U.S. patent application number 10/821001 was filed with the patent office on 2005-02-10 for recombinant negative strand rna virus expression systems and vaccines.
This patent application is currently assigned to Medlmmune Vaccines, Inc.. Invention is credited to Garcia-Sastre, Adolfo, Palese, Peter.
Application Number | 20050032043 10/821001 |
Document ID | / |
Family ID | 34528344 |
Filed Date | 2005-02-10 |
United States Patent
Application |
20050032043 |
Kind Code |
A1 |
Palese, Peter ; et
al. |
February 10, 2005 |
Recombinant negative strand RNA virus expression systems and
vaccines
Abstract
Recombinant negative-strand viral RNA templates are described
which may be used with purified RNA-directed RNA polymerase complex
to express heterologous gene products in appropriate host cells
and/or to rescue the heterologous gene in virus particles. The RNA
templates are prepared by transcription of appropriate DNA
sequences with a DNA-directed RNA polymerase. The resulting RNA
templates are of the negative-polarity and contain appropriate
terminal sequences which enable the viral RNA-synthesizing
apparatus to recognize the template. Bicistronic mRNAs can be
constructed to permit internal initiation of translation of viral
sequences and allow for the expression of foreign protein coding
sequences from the regular terminal initiation site, or vice
versa.
Inventors: |
Palese, Peter; (Leonia,
NJ) ; Garcia-Sastre, Adolfo; (New York, NY) |
Correspondence
Address: |
QUINE INTELLECTUAL PROPERTY LAW GROUP, P.C.
P O BOX 458
ALAMEDA
CA
94501
US
|
Assignee: |
Medlmmune Vaccines, Inc.
297 North Bernardo Avenue
Mountain View
CA
94043
|
Family ID: |
34528344 |
Appl. No.: |
10/821001 |
Filed: |
April 7, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10821001 |
Apr 7, 2004 |
|
|
|
09396539 |
Sep 14, 1999 |
|
|
|
09396539 |
Sep 14, 1999 |
|
|
|
09106377 |
Jun 29, 1998 |
|
|
|
6001634 |
|
|
|
|
09106377 |
Jun 29, 1998 |
|
|
|
08252508 |
Jun 1, 1994 |
|
|
|
5854037 |
|
|
|
|
08252508 |
Jun 1, 1994 |
|
|
|
08190698 |
Feb 1, 1994 |
|
|
|
08190698 |
Feb 1, 1994 |
|
|
|
07925061 |
Aug 4, 1992 |
|
|
|
07925061 |
Aug 4, 1992 |
|
|
|
07527237 |
May 22, 1990 |
|
|
|
5166057 |
|
|
|
|
Current U.S.
Class: |
435/5 ;
536/23.1 |
Current CPC
Class: |
A61K 39/12 20130101;
C12Y 302/01018 20130101; A61K 39/145 20130101; C12N 2760/16134
20130101; C12N 2760/16022 20130101; C12N 15/11 20130101; C12N
2760/16122 20130101; Y02A 50/466 20180101; C12N 2740/16134
20130101; C12N 2840/203 20130101; Y02A 50/30 20180101; C12N 15/10
20130101; C12N 2840/85 20130101; A61K 39/00 20130101; C12N 15/86
20130101; C12N 2740/16122 20130101; C12N 2760/16051 20130101; C07K
14/005 20130101; C12N 2760/16143 20130101; A61K 39/21 20130101;
C12N 9/127 20130101; C12N 9/1247 20130101; C12Y 207/07006 20130101;
A61K 2039/5256 20130101 |
Class at
Publication: |
435/005 ;
536/023.1 |
International
Class: |
C12Q 001/70; C07H
021/02 |
Claims
1-34. (Cancelled).
35. A method for rescuing a recombinant negative strand RNA virus
comprising: (a) introducing into a 293 cell expression vectors
which direct the expression in said cells of genomic or antigenomic
vRNA segments, and a nucleoprotein, and an RNA-dependent
polymerase, so that ribonucleoprotein complexes can be formed and
viral particles can be assembled in the absence of helper virus;
and (b) culturing said cells wherein viral particles are packaged
and rescued.
36. The method of claim 35 wherein the recombinant negative strand
RNA virus is a segmented virus.
37. The method of claim 36 wherein the negative strand RNA virus is
influenza.
38. A method for generating in cultured cells infectious viral
particles of a segmented negative-strand RNA virus having greater
than 3 genomic vRNA segments, said method comprising: (a)
introducing into cultured cells expression vectors which direct the
expression of the genomic or antigenomic vRNA segments of said
virus, and a nucleoprotein, and an RNA dependent polymerase so that
RNP complexes containing the genomic vRNA segments of said virus
can be formed and said viral particles, can be assembled within
said cells in the absence of helper virus; and (b) culturing said
cells wherein said viral particles are produced.
39. The method of claim 38 wherein one or more further expression
vectors are employed in said cells to express one or more proteins
selected from said nucleoprotein and the subunits of said
RNA-dependent RNA polymerase.
40. The method of claim 38 wherein a cell line is employed which
contains expression vectors which direct expression of one or more
of said nucleoprotein and the subunits of said RNA-dependent RNA
polymerase.
41. The method of claims 38, 39 or 40 wherein said virus is an
influenza virus of type A, B or C.
42. The method of claim 38 wherein said virus is a reassortant
virus having vRNA segments derived from more than one parent
virus
43. The method of claim 38 wherein said expression vectors direct
expression of genomic vRNA segments of said virus.
44. The method of claim 38 which further comprises amplifying viral
particles produced by said cells by one or more further cellular
infection steps employing cells which are the same or different
from said first population of cells.
45. The method of claim 38 which further comprises isolating
infectious viral particles.
46. The method of claim 38 which further comprises a viral
attenuation or killing step.
47. The method of claim 38 wherein said expression vectors are all
plasmids.
48. The method of claim 38 wherein said expression vectors consist
of a separate expression vector for expression of each vRNA segment
of said virus or the corresponding cRNAs.
49. A method for rescuing a chimeric recombinant negative strand
RNA virus, wherein said chimeric virus expresses heterologous
nucleic acid sequences, comprising: (a) introducing into a 293
cell, expression vectors which direct the expression in said cells
of genomic or antigenomic vRNA segments, and a nucleoprotein, and
an RNA-dependent RNA polymerase, so that ribonucleoprotein
complexes can be formed and viral particles can be assembled in the
absence of helper virus; and (b) culturing said cells wherein viral
particles are packaged and rescued.
50. The method of claim 49, wherein said heterologous nucleic acid
sequences are inserted into a DNA complement of a negative strand
RNA virus gene, such that said heterologous nucleic acid sequences
are flanked by the viral polymerase binding site, and a
polyadenylation site.
51. The method of claim 49, wherein oligonucleotides encoding the
viral polymerase binding site of the negative strand RNA virus are
ligated to said heterologous nucleic acid sequences.
52. The method of claim 49, wherein the chimeric recombinant
negative strand RNA virus is a segmented virus.
53. The method of claim 52, wherein the segmented RNA virus is
influenza.
54. The method of claim 49, wherein said heterologous nucleic acid
sequences are derived from human immunodeficiency virus (HIV).
55. The method of claim 49, wherein said pathogenic antigens are
hepatitis B surface antigen, glycoproteins of herpes virus, or VP1
protein of poliovirus.
56. The method of claim 49, wherein said non-viral pathogens are
bacteria or parasites.
57. The method of claim 49, wherein said heterologous nucleic acid
sequences encode viral genes from different strains of the negative
strand RNA virus.
58. The method of claim 49, wherein said heterologous nucleic acid
sequences are antisense nucleic acids.
59. The chimeric recombinant negative strand RNA virus produced by
the method of claim 49.
60. A method for generating in cultured cells infectious viral
particles of a chimeric negative strand RNA virus, wherein said
chimeric virus expresses heterologous nucleic acid sequences and
has greater than 3 genomic vRNA segments, comprising: (a)
introducing into cultured cells expression vectors which direct the
expression of genomic or antigenomic vRNA segments of said chimeric
virus, and a nucleoprotein, and an RNA dependent RNA polymerase so
that RNP complexes containing the genomic vRNA segments of said
chimeric virus can be formed and said viral particles can be
assembled within said cells in the absence of helper virus; and (b)
culturing said cells wherein said viral particles are produced.
61. The method of claim 60, wherein one or more further expression
vectors are employed in said cells to express one or more proteins
selected from said nucleoprotein and the subunits of said
RNA-dependent polymerase.
62. The method of claim 60, wherein a cell line is employed which
contains expression vectors which direct expression of one or more
of said nucleoprotein and the subunits of said RNA-dependent RNA
polymerase.
63. The method of claim 60, 61, or 62 wherein said virus is an
influenza virus of type A, B or C.
64. The method of claim 60, wherein said expression vectors direct
expression of genomic vRNA segments of said chimeric virus.
65. The method of claim 60 which further comprises amplifying viral
particles produced by said cells by one or more further cellular
infection steps employing cells which are the same or different
from said first population of cells.
66. The method of claim 60, which further comprises isolating
infectious viral particles.
67. The method of claim 60, which further comprises a viral
attenuation or killing step.
68. The method of claim 60, wherein said expression vectors are all
plasmids.
69. The method of claim 60, wherein said expression vectors consist
of a separate expression vector for expression of each vRNA segment
of said chimeric virus or the corresponding cRNAs.
70. The method of claim 60, wherein said heterologous nucleic acid
sequences are engineered into the expression vectors directing the
expression of the vRNA segments of said chimeric virus.
71. The method of claim 53 which further comprises amplifying viral
particles produced by said first population of cells by one or more
further cellular infection steps employing cells which are the same
or different from said first population of cells.
72. The method of claim 53 which further comprises isolating
infectious viral particles.
73. The method of claim 53 which further comprises an attenuation
or viral killing step.
74. The method of claim 53 which further comprises incorporating
attenuated or killed vial particles into a vaccine composition.
75. A vaccine formulation comprising the chimeric recombinant
negative strand RNA virus produced by the method of claim 49.
76. A vaccine formulation comprising the chimeric recombinant
negative strand RNA virus produced by the method of claim 49,
wherein said heterologous nucleic acid sequences are derived from
human immunodeficiency virus.
77. A vaccine formulation comprising the chimeric recombinant
negative strand RNA virus produced by the method of claim 49,
wherein said pathogenic antigen is hepatitis B surface antigen,
glycoprotein of herpes virus, or VP1 protein of poliovirus.
78. The vaccine formulation comprising the chimeric recombinant
negative strand RNA virus produced by the method of claim 49,
wherein said virus is influenza.
79. A pharmaceutical composition comprising, the chimeric
recombinant negative strand RNA virus produced by the method of
claim 49, and a pharmaceutically acceptable carrier.
Description
1. INTRODUCTION
[0001] The present invention relates to recombinant negative strand
virus RNA templates which may be used to express heterologous gene
products in appropriate host cell systems and/or to construct
recombinant viruses that express, package, and/or present the
heterologous gene product. The expression products and chimeric
viruses may advantageously be used in vaccine formulations.
[0002] The invention is demonstrated by way of examples in which
recombinant influenza virus RNA templates containing a heterologous
gene coding sequences in the negative-polarity were constructed.
These recombinant templates, when combined with purified viral
RNA-directed RNA polymerase, were infectious, replicated in
appropriate host cells, and expressed the heterologous gene product
at high levels. In addition, the heterologous gene was expressed
and packaged by the resulting recombinant influenza viruses.
2. BACKGROUND OF THE INVENTION
[0003] A number of DNA viruses have been genetically engineered to
direct the expression of heterologous proteins in host cell systems
(e.g., vaccinia virus, baculovirus, etc.). Recently, similar
advances have been made with positive-strand RNA viruses (e.g.,
poliovirus). The expression products of these constructs, i.e., the
heterologous gene product or the chimeric virus which expresses the
heterologous gene product, are thought to be potentially useful in
vaccine formulations (either subunit or whole virus vaccines). One
drawback to the use of viruses such as vaccinia for constructing
recombinant or chimeric viruses for use in vaccines is the lack of
variation in its major epitopes. This lack of variability in the
viral strains places strict limitations on the repeated use of
chimeric vaccinia, in that multiple vaccinations will generate
host-resistance to the strain so that the inoculated virus cannot
infect the host. Inoculation of a resistant individual with
chimeric vaccina will, therefore, not induce immune
stimulation.
[0004] By contrast, influenza virus, a negative-strand RNA virus,
demonstrates a wide variability of its major epitopes. Indeed,
thousands of variants of influenza have been identified; each
strain evolving by antigenic drift. The negative-strand viruses
such as influenza would be attractive candidates for constructing
chimeric viruses for use in vaccines because its genetic
variability allows for the construction of a vast repertoire of
vaccine formulations which will stimulate immunity without risk of
developing a tolerance. However, achieving this goal has been
precluded by the fact that, to date, it has not been possible to
construct recombinant or chimeric negative-strand RNA particles
that are infectious.
2.1. The Influenza Virus
[0005] Virus families containing enveloped single-stranded RNA of
the negative-sense genome are classified into groups having
non-segmented genomes (Paramyxoviridae, Rhabdoviridae) or those
having segmented genomes (Orthomyxoviridae, Bunyaviridae and
Arenaviridae). The Orthomyxoviridae family, described in detail
below, and used in the examples herein, contains only the viruses
of influenza, types A, B and C.
[0006] The influenza virions consist of an internal
ribonucleoprotein core (a helical nucleocapsid) containing the
single-stranded RNA genome, and an outer lipoprotein envelope lined
inside by a matrix protein (M). The segmented genome of influenza A
consists of eight molecules (seven for influenza C) of linear,
negative polarity, single-stranded RNAs which encode ten
polypeptides, including: the RNA-directed RNA polymerase proteins
(PB2, PB1 and PA) and nucleoprotein (NP) which form the
nucleocapsid; the matrix proteins (M1, M2); two surface
glycoproteins which project from the lipoprotein envelope:
hemagglutinin (HA) and neuraminidase (NA); and nonstructural
proteins whose function is unknown (NS1 and NS2). Transcription and
replication of the genome takes place in the nucleus and assembly
occurs via budding on the plasma membrane. The viruses can reassort
genes during mixed infections.
[0007] Influenza virus adsorbs via HA to sialyloligosaccharides in
cell membrane glycoproteins and glycolipids. Following endocytosis
of the virion, a conformational change in the HA molecule occurs
within the cellular endosome which facilitates membrane fusion,
thus triggering uncoating. The nucleocapsid migrates to the nucleus
where viral RNA is transcribed as the essential initial event in
infection. Viral mRNA is transcribed by a unique mechanism in which
viral endonuclease cleaves the capped 5'-terminus from cellular
heterologous mRNAs which then serve as primers for transcription of
viral RNA templates by the viral transcriptase. Transcripts
terminate at sites 15 to 22 bases from the ends of their templates,
where oligo(U) sequences act as signals for the
template-independent addition of poly(A) tracts. Of the eight viral
mRNA molecules so produced, six are monocistronic messages that are
translated directly into the proteins representing HA, NA, NP and
the viral polymerase proteins, PB2, PB1 and PA. The other two
transcripts undergo splicing, each yielding two mRNAs which are
translated in different reading frames to produce M1, M2, NS1 and
NS2. In other words, the eight viral mRNAs code for ten proteins:
eight structural and two nonstructural. A summary of the genes of
the influenza virus and their protein products is shown in Table I
below.
1TABLE I INFLUENZA VIRUS GENOME RNA SEGMENTS AND CODING
ASSIGNMENTS.sup.a Length.sup.b Encoded Length.sup.d Molecules
(Nucleo- Poly- (Amino Per Segment tides) peptide.sup.vc Acids)
Virion Comments 1 2341 PB2 759 30-60 RNA transcriptase component;
host cell RNA cap binding 2 2341 PB1 757 30-60 RNA transcriptase
component; initiation of transcription; endonuclease activity? 3
2233 PA 716 30-60 RNA transcriptase component; elongation of mRNA
chains? 4 1778 HA 566 500 Hemagglutinin; trimer; envelope
glycoprotein; mediates attachment to cells 5 1565 NP 498 1000
Nucleoprotein; associated with RNA; structural component of RNA
transcriptase 6 1413 NA 454 100 Neuraminidase; tetramer; envelope
glycoprotein 7 1027 M.sub.1 252 3000 Matrix protein; lines inside
of envelope. M.sub.2 96 Structural protein in plasma membrane;
spliced mRNA ? ?9 Unidentified protein 8 890 NS.sub.1 230
Nonstructural protein; function unknown NS.sub.2 121 Nonstructural
protein; function unknown; spliced mRNA .sup.aAdapted from R.A.
Lamb aznd P.W. Choppin (1983), Reproduced from the Annual Review of
Biochemistry, Volume 52, 467-506. .sup.bFor A/PR/8/34 strain
.sup.cDetermined by biochemical and genetic approaches
.sup.dDetermined by nucleotide sequence analysis and protein
sequencing
[0008] Following transcription, virus genome replication is the
second essential event in infection by negative-strand RNA viruses.
