg Lys Ala Cys Gly 1 5 10 102 13
PRT Homo sapiens 102 Cys Gln Ile Asn Lys Met Lys Ser Arg Phe Ala
Cys Gly 1 5 10 103 13 PRT Homo sapiens 103 Cys Gln Leu Asn Lys Met
Lys Ser Arg Lys Ala Cys Gly 1 5 10 104 13 PRT Homo sapiens 104 Cys
Gln Ile Asn Lys Phe Lys Ser Arg Phe Ala Cys Gly 1 5 10 105 38 DNA
Homo sapiens 105 atgaaaaaac tcttaaagtc ggcgttatta tccgccgc 38 106
44 DNA Homo sapiens 106 atgaaaaaac tcttgaaatc ggtattagtg tttgccgctt
tgag 44 107 44 DNA Homo sapiens 107 atgaaaaaac tcttaaaatc
ggcattatta tttgccgctg cggg 44 108 44 DNA Homo sapiens 108
atgaaaaaac tcttgaaatc ggcattattg tttgccgcta cggg 44 109 50 DNA Homo
sapiens 109 atgaaaaaac tcttgaaatc ggtattagca tttgccgttt tgggttctgc
50 110 40 DNA Homo sapiens 110 ttagaatctg aactgaccag atacgtgagc
agctctctcg 40 111 35 DNA Homo sapiens 111 ttagaagcgg aattgtgcat
ttacgtgagc agctc 35 112 43 DNA Homo sapiens 112 ttagaatctg
aattgagcat taatgtgagc agctctttcg tcg 43 113 51 DNA Homo sapiens 113
ttagaatctg aattgaccat tcatgtgagc agctctttca ttgattaagc g 51 114 42
DNA Homo sapiens 114 ttagaaacgg aactgagcat ttacgtgagc tgctctttca tc
42
* * * * *