U.S. patent application number 10/831063 was filed with the patent office on 2005-02-24 for single chain antigen-binding polypeptides for polymer conjugation.
Invention is credited to Basu, Amartya, Filpula, David Ray, Wang, Maoliang, Yang, Karen.
Application Number | 20050042680 10/831063 |
Document ID | / |
Family ID | 27488916 |
Filed Date | 2005-02-24 |
United States Patent
Application |
20050042680 |
Kind Code |
A1 |
Filpula, David Ray ; et
al. |
February 24, 2005 |
Single chain antigen-binding polypeptides for polymer
conjugation
Abstract
The present invention relates to monovalent and multivalent
single-chain antigen-binding polypeptides with site-specific
modifications. The provided polypeptides are capable of being
covalently linked or conjugated to polyalkylene oxides at the
modified sites. The resulting conjugates retain antigen binding
properties and exhibit prolonged circulating time and reduced
antigenicity relative to unconjugated single chain antigen binding
polypeptides. Methods and compositions for making and using the
single chain antigen-binding polypeptides with site-specific
modifications are also provided.
Inventors: |
Filpula, David Ray;
(Piscataway, NJ) ; Yang, Karen; (Edison, NJ)
; Basu, Amartya; (Berkeley Heights, NJ) ; Wang,
Maoliang; (East Brunswick, NJ) |
Correspondence
Address: |
MUSERLIAN, LUCAS AND MERCANTI, LLP
475 PARK AVENUE SOUTH
15TH FLOOR
NEW YORK
NY
10016
US
|
Family ID: |
27488916 |
Appl. No.: |
10/831063 |
Filed: |
April 23, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10831063 |
Apr 23, 2004 |
|
|
|
10423847 |
Apr 25, 2003 |
|
|
|
10423847 |
Apr 25, 2003 |
|
|
|
09791578 |
Feb 26, 2001 |
|
|
|
10423847 |
Apr 25, 2003 |
|
|
|
09791540 |
Feb 26, 2001 |
|
|
|
6824782 |
|
|
|
|
09791540 |
Feb 26, 2001 |
|
|
|
09069842 |
Apr 30, 1998 |
|
|
|
60044449 |
Apr 30, 1997 |
|
|
|
60050472 |
Jun 23, 1997 |
|
|
|
60063074 |
Oct 27, 1997 |
|
|
|
60067341 |
Dec 2, 1997 |
|
|
|
Current U.S.
Class: |
435/7.1 ;
435/320.1; 435/325; 435/69.1; 530/350; 536/23.5 |
Current CPC
Class: |
A61P 35/00 20180101;
G01N 33/6857 20130101; C07K 2317/41 20130101; C07K 19/00 20130101;
A61K 2039/505 20130101; C07K 2319/00 20130101; C07K 2317/622
20130101; C07K 16/30 20130101; A61K 47/60 20170801 |
Class at
Publication: |
435/007.1 ;
435/069.1; 435/320.1; 435/325; 530/350; 536/023.5 |
International
Class: |
G01N 033/53; C07H
021/04; C07K 014/715 |
Claims
What is claimed is:
1. A single-chain antigen-binding polypeptide capable of
site-specific conjugation to a polyalkylene oxide polymer, that
comprises, (a) a first polypeptide comprising an antigen-binding
portion of a variable region of an antibody heavy or light chain;
(b) a second polypeptide comprising an antigen-binding portion of a
variable region of an antibody heavy or light chain; and (c) a
peptide linker linking the first and second polypeptides, wherein
the single-chain antigen-binding polypeptide has at least one Cys
residue which is capable of being conjugated to a polyalkylene
oxide polymer, and has at least one antigen binding site, and
wherein the Cys residue is located at a position selected from the
group consisting of: (i) a C-terminus of the heavy chain or light
chain variable region; (ii) an N-terminus of the heavy chain or
light chain variable region; (iii) any amino acid position of the
peptide linker; (iv) both the N-terminus and C-terminus; (v)
position 2 of the linker; (vi) both position 2 of the linker and
the C-terminus; and (iv) combinations thereof; and wherein the
single-chain antigen-binding polypeptide binds to TNF-.alpha..
2. The single-chain antigen-binding polypeptide of claim 1 wherein
the Cys residue is located at a position selected from the group
consisting of position 2 of the linker, the C-terminus and
combinations thereof.
3. The single-chain antigen-binding polypeptide of claim 1 wherein
the first polypeptide comprises a variable region of an antibody
light chain and the second polypeptide comprises a variable region
of an antibody heavy chain.
4. The single-chain antigen-binding polypeptide of claim 1, wherein
the C-terminus of the second polypeptide is the native
C-terminus.
5. The single-chain antigen-binding polypeptide of claim 1 wherein
the peptide linker ranges in size from 2 to 18 residues
6. A conjugate comprising the single-chain antigen-binding
polypeptide of claim 1, and comprising a polyalkylene oxide
polymer, wherein the polyalkylene oxide polymer is covalently
linked to the single-chain antigen-binding polypeptide at a Cys
residue.
7. The conjugate of claim 6 wherein the polyalkylene oxide is
linked to the single-chain antigen-binding polypeptide at a Cys
residue via a linker selected from the group consisting of a
maleimide, vinylsulfone, thiol, orthopyridyl disulfide and a
iodoactemide linker.
8. The conjugate of claim 6 wherein the polyalkylene oxide is
linked to the single-chain antigen-binding polypeptide at a Cys
residue via a maleimide linker.
9. The conjugate of claim 6 wherein the polyalkylene oxide ranges
in size from about 5,000 to about 40,000 Daltons.
10. The conjugate of claim 6 wherein the polyalkylene oxide is a
polyethylene oxide.
11. The conjugate of claim 6, wherein the polyalkylene oxide is
conjugated to at least two single-chain antigen-binding
polypeptides, and each single-chain antigen-binding polypeptide is
the same, or different.
12. The conjugate of claim 11 wherein the single-chain
antigen-binding polypeptide is further conjugated to an additional
functional moiety.
13. The conjugate of claim 12 wherein the additional functional
moiety is a detectable label or tag.
14. A polynucleotide encoding the single-chain antigen-binding
polypeptide of claim 1.
15. A replicable expression vector comprising the polynucleotide of
claim 14.
16. A method of producing the single-chain antigen-binding
polypeptide, comprising the steps of: (a) culturing a host cell
comprising the expression vector of claim 12, and (b) collecting
the single-chain antigen-binding polypeptide expressed by the host
cell.
17. A method of detecting TNF-.alpha. suspected of being in a
sample, comprising: (a) contacting the sample with a reagent
comprising the single-chain antigen-binding polypeptide of claim 1,
and (b) detecting whether the single-chain antigen-binding
polypeptide has bound to the TNF-.alpha..
18. The method of claim 17 wherein the single-chain antigen-binding
polypeptide is covalently conjugated to at least one polyalkylene
oxide polymer via a Cys residue of the single-chain antigen-binding
polypeptide.
19. The method of claim 18 wherein the conjugate is anchored to a
solid substrate.
20. A method of treating or preventing TNF-.alpha. related toxicity
in a mammal, comprising administering the single-chain
antigen-binding polypeptide of claim 1 to the mammal, wherein the
single-chain antigen-binding polypeptide is administered in an
amount effective to inhibit TNF-.alpha. activity in the mammal.
21. The method of claim 20 wherein the administered single-chain
antigen-binding polypeptide is covalently conjugated to at least
one polyalkylene oxide polymer via at least one of the Cys
residues.
22. The method of claim 20 wherein the single-chain antigen-binding
polypeptide is administered in an amount ranging from about 10
.mu.g/kg to about 4,000 .mu.g/kg.
23. The method of claim 20 wherein the single-chain antigen-binding
polypeptide is administered in an amount ranging from about 20
.mu.g/kg to about 400 .mu.g/kg.
24. A protein comprising two or more of the single-chain
antigen-binding polypeptides of claim 1, wherein each single-chain
antigen-binding polypeptide is the same or different.
25. The protein of claim 24 that is bivalent, trivalent or
tetravalent.
26. The protein of claim 24 wherein the constituent single-chain
antigen-binding polypeptides are noncovalently associated.
27. The protein of claim 26 herein the peptide linker of the
constituent single-chain antigen-binding polypeptides range in size
from 2 to 18 residues.
28. The protein of claim 24 wherein the constituent single-chain
antigen-binding polypeptides are covalently linked.
29. The protein of claim 24 that is encoded as a single,
multivalent protein.
30. A polynucleotide encoding the protein of claim 29.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to monovalent and multivalent
single-chain antigen-binding polypeptides with site-specific
modifications facilitating site-specific covalent linkage of
polymers to the inventive polypeptides. The invention provides such
modified single-chain antigen-binding polypeptides, vectors and
host cells encoding the same, as well as methods of making and
using the polypeptides. The invention also provide for conjugates
of the modified single-chain antigen-binding polypeptides with
polymers, such as polyalkylene oxide ("PAO") to provide new and
improved prodrugs, and methods of making and using these
conjugates.
DESCRIPTION OF THE RELATED ART
[0002] Naturally occurring antibodies are immunoglobulins produced
by the immune system of vertebrates, including mammals, in response
to the presence of one or more specific substances, i.e., antigens,
when these are recognized as foreign by the immune cells of the
animal. In humans, there are five classes of antibodies which have
the ability to selectively recognize and preferentially bind to
specific antigens. Each antibody class has the same basic structure
or multiples of that structure. The basic unit consists of two
identical polypeptides called heavy or H chains (molecular weight
in IgG approximately 50,000 Daltons each) and two identical
polypeptides called light or L chains (molecular weight
approximately 25,000 Daltons each). Each of the five antibody
classes has a similar set of light chains and a distinct set of
heavy chains. A light chain is composed of one variable and one
constant domain, while a heavy chain is composed of one variable
and three or more constant domains. The variable domains determine
the specificity of the immunoglobulin, the constant regions have
other functions.
[0003] Broadly, pairs of suitable light and heavy polypeptide
chains are associated in natural antibodies, and in other types of
antibodies, to form antigen binding sites. Each individual light
and heavy chain folds into regions of approximately 110 amino
acids, assuming a conserved three-dimensional conformation. The
light chain comprises one variable region (V.sub.L) and one
constant region (C.sub.L), while the heavy chain comprises one
variable region (V.sub.H) and three constant regions (C.sub.H1,
C.sub.H2 and C.sub.H3). Pairs of regions associate to form discrete
structures. In particular, the light and heavy chain variable
regions associate to form an "Fv" area which contains the
antigen-binding site. The constant regions are not necessary for
antigen binding and in some cases can be separated from the
antibody molecule by proteolysis, yielding biologically active
(i.e., binding) variable regions composed of half of a light chain
and one quarter of a heavy chain.
[0004] Further, all antibodies of a certain class and their Fab
fragments (i.e., fragments composed of V.sub.L, C.sub.L, V.sub.H,
and C.sub.H1) whose structures have been determined by x-ray
crystallography show similar variable region structures despite
large differences in the sequence of hypervariable segments even
when from different animal species. The immunoglobulin variable
region seems to be tolerant towards mutations in the
antigen-binding loops. Therefore, other than in the hypervariable
regions, most of the so-called "variable" regions of antibodies,
which are defined by both heavy and light chains, are, in fact,
quite constant in their three dimensional arrangement. See for
example, Huber, R., Science 233:702-703 (1986), incorporated by
reference herein.
[0005] Natural antibodies are typically heterogeneous, binding to
many different epitopes, or parts of a foreign antigen. In
contrast, monoclonal antibodies ("MAbs") are antibodies that are
homogenous in their binding affinity. MAbs have been shown to be
useful both as diagnostic and therapeutic agents. MAbs are produced
routinely by established procedures, e.g., from hybridomas
generated by fusion of mouse lymphoid cells with an appropriate
mouse myeloma cell line, as well as by more advanced recombinant
techniques.
[0006] Even smaller antibody-like proteins or polypeptides are
formed of antigen binding sites with minimal additional structure.
These are art-known as single-chain antigen-binding proteins or
polypeptides ("SCAs") or single-chain variable fragments of
antibodies ("sFv"). These may incorporate a linker polypeptide to
bridge individual variable regions, V.sub.L and V.sub.H, into a
single polypeptide chain.
[0007] A description of the theory and production of single-chain
antigen-binding proteins is found in Ladner et al., U.S. Pat. Nos.
4,946,778, 5,260,203, 5,455,030 and 5,518,889, and in Huston et
al., U.S. Pat. No. 5,091,513 ("biosynthetic antibody binding sites"
(BABS)), which disclosures are all incorporated herein by
reference. The single-chain antigen-binding proteins produced under
the process recited in the above patents have binding specificity
and affinity substantially similar to that of the corresponding Fab
fragment.
[0008] Broadly, pairs of suitable light and heavy chains can be
associated to form antigen binding sites. Each individual light and
heavy chain folds into regions of approximately 110 amino acids,
assuming a conserved three-dimensional conformation. The light
chain comprises one variable region (V.sub.L) and one constant
region (C.sub.L), while the heavy chain comprises one variable
region (V.sub.H) and three constant regions (C.sub.H1, C.sub.H2 and
C.sub.H3). Pairs of regions associate to form discrete structures.
In particular, the light and heavy chain variable regions associate
to form an "Fv" area which contains the antigen-binding site. The
constant regions are not necessary for antigen binding and in some
cases can be separated from the antibody molecule by proteolysis,
yielding biologically active (i.e., binding) variable regions
composed of half of a light chain and one quarter of a heavy
chain.
[0009] Further, x-ray crystallography has confirmed that all
antibodies of a particular class, and their Fab fragments (i.e.,
fragments composed of V.sub.L, C.sub.L, V.sub.H, and C.sub.H1) show
similar variable region structure, but large differences in the
sequences of their respective hypervariable segments. This is also
observed in comparisons of antibodies derived from different
respective animal species. The immunoglobulin variable region seems
to be tolerant of mutations in the antigen-binding loops.
Therefore, other than in the hypervariable regions, most of the
so-called "variable" regions of antibodies, which are defined by
both heavy and light chains, are, in fact, quite constant in their
three dimensional arrangement. See for example, Huber, R., Science
233:702-703 (1986), incorporated by reference herein.
[0010] The in vivo properties of SCA polypeptides are different
from those of MAbs and larger, more conventional antibody
fragments. Their small size allows SCAs to be cleared more rapidly
from the blood, and to penetrate more rapidly into tissues
(Milenic, D. E. et al., Cancer Research 51:6363-6371(1991); Colcher
et al., J. Natl. Cancer Inst. 82:1191 (1990); Yokota et al., Cancer
Research 52:3402 (1992)). In addition, SCA polypeptides are not
retained in tissues such as the liver and kidneys due to the
absence of a constant region normally present in antibody
molecules. Thus, SCA polypeptides have applications in cancer
diagnosis and therapy, where rapid tissue penetration and clearance
are advantageous.
[0011] Synthetic antigen binding proteins are also described by
Huston et al. in U.S. Pat. No. 5,091,513, incorporated by reference
herein. The described proteins are characterized by one or more
sequences of amino acids constituting a region that behaves as a
biosynthetic antibody binding site (BABS). The sites comprise (1)
noncovalently associated or disulfide bonded synthetic V.sub.H and
V.sub.L regions, (2) V.sub.H--V.sub.L or V.sub.L--V.sub.H single
chains wherein the V.sub.H and V.sub.L are attached to a
polypeptide linker, or (3) individual V.sub.H or V.sub.L domains.
The binding domains comprises complementarity determining regions
(CDRs) linked to framework regions (FRs), which may be derived from
separate immunoglobulins. It should be noted that the Huston et al.
proteins include one characterized by having an initial heavy
chain, i.e., the V.sub.H--peptide linker--V.sub.L domain.
[0012] Multivalent antigen-binding proteins are known. As described
herein, a multivalent antigen-binding protein includes two or more
single-chain protein molecules. These can be associated or linked
by covalent or noncovalent bonding. Enhanced antigen binding
activity, di- and multi-specific binding, and other novel uses of
multivalent antigen-binding proteins have been demonstrated. See,
e.g., Whitlow, M., et al., Protein Engng. 7:1017-1026 (1994);
Hoogenboom, H. R., Nature Biotech. 15:125-126(1997); and WO
93/11161, and co-owned U.S. Pat. Nos. 5,869,620, 6,025,165,
6,027,725, 6,103,889, 6,121,424 and 6,515,110, all incorporated by
reference herein.
[0013] Although peptides, such as the single-chain polypeptides
described above, and fusion proteins thereof, have not been
associated with significant antigenicity in mammals, it has been
desirable to prolong the circulating life and even further reduce
the possibility of an antigenic response.
[0014] One way to enhance the circulating life and reduce the
antigenicity of proteins and polypeptides has been to conjugate
them to polymers, such as polyalkylene oxides. However, the
relatively small size of the polypeptides and their delicate
structure/activity relationship, have made polyethylene glycol
modification difficult and unpredictable.
[0015] To effect covalent attachment of polyalkalene oxides to a
protein, the hydroxyl end groups of the polymer must first be
converted into reactive functional groups. This process is
frequently referred to as "activation" and the product is called
"activated PEG" or activated polyalkylene oxide. For example,
methoxy poly(ethylene glycol) (mPEG), capped on one end with a
functional group, reactive towards amines on a protein molecule, is
used in most cases.
[0016] A number of activated polymers, such as succinimidyl
succinate derivatives of PEG ("SS-PEG"), have been introduced
(Abuchowski et al., Cancer Biochem. Biophys. 7:175-186 (1984)).
SS-PEG reacts quickly with proteins (30 minutes) under mild
conditions yielding active yet extensively modified conjugates.
Zalipsky, in U.S. Pat. No. 5,122,614, discloses poly(ethylene
glycol)-N-succinimide carbonate and its preparation. This form of
the polymer is said to react readily with the amino groups of
proteins, as well as low molecular weight peptides and other
materials that contain free amino groups. Other linkages between
the amino groups of the protein, and the PEG are also art known
such as urethane linkages (Veronese et al., Appl. Biochem.
Biotechnol. 11:141-152 (1985)), carbamate linkages (Beauchamp et
al., Analyt. Biochem. 131:25-33 (1983)), and others.
[0017] However, despite these and other methods, it has often been
found that the resulting conjugates lack sufficient retained
activity. For example, Benhar et al. (Bioconjugate Chem. 5:321-326
(1994)) observed that PEGylation of a recombinant single-chain
immunotoxin resulted in the loss of specific target
immunoreactivity of the immunotoxin. The loss of activity of the
immunotoxin was the result of PEG conjugation at two lysine
residues within the antibody-combining region of the immunotoxin.
To overcome this problem, Benhar et al. replaced these two lysine
residues with arginine residues and were able to obtain an active
immunotoxin that was 3-fold more resistant to inactivation by
derivatization.
[0018] Another suggestion for overcoming these problems discussed
above is to use longer, higher molecular weight polymers. These
materials, however, are difficult to prepare and expensive to use.
Further, they provide little improvement over more readily
available polymers. Another alternative suggested is to attach two
strands of polymer via a triazine ring to amino groups of a
protein. See, for example, Enzyme 26:49-53 (1981) and Proc. Soc.
Exper. Biol. Med., 188:364-369 (1988). However, triazine is a toxic
substance that is difficult to reduce to acceptable levels after
conjugation.
[0019] An examination of the three-dimensional structure of an SCA
protein reveals that the C-terminus and the linker region are
farthest removed from the antigen-binding site and therefore might
be sites for polymer conjugation wherein the attached polymer does
not sterically block or disrupt the conformation of the
antigen-binding site or the surrounding Fv architecture (Wang M.,
et al., 1998 Protein Engng 11:1277-1283) in the context of
positioning sites for polymer linkage to inserted residues that are
glycosylated, in vivo, during production of those proteins.
[0020] Efforts to position amino acid residues within SCA structure
for more effective polymer conjugation have been described by the
following co-owned parents of the present patent application, all
of which are incorporated by reference herein: U.S. Ser. Nos.
09/791,578 and 09/791,540 both filed on Feb. 26, 2001, describing
selectively positioned Cys and oligo Lys residues.
[0021] Co-owned U.S. Ser. Nos. 09/956,087 and 09/956,086, both Sep.
20, 2001 describe tandem and triplet ASN, and related sites in an
SCA for selectively positioned glycosylation to which polymers are
selectively conjugated. However, there remains a need in the art
for further options and improvements in positional conjugation of
polymers to SCA proteins, as well as further options and
improvements in conjugation chemistry, that allows for the binding
activity and specificity of the polypeptide to be retained, along
with all of the benefits of polymer conjugations.
SUMMARY OF THE INVENTION
[0022] In order to address these longstanding needs, the invention
provides for a TNF.alpha.-binding, single-chain antigen-binding
polypeptide ("SCA") capable of site-specific conjugation to a
polyalkylene oxide polymer, that comprises,
[0023] a first polypeptide comprising an antigen-binding portion of
a variable region of an antibody heavy or light chain;
[0024] a second polypeptide comprising an antigen-binding portion
of a variable region of an antibody heavy or light chain; and
[0025] a peptide linker linking the first and second
polypeptides,
[0026] wherein the single-chain antigen-binding polypeptide has at
least one Cys residue which is capable of being conjugated to a
polyalkylene oxide polymer, and has at least one antigen binding
site. The Cys residue is preferably located at one or more of the
following positions:
[0027] a C-terminus of the heavy chain or light chain variable
region;
[0028] an N-terminus of the heavy chain or light chain variable
region;
[0029] any amino acid position of the peptide linker;
[0030] both the N-terminus and C-terminus;
[0031] position 2 of the linker;
[0032] position 5 of the linker;
[0033] both position 2 of the linker and the C-terminus; and
[0034] combinations thereof.
[0035] Preferably, the TNF.alpha.-binding SCA selectively binds to
TNF.alpha..
[0036] More preferred Cys positions include, e.g., position 2 of
the linker, the C-terminus and combinations thereof. The C-terminus
is preferably a naturally occurring C-terminus, but can also
include any art known modifi35cations thereof
[0037] The SCA of the invention is optionally formed of variable
regions from light and/or heavy chains of an antibody of interest,
e.g., preferably an anti-TNF.alpha. antibody.
[0038] The invention also provides conjugates comprising the
inventive single-chain antigen-binding polypeptides or proteins,
wherein the conjugates include a substantially non-antigenic
polymers, e.g., a polyalkylene oxide polymer. The polyalkylene
oxide is preferably a polyethylene glycol or "PEG" polymer.
[0039] The polyalkylene oxide is any suitable size range, but
preferably ranges in size from about 5,000 to about 40,000
Daltons.
[0040] Preferably the polyalkylene oxide polymer is covalently
linked to the single-chain antigen-binding polypeptide at a Cys
residue.
[0041] Preferably, the polyalkylene oxide is linked to the
single-chain antigen-binding polypeptide at a Cys residue via a
linker, such as, for instance, a maleimide, vinylsulfone, thiol,
orthopyridyl disulfide and/or a iodoactemide linker. The maleimide
linker is most preferred.
[0042] In the polymer-conjugated embodiments of the invention, the
polyalkylene oxide is optionally conjugated to at least two
single-chain antigen-binding polypeptides, wherein each
single-chain antigen-binding polypeptide is the same, or
different.
[0043] Optionally, the conjugate, e.g. either the PAO or the SCA,
or both, is further linked or conjugated to an additional
functional moiety, e.g., a detectable label or tag.
[0044] The invention also provides for polynucleotides encoding the
single-chain antigen-binding polypeptides, replicable expression
vectors comprising the polynucleotides, and suitable host cells for
expressing the same.
[0045] The inventive SCA proteins are produced by any suitable,
art-known process or method, but are preferably produced, as
exemplified herein, by culturing a host cell comprising an SCA
encoding expression vector and collecting the single-chain
antigen-binding polypeptide expressed by the host cell.
[0046] The invention further provides for a protein comprising two
or more single-chain antigen-binding polypeptides capable of
site-specific conjugation as a multivalent antigen-binding protein
in the form of dimers, trimers, tetramers, and the like.
[0047] The inventive multivalent protein is prepared by art-known
methods wherein each SCA is linked by covalent or noncovalent
linkers, e.g., peptide linkers, disulfide linkers, and the like. In
an alternative option, the protein is assembled with noncovalent
linkers by reducing and refolding the constituent SCA polypeptides.
In the later option, it is particularly preferred that the peptide
linker of the constituent single-chain antigen-binding proteins or
polypeptides range in size from 2 to 18 residues.
[0048] The invention further provides for a multivalent protein,
having the particular Cys residues in one or more of the
constituent SCA polypeptides, that is encoded as a single,
multivalent protein. A polynucleotide encoding such a single chain
multivalent protein is also contemplated as part of the present
invention.
[0049] Methods for using the inventive SCAs and polymer conjugates
are also provided. Simply by way of example, one such method
includes the steps of:
[0050] contacting a sample suspected of containing TNF.alpha. with
a reagent comprising a single-chain antigen-binding polypeptide or
a multivalent protein according to the invention, and detecting
whether the single-chain antigen-binding polypeptide or multivalent
protein according to the invention has bound to the TNF.alpha..
Advantageously, the polypeptide or multivalent protein according to
the invention is conjugated to a polyalkylene oxide polymer.
[0051] For all of the above methods, the conjugate, either the SCA
or the polymer, is optionally anchored to a solid substrate.
[0052] Also provided are methods of treating or diagnosing a
disease or disorder in a mammal, e.g., a human, comprising
administering an effective amount of the TNF.alpha.-binding
single-chain antigen-binding polypeptide of the invention, wherein
the single-chain antigen-binding polypeptide binds to TNF.alpha.
and is administered in an amount effective to inhibit TNF.alpha.
related toxicity. The single-chain antigen-binding polypeptide of
the invention and/or polymer conjugates thereof, is administered in
amounts ranging from about 10 .mu.g/kg to about 4,000 .mu.g/kg, and
more preferably in amounts ranging from about 20 .mu.g/kg to about
800 .mu.g/kg, and even more preferably from about 20 .mu.g/kg to
about 400 .mu.g/kg, by any art-known systemic route, wherein the
dose is repeated as needed for effecting a clinical response.
Administration by perfusion into body cavities, by inhalation or
intranasal routes, along with topical administration, is also
contemplated in order to treat systemic, as well as more localized
conditions benefiting from the inventive anti-TNF alpha
polypeptides, proteins and polymer conjugated compounds. Such
conditions include, e.g., toxic shock syndromes, and any other
art-known inflammatory processes responsive to anti-TNF alpha
treatment.
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] FIG. 1A illustrates the sequence of the DNA molecule
encoding SCA 2-7-SC-1 (SEQ ID-NO: 1) having the construction
V.sub.L-218-V.sub.H-his.s- ub.6 and no Cys mutein, and the
expressed protein (SEQ ID NO: 10).
[0054] FIG. 1B illustrates the sequence of the DNA molecule
encoding 2-7-SC-2 (SEQ ID NO: 2) having the construction
V.sub.L-218-V.sub.H-his.s- ub.6 and that encodes an SCA with a
C-terminus Cys, and the expressed protein (SEQ ID NO: 11).
[0055] FIG. 1C illustrates the sequence of the DNA molecule
encoding 2-7-SC-3 (SEQ ID NO: 3) having the construction
V.sub.H-(GGGGS).sub.3-V.s- ub.L-his.sub.6 and that encodes an SCA
with a C-terminus Cys, and the expressed protein (SEQ ID NO:
12).
[0056] FIG. 1D illustrates the sequence of the DNA molecule
encoding 2-7-SC-4 (SEQ ID NO: 4) having the construction
V.sub.L-218-V.sub.H and that encodes an SCA with a C-terminus Cys,
and the expressed protein (SEQ ID NO: 13).