As with other negative-strand RNA viruses, virus genome replication
in influenza is mediated by virus-specified proteins. It is
hypothesized that most or all of the viral proteins that transcribe
influenza virus mRNA segments also carry out their replication. All
viral RNA segments have common 3' and 5' termini, presumably to
enable the RNA-synthesizing apparatus to recognize each segment
with equal efficiency. The mechanism that regulates the alternative
uses (i.e., transcription or replication) of the same complement of
proteins (PB2, PB1, PA and NP) has not been clearly identified but
appears to involve the abundance of free forms of one or more of
the nucleocapsid proteins, in particular, the NP. The nucleus
appears to be the site of virus RNA replication, just as it is the
site for transcription.
[0009] The first products of replicative RNA synthesis are
complementary copies (i.e., plus-polarity) of all influenza virus
genome RNA segments (cRNA). These plus-stranded copies
(anti-genomes) differ from the plus-strand mRNA transcripts in the
structure of their termini. Unlike the mRNA transcripts, the
anti-genomic cRNAs are not capped and methylated at the 5' termini,
and are not truncated and polyadenylated at the 3' termini. The
cRNAs are coterminal with their negative strand templates and
contain all the genetic information in each genomic RNA segment in
the complementary form. The cRNAs serve as templates for the
synthesis of genomic negative-strand vRNAs.
[0010] The influenza virus negative strand genomes (vRNAs) and
antigenomes (cRNAs) are always encapsidated by nucleocapsid
proteins; the only unencapsidated RNA species are virus mRNAs. In
contrast to the other enveloped RNA viruses, nucleocapsid assembly
appears to take place in the nucleus rather than in the cytoplasm.
The virus matures by budding from the apical surface of the cell
incorporating the M protein on the cytoplasmic side or inner
surface of the budding envelope. The HA and NA become glycosylated
and incorporated into the lipid envelope. In permissive cells, HA
is eventually cleaved, but the two resulting chains remain united
by disulfide bonds.
[0011] It is not known by what mechanism one copy of each of the
eight genomic viral RNAs is selected for incorporation into each
new virion. Defective interfering (DI) particles are often
produced, especially following infection at high multiplicity.
2.2. RNA Directed RNA Polymerase
[0012] The RNA-directed RNA polymerases of animal viruses have been
extensively studied with regard to many aspects of protein
structure and reaction conditions. However, the elements of the
template RNA which promote optimal expression by the polymerase
could only be studied by inference using existing viral RNA
sequences. This promoter analysis is of interest since it is
unknown how a viral polymerase recognizes specific viral RNAs from
among the many host-encoded RNAs found in an infected cell.
[0013] Animal viruses containing plus-sense genome RNA can be
replicated when plasmid-derived RNA is introduced into cells by
transfection (for example, Racaniello et al., 1981, Science
214:916-919; Levis, et al., 1986, Cell 44: 137-145). In the case of
poliovirus, the purified polymerase will replicate a genome RNA in
in vitro reactions and when this preparation is transfected into
cells it is infectious (Kaplan, et al., 1985, Proc. Natl. Acad.
Sci. USA 82:8424-8428). However, the template elements which serve
as transcription promoter for the poliovirus-encoded polymerase are
unknown since even RNA homopolymers can be copied (Ward, et al.,
1988, J. Virol. 62: 558-562). SP6 transcripts have also been used
to produce model defective interfering (DI) RNAs for the Sindbis
viral genome. When the RNA is introduced into infected cells, it is
replicated and packaged. The RNA sequences which were responsible
for both recognition by the Sindbis viral polymerase and packaging
of the genome into virus particles were shown to be within 162
nucleotides (nt) of the 5' terminus and 19 nt of the 3' terminus of
the genome (Levis, et al., 1986, Cell 44: 137-145). In the case of
brome mosaic virus (BMV), a positive strand RNA plant virus, SP6
transcripts have been used to identify the promoter as a 134 nt
tRNA-like 3' terminus (Dreher, and Hall, 1988, J. Mol. Biol. 201:
31-40). Polymerase recognition and synthesis were shown to be
dependent on both sequence and secondary structural features
(Dreher, et al., 1984, Nature 311: 171-175).
[0014] The negative-sense RNA viruses have been refractory to study
of the sequence requirements of the replicase. The purified
polymerase of vesicular stomatitis virus is only active in
transcription when virus-derived ribonucleoprotein complexes (RNPs)
are included as template (De and Banerjee, 1985, Biochem. Biophys.
Res. Commun. 126: 40-49; Emerson and Yu, 1975, J. Virol. 15:
1348-1356; Naito, and Ishihama, 1976, J. Biol. Chem. 251:
4307-4314). RNPs have been reconstituted from naked RNA of VSV DI
particles using infected cell extracts as protein source. These
RNPs were then replicated when added back to infected cells
(Mirakhur, and Peluso, 1988, Proc. Natl. Acad. Sci. USA 85:
7511-7515). With regard to influenza viruses, it was recently
reported that naked RNA purified from virus was used to
reconstitute RNPS. The viral nucleocapsid and polymerase proteins
were gel-purified and renatured on the viral RNA using thioredoxin
(Szewczyk, et al., 1988, Proc. Natl. Acad. Sci. USA, 85:
7907-7911). However, these authors did not show that the activity
of the preparation was specific for influenza viral RNA, nor did
they analyze the signals which promote transcription.
[0015] During the course of influenza virus infection the
polymerase catalyzes three distinct transcription activities. These
include the synthesis of (a) subgenomic mRNA, which contains a 5'
cap and a 3' poly-A tail; (b) a full length plus-strand or
anti-genome (cRNA) copied from the genome RNA; and (c) genomic vRNA
synthesized from the full length cRNA (reviewed in Ishihama and
Nagata, 1988, CRC Crit. Rev. Biochem. 23: 27-76; and Krug,
Transcription and replication of influenza viruses. In: Genetics of
influenza viruses, Ed., Palese, P. and Kingsbury, D. W. New York,
Springer-Verlag, 1983, p. 70-98). Viral proteins PB2, PB1 and PA
are thought to catalyze all influenza virus-specific RNA synthesis
when in the presence of excess nucleocapsid protein (NP; see above
reviews). These polymerase functions have been studied using RNP
cores derived from detergent-disrupted virus, and RNPs from the
nuclear extracts of infected cells. Transcription from the RNPs
derived from disrupted virus occurs when primed with either
dinucleotide adenylyl-(3'-5')-guanosine (ApG) or capped mRNAs. The
plus sense mRNA products have terminated synthesis 17-20
nucleotides upstream of the 5' terminus of the RNA template and
have been processed by the addition of poly A tails. These products
cannot serve as template for the viral-sense genome since they lack
terminal sequences (Hay, et al., 1977, Virology 83: 337-355). RNPs
derived from nuclear extracts of infected cells also synthesize
polyadenylated mRNA in the presence of capped RNA primers. However,
if ApG is used under these conditions, both RNAs, polyadenylated
and full length cRNA, can be obtained (Beaton and Krug, 1986, Proc.
Natl. Acad. Sci. USA 83: 6282-6286; Takeuchi, et al., 1987, J.
Biochem. 101: 837-845). Recently it was shown that replicative
synthesis of cRNA could occur in the absence of exogenous primer if
the nuclear extract was harvested at certain times post infection.
In these same preparations the synthesis of negative-sense vRNA
from a cRNA template was also observed (Shapiro and Krug, 1988, J.
Virol. 62: 2285-2290). The synthesis of full length cRNA was shown
to be dependent upon the presence of nucleocapsid protein (NP)
which was free in solution (Beaton and Krug, 1986, Proc. Natl.
Acad. Sci. USA 83: 6282-6286; Shapiro and Krug, 1988, J. Virol. 62:
2285-2290). These findings led to the suggestion that the
regulatory control between mRNA and cRNA synthesis by the RNP
complex is based on the requirement for there being an excess of
soluble NP (Beaton and Krug, 1986, Proc. Natl. Acad. Sci. USA 83:
6282-6286).
[0016] Another line of investigation has focused on the preparation
of polymerase-RNA complexes derived from RNPs from
detergent-disrupted virus. When the RNP complex is centrifuged
through a CsCl-glycerol gradient, the RNA can be found associated
with the three polymerase (P) proteins at the bottom of the
gradient. Near the top of the gradient, free NP protein can be
found (Honda, et al., 1988, J. Biochem. 104: 1021-1026; Kato, et
al., 1985, Virus Research 3, 115-127). The purified polymerase-RNA
complex (bottom of gradient), is active in initiating ApG-primed
synthesis of RNA, but fails to elongate to more than 12-19
nucleotides. When fractions from the top of the gradient containing
the NP protein are added back to the polymerase-RNA complex,
elongation can ensue (Honda, et al., 1987, J. Biochem. 102: 41-49).
These data suggest that the NP protein is needed for elongation,
but that initiation can occur in the absence of NP.
[0017] It has been shown that the genomic RNA of influenza viruses
is in a circular conformation via base-pairing of the termini to
form a panhandle of 15 to 16 nt (Honda, et al., 1988, J. Biochem.
104: 1021-1026; Hsu, et al., 1987, Proc. Natl. Acad. Sci. USA 84:
8140-8144). Since the viral polymerase was found bound to the
panhandle, this led to the suggestion that a panhandle structure
was required for recognition by the viral polymerase (Honda, et
al., 1988, J. Biochem. 104: 1021-1026.) Therefore, it was
hypothesized in these two reports that the promoter for the viral
RNA polymerase was the double stranded RNA in panhandle
conformation.
3. SUMMARY OF THE INVENTION
[0018] Recombinant negative-strand viral RNA templates are
described which may be used with purified RNA-directed RNA
polymerase complex to express heterologous gene products in
appropriate host cells and/or to rescue the heterologous gene in
virus particles. The RNA templates are prepared by transcription of
appropriate DNA sequences with a DNA-directed RNA polymerase. The
resulting RNA templates are of the negative-polarity and contain
appropriate terminal sequences which enable the viral
RNA-synthesizing apparatus to recognize the template. Bicistronic
mRNAs can be constructed to permit internal initiation of
translation of viral sequences and allow for the expression of
foreign protein coding sequences from the regular terminal
initiation site, or vice versa.
[0019] As demonstrated by the examples described herein,
recombinant negative-sense influenza RNA templates may be mixed
with purified viral polymerase proteins and nucleoprotein (i.e.,
the purified viral polymerase complex) to form infectious
recombinant RNPs. These can be used to express heterologous gene
products in host cells or to rescue the heterologus gene in virus
particles by cotransfection of host cells with recombinant RNPs and
virus. Alternatively, the recombinant RNA templates or recombinant
RNPs may be used to transfect transformed cell lines that express
the RNA dependent RNA-polymerase and allow for complementation.
Additionally, a non-virus dependent replication system for
influenza virus is also described. Vaccinia vectors expressing
influenza virus polypeptides were used as the source of proteins
which were able to replicate and transcribe synthetically derived
RNPs. The minimum subset of influenza virus protein needed for
specific replication and expression of the viral RNP was found to
be the three polymerase proteins (PB2, PB1 and PA) and the
nucleoprotein (NP). This suggests that the nonstructural proteins,
NS1 and NS2, are not absolutely required for the replication and
expression of viral RNP.
[0020] The expression products and/or chimeric virions obtained may
advantageously be utilized in vaccine formulations. The use of
recombinant influenza for this purpose is especially attractive
since influenza demonstrates tremendous strain variability allowing
for the construction of a vast repertoire of vaccine formulations.
The ability to select from thousands of influenza variants for
constructing chimeric viruses obviates the problem of host
resistance encountered when using other viruses such as vaccinia.
In addition, since influenza stimulates a vigorous secretory and
cytotoxic T cell response, the presentation of foreign epitopes in
the influenza virus background may also provide for the induction
of secretory immunity and cell-mediated immunity.
3.1. Definitions
[0021] As used herein, the following terms will have the meanings
indicated:
[0022] cRNA=anti-genomic RNA
[0023] HA=hemagglutinin (envelope glycoprotein)
[0024] M=matrix protein (lines inside of envelope)
[0025] MDCK=Madin Darby canine kidney cells
[0026] MDBK=Madin Darby bovine kidney cells
[0027] moi=multiplicity of infection
[0028] NA=neuraminidase (envelope glycoprotein)
[0029] NP=nucleoprotein (associated with RNA and required for
polymerase activity)
[0030] NS=nonstructural protein (function unknown)
[0031] nt=nucleotide
[0032] PA, PB1, PB2=RNA-directed RNA polymerase components
[0033] RNP=ribonucleoprotein (RNA, PB2, PB1, PA and NP)
[0034] rRNP=recombinant RNP
[0035] vRNA=genomic virus RNA
[0036] viral polymerase complex=PA, PB1, PB2 and NP
[0037] WSN=influenza A/WSN/33 virus
[0038] WSN-HK virus: reassortment virus containing seven genes from
WSN virus and the NA gene from influenza A/HK/8/68 virus
4. DESCRIPTION OF THE FIGURES
[0039] FIG. 1. Purification of the polymerase preparation. RNP
cores were purified from whole virus and then subjected to
CsCl-glycerol gradient centrifugation. The polymerase was purified
from fractions with 1.5 to 2.0 M CsCl. Samples were then analyzed
by polyacrylamide gel electrophoresis on a 7-14% linear gradient
gel in the presence of 0.1% sodium dodecylsulfate followed by
staining with silver. Protein samples contained 1.4 .mu.g whole
virus (lane 1), 0.3 .mu.g whole virus (lane 2), 5 .mu.l of RNP
cores (lane 3) and 25 .mu.l RNA polymerase (lane 4). Known
assignments of the proteins are indicated at the left.
[0040] FIG. 2. Plasmid constructs used to prepare RNA templates.
The plasmid design is depicted with the solid box representing
pUC-19 sequences, the hatched box represents the truncated promoter
specifically recognized by bacteriophage T7 RNA polymerase, the
solid line represents the DNA which is transcribed from plasmids
which have been digested with MboII. The white box represents
sequences encoding the recognition sites for MboII, EcoRI and PstI,
in that order. Sites of cleavage by restriction endonucleases are
indicated. Beneath the diagram, the entire sequences of RNAs which
result from synthesis by T7 RNA polymerase from MboII-digested
plasmid are given. The V-wt RNA has the identical 5' and 3' termini
as found in RNA segment 8 of influenza A viruses, separated by 16
"spacer" nucleotides. The RNA, M-wt, represents the exact opposite
stand, or "message-sense", of V-wt. Restriction endonuclease sites
for DraI, EcoRI, PstI and SmaI are indicated. T7 transcripts of
plasmids cleaved by these enzymes result in, respectively, 32, 58,
66 and 91 nucleotide long RNAs. The sequences of V-d5' RNA are
indicated. The plasmid design is essentially the same as that used
for the V-wt RNA except for the minor changes in the "spacer"
sequence. The point mutants of V-d5' RNAs which were studied are
indicated in Table I.
[0041] FIG. 3. Analysis of products of influenza viral polymerase.
FIG. 3A: Polymerase reaction mixtures containing 0.4 mM ApG (lane
2) or no primer (lane 3) were electrophoresed on 8% polyacrylamide
gels containing 7.7 M urea. FIG. 3B: The nascent RNA is resistant
to single-stranded specific nuclease S1. Following the standard
polymerase reaction, the solutions were diluted in nuclease S1
buffer (lane 1) and enzyme was added (lane 2). As control for S1
digestion conditions, radioactively labeled single-stranded V-wt
RNA was treated with nuclease S1 (lane 3) or with buffer alone
(lane 4). FIG. 3C: Ribonuclease T1 analayis of gel-purified
reaction products. The reaction products of the viral polymerase
using the V-wt RNA template was subjected to electrophoresis on an
.8% polyacrylamide gel. The 53 nt band and the smaller transcript
were excised and eluted from the gel matrix. These RNAs were
digested with RNAse T1 and analyzed by electrophoresis on a 20%
polyacrylamide gel containing 7.7 M urea. For comparison, T7
transcripts of M-wt and V-wt RNAs which had been synthesized in the
presence of a .alpha.-.sup.32P-UTP were also analyzed with RNAse
T1. The predicted radiolabeled oliognucleotides of the control RNAs
are indicated. Lane 1, 53 nucleotide full length (FL) product; lane
2, 40-45 nucleotide smaller (Sm) RNA product; lane 3, M-wt RNA
labeled by incorporation of .sup.32P-UMP; and lane 4, V-wt RNA
labeled as in lane 3.
[0042] FIG. 4. Optimal reaction conditions for the viral
polymerase. FIG. 4A: Reactions with V-wt template were assembled on
ice and then incubated at the indicated temperatures for 90
minutes. FIG. 4B: Reactions with the V-wt template were prepared in
parallel with the indicated NaCl or KCl concentrations and were
incubated at 30{grave over ()}C. for 90 minutes. FIG. 4C: A single
reaction with the V-wt template was incubated at 30{grave over
()}C., and at the indicated times, samples were removed and
immediately processed by phenol-chloroform extraction. All gels
contained 8% polyacrylamide with 7.7 M urea.