[0057] FIG. 1E illustrates the sequence of the DNA molecule
encoding 2-7-SC-5 (SEQ ID NO: 5) having the construction
V.sub.L-218-V.sub.H-his.s- ub.6 and that encodes an SCA with a Cys
at linker position 2, and the expressed protein (SEQ ID NO:
14).
[0058] FIG. 1F illustrates the sequence of the DNA molecule
encoding 2-7-SC-6 (SEQ ID NO: 6) having the construction
V.sub.L-218-V.sub.H-his.s- ub.6 and that encodes an SCA with a Cys
at linker position 2 and a Cys at the C terminus, and the expressed
protein (SEQ ID NO: 15).
[0059] FIG. 1G illustrates the sequence of the DNA molecule
encoding 2-7-SC-7 (SEQ ID NO: 7) having the construction
V.sub.H-(GGGGS).sub.3-V.s- ub.L-his.sub.6 and that encodes an SCA
with a Cys at linker position 5 and the expressed protein (SEQ ID
NO: 16).
[0060] FIG. 1H illustrates the sequence of the DNA molecule
encoding 2-7-SC-8 (SEQ ID NO: 8) having the construction
V.sub.L-218-V.sub.H-his.s- ub.6 and that encodes an SCA with a Cys
at both the N-terminus and C-terminus, and the expressed protein
(SEQ ID NO: 17).
[0061] FIG. 1-I illustrates the sequence of the DNA molecule
encoding 2-7-SC-9 (SEQ ID NO: 9) having the construction
V.sub.L-GGGGS-V.sub.H-his- .sub.6 and that encodes an SCA with no
free Cys, and the expressed protein (SEQ ID NO: 18).
[0062] FIG. 2A. illustrates clone 2-7-SC-2 SCA expression.
Expression of the SCA protein is induced by 1% methanol or MeOH in
Pichia culture. 27 kDa is marked by the arrow (".fwdarw.").
[0063] FIG. 2B illustrates expression and purification data for
clone 2-7-SC-2, including the SDS-PAGE gel analysis by Coomassie
Blue staining of the fractions, and the yield at each step. A small
amount of .about.54 kDa disulfide-linked dimer is visible in the
stained gel. Legend: STD, Mark12 protein molecular weight
standards; SUP, fermentation harvest supernatant; DIA, diafiltered
supernatant; DEAE, first DEAE chromatography flow-through; Ni++,
eluted sample after nickel affinity chromatography; DEAE, second
DEAE chromatography. Peaks are visible at about 27 kDa, as
identified by the carrot ">".
[0064] FIG. 3A illustrates the structure of mPEG-MAL.
[0065] FIG. 3B illustrates the structure of mPEG.sub.2(MAL).
[0066] FIG. 3C illustrates the structure of mPEG(MAL).sub.2.
[0067] FIG. 3D illustrates the structure of
mPEG.sub.2(MAL).sub.2.
[0068] FIG. 3E illustrates reaction of activated PEG-MAL with a
thiol-SCA.
[0069] FIG. 3F illustrates a vinylsulfone active PEG.
[0070] FIG. 4 is a spectrograph plot of absorbance verses
wavelength between 200 and 400 nm. Curve A is cysteine, 3 mM; curve
B is PEG-MAL (1 mM)+cysteine (3 mM) post-reaction; and curve C is
PEG-MAL 1 mM.
[0071] FIG. 5A illustrates an SDS-PAGE analysis of 2-7-SC-5 and
2-7-SC-5 conjugates with visualization by Brilliant Blue Stain.
Lane 1 provides MARK12 (Invitrogen) protein size standards, lane 2
is non-conjugated 2-7-SC-5 SCA, lane 3 is PEG(20K)2-7-SC-5 SCA and
lane4 is PEG(40K)2-7-SC-5 SCA.
[0072] FIG. 5B illustrates an SDS-PAGE analysis of 2-7-SC-5 and
2-7-SC-5 conjugates with visualization by iodine staining. Lane 1
provides MARK12 protein size standards, lane 2 is non-conjugated
2-7-SC-5 SCA, lane 3 is PEG(20K)2-7-SC-5 SCA and lane4 is
PEG(40K)2-7-SC-5 SCA.
[0073] FIG. 6A illustrates flow cytometry analysis of the binding
of biotinylated TNF.alpha. to cell receptor in the presence of
2-7-SC-2 SCA. Curve 1 represents the cell population without
fluorescence labeling, curve 2 represents the cell population after
binding to biotin-TNF.alpha. and then to streptavidin-PE, curve 3
represents the cell population preincubated with SCA,
biotin-TNF.alpha., and then streptavidin-PE.
[0074] FIG. 6B illustrates flow cytometry analysis of the binding
of biotinylated TNF.alpha. to cell receptor in the presence of
2-7-SC-2 PEG(20K) SCA. Curve 1 represents the cell population
without fluorescence labeling, curve 2 represents the cell
population after binding to biotin-TNF.alpha. and then to
streptavidin-PE, curve 3 represents the cell population
preincubated with PEG-SCA, biotin-TNF.alpha. and then to
streptavidin-PE.
[0075] FIG. 6C illustrates flow cytometry analysis of the binding
of biotinylated TNF.alpha. to cell receptor in the presence of
2-7-SC-2 PEG(40K) SCA. Curve 1 represents the cell population
without fluorescence labeling, curve 2 represents the cell
population after binding to biotin-TNF.alpha. and then to
streptavidin-PE, curve 3 represents the cell population
preincubated with PEG-SCA, TNF.alpha. and then to
streptavidin-PE.
[0076] FIG. 7 shows a Western blot analysis of D2E7 2-7-SC-2 SCA
protein and PEG-SCA derivatives. The primary detection antibody was
anti-2-7-SC-1 SCA rabbit antiserum prepare from rabbits immunized
with the purified recombinant SCA protein. Lane 1 and 7, molecular
weight markers (250, 148, 98, 64, 50, 36, 22, 16, 6 and 4 kDa);
lane 2, 2-7-SC-2 SCA protein; lane 3, ethyl-2-7-SC-2; lane 4, PEG
(5 kDa)-2-7-SC-2; lane 5, PEG (20 kDa)-2-7-SC-2; lane 6, PEG (40
kDa)-2-7-SC-2.
[0077] FIG. 8 shows the scanned image intensity of the bands of
D2E7 2-7-SC-2 and PEGylated forms confirming reactivity of this
anti-D2E7 antiserum with the recombinant SCA proteins and PEG-SCA
conjugates. Band A is 2-7-SC-2, Band B is 2-7-SC-5, Band C is
PEG(20 k)-2-7-SC-2, Band D is PEG(20 k)-2-7-SC-5, Band E is PEG(40
k)-2-7-SC-2, Band F is PEG(40 k)-2-7-SC-5.
[0078] FIG. 9 shows the SDS PAGE analysis of a representative set
of samples for the pharmacokinetic studies. 2-7-SC-2 SCA proteins
and 2-7-SC-2 PEG-SCA conjugates were examined on Coomassie Blue
stained gels. On the left gel, the loaded samples were non-reduced.
On the right gel, the samples were reduced with 3 mM
beta-mercaptoethanol and heated to 85.degree. C. for 2 minutes
prior to loading. Approximately ten micrograms of protein was
loaded for each lane. Legend: MM-molecular weight standards; lane
1, 2-7-SC-2 SCA; lane 2, 2-7-SC-2 SCA modified with
N-ethylmaleimide; lane 3, 2-7-SC-2 SCA-PEG(40 kDa); lane 4,
2-7-SC-2 SCA-PEG(20 kDa).
DETAILED DESCRIPTION OF THE INVENTION
[0079] Accordingly, the present invention provides improved
anti-TNF-.alpha. single-single chain antigen-binding polypeptides
and/or multivalent proteins comprised of such polypeptides, with
engineered functional groups selected to facilitate site-directed
conjugation to polymers, e.g., substantially non-antigenic
polymers. Conjugates of the inventive polypeptides with polymers,
as well as methods of making and using the same, are also
provided.
[0080] The invention broadly relates to the discovery that
single-chain antigen-binding proteins ("SCA") or single-chain
variable fragments of antibodies ("sFv"), have enhanced properties
when conjugated to suitable polyalkylene oxide polymers at specific
locations on the SCA polypeptide. The SCAs of the invention are
engineered to include functional groups for selective polymer
conjugation at such specific locations. The benefits of polymer
conjugation broadly include substantially reduced antigenicity in
vivo, and increased circulating half-life after administration to
an animal or human patient. Without meaning to be bound by any
theory or hypothesis as to how the inventive SCAs provide
conjugates with desirable properties, it is believed that, by
engineering the binding sites at selected locations on the
polypeptide chain or chains, interference with antigen binding
function and chain tertiary structure by the presence of the
conjugated polymer(s) is avoided or minimized.
[0081] In order to better appreciate the scope of the invention,
the following terms are defined. The terms "single-chain
antigen-binding molecule" ("SCA") or "single-chain Fv" (sFv) are
used interchangeably herein unless otherwise specified. The terms,
"protein" and "polypeptide" are also used interchangeably unless
otherwise specified. Broadly, an SCA is structurally defined as
comprising the binding portion of a first polypeptide from the
variable region of an antibody V.sub.L (or V.sub.H), associated
with the binding portion of a second polypeptide from the variable
region of an antibody V.sub.H (or V.sub.L), the two polypeptides
being joined by a peptide linker linking the first and second
polypeptides into a single polypeptide chain, such that the first
polypeptide is N-terminal to the linker and second polypeptide is
C-terminal to the first polypeptide and linker.
[0082] The SCA thus comprises a pair of variable regions connected
by a polypeptide linker. The regions may associate to form a
functional antigen-binding site, as in the case wherein the regions
comprise a light-chain and a heavy-chain variable region pair with
appropriately paired complementarity determining regions (CDRs). In
this case, the single-chain protein is broadly referred to as a
"single-chain antigen-binding protein" or "single-chain
antigen-binding molecule" or "single-chain antigen-binding
polypeptide." As defined above, the SCAs are optionally
"monovalent" or "multivalent." Monovalent SCAs are engineered to
include only a single antigen binding site, i.e., a single pair of
variable regions connected by a polypeptide linker associating to
form the antigen binding site. Multivalent SCAs are antigen binding
proteins engineered to include two or more antigen binding sites,
ie., two or more pairs of variable regions connected by a
polypeptide linker, including SCAs that include two or more
single-chain antigen-binding polypeptides as described above. The
constituent SCA moieties are associated by any art-known
method.
[0083] In one embodiment, multivalent binding proteins according to
the invention include two or more SCAs that are noncovalently
associated so as to remain fully functional as antigen binding
proteins. In another embodiment, multivalent binding proteins
include two or more SCAs that are associated by covalent linkage,
e.g., via one of several art-known peptide or non-peptide linker
chemistries. Further, multivalent binding proteins, e.g., formed of
plural SCAs, can be expressed or synthetically constructed as a
single peptide chain, analogously to a monovalent SCA, but with two
or more repeated SCA domains, that are the same or different.
[0084] SCAs are constructed so that the V.sub.L is the N-terminal
domain followed by the linker and V.sub.H (a V.sub.L-Linker-V.sub.H
construction). In an alternative embodiment, SCAs are constructed
so that V.sub.H is the N-terminal domain followed by the linker and
V.sub.L (V.sub.H-Linker-V.sub.L construction). The preferred
embodiment contains V.sub.L in the N-terminal domain (see, Anand,
N. N., et al., J. Biol. Chem. 266:21874-21879 (1991)). Optionally,
multiple linkers are employed.
[0085] A description of the theory and production of single-chain
antigen-binding proteins is found in Ladner et al., U.S. Pat. Nos.
4,946,778, 5,260,203, 5,455,030 and 5,518,889, and in Huston et
al., U.S. Pat. No. 5,091,513 ("biosynthetic antibody binding sites"
(BABS)), all incorporated herein by reference. The SCAs produced
according to the above patents have binding specificity and
affinity substantially similar to that of the corresponding Fab
fragment.
[0086] Variable Domains (Fv)
[0087] The SCAs of the invention are constructed with variable
domains ("Fv") that are selected, derived or modeled from any
desirable natural or artificial antibody. In another preferred
embodiment, Fv for use in the invention are obtained from libraries
of Fvs configured as permutation libraries, screened against a
desired binding target(s). Simply by way of example, large numbers
of MAbs have been employed by the art to obtain Fv domains and it
is contemplated that Fv domains can be obtained, and employed in
the SCAs of the invention, from any of these. Simply by way of
example, and without limitation, the following MAbs are employed to
provide Fv domains: 26-10, MOPC 315, 741F8, 520C9, McPC 603, D1.3,
murine phOx, human phOx, RFL3.8 sTCR, 1A6, Sel55-4, 18-2-3, 4-4-20,
7A4-1, B6.2, CC49, 3C2, 2c, MA-15C5/K.sub.12G.sub.0, Ox, etc. (See,
Huston, J. S. et al., Proc. Natl. Acad. Sci. (USA) 85:5879-5883
(1988); Huston, J. S. et al., SIM News 38(4) (Supp.):11 (1988);
McCartney, J. et al., ICSU Short Reports 10:114 (1990); McCartney,
J. E. et al., unpublished results (1990); Nedelman, M. A. et al.,
J. Nuclear Med. 32 (Supp.): 1005 (1991); Huston, J. S. et al., In:
Molecular Design and Modeling: Concepts and Applications, Part B,
edited by J. J. Langone, Methods in Enzymology 203:46-88 (1991);
Huston, J. S. et al., In: Advances in the Applications of
Monoclonal Antibodies in Clinical Oncology, Epenetos, A. A. (Ed.),
London, Chapman & Hall (1993); Bird, R. E. et al., Science
242:423-426 (1988); Bedzyk, W. D. et al., J. Biol. Chem.
265:18615-18620 (1990); Colcher, D. et al., J. Nat. Cancer Inst.
82:1191-1197 (1990); Gibbs, R. A. et al., Proc. Natl. Acad. Sci.
(USA) 88:4001-4004 (1991); Milenic, D. E. et al., Cancer Research
51:6363-6371 (1991); Pantoliano, M. W. et al., Biochemistry
30:10117-10125 (1991); Chaudhary, V. K. et al., Nature 339:394-397
(1989); Chaudhary, V. K. et al., Proc. Natl. Acad. Sci. (USA)
87:1066-1070 (1990); Batra, J. K. et al., Biochem. Biophys. Res.
Comm. 171:1-6 (1990); Batra, J. K. et al., J. Biol. Chem.
265:15198-15202 (1990); Chaudhary, V. K. et al., Proc. Natl. Acad.
Sci. (USA) 87:9491-9494 (1990); Batra, J. K. et al., Mol. Cell.
Biol. 11:2200-2205 (1991); Brinkmann, U. et al., Proc. Natl. Acad.
Sci. (USA) 88:8616-8620 (1991); Seetharam, S. et al., J. Biol.
Chem. 266:17376-17381 (1991); Brinkmann, U. et al., Proc. Natl.
Acad. Sci. (USA) 89:3075-3079 (1992); Glockshuber, R. et al.,
Biochemistry 29:1362-1367 (1990); Skerra, A. et al., Bio/Technol.
9:273-278 (1991); Pack, P. et al., Biochemistry 31:1579-1534
(1992); Clackson, T. et al., Nature 352:624-628 (1991); Marks, J.
D. et al., J. Mol. Biol. 222:581-597 (1991); Iverson, B. L. et al.,
Science 249:659-662 (1990); Roberts, V. A. et al., Proc. Natl.
Acad. Sci. (USA) 87:6654-6658 (1990); Condra, J. H. et al., J.
Biol. Chem. 265:2292-2295 (1990); Laroche, Y. et al., J. Biol.
Chem. 266:16343-16349 (1991); Holvoet, P. et al., J. Biol. Chem.
266:19717-19724 (1991); Anand, N. N. et al., J. Biol. Chem.
266:21874-21879 (1991); Fuchs, P. et al., Bio/Technol. 9:1369-1372
(1991); Breitling, F. et al., Gene 104:104-153 (1991); Seehaus, T.
et al., Gene 114:235-237 (1992); Takkinen, K. et al., Protein
Engng. 4:837-841 (1991); Dreher, M. L. et al., J. Immunol. Methods
139:197-205 (1991); Mottez, E. et al., Eur. J. Immunol. 21:467-471
(1991); Traunecker, A. et al., Proc. Natl. Acad. Sci. (USA)
88:8646-8650 (1991); Traunecker, A. et al., EMBO J. 10:3655-3659
(1991); Hoo, W. F. S. et al., Proc. Natl. Acad. Sci. (USA)
89:4759-4763 (1993)). All of the foregoing citations are
incorporated by reference herein.
[0088] In particular, the anti-TNF.alpha. MAb described as D2E7 by
U.S. Pat. No. 6,258,562, and the anti-erbB-2 MAb (HERCEPTIN.TM.)
described by Carter P et al., 1992, Proc Natl Acad Sci (USA)
89:4285-4289 served as exemplary models for the engineering of SCAs
and SCA-polyalkylene oxide conjugates, according to the invention.
D2E7 is commercially available as Humira.RTM. (Abbott Immunology,
Abbott Park, Ill.). In addition, the CC49 MAb was developed by Dr.
Jeffrey Schlom's group, Laboratory of Tumor Immunology and Biology,
National Cancer Institute. It binds specifically to the
pan-carcinoma tumor antigen TAG-72. See Muraro, R. et al., Cancer
Research 48:4588-4596 (1988). The anti-TAG-72 CC-49 SCA described
by Filpula et al. 1996 (Antibody Engineering: A Practical Approach,
, Oxford University Press, pp 253-268), was also prepared as a
Cys-modified SCA and as an exemplary conjugate according to the
invention. All of the foregoing citations are incorporated by
reference herein.
[0089] Peptide Linkers
[0090] SCAs according to the invention include peptide linkers
designed to span the C-terminus of V.sub.L, or neighboring site
thereof, and the N-terminus of V.sub.H, or neighboring site
thereof, or to link the C-terminus of V.sub.H and the N-terminus of
V.sub.L.
[0091] The artisan will appreciate that linker length depends upon
the nature of the polypeptides to be linked and the desired
activity of the linked fusion polypeptide resulting from the
linkage. Generally, the linker should be long enough to allow the
resulting linked fusion polypeptide to properly fold into a
conformation providing the desired biological activity, i.e.,
antigen-binding. In each particular case, the preferred length will
depend upon the nature of the polypeptides to be linked and the
desired activity of the linked fusion polypeptide resulting from
the linkage.
[0092] Where conformational information is available, as is the
case with the SCA polypeptides discussed below, the appropriate
linker length may be estimated by consideration of the
3-dimensional conformation of the substituent polypeptides and the
desired conformation of the resulting linked fusion polypeptide.
Where such information is not available, the appropriate linker
length may be empirically determined by testing a series of linked
fusion polypeptides with linkers of varying lengths for the desired
biological activity. Such linkers are described in detail in WO
94/12520, incorporated herein by reference.
[0093] Peptide linkers used to construct SCA polypeptides generally
range in size from about 2 to about 50 amino acid residues in
length, and preferably, from about to 2 to about 10 residues. In
certain other embodiments, the linkers range in size from about 10
to about 30 residues. In certain more preferred embodiment,
particularly for embodiments related to multivalent binders
comprising two or more noncovalently associated SCA polypeptides,
it is preferred that the linker range in size from about 2 to about
20 amino acid residues. More preferably, such linkers are serine
rich or glycine rich.
[0094] The linkers are designed to be flexible, and it is
recommended that an underlying sequence of alternating Gly and Ser
residues be used. To enhance the solubility of the linker and the
single chain Fv protein associated therewith, three charged
residues may be included, two positively charged lysine residues
(K) and one negatively charged glutamic acid residue (E).
Preferably, one of the lysine residues is placed close to the
N-terminus of V.sub.H, to replace the positive charge lost when
forming the peptide bond of the linker and the V.sub.H. Such
linkers are described in detail by co-owned U.S. Pat. No.
5,856,456, incorporated by reference herein. See also, Whitlow, M.,
et al., Protein Engng. 7:1017-1026 (1994), incorporated by
reference herein.
[0095] For multivalent antigen binding proteins according to the
invention, the covalent or noncovalent association of two or more
SCA polypeptides is preferred for their formation. Although,
multivalent SCAs can be produced from SCA with linkers as long as
25 residues, they tend to be unstable. Holliger, P., et al., Proc.
Natl. Acad. Sci. (USA) 90:6444-6448 (1993), have recently
demonstrated that linkers 0 to 15 residues in length facilitate the
formation of divalent Fvs. See, Whitlow, M., et al., Protein Engng
7:1017-1026 (1994); Hoogenboom, H. R., Nature Biotech. 15:125-126
(1997); and WO 93/11161, incorporated by reference herein.
[0096] Identification and Synthesis of Site-specific PEGylation
Sequences
[0097] The invention provides for thiol functional moieties, e.g.,
a thiol-containing amino acid residue located at specific sites in
the V.sub.L and V.sub.H regions, adjacent to the C-terminus of the
polypeptide (V.sub.L, V.sub.H or a neighboring site thereof), the
N-terminus of the polypeptide (V.sub.L, V.sub.H or neighboring site
thereof), the linker region between the first and second
polypeptide regions, or in a combination of these regions. In the
present invention, it is preferred that specific sites for polymer
conjugation be located in the polypeptide linker, the C-terminus or
adjacent to the C-terminus of the SCA, and preferably, at the
second residue of the linker.
[0098] The thiol-containing functional group can be any known to
art, including natural amino acid residues, and/or
non-naturally-occurring amino acid residues, as well has
thiol-functionalized derivatives of the same. In a preferred
embodiment, the thiol functional moiety is a cysteine residue. This
is preferred because SCA proteins normally have two buried
disulfide bonds (Padlan EA, 1994, Antibody-Antigen Complexes, R. G.
Landes Company, Austin), but no free cysteines. Thus, only the
engineered Cys thiols are available for conjugation with activated
polymers selective for reaction with thiols.
[0099] The particular nucleotide sequence which is used to
introduce a Cys site into the various positions will depend upon
the naturally-occurring nucleotide sequence. The most preferred
sites are those in which it takes a minimum number of changes to
create the Cys insertion while meeting the above-described steric
requirements, as well. Of course, based on the redundancy of the
genetic code, a particular amino acid may be encoded by multiple
nucleotide sequences.
[0100] Any suitable art-known method for site-directed mutagenesis
is used to change the native protein sequence to one that
incorporates the Cys residue. The mutant protein gene is placed in
an expression system, such as bacterial cells, yeast or other
fungal cells, insect cells or mammalian cells. The mutant protein
is then purified by standard methods for recovery of proteins.
[0101] Preferably, nucleic acid molecules expressing SCA muteins
are produced by oligonucleotide-directed mutagenesis. Such methods
for generating the site-specific Cys muteins, and related
techniques for mutagenesis of cloned DNA, are well known in the
art. See, Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL,
2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
(1989); Ausubel et al. (eds.), CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley and Sons (1987), both incorporated herein by
reference.
[0102] Hosts and Vectors
[0103] After mutating the nucleotide sequence of an SCA of interest
to provide for a Cys residue at the desired location, the mutated
nucleic acid is preferably inserted into a suitable cloning vector,
where the nucleotide encoding the SCA is operably linked to
regulatory sequences controlling transcriptional expression. These
are preferably selected by art-known techniques in order to
optimize SCA production from a desired host cell system.
[0104] SCAs are known to be expressed and produced by prokaryotic
or eukaryotic host cells, although for many purposes eukaryotic
host cells are preferred. Preferred prokaryotic hosts include, but
are not limited to, bacteria such as Bacillus, Streptomyces,
Streptococci, and/or Escherichia coli. Preferred eukaryotic host
cells include yeast or other fungal cells, insect cells and/or
mammalian cells. Preferably, these include human or primate cells,
present either in vivo, or in tissue culture. More preferably, the
inventive SCAs are produced by transformed yeast, such as Pichia
pastoris. Expression vectors are optionally selected to provide
transient expression in a host cell, or to integrate into the host
cell genome to create a transformed cell line.
[0105] Standard protein purification methods are used to purify
these mutant proteins. Only minor modification to the native
protein purification scheme may be required. For example, selection
of vectors, hosts, methods of production, isolation and
purification of monovalent, multivalent and fusion forms of
proteins, especially SCA polypeptides, are thoroughly described by
e.g., co-owned U.S. Pat. Nos. 4,946,778 and 6,323,322 incorporated
by reference herein.
[0106] In one preferred embodiment, a nucleic acid molecule
encoding an SCA of interest and a selection marker is integrated
into a host cell chromosome, either as a single vector or as
co-introduced vectors. The marker may complement an auxotrophy in
the host (such as his4, leu2, or ura3, which are common yeast
auxotrophic markers), biocide resistance, e.g., antibiotics, or
resistance to heavy metals, such as copper, or the like. The
selectable marker gene can either be directly linked to the SCA DNA
sequence to be expressed, or introduced into the same cell by
co-transfection. Cells which have stably integrated the introduced
nucleic acid are selected by survival or other effects of the
marker in a given system.
[0107] In another embodiment, the SCA of interest is encoded by a
suitable plasmid vector capable of autonomous replication in the
recipient host cell. Any of a wide variety of art-known vectors may
be employed for this purpose. Factors of importance in selecting a
particular plasmid or viral vector include: the ease with which
recipient cells that contain the vector may be recognized and
selected from those recipient cells which do not contain the
vector; the number of copies of the vector which are desired in a
particular host; and whether it is desirable to be able to
"shuttle" the vector between host cells of different species.
[0108] Any of a series of yeast vector systems can be utilized.
Examples of such expression vectors include the yeast 2-micron
circle, the expression plasmids YEP13, YCP and YRP, etc., or their
derivatives. Such plasmids are well known in the art (Botstein et
al., Miami Wntr. Symp. 19:265-274 (1982); Broach, J. R., In: The
Molecular Biology of the Yeast Saccharomyces: Life Cycle and
Inheritance, Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y., p. 445-470 (1981); Broach, J. R., Cell 28:203-204 (1982)).
115
[0109] For a mammalian host, several art-known vector systems are
available. One class of vectors utilize DNA elements which provide
autonomously replicating extra-chromosomal plasmids, derived from
animal viruses such as bovine papilloma virus, polyoma virus,
adenovirus, or SV40 virus. A second class of vectors relies upon
the integration of the desired gene sequences into the host
chromosome. Cells which have stably integrated the introduced DNA
into their chromosomes are marker selected as discussed supra.
Additional elements may also be needed for optimal synthesis of
mRNA. These elements may include splice signals, as well as
transcription promoters, enhancers, and termination signals. The
cDNA expression vectors incorporating such elements include those
described by Okayama, H., Mol. Cell. Biol. 3:280 (1983), and others
well known to the art.
[0110] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript
vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A,
available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540,
pRIT5 available from Pharmacia. Among preferred eukaryotic vectors
are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene;
and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred
vectors for expression in Pichia are pHIL-S 1 (Invitrogen Corp.)
and pPIC9 (Invitrogen Corp.). Other suitable vectors will be
readily apparent to the skilled artisan.
[0111] Once the vector or DNA sequence containing the constructs
has been prepared for expression, the DNA constructs may be
introduced or transformed into an appropriate host. Various
techniques may be employed, such as transformation, transfection,
protoplast fusion, calcium phosphate precipitation,
electroporation, or other conventional techniques. After the cells
have been transformed with the recombinant DNA (or RNA) molecule,
the cells are grown in media and screened for appropriate
activities. Expression of the sequence results in the production of
the mutant SCA for PEG conjugation of the present invention.
[0112] Production and Purification of SCA Proteins
[0113] The monovalent or multivalent antigen-binding proteins of
the invention can be produced by any suitable art-known methods.
Broadly, the method includes preparing a suitable expression
vector, expressing the vector in a compatible host cell, culturing
the host cells and recovering the desired protein.
[0114] For expression in prokaryiotic cells or other cultured cells
not capable of secreting the recombinant protein into the culture
medium, the recovery is from the harvested cells. The harvested
cellular material is subjected to cell lysis and washing,
solubilization of the formed inclusion bodies in a compatible
denaturing solvent, refolding by dilution under conditions
effective to provide refolding into a function binding protein, and
two ion-exchange HPLC chromatography steps. Preferred prokaryotic
expression systems include, e.g., Escherichia coli ("E. coli") See,
for example, U.S. Pat. Nos. 4,946,778, 5,260,203, 5,455,030,
5,518,889, AND 5,534,621, as well as Bird et al., Science 242:423
(1988), also incorporated by reference herein.
[0115] Initial work on expression of the exemplified SCA proteins
employed the E. coli expression system obtained from Xoma
Corporation (araB promoter and pelB signal). The SCA protein was
successfully expressed. However, the proteins expressed by the Xoma
Corp. system remained cell associated in the periplasm, and would
have required additional purification steps.
[0116] A more preferred expression system employs eukaryotic host
cells and an expression vector with a secretion signal sequence.
This preferred embodiment avoids the need to recover the SCA
expressed as insoluble inclusion bodies from E. coli host cells.
glycosylation, where needed. A number of recombinant DNA strategies
exist which utilize strong promoter sequences and high copy number
of plasmids which can be utilized for production of the desired
proteins in yeast. Yeast recognizes leader sequences on cloned
mammalian gene products, and secretes peptides bearing leader
sequences (i.e., pre-peptides).
[0117] For this reason, the SCA proteins exemplified herein were
all expressed by secretion from the yeast Pichia pastoris and
recovered from solution.
[0118] SCA Proteins with D2E7 MAb Variable Domains
[0119] In a particularly preferred embodiment, SCAs according to
the invention were developed employing variable domains of the D2E7
MAb. The D2E7 MAb was developed by Cambridge Antibody Technology
and BASF Corporation. It binds specifically to a human cytokine,
tumor necrosis factor alpha (TNF-.alpha.), and the MAb is described
in detail by U.S. Pat. Nos. 6,09,0382, 6,258,562, incorporated by
reference herein.. Selected domains of this antibody served as
models to prepare a number of exemplary SCA molecules having one or
more Cys residues incorporated into their respective polypeptide
sequences at specific locations.
[0120] In brief, a wholly synthetic gene was constructed by
polymerase chain reaction (PCR) using 14 long overlapping synthetic
oligonucleotides, ranging from 20 bases to 102 bases in length,.
Oligonucleotide-directed mutagenesis was further employed to
construct other variants of the original sequence. The SCAs encoded
by the resulting vectors contain the complete variable light
(V.sub.L) and variable heavy (V.sub.H) segments of the D2E7 MAb,
connected by a peptide linker. The exemplified linkers were an
eighteen residue linker designated as the "218-linker," and a 15
residue linker.
[0121] The eighteen amino acid "218-linker" has been described by
Filpula et al, 1996, Antibody Engineering: A Practical Approach,
1996, Oxford University Press, pp 253-268). The 15 amino acid long
(GGGGS).sub.3 linker (SEQ ID NO; 42) has been described by Huston J
S et al, 1988, Proc Natl Acad Sci (USA) 85:5879-5883. In some
cases, a six-histidine tag (his.sub.6) (SEQ ID NO: 43) at the
C-terminus was included to simplify purification via metal
immobilized metal ion-affinity chromatography (IMAC). The completed
genes were cloned into an E. coli plasmid for DNA sequence
confirmation on an ABI PRISM.RTM. 310 Genetic Analyzer from Applied
Biosystems (Foster City, Calif.) (formerly produced by
ABI/Perkin-Elmer). The domain orientations, linkers, and placement
of the free cysteine are summarized in Table 1, below.
1TABLE 1 SCA CLONES WITH D2E7 Fv SCA Clone Nos. SEQ ID NOs DESIGN
Free Cys at Position(s) FIGS. 2-7-SC-1 SEQ ID NO: 1
V.sub.L-218-V.sub.H-his.sub.6 None 1A 2-7-SC-2 SEQ ID NO: 2
V.sub.L-218-V.sub.H-his.sub.6 C-terminus 1B 2-7-SC-3 SEQ ID NO: 3
V.sub.H-(GGGGS).sub.3-V.sub.L-his.sub.6 C-terminus 1C 2-7-SC-4 SEQ
ID NO: 4 V.sub.L-218-V.sub.H C-terminus 1D 2-7-SC-5 SEQ ID NO: 5
V.sub.L-218-V.sub.H-his.sub.6 Linker position 2 1E 2-7-SC-6 SEQ ID
NO: 6 V.sub.L-218-V.sub.H-his.sub.6 Linker position 2 and
C-terminus 1F 2-7-SC-7 SEQ ID NO: 7
V.sub.H-(GGGGS).sub.3-V.sub.L-his.sub.6 Linker position 5 1G
2-7-SC-8 SEQ ID NO: 8 V.sub.L-218-V.sub.H-his.sub.6 Both N- and
C-terminus 1H 2-7-SC-9 SEQ ID NO: 9 V.sub.L-GGGGS-V.sub.H-his.sub.-
6 None 1-I
[0122] As summarized by Table 1, above, FIGS. 1A, 1B, 1C, 1D, 1E,
1F, 1G, 1H and 1-I present the DNA and encoded polypeptide
sequences of the above nine genes.
[0123] Recombinant expression and purification of SCA proteins.
[0124] As noted above, Pichia pastoris was employed for production
of the SCA variant proteins described above. The signal sequence
from the yeast alpha mating factor was inserted directly in front
of the mature coding sequence for each of these SCA proteins. The
amino acid sequence of this signal peptide is Met Arg Phe Pro Ser
Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser Ala Leu Ala {circumflex
over ( )}Ala (SEQ ID NO: 36) where the "{circumflex over ( )}"
indicates the cleavage site. A 20.sup.th amino acid of the signal
(the alanine after the {circumflex over ( )}) was also included in
these constructs. Therefore, the amino terminus of the mature SCA
protein contains this alanine, followed, in each exemplified SCA,
by the complete amino acid sequences illustrated by FIGS. 2A-2H
(SEQ ID NOS. 1-9), respectively; as enumerated by Table 1).
N-terminal protein sequence analysis confirmed that these sequences
were correctly processed. The mutant genes expressing the D2E7 SCAs
were individually ligated at the EcoRI site into the Pichia
transfer plasmid pHIL-D2 (Invitrogen Corp.) and transformed into
the yeast Pichia pastoris host GS-115.
[0125] Detailed protocols for these procedures are presented in the
Pichia Expression Kit Instruction Manual Cat. No. X1710-01 (1994)
from Invitrogen Corporation, incorporated by reference herein.
Initial evaluation of expression was done by Coomassie Blue
staining of SDS-PAGE gels. The clone numbers for the Pichia
expression strains for each SCA protein correspond to the 2-7-SC
numbers in Table 1, supra.
[0126] The SCA proteins (.about.27 kDa) were expressed and secreted
at high levels in recombinant Pichia (about 20-100 mg/L). Analysis
on SDS-PAGE gels in the absence of reductant demonstrated the
expected presence of both monomers and dimers formed by a single
disulfide cross-link of two monomers. Rabbit antiserum versus the
purified 2-7-SC-1 SCA protein was prepared. Western analysis with
this reagent verified the identity of the expressed SCA
proteins.
[0127] For example, FIG. 8 shows a representative Western blot
analysis of D2E7 2-7-SC-2 and PEGylated forms confirming reactivity
of this anti-D2E7 antiserum with the recombinant SCA proteins and
PEG-SCA conjugates. Anti-218-linker antibody was employed. 1 .mu.g
of each samle was analyszed on 4-20% non-reducing SDS-PAGE gel. The
primary and secondary antibodies are anti 18-linker antibody raised
in rabbit and goat anti rabbit antibody conjugatd horserasish
peroxidase, respectively. The enzyme substrate was TMBM peroxidase
substrate from Moss, In. D2E7 2-7-SC-2 has PEG at c-terminal and
2-7-SC-5 has PEG at 218 linker. Band A is 2-7-SC-2, Band B is
2-7-SC-5, Band C is PEG(20k)-2-7-SC-2, Band D is PEG(20k)-2-7-SC-5,
Band E is PEG(40k)-2-7-SC-2, Band F is PEG(40k)-2-7-SC-5.
[0128] The SCA proteins were purified from Pichia pastoris
supernatants to greater than 95% purity by simple two or three
column chromatography protocols. For the SCA proteins bearing a
his.sub.6 tag (SEQ ID NO: 43), the dialyzed fermentation medium was
diafiltered and passed through a DEAE column, then bound to an IMAC
nickel affinity column, (QIAGEN). The bound SCA protein was eluted
with imidazole; then flowed through a second DEAE anion exchange
column. The flow-through was diafiltered for concentration of the
SCA protein and further characterized. For SCA proteins lacking the
his.sub.6 tag (SEQ ID NO: 43), the SCA protein was either purified
on a protein L-agarose column with low pH elution, obtained from
Pierce Biotechnology, Inc (Rockford, Ill.), or captured on HS
cation exchange chromatography, obtained from Amersham Pharmacia
(Piscataway, N.J.), followed by salt gradient elution and
diafiltration. HS chromatography was the preferred method.
[0129] FIGS. 2A and 2B show representative expression and
purification data for clone 2-7-SC-2, including the SDS-PAGE gel
analysis by Coomassie Blue staining of the fractions, and the yield
at each step. A small amount of .about.54 kDa disulfide-linked
dimer is visible in the stained gel.
[0130] Thiol-Specific Activated Polymers
[0131] Preferably, the inventive SCAs are linked to thiol-specific
activated polymers. Specifically, the activated polymers preferably
employed in the present invention are those which have a
sulfhydryl- or thiol- selective terminal linking group on at least
one terminal thereof. Several art-known activated polymers, e.g.,
polyalkylene oxide (PAO) polymers that are reactive with free
thiols, are readily employed in the practice of the invention.
Examples of reactive groups include maleimide, vinylsulfone, thiol,
orthopyridyl disulfide, and iodoactemide, with maleimide activated
polyethylene glycols (PEG-mal's) being more preferred, in view of
the maleimide group being highly specific for thiols and the
conjugation reaction taking place under mild conditions. See also,
for example, co-owned U.S. Pat. No.5,730,990, incorporated by
reference herein. Additional sulfhydral selective activated
PEG-polymers are also available from Nektar Therapeutics (formerly
Shearwater Corporation) as illustrated by the 2001 Shearwater
Corporation Catalog, incorporated by reference herein. See also
Goodson, R. J. & Katre, N. V. 1990, Bio/Technology 8:343;
Kogan, T. P. 1992, Synthetic Comm. 22 2417, incorporated by
reference herein.
[0132] For example, the linear polymers mPEG-MAL (5 kDa) (e.g.,
Shearwater Cat. No. 2D3X0T01) and mPEG-MAL (20 kDa), as well as
branched polymer mPEG2-MAL (40 kDa) (e.g., Shearwater Cat. No.
2D2M0H01) conjugated to inventive SCAs, are exemplified herein.
Structures of these maleimide-PEG polymers and the conjugation
chemistry are shown for convenience by FIGS. 3A-3E. FIG. 3F
illustrates mPEG-vinylsulfone. The various maleimide- activated
polymers readily react with free thiols, as illustrated by FIG. 3E.
In FIG. 3E, "SCA" is a protein according to the invention having at
least one free thiol (S-H). See Table 2, below.
2 TABLE 2 Nektar/Shearwater FIG Nos. Description Cat. Nos. mPEG-MAL
2D2M0H01, 2D2M0P01 mPEG.sub.2(MAL) 2D3X0T01 mPEG(MAL).sub.2
2D2D0H0F, 2D2D0P0F mPEG.sub.2(MAL).sub.2 Catalog, page 10 mPEG
Vinylsulfone
[0133] Additional polymeric platforms which can include the
sulfhydryl-specific linkers include those disclosed in
commonly-assigned U.S. Pat. Nos. 5,643,575, 5,919,455, 6,113,906,
(U-PEG's), 6,153,655 and 6,395,266 (terminally branched PEG's),
6,251,382 (polyPEG's) and U.S. Ser. No. 10/218,167 (bicines), etc.
See also Shearwater Polymers, Inc. catalog "Polyethylene Glycol and
Derivatives 2001". The disclosure of each of the foregoing is
incorporated herein by reference.
[0134] As mentioned above, the polymer portion of the conjugate is
preferably a polyalkylene oxide. More preferably, the polymer
portion is a polyethylene glycol which is substantially
non-antigenic. Although PAO's and PEG's can vary substantially in
weight average molecular weight, those included in the compositions
of the present invention independently have a weight average
molecular weight of from about 2,000 Da to about 136,000 Da in most
aspects of the invention. More preferably, the polymer has a weight
average molecular weight of from about 3,000 Da to about 100,000
Da. Most preferably, the polymer portion has a weight average
molecular weight of from about 5,000 Da to about 40,000 Da.
[0135] The polymeric substances included herein are preferably
water-soluble at room temperature. A non-limiting list of such
polymers include polyalkylene oxide homopolymers such as
polyethylene glycol (PEG) or polypropylene glycols,
polyoxyethylenated polyols, copolymers thereof and block copolymers
thereof, provided that the water solubility of the block copolymers
is maintained. Confirmation of the specific reactivity of the
maleimide polymers with free cysteine, but not with lysine or
histidine, was accomplished by reaction of the maleimides with
these respective free amino acids.
[0136] FIG. 4 confirms the reactivity of cysteine with activated
PEG-MAL. The absorbance for cysteine, as a 3mM solution, is shown
as curve A. The absorbance curve for activated PEG-MAL, at a
concentration of 1 mM, is shown as curve C and is characterized by
a wide absorbance peak centered on 300 nm. Absorbance curve B was
taken of a solution combining cysteine and activated PEG-MAL in a
1:3 ratio (1 mM PEG-MAL and 3 mM cysteine, 100 mM sodium phosphate,
pH 6.0, 1 mM EDTA, 25.degree. C.). The B curve tracks the A curve,
with a shift to the right, but the characteristic 300 nM broad peak
of PEG-MAL, is not present, confirming the reactivity of cysteine
with activated PEG-MAL. Analogous absorbance curves for histidine
or lysine (not shown), confirm that these residues are not highly
reactive under the employed conditions.
[0137] Labeled or Tagged Conjugates
[0138] Upon production of a polyalkylene oxide conjugated SCAs
according to the invention, the conjugates are optionally further
modified by linking or conjugating a diagnostic or therapeutic
agent to the SCA-polymer conjugate. The general method of preparing
an antibody conjugate according to the invention is described in
Shih, L. B., et al., Cancer Res. 51:4192 (1991); Shih, L. B., and
D. M. Goldenberg, Cancer Immunol. Immunother. 31:197 (1990); Shih,
L. B., et al., Intl. J. Cancer 46:1101 (1990); Shih, L. B., et al.,
Intl. J. Cancer 41:832 (1988), all incorporated herein by
reference. The indirect method involves reacting an antibody (or
SCA), whose polyalkylene oxide has a functional group, with a
carrier polymer loaded with one or plurality of bioactive
molecules, such as, peptides, lipids, nucleic acids (i.e.,
phosphate-lysine complexes), drug, toxin, chelator, boron addend or
detectable label molecule(s).
[0139] In certain alternative embodiments, the polyalkylene oxide
conjugated SCA is directly conjugated or linked to a diagnostic or
therapeutic agent. The general procedure is analogous to the
indirect method of conjugation except that a diagnostic or
therapeutic agent is directly attached to an oxidized sFv
component. See Hansen et al., U.S. Pat. No. 5,443,953, incorporated
herein by reference.
[0140] Pharmaceutical Compositions and Administering the SCA and/or
SCA-Polymer Conjugates
[0141] The pharmaceutical compositions of the invention may include
a "therapeutically effective amount" or a "prophylactically
effective amount" of an SCA and/or SCA-polymer conjugate of the
invention. A "therapeutically effective amount" refers to an amount
effective, at dosages and for periods of time necessary, to achieve
the desired therapeutic result. A therapeutically effective amount
of the SCA and/or SCA-polymer conjugate may vary according to
factors such as the disease state, age, sex, and weight of the
individual, and the ability of the antibody or antibody portion to
elicit a desired response in the individual. A therapeutically
effective amount is also one in which any toxic or detrimental
effects of the antibody or antibody portion are outweighed by the
therapeutically beneficial effects. A "prophylactically effective
amount" refers to an amount effective, at dosages and for periods
of time necessary, to achieve the desired prophylactic result.
Typically, since a prophylactic dose is used in subjects prior to
or at an earlier stage of disease, the prophylactically effective
amount will be less than the therapeutically effective amount.
[0142] Dosage regimens may be adjusted to provide the optimum
desired response (e g., a therapeutic or prophylactic response).
For example, a single bolus may be administered, several divided
doses may be administered over time or the dose may be
proportionally reduced or increased as indicated by the exigencies
of the therapeutic situation. It is especially advantageous to
formulate parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the mammalian subjects to be treated; each unit
containing a predetermined quantity of active compound calculated
to produce the desired therapeutic effect in association with the
required pharmaceutical carrier. The specification for the dosage
unit forms of the invention are dictated by and directly dependent
on (a) the unique characteristics of the active compound and the
particular therapeutic or prophylactic effect to be achieved, and
(b) the limitations inherent in the art of compounding such an
active compound for the treatment of sensitivity in
individuals.
[0143] An exemplary, non-limiting range for a therapeutically or
prophylactically effective amount of an SCA and/or SCA-polymer
conjugate of the invention is 0.1-20 mg/kg, more preferably 1-10
mg/kg. It is to be noted that dosage values may vary with the type
and severity of the condition to be alleviated. It is to be further
understood that for any particular subject, specific dosage
regimens should be adjusted over time according to the individual
need and the professional judgment of the person administering or
supervising the administration of the compositions, and that dosage
ranges set forth herein are exemplary only and are not intended to
limit the scope or practice of the claimed composition.
[0144] Pharmaceutical Compositions
[0145] In a further preferred embodiment, the SCAs of the invention
are employed for treating and/or diagnosing conditions related to
the binding specificity of a particular SCA protein of interest.
Thus, an SCA and/or SCA-polymer conjugate is administered by
art-known methods, to an animal or person having a disease or
disorder for which the binding properties of the administered SCA
are useful in treating or diagnosing such disease or disorder.
Preferably, the SCA is polymer-conjugated according to the
invention.
[0146] The SCAs and conjugated SCAs of the invention can be
incorporated into pharmaceutical compositions suitable for
administration to a subject, e.g., an animal or person in need of
such administration. Typically, the pharmaceutical composition
comprises an SCA polypeptide having at least one type of binding
specificity, and a pharmaceutically acceptable carrier.
[0147] The term, "pharmaceutically acceptable carrier" includes any
and all solvents, dispersion media, coatings, antimicorbial, e.g.,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like, that are physiologically compatible.
Examples of pharmaceutically acceptable carriers include one or
more of water, saline, phosphate buffered saline, dextrose,
glycerol, ethanol and the like, as well as combinations thereof. In
many cases, it will be preferable to -include isotonic agents, for
example, sugars, polyalcohols such as mannitol, sorbitol, or sodium
chloride in the composition. Pharmaceutically acceptable carriers
may further comprise minor amounts of auxiliary substances such as
wetting or emulsifying agents, preservatives or buffers, which
enhance the shelf life or effectiveness of the antibody or antibody
portion.
[0148] The inventive compositions are optionally prepared in a
variety of forms. These include, for example, liquid, semi-solid
and solid dosage forms, such as liquid solutions (e.g., injectable
and infusible solutions), dispersions or suspensions, tablets,
pills, powders, liposomes and suppositories. The preferred form
depends on the intended mode of administration and therapeutic
application. Typical preferred compositions are in the form of
injectable or infusible solutions, such as compositions similar to
those used for passive immunization of humans with other
antibodies. The preferred mode of administration is parenteral
(e.g., intravenous, subcutaneous, intraperitoneal,
intramuscular).
[0149] In a preferred embodiment, the SCA and/or SCA-polymer
conjugate is administered by intravenous infusion or injection. In
another preferred embodiment, the antibody is administered by
intramuscular or subcutaneous injection. Administration via
inhalation, as a spray, aerosol or mist is also contemplated where
that route is advantageous, e.g., for systemic absorption and/or
local action within the respiratory system.
[0150] Therapeutic compositions typically must be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
dispersion, liposome, or other ordered structure suitable to high
drug concentration. Sterile injectable solutions can be prepared by
incorporating the active compound (i.e., antibody or antibody
portion) in the required amount in an appropriate solvent with one
or a combination of ingredients enumerated above, as required,
followed by filtered sterilization.
[0151] Generally, dispersions are prepared by incorporating the
active compound into a sterile vehicle that contains a basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum drying and freeze-drying that yields a
powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof. The
proper fluidity of a solution can be maintained, for example, by
the use of a coating such as lecithin, by the maintenance of the
required particle size in the case of dispersion and by the use of
surfactants. Prolonged absorption of injectable compositions can be
brought about by including in the composition an agent that delays
absorption, for example, monostearate salts and gelatin.
[0152] The SCAs and/or SCA-polymer conjugates of the present
invention can be administered by a variety of methods known in the
art, although for many therapeutic applications, the preferred
route/mode of administration is intravenous injection or infusion.
As will be appreciated by the skilled artisan, the route and/or
mode of administration will vary depending upon the desired
results.
[0153] In certain embodiments, the SCAs and/or SCA-polymer
conjugates of the invention may be orally administered, for
example, with an inert diluent or an assimilable edible carrier.
The SCAs and/or SCA-polymer conjugates (and other ingredients, if
desired) are optionally enclosed in a hard or soft shell gelatin
capsule, compressed into tablets, or incorporated directly into the
subject's diet. For oral therapeutic administration, the compounds
may be incorporated with excipients and used in the form of
ingestible tablets, buccal tablets, troches, capsules, elixirs,
suspensions, syrups, wafers, and the like. To administer the SCAs
and/or SCA-polymer conjugates of the invention by other than
parenteral administration, it may be necessary to coat the compound
with, or co-administer the compound with, a material to prevent its
inactivation.
[0154] Supplementary active compounds can also be incorporated into
the pharmaceutical compositions. In certain embodiments, an SCAs
and/or SCA-polymer conjugate of the invention is co-formulated with
and/or co-administered with one or more additional therapeutic
agents that will provide additive, synergistic or supplementary
therapeutic or diagnostic activity for a disease or disorder.
[0155] Administering Anti-hTNF-.alpha. SCAs and/or SCA-Polymer
Conjugates
[0156] For example, anti-hTNF.alpha. SCAs and/or SCA-polymer
conjugates of the invention may be co-formulated and/or
co-administered with one or more additional antibodies or SCAs that
bind other targets (e.g., that bind other cytokines or that bind
cell surface molecules), one or more cytokines, soluble hTNF.alpha.
receptors (see e.g., PCT Publication No. WO 94/06476) and/or one or
more chemical agents that inhibit hTNF-.alpha. production or
activity (such as cyclohexane-ylidene derivatives as described in
PCT Publication No. WO 9311975 1). Furthermore, one or more SCAs
and/or SCA-polymer conjugates of the invention may be used in
combination with two or more of the foregoing therapeutic agents.
Such combination therapies may advantageously utilize lower dosages
of the individual administered therapeutic agents.
[0157] Indications for Anti-TNF.alpha.-SCAs and Preferred
Co-Administered Agents
[0158] Simply by way of a example, U.S. Pat. Nos. 6,258,562 and
6,090,382, incorporated by reference herein, provide an exhaustive
list of diseases and disorders for which TNF.alpha. is a mediator
or co-mediator of primary or other aspects of disease processes.
Art-known agents for treating or palliating such diseases or
disorders are contemplated to be co-formulated or co-administered
with the anti-TNF.alpha. embodiments of the inventive SCAs and/or
polymer conjugated SCAs. In brief, the list of diseases and
disorders mediated by or related to the actions of TNF.alpha., and
therefore rationally treated by a TNF.alpha. binder, optionally in
combination with other art-known therapeutics, is stated by U.S.
Pat. No. 6,258,562 to include, e.g., sepsis, autoimmune diseases,
infectious diseases, transplantation/rejection, malignancy,
pulmonary and intestinal disorders.
[0159] These indications and, where applicable, agents that are
optionally co-formulated in treating such indications with
anti-TNF.alpha. SCAs, are as follows.
[0160] Sepsis.
[0161] Treatable conditions associated with sepsis include
TNF.alpha.--mediated septic shock syndrome and associated
hypotension, myocardial suppression, vascular leakage syndrome,
organ necrosis, stimulation of the release of toxic secondary
mediators and activation of the clotting cascade, endotoxic shock,
gram negative sepsis and toxic shock syndrome.
[0162] Autoimmune diseases.
[0163] Treatable conditions associated with auto immune diseases
include, tissue inflammation and joint destruction in rheumatoid
arthritis, death of islet cells and the insulin resistance in
diabetes, cytotoxicity to oligodendrocytes and induction of
inflammatory plaques in multiple sclerosis. Agents contemplated to
be co-formulated or co-administered with the inventive
anti-TNF.alpha. SCAs and/or polymer conjugated SCAs include any
art-known agents available to treat such autoimmune disorders
including, e.g., glucocorticosteroids, non-steroidal
anti-inflammatory drug(s) (NSAIDs); cytokine suppressive
anti-inflammatory drug(s) (CSAIDs); CDP-57111BAY-10-3356 (humanized
anti-TNF.alpha. antibody; Celltech/Bayer); cA2 (chimeric
anti-TNF.alpha. antibody; Centocor); 75 kdTNFR-IgG (75 kD TNF
receptor-IgG. fusion protein; Immunex; see e.g., Arthritis &
Rheumatism (1994) Vol. 37. S295; J. Invest Med. (1996) Vol. 44
235A); 55 kdTNFR-IgG (55 kD TNF receptor-IgG fusion protein;
Hoffmann-LaRoche); IDEC-CE9.I/SB 210396 (non-depleting primatized
anti-CD4 antibody; IDEC/SmithKline, to name but a few.
[0164] Infectious diseases.
[0165] Treatable conditions associated with infectious diseases
include TNF.alpha.--mediated brain inflammation, capillary
thrombosis and infarction in malaria, venous infarction in
meningitis, cachexia secondary to invention, e.g., HIV virus
invention, stimulation of viral proliferation and central nervous
system injury in HIV infection, fever and myalgias due to
infections such as influenza). Agents contemplated to be
co-formulated or co-administered with the inventive anti-TNF.alpha.
SCAs and/or polymer conjugated SCAs include any art-known
anti-infective agents, e.g., antibiotics, anti-bacterials,
antivirals, and the like, as well as non-steroidal
anti-inflammatory drug(s) ("NSAIDs") and/or antibodies or SCAs that
bind to the infective agent and/or its toxins or essential
components.
[0166] Transplantation Treatable conditions associated with
transplantion medicine, rejection of transplants or side effects of
the required immunosuppression agents include TNF.alpha.--mediated
allograft rejection and graft versus host disease (GVHD), to name
but a few transplantation-related effects. Agents contemplated to
be co-formulated or co-administered with the inventive
anti-TNF.alpha. SCAs and/or polymer conjugated SCAs include, e.g.,
glucocorticosteriods, cyclosporin A, FK506, and/or OKT3, to inhibit
OKT3-induced reactions, as well as in combination with binders
directed to immune cell receptors such as antibodies or SCAs
binding to CD25 (IL-2 receptor-.alpha.),CD11a (LFA-1), CD54
(ICAM-1), CD4, CD45, CD28/CTLA4, CD80 (B7-1) and/or CD86
(B7-2).