[0043] FIG. 5. Template specificity of the viral polymerase. FIG.
5A: The viral polymerase reaction requires 3' terminal promoter
sequences. Different template RNAs were used in reactions under
standard conditions. Lane 1, the V-Pst RNA, which is identical to
V-wt except it has a 13 nt extension at the 3' end; lane 2, V-Sma
RNA, which has a 38 nt extension at the 3' end; lane 3, V-wt RNA;
lane 4, a DNA polynucleotide with identical sequence as the V-wt
RNA; lane 5, an 80 nt RNA generated by bacteriophage T3 RNA
polymerase transcription of a pIBI-31 plasmid digested with
HindIII. The autoradiograph was overexposed in order to emphasize
the absence of specific reaction products when these other
templates were used. FIG. 5B: 10 ng of each template RNA were
incubated with the viral polymerase and the products were then
subjected to electrophoresis on 8% polyacrylamide gels containing
7.7 M urea. Lane 1, V-wt RNA; lane 2, V-Dra RNA; lane 3, V-Eco RNA;
lane 4, M-wt RNA are shown; and lane 5, a 53 nt marker
oligonucleotide. For the exact sequence differences refer to FIG. 2
and Section 6.1 et seq.
[0044] FIG. 6. The RNA promoter does not require a terminal
panhandle. Polymerase reaction using two template RNAs. Each
reaction contained 5 hg of V-wt RNA. As a second template the
reactions contained 0 ng (lane 1), 0.6 ng (lane 2), and 3.0 ng
(lane 3) of V-d5' RNA. The resulting molar ratios are as indicated
in the figure. The reaction products were analyzed on an 8%
polyacrylamide gel in the presence of 7.7 M urea. Following
densitometry analysis of autoradiographs, the relative intensity of
each peak was corrected for the amount of radioactive UMP which is
incorporated in each product.
[0045] FIG. 7. Specificity of promoter sequences. RNAs which lacked
the 5' terminus and contained point mutations (Table II) were
compared with V-d5' RNA in standard polymerase reactions. The right
panel is from a separate reaction set. Quantitative comparisons is
outlined in Table II.
[0046] FIG. 8. High concentration polymerase preparations are
active in cap-endonuclease primed and in primeness RNA synthesis
reactions. FIG. 8A: Primer specificty of the high concentration
enzyme. Radioactively synthesized 30 nt template is in lane 1.
Reactions using 20 ng of V-d5' RNA and 5 .mu.l of viral polymerase
contained as primer: no primer (lane 2); 100 ng BMV RNA (De and
Banerjee, 1985, Biochem. Biophys. Res. Commun. 6:40-49) containing
a cap 0 structure (lane 3); 100 ng rabbit globin mRNA, containing a
cap 1 structure, (lane 4); and 0.4 mM ApG (lane 5). A lighter
exposure of lane 5 is shown as lane 6. FIG. 8B: Nuclease S1
analysis of gel-purified RNAs. Products from reactions using as
primer ApG (lanes 1 and 2); no primer (lanes 3 and 4); or globin
mRNA (lanes 5 and 6) were electrophoresed in the absence of urea
and the appropriate gel piece was excised and the RNA was eluted.
This RNA was then digested with nuclease S1 (lanes 2, 4, and 6) and
the products were denatured and analyzed on an 8% polyacrylamide
gel containing 7.7 M urea.
[0047] FIG. 9. Genomic length RNA synthesis from reconstitituted
RNPs. Reaction products using 10 .mu.l of polymerase and as
template 890 nt RNA identical to the sequence of segment 8 of virus
A/WSN/33 and RNA extracted from A/PR/8/34 virus were analyzed on a
4% polyacrylamide gel containing 7.7 M urea. In lane 1, the 890 nt
template synthesized radioactively by T7 RNA polymerase is shown.
The 890 nt plasmid-derived RNA was used as template in lanes 2, 3,
8 and 9. RNA extracted from virus was used as template in lanes 4,
5, 10 and 11. No template was used in lanes 6 and 7. No primer was
used in lanes 2 to 5, and ApG was used as primer in lanes 6 to 11.
Reaction products were treated with nuclease S1 in lanes 3, 5, 7, 9
and 11.
[0048] FIG. 10. Diagrammatic representation of a PCR-directed
mutagenesis method which can be used to replace viral coding
sequences within viral gene segments.
[0049] FIG. 11.(A). Diagrammatic representation of relevant
portions of PIVCAT1. The various domains are labeled and are, from
left to right; a truncated T7 promoter; the 5' nontranslated end of
influenza A/PR/8/34 virus segment 8 (22 nucleotides); 8.
nucleotides of linker sequence; the entire CAT gene coding region
(660 nucleotides) the entire 3' nontranslated end of influenza
A/PR/8/34 virus segment 8 (26 nucleotides); and linker sequence
containing the HaI restriction enzyme site. Relevant restriction
enzyme sites and start and stop sites for the CAT gene are
indicated. (B) The 716 base RNA product obtained following HgaI
digestion and transcription of pIVACAT1 by T7 RNA polymerase.
Influenza viral sequences are indicated by bold letters, CAT gene
sequences by plain letters, and linker sequences by italics. The
triplets--in antisense orientation--representing the initiation and
termination codons of the CAT gene are indicated by arrow and
underline, respectively.
[0050] FIG. 12. RNA products of T7 polymerase transcription and in
vitro influenza virus polymerase transcription. Lanes 1-4:
polyacrylamide gel analysis of radiolabeled T7 polymerase
transcripts from pIVACAT1, and pHgaNS. Lanes 5 and 6:
Polyacrylamide gel analysis of the radiolabeled products of in
vitro transcription by purified influenza A polymerase protein
using unlabeled 1VACAT1 RNA and HgaNS RNA templates. Lane 1: HgaNS
RNA of 80 nt. Lanes 2-4: different preparations of IVACAT1 RNA.
Lane 5: viral polymerase transcript of IVACAT1 RNA. Lane 6: viral
polymerase transcript of HgaNS RNA.
[0051] FIG. 13. Schematic of the RNP-transfection and passaging
experiments.
[0052] FIG. 14. CAT assays of cells RNP-transfected with IVACAT1
RNA. (A) Time course of RNP-transfection in 293 cells. Cells were
transfected at -1 hour with the recombinant RNP and infected with
virus at 0 hour. Cells were harvested at the indicated time points
and assayed for CAT activity. (B) Requirements for RNP-transfection
of 293 cells Paramaeters of the reaction mixtures were as
indicated. (C) RNP-transfection of MDCK cells. MDCK cells were
transfected with IVACAT1 RNA-polymerase at either -1 hour or +2
hours relative to virus infection. Cells were harvested and CAT
activity assayed at the indicated times. Components/conditions of
the reaction were as indicated. "Time" indicates the time point of
harvesting the cells. T=0 marks the time of addition of helper
virus. "RNA" represents the IVACAT1 RNA. "Pol" is the purified
influenza A/PR/8/34 polymerase protein complex. "WSN" indicates the
influenza A/WSN/33 helper virus. "Pre-Inc." indicates preincubation
of RNA and polymerase in transcription buffer at 30{grave over ()}
C. for 30 min. "RNP transfection" indicates the time of RNP
transfection relative to virus infection. "+/-" indicate presence
or absence of the particular component/feature. "C" indicates
control assays using commercially available CAT enzyme
(Boehringer-Mannheim).
[0053] FIG. 15. CAT activity in MDCK cells infected with
recombinant virus. Supernatant from RNP-transfected and helper
virus-infected MDCK cells was used to infect fresh MDCK cells. The
inoculum was removed 1 hour after infection, cells were harvested
11 hours later and CAT activity was assayed. Lane 1: extract of
cells infected with helper virus only. Lane 2: extract of cells
infected with 100 .mu.l of supernatant from RNP-transfected and
helper virus-infected MDCK cells. Lane 3: Supernatant (80 .mu.l) of
cells from lane 2. Lane 4: Same as lane 2 except that helper virus
(MOI 4) was added to inoculum. In contrast to experiments shown in
FIG. 4, the assays contained 20 .mu.l of .sup.14C
chloramphenicol.
[0054] FIG. 16. Diagram of relevant portions of the neuraminidase
(NA) gene contained in plasmids used for transfection experiments.
The pUC19 derived plasmid pT3NAv contains the influenza A/WSN/33
virus NA gene and a truncated promoter specifically recognized by
bacteriophage T3 RNA polymerase. The T3 promoter used is truncated
such that the initial transcribed nucleotide (an adenine)
corresponds to the 5' adenine of the WSN NA gene. At the 3' end of
the cDNA copy of the NA gene, a Ksp632I restriction enzyme site was
inserted such that the cleavage site occurs directly after the 3'
end of the NA gene sequence. A 1409 nucleotide long transcript was
obtained following Ksp632I digestion and transcription by T3 RNA
polymerase of PT3NAv (as described in Section 8.1, infra). The 15
5' terminal nucleotides, the 52 nucleotides corresponding to the
region between the restriction endonuclease sites NcoI and PstI and
the 12 3' terminal nucleotides are shown. The transcript of pT3NAv
mut 1 is identical to that of pT3NAv except for a single deletion,
eleven nucleotides downstream from the 5' end of the wild type RNA.
The transcript of the pT3NAv mut 2 is identical to that of pT3NAv
except for 5 mutations located in the central region (indicated by
underline). These five mutations do not change the amino acid
sequence in the open reading frame of the gene. The serine codon
UCC at position 887-889 (plus sense RNA) was replaced with the
serine codon AGU in the same frame. The numbering of nucleotides
follows Hiti et al., 1982, J. Virol. 41:730-734.
[0055] FIG. 17. Polyacrylamide gel electrophoresis of RNAs purified
from rescued influenza viruses. RNA transcripts of pT3NAs (FIG. 16)
of phenol-extracted RNA derived from influenza A/WSN/33 virus was
mixed with purified polymerase preparations following the protocol
described in Section 6.1.1, infra. These reconstituted RNPs were
then transfected into MDBK cells which had been infected one hour
earlier with WSN-HK helper virus. The medium, containing 28
.mu.g/ml plasminogen, was harvested after 16 hours and virus was
amplified and plaqued on MDBK cells in the absence of protease.
Virus obtained from plaques was then further amplified in MDBK
cells and RNA was phenol-extracted from purified virus preparations
as described in Sections 6.1 et seq. and 7.1 et seq. RNAs were
separated on 2.8% polyacrylamide-0.075% bisacrylamide gels
containing 7.7 M urea in TBE buffer and visualized by
silverstaining as described in Section 6.1 et seq. Lanes 1 and 6:
WSN-HK virus RNA. Lane 2: RNA of virus which was rescued from MDBK
cells following RNP-transfection with pT3NAv derived NA RNA and
infection with helper virus WSN-HK. Lane 3: NA RNA transcribed in
vitro from pT3NAv. Lane 4: RNA of control WSN virus. Lane 5: RNA of
virus which was rescued from MDBK cells following RNP-transfection
with phenol-extracted WSN virus RNA and infection with helper virus
WSN-HK.
[0056] FIG. 18. Sequence analysis of RNA obtained from rescued
influenza virus containing five site-specific mutations. Following
infection with the WSN-HK helper virus, MDBK cells were
RNP-transfected with T3NAv mut 2 RNA which was obtained by
transcription from pT3NAv mut 2. Following-overnight incubation in
the presence of 28 .mu.g/ml plasminogen, medium was used for
propagation and plaquing on MDBK cells in the absence of protease.
Virus from plaques was then amplified and RNA was obtained
following phenol-extraction of purified virus. Rescue of the mutant
NA gene into virus particles was verified through direct RNA
sequencing using 5'-TACGAGGAAATGTTCCTGTTA-3' as primer
(corresponding to position 800-819; Hiti et al., J. Virol.
41:730-734) and reverse transcriptase (Yamashita et al., 1988,
Virol. 163:112-122). Sequences shown correspond to position 878-930
in the NA gene (Hiti et al., J. Virol. 41:730-734). The arrows and
the underlined nucleotides indicate the changes in the mutant RNA
compared to the wild type RNA. Left: Control RNA obtained from
influenza A/WSN/33 virus. Right: RNA of mutant virus rescued from
MDBK cells which were RNP-transfected with T3NAv mut 2 RNA and
infected with helper virus WSN-HK.
[0057] FIG. 19. CAT expression in vaccinia virus-infected/IVACAT-1
RNP transfected cells. Approximately 10.sup.6 mouse C127 cells in
35 mm dishes were infected with mixtures of recombinant vaccinia
viruses (Smith et al., 1986) at an M.O.I. of approximately 10 for
each vector. After 1.5 hours, synthetic IVACAT-1 RNP was
transfected into the virus-infected cells as described (Lutjyes et
al., 1989). Cells were incubated overnight, harvested and assayed
for CAT activity according to standard procedures (Gorman et al.,
1982). The assays contained 0.05 uCl [.sup.14C] chloramphenicol, 20
ul of 40 mM acetyl-CoA (Boehringer and 50 ul of cell extracts in
0.25 M Tris buffer (pH 7.5). Incubation times were approximately 4
hours. The labels under the lane numbers indicate the treatment of
cells. Lanes 1-control; 2-naked RNA transfection (no polymerase
added), no helper virus infection; 3-RNP transfection, no helper
virus; 4-RNP transfection, influenza virus as helper; Lanes
5-11-RNP transfection, vaccinia virus vectors as helper viruses
express the indicated influenza virus proteins.
[0058] FIG. 20. Test of various cell lines. A) Cells were infected
with vaccinia vectors expressing the PB2, PB1 and PA proteins
(Lanes 1,3,5,7) or the PB2, PB1, PA and NP proteins (Lanes
2,4,6,8), transfected with IVACAT-1 RNP and examined for CAT
activity as described. Lanes 1,2: Maden-Darby Canine Kidney (MDCK)
cell; 3,4: Hela cells, 5,6: 293 cells (Graham et al., 1977 J. gen.
Virol 36: 59-72); 7,8 L cells. B) Cell line 3 PNP-4 was used as
host cell. Shown under each lane is the influenza viral proteins
expressed in each sample. C) 293 cells were infected with the four
required vaccinia and transfected with synthetic RNP made using
IVA-CAT-1 (lane 1) or IVA-CAT-2 (lane 2) RNA. After overnight
incubation, cells were harvested and CAT assayss were
performed.
[0059] FIG. 21. Schematic representation of plasmids used in
RNP-transfection experiments. All plasmids are pUC19 derivatives.
The arrows indicate selected restriction sites of the constructs.
Asterisks represent the first ATG at the 5' end of the encoded
mRNA. Closed squares represent the first ATG downstream of the
BIP-IRES sequences. Domains of the plasmids are indicated as
follows: 3'NA N.C. and 5'NA N.C.: 3' and 5' noncoding regions of
the influenza A/WSN/33 NA gene (Hiti, A. L. and Nayak, D. P., 1982,
J. Virology 41: 730-734); deINA: small ORF (110 aa) derived from
the influenza A/WSN/33 NA coding sequences; BIP: IRES sequences
derived from the 5' untranslated region of the BiP mRNA; CAT ORF:
coding sequences of the CAT gene; T3: truncated T3 RNA polymerase
promoter; NA coding sequence: NA coding sequence of the influenza
A/WSN/33 virus NA gene; X: coding sequences of the foreign
recombinant proteins GP2 or HGP2. ORFs 1 and 2 are indicated by a
line below the pT3GP2/BIP-NA and pT3HGP2/BIP-NA plasmid
representations. GP2 and HGP2 polypeptide domains are indicated at
the bottom. L: leader peptide (15 aa) derived from the HA protein
of influenza A/Japan/305/57 virus; GP41: ectodomain derived from
the ectodomain of the gp4l protein of HIV-1; TM and TM':
transmembrane domains derived from the gp4l protein (22 aa) of
HIV-1 and from the HA protein (27 aa) of influenza A/WSN/33 virus,
respectively; CT and CT': cytoplasmic tails derived from the
truncated cytoplasmic domain of gp4l (2 aa) of HIV-1 and from the
HA protein (10 aa) of influenza A/WSN/33 virus, respectively. The
total length in amino acids of the encoded GP2 and HGP2 proteins,
including the leader peptide, are indicated on the right.
[0060] FIG. 22. CAT assays of MDBK cells that were RNP-transfected
with NACAT(wt) or BIP-NA RNA. Cells were RNP-transfected 1 h after
virus infection, harvested 16 h posttransfection, and assayed for
CAT activity. Mock sample represents mock-transfected cells.
[0061] FIG. 23. Polyacrylamide gel electrophoresis of RNAS
extracted from BIP-NA transfectant influenza viruses. RNAs were
visualized by silver staining. RNAs that encode polymerase proteins
(P), hemagglutinin (HA), nucleoprotein (NP), neuraminidase (NA),
matrix proteins (M), and nonstructural proteins (NS) are indicated
on the left. BIP-NA RNA is indicated by the arrow. 18S ribosomal
RNA is also indicated. Lane 1: influenza A/WSN/33 virus RNA; lane
2: BIP-NA virus RNA; lane 3: RNA transcribed in vitro from
pT3BIP-NA. In order to facilitate the comparison of the RNA
patterns, lane 2 has a shorter photographic exposure time than
lanes 1 and 3.
[0062] FIG. 24. Polyacrylamide gel electrophoresis of RNAs
extracted from GP2/BIP-NA and HGP2/BIP-NA transfectant viruses.
RNAs were visualized by silver staining. RNAs that encode
polymerase proteins (P), hemagglutinin (HA), nucleoprotein (NP),
neuraminidase (NA), matrix proteins (M), and nonstructural proteins
(NS) are indicated on the right. The positions of GP2/BIP-NA and
HGP2/BIP-NA RNAs are indicated by arrows. 18S ribosomal RNA is also
indicated. Lanes 1 and 3: RNAs transcribed in vitro from
pT3HGP2/BIP-NA and pT3GP2/BIP-NA, respectively; lane 2: HGP2/BIP-NA
virus RNA; lane 4: GP2/BIP-NA virus RNA; lane 5: influenza A/WSN/33
virus RNA. Lane 5 has a shorter photographic exposure time than
lanes 1-4.
[0063] FIG. 25. Immunostaining of influenza virus-infected MDCK
cells. MDCK monolayers were infected at an MOI.gtoreq.2 with
influenza A/WSN/33 virus or with the transfectant viruses
GP2/BIP-NA or HGP2/BIP-NA. 9 h postinfection, cells were fixed and
stained with a specific monocional antibody (2F5) directed against
gp4l as described in Materials and Methods, Section 10.1.
below.
[0064] FIG. 26A-B. Western blot analysis of the GP2 and HGP2
proteins in infected cell extracts and in purified virions. A. MDBK
cells were infected at an MOI.gtoreq.2 with influenza A/WSN/33
virus, GP2/BIP-NA or HGP2/BIP-NA transfectant viruses. 8 h
postinfection, cells were lysed in NP-40 lysis buffer, and cellular
extracts were subjected to SDS-PAGE. The monocional antibody 2F5
was used to detect the recombinant proteins GP2 and HGP2 in the
western blot analysis. Lane 1: influenza A/WSN/33 virus-infected
cells; lane 2: GP2/BIP-NA virus-infected cells; lane 3: HGP2/BIP-NA
virus-infected cells. B. 2 .mu.g of purified virus was analyzed by
the same technique. Lane 1: influenza A/WSN/33 virus; lane 2:
GP2/BIP-NA virus; lane 3: HGP2/BIP-NA virus.
5. DESCRIPTION OF THE INVENTION
[0065] This invention relates to the construction and use of
recombinant negative strand viral RNA templates which may be used
with viral RNA-directed RNA polymerase to express heterologous gene
products in appropriate host cells and/or to rescue the
heterologous gene in virus particles. The RNA templates may be
prepared by transcription of appropriate DNA sequences using a
DNA-directed RNA polymerase such as bacteriophage T7, T3 or the Sp6
polymerase. Using influenza, for example, the DNA is constructed to
encode the message-sense of the heterologous gene sequence flanked
upstream of the ATG by the complement of the viral polymerase
binding site/promoter of influenza, i.e., the complement of the
3'-terminus of a genome segment of influenza. For rescue in virus
particles, it may be preferred to flank the heterologous coding
sequence with the complement of both the 3'-terminus and the
5'-terminus of a genome segment of influenza. After transcription
with a DNA-directed RNA polymerase, the resulting RNA template will
encode the negative polarity of the heterologous gene sequence and
will contain the vRNA terminal sequences that enable the viral
RNA-directed RNA polymerase to recognize the template.
[0066] The recombinant negative sense RNA templates may be mixed
with purified viral polymerase complex comprising viral
RNA-directed RNA polymerase proteins (the P proteins) and
nucleoprotein (NP) which may be isolated from RNP cores prepared
from whole virus to form "recombinant RNPs" (rRNPs). These rRNPs
are infectious and may be used to express the heterologous gene
product in appropriate host cells or to rescue the heterologous
gene in virus particles by cotransfection of host cells with the
rRNPs and virus. Alternatively, the recombinant RNA templates may
be used to transfect transformed cell lines that express the
RNA-directed RNA polymerase proteins allowing for
complementation.
[0067] The invention is demonstrated by way of working examples in
which. RNA transcripts of cloned DNA containing the coding
region--in negative sense orientation--of the chloramphenicol
acetyltransferase (CAT) gene, flanked by the the 22 5' terminal and
the 26 3' terminal nucleotides of the influenza A/PR/8/34 virus NS
RNA were mixed with isolated influenza A virus polymerase proteins.
This reconstituted ribonucleoprotein (RNP) complex was transfected
into MDCK (or 293) cells, which were infected with influenza virus.
CAT activity was negligible before and soon after virus infection,
but was demonstrable by seven hours post virus infection. When cell
supernatant containing budded virus from this "rescue" experiment
was used to infect a new monolayer of MDCK cells, CAT activity was
also detected, suggesting that the RNA containing the recombinant
CAT gene had been packaged into virus particles. These results
demonstrate the successful use of recombinant negative strand viral
RNA templates and purified RNA-dependent RNA polymerase to
reconstitute recombinant influenza virus RNP. Furthermore, the data
suggest that the 22 5' terminal and the 26 3' terminal sequences of
the influenza A virus RNA are sufficient to provide the signals for
RNA tanscription, RNA replication and for packaging of RNA into
influenza virus particles.
[0068] Using this methodology we also demonstrated the rescue of
synthetic RNAs, derived from appropriate recombinant plasmid DNAs,
into stable and infectious influenza viruses. In particular, RNA
corresponding to the neuraminidase (NA) gene-of influenza A/WSN/33
virus (WSN) was transcribed in vitro from plasmid DNA and,
following the addition of purified influenza virus polymerase
complex, was transfected into MDBK cells. Superinfection with
helper virus lacking the WSN NA gene resulted in the release of
virus containing the WSN NA gene. We then introduced five point
mutations into the WSN NA gene by cassette mutagenesis of the
plasmid DNA. Sequence analysis of the rescued virus revealed that
the genome contained all five mutations present in the mutated
plasmid. This technology can be used to create viruses with
site-specific mutations so that influenza viruses with defined
biological properties may be engineered.
[0069] The ability to reconstitute RNP's in vitro allows the design
of novel chimeric influenza viruses which express foreign genes.
One way to achieve this goal involves modifying existing influenza
virus genes. For example, the HA gene may be modified to contain
foreign sequences in its external domains. Where the heterologous
sequence are epitopes or antigens of pathogens, these chimeric
viruses may be used to induce a protective immune response against
the disease agent from which these determinants are derived. In
addition to modifying genes coding for surface proteins, genes
coding for nonsurface proteins may be altered. The latter genes
have been shown to be associated with most of the important
cellular immune responses in the influenza virus system (Townsend
et al., 1985, Cell 42:475-482). Thus, the inclusion of a foreign
determinant in the NP or the NS gene of an influenza virus
may--following infection--induce an effective cellular immune
response against this determinant. Such an approach may be
particularly helpful in situations in which protective immunity
heavily depends on the induction of cellular immune responses
(e.g., malaria, etc.).
[0070] Another approach which would permit the expression of
foreign proteins (or domains of such proteins) via chimeric
influenza viruses concerns the introduction of complete
heterologous genes into the virus. Influenza virus preparations
with more than eight RNA segments have previously been described
(Nayak, D. et al. in Genetics of Influenza Virus, P. Palese and D.
W. Kingsbury, eds., Springer-Verlag, Vienna, pp. 255-279). Thus,
chimeric influenza viruses with nine or more RNA segments may be
viable, and correct packaging of such chimeric viruses may readily
occur.
[0071] The invention may be divided into the following stages
solely for the purpose of description and not by way of limitation:
(a) construction of recombinant RNA templates; (b) expression of
heterologous gene products using the recombinant RNA templates; and
(c) rescue of the heterologous gene in recombinant virus particles.
For clarity of discussion, the invention is described in the
subsections below using influenza. Any strain of influenza (e.g.,
A, B, C) may be utilized. However, the principles may be
analagously applied to construct other negative strand RNA virus
templates and chimeric viruses including, but not limited to
paramyxoviruses, such as parainfluenza viruses, measles viruses,
respiratory syncytial virus; bunyaviruses; arena viruses; etc. A
particularly interesting virus system that can be used in
accordance with the invention are the orthomyxo-like insect virus
called Dhori (Fuller, 1987, Virology 160:81-87).
5.1. Construction of the Recombinant RNA Templates
[0072] Heterologous gene coding sequences flanked by the complement
of the viral polymerase binding site/promoter, e.g, the complement
of 3'-influenza virus terminus, or the complements of both the 3'-
and 5'-influenza virus termini may be constructed using techniques
known in the art. Recombinant DNA molecules containing these hybrid
sequences can be cloned and transcribed by a DNA-directed RNA
polymerase, such as bacteriophage T7, T3 or the Sp6 polymerase and
the like, to produce the recombinant RNA templates which possess
the appropriate viral sequences that allow for viral polymerase
recognition and activity.
[0073] One approach for constructing these hybrid molecules is to
insert the heterologous coding sequence into a DNA complement of an
influenza virus genomic segment so that the heterologous sequence
is flanked by the viral sequences required for viral polymerase
activity; i.e., the viral polymerase binding site/promoter,
hereinafter referred to as the viral polymerase binding site. In an
alternative approach, oligonucleotides encoding the viral
polymerase binding site, e.g., the complement of the 3'-terminus or
both termini of the virus genomic segments can be ligated to the
heterologous coding sequence to construct the hybrid molecule. The
placement of a foreign gene or segment of a foreign gene within a
target sequence was formerly dictated by the presence of
appropriate restriction enzyme sites within the target sequence.
However, recent advances in molecular biology have lessened this
problem greatly. Restriction enzyme sites can readily be placed
anywhere within a target sequence through the use of site-directed
mutagenesis (e.g., see, for example, the techniques described by
Kunkel, 1985, Proc. Natl. Acad. Sci. U.S.A. 82;488). Variations in
polymerase chain reaction (PCR) technology, described infra, also
allow for the specific insertion of sequences (i.e., restriction
enzyme sites) and allow for the facile construction of hybrid
molecules. Alternatively, PCR reactions could be used to prepare
recombinant templates without the need of cloning. For example, PCR
reactions could be used to prepare double-stranded DNA molecules
containing a DNA-directed RNA polymerase promoter (e.,
bacteriophase T3, T7 or Sp6) and the hybrid sequence containing the
heterologous gene and the influenza viral polymerase binding site.
RNA templates could then be transcribed directly from this
recombinant DNA. In yet another embodiment, the recombinant RNA
templates may be prepared by ligating RNAs specifying the negative
polarity of the heterologous gene and the viral polymerase binding
site using an RNA ligase. Sequence requirements for viral
polymerase activity and constructs which may be used in accordance
with the invention are described in the subsections below.
5.1.1. The Viral 3'-Terminus is Required for Polymerase
Activity
[0074] The experiments described in Section 6 et seq., infra, are
the first to define promoter sequences for a polymerase of a
negative-sense RNA virus, and it was found that the specificity
lies in the 3' terminal 15 nucleotides. These viral polymerase
binding site sequences, as well as functionally equivalent
sequences may be used in accordance with the invention. For
example, functionally equivalent sequences containing substitions,
insertions, deletions, additions or inversions which exhibit
similar activity may be utilized. The RNA synthesis by the viral
polymerase described infra is a model for specific recognition and
elongation by the influenza viral polymerase for the following
reasons: (a) the polymerase has high activity when primed with ApG,
a feature unique to influenza viral polymerase; (b) it has optimal
activity at temperature and ionic conditions previously shown to be
effective for the viral RNPs; (c) the polymerase is specific for
influenza viral sequences on the model RNA templates; (d) the
polymerase is active in the cap-endonuclease primed RNA synthesis
which is the hallmark of the influenza viral polymerase; (e)
recognition of cap donor RNA is specific to cap 1 structures; and
(f) genomic RNA segments are specifically copied.
5.1.2. A Terminal Panhandle is not Required for Optimal Recognition
and Synthesis by the Viral Polymerase
[0075] We had previously shown that the influenza viral segment
RNAs base-pair at their termini to form panhandle structures. This
was achieved by two methods. A cross-linking reagent derivative of
psoralen covalently bound the termini of each segment in intact
virus or in RNPs from infected cells (Hsu et al., 1987, Proc. Natl.
Acad. Sci. USA 84: 8140-8144). The treated RNA was seen by electron
microscopy to be circular, by virtue of the crosslinked termini.
Similarly, the RNA termini in RNPs were found to be sensitive to
ribonuclease V1, which recognizes and cleaves double-stranded RNA,
and the viral polymerase was found to be bound to both termini in
the panhandle conformation (Honda, et al., 1988, J. Biochem. 104:
1021-1026). In these studies the panhandle structure of the genomic
RNA was shown to exist, and it was inferred to play a role in
polymerase recognition. Although the template RNAs used in the
examples described, were originally prepared to reveal
panhandle-specific protein binding, it was found that the terminal
panhandle had no obvious role in the polymerase reactions studied
herein.
5.1.3. The RNA Polymerase Preparation Specifically Copies Negative
Sense Templates
[0076] The viral polymerase was shown to synthesize RNA with
optimal efficiency if the template had the "wild-type" negative
sense 3' terminus. It was shown that RNAs of unrelated sequence
were not copied, and that those with extra polylinker sequences on
the 3' end were much less efficiently copied. A DNA of the correct
sequence was similarly unsuitable as a template. The reaction was
highly specific since the M-wt template was replicated only at very
low levels. Even though our source of polymerase was intact virus,
this finding was very surprising since it had never been suggested
that the polymerase which recognizes the viral sense RNA would not
efficiently copy the plus sense strand. Studies are underway to
examine the specificity of the polymerase purified from infected
cells at times post infection when the complementary RNA is copied
into genomic templates. The present data support a model whereby
the viral polymerase which copies vRNA is functionally different
from that which synthesizes vRNA from cRNA by virtue of their
promoter recognition. It is possible that by regulated modification
of the polymerase in infected cells it then becomes capable of
recognizing the 3' terminus of plus sense RNA. By analyzing
promoter mutants we investigated the fine specificity of the
reaction and found that the only single mutation which generated a
significantly lower level of synthesis was that of V-A.sub.3 RNA.
Furthermore, combinations of two or more point changes in positions
3, 5, 8 and 10 greatly lowered synthesis levels.
5.1.4. Insertion of the Heterologous Gene Sequence into the PB2,
PB1, PA or NP Gene Segments
[0077] The gene segments coding for the PB2, PB1, PA and NP
proteins contain a single open reading frame with 24-45
untranslated nucleotides at their 5'-end, and 22-57 untranslated
nucleotides at their 3'-end. Insertion of a foreign gene sequence
into any of these segments could be accomplished by either a
complete replacement of the viral coding region with the foreign
gene or by a partial replacement. Complete replacement would
probably best be accomplished through the use of PCR-directed
mutagenesis. The principle of this mutagenesis method is
illustrated in FIG. 10. Briefly, PCR-primer A would contain, from
5' to 3', a unique restriction enzyme site, such as a class IIS
restriction enzyme site (i.e., a "shifter" enzyme; that recognizes
a specific sequence but cleaves the DNA either upstream or
downstream of that sequence); the entire 3' untranslated region of
the influenza gene segment; and a stretch of nucleotides
complementary to the carboxy-terminus coding portion of the foreign
gene product. PCR-primer B would contain from the 5' to 3' end: a
unique restriction enzyme site; a truncated but active phage
polymerase sequence; the complement of the entire 5' untranslated
region of the influenza gene segment (with respect to the negative
sense vRNA); and a stretch of nucleotides corresponding to the 5'
coding portion of the foreign gene. After a PCR reaction using
these primers with a cloned copy of the foreign gene, the product
may be excised and cloned using the unique restriction sites.
Digestion with the class IIS enzyme and transcription with the
purified phage polymerase would generate an RNA molecule containing
the exact untranslated ends of the influenza viral gene segment
with a foreign gene insertion. Such a construction is described for
the chloramphenicol acetyltransferase (CAT) gene used in the
examples described in Section 7 infra. In an alernate embodiment,
PCR-primed reactions could be used to prepare double-stranded DNA
containing the bacteriophage promoter sequence, and the hybrid gene
sequence so that RNA templates can be transcribed directly without
cloning.