[0167] Malignancy. Treatable conditions associated with malignancy
include TNF.alpha.--mediated cachexia, tumor growth, metastatic
potential and cytotoxicity in malignancies. Agents contemplated to
be co-formulated or co-administered with the inventive
anti-TNF.alpha. SCAs and/or polymer conjugated SCAs include any
art-known anti-tumor or anti-cancer agents.
[0168] Pulmonary Disorders,
[0169] Treatable conditions associated with pulmonary disorders
include adult respiratory distress syndrome, shock lung, chronic
pulmonary inflammatory disease, pulmonary sarcoidosis, pulmonary
fibrosis and silicosis. For pulmonary disorders, the inventive
anti-TNF.alpha. SCAs and/or polymer conjugated SCAs are optionally
administered by oral or nasal spray, or formulated for
administration as an aerosol, via any standard inhalation system.
Such formulations can be co-administered or administered at
alternate times with other agents suitable for treating such
pulmonary disease or disorder, or an agent that facilitates
bronchial. access for the SCA formulation.
[0170] Intestinal Disorders.
[0171] Treatable conditions associated with intestinal disorders
include the range of inflammatory bowel disorders, e.g., Crohn's
disease and/or ulcerative colitis. Agents contemplated to be
co-formulated or co-administered with the inventive anti-TNF.alpha.
SCAs and/or polymer conjugated SCAs include, budenoside; epidermal
growth factor; corticosteroids; cyclosporin, sulfasalazine;
aminosalicylates; 6-mercaptopurine; azathioprine; metronidazole;
lipoxygenase inhibitors; mesalamine; olsalazine; balsalazide;
antioxidants; thromboxane inhibitors; IL-1 receptor antagonists;
anti-IL-1.beta. MAbs; anti-IL-6 MAbs; growth factors; elastase
inhibitors; pyridinyl-imidazole compounds; CDP-571/BAY-10-3356
(humanized anti-TNF.alpha. antibody; Celltech/Bayer); cA2 (chimeric
anti-TNF.alpha. antibody; Centocor); 75 kdTNFR-IgG (75 kD TNF
receptorIgG fusion protein; Immunex; 55 kdTNFR-IgG (55 kD TNF
receptor-IgG fusion protein; Hoffmann-LaRoche); interleukin-10 (SCH
52000; Schering Plough); IL4; IL-10 and/or IL4 agonists (e.g.,
agonist antibodies); interleukin-11; glucuronide- or
dextran-conjugated prodrugs of prednisolone, dexamethasone or
budesonide; ICAM-1 antisense phosphorothioate oligodeoxynucleotides
(ISIS 2302; Isis Pharmaceuticals, Inc.); soluble complement
receptor 1 (TP10; T Cell Sciences, Inc.); slow-release mesalazine;
methotrexate; antagonists of Platelet Activating Factor (PAF);
ciprofloxacin; and lignocaine.
[0172] Diagnostic and Assay Methods: Anti-TNF.alpha. SCA or
SCA-Conjugates
[0173] The anti-hTNF.alpha. SCAs and/or SCA-polymer conjugates of
the invention can be used to detect hTNF.alpha. in samples of
interest, such as in a biological sample, including serum or plasma
or other clinical specimens, using a conventional immunoassay.
These include enzyme linked immunosorbent assays (ELISA),
radioimmunoassay (RIA) or tissue immunohistochemistry.
[0174] The invention provides a method for detecting hTNF.alpha. in
a biological sample comprising contacting a biological sample with
an antibody, or antibody portion, of the invention and detecting
either the antibody (or antibody portion) bound to hTNF.alpha. or
unbound SCA and/or SCA-polymer conjugates, to thereby detect
hTNF.alpha. in the biological sample. The SCA is directly or
indirectly labeled with a detectable substance to facilitate
detection of the bound or unbound antibody. Suitable detectable
substances include various enzymes, prosthetic groups, fluorescent
materials, luminescent materials and radioactive materials.
Examples of suitable enzymes include horseradish peroxidase,
alkaline phosphatase, .beta.-galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group
complexes include streptavidin/biotin and avidin/biotin; examples
of suitable fluorescent materials include umbelliferone,
fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; and examples of suitable radioactive material include
.sup.125I, .sup.131I, .sup.35S or .sup.3H.
[0175] In an optional embodiment, the inventive SCAs are not
labelled, but hTNF.alpha. is assayed in biological fluids by a
competition immunoassay wherein rhTNF.alpha. standards are labeled
with a detectable substance, and an unlabeled anti-hTNF.alpha. SCA
and/or SCA-polymer conjugate. In this assay, the biological sample,
the labeled rhTNF.alpha. standards and the anti-hTNF.alpha. SCA
and/or SCA-polymer conjugate are combined and the amount of labeled
rhTNF.alpha. standard bound to the unlabeled SCA and/or SCA-polymer
conjugate is determined. The amount of hTNF.alpha. in the
biological sample is inversely proportional to the amount of
labeled rhTNF.alpha. standard bound to the anti-hTNF.alpha. SCA
and/or SCA-polymer conjugate.
[0176] U.S. Pat. Nos. 6,258,562 and 6,090,382 indicate that the
D2E7 MAb can also be used to detect TNF.alpha.s from species other
than humans, in particular TNF.alpha.s from primates (e.g.,
chimpanzee, baboon, marmoset, cynomolgus and rhesus), pig and
mouse, it is contemplated that the anti-TNF.alpha. SCA and/or
SCA-polymer conjugates of the invention are readily employed for
that purpose, as well.
EXAMPLES
[0177] The following examples serve to provide further appreciation
of the invention but are not meant in any way to restrict the
effective scope of the invention.
Example 1
Design of SCA Proteins With at Least One Free Thiol.
[0178] Nine SCA polypeptides were designed based on the variable
domains of the D2E7 MAb. The use of the term, "D2E7 SCA" herein
refers to any of the SCA produced with the D2E7 variable domains as
exemplified herein, unless otherwise indicated. Each was
constructed as follows.
[0179] As noted supra a wholly synthetic gene was constructed by
polymerase chain reaction (PCR) using 14 long overlapping synthetic
oligonucleotides, ranging from 20 bases to 102 bases in length, ).
Oligonucleotide-directed mutagenesis was further employed to
construct other variants of the original sequence. The expressed
SCA proteins contain the complete variable light (V.sub.L) and
variable heavy (V.sub.H) segments of the D2E7 MAb, connected by a
peptide linker. Two linkers were employed.
[0180] Linker "218" is an eighteen amino acid residue 218-linker
described by Filpula et al., 1996 (Antibody Engineering: A
Practical Approach, Oxford University Press, pp 253-268).
[0181] The "(GGGGS).sub.3 linker" (SEQ ID NO: 42) is a 15 amino
acid residue linker described by Huston J S et al, 1988, Proc Natl
Acad Sci (USA) 85:5879-5883. In some cases, as noted by Table 1,
supra, a six-histidine tag (his.sub.6) (SEQ ID NO: 43) at the
C-terminus was included to simplify purification via metal
immobilized metal ion- affinity chromatography ("IMAC").
[0182] The completed genes were cloned into an E. coli plasmid for
DNA sequence confirmation on an ABI PRISM.RTM. 310 Genetic Analyzer
from Applied Biosystems (Foster City, Calif.) (formerly produced by
ABI/Perkin-Elmer). The domain orientations, linkers, and placement
of the free cysteine in each respective SCA modeled on the D2E7
MAb, are summarized in Table 1, supra (clone numbers 2-7-SC-1
through -9).
[0183] The nucleic acid chains expressing each of clone numbers
2-7-SC- 1 through -9 were prepared as follows.
[0184] Method of Cloning and Expression of D2E7 SCA
[0185] The synthetic V.sub.L-V.sub.H version of D2E7 SCA gene was
constructed by two rounds of PCR using six overlapping
oligonucleotides as templates for the V.sub.L chain and six
overlapping oligonucleotides as templates for V.sub.H chain. The
V.sub.L chain and V.sub.H chain of D2E7 SCA gene were linked with a
218 linker. The C-terminus of the encoded protein was followed by 6
tandem histidines for IMAC purification purposes.
[0186] Six oligonucleotides from 5' to 3' end for V.sub.L were
designed as follows:
3 V.sub.L1: GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAG- GGG
(SEQ ID NO: 19) AC V.sub.L2:
GCATCTGTAGGGGACAGAGTCACCATCACTTGTCGGGCAAGTCAG (SEQ ID NO: 20)
GGCATCAGAAATTACTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCC CCT V.sub.L3:
CCCTGATTGCAAAGTGGATGCAGCATAGATCAGGAGCTTA- GGGGCTTT (SEQ ID NO: 45)
CCCTGG V.sub.L4: TCCACTTTGCAATCAGGGGTCCCATCTCGGTTCAGTGGCAGTGGAT
(SEQ ID NO: 21) CTGGGACAGATTTC V.sub.L5:
TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTACAGCCTGAAG (SEQ ID NO: 22)
ATGTTGCAACTTATTACTGTCAAAGGTATAACCGTGCACCGTATACTTT TGGCCAG V.sub.L6:
ACCACTCCCGGGTTTGCCGCTACCACTAGTAG- AGCCTTTGATTTCC (SEQ ID NO: 23)
ACCTTGGTCCCCTGGCCAAAAGTATA.
[0187] Among them, V.sub.L1, 2, 4 and 5 were forward (sense)
oligonucleotides, and V.sub.L3 and 6 were reverse oligonucleotides.
Six oligonucleotides from 5' to 3' end for V.sub.H were designed as
follows:
4 V.sub.H1: GGCAAACCCGGGAGTGGTGAAGGTAGCACTAAAGGTGAGGTGCA (SEQ ID
NO: 24) GCTGGTGGAGTCTGGGGGA. V.sub.H2:
GTGGAGTCTGGGGGAGGCTTGGTACAGCCCGGCAGGTCCCTGAGA (SEQ ID NO: 25)
CTCTCCTGTGCGGCCTCTGGATTCACCTTTGATGATTATGCCATGCACT- G GGTCCGG
V.sub.H3: CCAAGTGATAGCTGAGACCCATTCCAGGCCCTTCCCTGGAGCTTGC (SEQ ID
NO: 26) CGGACCCAGTGCAT V.sub.H4:
TCAGCTATCACTTGGAATAGTGGTCACATAGACTATGCGGACTCTG (SEQ ID NO: 27)
TGGAGGGCCGATTC V.sub.H5:
GTGGAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCC (SEQ ID NO: 28)
CTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGATACGGCCGTATAT TACTGTGCG
V.sub.H6: AGACGAGACGGTGACCAGGGTACCTTGGCC- CCAATAGTCAAGGGA (SEQ ID
NO: 29) GGACGCGGTGCTAAGGTACGAGACTT- TCGCACAGTAATATAC
[0188] Among them, V.sub.H1, 2, 4 and 5 were forward
oligonucleotides and V.sub.H3 and 6 were reverse oligonucleotides.
All oligonucleotide designed for the synthetic V.sub.L and V.sub.H
of D2E7 SCA were synthesized by MWG Biotech, Inc.
[0189] The V.sub.L of the D2E7 SCA gene was assembled in a first
round PCR, using 2mM Tris (pH8.4), 5 mM KCl, 7.5 mM MgCl.sub.2, 1.5
mM dNTP, 2 units of Platinum Tag polymerase (Invitrogen),
oligonucleotides V.sub.L 1, 2, 3, 4, 5 and 6 (1 pmol each) as
templates, 5' TGGCGAGCTCTGACATCCAGATGACCCAGTCT (SEQ ID NO: 30) (50
pmol) as forward primer and 5'ACCACTCCCGGGTTTGCCGCTACCACTAGTAGA
(SEQ ID NO: 31) (50 pmol) as reverse primer.
[0190] The PCR was performed for 30 cycles of 94.degree. C. for 30
seconds, 56.degree. C. for 30 seconds and 72.degree. C. for 60
seconds, followed by 72.degree. C. for 10 minutes.
[0191] The V.sub.H of the D2E7 SCA gene was assembled in a first
round PCR, using 2 mM Tris (pH8.4), 5 mM KCl, 7.5 mM MgCl.sub.2,
1.5 mM dNTP, 2 units of Platinum Tag polymerase (Invitrogen),
oligonucleotides V.sub.H1, 2, 3, 4, 5 and 6 (1 pmol each) as
templates, 5' GGCAAACCCGGGAGTGGTGA (SEQ ID NO: 32) (50 pmol) as
forward primer and 5'GCCACTCGAGCTATTAGTGATGGTGATG-
GTGGTGAGACGAGACGGTG ACCAG (SEQ ID NO: 33) as reverse primer (50
pmol). The PCR was performed for 30 cycles of 94.degree. C. for 30
seconds, 56.degree. C. for 30 seconds and 72.degree. C. for 60
seconds, followed by 72.degree. C. for 10 minutes.
[0192] Genetic construction of the variant D2E7 SCA genes encoding
the variant SCA proteins of Table 1 was accomplished by site
directed mutagenesis. For example,2-7-SC-5 is a mutant of D2E7 SCA
(2-7-SC-1) with an amino acid change from serine to cysteine at the
residue 109 in the 218 linker. This gene was created by two rounds
of PCR using 2-7-SC- 1 DNA as a template and four oligonucleotides
as primers.
[0193] The primers for construction of clone 2-7-SC-8 were designed
as follows:
5 Forward primer 1: CTCGAATTCACCATGAGATTTCCTTC (SEQ ID NO: 37)
Forward primer 2: AAGGTGGAAATCAAAGGCTGTACTAGTG- GTAGCGGCAAACCC (SEQ
ID NO: 38) Reverse primer 1:
GGGTTTGCCGCTACCACTAGTACAGCCTTTGATTTCCACCTT (SEQ ID NO: 39) Reverse
primer 2: CGAGAATTCTCATTAATTGCGC AGGTAGCC (SEQ ID NO: 40)
[0194] Two fragments were amplified separately in the first round
of PCR by two primer combinations (forward primer 1 and reverse
primer 1, and forward primer 2 and reverse primer 2, 50 pmol each),
using 2 mM Tris (pH8.4), 5 mM KCl, 7.5 mM MgCl.sub.2, 1.5 mM dNTP,
2 units of Platinum Tag polymerase (Invitrogen), and 2-7-SC-8 DNA
(10 ng) as template. The D2E7 SCA gene variant for 2-7-SC-8 was
completed by hybrid extension in the second round of PCR, using
forward primer 1 and reverse primer 2 (50 pmol each), 2 mM Tris
(pH8.4), 5 mM KCl, 7.5 mM MgCl.sub.2, 1.5mM dNTP, 2 units of
Platinum Tag polymerase (Invitrogen), and the two fragments (10 ng
each) from the first round of PCR as templates.
[0195] The complete PCR product of the 2-7-SC-8 SCA gene, with
cysteine at the residue 109, was cloned into vector pHilD2 and used
to transform Pichia GS 115 strain, as described below.
[0196] The remaining genes of Table 1 were generated by similar
site directed mutagenesis steps. For the 2-7-SC-2 gene (SEQ ID
NO:2), the PCR reverse oligonucleotide primer encoded the cysteine
codon TGC after the six C-terminal histidine codons. For the
2-7-SC-3 gene (SEQ ID NO:3), the PCR reverse oligonucleotide primer
encoded the cysteine codon TGC after the six C-terminal histidine
codons. For the 2-7-SC-4 gene (SEQ ID NO:4), the PCR reverse
oligonucleotide primer encoded the cysteine codon TGC directly
after the C-terminal V.sub.H serine codon. For the 2-7-SC-6 gene
(SEQ ID NO:6), the central oligonucleotide primer encoded the
cysteine codon TGC at position 2 of the 218 linker, and the
C-terminal reverse primer encoded the cysteine codon TGC after the
six C-terminal histidine codons. For the 2-7-SC-7 gene (SEQ ID
NO:7), the central oligonucleotide primer encoded the cysteine
codon TGC at nucleotides 376-378 (FIG. 1G), corresponding to
residue position 5 of the (GGGGS).sub.3 linker (SEQ ID NO: 42).
[0197] For the 2-7-SC-8 gene (SEQ ID NO:8), the PCR forward
oligonucleotide primer encoded the cysteine codon TGC before the
N-terminal V.sub.L amino acid Asp, and the PCR reverse
oligonucleotide primer encoded the cysteine codon TGC after the six
C-terminal histidine codons. For the 2-7-SC-9 gene (SEQ ID NO:9), a
5 codon linker encoding GGGGS (SEQ ID NO: 44) replaced the 18 codon
218-linker.
[0198] For assembling the complete D2E7SCA gene and expression of
D2E7SCA in Pichia, a signal sequence was added at the 5' end of
D2E7SCA gene in a second round of PCR, using 2 mM Tris (pH8.4), 5
mM KCl, 7.5 mM MgCl.sub.2, 1.5 mM dNTP, 2 units of Platinum Tag
polymerase (Invitrogen), first round of PCR products of V.sub.L and
V.sub.H of D2E7SCA gene (1 ng each) as templates,
5'CCTCGGAATTCACCATGAGATTTCCTTCAATTTTTACTGCTGTTTTATT
CGCAGCATCCTCCGCATTAGCTGCTGACATCCAGATGACCCAG (SEQ ID NO: 34) (50
pmol) as forward primer and
5'CGCGGAATTCTATTAGTGATGGAGATGGAGGAGAGACGAGACGGTG ACCAG (SEQ ID NO:
35) (50 pmol) as reverse primer. The PCR was performed for 30
cycles of 94.degree. C. for 30 seconds, 56.degree. C. for 30
seconds and 72.degree. C. for 60 seconds, followed by 72.degree. C.
for 10 minutes.
[0199] The gene product of the second round of PCR-assembled D2E7
SCA with 5' end signal sequence was purified by 1% agarose gel,
digested by EcoR1 at 37.degree. C. for 60 minutes and ligated at
EcoR1 site of vector pHilD2 (Invitrogen) using T4 DNA ligase at
12.degree. C. for 60 minutes. 100 .mu.l of DH5.alpha. competent
cells (Invitrogen) were transformed by the ligation reaction
product and incubated on ice for 30 minutes and at 42.degree. C.
for 45 seconds, then 1 ml of S.O.C media was added and incubated at
37.degree. C. for 50 minutes with shaking at 250 rpm. 0.1 ml of the
transformation mixture was spread onto LB Ampicillin (10 mg/L)
plates and incubated at 37.degree. C. for 16 hours.
[0200] Several pHilD2-D2E7SCA plasmid-transformed DH5.alpha. clones
on the LB Ampicillin (10 mg/L) plates were grown in 2 ml of LB
media at 37.degree. C. for 16 hours. The plasmid mini-preparations
of D2E7SCA from each clone were prepared. DNA sequence of
pHilD2-D2E7SCA plasmid was confirmed using BigDye terminator cycle
DNA sequencing kit (Applied Biosystem) by ABI Prism 310 Genetic
Analyzer.
[0201] Each of the variant SCA clones listed in Table 1 was
generated by the following procedures. For Pichia transformation,
pHilD2-D2E7SCA plasmid was digested with Sal1 at 37.degree. C. for
60 minutes and re-suspended in 10 .mu.l distilled Water after
phenol extraction and ethanol precipitation. Pichia GS 115 cells
were grown in 50 ml of YPD media at 30.degree. C. for 16 hours with
shaking at 250 rpm (OD.sub.600=1.2), washed in ice-cold distilled
water three times and in 1M Sorbitol one time, and finally
re-suspended in 0.1 ml of 1M sorbitol.
[0202] The prepared Pichia GS 115 cells were mixed with
Sal1-digested 10 .mu.g of pHilD2-D2E7SCA plasmid in an ice-cold 0.1
cm electorporation cuvette and pulsed under the conditions of 800V,
10 .mu.F and 129 by electro cell manipulator (BTX). After pulsing,
1 ml of ice-cold 1M sorbitol was added into the electroporation
cuvette. The whole content was transferred into a 15 ml tube and
incubated at 30.degree. C. for 1 hour. 0.2 ml of the transformation
mixture was spread onto RDB media plates and incubated at
30.degree. C. for four days.
[0203] Several pHilD2-D2E7SCA plasmid-transformed Pichia clones
from RDB plates were inoculated into 25 ml of BMGY media in 500 ml
flasks and incubated at 30.degree. C. with shaking at 250 rpm for
two days. The cells were harvested by centrifugation at 3,000 rpm
at room temperature, re-suspended into 5 ml of BMMY of media in 50
ml flasks to induce expression and incubated at 30.degree. C. with
shaking for another two days.
[0204] 1 ml sample from each culture was transferred into
micro-centrifuge tubes and centrifuged at 14,000 rpm for 2 minute
at room temperature. 40 .mu.l sample from supernatant of each
culture was analyzed by Coomassie Blue-stained SDS-PAGE and Western
blot.
Example 2
Recombinant Expression and Purification of SCA Proteins.
[0205] The SCA proteins described in Example 1 (Clone numbers
2-7-SC-1 through -9). were all produced by expression and secretion
from the yeast Pichia pastoris. The secretion signal sequence from
the yeast alpha mating factor was inserted directly in front of the
mature coding sequence for each of these SCA proteins.
[0206] The amino acid sequence of this signal peptide is Met Arg
Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser Ala Leu Ala
{circumflex over ( )}Ala (SEQ ID NO: 36) where the {circumflex over
( )}indicates the cleavage site. We also included this 20.sup.th
amino acid of the signal (the alanine after the {circumflex over (
)}) in our constructions. Therefore, the amino terminus of each
respective mature SCA protein contains this alanine followed by the
complete amino acid sequences recorded in FIGS 1A-1F. N-terminal
protein sequence analysis confirmed these correctly processed
sequences. These mutant SCA genes were individually ligated at the
EcoRI site into the Pichia transfer plasmid pHIL-D2 (Invitrogen
Corp.) and transformed into the yeast Pichia pastoris host GS-115.
Detailed protocols for these procedures are presented in the Pichia
Expression Kit Instruction Manual Cat. No. X1710-01 (1994) from
Invitrogen Corporation, incorporated by reference herein. Initial
evaluation of expression was done by Coomassie Blue staining of
SDS-PAGE gels.
[0207] Pichia Fermentation of D2E7 SCA clones
[0208] All expression clones of anti-TNF.alpha. SCA D2E7, including
clones 2-7-SC-2, 2-7-SC-3, 2-7-SC-4, 2-7-SC-5 and 2-7-SC-7, were
generated in Pichia pastoris, a methylotrophic yeast, and proteins
were secreted into growth medium. The high density fermentation of
D2E7 SCA variants were performed in BMGY medium, the basal medium
supplemented with YNB and Biotin (see Medium Composition) using
automatic feed control fermenters (Models, BioFlow 3000 and BioFlow
IV; New Brunswick Scientific, Co, Edison, N.J., USA). in BMGY for
16-20 h, (c) growth phase in glycerol (50%) for 4 h, and (d)
induction of D2E7 variants with methanol for 45 h. Feeding of each
component was optimized with respect to dissolved oxygen level
which was set at 30%. The growth temperature was set at 29.degree.
C. and pH was maintained at 6.0 using ammonium hydroxide and
phosphoric acid during the run. Different parameters monitored over
a 68 h fermentation period where OD.sub.600 values of the growing
culture reached from 0.5 to 125 at the end of phase (b), from 125
to 200 at the end of glycerol-feeding phase (phase c) and finally,
from 200 to 300 at the end of induction phase (phase d).
[0209] On an average, the expression of D2E7 variants in the
fermentation supernatants was between 50 and 100 mg/L. 2-7-SC-2 ,
the V.sub.L-V.sub.H variant with a free cysteine engineered at the
carboxyl terminal followed by a histidine tail, was found to be the
most robust clone that performed well with excellent
reproducibility during fermentation.
[0210] Description of supplies
[0211] BMGY (per L)
[0212] Yeast Extract:
[0213] Peptone:
[0214] Glycerol:
[0215] Phosphate Buffer:
[0216] (1M, pH 6.0)
[0217] YNB:
[0218] Biotin:
[0219] FMT30 (Breox):
[0220] Inducer
[0221] Methanol
[0222] Oxygen
[0223] Compressed oxygen
[0224] The SCA proteins of Example 1 were purified from Pichia
pastoris supernatants to greater than 95% purity by simple two or
three column chromatography protocols.
[0225] Purification of Proteins from Clones 2-7-SC-2, 2-7-SC-3,
2-7-SC-5, 2-7-SC-7 D2E7 SCAs with Histidine tag
[0226] The D2E7 variants, 2-7-SC-2, SCA2-7-SC-3, SCA2-7-SC-4,
SCA2-7-SC-5, and 2-7-SC-7 were purified from fermentation
supernatant using a combination of ion-exchange and affinity column
chromatography. The supernatant was diafiltered extensively to
concentrate the sample while exchanging the spent medium with
Buffer C containing Tris, 20 mM at pH 7.4 and 50 mM NaCl. The
buffer exchanged sample was then subjected to DEAE column
chromatography (Cat# 17-0709-01; Amersham BioSciences, Piscataway,
N.J.). D2E7 SCAs did not bind to DEAE column under the specified
conditions. The flow through from the DEAE column was dialyzed
against buffer A containing Tris, 50 mM at pH 8.0 and 0.3 M NaCl
and applied to Ni-NTA resin (Qiagen, Inc., Valencia, Calif.)
previously equilibrated with the same buffer. Non-specific binding
was disrupted using a stringent wash with buffer B containing 10%
glycerol in buffer A followed by the removal of glycerol by buffer
A. Further low-affinity interactions were washed-off by passing 3
column volumes of 60-100 mM imidazole (100 mM only for 2-7-SC-2).
Finally, the bound SCA was eluted from the Ni-NTA column with 3-5
column volume of 250 mM imidazole. For both washing and elution,
imidazole was prepared in buffer A.
[0227] The peak fractions were pooled and dialyzed extensively
against buffer C, the DEAE-buffer. The dialyzed sample was
clarified by high speed centrifugation and passed through DEAE
column as the final step of purification. Protein concentration of
the purified sample was then determined by UV.sub.280 and by BCA
method before storing at -20.degree. C. for future use.
[0228] Purification of Proteins 2-7-SC-4 D2E7 SCA without Histidine
tag
[0229] Protein L strongly binds to VL domains of many different
species. The binding is extremely species specific, and also
sub-type specific. The VL domain of 2-7-SC-4 could be recognized by
protein L and taking advantage of this specificity of interaction,
we purified 2-7-SC-4 in single step, directly from the diafiltered
samples. Low pH elution of 2-7-SC-4 from protein L column (Cat#
CLBL 201-5, CBD Technologies Ltd, Buffalo, N.Y.) did not affect the
structural or functional integrity of the SCA. In brief,
fermentation supernatant was diafiltered and exchanged with PBS for
loading the sample onto the column. Non-specifically bound proteins
were washed away with a large volume of PBS after loading.
[0230] The SCA protein was eluted from the column with Glycine
buffer (10 mM) at pH 2.0 and collected immediately on 3M Tris to
neutralize the solution. Fractions were analyzed on SDS-PAGE,
positive fractions were pooled together and dialyzed against PBS.
The SCA protein was clarified by high speed centrifugation after
dialysis, protein concentration was determined and stored at
-20.degree. C. for future use.
[0231] Alternate, less preferred methods, like HS (POROS 50 HS;
code: 1-3359-07; Applied BioSciences, Foster City, Calif.) or
Q-sepharose FF (cat# 17-0510-01, Amersham BioSciences, Piscataway,
N.J.) were also used effectively in SCA purification.
[0232] The following table shows purification of 2-7-SC-2 D2E7
variants by various columns, percentage yields after each step of
purification and quality of purification for each variant.