[0078] Depending on the integrity of the foreign gene product and
the purpose of the construction, it may be desirable to construct
hybrid sequences that will direct the expression of fusion
proteins. For example, the four influenza virus proteins, PB2, PB1,
PA or NP are polymerase proteins which are directed to the nucleus
of the infected cell through specific sequences present in the
protein. For the NP this amino acid sequence has been found to be
(single letter code) QLVWMACNSAAFEDLRVLS (Davey et al., 1985, Cell
40:667-675). Therefore, if it is desired to direct the foreign gene
product to the nucleus (if by itself it would not ordinarily do so)
the hybrid protein should be engineered to contain a domain which
directs it there. This domain could be of influenza viral origin,
but not necessarily so. Hybrid proteins can also be made from
non-viral sources, as long as they contain the necessary sequences
for replication by influenza virus (3' untranslated region,
etc.).
[0079] As another example, certain antigenic regions of the viral
gene products may be substituted with foreign sequences. Townsend
et al., (1985, Cell 42:475-482), identified an epitope within the
NP molecule which is able to elicit a vigorous CTL (cytotoxic T
cell) response. This epitope spans residues 147-161 of the NP
protein and consists of the amino acids TYQRTRQLVRLTGMDP.
Substituting a short foreign epitope in place of this NP sequence
may elicit a strong cellular immune response against the intact
foreign antigen. Conversely, expression of a foreign gene product
containing this 15 amino acid region may also help induce a strong
cellular immune response against the foreign protein.
5.1.5. Insertion of the Heterologous Gene Sequence into the HA or
NA Gene Segments
[0080] The HA and NA proteins, coded for by separate gene segments,
are the major surface glycoproteins of the virus. Consequently,
these proteins are the major targets for the humoral immune
response after infection. They have been the most widely-studied of
all the influenza viral proteins as the three-dimensional
structures of both these proteins have been solved.
[0081] The three-dimensional structure of the H3 hemagglutinin
along with sequence information on large numbers of variants has
allowed for the elucidation of the antigenic sites on the HA
molecule (Webster et al., 1983, In Genetics Of Influenza Virus, P.
Palese and D. W. Kingsbury, eds., Springer-Verlag, Vienna, pp.
127-160). These sites fall into four discrete non-overlapping
regions on the surface of the HA. These regions are highly variable
and have also been shown to be able to accept insertions and
deletions. Therefore, substitution of these sites within HA (e.g.,
site A; amino acids 122-147 of the A/HK/68 HA) with a portion of a
foreign protein may provide for a vigorous humoral response against
this foreign peptide. In a different approach, the foreign peptide
sequence may be inserted within the antigenic site without deleting
any viral sequences. Expression products of such constructs may be
useful in vaccines against the foreign antigen, and may indeed
circumvent a problem discussed earlier, that of propagation of the
recombinant virus in the vaccinated host. An intact HA molecule
with a substitution only in antigenic sites may allow for HA
function and thus allow for the construction of a viable virus.
Therefore, this virus can be grown without the need for additional
helper functions. Of course, the virus should be attenuated in
other ways to avoid any danger of accidental escape.
[0082] Other hybrid constructions may be made to express proteins
on the cell surface or enable them to be released from the cell. As
a surface glycoprotein, the HA has an amino-terminal cleavable
signal sequence necessary for transport to the cell surface, and a
carboxy-terminal sequence necessary for membrane anchoring. In
order to express an intact foreign protein on the cell surface it
may be necessary to use these HA signals to create a hybrid
protein. Alternatively, if only the transport signals are present
and the membrane anchoring domain is absent, the protein may be
excreted out of the cell.
[0083] In the case of the NA protein, the three-dimensional
structure is known but the antigenic sites are spread out over the
surface of the molecule and are overlapping. This indicates that if
a sequence is inserted within the NA molecule and it is expressed
on the outside surface of the NA it will be immunogenic.
Additionally, as a surface glycoprotein, the NA exhibits two
striking differences from the HA protein. Firstly, the NA does not
contain a cleavable signal sequence; in fact, the amino-terminal
signal sequence acts as a membrane anchoring domain. The
consequence of this, and the second difference between the NA and
HA, is that the NA is orientated with the amino-terminus in the
membrane while the HA is orientated with the carboxy-terminus in
the membrane. Therefore it may be advantageous in some cases to
construct a hybrid NA protein, since the fusion protein will be
orientated opposite of a HA-fusion hybrid.
5.1.6. Insertion of the Heterologous Gene into the NS and M Gene
Segments
[0084] The unique property of the NS and M segments as compared to
the other six gene segments of influenza virus is that these
segments code for at least two protein products. In each case, one
protein is coded for by an mRNA which is co-linear with genomic RNA
while the other protein is coded for by a spliced message. However,
since the splice donor site occurs within the coding region for the
co-linear transcript, the NS1 and NS2 proteins have an identical 10
amino acid amino terminus while M1 and M2 have an idential 14 amino
acid amino terminus.
[0085] As a result of this unique structure, recombinant viruses
may be constructed so as to replace one gene product within the
segment while leaving the second product intact. For instance,
replacement of the bulk of the NS2 or M2 coding region with a
foreign gene product (keeping the splice acceptor site) could
result in the expression of an intact NS1 or M1 protein and a
fusion protein instead of NS2 or M2. Alternatively, a foreign gene
may be inserted within the NS gene segment without affecting either
NS1 or NS2 expression. Although most NS genes contain a substantial
overlap of NS1 and NS2 reading frames, certain natural NS genes do
not. We have analyzed the NS gene segment from A/Ty/Or/71 virus
(Norton et al., 1987, Virology 156:204-213) and found that in this
particular gene, the NS1 protein terminates at nucleotide position
409 of the NS gene segment while the splice acceptor site for the
NS2 is at nucleotide position 528. Therefore, a foreign gene could
be placed between the termination codon of the NS1 coding region
and the splice acceptor site of the NS2 coding region without
affecting either protein. It may be necessary to include a splice
acceptor site at the 5' end of the foreign gene sequence to ensure
protein production (this would encode a hybrid protein containing
the amino-terminus of NS1). In this way, the recombinant virus
should not be defective and should be able to be propagated without
need of helper functions.
[0086] Although the influenza virus genome consists of eight
functional gene segments it is unknown how many actual segments a
virus packages. It has been suggested that influenza can package
more than eight segments, and possibly up to 12 (Lamb and Choppin,
1983, Ann. Rev. Biochem. 52:467-506). This would allow for easier
propagation of recombinant virus in that "ninth" gene segment could
be designed to express the foreign gene product. Although this
"ninth" segment may be incorporated into some viruses, it would
soon be lost during virus growth unless some selection is supplied.
This can be accomplished by "uncoupling" the NS or M gene segment.
The NS2 coding portion could be removed from the NS gene segment
and placed on the gene segment coding for the foreign protein
(along with appropriate splicing signals). The resulting
recombinant virus with the "uncoupled" NS or M gene would be able
to propagate on its own and also would necessarily have to package
the "ninth" gene segment, thus ensuring expression of the foreign
gene.
[0087] Alternatively, a bicistronic mRNA could be constructed to
permit internal initiation of translation of viral sequences and
allow for the expression of foreign protein coding sequences from
the regular terminal initiation site. Alternatively, a bicistronic
mRNA sequence may be constructed wherein the viral sequence is
translated from the regular terminal open reading frame, while the
foreign sequence is initiated from an internal site. Certain
internal ribosome entry site (IRES) sequences may be utilized. The
IRES sequences which are chosen should be short enough to not
interfere with influenza virus packaging limitations. Thus, it is
prefereable that the IRES chosen for such a bicistronic approach be
no more than 500 nucleotides in length, with less than 250
nucleotides being preferred. Further, it is preferable that the
IRES utilized not share sequence or structural homology with
picornaviral elements. Preferred IRES elements include, but are not
limited to the mammalain BiP IRES (see Section 10, below) and the
hepatitis C virus IRES.
5.2. Expression of Heterologous Gene Products using Recombinant RNA
Template
[0088] The recombinant templates prepared as described above can be
used in a variety of ways to express the heterologous gene products
in appropriate host cells or to create chimeric viruses that
express the heterologous gene products. In one embodiment, the
recombinant template can be combined with viral polymerase complex
purified as described in Section 6, infra, to produce rRNPs which
are infectious. To this end, the recombinant template can be
transcribed in the presence of the viral polymerase complex.
Alternatively, the recombinant template may be mixed with or
transcribed in the presence of viral polymerase complex prepared
using recombinant DNA methods (e.g. see Kingsbury et al., 1987,
Virology 156:396-403). Such rRNPs, when used to transfect
appropriate host cells, may direct the expression of the
heterologous gene product at high levels. Host cell systems which
provide for high levels of expression include continuous cell lines
that supply viral functions such as cell lines superinfected with
influenza, cell lines engineered to complement influenza viral
functions, etc.
[0089] In an alternate embodiment of the invention, the recombinant
templates or the rRNPs may be used to transfect cell lines that
express the viral polymerase proteins in order to achieve
expression of the heterologous gene product. To this end,
transformed cell lines that express all three polymerase proteins
such as 3P-38 and 3P-133 (Krystal et al., 1986, Proc. Natl. Acad.
Sci. U.S.A. 83:2709-2713) may be utilized as appropriate host
cells. Host cells may be similarly engineered to provide other
viral functions or additional functions such as NP.
5.2.1. Purifacation of the Viral Polymerase
[0090] The viral polymerase proteins used to produce the rRNPs may
be purified from dissociated RNP cores isolated from whole virus.
In general, RNP cores may be prepared using standard methods
(Plotch et al., 1981, Cell 23:847-858; Rochavansky, 1976, Virology
73:327-338). The pooled RNP cores may then be centrifuged on a
second gradient of CsCl (1.5-3.0 M) and glycerol (30%-45%) as
described by Honda et al., 1988, J. Biochem. 104:1021-1026. The
active viral polymerase fractions may be isolated from top of the
gradient, i.e. in the region of the gradient correlating with 1.5
to 2.0 M CsCl and corresponding to the fraction Honda et al.
identified as "NP". Surprisingly, this fraction contains all the
viral polymerase proteins required for the active complex.
Moreover, the P proteins which may be recovered from the bottom of
the gradient are not required, and indeed do not provide for the
transcription of full length viral RNA. Thus, it appears that the
so-called "NP" fraction contains, in addition to NP, the active
forms of the PB2, PB1, and PA proteins.
5.2.2. High Concentrations of Polymerase are Required for
Cap-Primed RNA Synthesis
[0091] High concentrations of viral polymerase complex are able to
catalyze this virus-specific cap-endonuclease primed transcription.
Under the conditions specified in Section 6 infra, about 50 ng NP
with 200 pg of the three P proteins were found to react optimally
with 5 to 10 ng RNA reaction. The observation has been that
although the NP selectively encapsidates influenza vRNA or cRNA in
vivo, the NP will bind to RNA nonspecifically in vitro (Kingsbury,
et al., 1987, Virology 156: 396-403; Scholtissek and Becht, 1971,
J. Gen. Virol. 10: 11-16). Presumably, in order for the viral
polymerase to recognize the viral template RNAs in our in vitro
reaction, they have to be encapsidated by the NP. Therefore, the
addition of a capped mRNA primer would essentially compete with the
template RNA for binding of NP. Since the dinucleotide ApG would
not be expected to bind NP, the low concentration polymerase was
able to use only the short templates with ApG. Supporting this
hypothesis is the observation that the higher concentration
polymerase preparation is inhibited through the addition of
progressively higher amounts of either template RNA or any
non-specific RNA. It should also be noted that the unusual
specificity for the m7GpppXm cap 1 structure previously shown with
viral RNPs was also found with the reconstituted RNPs.
5.2.3. Genomic Length RNA Templates are Efficiently Copied
[0092] Plasmid-derived RNA identical to segment 8 of the A/WSN/33
virus was specifically copied by the polymerase (using the PCR
method described in FIG. 10). In reactions using RNA extracted from
virus, all eight segments were copied, although the HA gene was
copied at a lower level. The background in these reactions was
decreased in comparison to the 30 to 53 nt templates, probably
since the contaminating RNAs in the polymerase preparation were
predominantly defective RNAs of small size. Recombinant templates
encoding foreign genes transcribed in this system may be used to
rescue the engineered gene in a virus particle.
5.3. Preparation of Chimeric Negative Strand RNA Virus
[0093] In order to prepare chimeric virus, reconstituted RNPs
containing modified influenza virus RNAs or RNA coding for foreign
proteins may be used to transfect cells which are also infected
with a "parent" influenza virus. Alternatively, the reconstituted
RNP preparations may be mixed with the RNPs of wild type parent
virus and used for transfection directly. Following reassortment,
the novel viruses may be isolated and their genomes be identified
through hybridization analysis. In additional approaches described
herein for the production of infectious chimeric virus, rRNPs may
be replicated in host cell systems that express the influenza viral
polymerase proteins (e.g., in virus/host cell expression systems;
transformed cell lines engineered to express the polymerase
proteins, etc.), so that infectious chimeric virus are rescued; in
this instance, helper virus need not be utilized since this
function is provided by the viral polymerase proteins expressed. In
a particularly desirable approach, cells infected with rRNPs
engineered for all eight influenza virus segments may result in the
production of infectious chimeric virus which contain the desired
genotype; thus eliminating the need for a selection system.
[0094] Theoretically, one can replace any one of the eight gene
segments, or part of any one of the eight segments with the foreign
sequence. However, a necessary part of this equation is the ability
to propagate the defective virus (defective because a normal viral
gene product is missing or altered). A number of possible
approaches exist to circumvent this problem. We have shown that
mutants of influenza virus defective in the PB2 and NP proteins can
be grown to substantially higher titers in cell lines which were
constructed to constitutively express the polymerase and NP
proteins (Krystal et al., 1986 Proc. Natl. Acad. Sci. U.S.A.
83:2709-2813). Similar techniques may be used to construct
transformed cell lines that constitutively express any of the
influenza genes. These cell lines which are made to express the
viral protein may be used to complement the defect in the
recombinant virus and thereby propagate it. Alternatively, certain
natural host range systems may be available to propagate
recombinant virus. An example of this approach concerns the natural
influenza isolate CR43-3. This virus will grow normally when
passaged in primary chick kidney cells (PCK) but will not grow in
Madin-Darby canine kidney cells (MDCK), a natural host for
influenza (Maassab & DeBorde, 1983, Virology 130:342-350). When
we analyzed this virus we found that it codes for a defective NS1
protein caused by a deletion of 12 amino acids. The PCK cells
contain some activity which either complements the defective NS1
protein or can completely substitute for the defective protein.
[0095] A third approach to propagating the recombinant virus may
involve co-cultivation with wild-type virus. This could be done by
simply taking recombinant virus and co-infecting cells with this
and another wild-type virus (preferably a vaccine strain). The
wild-type virus should complement for the defective virus gene
product and allow growth of both the wild-type and recombinant
virus. This would be an analagous situation to the propagation of
defective-interfering particles of influenza virus (Nayak et al.,
1983, In: Genetics of Influenza Viruses, P. Palese and D. W.
Kingsbury, eds., Springer-Verlag, Vienna, pp. 255-279). In the case
of defective-interfering viruses,. conditions can be modified such
that the majority of the propagated virus is the defective particle
rather than the wild-type virus. Therefore this approach may be
useful in generating high titer stocks of recombinant virus.
However, these stocks would necessarily contain some wild-type
virus.
[0096] Alternatively, synthetic RNPs may be replicated in cells
co-infected with recombinant viruses that express the influenza
virus polymerase proteins. In fact, this method may be used to
rescue recombinant infectious virus in accordance with the
invention. To this end, the influenza virus polymerase proteins may
be expressed in any expression vector/host cell system, including
but not limited to viral expression vectors (e.g., vaccinia virus,
adenovirus, baculovirus, etc.) or cell lines that express the
polymerase proteins (e.g., see Krystal et al., 1986, Proc. Natl.
Acad. Sci. USA 83: 2709-2713). Moreover, infection of host cells
with rRNPs encoding all eight influenza virus proteins may result
in the production of infectious chimeric virus particles. This
system would eliminate the need for a selection system, as all
recombinant virus produced would be of the desired genotype. In the
examples herein, we describe a completely synthetic replication
system where, rather than infecting cells with influenza virus,
synthetic RNP's are replicated in cells through the action of
influenza virus proteins expressed by recombinant vaccinia vectors.
In this way we show that the only influenza virus proteins
essential for transcription and replication of RNP are the three
polymerase proteins and the nucleoprotein.
[0097] It should be noted that it may be possible to construct a
recombinant virus without altering virus viability. These altered
viruses would then be growth competent and would not need helper
functions to replicate. For example, alterations in the
hemagglutinin gene segment and the NS gene segment discussed,
supra, may be used to construct such viable chimeric viruses.
[0098] In the examples infra, the construction of a recombinant
plasmid is described that, following transcription by T7
polymerase, yielded an RNA template which was recognized and
transcribed by the influenza virus polymerase in vitro. This RNA
template corresponds to the NS RNA of an influenza virus except
that the viral coding sequences are replaced by those of a CAT
gene. This recombinant negative strand viral RNA template was then
mixed with purified influenza virus polymerase to reconstitute an
RNP complex. The recombinant RNP complex was transfected into cells
which were then infected with influenza virus, leading to
expression of CAT activity.
[0099] A number of factors indicate that this system represents a
biologically active recombinant RNP complex which is under tight
control of the signals for transcription, replication and packaging
of influenza virus RNAs. First, the CAT gene is of negative
polarity in the recombinant viral RNA used for RNP transfection.
Thus, the ircoming RNA cannot be translated directly in the cell
and must first be transcribed by the influenza virus polymerase to
permit translation and expression of the CAT gene. Secondly,
neither transfected naked recombinant RNA alone in the presence of
infecting helper virus, nor recombinant RNP complex in the absence
of infecting helper virus is successful in inducing CAT activity.
This suggests that influenza viral proteins provided by the
incoming RNP, as well as by the infecting helper virus, are
necessary for the amplification of the recombinant RNA template.
Finally, after RNP-transfection and infection by helper virus,
virus particles emerge which apparently contain the recombinant
RNA, since these particles again induce CAT activity in freshly
infected cells. These results suggest that the 26 3' terminal and
the 22 5' terminal nucleotides corresponding to the terminal
nucleotides in the influenza A virus NS RNA are sufficient to
provide the signals for polymerase transcription and replication,
as well as for packaging of the RNA into particles.
[0100] The foregoing results, which defined the cis acting
sequences required for transciption, replication and packaging of
influenza virus RNAs, were extended by additional working examples,
described infra, which demonstrate that recombinant DNA techniques
can be used to introduce site-specific mutations into the genomes
of infectious influenza viruses.
[0101] Synthetic RNAS, derived by transcription of plasmid RNA in
vitro were used in RNP-transfection experiments to rescue
infectious influenza virus. To enable selection of this virus, we
chose a system that required the presence of a WSN-like
neuraminidase gene in the rescued virus. Viruses containing this
gene can grow in MDBK cells in the absence of protease in the
medium (Schulman et al., 1977, J. Virol. 24:170-176). The helper
virus WSN-HK does not grow under these circumstances. Clearly,
alternative selection systems exist. For example, antibody screens
or conditionally lethal mutants could be used to isolate rescued
viruses containing RNAs derived from plasmid DNAs. In the
experiments viruses described infra, viruses which were WSN
virus-like were recovered. The WSN NA gene was derived from plasmid
DNAs or from purified WSN virion RNA (FIG. 17, lanes 2 and 5). In
the latter case, using whole virion RNA for the RNP-transfection,
we do not know whether other genes were also transfered to the
rescued virus, since the helper virus shares the remaining seven
genes with WSN virus. The rescued viruses had the expected RNA
patterns (FIG. 17) and grew to titers in MDBK or MDCK cells which
were indistinguishable from those of the wild type WSN virus. It
should be noted that rescue of an NA RNA containing a single
nucleotide deletion in the 5' nontranslated region was not
possible. This again illustrates the importance of regulatory
sequences present in the non-translated regions of influenza virus
RNAs. We also rescued virus using RNA that was engineered to
contain 5 nucleotide changes in a 39 nucleotide long region (FIG.
16). We verified the presence of these mutations in the rescued
mutant virus by direct sequencing of the RNA (FIG. 18). These
mutations did not result in any amino acid change in the
neuraminidase protein and thus were not expected to change the
biological property of the virus. Although this virus was not
extensively studied, its plaquing behavior and its growth
characteristics were indistinguishable from that of wild type WSN
virus. Using such technology, mutations may be introduced that will
change the biological characteristics of influenza viruses. These
studies will help in distinguishing the precise functions of all
the viral proteins, including those of the nonstructural proteins.
In addition, the nontranslated regions of the genome can be studied
by mutagenesis, which should lead to a better understanding of the
regulatory signals present in viral RNAs. An additional area of
great interest concerns the development of the influenza virus
system as a vaccine vector.
5.4. Vaccine Formulations Using the Chimeric Viruses
[0102] Virtually any heterologous gene sequence may be constructed
into the chimeric viruses of the invention for use in vaccines.
Preferably, epitopes that induce a protective immune response to
any of a variety of pathogens, or antigens that bind neutralizing
antibodies may be expressed by or as part of the chimeric viruses.
For example, heterologous gene sequences that can be constructed
into the chimeric viruses of the invention for use in vaccines
include but are not limited to epitopes of human immunodeficiency
virus (HIV) such as gp120; hepatitis B virus surface antigen
(HBsAg); the glycoproteins of herpes virus (e.g. gD, gE); VP1 of
poliovirus; antigenic determinants of non-viral pathogens such as
bacteria and parasites, to name but a few. In another embodiment,
all or portions of immunoglobulin genes may be expressed. For
example, variable regions of anti-idiotypic immunoglobulins that
mimic such epitopes may be constructed into the chimeric viruses of
the invention.
[0103] Either a live recombinant viral vaccine or an inactiviated
recombinant viral vaccine can be formulated. A live vaccine may be
preferred because multiplication in the host leads to a prolonged
stimulus of similar kind and magnitude to that occurring in natural
infections, and therefore, confers substantial, long-lasting
immunity. Production of such live recombinant virus vaccine
formulations may be accomplished using conventional methods
involving propagation of the virus in cell culture or in the
allantois of the chick embryo followed by purification.
[0104] In this regard, the use of genetically engineered influenza
virus (vectors) for vaccine purposes may require the presence of
attenuation characteristics in these strains. Current live virus
vaccine candidates for use in humans are either cold adapted,
temperature sensitive, or passaged so that they derive several
(six) genes from avian viruses, which results in attenuation. The
introduction of appropriate mutations (e.g., deletions) into the
templates used for transfection may provide the novel viruses with
attenuation characteristics. For example, specific missense
mutations which are associated with temperature sensitivity or cold
adaption can be made into deletion mutations. These mutations
should be more stable than the point mutations associated with cold
or temperature sensitive mutants and reversion frequencies should
be extremely low.
[0105] Alternatively, chimeric viruses with "suicide"
characteristics may be constructed. Such viruses would go through
only one or a few rounds of replication in the host. For example,
cleavage of the HA is necessary to allow for reinitiation of
replication. Therefore, changes in the HA cleavage site may produce
a virus that replicates in an appropriate cell system but not in
the human host. When used as a vaccine, the recombinant virus would
go through a single replication cycle and induce a sufficient level
of immune response but it would not go further in the human host
and cause disease. Recombinant viruses lacking one or more of the
essential influenza virus genes would not be able to undergo
successive rounds of replication. Such defective viruses can be
produced by co-transfecting reconstituted RNPs lacking a specific
gene(s) into cell lines which permanently express this gene(s).
Viruses lacking an essential gene(s) will be replicated in these
cell lines but when administered to the human host will not be able
to complete a round of replication. Such preparations may
transcribe and translate--in this abortive cycle--a sufficient
number of genes to induce an immune response. Alternatively, larger
quantities of the strains could be administered, so that these
preparations serve as inactivated (killed) virus vaccines. For
inactivated vaccines, it is preferred that the heterologous gene
product be expressed as a viral component, so that the gene product
is associated with the virion. The advantage of such preparations
is that they contain native proteins and do not undergo
inactivation by treatment with formalin or other agents used in the
manufacturing of killed virus vaccines.
[0106] In another embodiment of this aspect of the invention,
inactivated vaccine formulations may be prepared using conventional
techniques to "kill" the chimeric viruses. Inactivated vaccines are
"dead" in the sense that their infectivity has been destroyed.
Ideally, the infectivity of the virus is destroyed without
affecting its immunogenicity. In order to prepare inactivated
vaccines, the chimeric virus may be grown in cell culture or in the
allantois of the chick embryo, purified by zonal
ultracentrifugation, inactivated by formaldehyde or
.beta.-propiolactone, and pooled. The resulting vaccine is usually
inoculated intramuscularly.
[0107] Inactivated viruses may be formulated with a suitable
adjuvant in order to enhance the immunological response. Such
adjuvants may include but are not limited to mineral gels, e.g.,
aluminum hydroxide; surface active substances such as lysolecithin,
pluronic polyols, polyanions; peptides; oil emulsions; and
potentially useful human adjuvants such as BCG and Corynebacterium
parvum.
[0108] Many methods may be used to introduce the vaccine
formulations described above, these include but are not limited to
oral, intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, and intranasal routes. It may be preferable to
introduce the chimeric virus vaccine formulation via the natural
route of infection of the pathogen for which the vaccine is
designed. Where a live chimeric virus vaccine preparation is used,
it may be preferable to introduce the formulation via the natural
route of infection for influenza virus. The ability of influenza
virus to induce a vigorous secretory and cellular immune response
can be used advantageously. For example, infection of the
respiratory tract by chimeric influenza viruses may induce a strong
secretory immune response, for example in the urogenital system,
with concomitant protection against a particular disease causing
agent.
6. EXAMPLE
Promoter Analysis of the Influenza Viral RNA Polymerase
[0109] In the examples described below, polymerase which is
depleted of genomic RNA was prepared from the upper fractions of
the CsCl-glycerol gradient centrifugation. This polymerase is able
to copy short model templates which are derived from transcription
of appropriate plasmid DNA with bacteriophage T7 RNA polymerase in
a sequence-specific manner. The termini of this model RNA are
identical to the 3' 15 and 5' 22 nucleotides conserved in segment 8
from all influenza A viral RNAs. By manipulating the plasmid in
order to prepare different RNAs to serve as template, we
demonstrated that recognition of and synthesis from this model RNA
was specific for the promoter at the 3' terminal sequence and did
not require the panhandle. In addition, site specific mutagenesis
identified nucleotide positions responsible for the viral
polymerase favoring synthesis from genomic sense templates over
complementary sense RNA. Conditions were also found in which
cap-endonuclease primed RNA synthesis could be observed using model
RNAs. In addition, the reconstituted system permitted
virus-specific synthesis from genomic length RNAs, derived either
from plasmids or from RNA purified from virus through phenol
extraction.
6.1. Materials and Methods
6.1.1. Purification of the Viral RNA Polymerase
[0110] RNP cores were prepared from whole virus using standard
methods (Plotch, et al., 1981, Cell 23: 847-858; Rochavansky, 1976,
Virology 73: 327-338). Two to three milligrams of virus were
disrupted by incubating in 1.5% Triton N-101, 10 mg/ml
lysolecithin, 100 mM tris-HCl, pH 8.0, 100 mM KCl, 5 mM MgCl.sub.2,
5% glycerol and 1.5 mM dithiothreitol. The sample was fractionated
by centrifugation on a 30-70% glycerol (w/v) step gradient in the
presence of 50 mM tris-HCl, pH 7.8 and 150 mM NaCl. The core
preparation was centrifuged at 45,000 rpm in an SW50.1 rotor for 4
hours at 4{grave over ()}C. Fractions enriched in RNP were
identified by SDS-polyacrylamide gel electrophoresis of protein
samples from each fraction and staining with silver. The core
fractions were then subjected to a second gradient centrifugation
as was described in Honda et al. 1988, J. Biochem. 104: 1021-1026.
This second gradient had steps of 0.5 ml 3.0 M CsCl and 45% (w/v)
glycerol, 1.75 ml 2.5 M CsCl and 40% glycerol, 1.25 ml 2.0 M CsCl
and 35% glycerol, and 1.0 ml of 1.5 M CsCl and 30% glycerol. All
steps were buffered with 50 mM tris-HCl, pH 7.6 and 100 mM NaCl.
0.5 ml of RNP cores were layered on top and the sample was
centrifuged at 45,000 rpm in an SW50.1 rotor for 25 hours at
4{grave over ()}C. Polymerase fractions were again identified by
SDS-polyacrylamide electrophoresis of the protein samples and
silver staining. Active polymerase fractions were generally found
in the region of the gradient correlating with 1.5 to 2.0 M CsCl.
These fractions were pooled and then dialyzed against 50 mM
tri-HCl, pH 7.6, 100 mM NaCl and 10 mM MgCl.sub.2 and concentrated
in centricon-10 tubes (Amicon) or fractions were dialyzed in bags
against 50 mM tris-HCl, pH 7.6, 100 mM NaCl, 10 mM MgCl.sub.2, 2 mM
dithiothreitol, and 50% glycerol.
6.1.2. Preparation of Plasmid
[0111] The plasmid design is indicated in FIG. 2. Insert DNA for
the pV-wt plasmid was prepared using an Applied Biosystems DNA
synthesizer. The "top" strand was
5'-GAAGCTTAATACGACTCACTATAAGTAGAAACAAGGGTGTTTTTTCATATCAT- T
TAAACTTC ACCCTGCTTTTGCTGAATTCATTCTTCTGCAGG-3'. The "bottom" strand
was synthesized by primer-extension with 5'-CCTGCAGAAGAATGA-3' as
primer. The 95 bp DNA was digested with HindIII and PstI and
purified by extraction with phenol/chloroform, ethanol
precipitation, and passage over a NACS-prepack ion exchange column
(Bethesda Research Laboratories). This DNA was ligated into pUC-19
which had been digested with HindIII and PstI and then used to
transform E. coli strain DH5-.alpha. which had been made competent
using standard protocols. Bacteria were spread on agar plates
containing X-gal and IPTG, and blue colonies were found to have the
plasmid containing the predicted insert since the small insert
conserved the lacZ reading frame and did not contain a termination
codon. The pM-wt plasmid was prepared by a similar strategy except
that both strands were chemically synthesized with the upper strand
having the sequence
2 5'-GAAGCTTAATACGACTCACTATAAGCAAAAGCAGGGTGAAGTTTA
AATGATATGAAAAAACACCCTTGTTTCTACTGAATTCATTCTTCTGCA GG-3'.
[0112] The pV-d5' plasmid (FIG. 2) was prepared using the
oligonucleotides
5'-AGCTTAATACGACTCACTATAAGATCTATTAAACTTCACCCTGCTTTTGCTGAATTCATTCTTCTGCA-3-
' and
5'-GAAGAATGAATTCAGCAAAAGCAGGGTGAAGTTTAATAGATCTTATAGTGAGTCGTATTA-3'.
The DNAs were annealed and ligated into the HindIII/PstI digested
pUC-19 and white colonies were found to contain the correct plasmid
because this insert resulted in a frameshift in the lacZ gene. The
point mutants were isolated following digestion of pV-d5' with
BglII and PstI and ligation of the linearized plasmid with a single
stranded oligonucleotide of mixed composition. Since BalII laves a
5' extension and PstI a 3' extension, a single oligonucleotide was
all that was necessary for ligation of insert. The host cell was
then able to repair gaps caused by the lack of a complementary
oligonucleotide. Oligonucleotides were designed to repair the
frameshift in the lacZ gene so that bacteria which contained mutant
plasmids were selected by their blue color.
[0113] Plasmid pHgaNS, which was used to prepare an RNA identical
to segment 8 of A/WSN/33, was prepared using the primers
5'-CCGAATTCTTAATACGACTCACTATAAGTAGAAACAAGGGTG-3' and
5'-CCTCTAGACGCTCGAGAGCAAAAGCAGGTG-3' in a polymerase chain reaction
off a cDNA clone. The product was then cloned into the XbaI/EcoRI
window of pUC19.
6.1.3. Preparation of RNA Templates
[0114] Plasmid DNAs were digested with MboII or other appropriate
endonucleases (see FIG. 2), and the linearized DNA was transcribed
using the bacteriophage T7 RNA polymerase. Run-off RNA transcripts
were treated with RNAse-free DNAse 1 and then the RNA was purified
from the proteins and free nucleotides using Qiagen tip-5 ion
exchange columns (Qiagen, Inc.). Following precipitation in
ethanol, purified RNAs were resuspended in water and a sample was
analyzed by electrophoresis and followed by silver staining of the
polyacrylamide gel in order to quantitate the yield of RNA.
6.1.4. Influenza Viral Polymerase Reactions
[0115] In a 25 .mu.l total volume, about 30 .mu.g of nucleoprotein
and 200 pg total of the three polymerase proteins were mixed with
10 ng of template RNA and the solution was made up to a final
concentration of: 50 mM Hepes pH 7.9, 50 mM NaCl, 5 mM MgCl.sub.2,
1 mM dithiothreitol, 0.05% NP-40, 0.4 mM adenylyl-(3'-5')-guanosyl
(ApG) dinucleotide (Pharmacia), 0.5 mM ATP, 0.5 mM GTP, 0.5 mM CTP
and approximately 0.6 .mu.M .alpha.-.sup.32P-UTP (40 .mu.Ci at 3000
Ci/mmole, New England Nuclear). Reactions were assembled on ice and
then transferred to a 30{grave over ()}C. water bath for 90
minutes. Reactions were terminated by the addition of 0.18 ml
ice-cold 0.3 M sodium acetate/10 mM EDTA and were then extracted
with phenol/chloroform (1:1 volume ratio). Following the first
extraction, 15 .mu.g polyI-polyC RNA was added as carrier, and the
sample was extracted again with phenol/chloroform. The samples were
then extracted with ether and precipitated in ethanol. Following
centrifugation, the RNA pellet was washed twice with 70% ethanol
and then dried under vacuum.