6TABLE 3 PURIFICATION 2-7-SC-2 (VL-VH, 218-LINKER, C-CYS, HIS-TAG)
Concentration of SCA Total SCA Sample (mg/ml) (mg) Yield (%)
Fermentation 0.07 250 100 Supernatant Diafiltered 0.38 230 92
Sample DEAE-Flow 0.13 210 84 Through Ni-Column- 5.0 200 80 Purified
DEAE- 2.13 190 76 Purified Buffer 2.7 186 74 Exchanged
[0233] FIGS. 2A and 2B presents representative SDS PAGE analysis of
samples from each purification step of 2-7-SC-2 SCA protein. The
gel was stained with Coomassie Blue. Purity of the final sample was
estimated at 95% from gel densitometry scanning. A small amount of
54 kDa disulfide-linked dimer was visible in the stained gel.
Example 3
Stability and Reactivity of Maleimide Derivatives of Polyethylene
Glycol
[0234] Maleimide Reactivity With Amino Acid Residues
[0235] Confirmation of the specific reactivity of the maleimide
polymers with free cysteine, but not with lysine or histidine, was
accomplished by reaction of these compounds with these respective
free amino acids. As shown in FIGS. 4A-4C, cysteine, but not
histidine or lysine (not shown), is highly reactive with the
PEG-maleimides under the standard reaction conditions employed.
[0236] Analysis and Stability of Active Maleimide Group
[0237] Functional group analysis was conducted in two steps, as
follows. reaction of MAL-PEG with cysteine and determination of
remaining unreacted cysteine after the reaction by titration with
5,5 '-dithio-bis(2-nitrobenzoic acid) ("DTNB"). Determination of
active MAL-PEG was conducted at a reaction molar ratio of 1:3
(MAL-PEG:Cysteine) in 50 mM sodium phosphate, pH 6 and 1 mM
EDTA.
[0238] The reaction was conducted as follows. A 1/40 volume of
cysteine in H.sub.2O was added to a 1 mM PEG solution to a final
concentration of 3 mM. The mixture was incubated at 25.degree. C.
in the dark for 10 min, followed by DTNB titration. In DTNB
titration, a 1/50 volume of the reaction mixture containing the
cysteine and Cys-MAL-PEG mixture was added to 0.2-0.3 mM DTNB in
100 mM sodium phosphate, pH 7.3 and 1 mM EDTA,.
[0239] The final concentration of remaining cysteine was between
0.04-0.06 mM. Absorbance at 412 nm was recorded after 5 min of
equilibrium at 25.degree. C. using 13,300 M.sup.-1 .cm.sup.-1 as an
extinction coefficient of DTNB. The reaction of MAL-PEG with
Beta-mercaptoethylamine was also investigated. This reaction is not
quantitative because beta-mercaptoethylamine is air-sensitive and
hygroscopic. The stability of MAL-PEG was monitored by a UV scan
between 240 and 400 nm. MAL-PEG had a maximum absorbance at 300 nm.
The peak disappeared after reacting with cysteine or hydrolyzing in
the presence of 0.1 N NaOH at 37.degree. C. for 2 hrs.
[0240] Stability of MAL-PEG
[0241] The stability of MAL-PEG is dependent on pH, temperature,
and incubation time. It was considered stable if there was less
than 10% decrease in absorbance at 300 nm. 1 mM MAL-PEG is stable
at 4.degree. C. for at least 24 hrs in all buffers tested (pH 5, pH
6, and pH 7 phosphate buffers). At 25.degree. C. and pH 5.0,
MAL-PEG is stable for 33 hours. Therefore, the preferred PEGylation
conditions are pH 5 or pH 6, 25.degree. C. for 2 hrs; or 4.degree.
C. for 24 hrs; or pH 5, 25.degree. C. for 24 hours.
[0242] Specificity of Mal-PEG Reaction with Cysteine
[0243] The reaction with Cysteine was completed in less than 2 min
regardless of reaction pH (5, 6, or 7) and temperature (4.degree.
C. or 25.degree. C.).
[0244] The reaction with lysine (Lys:MAL-PEG=15:1) was not observed
in pH 5 and pH 6 buffers during 24 hrs incubation at 4.degree. C.
or 25.degree. C. However, at pH 7, 25.degree. C., greater than 10%
MAL-PEG reacted with lysine during 24 hours of incubation. There
was no reaction with histidine at a molar ratio of 15:1
(Histidine:MAL-PEG) pH 5, 6, and 7 during 24 hours incubation at
4.degree. C. or 25.degree. C.
Example 4
Pegylation of SCA Proteins
[0245] 4A. Materials and Methods
[0246] HiPrep.RTM. 26/10 and G-25 PD-10 desalting columns
(Pharmacia Biotech, 17-1408-01, New Jersey) and Poros 50 Micron HS
media (Applied Biosystems) were used. mPEG-maleimide compounds were
purchased from Nektar Therapeutics (San Carlos, Calif.; formerly
Shearwater Corp.) or synthesized at Enzon Pharmaceuticals, Inc.
[0247] PEG-MAL polymers employed in this study included the 40 kDa
branched PEG2, 20 kDa linear PEG, 5 kDa linear PEG, 20 kDa bis-MAL
bifunctional PEG, and 40 kDa branched U-PEG. N-ethylmaleimide and
6-(Biotinamidocaproylamido) caproic acid N-Hydroxysuccinimide ester
were purchased from Sigma. rProtein A Sepharose Fast Flow was
obtained from Amersham Biosciences Corp. (Piscataway, N.J.).
Ultralink Iodoacetyl.RTM. was obtained from Pierce Biotechnology,
Inc (Rockford, Ill.). DMSO, (Minneapolis, Minn.).
Streptavidin-Phycoerythrin was obtained from BD Sciences (San Jose,
Calif.). The 96 well microtiter plates were purchased from Midwest
Scientific (St. Louis, Mo.).
[0248] Streptavidin-peroxidase was from Sigma and TMB peroxidase
substrate was from Moss, Inc. (Pasadena, Md.). TNFa was purchased
from Chemicon (Temecula, Calif.). Titrisol.RTM. iodine solution was
obtained from EM Science (Gibbstown, N.J.)
[0249] 4B. Reduction of D2E7 SCAs
[0250] The free cysteine residue at the C-terminus or linker of the
SCAs isolated by Example 3 was reduced before reaction with
MAL-PEG. The reduction solution contained 3 mg/ml D2E7 SCA, 2 mM
dithiothreitol (DTT), 2 mM EDTA, and 100 mM sodium phosphate, pH
7.8. The reduction was conducted at 37.degree. C. for 2 hrs. Free
DTT was removed on HiPrep.RTM. desalting column for 15-ml samples,
or PD-10 for a 4-ml sample. The column was equilibrated with 100 mM
sodium phosphate pH 6.0, 2 mM EDTA. The recovery of D2E7 SCA after
reduction and desalting was 85%. Other reductants, including
beta-mercaptoethylamine and beta-mercaptoethanol, were also
successfully used in modified procedures. Sulfhydryl group
quantitation was performed as described by Grassetti DR et al,
1967, Archives Biochem Biophys 119:41-49, and Riddles P W et al,
1979, Anal Biochem 94:75-81, incorporated by reference herein. Near
quantitative reduction of one thiol per SCA was achieved.
[0251] 4C. PEGylation and Purification of SCA Methods
[0252] The SCA proteins isolated by Example 3 were PEGylated
through cysteine-specific reactions with PEG maleimide compounds.
2-7-SC-2 and 2-7-SC-5 were chosen for extensive studies of PEG-SCA
characterization. For these SCA proteins, maleimide-PEG conjugates
with 5 kDa, 20 kDa, 40 kDa (branched) and bis-maleimide compounds
were examined. Reaction of the SCA proteins with N-ethylmalemide
provided a control conjugation reaction which blocks the free thiol
but adds minimal molecular mass. Other D2E7 SCA proteins were
modified with selected PEG-maleimide polymers as listed in the
section on BIAcore analysis.
[0253] The reaction buffer contained 1 mg/ml reduced SCA, 100 mM
sodium phosphate pH 6.0, 2 mM EDTA, and PEG maleimide compound at a
reaction molar ratio of 10:1 (PEG:D2E7). The reaction was conducted
at 25.degree. C. under Nitrogen for 2 hrs.
[0254] The typical yield of the conjugation analyzed on SDS-PAGE
was 80%. An HS column was used for purification of PEG-SCA from
native SCA, high molecular weight impurities, free PEG, side
reaction products, and endotoxin. In less preferred methods, S and
SP columns were also successfully utilized. The column
equilibration buffer contained 10 mM sodium phosphate, pH 5.0, and
elution buffer was made of 1 M NaCl in 10 mM sodium phosphate, pH
5.0. Free PEG was in the flow through. PEG-D2E7 SCA conjugates were
eluted sequentially with conjugates with higher numbers of attached
PEG eluting first, followed by conjugates with a single polymer
attached, and finally, native D2E7 SCA. PEG-D2E7 conjugates of
different sizes were therefore eluted at different concentrations
of NaCl.
[0255] 4D. Reduction of D2E7 SCA--Results Summary
[0256] D2E7 SCA produced in Pichia pastoris and purified as
described has to be reduced prior to a reaction with MAL-PEG.
[0257] DTT at the concentrations from 0.5 mM to 50 mM was tested.
It was shown that 0.5 mM was sufficient to reduce monomer to dimer.
DTT at a concentration higher than 10 mM generated some
precipitate. The higher the concentration of DTT used, the higher
amount of D2E7 SCA precipitated. The precipitate might be denatured
D2E7 SCA. 2-mM DTT was chosen for standard PEGylation protocols.
Beta-mercaptoethylamine, glutathione, and cysteine from 2 mM to 10
mM were also investigated. It was shown that a concentration higher
than 10 mM was required to reduce the dimer to monomer.
[0258] DTT at 0.5 mM was as efficient, as the other reducing
reagents at 10 mM, in reduction of the 2-7-SC-2 dimer to monomer.
The yields of conjugates after reduction were about 80% of the
starting reduced SCA protein.
[0259] 4E. PEGylation--Results Summary
[0260] The reaction ratios ranging from 1:1 to 10:1 (MAL-PEG:D2E7
SCA) were investigated for PEGylation yield at pH 6.0. A ratio of
1:4 was the minimum required to give a high yield of the
conjugate.
[0261] Reaction times from 10 min to 24 hrs at 25.degree. C., and
18 hrs at 4.degree. C. were studied. It was shown that the reaction
was completed in 10 min at 25.degree. C. (the shortest time
tested).
[0262] A high concentration of protein (e.g., >1 mg/ml) is not
desirable for a reaction of the free cysteine residue of D2E7 SCA
with MAL-PEG since yields are reduced. This contrasts with the
optimal approach for a non-specific multi-PEGylation. Protein
concentrations of 0.5, 1.5, 2.0, 2.5, and 3 mg/ml were tested. D2E7
SCA protein of 0.2-1 mg/ml was used as the preferred concentration
for constructing the conjugates.
[0263] The reaction pH from 5-8 was investigated. For PEGylation,
pH 6.0 was used. Unconjugated D2E7 SCA could be recycled for
re-conjugation. The yield from the second conjugation reaction was
similar to that obtained for the initial D2E7 SCA PEGylation. The
best conjugation yield was 85%. Overall, the results demonstrate
that monoPEGylated SCA proteins may be generated in good yield via
robust conjugation methods using the designed single free-thiol
variant SCA proteins.
[0264] 4F. Purification Results Summary
[0265] Ultrafiltration with polyethersulfone membranes cannot be
used for concentration and changing buffers of the 2-7-SC-2 SCA
protein and its conjugates, since most of the protein was lost to
the membrane.
[0266] There was 100% recovery of the protein on Millipore
regenerated cellulose membranes such as Centriplus, Centricon, and
Amicon There was 10% loss of the protein on a 0.2-.mu.m low protein
binding sterile filter. The total yield after two steps of
purification, two steps of concentration, and one step of
filtration was 30-40%.
[0267] The purified PEG-SCA proteins were subjected to SDS PAGE
analysis and visualized with Coomassie Blue stain (data not shown).
The analysis indicated that trace amounts (.about.1%) of unreacted
SCA protein remained in the purified 40 kDa MAL-PEG and 20 kDa
MAL-PEG reactions. Iodine stain of SDS PAGE gel, which highlights
the polyethylene glycol containing compounds, also revealed trace
amounts (<1%) of free PEG that were detectable in the purified
40 kDa MAL-PEG and 20 kDa MAL-PEG reactions.
[0268] The 40 kDa MAL-PEG reactions sometimes also displayed a
trace (.about.1%) of very high molecular weight PEG impurities.
Polymers in the very high mass range were also detectable in the
starting unreacted 40 kDa MAL-PEG polymers. N-ethylmaleimide
reduction totally blocks the formation of dimers in the SCA
proteins having a single free cysteine.
[0269] 4G. Removal of Endotoxin by Ion Exchange Chromatography
[0270] Endotoxin present in protein samples was removed by DEAE or
HS columns. At pH 7-8, endotoxin was bound to a DEAE column while
the D2E7 SCA was present in the flow through fraction, whereas at
pH 5.0, endotoxin was present in the flow through fraction and D2E7
SCA was bound to HS column. An HS column was used to remove
endotoxin from D2E7 SCA protein. The column equilibration buffer
contained 10 mM sodium phosphate, pH 5.0 and elution buffer
contained 1 M NaCl and 10 mM sodium phosphate, pH 5.0. Typical
endotoxin values in the purified samples were below 1 EU/ml.
Example 5
Analytical Characterization of SCA AND PEG-SCA.
[0271] 5A. Determination of Protein Concentration
[0272] Protein concentrations were determined by UV at 280 nm. The
extinction coefficient of the SCAs obtained in Example 3 were 1.24
ml/mg.cm. The concentration was also confirmed by the bicinchoninic
acid assay ("BCA"), obtained as a Micro BCA Protein Assay Reagent
kit from Pierce Biotechnology, Inc (Rockford, Ill.) using lysozyme
or a Fab as standards. The BCA assay was conducted as recommended
by the manufacturer and essentially according to the method of
Smith, P. K., et al. 1985, Anal. Biochem. 150, 76-85, incorporated
by reference herein.
[0273] Protein Concentration Determination Results
[0274] UV at 280 nm (data not shown) and BCA, as discussed supra,
using lysozyme and a human Fab as standards. gave similar results
in protein concentration determinations. For the BCA analysis, EDTA
should be removed along with DTT after reduction, since these
reagents interfere with the assay. All samples for animal studies
were analyzed for protein content by UV and confirmed by BCA using
lysozyme as a standard.
[0275] 5B. Anti-D2E7 SCA Polyclonal Antibody and Biotinylated
Anti-D2E7 SCA Antibody
[0276] Purification of Anti D2E7 SCA Antibody.
[0277] Anti-2-7-SC-1 SCA antibodies were raised in rabbits and
purified by Protein A chromatography and D2E7 SCA-conjugated
affinity column chromatography. For a Protein A column
purification, the antibody was diluted with two volumes of Tris
buffer to make a final concentration of 0.1 M Tris-HCl, pH 8.0,
0.02% NaN.sub.3. The diluted samples were loaded on a 2-ml Protein
A Sepharose column which was equilibrated with 0.1 M Tris-HCl, pH
8.0, 0.02% NaN.sub.3 at an equal volume of antiserum to protein A
resin. Anti-2-7-SC-2 SCA was eluted out with 50 mM glycine, pH 3.0
to a 1/10 volume of 1 M Tris-HCl, pH 8.0. The antibody
concentration was determined at 280 nm using an extinction
coefficient of 0.8 ml/mg.cm. A D2E7 SCA-conjugated affinity column
was prepared by a coupling reaction of Ultralink Iodoacetyl with
the free cysteine residue of 2-7-SC-2 SCA protein. Specifically,
.about.7 ml of Ultralink Iodoacetyl resin rinsed with 2 volumes of
50 mM phosphate, 5 mM EDTA, pH 7.8, were mixed with .about.6.5 ml
of 1.45 mg/ml 2-7-SC-2 SCA at 25.degree. C. for 15 min. The
coupling reaction was monitored by measuring absorbance of the
supernatant at 280 nm. The protein concentration in the supernatant
was decreased by 80%. The resin was washed with 3 volumes of 50 mM
phosphate, pH 7.8, 5 mM EDTA and then treated with 50 mM cysteine
for 40 min. The sample was then transferred to the column and
washed with 1 M NaCl, 50 mM glycine, pH 3.0, and then with PBS. The
anti-2-7-SC-2 SCA antibody purified from the Protein A column was
passed through the D2E7 SCA-conjugated column which was
equilibrated with standard PBS. The column was chased to baseline
with PBS and the antibody was eluted out with 50 mM glycine, pH 3.0
to a 1/10 volume of 1 M Tris-HCl, pH 8.0.
[0278] Biotinylated Anti-D2E7 SCA Antibody.
[0279] Glycine and Tris components in the samples were removed by a
PD-10 desalting column, which was equilibrated with 50 mM
phosphate, pH 7.6, 100 mM NaCl. To the antibody solution was added
1/10 volume of activated Biotin in DMSO at a reaction molar ratio
of 40:1 (biotin:antibody). After 1 hr at 25.degree. C., the
biotinylated antibody was purified on a PD-10 desalting column
which was equilibrated with PBS (10 mM sodium phosphate, 138 mM
NaCl, 2.7 mM KCl, pH 7.4).
[0280] 5C. Western Blot
[0281] Anti D2E7 SCA rabbit antiserum was used as a primary
antibody and goat anti rabbit HRP was used as a secondary antibody.
Binding was measured with a TMBM peroxidase substrate. Rabbit
antiserum was also previously prepared from against the synthetic
18 residue 218-linker peptide. Reactivity with SCA proteins
containing this linker was also established.
[0282] Western Blot Results
[0283] All bands shown on the gels from purified preparations were
Western Blot positive. FIG. 7 shows an example of a Western
analysis of D2E7 SCA and PEG-SCA compounds detected with
anti-2-7-SC-1 antiserum. The primary detection antibody was
anti-2-7-SC-1 SCA rabbit antiserum prepare from rabbits immunized
with the purified recombinant SCA protein. Lane 1 and 7, molecular
weight markers (250, 148, 98, 64, 50, 36, 22, 16, 6 and 4 kDa);
lane 2, 2-7-SC-2 SCA protein; lane 3, ethyl-2-7-SC-2 ; lane 4, PEG
(5 kDa)-2-7-SC-2 ; lane 5, PEG (20 kDa)-2-7-SC-2 ; lane 6, PEG (40
kDa)-2-7-SC-2.
[0284] It was not established what proportion of the 2-7-SC-2 SCA
protein existed as monomer and dimer in the animal studies because
of the low concentration in plasma. However, the slightly more
rapid clearance of the 2-7-SC-2 protein modified with
N-ethylmaleimide could suggest that some of the starting SCA
protein was dimer and exhibited slower clearance due to a larger
mass or avidity.
[0285] 5D. Purity Analysis
[0286] The dimer form is generated by cross linking of the free
cysteine residues since the 2-7-SC-2 SCA modified with
N-ethyl-maleimide did not show any dimer on a non-reducing
SDS-PAGE.
[0287] The purified PEG-SCA conjugates typically contained
essentially no free PEG as detected by Iodine stain, less than 1%
of unmodified SCA, and less than 1% high molecular weight molecules
as detected on SDS-PAGE.
[0288] 5E. Iodine stain
[0289] SDS PAGE gels were rinsed with dH.sub.2O and placed in 5%
barium chloride solution. After 10 min of gentle mixing, the gel
was rinsed with H.sub.2O and then placed in 0.1 M Titrisol.RTM.
iodine solution for color development.
[0290] 5F. Mass Determination
[0291] The exact mass values of SCA and PEG-SCA conjugates were
determined by matrix assisted laser desorption ionization mass
spectrometry ("MALDI-TOF"; Bruker Daltronics OmniFlex NT) using an
internal standard with similar molecular weight on the
.alpha.-cyano-4-hydroxy cinamic acid (CHCA) matrix. Apparent
molecular weights (Stoke radius) of the SCA proteins were estimated
using Superdex 200 HR 10/30 Gel Filtration column chromatography
[Amersham Biosciences, by the method of the manufacturer] which was
equilibrated in 50 mM sodium phosphate, pH 6.5 and 150 mM
NaCl,.
[0292] Additionally, analysis of molecular masses on 4-20% SDS-PAGE
gels was performed using appropriate protein and PEG-protein
standards. The apparent molecular weight of the PEG-40k-SCA, as
determined by size exclusion chromatography, was 670 kDa, or about
10-fold more than its molecular mass.
[0293] Molecular Weight Determination Results for 2-7-SC-2:
[0294] The molecular weight determination results are shown in
Table 4.
7TABLE 4 Compound MALDI-TOF SEC .times. 10.sup.3 SDS-PAGE .times.
10.sup.3 D2E7 SCA 27,394 .+-. 295 20 30 Ethyl-D2E7 SCA 27,858 20 30
PEG-5k-D2E7 SCA 33,715 36 PEG-20k-D2E7 SCA 49,874 340 56
PEG-40k-D2E7 SCA 73,123 670 170
[0295] The correlation of PEG size over protein size on 4-20% SDS
gel was Y=0.00156X Other D2E7 SCA variants and PEG-SCA compounds
displayed comparable mass values that conformed to their molecular
weight and polymer size.
[0296] 5G. N-terminal Sequencing and Peptide Mapping:
[0297] N-terminal sequencing of 2-7-SC-2 and 2-7-SC-5 confirmed the
expected processing of signal sequence, such that the N-terminal
amino acid of the secreted SCA proteins is alanine followed by the
first residue of V.sub.L.
[0298] Peptide Mapping on 2-7-SC-5 -40 kDa PEG
[0299] The protein (0.2 mg total) was denatured and reduced in 6 M
Guanidine HCl containing I mM EDTA and 5 mM DTT. The solution was
allowed to incubate at 37.degree. C. for 1 h. Alkylating agent,
iodoacetamide, was added to the final concentration of 15 mM and
the reaction was performed at room temperature for 1 h. After
alkylation, the excessive iodoacetamide was inactivated by adding
.beta.-mercaptoethanol to 45 mM (final concentration) and the
solution was subjected to PD10 desalting column. The alkylated
PEG-2-7-SC-5 was concentrated with Centricom 10 and then hydrolyzed
by TPCK-treated trypsin with enzyme to protein ratio of 1:20 (w/w).
The hydrolysis was allowed for 6-8 h at 37.degree. C. and then
added same amount of fresh trypsin for overnight reaction. The
hydrolyzed protein solution was brought to dryness by Speedvac and
reconstituted in HPLC-grade water.
[0300] The resultant peptide mixture was fractionated by HPLC size
exclusion chromatography (Superdex 75) with HPLC-grade water. The
factions were manually collected and analyzed by Tricine SDS-PAGE
stained with iodine solution (20 mM in 5% BaCl). The positively
stained fractions were further resolved by reversed-phase HPLC
(Jupiter C18, 2.times.250 mm) with the gradient of acetonitrile
(containing 0.05% TFA) from 5-70% in 60 min. The peaks were
collected manually and dried in Speedvac. The peaks were
reconstituted with 10 .mu.l water and 5 .mu.l was taken for Tricine
SDS-PAGE analysis. The positively iodine-stained fraction (only
one, .about.40 min of retention time) was subjected to amino acid
sequencer analysis (Applied Biosystems). The sequence obtained from
the analysis was G.quadrature. TSGSGKPG (SEQ ID NO: 41), where the
blank square represents the modified amino acid, indicating that
maleimide--PEG 40K is accurately attached to cysteine (position 110
from N-terminal Ala 1).
[0301] 5H. Stability of D2E7 and PEG-D2E7--Results
[0302] D2E7 SCA and PEG-D2E7 SCA conjugates were shown to be stable
after 10 cycles of freeze-thaw. Aliquots of native 2-7-SC-2 SCA
(concentration 1.1 mg/ml in 50 mM Tris/Glycine buffer at pH 7.0)
were subjected to freezing at -80.degree. C. for 15 minutes
followed by thawing at 37.degree. C. for 10 minutes. The
freeze-thaw maneuver was performed for 3, 5, and 10 cycles and the
integrity of the native SCA was analyzed by SDS-PAGE and by
established TNF-sensitive cell rescue assay. The SCA was found be
to very stable and could physically withstand at least 10
freeze-thaw cycles without showing any degradation as determined by
Coomassie blue staining of polyacrylamide gel (data not shown).
There was no change in biological activity of 2-7-SC-2
(IC.sub.50:224.6 nM) upon 5 cycles of freeze-thaw.
[0303] All D2E7 PEG-SCA proteins in this study were found to be
stable for 30 days at 4.degree. C. in 20 mM sodium phosphate, pH
6.5, 150 mM NaCl. 2-7-SC-2 SCA protein was stable at a pH 3-10,
25.degree. C., 18 hrs incubation. NaCl at a concentration up to 1.2
M had no effect on activity or solubility of 2-7-SC-2, in 20 mM
sodium phosphate, pH 7.4, at 25.degree. C.
[0304] 5I. Antigenicity
[0305] PEGylated D2E7 SCA proteins display a marked decrease in
binding efficiency to anti-D2E7 SCA polyclonal antibodies. PEG-SCA
2-7-SC-5 is marginally reactive with anti-218 peptide rabbit serum
as analyzed by Western blots using anti-218 antiserum.
Example 6
Flow Cytometry Analysis of SCA and PEG-SCA Proteins
[0306] Cell Surface Receptor Binding Assay for 2-7-SC-2, 2-7-SC-3,
2-7-SC4, 2-7-SC-5
[0307] The WEHI-13VAR cell line was used to analyze TNF-alpha
binding to the cell receptor in the presence of D2E7 SCA or
PEG-D2E7 SCA. The Biotin TNF-alpha (0.04 .mu.g) was preincubated
with D2E7 SCA or PEG-D2E7 SCA (1-4 .mu.g) in 50 .mu.l of FACS
buffer (1% FBS and 0.05% NaN.sub.3 in PBS) at 25.degree. C. for 30
min and then at 4.degree. C. for 15 min with shaking.
[0308] At the same time, the controls, such as biotinylated soybean
trypsin inhibitor (0.05 .mu.g), polyclonal goat IgG anti-human
TNF-alpha antibody (20 .mu.g), and CC49 SCA (4 .mu.g), were also
pre-incubated with biotin-TNF-alpha (0.04 .mu.g) in 50 .mu.l FACS
buffer. WEHI-13VAR cells were detached from flask using ice cold 20
mM EDTA in PBS, 37.degree. C. for 2-3 min. The cells were
resuspended in RPMI 1640 Medium and span down at 2000 rpm for 5min.
The cells were then washed once with medium and twice with FACS
wash buffer and counted using a hemacytometer.
[0309] The cells were suspended in FACS buffer to a final
concentration of 2.times.10.sup.6 cells/ml. All amber eppendorf
tubes used for cells were blocked with FACS buffer for at least 1
hr at 4.degree. C. For the effect of Actinomycin D and Fc block
reagent (BD Biosciences)on TNF-alpha binding to cell receptor, the
cells (10.sup.5) were pre-incubated with 0.05 .mu.g Actinomycin
D/1.times.10.sup.6 cells or 1 .mu.g Fc blocking/1.times.10.sup.6
cells in 50 .mu.l FACS buffer for 15-30 min at 4.degree. C. To 50
.mu.l mixture of TNF-alpha and PEG-D2E7 SCA was added 50 .mu.l of
1.times.10.sup.5 WEHI-13VAR cells. After 60 min incubation at
4.degree. C. in the dark, the cells were span down and resuspended
in 80 .mu.l cold FACS buffer. 10-.mu.l of
Streptavidin-Phycoerythrin was added. The mixture was incubated in
the dark at 4.degree. C. for 30 min. The cells were then washed
twice with cold 1 ml of FACS buffer and resuspended in 0.3 ml FACS
wash buffer for analysis.