[0116] In reactions using the high concentration polymerase,
conditions were identical as above except that 20 ng of template
RNA were added. In reactions using genomic length RNAS, the amount
of polymerase used was doubled, 50 ng of template RNA was used, and
the UTP concentration was raised to 2.6 .mu.M.
[0117] The RNA was resuspended in a dye mix containing 78%
formamide, 10 mM EDTA, 0.1% xylene cyanol and 0.05% bromophenol
blue. Typically, a sample from this RNA was electrophoresed on an
8% polyacrylamide gel in the absence of urea, and the remainder was
denatured by heating to 100{grave over ()}C. for 1.5 minutes and an
aliquot was loaded on an 8% polyacrylamide gel containing 7.7 M
urea. Gels were fixed by a two step procedure, first in 10% acetic
acid, and then in 25% methanol/8% acetic acid. Gels were dried onto
filter paper and then exposed to x-ray film.
[0118] When different RNAs were being tested for use as template,
the different RNA preparations were always analyzed on
polyacrylamide gels and stained with silver in order that equal
amounts of each template were used. To quantitate the amount of
product, gels were exposed to x-ray film in the absence of an
intensifying screen in order to improve the linearity of the
densitometer readings. Autoradiographs were analyzed using a FB910
scanning densitometer (Fisher Biotech) and peaks were evaluated
using computer software from Fisher Biotech.
6.1.5. Nuclease Analysis of Reaction Productions
[0119] For ribonuclease T1 analysis of the two principle RNA
products, reaction products were analyzed by 8% polyacrylamide gel
electrophoresis (without urea) and the gel was not treated with
fixative. The wet gel was exposed to an x-ray film and the
appropriate gel pieces were located and excised. The gel piece was
crushed in 0.3 ml containing 10 mM tris pH 7.5, 1 mM EDTA, 0.1%
sodium dodecyl sulfate, and 1 .mu.g tRNA as carrier. The RNA
diffused into this solution for 3 hours and then the gel was
pelleted and the supernatant was made 0.3M in sodium acetate. The
supernatant was then extracted twice in phenol/chloroform and once
in ether and then precipitated in ethanol. The RNA pellet was
resuspended in 5 .mu.l formamide, denatured in boiling water for
1.5 minutes and then diluted by the addition of 0.1 ml 10 mM
tris-HCl, pH 7.5, and 1 mM EDTA. Ribonuclease T1 (50 units,
Boehringer Mannheim Biochemicals) was added and the samples were
incubated for 60 minutes at 37{grave over ()}C. V-wt and M-wt RNAs
synthesized with T7 RNA polymerase in the presence of
.alpha.-.sup.32P-UTP were similarly digested with RNAse T1.
Reaction products were extracted in phenol/chloroform and
precipitated in ethanol and then were analyzed on 20%
polyacrylamide gels containing 7.7 M urea.
[0120] Nuclease S1 analysis of reaction products was done on
transcribed RNA by first terminating the standard polymerase
reaction through the addition of S1 buffer to a volume of 0.2 ml
with 0.26 M NaCl, 0.05 M sodium acetate, pH 4.6, and 4.5 mM zinc
sulfate. The sample was divided into two 0.1 ml volumes and 100
units of S1 nuclease (Sigma Chemical Company) were added to one
tube. The samples were incubated for 60 minutes at 37{grave over
()}C. Following the incubation, EDTA (10 mM final concentration)
and 15 g polyI-polyC RNA was added and the sample was extracted
with phenol/chloroform and precipitated in ethanol. The samples
were then subjected to polyacrylamide gel electrophoresis.
6.2. Results
6.2.1. Preparation of Influenza Viral RNA Polymerase and of
Template RNA
[0121] RNP cores of influenza virus A/Puerto Rico/8/34 were
prepared by disruption of virus in lysolecithin and Triton N-101
followed by glycerol gradient centrifugation (Rochavansky, 1976,
Virology 73: 327-338). Fractions containing cores were then
subjected to a second centrifugation in a CsCl-glycerol step
gradient (Honda, et al., 1988, J. Biochem. 104: 1021-1026).
Fractions containing the polymerase were identified by gel
electrophoresis of samples followed by silver-staining. FIG. 1
shows the polymerase preparation after CsCl centrifugation. Bovine
serum albumin (BSA) was added during dialysis to protect against
protein loss. Densitometric scanning of lane 4 compared to known
quantities of whole virus in lanes 1 and 2 allowed us to estimate
that the proteins in lane 4 consist of 150 ng of NP and about 1 ng
total of the three polymerase proteins. One fifth of the
preparation used for this gel was used per reaction.
[0122] The overall design of the plasmids used to prepare template
RNAs in this study is depicted in FIG. 2. The entire insert was
prepared using oligonucleotides from a DNA synthesizer which were
then cloned into the polylinker of pUC19. The insert contained a
truncated promoter sequence recognized by the bacteriophage T7 RNA
polymerase (Studier and Dunn, 1983, Cold Spring Harbor Symposia on
Quantitative Biology, XLVII, 999-1007) so that the first
nucleotides synthesized were the terminal 22 nucleotides (nt) of
the conserved sequence from the 5' end of the genome RNA. When the
plasmid was cut with restriction endonuclease MboII (which cuts 7
bases upstream of its recognition site), the RNA which resulted
from T7 RNA polymerase transcription ended with the terminal 3'
nucleotides of the influenza viral sequence. Included in the
sequence was the poly-U stretch adjacent to the 5' end of the
conserved terminus which is thought to comprise at least part of
the termination-polyadenylation signal (Robertson, et al., 1981, J.
Virol. 38, 157-163). The total length of this model genomic RNA was
53 nt since a 16 nt spacer separated the terminal conserved
sequences. The model RNA which contained both termini identical to
those of vRNA was named V-wt. The RNA M-wt encoded the exact
complementary strand of V-wt so that the termini match those of
complementary RNA (cRNA). V-wt and M-wt were constructed to serve
as models for influenza virus-specific vRNA and cRNA,
respectively.
6.2.2. Viral Polymerase Catalyzes Synthesis of a Full Length Copy
of the Template
[0123] In the reaction using the influenza viral polymerase, V-wt
template and ApG primer, a product was obtained which comigrated
with a 53 nt RNA on denaturing gels. RNA migrating as a doublet at
a position of about 40 to 45 nucleotides (FIG. 3A, lane 2) was also
seen. This shorter product is shown below to be RNA which had
terminated at a stretch of adenosines present between nucleotides
43-48 in the virion sense template. In addition to the template
specific transcripts, a general background of light bands could be
seen which correspond to truncated RNA products transcribed from
viral genomic RNA not removed during the CsCl-glycerol
centrifugation step. When no primer is used, there was no specific
transcription product seen (FIG. 3A, lane 3). Additional
experiments showed globin mRNA, containing a terminal cap 1
structure, was inactive as primer using initial preparations of
polymerase.
[0124] When the polymerase reaction was terminated by the addition
of excess buffer favorable for nuclease S1 digestion and nuclease
was added, the radioactively-labeled product was resistant to
digestion (FIG. 3B, lane 2). By contrast these conditions very
efficiently digested the V-wt single-stranded RNA radioactively
synthesized with T7 RNA polymerase (FIG. 3B, lanes 3 and 4). These
nuclease S1 data confirmed that the opposite strand was indeed
being synthesized in these reactions. The product of the reaction
might be a double stranded RNA, but it could not be ruled out that
the product was in fact single stranded and later annealed to the
template RNA in the presence of high salt used in the nuclease
reaction.
[0125] The RNA products were purified by electrophoresis on an 8%
gel, excised, eluted from the gel, and then digested by
ribonuclease T1. Products were analyzed by electrophoresis and
compared to the patterns generated by RNase T1 digestion of
internally labeled M-wt and V-wt control probes. As can be seen in
FIG. 3C, the full length RNA (lane 1) has the identical pattern as
does the plus sense RNA, M-wt (lane 3), and it does not have the
pattern of the V-wt RNA (lane 4). The observed patterns were
essentially identical to that which is predicted from the sequence
of the RNA and thus showed that the polymerase faithfully copied
the V-wt template. The smaller RNA product, a doublet with most
templates, was also digested with RNase T1. Its pattern was similar
to that of the full length RNA product (FIG. 3C, lane 2) except the
14 base oligonucleotide was not present. Instead, a faint 13 base
oligonucleotide was seen, thus mapping the termination of the short
RNA to position 44, a site where two uridines would be
incorporated. Since the amount of smaller RNA product decreased at
higher UTP concentrations and disappeared when CTP was used as
label, these bands appeared to be an artifact of low UTP
concentrations in the polymerase reaction.
6.2.3. Conditions for the Polymerase Reactions Using Model RNA
Templates
[0126] It was found that protein samples containing about 30 ng of
NP protein and about 200 pg total of the three P proteins would
react optimally with 5 to 10 ng of RNA. By using cold competitor
RNA, polyI-polyC, it was found that excess RNA nonspecifically
inhibited transcription, possibly via non-specific binding of the
NP protein (Kingsbury, et al., 1987, Virology 156: 396-403;
Scholtissek and Becht, 1971, J. Gen. Virol. 10: 11-16). In the
absence of nonspecific competitor, variations in the amount of
template between 1 and 10 ng produced little change in the
efficiency of RNA synthesis. The NP protein and RNA were present at
about equal molar concentrations and these were each about a
thousand-fold in excess of the moles of the complex (assuming it to
be 1:1:1) formed by the three P proteins in the typical
reaction.
[0127] Since these reconstituted RNPs were able to use ApG but not
globin mRNA as primer, we tested these model RNPs for other
variables of the transcription reaction. In all other ways tested,
the reconstituted RNPs behaved in solution similarly to those RNPs
purified from detergent disrupted virus. The optimum temperature
for RNA synthesis was 30{grave over ()}C. (FIG. 4A, lane 2) as has
been repeatedly found for the viral polymerase (Bishop, et al.,
1971, J. Virol. 8: 66-73; Takeuchi, et al., 1987, J. Biochem. 101:
837-845; Ulmanen, et al., 1983, J. Virol. 45: 27-35). Also, the
most active salt conditions were 60 mM NaCl (FIG. 4B, lane 2),
again consistent with conditions used by several groups (Bishop, et
al., 1971, J. Virol. 8: 66-73; Honda, et al., 1988, J. Biochem.
104: 1021-1026; Shapiro, and Krug, 1988, J. Virol. 62: 2285-2290).
FIG. 4C shows a time-course experiment. The amount of RNA synthesis
appeared to increase roughly linearly for the first 90 minutes, as
was found for viral RNPs (Takeuchi, et al., 1987, J. Biochem. 101:
837-845).
6.2.4. Specificity of the Elongation Reaction
[0128] Various RNAs were tested for suitability as templates for
the RNA polymerase of influenza virus. The pV-wt plasmid clone was
digested with either EcoRI, PstI or SmaI, and T7 polymerase was
used to transcribe RNA. This resulted in RNAs identical to V-wt
except for the addition of 5, 13 and 38 nt at the 3' end. In FIG.
5A an overexposure of an autoradiograph is shown in order to
demonstrate that no transcripts over background were observed in
reactions which contained as template: two of the RNAs identical to
V-wt except they contained 13 and 38 nt of extra sequence on the 3'
terminus (lanes 1 and 2); a single stranded DNA of identical
sequence to that of V-wt (lane 4); and an unrelated 80 nt RNA
generated by transcribing the polylinker of pIBI-31 with T3 RNA
polymerase (lane 5). However, the V-Eco template, containing five
extra nucleotides on the 3' end, could be recognized and faithfully
transcribed, although at approximately one-third the efficiency of
the wild type V-wt RNA (FIG. 5B, lane 3). It is interesting to note
that initiation on the V-Eco RNA by the influenza viral polymerase
appeared to occur at the correct base since the transcribed RNA was
the same size as the product form the V-wt template.
6.2.5. Analysis of the Promoter Region for the Viral RNA
Polymerase
[0129] The original construct used for these studies contained the
sequences of both RNA termini of genomic RNAs which could base pair
and thus form a panhandle. This was done since it was shown that
the vRNA in virions and in RNPs in infected cells was in circular
conformation via the 15 to 16 nt long panhandle (Honda, et al.,
1988, J. Biochem. 104: 1021-1026; Hsu, et al., 1987, Proc. Natl.
Acad. Sci. USA 84: 8140-8144). It was further shown that the viral
polymerase was bound to the double stranded structure (Honda, et
al., 1988, J. Biochem. 104: 1021-1026), thus leading to the
suggestion that the promoter for RNA synthesis was the panhandle.
In order to test whether the panhandle was an absolute requirement
for recognition, the following templates were used: the plasmid
pV-wt was digested with DraI prior to transcription by the T7
polymerase (FIG. 2). This should result in an RNA molecule of 32 nt
containing only virus-specific sequences from the 5' end of the
RNA. When this RNA was used as template, no apparent product was
produced (FIG. 5B, lane 2). Therefore the 3' terminus of virion RNA
was required for this reaction. This finding was consistent with
the fact that the initiation site at the 3' end of V-wt was not
present in V-Dra. A second plasmid clone was produced which deleted
the 5' terminal sequences but kept intact the 3' terminus. This
clone, pV-d5', when digested with MboII and used for transcription
by T7 polymerase produced a major transcript of 30 nt and minor
species of 29 and 31 nt. Surprisingly, this template was recognized
and copied by the influenza viral polymerase. FIG. 7, lane 1, shows
that the product of the viral RNA polymerase reaction with V-d5'
contains multiple bands reflecting the input RNA. When the products
shown in FIG. 7, lane 1, were eluted from gels and subjected to
RNase T1 analysis, the pattern expected of the transcription
product of V-d5' was observed. Since the V-d5' RNA template was
copied, the panhandle was not required for viral polymerase binding
and synthesis.
[0130] Although the 5' terminus was not required for synthesis by
the polymerase, a distinct possibility was that V-wt RNA might be a
preferred template as compared to V-d5'. In order to examine this,
reactions were done in which the templates were mixed. The V-wt RNA
was present at 5 ng in each reaction. The V-d5' was absent (FIG. 6,
lane 1) or was present at a 1/5 molar ratio (FIG. 6, lane 2) or a
1/1 molar ratio (FIG. 6, lane 3). The relative intensities of the
bands from each RNA were determined by densitometry of the
autoradiograph. The values were corrected for the amount of the
radioactive nucleotide, UTP, which could be incorporated into each
product, and the value was normalized so that the level of
synthesis in each lane was set equal to one. The level of copying
of V-wt decreased as V-d5' was increased. When V-d5' was present in
one fifth molar ratio, its corrected level of synthesis was about
one fourth of that from V-wt (FIG. 6, lane 2). When the two
templates were present in equimolar amounts, the level of synthesis
from V-wt was about 60% of the total (FIG. 6, lane 3) which might
be within the expected range of experimental error for equivalent
levels of synthesis. Similar results were obtained when V-d5' RNA
was kept constant and the V-wt RNA was varied. It was thus
concluded that the panhandle-containing V-wt RNA was not greatly
favored over the template RNA which only contained the proper 3'
terminus.
6.2.6. The Viral Polymerase does not Copy RNA Templates Containing
Plus-Sense Termini
[0131] As described earlier, the influenza RNA polymerase performs
three distinct activities during the course of an infection. Two
activities involve the transcription of genome sense RNA and the
third involves copying of the complementary sense RNA into vRNA. We
therefore constructed an RNA template which contained the 5' and 3'
termini of the complementary sense RNA of segment 8 (M-wt; FIG.
2).
[0132] When the M-wt RNA was used as template, little synthesis was
observed (FIG. 5B, lane 4). In two experiments used for
quantitation, the average level of synthesis from M-wt RNA was 4%
that of V-wt. In comparing the V-wt and M-wt RNA promoters, the
M-wt has only three transition changes and one point insertion
within the 3' 15 nucleotides. These include a G to A change at
position 3, a U to C change at position 5, a C to U change at
position 8 and an inserted U between the ninth and tenth
nucleotides (see Table II, below). In order to determine which of
the four point differences in the 3' termini were responsible for
the specificity, many combinations of these were prepared and
assayed for efficiency as a template (FIG. 7). These templates were
derivatives of V-d5' since they did not contain the 5' terminus.
The results of densitometry scans of several experiments are
outlined in Table II.
3TABLE II QUANTITATIVE COMPARISON OF THE EFFECT OF POINT MUTATIONS
IN THE PROMOTER SEOUENCE* RNA Level of Template 3' sequence
Synthesis V-d5' CACCCUGCUUUUGCU-OH 1 V-A3 CACCCUGCUUUUACU-OH 0.4
V-C5 CACCCUGCUUCUGCU-OH 1.0 V-dU.sub.25U.sub.8 CACCCUGUUUUUGCU-OH
1.0 V-U.sub.8A.sub.3 CACCCUGUUUUUACU-OH 0.08 V-U.sub.8C.sub.5
CACCCUGUUUCUGCU-OH 0.3 V-iU.sub.10 CACCCUUGCUUUUGCU-OH 0.7
V-iU.sub.10A.sub.3 CACCCUUGCUUUUACU-OH 0.06
V-iU.sub.10U.sub.8A.sub.3 CACCCUUGUUUUUACU-OH 0.2
V-iU.sub.10U.sub.8C.sub.5A.sub.- 3 CACCCUUGUUUCUACU-OH 0.2
*Sequences of V-wt, M-wt and V-d5' are shown in FIG. 2. All other
RNAs are identical to V-d5' except for the indicated positions. The
subscripted number indicates the distance from the 3' end of a
change, and d and i refer to deleted or inserted nucleotides.