[0310] Flow cytometry analysis--Results
[0311] Biotinylated soybean trypsin inhibitor, polyclonal goat
anti-human interferon-alpha IgG, and CC49 SCA (Enzon) exhibited no
binding and served as negative controls. Preincubation with Fc
block reagents (BD Biosciences) and Actinomycin D to the cells had
no effect on TNF-alpha Binding. PEG-D2E7 2-7-SC-2 SCA conjugates
(ethyl-, 5 k, 20 k or 40 k PEG) completely eliminated TNF-alpha
binding to the cells at a molar ratio higher than 16:1 (D2E7
SCA:TNF-alpha).
[0312] At the same molar ratios of D2E7 SCA to TNF-alpha, native
D2E7 SCA also reduced TNF-alpha binding to the cells, but not
fully. Therefore, in this analysis, the PEG-SCA versions of the
D2E7 were more potent than the native SCA proteins. FIGS. 6A, 6B
and 6C shows representative data of 2-7-SC-2 SCA and PEG-SCA
compounds in flow cytometry analysis of the capacity of these
compounds to prevent biotin labeled TNF-.alpha. from binding to its
receptor on WEHI-13VAR cells. These data show that the
anti-TNF-.alpha. PEG-SCA compounds are highly active in blocking
the binding of this cytokine to its receptor in a cell based
system.
[0313] Flow Cytometry Analysis of TNF.alpha. Binding to Cell
Receptor in the Presence of 2-7-SC-2 or PEG-2-7-SC-2. 1, cell
population without fluorescence labeling; 2, cell population after
binding to biotin-TNF.alpha. and then to
streptavidin-phycoerythrin; and 3, effect of 2-7-SC-2 (FIG. 6A),
PEG(20 k)-2-7-SC-2 (FIG. 6B), and PEG(40 k)-2-7-SC-2 (FIG. 6C) on
TNF.alpha. binding to cell receptor. The molar ratio of 2-7-SC-2 or
PEG-2-7-SC-2 to TNF.alpha. is 16:1. The shift towards low
fluorescence intensity indicates reduced binding of TNF.alpha. to
the cells.
Example 7
Biacore Analysis
[0314] Kinetic Analysis of the interaction of recombinant
hTNF-alpha with D2E7 SCA and PEG-SCA
[0315] The interaction between TNF-.alpha. and D2E7 SCA variants
and their PEGylated forms was analyzed by surface plasmon resonance
(SPR) techniques using a BiaCore X instrument (BiaCore, Inc.;
Piscataway, N.J.). Recombinant human TNF-.alpha. of >97% purity
(Pierce; Rockford, Ill.) was immobilized on a CM5 chip (BiaCore,
Cat # BR-1000-14) as a 10 .mu.g/ml solution at pH 5.0 (acetate
buffer, BiaCore, Cat t# BR-1003-51). The immobilized surface was
washed three times with acetate buffer, pH 4.5 (BiaCore, Cat #
BR-1003-50) and subjected to ligand stability analysis for 6 cycles
with 500 nM native SCA.
[0316] D2E7 SCA served as analyte with acetate at pH 4.5 as the
regeneration buffer. Over the stable TNF-.alpha.-bound surface,
different concentrations of SCAs or PEG-SCAs were examined for
association (3 minutes) and dissociation (2 minutes or 5 minutes)
and the data were analyzed for kinetic parameters (e.g., k.sub.on,
k.sub.off, K.sub.A, and K.sub.D values) using BiaEvaluation
software (version 3.0). HBS-N (BiaCore, Cat t# BR-1003-69) was used
as the running buffer in this protocol.
8 Kinetic Analysis of Interaction between immobilized rhTNF-.alpha.
with D2E7 SCA or PEG-SCA Methods TNF-alpha Source: Pierce,
recombinant form, cat# RTNFA50 MW: 17.4 kD, 157 aa Purity:
>97%
[0317] Reconstitution: In distilled water "DW" to a concentration
of 100 .mu.g/ml. No additives are present in the preparation
9 Storage: Stored at -70 degrees C.
[0318]
10 D2E7 SCA: Clone 2-7-SC-2 Source: Enzon Pharmaceuticals, Inc.,
recombinant form, expressed in Pichia MW: 27 kD, with 218 linker
Purity: >90% Reconstitution: In 10 mM phosphate buffer, pH 7.0,
with 150 mM NaCl Storage: Stored at 4.0 degrees C.
[0319] Immobilization: Using New CM5 Chip
[0320] TNF conc.: 10 .mu.g/ml, diluted directly from the stock in
acetate buffer at pH 5.0
[0321] Flow rate: 5.0 .mu.l/min
[0322] Channels: FC 1-2, 3.0 min activation with 1:1 NHS/EDC
mixture
[0323] Channel: FC2, manual injection of 15 .mu.l of TNF, 10
.mu.g/ml (Less volume to be injected to achieve lower RUs)
[0324] Channels: FC1-2, 3 minutes inactivation with 1 M
Ethanolamine, pH 8.5
[0325] Channel: FC1-2, manual injection of 25 .mu.l of BSA, 1
.mu.g/ml in HBS-N buffer
[0326] Channels: FC1-2, 1 min injection of 10 mM acetate, pH 4.5,
100 .mu.l/min, to clean the injection port
[0327] Final RU (response unit) was 199.
[0328] The CM5 Chip was washed with HBSN buffer and tested for at
least 6 cycles of stability with 500 nM 2-7-SC-2. The CM5 Chip was
then used for kinetic analysis.
[0329] Kinetic Analysis of D2E7 2-7-SC-2
[0330] Concentration of 2-7-SC-2: diluted in HBS-N immediately
before injection
[0331] 2.98 .mu.g/ml (1080 nM)
[0332] 1.49 .mu.g/ml (540 nM)
[0333] 0.745 .mu.g/ml (270 nM)
[0334] 0.3725 .mu.g/ml (135 nM)
[0335] 0.186 .mu.g/ml (67.5 nM)
[0336] 93 ng/ml (33.75 nM)
[0337] 46.5 ng/ml (16.875 nM)
[0338] 23.28 ng/ml (8.4375 nM)
[0339] 0 .mu.g/ml (0 nM)
[0340] Flow Rate: 25 .mu.l/min (Note: 30 .mu.l/min resulted in
similar binding as that of 20 and 25 .mu.l/min)
11 Duration of association: 3 minutes Duration of dissociation: 2
minutes and 5 minutes Regeneration Buffer: 10 mM Acetate, pH
4.5
[0341] Regeneration was performed in two steps, 100.mu.l wash at
100 .mu.l/min as the 1.sup.st wash and 40
[0342] 80 .mu.l at 100 .mu.l/min as 2.sup.nd wash, depending on the
RU left on the chip after the 1.sup.st wash
[0343] Data Analysis
[0344] The association and dissociation kinetic curves for the
bimolecular binding reaction were analyzed using 1:1 binding fit
with and without mass transfer limitations. No significant
improvement in kinetics was achieved by including mass transfer
parameters, showing that mass transfer phenomenon was not prevalent
in the experiments. 2-7-SC-4 and PEG-40 k-2-7-SC-4 were prepared
for this purpose FACS results independently showed that there was
no difference between D2E7/PEG-D2E7 SCA binding to TNF-alpha, with
and without the SCA his-tag segment.
[0345] The results from Biacore and cell rescue studies have also
confirmed that the his-tag segment is not responsible for binding
events of the antigen and SCA.
[0346] Direct binding kinetics were determined by immobilizing
TNF-alpha on CM5 Chip and allowing different concentrations of
native and PEG-versions of 2-7-SC-2 to flow over the bound ligand.
Table 5, below, provides the ka (k.sub.on), kd (k.sub.off),
K.sub.A, and K.sub.D values of different forms of 2-7-SC-2
SCAs.
[0347] Kinetic Parameters of 2-7-SC-2 SCA compounds
12TABLE 5 2-7-SC-2 Versions ka (M.sup.-1s.sup.-1) Kd (s.sup.-1) KA
(M.sup.-1) KD (M) 2-7-SC-2 -native 3.28e.sup.5 3.92e.sup.-4
8.36e.sup.8 1.2e.sup.-9 2-7-SC-2 -NE-mal 1.47e.sup.5 7.87e.sup.-5
1.86e.sup.9 5.37e.sup.-10 2-7-SC-2 -5K-PEG 4.96e.sup.4 3.01e.sup.-4
1.65e.sup.8 6.06e.sup.-9 2-7-SC-2 -20K-PEG 1.6e.sup.3 4.18e.sup.-4
3.83e.sup.6 2.61e.sup.-7 2-7-SC-2 -40K-PEG 4.47e.sup.3 6.78e.sup.-4
6.59e.sup.6 1.52e.sup.-7
[0348] Table 5, above, confirms that the PEGylated SCA proteins
maintain high affinity for their ligand. However, different PEG-SCA
designed molecules show differences in on-rates and off-rates. In
particular, the 40 kDa PEG version of 2-7-SC-2 has significantly
diminished on-rates, but retained off-rates, when compared to the
parent SCA. This could reflect a steric hindrance effect in this
artificial binding environment on the BIACore chip by the large and
flexible PEG polymers. In contrast, the cell based assays described
elsewhere in this study show a similar binding potency for the
native and 40 kDa PEGylated SCA proteins.
[0349] The specific trends in on-rate and off-rate perturbations by
PEGylation could reveal a compound-specific conformation or
arrangement of the polymer with respect to the conjugated protein.
The further studies on additional PEG-SCA compounds described below
highlight this possibility. 2-7-SC-4 --40 kDa-PEG data indicate
that placement of the PEG polymer directly at C-terminus
substantially improved off-rates. The strategy of using the defined
parameters of SCA cysteine placement and PEG polymer mass as
disclosed in this study may allow the optimization of binding and
activity properties for any individual PEG-SCA protein
conjugate.
[0350] Binding Kinetics of 2-7-SC-5 and 2-7-SC-7 to rhTNF
[0351] Direct binding kinetics were determined by immobilizing
TNF-alpha on CM5 Chip and allowing different concentrations of
native and PEG-versions of 2-7-SC-5 and 2-7-SC-7/ to flow over the
bound ligand. Tables below provide the ka, k.sub.d, K.sub.A, and
K.sub.D values of different forms of 2-7-SC-5 and 2-7-SC-7.
13TABLE 6 KINETIC PARAMETERS OF 2-7-SC-5 SCA COMPOUNDS 2-7-SC-5
Versions Ka (M.sup.-1s.sup.-1) kd (s.sup.-1) KA (M.sup.-1) KD (M)
2-7-SC-5 -native 1.73e5 1.12e-5 1.55e10 6.44e-11 2-7-SC-5 -40K-PEG
2.04e3 2.23e-6 9.18e8 1.09e-9
[0352]
14TABLE 7A KINETIC PARAMETERS OF 2-7-SC-7 Version Ka
(M.sup.-1s.sup.-1) kd (s.sup.-1) KA (M.sup.-1) KD (M) 2-7-SC-7
-native 3.51e4 2.96e-6 1.19e10 8.43e-11
[0353]
15TABLE 7B KINETIC PARAMETERS OF 2-7-SC-7 2-7-SC-7 Version ka
(M.sup.-1s.sup.-1) kd (s.sup.-1) KA (M.sup.-1) KD (M) 2-7-SC-7
-20K-PEG 4.37e4 2.89e-4 1.51e8 6.61e-9
[0354] Direct binding kinetics were determined by immobilizing
TNF.alpha. on CM5 Chip and allowing different concentrations of
native and PEG-versions of 2-7-SC-3/2-7-SC-7 to flow over the bound
ligand. Tables below provide the k.sub.a, k.sub.d, K.sub.A, and
K.sub.D values of different forms of 2-7-SC-3 and 2-7-SC-7.
16TABLE 8A Kinetic Parameters of 2-7-SC-3 SCAs and Conjugates
2-7-SC-3 Versions ka (M.sup.-1s.sup.-1) kd (s.sup.-1) KA (M.sup.-1)
KD (M) 2-7-SC-3 -native 4.64e.sup.4 4.16e.sup.-4 1.1e.sup.8
9.05e.sup.-9 2-7-SC-3 -20K-PEG 1.02e.sup.4 2.5e.sup.-4 4.07e.sup.7
2.45e.sup.-8 2-7-SC-3 40K-PEG 4.14e.sup.3 4.04e.sup.-4 1.03e.sup.7
9.74e.sup.-8
[0355]
17TABLE 8B Kinetic Parameters of 2-7-SC-4 SCAs and Conjugates KA
K.sub.on(1/Ms) K.sub.off(1/s) (1/M) KD (M) 2-7-SC-4 native
2.72e.sup.5 4.95e.sup.-4 5.49e.sup.8 1.82e.sup.-9 2-7-SC-4 40K-PEG
1.12e.sup.4 4.04e.sup.-6 2.78e.sup.9 3.6e.sup.-10
Example 8
Assay for Neutralization of TNF-.alpha. Cellular Cytotoxicity
[0356] A cell-based assay for neutralization of TNF-.alpha.
cellular cytotoxicity was conducted as follows.
[0357] WEHI-13VAR cells (obtained from the American Type Culture
collection, ATCC No. CRL-2148) are more sensitive to TNF-.alpha. in
the presence of Actinomycin D, and were employed in the assay.
[0358] WEHI-13VAR cells were seeded in a 96-well plate, 10,000
cells per well and incubated overnight at 37.degree. C in a
humidified incubator with 5% CO.sub.2. A range of concentrations of
D2E7 SCA proteins and their PEGylated forms were added to the
seeded cells in the 96-well plates in serial dilutions from 10
.mu.g/ml to 2.5 ng/ml diluted in culture medium.
[0359] Immediately following the addition of D2E7 SCA compounds,
rhTNF-alpha (Pierce) was added to each well at a concentration of
1.0 ng/ml. The cells were then allowed to grow for 24 h and cell
viability was determined by addition of 15 .mu.l MTT dye reagent
(Cat # G4000, Promega Corporation [Madison, Wis.])
(3-(4,5,dimethylthiazol2yl)2,5-diphe- nyl tetrazolium bromide)
following the manufacturer's instruction. The analysis of cell
rescue was performed by comparing the viability of D2E7-treated
cells with untreated cells in the presence of TNF-.alpha..
[0360] Control wells consisted of untreated cells, and cells
treated with TNF-.alpha. alone. The cells in the control wells
exhibited a complete loss of viability. The percentage of viable
cells (or rescued cells) in experimental wells was plotted against
the log of D2E7 concentrations and IC.sub.50 values were determined
for each data set. Each value was derived from a triplicate
experimental set.
[0361] Cell Rescue by D2E7 SCA Proteins from TNF-Alpha
Lethality
[0362] The ability of the anti-TNF.alpha. SCA proteins, such as
those listed by Tables 9A, 9B and 9C, infra, to protect cells from
negative effects of TNF.alpha. was confirmed by employing a
TNF.alpha.--sensitive cell-line, and contacting the cells with
TNF.alpha., with and without SCA protein 2-7-SC-2. Results are were
consistent with additional tests conducted with other SCA proteins
prepared by Example 1.
[0363] Materials and Methods
[0364] Cell line: WEHI-13VAR cells; ATCC# CRL-2148, mouse cell line
Propagation: RPMI 1640 medium with 2 mM G-glutamine, 1.5 g/L sodium
bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium
pyruvate, and 10% FBS
[0365] Freeze Medium: Culture medium, 95% and DMSO, 5%
[0366] Assay Method
[0367] WEHI-13VAR cells were trypsinized and seeded in 96-well
plate, 10,000 cells/well in complete RPMI-1640 medium and allowed
to establish for 12 h in a humidified incubator at 37.degree. C.
with 5% CO.sub.2
[0368] Cells were washed with PBS and fresh medium was added to
each well Different D2E7 SCA variants and their PEGylated forms
were added to wells, including those listed by Tables 9A, 9B and
9C, infra. The SCAs were serially diluted from 10 .mu.g/ml to 2.5
ng/ml (diluted in complete RPMI medium). No D2E7 was added to the
control cells.
[0369] Immediately following the addition of the D2E7 compound,
recombinant hTNF-alpha (1.0 ng/ml diluted in RPMI medium, not
complete medium) was added to each well. No TNF-alpha was added to
the untreated control cells.
[0370] Cells were incubated for 24 h in humidified incubator at
37.degree. C. with 5% CO.sub.2
[0371] At the end of incubation period, 15 .mu.l MTT dye reagent
(Cat# G4000, Promega Corporation) was added to each well and the
plate was incubated for 4 h at 37.degree. C. before stop solution
was added to each well. The content of each well was mixed
thoroughly and crystals were allowed to solubilize overnight at
room temperature.
[0372] The plate was read at 570 nm and 630 nm in a 96-well plate
reader (Molecular Devices) and the difference (measure of cell
viability) in absorbance units was plotted against the
concentration of D2E7 compound used to rescue the cells against
TNF-alpha cytotoxicity.
[0373] The concentration of D2E7 SCA protein at which 50% cells
were rescued was determined for each set of experiment from the
viability graph using log[D2E7] as X-axis and % Rescued as Y-axis
parameters.
[0374] The stability of Mal-PEG (20 kDa) polymer at 25.degree. C.,
50 mM sodium phosphate pH 7.0, 1 mM EDTA was investigated by UV
absorbance scanning from 220 nm to 400 nm for 0, 2, 4, 22, and 33
hours. After 33 hours at 25.degree. C., 3 mM cysteine was added and
the mixture was scanned after 5 minutes incubation. The time
dependent conversion of the distinctive peak at 300 nm was
quantitated.
[0375] Note: WEHI-13VAR cells are more sensitive to TNF-alpha and
lymphotoxin than L929 (ATCC CCL-1). In the absence of Actinomycin D
these cells lose sensitivity to TNF within 30 days. Also, addition
of Actinomycin D was found to be detrimental for the rescue of
cells by D2E7 compounds.
[0376] The native 2-7-SC-2, 2-7-SC-2 -NE-maleimide, 5K, 20K, and
40K PEGylated 2-7-SC-2 s were analyzed for their potency to rescue
cells from TNF-mediated killing. Table 9A provides the IC.sub.50
values (to rescue 50% WEHI-13VAR cells from killing by 1.0 ng/ml
TNF) for each version of 2-7-SC-2.
18TABLE 9A Cell rescue by 2-7-SC-2 SCA compounds: 2-7-SC-2 Versions
IC.sub.50 Values 2-7-SC-2 native 3.05 .times. 10 - 9 M 2-7-SC-2
-NE-maleimide 3.71 .times. 10 - 9 M 2-7-SC-2 -5K-PEG 4.27 .times.
10 - 9 M 2-7-SC-2 -20K-PEG 3.52 .times. 10 - 9 M 2-7-SC-2 -40K-PEG
11.09 .times. 10 - 9 M
[0377]
19TABLE 9B Cell rescue by 2-7-SC-4 SCA compounds 2-7-SC-4 Versions
IC.sub.50 Values 2-7-SC-4 native 7.18 .times. 10 - 9 M 2-7-SC-4
-40K-PEG 4.64 .times. 10 - 9 M
[0378]
20TABLE 9C Cell rescue by 2-7-SC-5 SCA compounds 2-7-SC-5 Versions
IC.sub.50 Values 2-7-SC-5 native 4.18 .times. 10 - 9 M 2-7-SC-5
-40K-PEG 6.91 .times. 10 - 9 M
[0379] These data confirm that the designed PEGylated versions of
D2E7 SCA display similar bioactivity in binding and neutralization
of the cytokine TNF-alpha in this cell-based assay. The PEG-SCA
compounds therefore are able to effectively neutralize this
cytokine and prevent its binding to the TNF-alpha receptors on
these cells.
Example 9
Pharmacokinetics of D2E7 SCA and PEG-SCAs
[0380] STUDY PROTOCOL: Pharmacokinetics of SCA and PEG-SCA
Conjugates in ICR Mice
[0381] Purpose of Study
[0382] This study was designed to examine the plasma
pharmacokinetics of SCA D2E7 (2-7-SC-2 and 2-7-SC-5 ) and the
PEGylated forms including PEG (5 kd), PEG(20 kd) and PEG(43 kd)
conjugates in ICR mice.
[0383] Test Articles (Stored at -20.degree. C. prior to
administration)
[0384] D2E7(2-7-SC-2, 2-7-SC-5) (100% active w/w)
[0385] PEG(20 kd)-D2E7(2-7-SC-2, 2-7-SC-5) (57.4% active w/w)
[0386] PEG(43 kd)-D2E7(2-7-SC-2, 2-7-SC-5) (38.6% active w/w)
21 Test System Species: ICR (Sprague Dawley Harlan) mice Age: 7-8
week Gender: Female Weight: Weight range at initiation:
approximately 25 g
[0387] Animal Husbandry:
[0388] Mice were housed 5 per cage in breeder boxes at the
University of Medicine and Dentistry of New Jersey ("UMDNJ")
vivarium. Cages were sized in accordance with the "Guide for the
Care and Use of Laboratory Animals of the Institute of Laboratory
Animal Resource", National Research Council. Waste material was
removed at a minimum of two times per week. The cages were clearly
labeled with a cage card indicating study, test article, animal
number, sex, and dose level. Animals were acclimated for one week
prior to study initiation
[0389] Diet
[0390] The mice had access to tap water and fed commercially
available lab chow ad libitum.
[0391] Sample Preparation
[0392] D2E7(2-7-SC-2, 2-7-SC-5) were diluted with PBS to 0.556
mg/mL D2E7
[0393] PEG(20 kd)-D2E7(2-7-SC-2, 2-7-SC-5 ) were diluted with PBS
to 0.503 mg/mL D2E7 equivalents
[0394] PEG(43 kd)-D2E7(2-7-SC-2, 2-7-SC-5 ) were diluted with PBS
to 0.541 mg/mL D2E7 equivalents
[0395] Phosphate Buffered Saline; 10 mM sodium phosphate, pH 6.5
containing 140 mM NaCl
[0396] Administration Site
[0397] D2E7(2-7-SC-2, 2-7-SC-5 ), PEG(20 kd)-D2E7(2-7-SC-2,
2-7-SC-5), and PEG(43 kd)-D2E7(2-7-SC-2, 2-7-SC-5) conjugates were
administered as a single dose (Day 1) i.v. via the tail vein.
[0398] Experimental Design
[0399] Fifty-four (54) mice were assigned, dosed and bled according
to the scheme of Table 10, below.
22TABLE 10 Dose D2E7 (mg/ Dose* Group Treatment N kg) (mg/kg) Inj
Time Points Bled (h) Vol.sup..sctn.(.mu.l) 1 20 kd PEG- 2-7-SC-5 3
7.0 4 iv 0.03 24 100/1000 2 20 kd PEG- 2-7-SC-5 3 7.0 4 iv 0.25 48
100/1000 3 20 kd PEG- 2-7-SC-5 3 7.0 4 iv 0.5 72 100/1000 4 20 kd
PEG- 2-7-SC-5 3 7.0 4 iv 1 96 100/1000 5 20 kd PEG- 2-7-SC-5 3 7.0
4 iv 3 1000 6 20 kd PEG- 2-7-SC-5 3 7.0 4 iv 6 1000 7 2-7-SC-5 3
4.0 4 iv 0.03 24 100/1000 8 2-7-SC-5 3 4.0 4 iv 0.25 48 100/1000 9
2-7-SC-5 3 4.0 4 iv 0.5 72 100/1000 10 2-7-SC-5 3 4.0 4 iv 1 96
100/1000 11 2-7-SC-5 3 4.0 4 iv 3 1000 12 2-7-SC-5 3 4.0 4 iv 6
1000 7 43 kd PEG-2-7-SC-5 3 10.4 4 iv 0.03 24 100/1000 8 43 kd
PEG-2-7-SC-5 3 10.4 4 iv 0.25 48 100/1000 9 43 kd PEG-2-7-SC-5 3
10.4 4 iv 0.5 72 100/1000 10 43 kd PEG-2-7-SC-5 3 10:4 4 iv 1 96
100/1000 11 43 kd PEG-2-7-SC-5 3 10.4 4 iv 3 1000 12 43 kd
PEG-2-7-SC-5 3 10.4 4 iv 6 1000 *D2E7 equivalent .sup..sctn.Repeat
bleeding was .about.1000 .mu.L
[0400] Two (2) untreated mice were bled via cardiac puncture into
EDTA containing tubes for the collection of untreated control
plasma.
[0401] Mice were injected intravenously with 200 .mu.L per mouse
with D2E7(2-7-SC-5 ), 180 .mu.L per mouse PEG(20 kd)-D2E7(2-7-SC-5
), and 190 .mu.L per mouse PEG(43 kd)-D2E7(2-7-SC-5 ) conjugates.
Following sedation with 0.09% avertin, mice were bled via the
retro-orbital sinus into EDTA containing vials. At 2 min, 15 min,
30 min and 1 hour mice were bled 100 .mu.L and at 3 h, 6 h, 24 h,
48 h, 72 h and 96 h mice were terminally bled .about.1000 .mu.L by
cardiac puncture. The plasma was collected following centrifugation
of the blood and immediately frozen at -80.degree. C. on dry
ice.
[0402] The plasma samples were thawed and the concentration of D2E7
compounds determined by ELISA. The data were modeled using
WinNonlin software to determine D2E7(2-7-SC-2, 2-7-SC-5 ), PEG(20
kd)-D2E7(2-7-SC-2 , 2-7-SC-5), and PEG(43 kd)-D2E7(2-7-SC-2,
2-7-SC-5 ) pharmacokinetic parameters.
[0403] Clinical Examinations: The mice were examined visually on
arrival. A detailed physical examination for signs of clinical
abnormality was performed only when necessary according to visual
assessment, in order to avoid excessive handling. The mice were
examined visually once daily following infusion of the test
article, for mortality and signs of reaction to treatment. Any
death and clinical signs were recorded. More frequent examinations
were performed if circumstances dictate. Animal Care Provision:
This study was conducted in accordance with the current guidelines
for animal welfare (NIH Publication 86-23, 1985).
[0404] Pharmacokinetics of D2E7 SCA and PEG-D2E7 SCA Conjugates in
Mice:
[0405] Enzyme-Linked Immunosorbent Assay (ELISA) of D2E7 SCA and
PEG-SCA
[0406] Sample Preparation. The linear range of SCA tested was
between 0.2 ng/ml and 30 ng/ml. ng/ml protein concentrations and an
optical reading within the linear range was used for analysis.
[0407] The standard SCA or PEG-SCA was diluted in plasma to a
similar dilution factor to the plasma samples analyzed or directly
diluted in dilution buffer (0.1% BSA and 0.05% Tween-20 in PBS, pH
7.4). To simplify the procedure, the standard was diluted in
dilution buffer for plasma sample analysis. The dosage by i.v. or
s.c. administration was 4.5 mg/kg. The dilution factors for plasma
samples by i.v. administration were 500 for 0.03-3 hr samples and
10 for 6-96 hr samples of SCA, 500 for 0.03-24 hrs samples and 10
for 4-96 hrs samples of PEG-5k-SCA, 800 for 0.033-6 hr samples and
100 for 24-96 hr samples of PEG-20 k-SCA, and 800 for all samples
of PEG-40 k-SCA. The dilution factors of the plasma samples by s.c.
administration were 200 for all samples of SCA and 300 for all
samples of PEG(20 k)-SCA.
[0408] ELISA Procedure. A sandwich ELISA was used to determine
plasma concentrations of SCA and PEG-SCA conjugates. The samples
were measured in terms of defined compositions as detected by the
antibody. The capture antibody was polyclonal anti D2E7 antibody
which was purified by protein A and D2E7-conjugated affinity
columns. For the binding to TNF.alpha., the plate was coated with
TNF.alpha.. The primary and secondary antibodies were biotinylated
anti D2E7 antibody and Streptavidin-peroxidase respectively. The
Maxisorp plates were coated with 400 ng/well anti D2E7 antibody or
TNF.alpha. in 50 .mu.l of 50 mM sodium bicarbonate at 25.degree. C.
for overnight. At the same time, for samples dilution, the Nunc
microwell plates or any regular 96-well plates that have a minimal
absorption of protein were blocked with blocking buffer (1% BSA, 5%
Sucrose, and 0.05% NaN.sub.3 in PBS, pH 7.4) at 4.degree. C. for
overnight. On the next day, the coating solution and blocking
solution were removed from both ELISA and Nunc plates with
aspirator. The ELISA plates were blocked with blocking solution
(250 ul/well) for at least 1 hr at 25.degree. C. and the Nunc
plates were washed three times with wash buffer (PBS with 0.05%
Tween-20, pH 7.4) or were allowed to air dry at 25.degree. C. and
stored at 4.degree. C. for further analysis. The ELISA plates after
removing blocking solution were washed with wash buffer three times
or allowed to air dry at 25.degree. C. and stored sealed at
4.degree. C. until further use. The plasma samples were diluted 1:2
in a consecutive manner from the top of the Nunc plate to the
bottom with 120 .mu.l left in each well. After the pre-dilution
with dilution buffer, 100 .mu.l of the samples was transferred to
ELISA plates and incubated at 4.degree. C. overnight. After the
sample solutions were removed and the plates were washed three
times with wash buffer, 20-ng biotin anti D2E7 antibody in 50 .mu.l
dilution buffer was added to each well. The samples were incubated
at 25.degree. C. for 2 hrs. 100-ul streptavidin-peroxidase was
added at 1:16,000 dilution after the primary antibody was removed
and the plates were washed with wash buffer for four times. The
plates were incubated at 25.degree. C. for 1 hr. The solution was
removed and the plates were washed three times with wash buffer.
The color was developed 10-20 min after adding 100 .mu.l of TMBE
substrate and stopped by adding 50 .mu.l 1 M H.sub.2SO.sub.4.
Absorbance at 450 nm was recorded.
[0409] Data Acquisition and Analysis. Data were acquired and
analyzed on a Molecular Devices microplate reader. The standard
curve was obtained by plotting of optical density of the endpoints
at 450 nm versus the concentrations of the standard and by drawing
the best fitting curve that has a correlation coefficient of 0.99
or better. All unknown sample concentrations were calculated from
the standard curve after the dilution factor has been incorporated.
The closest numbers of all data points that have an appropriate
optical density have been averaged for the results.
[0410] Pharmacokinetics of D2E7 SCA and PEGD2E7 SCA Conjugates in
Mice
[0411] PK parameters for all 2-7-SC-2 series (2-7-SC-2,
ethyl-2-7-SC-2 , PEG-5 k-2-7-SC-2, PEG-20 k-2-7-SC-2, PEG-40
k-2-7-SC-2 ) were determined. PK parameters for 2-7-SC-5 , PEG-20
k-2-7-SC-5 , and PEG-40 k-2-7-SC-5 were determined. PK parameters
for 2-7-SC-2 and PEG-20 k-2-7-SC-2 by s.c. injection were also
determined.
[0412] From the pilot experiments, a lower detection sensitivity of
2-7-SC-2 (50 ng/ml) using anti 218 linker was observed. An
approximately 100-fold extension of circulating half-life in mice
was observed in the 40 kDa PEG-SCA compounds (2-7-SC-2, 2-7-SC-5 )
when compared to the unmodified SCA protein. Table 11, below,
displays the determined pharmacokinetic parameters for 2-7-SC-2,
PEG-2-7-SC-2 , 2-7-SC-5 , PEG-2-7-SC-5 administered via intravenous
injection (IV) or subcutaneous (SC) injection.
23TABLE 11 Pharmacokinetic Parameters of D2E7 SCA and PEG-SCA in
Mice.sup.1 AUC CL V.sub.SS C.sub.max SCA/PEG Rte t.sub.1/2 (hr)
t.sub.1/2 (hr) MRT (hr) hr .multidot. .mu.g/ml ml/hr/kg ml/kg
.mu.g/ml 2-7-SC2 i.v. 0.15 .+-. 0.03 0.70 .+-. 0.20 0.37 .+-. 0.23
11.3 .+-. 1.4 387 .+-. 49 280 .+-. 57 53.8 .+-. 3.8 Ethyl-2-7-SC2
i.v. 0.08 .+-. 0.00 0.7 .+-. 00 0.44 .+-. 0.02 4.2 .+-. 0.1 .sup.
1035 .+-. 12.sup. 450 .+-. 20 36.5 .+-. 0.1 PEG(5k)-2-7-SC2.sup.2
i.v. 2.57 .+-. 0.87 6.74 .+-. 5.19 8.21 .+-. 6.23 338 .+-. 80 10.5
.+-. 2.6 84.1 .+-. 33.7 104 .+-. 6 PEG(20k)2-7-SC2.sup.3 i.v. 4.38
.+-. 1.76 27.2 .+-. 49.0 19.9 .+-. 34.1 347 .+-. 138 12.6 .+-. 5.0
250 .+-. 346 54.9 .+-. 1.4 PEG(40k)2-7-SC2 i.v. 21.62 .+-. 2.64
28.3 .+-. 4.1 40.6 .+-. 5.8 3463 .+-. 387 1.26 .+-. 0.14 51.3 .+-.
3.2 111 .+-. 5 2-7-SC-5 i.v. 0.23 = 0.01 1.34 .+-. 0.13 1.51 .+-.
0.16 19.1 .+-. 1.0 203 .+-. 10 308 .+-. 18 57.8 .+-. 0.9 PEG(20k)
2-7-SC-5.sup.2 i.v. 3.57 .+-. 0.97 7.00 .+-. 2.64 9.79 .+-. 3.66
449.5 .+-. 115.1 8.91 .+-. 1.46 81.0 .+-. 10.3 88.2 .+-. 10.8
PEG(40k)-2-7-SC5 i.v. 20.7 .+-. 3.8 30.7 .+-. 14.0 41.2 .+-. 15.3
2624 .+-. 466 1.36 .+-. 0.24 56.0 .+-. 13.5 88.0 .+-. 3.6 2-7-SC2
s.c. .sup. 1.4 .+-. 30.2.sup.3 22.4 .+-. 5.0 178 .+-. 39 4.11 .+-.
0.44 PEG(20k)2-7-SC2 s.c. 26.0 .+-. 3.0 1925 .+-. 115 2.08 .+-.
0.12 39.0 .+-. 1.8 .sup.1Pharmacokinetic parameters for intravenous
("i.v.") were determined by using a two compartment, i.v. bolus, no
lag time, 1st order elimination model. Pharmacokinetic parameters
for sc were determined by using a one compartment, 1st order input,
1st order elimination model. .sup.2The data are an average of two
analyses of computer modeling and the highest standard deviation
was taken. .sup.3High numbers of standard deviation.
[0413] These results demonstrate that the circulating lives of
PEGylated SCA proteins can designed to cover the range of
therapeutically useful pharmacokinetics. The two-log extension of
serum half-life in the 40 kDa PEG conjugated SCA places these
compounds in the pharmacokinetic range of intact monoclonal
antibodies. The site-specific attachment of the PEG polymer at a
unique site distant from the antigen-binding site allows the
manufacture of not only active antigen-binding proteins, but also
production of a product that is relatively homogeneous in its
composition, in contrast to the substantial heterogeneity of SCA
proteins PEGylated using random amine chemistries. The large
difference in circulating lives of the 40 kDa PEGylated SCA
proteins of this study when compared to the 20 kDa PEGylated SCA
proteins was somewhat surprising. We did not predict this based on
our results of randomly PEGylated (CC49) SCA proteins, where there
was evidence of a pharmacokinetic plateau at about 20 kDa PEG,
since the 12 kDa PEG displayed comparable circulating lives.
[0414] While not being bound by any theory or hypothesis as to how
the invention may operate, it is believed that it is the branched
chain structure that also contributes to vastly prolonged
circulating lives of the 40 kDa PEG-SCA compounds. Of special
interest is the success in using the PEG-SCA (20 kDa PEG) in
subcutaneous injections. This route of administration provided
markedly better AUC values than intravenous administration. The
subcutaneous route may ultimately be preferred for the formulation
of PEG-SCA therapeutics. The linker attachment of PEG to the SCA
proved successful and compared well in animal studies with the
C-terminal PEG attachment. Possibly, the linker attachment of PEG
could also contribute to promotion of SCA stability and diminished
antigenicity and/or proteolysis.
Example 10
Dimeric D2E7 PEG-SCA Proteins via bis-Maleimide-PEG
[0415] In order to generate bivalent PEG-SCA compounds having two
SCA proteins per one polymer, bis-maleimide-PEG polymers were
employed. These have the activated maleimide group at both termini
of the polymer. SDS PAGE analysis demonstrated that the SCA-PEG-SCA
compounds could be synthesized using the methods of this
disclosure. The effects of reaction pH and the reaction molar ratio
are shown in Table 12 and Table 13, respectively.
[0416] Effect of Reaction Molar Ratio on Formation of Bis- and
Mono-D2E7 SCA-
24 TABLE 12 bis-mal-PEG:D2E7-2-7-SC-2 0.165:1 0.335:1 1:1 bis-D2E7
SCA-PEG conjugate (%) 20.7 21.5 17.6 mono-D2E7 SCA-PEG conjugate
(%) 9.4 21.3 26.0 bis- and mono-D2E7-SCA-PEG conjugates (%) 30.1
42.8 43.6
[0417] The data were obtained by gel image analysis on 4-20%
SDS-PAGE gel. Bis-mal-PEG (20 k) was dissolved in 100 mM sodium
phosphate, pH 6 to a concentration of 3.7 mg/ml. It was then slowly
added to 1 mg/ml D2E7 2-7-SC-2 in 100 mM sodium phosphate, pH 6 and
1 mM EDTA at 1/30 to 1/10 volume of D2E7 2-7-SC-2 and the reaction
molar ratio indicated. The reaction was conducted at 25 .degree. C.
under Nitrogen for 1.5 hrs.
[0418] Effect of Reaction pH on Formation of Bis- and Mono-D2E7
SCA-PEG (20 k)
25 TABLE 13 pH 5.0 5.5 6.0 6.5 7.0 7.5 bis-D2E7 17.6 19.0 28.2 34.0
37.7 38.4 2-7-SC- 2-PEG (%) mono-D2E7 21.4 23.9 13.7 18.2 14.5 16.4
2-7-SC- 2-PEG (%) bis- and 39.0 42.9 41.9 52.1 52.1 54.9 mon-D2E7
2-7-SC- 2-PEG (%)
[0419] The reaction contained 1 mg/ml D2E7 2-7-SC-2 and 0.12 mg/ml
bis-mal-PEG compound at a reaction molar ratio of 0.165:1
(bis-mal-PEG:2-7-SC-2) in 100 mM sodium phosphate, at the pH
indicated. The reaction was conducted at 25 .degree. C., under
Nitrogen for 2 hrs. The samples were analyzed on 4-20% SDS-PAGE gel
and the corresponding band of each compound were quantitated. High
molecular weight impurities were less than 1% and the dimer of
2-7-SC-2 was less than 5%.
Example 11
Confirmation of Anti-TNF Alpha Activity in Mice
[0420] This example confirms the efficacy of PEGylated anti-tumor
necrosis factor-alpha single chain antibody (Peg-anti-TNF-.alpha.
SCA), native anti-TNF-.alpha. SCA, and Humira.RTM. (intact D2E7)
anti-TNF-.alpha. antibody in neutralizing the inflammation cascade
(prophylaxis) prompted by TNF-.alpha. in a standard animal model
based on TNF-.alpha. challenge, as described by Galanos et al.
1979, Proc. Nat'l Acad Sci (USA) 76:5939-5943, incorporated by
reference herein.
[0421] In brief, endotoxemia was induced in C57/BL6 mice by
injecting TNF-.alpha. into D-galactosamine (NGal) sensitized mice
via the intraperitoneal route (i.p.). In brief, C57/BL6 mice were
injected i.p. with different doses of native SCA, PEG-SCA, and
Humira.RTM., 30 minutes prior to challenging the mice with a
combination of recombinant human TNF-.alpha. (1.0 .mu.g/animal) and
N-galactosamine (20 mg/animal). Surviving mice were euthanized
after 24 h.
[0422] Injection of NGal and TNF together caused lethality in
nearly all animals within 24 hrs. Thirty minutes before
intraperitoneal ("IP") administration of 1 microgram of TNF and 20
mg of NGal, various doses of D2E7 MAb (Humira.RTM.)
TNF-neutralizing MAb or the 20 or 40 kDa PEG-SCA compounds were
administered. The mice treated with both the E2E7 MAb and PEG-SCA
compounds exhibited comparably high survival rates at comparable
doses.
[0423] Materials and Methods
[0424] Test animals were female C57B1/6 (Sprague Dawley Harlan)
mice aged 7-8 weeks, weighing approximately 25 g at initiation. The
mice were maintained with tap water and commercially available lab
chow ad libitum. The agents tested for protective properties
against challenge by TNF-.alpha. were 2-7-SC-5 native SCA;
2-7-SC-5-20K-PEG-SCA; 2-7-SC-5-43K-PEG-SCA, prepared as described
above, and intact d2E7 MAb (Humira.RTM. from Abbott Immunology,
Abbott Park, Ill.). Control was phosphate buffer solution ("PBS").
The agents were administered via a single intraperitoneal ("IP")
injection.
[0425] One hundred twenty-six (126) mice were assigned according to
the following protocol:
26TABLE 14 Part 1 Dose (.mu.g/ mouse in 100 Group Treatment
Stimulant N .mu.l PBS) 1 PBS TNF-.alpha. 7 --* 2 PBS TNF-.alpha.
and D-galactosamine 7 --* 3 SCA-1.7 TNF-.alpha. and D-galactosamine
7 1.7 4 SCA-0.85 TNF-.alpha. and D-galactosamine 7 0.85 5 SCA-0.42
TNF-.alpha. and D-galactosamine 7 0.42 6 SCA-0.21 TNF-.alpha. and
D-galactosamine 7 0.21 7 Humira-5 TNF-.alpha. and D-galactosamine 7
5 8 Humira-2.5 TNF-.alpha. and D-galactosamine 7 2.5 9 Humira-1.25
TNF-.alpha. and D-galactosamine 7 1.25 10 Humira-0.625 TNF-.alpha.
and D-galactosamine 7 0.625 *Mice receiving PBS treatment will be
dosed at a volume of 100 .mu.l, ip.
[0426]
27TABLE 14 Part 2 Dose (.mu.g/mouse Group Treatment Stimulant N in
100 .mu.l PBS) 11 20k Peg-SCA-1.7 TNF-.alpha. and D-galactosamine 7
1.7 12 20k Peg-SCA-0.85 TNF-.alpha. and D-galactosamine 7 0.85 13
20k Peg-SCA-0.42 TNF-.alpha. and D-galactosamine 7 0.42 14 20k
Peg-SCA-0.21 TNF-.alpha. and D-galactosamine 7 0.21 15 43k
Peg-SCA-1.7 TNF-.alpha. and D-galactosamine 7 1.7 16 43k
Peg-SCA-0.85 TNF-.alpha. and D-galactosamine 7 0.85 17 43k
Peg-SCA-0.42 TNF-.alpha. and D-galactosamine 7 0.42 18 43k
Peg-SCA-0.21 TNF-.alpha. and D-galactosamine 7 0.21
[0427] Following at least one week of acclimation, mice were
injected i.p. with the specific treatment indicated above. Thirty
minutes following this injection (t=0), mice were challenged i.p.
with stimulants as indicated. (Mice received 1.0 .mu.g/mouse of
recombinant TNF-.alpha. in 50 .mu.l PBS and/or 20 mg/mouse
D-galactosamine in 200 .mu.PBS.)
[0428] The above experiment was then repeated, using the same
procedures, but with higher doses of the test compounds: 0.125
.mu.g 0.625 .mu.g 2.5 .mu.g and 10.0 .mu.g per mouse for each of
2-7-SC-5-20K-PEG-SCA and 2-7-SC-5-40K-PEG-SCA, respectively.
Non-conjugated 2-7-SC-5 SCA was tested at 20 .mu.g and intact D2E5
(Humira) was tested at 0.625 .mu.g/mouse.
[0429] Results
[0430] The % survival data was plotted against dose of compound
(data not shown). The dose of compound offering at least 70%
protection to TNF-.alpha. challenged mice was considered to be the
baseline for efficacy comparison. Identical doses (0.625
.mu.g/animal) of Humira.RTM. and PEG-SCAs, both 20 k- and 40
kDa-PEG-SCAs) protected mice from TNF-induced lethality. However, a
higher dose of native, non-conjugated SCA (20 .mu.g/animal or about
800 .mu.g/kg) was required to achieve a similar level of protection
in these mice. On molar basis, the derived data demonstrated that
approximately 3-fold excess of 20- or 40 kDa-PEG-SCA was necessary
to achieve survival equivalence similar to the full length
antibody. On the other hand, 100-fold molar excess of native SCA
was required to attain similar protection against TNF-induced
lethality. These data suggest that modification of D2E7 SCA by PEG
offers distinct advantages over the native protein by increasing
the circulating half life of the protein in plasma.
[0431] Since the test animals averaged about 25 grams, 0.625
.mu.g/animal corresponds to a dose of about 25 .mu.g/kg and 10
.mu.g/animal corresponds to about 400 .mu.g/kg.
Sequence CWU 1
1
45 1 756 DNA Artificial Sequence CDS (1)..(756) Description of
Artificial Sequence Synthetic 2-7-SC-1 nucleotide sequence 1 gac
atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta ggg 48 Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10
15 gac aga gtc acc atc act tgt cgg gca agt cag ggc atc aga aat tac
96 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Tyr
20 25 30 tta gcc tgg tat cag caa aaa cca ggg aaa gcc cct aag ctc
ctg atc 144 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45 tat gct gca tcc act ttg caa tca ggg gtc cca tct
cgg ttc agt ggc 192 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 agt gga tct ggg aca gat ttc act ctc acc
atc agc agc cta cag cct 240 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Ser Ser Leu Gln Pro 65 70 75 80 gaa gat gtt gca act tat tac tgt
caa agg tat aac cgt gca ccg tat 288 Glu Asp Val Ala Thr Tyr Tyr Cys
Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90 95 act ttt ggc cag ggg acc
aag gtg gaa atc aaa ggc tct act agt ggt 336 Thr Phe Gly Gln Gly Thr
Lys Val Glu Ile Lys Gly Ser Thr Ser Gly 100 105 110 agc ggc aaa ccc
ggg agt ggt gaa ggt agc act aaa ggt gag gtg cag 384 Ser Gly Lys Pro
Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu Val Gln 115 120 125 ctg gtg
gag tct ggg gga ggc ttg gta cag ccc ggc agg tcc ctg aga 432 Leu Val
Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg Ser Leu Arg 130 135 140
ctc tcc tgt gcg gcc tct gga ttc acc ttt gat gat tat gcc atg cac 480
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Met His 145
150 155 160 tgg gtc cgg caa gct cca ggg aag ggc ctg gaa tgg gtc tca
gct atc 528 Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser
Ala Ile 165 170 175 act tgg aat agt ggt cac ata gac tat gcg gac tct
gtg gag ggc cga 576 Thr Trp Asn Ser Gly His Ile Asp Tyr Ala Asp Ser
Val Glu Gly Arg 180 185 190 ttc acc atc tcc aga gac aac gcc aag aac
tcc ctg tat ctg caa atg 624 Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
Ser Leu Tyr Leu Gln Met 195 200 205 aac agt ctg aga gct gag gat acg
gcc gta tat tac tgt gcg aaa gtc 672 Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala Lys Val 210 215 220 tcg tac ctt agc acc gcg
tcc tcc ctt gac tat tgg ggc caa ggt acc 720 Ser Tyr Leu Ser Thr Ala
Ser Ser Leu Asp Tyr Trp Gly Gln Gly Thr 225 230 235 240 ctg gtc acc
gtc tcg tct cac cac cat cac cat cac 756 Leu Val Thr Val Ser Ser His
His His His His His 245 250 2 759 DNA Artificial Sequence CDS
(1)..(759) Description of Artificial Sequence Synthetic 2-7-SC-2
nucleotide sequence 2 gac atc cag atg acc cag tct cca tcc tcc ctg
tct gca tct gta ggg 48 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly 1 5 10 15 gac aga gtc acc atc act tgt cgg gca
agt cag ggc atc aga aat tac 96 Asp Arg Val Thr Ile Thr Cys Arg Ala
Ser Gln Gly Ile Arg Asn Tyr 20 25 30 tta gcc tgg tat cag caa aaa
cca ggg aaa gcc cct aag ctc ctg atc 144 Leu Ala Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 tat gct gca tcc act
ttg caa tca ggg gtc cca tct cgg ttc agt ggc 192 Tyr Ala Ala Ser Thr
Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 agt gga tct
ggg aca gat ttc act ctc acc atc agc agc cta cag cct 240 Ser Gly Ser
Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 gaa
gat gtt gca act tat tac tgt caa agg tat aac cgt gca ccg tat 288 Glu
Asp Val Ala Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90
95 act ttt ggc cag ggg acc aag gtg gaa atc aaa ggc tct act agt ggt
336 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Ser Thr Ser Gly
100 105 110 agc ggc aaa ccc ggg agt ggt gaa ggt agc act aaa ggt gag
gtg cag 384 Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu
Val Gln 115 120 125 ctg gtg gag tct ggg gga ggc ttg gta cag ccc ggc
agg tcc ctg aga 432 Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly
Arg Ser Leu Arg 130 135 140 ctc tcc tgt gcg gcc tct gga ttc acc ttt
gat gat tat gcc atg cac 480 Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe
Asp Asp Tyr Ala Met His 145 150 155 160 tgg gtc cgg caa gct cca ggg
aag ggc ctg gaa tgg gtc tca gct atc 528 Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val Ser Ala Ile 165 170 175 act tgg aat agt ggt
cac ata gac tat gcg gac tct gtg gag ggc cga 576 Thr Trp Asn Ser Gly
His Ile Asp Tyr Ala Asp Ser Val Glu Gly Arg 180 185 190 ttc acc atc
tcc aga gac aac gcc aag aac tcc ctg tat ctg caa atg 624 Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met 195 200 205 aac
agt ctg aga gct gag gat acg gcc gta tat tac tgt gcg aaa gtc 672 Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Val 210 215
220 tcg tac ctt agc acc gcg tcc tcc ctt gac tat tgg ggc caa ggt acc
720 Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly Gln Gly Thr
225 230 235 240 ctg gtc acc gtc tcg tct cac cac cat cac cat cac tgc
759 Leu Val Thr Val Ser Ser His His His His His His Cys 245 250 3
750 DNA Artificial Sequence CDS (1)..(750) Description of
Artificial Sequence Synthetic 2-7-SC-3 nucleotide sequence 3 gaa
gtg cag ctg gtt gaa agc ggt ggc ggt ctg gtg cag ccg ggt cgt 48 Glu
Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10
15 agc ctg cgt ctg tct tgt gca gcg agc ggc ttc acg ttt gat gac tat
96 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30 gca atg cac tgg gtt cgt cag gcg ccg ggc aaa ggt ctg gaa
tgg gtc 144 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45 agc gcg atc acc tgg aac agc ggt cac att gac tat
gca gat tct gtt 192 Ser Ala Ile Thr Trp Asn Ser Gly His Ile Asp Tyr
Ala Asp Ser Val 50 55 60 gaa ggt cgt ttc acc atc agc cgt gac aat
gct aag aac agc ctg tac 240 Glu Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ala Lys Asn Ser Leu Tyr 65 70 75 80 ctg caa atg aac agc ctg cgt gca
gaa gac acc gct gtg tac tat tgc 288 Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 gcg aaa gtc agc tat ctg
agc acg gct agc tct ctg gac tac tgg ggt 336 Ala Lys Val Ser Tyr Leu
Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly 100 105 110 cag ggc acg ctg
gtt acc gtt agc tct ggt ggc ggt ggc agc ggt ggc 384 Gln Gly Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 ggt ggc
tct ggt ggc ggt ggc agc gac atc cag atg acc cag tct cca 432 Gly Gly
Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro 130 135 140
tcc tcc ctg tct gca tct gta ggg gac aga gtc acc atc act tgt cgg 480
Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg 145
150 155 160 gca agt cag ggc atc aga aat tac tta gcc tgg tat cag caa
aaa cca 528 Ala Ser Gln Gly Ile Arg Asn Tyr Leu Ala Trp Tyr Gln Gln
Lys Pro 165 170 175 ggg aaa gcc cct aag ctc ctg atc tat gct gca tcc
act ttg caa tca 576 Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser
Thr Leu Gln Ser 180 185 190 ggg gtc cca tct cgg ttc agt ggc agt gga
tct ggg aca gat ttc act 624 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr 195 200 205 ctc acc atc agc agc cta cag cct
gaa gat gtt gca act tat tac tgt 672 Leu Thr Ile Ser Ser Leu Gln Pro
Glu Asp Val Ala Thr Tyr Tyr Cys 210 215 220 caa agg tat aac cgt gca
ccg tat act ttt ggc cag ggg acc aag gtg 720 Gln Arg Tyr Asn Arg Ala
Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val 225 230 235 240 gaa atc aaa
cac cac cat cac cat cac tgc 750 Glu Ile Lys His His His His His His
Cys 245 250 4 741 DNA Artificial Sequence CDS (1)..(741)
Description of Artificial Sequence Synthetic 2-7-SC-4 nucleotide
sequence 4 gac atc cag atg acc cag tct cca tcc tcc ctg tct gca tct
gta ggg 48 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly 1 5 10 15 gac aga gtc acc atc act tgt cgg gca agt cag ggc
atc aga aat tac 96 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly
Ile Arg Asn Tyr 20 25 30 tta gcc tgg tat cag caa aaa cca ggg aaa
gcc cct aag ctc ctg atc 144 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys
Ala Pro Lys Leu Leu Ile 35 40 45 tat gct gca tcc act ttg caa tca
ggg gtc cca tct cgg ttc agt ggc 192 Tyr Ala Ala Ser Thr Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 agt gga tct ggg aca gat
ttc act ctc acc atc agc agc cta cag cct 240 Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 gaa gat gtt gca
act tat tac tgt caa agg tat aac cgt gca ccg tat 288 Glu Asp Val Ala
Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90 95 act ttt
ggc cag ggg acc aag gtg gaa atc aaa ggc tct act agt ggt 336 Thr Phe
Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Ser Thr Ser Gly 100 105 110
agc ggc aaa ccc ggg agt ggt gaa ggt agc act aaa ggt gag gtg cag 384
Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu Val Gln 115
120 125 ctg gtg gag tct ggg gga ggc ttg gta cag ccc ggc agg tcc ctg
aga 432 Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg Ser Leu
Arg 130 135 140 ctc tcc tgt gcg gcc tct gga ttc acc ttt gat gat tat
gcc atg cac 480 Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
Ala Met His 145 150 155 160 tgg gtc cgg caa gct cca ggg aag ggc ctg
gaa tgg gtc tca gct atc 528 Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val Ser Ala Ile 165 170 175 act tgg aat agt ggt cac ata gac
tat gcg gac tct gtg gag ggc cga 576 Thr Trp Asn Ser Gly His Ile Asp
Tyr Ala Asp Ser Val Glu Gly Arg 180 185 190 ttc acc atc tcc aga gac
aac gcc aag aac tcc ctg tat ctg caa atg 624 Phe Thr Ile Ser Arg Asp
Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met 195 200 205 aac agt ctg aga
gct gag gat acg gcc gta tat tac tgt gcg aaa gtc 672 Asn Ser Leu Arg
Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Val 210 215 220 tcg tac
ctt agc acc gcg tcc tcc ctt gac tat tgg ggc caa ggt acc 720 Ser Tyr
Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly Gln Gly Thr 225 230 235
240 ctg gtc acc gtc tcg tct tgc 741 Leu Val Thr Val Ser Ser Cys 245
5 756 DNA Artificial Sequence CDS (1)..(756) Description of
Artificial Sequence Synthetic 2-7-SC-5 nucleotide sequence 5 gac
atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta ggg 48 Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10
15 gac aga gtc acc atc act tgt cgg gca agt cag ggc atc aga aat tac
96 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Tyr
20 25 30 tta gcc tgg tat cag caa aaa cca ggg aaa gcc cct aag ctc
ctg atc 144 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45 tat gct gca tcc act ttg caa tca ggg gtc cca tct
cgg ttc agt ggc 192 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 agt gga tct ggg aca gat ttc act ctc acc
atc agc agc cta cag cct 240 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Ser Ser Leu Gln Pro 65 70 75 80 gaa gat gtt gca act tat tac tgt
caa agg tat aac cgt gca ccg tat 288 Glu Asp Val Ala Thr Tyr Tyr Cys
Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90 95 act ttt ggc cag ggg acc
aag gtg gaa atc aaa ggc tgt act agt ggt 336 Thr Phe Gly Gln Gly Thr
Lys Val Glu Ile Lys Gly Cys Thr Ser Gly 100 105 110 agc ggc aaa ccc
ggg agt ggt gaa ggt agc act aaa ggt gag gtg cag 384 Ser Gly Lys Pro
Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu Val Gln 115 120 125 ctg gtg
gag tct ggg gga ggc ttg gta cag ccc ggc agg tcc ctg aga 432 Leu Val
Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg Ser Leu Arg 130 135 140
ctc tcc tgt gcg gcc tct gga ttc acc ttt gat gat tat gcc atg cac 480
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Met His 145
150 155 160 tgg gtc cgg caa gct cca ggg aag ggc ctg gaa tgg gtc tca
gct atc 528 Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser
Ala Ile 165 170 175 act tgg aat agt ggt cac ata gac tat gcg gac tct
gtg gag ggc cga 576 Thr Trp Asn Ser Gly His Ile Asp Tyr Ala Asp Ser
Val Glu Gly Arg 180 185 190 ttc acc atc tcc aga gac aac gcc aag aac
tcc ctg tat ctg caa atg 624 Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn
Ser Leu Tyr Leu Gln Met 195 200 205 aac agt ctg aga gct gag gat acg
gcc gta tat tac tgt gcg aaa gtc 672 Asn Ser Leu Arg Ala Glu Asp Thr
Ala Val Tyr Tyr Cys Ala Lys Val 210 215 220 tcg tac ctt agc acc gcg
tcc tcc ctt gac tat tgg ggc caa ggt acc 720 Ser Tyr Leu Ser Thr Ala
Ser Ser Leu Asp Tyr Trp Gly Gln Gly Thr 225 230 235 240 ctg gtc acc
gtc tcg tct cac cac cat cac cat cac 756 Leu Val Thr Val Ser Ser His
His His His His His 245 250 6 750 DNA Artificial Sequence CDS
(1)..(750) Description of Artificial Sequence Synthetic 2-7-SC-6
nucleotide sequence 6 gaa gtg cag ctg gtt gaa agc ggt ggc ggt ctg
gtg cag ccg ggt cgt 48 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Arg 1 5 10 15 agc ctg cgt ctg tct tgt gca gcg agc
ggc ttc acg ttt gat gac tat 96 Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Asp Asp Tyr 20 25 30 gca atg cac tgg gtt cgt cag
gcg ccg ggc aaa ggt ctg gaa tgg gtc 144 Ala Met His Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 agc gcg atc acc tgg
aac agc ggt cac att gac tat gca gat tct gtt 192 Ser Ala Ile Thr Trp
Asn Ser Gly His Ile Asp Tyr Ala Asp Ser Val 50 55 60 gaa ggt cgt
ttc acc atc agc cgt gac aat gct aag aac agc ctg tac 240 Glu Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 ctg
caa atg aac agc ctg cgt gca gaa gac acc gct gtg tac tat tgc 288 Leu
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90
95 gcg aaa gtc agc tat ctg agc acg gct agc tct ctg gac tac tgg ggt
336 Ala Lys Val Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly
100 105 110 cag ggc acg ctg gtt acc gtt agc tct ggt ggc ggt ggc tgc
ggt ggc 384 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Cys
Gly Gly 115 120 125 ggt ggc tct ggt ggc ggt ggc agc gac atc cag atg
acc cag tct cca 432 Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met
Thr Gln Ser Pro 130 135 140 tcc tcc ctg tct gca tct gta ggg gac aga
gtc acc atc act tgt cgg 480 Ser Ser Leu Ser Ala Ser Val Gly Asp Arg
Val Thr Ile Thr Cys Arg 145 150 155 160 gca agt cag ggc atc aga aat
tac tta gcc tgg tat cag caa aaa cca 528 Ala Ser Gln Gly Ile Arg Asn
Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 165 170 175 ggg aaa gcc cct aag
ctc ctg atc tat gct gca tcc act ttg caa tca 576 Gly Lys Ala Pro Lys
Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln Ser 180 185 190 ggg gtc cca
tct cgg ttc agt
ggc agt gga tct ggg aca gat ttc act 624 Gly Val Pro Ser Arg Phe Ser
Gly Ser Gly Ser Gly Thr Asp Phe Thr 195 200 205 ctc acc atc agc agc
cta cag cct gaa gat gtt gca act tat tac tgt 672 Leu Thr Ile Ser Ser
Leu Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys 210 215 220 caa agg tat
aac cgt gca ccg tat act ttt ggc cag ggg acc aag gtg 720 Gln Arg Tyr
Asn Arg Ala Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val 225 230 235 240
gaa atc aaa cac cac cat cac cat cac tgc 750 Glu Ile Lys His His His
His His His Cys 245 250 7 747 DNA Artificial Sequence CDS
(1)..(747) Description of Artificial Sequence Synthetic 2-7-SC-7
nucleotide sequence 7 gaa gtg cag ctg gtt gaa agc ggt ggc ggt ctg
gtg cag ccg ggt cgt 48 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Arg 1 5 10 15 agc ctg cgt ctg tct tgt gca gcg agc
ggc ttc acg ttt gat gac tat 96 Ser Leu Arg Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Asp Asp Tyr 20 25 30 gca atg cac tgg gtt cgt cag
gcg ccg ggc aaa ggt ctg gaa tgg gtc 144 Ala Met His Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 agc gcg atc acc tgg
aac agc ggt cac att gac tat gca gat tct gtt 192 Ser Ala Ile Thr Trp
Asn Ser Gly His Ile Asp Tyr Ala Asp Ser Val 50 55 60 gaa ggt cgt
ttc acc atc agc cgt gac aat gct aag aac agc ctg tac 240 Glu Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 ctg
caa atg aac agc ctg cgt gca gaa gac acc gct gtg tac tat tgc 288 Leu
Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90
95 gcg aaa gtc agc tat ctg agc acg gct agc tct ctg gac tac tgg ggt
336 Ala Lys Val Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly
100 105 110 cag ggc acg ctg gtt acc gtt agc tct ggt ggc ggt ggc tgc
ggt ggc 384 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Cys
Gly Gly 115 120 125 ggt ggc tct ggt ggc ggt ggc agc gac atc cag atg
acc cag tct cca 432 Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met
Thr Gln Ser Pro 130 135 140 tcc tcc ctg tct gca tct gta ggg gac aga
gtc acc atc act tgt cgg 480 Ser Ser Leu Ser Ala Ser Val Gly Asp Arg
Val Thr Ile Thr Cys Arg 145 150 155 160 gca agt cag ggc atc aga aat
tac tta gcc tgg tat cag caa aaa cca 528 Ala Ser Gln Gly Ile Arg Asn
Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 165 170 175 ggg aaa gcc cct aag
ctc ctg atc tat gct gca tcc act ttg caa tca 576 Gly Lys Ala Pro Lys
Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln Ser 180 185 190 ggg gtc cca
tct cgg ttc agt ggc agt gga tct ggg aca gat ttc act 624 Gly Val Pro
Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 195 200 205 ctc
acc atc agc agc cta cag cct gaa gat gtt gca act tat tac tgt 672 Leu
Thr Ile Ser Ser Leu Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys 210 215
220 caa agg tat aac cgt gca ccg tat act ttt ggc cag ggg acc aag gtg
720 Gln Arg Tyr Asn Arg Ala Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val
225 230 235 240 gaa atc aaa cac cac cat cac cat cac 747 Glu Ile Lys
His His His His His His 245 8 762 DNA Artificial Sequence CDS
(1)..(762) Description of Artificial Sequence Synthetic 2-7-SC-8
nucleotide sequence 8 tgc gac atc cag atg acc cag tct cca tcc tcc
ctg tct gca tct gta 48 Cys Asp Ile Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val 1 5 10 15 ggg gac aga gtc acc atc act tgt cgg
gca agt cag ggc atc aga aat 96 Gly Asp Arg Val Thr Ile Thr Cys Arg
Ala Ser Gln Gly Ile Arg Asn 20 25 30 tac tta gcc tgg tat cag caa
aaa cca ggg aaa gcc cct aag ctc ctg 144 Tyr Leu Ala Trp Tyr Gln Gln
Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 atc tat gct gca tcc
act ttg caa tca ggg gtc cca tct cgg ttc agt 192 Ile Tyr Ala Ala Ser
Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 ggc agt gga
tct ggg aca gat ttc act ctc acc atc agc agc cta cag 240 Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln 65 70 75 80 cct
gaa gat gtt gca act tat tac tgt caa agg tat aac cgt gca ccg 288 Pro
Glu Asp Val Ala Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg Ala Pro 85 90
95 tat act ttt ggc cag ggg acc aag gtg gaa atc aaa ggc tct act agt
336 Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Ser Thr Ser
100 105 110 ggt agc ggc aaa ccc ggg agt ggt gaa ggt agc act aaa ggt
gag gtg 384 Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly
Glu Val 115 120 125 cag ctg gtg gag tct ggg gga ggc ttg gta cag ccc
ggc agg tcc ctg 432 Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro
Gly Arg Ser Leu 130 135 140 aga ctc tcc tgt gcg gcc tct gga ttc acc
ttt gat gat tat gcc atg 480 Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
Phe Asp Asp Tyr Ala Met 145 150 155 160 cac tgg gtc cgg caa gct cca
ggg aag ggc ctg gaa tgg gtc tca gct 528 His Trp Val Arg Gln Ala Pro
Gly Lys Gly Leu Glu Trp Val Ser Ala 165 170 175 atc act tgg aat agt
ggt cac ata gac tat gcg gac tct gtg gag ggc 576 Ile Thr Trp Asn Ser
Gly His Ile Asp Tyr Ala Asp Ser Val Glu Gly 180 185 190 cga ttc acc
atc tcc aga gac aac gcc aag aac tcc ctg tat ctg caa 624 Arg Phe Thr
Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln 195 200 205 atg
aac agt ctg aga gct gag gat acg gcc gta tat tac tgt gcg aaa 672 Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys 210 215
220 gtc tcg tac ctt agc acc gcg tcc tcc ctt gac tat tgg ggc caa ggt
720 Val Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly Gln Gly
225 230 235 240 acc ctg gtc acc gtc tcg tct cac cac cat cac cat cac
tgc 762 Thr Leu Val Thr Val Ser Ser His His His His His His Cys 245
250 9 717 DNA Artificial Sequence CDS (1)..(717) Description of
Artificial Sequence Synthetic 2-7-SC-9 nucleotide sequence 9 gac
atc cag atg acc cag tct cca tcc tcc ctg tct gca tct gta ggg 48 Asp
Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10
15 gac aga gtc acc atc act tgt cgg gca agt cag ggc atc aga aat tac
96 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Tyr
20 25 30 tta gcc tgg tat cag caa aaa cca ggg aaa gcc cct aag ctc
ctg atc 144 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu
Leu Ile 35 40 45 tat gct gca tcc act ttg caa tca ggg gtc cca tct
cgg ttc agt ggc 192 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser
Arg Phe Ser Gly 50 55 60 agt gga tct ggg aca gat ttc act ctc acc
atc agc agc cta cag cct 240 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
Ile Ser Ser Leu Gln Pro 65 70 75 80 gaa gat gtt gca act tat tac tgt
caa agg tat aac cgt gca ccg tat 288 Glu Asp Val Ala Thr Tyr Tyr Cys
Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90 95 act ttt ggc cag ggg acc
aag gtg gaa atc aaa ggt ggc ggt ggc tct 336 Thr Phe Gly Gln Gly Thr
Lys Val Glu Ile Lys Gly Gly Gly Gly Ser 100 105 110 gag gtg cag ctg
gtg gag tct ggg gga ggc ttg gta cag ccc ggc agg 384 Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 115 120 125 tcc ctg
aga ctc tcc tgt gcg gcc tct gga ttc acc ttt gat gat tat 432 Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 130 135 140
gcc atg cac tgg gtc cgg caa gct cca ggg aag ggc ctg gaa tgg gtc 480
Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 145
150 155 160 tca gct atc act tgg aat agt ggt cac ata gac tat gcg gac
tct gtg 528 Ser Ala Ile Thr Trp Asn Ser Gly His Ile Asp Tyr Ala Asp
Ser Val 165 170 175 gag ggc cga ttc acc atc tcc aga gac aac gcc aag
aac tcc ctg tat 576 Glu Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser Leu Tyr 180 185 190 ctg caa atg aac agt ctg aga gct gag gat
acg gcc gta tat tac tgt 624 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 195 200 205 gcg aaa gtc tcg tac ctt agc acc
gcg tcc tcc ctt gac tat tgg ggc 672 Ala Lys Val Ser Tyr Leu Ser Thr
Ala Ser Ser Leu Asp Tyr Trp Gly 210 215 220 caa ggt acc ctg gtc acc
gtc tcg tct cac cac cat cac cat cac 717 Gln Gly Thr Leu Val Thr Val
Ser Ser His His His His His His 225 230 235 10 252 PRT Artificial
Sequence Description of Artificial Sequence Synthetic 2-7-SC-1
protein sequence 10 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser
Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser
Gln Gly Ile Arg Asn Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro
Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu
Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly
Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp
Val Ala Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Ser Thr Ser Gly 100
105 110 Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu Val
Gln 115 120 125 Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg
Ser Leu Arg 130 135 140 Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp
Asp Tyr Ala Met His 145 150 155 160 Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu Glu Trp Val Ser Ala Ile 165 170 175 Thr Trp Asn Ser Gly His
Ile Asp Tyr Ala Asp Ser Val Glu Gly Arg 180 185 190 Phe Thr Ile Ser
Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met 195 200 205 Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Val 210 215 220
Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly Gln Gly Thr 225
230 235 240 Leu Val Thr Val Ser Ser His His His His His His 245 250
11 253 PRT Artificial Sequence Description of Artificial Sequence
Synthetic 2-7-SC-2 protein sequence 11 Asp Ile Gln Met Thr Gln Ser
Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile
Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn Tyr 20 25 30 Leu Ala Trp
Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr
Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg Ala
Pro Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly
Ser Thr Ser Gly 100 105 110 Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser
Thr Lys Gly Glu Val Gln 115 120 125 Leu Val Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Arg Ser Leu Arg 130 135 140 Leu Ser Cys Ala Ala Ser
Gly Phe Thr Phe Asp Asp Tyr Ala Met His 145 150 155 160 Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile 165 170 175 Thr
Trp Asn Ser Gly His Ile Asp Tyr Ala Asp Ser Val Glu Gly Arg 180 185
190 Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met
195 200 205 Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala
Lys Val 210 215 220 Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp
Gly Gln Gly Thr 225 230 235 240 Leu Val Thr Val Ser Ser His His His
His His His Cys 245 250 12 250 PRT Artificial Sequence Description
of Artificial Sequence Synthetic 2-7-SC-3 protein sequence 12 Glu
Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10
15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45 Ser Ala Ile Thr Trp Asn Ser Gly His Ile Asp Tyr
Ala Asp Ser Val 50 55 60 Glu Gly Arg Phe Thr Ile Ser Arg Asp Asn
Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Val Ser Tyr Leu
Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly
Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro 130 135 140
Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg 145
150 155 160 Ala Ser Gln Gly Ile Arg Asn Tyr Leu Ala Trp Tyr Gln Gln
Lys Pro 165 170 175 Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser
Thr Leu Gln Ser 180 185 190 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly
Ser Gly Thr Asp Phe Thr 195 200 205 Leu Thr Ile Ser Ser Leu Gln Pro
Glu Asp Val Ala Thr Tyr Tyr Cys 210 215 220 Gln Arg Tyr Asn Arg Ala
Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val 225 230 235 240 Glu Ile Lys
His His His His His His Cys 245 250 13 247 PRT Artificial Sequence
Description of Artificial Sequence Synthetic 2-7-SC-4 protein
sequence 13 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly
Ile Arg Asn Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys
Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala
Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90 95 Thr Phe
Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Ser Thr Ser Gly 100 105 110
Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Glu Val Gln 115
120 125 Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg Ser Leu
Arg 130 135 140 Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr
Ala Met His 145 150 155 160 Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val Ser Ala Ile 165 170 175 Thr Trp Asn Ser Gly His Ile Asp
Tyr Ala Asp Ser Val Glu Gly Arg 180 185 190 Phe Thr Ile Ser Arg Asp
Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met 195 200 205 Asn Ser Leu Arg
Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Val 210 215 220 Ser Tyr
Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly Gln Gly Thr 225 230 235
240 Leu Val Thr Val Ser Ser Cys 245 14 252 PRT Artificial Sequence
Description of Artificial Sequence Synthetic 2-7-SC-5 protein
sequence 14 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly
Ile Arg Asn Tyr 20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35
40 45 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gln Arg Tyr
Asn Arg Ala Pro Tyr 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu
Ile Lys Gly Cys Thr Ser Gly 100 105 110 Ser Gly Lys Pro Gly Ser Gly
Glu Gly Ser Thr Lys Gly Glu Val Gln 115 120 125 Leu Val Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Arg Ser Leu Arg 130 135 140 Leu Ser Cys
Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Met His 145 150 155 160
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile 165
170 175 Thr Trp Asn Ser Gly His Ile Asp Tyr Ala Asp Ser Val Glu Gly
Arg 180 185 190 Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
Leu Gln Met 195 200 205 Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
Tyr Cys Ala Lys Val 210 215 220 Ser Tyr Leu Ser Thr Ala Ser Ser Leu
Asp Tyr Trp Gly Gln Gly Thr 225 230 235 240 Leu Val Thr Val Ser Ser
His His His His His His 245 250 15 250 PRT Artificial Sequence
Description of Artificial Sequence Synthetic 2-7-SC-6 protein
sequence 15 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro
Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly
Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Thr Trp Asn Ser Gly
His Ile Asp Tyr Ala Asp Ser Val 50 55 60 Glu Gly Arg Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn
Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys
Val Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly 100 105 110
Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Cys Gly Gly 115
120 125 Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser
Pro 130 135 140 Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile
Thr Cys Arg 145 150 155 160 Ala Ser Gln Gly Ile Arg Asn Tyr Leu Ala
Trp Tyr Gln Gln Lys Pro 165 170 175 Gly Lys Ala Pro Lys Leu Leu Ile
Tyr Ala Ala Ser Thr Leu Gln Ser 180 185 190 Gly Val Pro Ser Arg Phe
Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 195 200 205 Leu Thr Ile Ser
Ser Leu Gln Pro Glu Asp Val Ala Thr Tyr Tyr Cys 210 215 220 Gln Arg
Tyr Asn Arg Ala Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val 225 230 235
240 Glu Ile Lys His His His His His His Cys 245 250 16 249 PRT
Artificial Sequence Description of Artificial Sequence Synthetic
2-7-SC-7 protein sequence 16 Glu Val Gln Leu Val Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala
Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile
Thr Trp Asn Ser Gly His Ile Asp Tyr Ala Asp Ser Val 50 55 60 Glu
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70
75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr
Cys 85 90 95 Ala Lys Val Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp
Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly
Gly Gly Cys Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Asp
Ile Gln Met Thr Gln Ser Pro 130 135 140 Ser Ser Leu Ser Ala Ser Val
Gly Asp Arg Val Thr Ile Thr Cys Arg 145 150 155 160 Ala Ser Gln Gly
Ile Arg Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro 165 170 175 Gly Lys
Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Leu Gln Ser 180 185 190
Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 195
200 205 Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Val Ala Thr Tyr Tyr
Cys 210 215 220 Gln Arg Tyr Asn Arg Ala Pro Tyr Thr Phe Gly Gln Gly
Thr Lys Val 225 230 235 240 Glu Ile Lys His His His His His His 245
17 254 PRT Artificial Sequence Description of Artificial Sequence
Synthetic 2-7-SC-8 protein sequence 17 Cys Asp Ile Gln Met Thr Gln
Ser Pro Ser Ser Leu Ser Ala Ser Val 1 5 10 15 Gly Asp Arg Val Thr
Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Asn 20 25 30 Tyr Leu Ala
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile
Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser 50 55
60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln
65 70 75 80 Pro Glu Asp Val Ala Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg
Ala Pro 85 90 95 Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
Gly Ser Thr Ser 100 105 110 Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly
Ser Thr Lys Gly Glu Val 115 120 125 Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Arg Ser Leu 130 135 140 Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Asp Asp Tyr Ala Met 145 150 155 160 His Trp Val
Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala 165 170 175 Ile
Thr Trp Asn Ser Gly His Ile Asp Tyr Ala Asp Ser Val Glu Gly 180 185
190 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln
195 200 205 Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
Ala Lys 210 215 220 Val Ser Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr
Trp Gly Gln Gly 225 230 235 240 Thr Leu Val Thr Val Ser Ser His His
His His His His Cys 245 250 18 239 PRT Artificial Sequence
Description of Artificial Sequence Synthetic 2-7-SC-9 protein
sequence 18 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser
Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly
Ile Arg Asn Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys
Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala
Thr Tyr Tyr Cys Gln Arg Tyr Asn Arg Ala Pro Tyr 85 90 95 Thr Phe
Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser 100 105 110
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 115
120 125 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp
Tyr 130 135 140 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu
Glu Trp Val 145 150 155 160 Ser Ala Ile Thr Trp Asn Ser Gly His Ile
Asp Tyr Ala Asp Ser Val 165 170 175 Glu Gly Arg Phe Thr Ile Ser Arg
Asp Asn Ala Lys Asn Ser Leu Tyr 180 185 190 Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 195 200 205 Ala Lys Val Ser
Tyr Leu Ser Thr Ala Ser Ser Leu Asp Tyr Trp Gly 210 215 220 Gln Gly
Thr Leu Val Thr Val Ser Ser His His His His His His 225 230 235 19
51 DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 19 gacatccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtagggga c 51 20 96 DNA Artificial Sequence
Description of Artificial Sequence Synthetic oligonucleotide 20
gcatctgtag gggacagagt caccatcact tgtcgggcaa gtcagggcat cagaaattac
60 ttagcctggt atcagcaaaa accagggaaa gcccct 96 21 60 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 21 tccactttgc aatcaggggt cccatctcgg ttcagtggca
gtggatctgg gacagatttc 60 22 102 DNA Artificial Sequence Description
of Artificial Sequence Synthetic oligonucleotide 22 tctgggacag
atttcactct caccatcagc agcctacagc ctgaagatgt tgcaacttat 60
tactgtcaaa ggtataaccg tgcaccgtat acttttggcc ag 102 23 72 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
oligonucleotide 23 accactcccg ggtttgccgc taccactagt agagcctttg
atttccacct tggtcccctg 60 gccaaaagta ta 72 24 63 DNA Artificial
Sequence Description of Artificial Sequence Synthetic
oligonucleotide 24 ggcaaacccg ggagtggtga aggtagcact aaaggtgagg
tgcagctggt ggagtctggg 60 gga 63 25 102 DNA Artificial Sequence
Description of Artificial Sequence Synthetic oligonucleotide 25
gtggagtctg ggggaggctt ggtacagccc ggcaggtccc tgagactctc ctgtgcggcc
60 tctggattca cctttgatga ttatgccatg cactgggtcc gg 102 26 60 DNA
Artificial Sequence Description of Artificial Sequence Synthetic
oligonucleotide 26 ccaagtgata gctgagaccc attccaggcc cttccctgga
gcttgccgga cccagtgcat 60 27 60 DNA Artificial Sequence Description
of Artificial Sequence Synthetic oligonucleotide 27 tcagctatca
cttggaatag tggtcacata gactatgcgg actctgtgga gggccgattc 60 28 102
DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 28 gtggagggcc gattcaccat ctccagagac
aacgccaaga actccctgta tctgcaaatg 60 aacagtctga gagctgagga
tacggccgta tattactgtg cg 102 29 87 DNA Artificial Sequence
Description of Artificial Sequence Synthetic oligonucleotide 29
agacgagacg gtgaccaggg taccttggcc ccaatagtca agggaggacg cggtgctaag
60 gtacgagact ttcgcacagt aatatac 87 30 32 DNA Artificial Sequence
Description of Artificial Sequence Primer 30 tggcgagctc tgacatccag
atgacccagt ct 32 31 33 DNA Artificial Sequence Description of
Artificial Sequence Primer 31 accactcccg ggtttgccgc taccactagt aga
33 32 20 DNA Artificial Sequence Description of Artificial Sequence
Primer 32 ggcaaacccg ggagtggtga 20 33 52 DNA Artificial Sequence
Description of Artificial Sequence Primer 33 gccactcgag ctattagtga
tggtgatggt ggtgagacga gacggtgacc ag 52 34 92 DNA Artificial
Sequence Description of Artificial Sequence Primer 34 cctcggaatt
caccatgaga tttccttcaa tttttactgc tgttttattc gcagcatcct 60
ccgcattagc tgctgacatc cagatgaccc ag 92 35 51 DNA Artificial
Sequence Description of Artificial Sequence Primer 35 cgcggaattc
tattagtgat ggagatggag gagagacgag acggtgacca g 51 36 20 PRT
Saccharomyces cerevisiae 36 Met Arg Phe Pro Ser Ile Phe Thr Ala Val
Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala 20 37 26 DNA
Artificial Sequence Description of Artificial Sequence Primer 37
ctcgaattca ccatgagatt tccttc 26 38 42 DNA Artificial Sequence
Description of Artificial Sequence Primer 38 aaggtggaaa tcaaaggctg
tactagtggt agcggcaaac cc 42 39 42 DNA Artificial Sequence
Description of Artificial Sequence Primer 39 gggtttgccg ctaccactag
tacagccttt gatttccacc tt 42 40 30 DNA Artificial Sequence
Description of Artificial Sequence Primer 40 cgagaattct cattaattgc
gcaggtagcc 30 41 10 PRT Artificial Sequence Description of
Artificial Sequence Synthetic peptide 41 Gly Ser Thr Ser Gly Ser
Gly Lys Pro Gly 1 5 10 42 15 PRT Artificial Sequence Description of
Artificial Sequence Linker peptide 42 Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 43 6 PRT Artificial
Sequence Description of Artificial Sequence 6-His tag 43 His His
His His His His 1 5 44 5 PRT Artificial Sequence Description of
Artificial Sequence Linker peptide 44 Gly Gly Gly Gly Ser 1 5 45 54
DNA Artificial Sequence Description of Artificial Sequence
Synthetic oligonucleotide 45 ccctgattgc aaagtggatg cagcatagat
caggagctta ggggctttcc ctgg 54
* * * * *