[0133] As shown in Table II, single point changes in V-d5' were
equally well copied as compared to V-d5' itself, except for the
V-A.sub.3 RNA which was copied at 40% efficiency (FIG. 7, lane 10;
Table II). When RNAs with two changes were tested, the activity
generally dropped to very low levels (FIG. 7, lanes 3, 4, and 5).
Therefore, these experiments confirmed that the specificity of the
reactions for-V-wt over M-wt was the result of the combination of
the nucleotide changes present at the 3' terminus of M-wt.
6.2.7. Cap-Endonuclease Primed RNA Synthesis
[0134] The method of purifying the viral polymerase was modified in
order to decrease loss of protein during dialysis. Rather than
using the Amicon centricon-10 dialysis system, the enzyme was
dialyzed in standard membranes resulting in higher concentrations
of all four viral core proteins. The pattern of the protein gel of
this preparation was identical to that shown in FIG. 1, lane 4,
except that there is no BSA-derived band. It was found that 5 .mu.l
of this preparation, containing 150 ng of NP and 5 ng total of the
three polymerase proteins, reacted optimally with 10 to 40 ng of
model RNA template. However, the use of higher levels of protein
increased the background, possibly due to higher levels of
contaminating RNAs (virion RNAs not removed by CsCl centrifugation)
yielding products of the size class around 50-75 nt, complicating
analysis of RNA templates containing a length of 50 nt.
[0135] This high concentration polymerase preparation was now
active in cap-endonuclease primed RNA synthesis (FIG. 8A, lane 4)
and also in primer-independent replication of the template RNA
(FIG. 8A, lane 2). When globin mRNA was used as primer for
transcription from the 30 nt V-d5' template, a triplet of bands of
size about 42 to 44 nt was apparent as product (FIG. 8A, lane 4),
consistent with cleavage of the cap structure at about 12 nt from
the 5' end of the mRNA and use of this oligonucleotide to initiate
synthesis from the 30 nt model template. Since excess RNA inhibits
RNA synthesis, probably via nonspecific binding of NP in vitro as
discussed above, the optimal amount of cap donor RNA added to each
reaction was found to be 100 ng, which is much lower than is
usually used with preformed RNP structures (e.g. Bouloy, et al.,
1980, Proc. Natl. Acad. Sci. USA 77:3952-3956). The most effective
primer was ApG (FIG. 8A, lane 5 and lighter exposure in lane 6).
The product migrates slower than that of the input template (FIG.
8A, lane 1) or the product in the absence of primer (FIG. 8A, lane
2) probably since the 5' terminus of the ApG product is
unphosphorylated. The intensity of the ApG-primed product was about
ten-fold higher than that of the cap-primed product, but at 0.4 mM,
ApG was at a 60,000-fold molar excess of the concentration of the
cap donors. Thus, although the intensity of the product band from
cap-priming was about ten-fold lower than that from ApG priming,
the cap-primed reaction was about 6000-fold more efficient on a
molar basis. This value is similar to the approximately 4000-fold
excess efficiency observed previously for the viral polymerase
(Bouloy, et al., 1980, Proc. Natl. Acad. Sci. USA 77: 3952-3956).
It has been previously shown that cap donor RNAs containing a cap 0
structure, as in BMV RNA, are about ten-fold less active in priming
the influenza viral polymerase (Bouloy, et al., 1980, Proc. Natl.
Acad. Sci. USA 77: 3952-3956). This unusual cap specificity was
shared by the reconstituted RNPs studied here as the specific
product from the model RNA was greatly decreased in reactions
containing BMV RNA as cap donor. A 30 nt product was observed in
lanes 2-4, probably due to primerless replication of the model
template.
[0136] That the product RNAs were of the opposite sense of the
input template V-d5' was shown by nuclease S1 analysis (FIG. 8B).
The ApG-primed (FIG. 8B, lanes 1 and 2) and the primeness (FIG. 8B,
lanes 3 and 4) RNA products were essentially nuclease resistant.
The product of the cap-primed reaction (FIG. 8B, lanes 5 and 6) was
partially sensitive to nuclease as about 12 nt were digested from
the product. These results were most consistent with the 5' 12 nt
being of mRNA origin as has been shown many times for influenza
virus-specific mRNA synthesis.
[0137] The promoter specificity of this polymerase preparation in
reactions primed with ApG was found to be essentially identical to
those for the lower concentration enzyme as shown earlier. However,
attempts thus far to perform similar analyses of promoter
specificity with the primerless and cap-primed reactions have been
frustrated by the comparatively,high levels of background, thus
making quantitation difficult.
6.2.8. Replication of Genomic Length RNA Templates
[0138] A full length 890 nt RNA identical to the sequence of
A/WSN/33 segment 8 was prepared by T7 RNA polymerase transcription
of plasmid DNA, pHgaNS, which had been digested with restriction
endonuclease HgaI. This RNA was copied in ApG-primed reactions
containing 10 .mu.l of the high concentration polymerase (FIG. 9,
lane 8). That the RNA was in fact a copy of the template was
demonstrated by its resistance to nuclease S1 (FIG. 9, lane 9). A
similar product was observed in the absence of primer (FIG. 9,
lanes 2 and 3). Confirmation that these product RNAs were full
length copies of the template was done by RNase T1 analysis. Virion
RNA purified from phenol-extracted A/PR/8/34 virus was similarly
copied in ApG primed reaction (FIG. 9, lanes 10 and 11) and in the
absence of primer (FIG. 9, lanes 4 and 5). Interestingly, the
product from replication of the HA gene was at greatly reduced
levels. The 3' end of this RNA differs from that of segment 8 only
at nucleotides 14 and 15, suggesting importance for these
nucleotides in the promoter for RNA synthesis. In addition, we
found that when whole viral RNA was used in the reconstituted RNPs,
the level of acid precipitable counts was about 70% of that
observed with native RNPs. The viral polymerase was also able to
copy these full length RNAs when globin mRNA was used in cap-primed
reaction.
7. EXAMPLE
Expression and Packaging of a Foreign Gene by Recombinant Influenza
Virus
[0139] The expression of the chloramphenicol transferase gene (CAT)
using rRNPs is described. The rRNPs were prepared using pIVACAT
(originally referred to as pCATcNS), a recombinant plasmid
containing the CAT gene. The pIVACAT plasmid is a pUC19 plasmid
conaining in sequence: the T7-promoter; the 5'-(viral-sense)
noncoding flanking sequence of the influenza A/PR8/34 RNA segment 8
(encodes the NS proteins); a BalII cloning site; the complete
coding sequence of the chloramphenicol transferase (CAT) gene in
the reversed and complemented order; the 3'-(viral-sense) noncoding
NS RNA sequence; and several restriction sites allowing run-off
transcription of the template. The pIVACAT can be transcribed using
T7 polymerase to create an RNA with influenza A viral-sense
flanking sequences around a CAT gene in reversed orientation.
[0140] The in vivo experiments described in the subsections below
utilized the recombinant RNA molecule described containing
sequences corresponding to the untranslated 3' and 5' terminal
sequences of the NS RNA of influenza virus A/PR/8/34 flanking the
antisense-oriented open reading frame of the CAT gene. This RNA was
mixed with purified influenza virus polymerase complex and
transfected into MDCK (or 293) cells. Following infection with
influenza A/WSN/33 virus, CAT activity was measured in the
RNP-transfected cells and amplification of the gene was indicated.
In addition, the-recombinant influenza virus gene was packaged into
virus particles, since CAT activity was demonstrated in cells
following infection with the recombinant virus preparation.
7.1. Materials and Methods
[0141] In order to get the flanking sequences of the NS RNA fused
to the coding sequence of the CAT gene, the following strategy was
used. Two suitable internal restriction sites were selected, close
to the start and stop codon of the CAT gene, that would allow the
replacement of the sequences flanking the CAT gene in the pCM7
plasmid with the 3'- and 5'-NS RNA sequences. At the 5' and, a
SfaNI site was chosen, (which generates a cut 57 nt from the ATG)
and at the 3'- end a ScaI site which generates a cut 28 nt from the
end of the gene (stop codon included). Next, four synthetic
oligonucleotides were made using an Applied Biosystems DNA
synthesizer, to generate two double-stranded DNA fragments with
correct overhangs for cloning. Around the start codon these
oligonucleotides formed a piece of DNA containing a XbaI overhang
followed by a HgaI site and a PstI site, the 3'-(viral-sense) NS
sequence immediately followed by the CAT sequence from start codon
up td the SfaNI overhang (underscored). In addition a silent
mutation was incorporated to generate an AccI site closer to the
start codon to permit future modifications.
4 Xba I Hga I Pst I Acc
5'-ctagacgccctgcagcaaaagcagggtgacaaagacataatggagaaaaaaatcac
3'tgcgggacgtcgttttcgtcccactgtttctgtattacctctttttttagtg I SfaN I
tgggtataccaccgttgatatatcccaatcgcatcgtaaa- 3' oligo2
acccatatggtggcaactatatagggttagcgtagcatttcttg- 5' oligo1
[0142] Around the stop codon the two other oligonucleotides
generated a piece of DNA as follows: a blunt-ended ScaI site, the
CAT sequence from this site up to and including the stop codon
(underlined) followed by a BglII site and a Xba I overhang.
5 Sca I Bgl II 5'-actgcgatgagtggcagggcggggcgtaatagat-3' oligo3
3'-tgacgctactcaccgtcccgccccgcattatctagatc-5' oligo4 XbaI
[0143] Using a single internal EcoRI site in the CAT sequence, the
SfaNI/EcoRI and the EcoRI/ScaI fragment from pCM7 were
independently cut out and purified from acrylamide gels. The
SfaNI/EcoRI fragment was subsequently ligated with the synthetic
DNA fragment obtained by annealing oligonucleotides 1 and 2 into a
pUC19 plasmid that was cut with XbaI and EcoRI. The EcoRI/ScaI
fragment was similarly cloned into an XbaI and EcoRI-digested pUC19
plasmid using oligonucleotides 3 and 4. The ligated DNA was
transformed into competent DH5a bacteria, amplified, isolated and
screened by means of restriction analysis using standard
techniques.
[0144] The recombinants with the SfaNI containing insert were cut
with XbaI and EcoRI and the plasmids with the ScaI insert were cut
with EcoRI and BglII. The fragments were purified from acrylamide
gel and cloned together into the pPHV vector which had been cut
with XbaI and BglII. After transformation, white colonies were
grown, analysed by endonuclease digestion and selected clones were
sequenced. The final clone, pCATcNS2, was grown in large amounts
and sequenced from the flanking pUC sequences up to 300 nt into the
CAT gene, revealing no discrepancies with the intended sequence,
with the exception of a G to A transition in the CAT gene, which
appeared silent.
7.1.1. Viruses and Cells
[0145] Influenza A/PR/8/34 and A/WSN/33 viruses were grown in
embryonated eggs and MDCK cells, respectively (Ritchey et al. 1976,
J. Virol. 18: 736-744; Sugiura et al., 1972, J. Virol. 10:
639-647). RNP-transfections were performed on human 293 cells
(Graham et al., 1977, J. Gen. Virol. 36:59-72) and on Madin-Darby
canine kidney (MDCK) cells (Sugiura et al., 1972, supra).
7.1.2. Construction of Plasmids
[0146] Plasmid pIVACAT1, derived from pUC19, contains the coding
region of the chloramphenicol acetyltransferase (CAT) gene flanked
by the noncoding sequences of the influenza A/PR/8/34 RNA segment
8. This construct is placed under the control of the T7 polymerase
promoter in such a way that the RNA transcript IVACAT1 contains in
5' to 3' order: 22 nucleotides derived from the 5' terminus of the
influenza virus NS RNA, an 8 nt linker sequence including a BglII
restriction site, the CAT gene in negative polarity, and 26 nt
derived from the 3' end of the influenza virus NS RNA (FIG.
11).
[0147] pIVACAT1 was constructed in the following way: In order to
obtain the correct 5'- end in pIVACAT1, the EcoRI-ScaI fragment of
the CAT gene derived from plasmid pCM7 (Pharmacia) was ligated to a
DNA fragment formed by two synthetic oligonucleotides. The sequence
of these oligonucleotides are:
5'-ACTGCGATGAGTGGCAGGGCGGGGCGTAATAGAT-3' (top strand), and
5'-CTAGATCTATTACGCCCCGCCCTGCCACTCATCGCAGT-3' (bottom strand). For
the 3'- end of the insert in pIVACAT1 the SfaN 1-EcoRI fragment of
the CAT gene was ligated to a DNA fragment made up of the synthetic
oligonucleotdies: 5'-CTAGACGCCCTGCAGCAAAAGCAGGGTGACAAAGACATAATG-
GAGAAAAAAAATCACTGGGTATACCACCGTTGATATATCCCAATCGCATCGTAAA-3' (top
strand), and
5'-GTTCTTTACGATGCGATTGGGATATATCAACGGTGGTATACCCAGTGATTTTTTTCTCCATTATGT-
CTTTGTCACCCTGCTTTTGCTGCAGGGCGT-3' (bottom strand). Oligonucleotides
were synthesized on an Applied Biosystems DNA synthesizer. These 5'
and 3' constructs were ligated into pUC19 shuttle vectors digested
with XbaI and EcoRI, grown up, cut out with EcoRI/BalII (5' region)
and XbaI/EcoRI (3' region) and ligated into BglII/XbaI cut pPHV.
The latter plasmid is similar to pV-WT described in Section 6,
supra, except that it contains a BglII site which separates the
noncoding terminal sequences of the influenza A virus NS RNA
segment. The final clone pIVACAT1 (FIG. 1) was grown up and the DNA
was partially sequenced starting from the flanking pUC sequences
and reaching into the CAT gene. No changes were found as compared
to the expected sequences with the exception of a silent G to A
transition in the CAT gene at position 106 relative to the start of
the IVACAT1 RNA.
7.1.3. T7 RNA Transcription
[0148] Plasmid pIVACAT1 was digested with HqaI (FIG. II), to allow
run-off transcription. The 5 nt overhang generated by this enzyme
was filled in with Klenow enzyme (BRL) and the DNA was purified
over a spin column (Boehringer). The T7 polymerase reaction was
performed using standard procedures in the presence of Rnasin
(Promega). Template DNA was removed from Rnase free Dnase I
(Promega). The RNA was purified over Qiagen tip-5 columns (Qiagen,
Inc.) and quantitated using 4% polyacrylamide gels which were
silver stained. NS RNA was prepared from plasmid pHgaNS in the same
way.
7.1.4. Purification of Influenza a Virus Polymerase and In Vitro
Transcription
[0149] The RNA polymerase complex was purified from influenza
A/PR/8/34 as described in Section 6, supra. In vitro transcriptions
of cold IVACAT1 or HgaNS RNA template were carried out using the
conditions which have been described in Section 6, supra.
Radiolabeled transcripts were analysed on 4% acrylamide gels.
7.1.5. RNP-Transfection of MDCK and 293 Cells
[0150] 35 mm dishes containing approximately 10.sup.6 cells were
treated with 1 ml of a solution of 300 .mu.g/ml DEAE-dextrin, 0.5%
DMSO in PBS/gelatine (0.1 mg/ml gelatine) for 30 minutes at room
temperature. After removal of this solution, 200 .mu.g of .mu.l
PBS/gelatine containing 1 .mu.g IVACAT1 RNA (1-2 .mu.l ), 20 .mu.l
of the purified polymerase preparation and 4 .mu.l of Rnasin was
added to the cells and incubated for 1 hour at 37{grave over ()}C.
This was followed by the addition of gradient purified influenza
A/WSN/33 virus (moi 2-10). After incubation for one hour at
37{grave over ()}C., 2.5 ml of either DMEM+10% FCS media (293
cells) or MEM media (MDCK cells) was added. In some experiments
MDCK cells were first infected and subsequently RNP-transfected.
Harvesting of cells was done in NET buffer or in media, using a
rubber policemen (MDCK cells), or by gentle suspension (293 cells).
Cells were spun down and the pellets were resuspended in 100 .mu.l
of 0.25 M Tris buffer, pH 7.5. The samples were subsequently
freeze-thawed three-times and the cell debris was pelleted. The
supernatant was used for CAT assays.
7.1.6. Passaging of Virus from RNP-Transfected Cells
[0151] MDCK cells were infected with helper virus and
RNP-transfected 2 hours later as described above. After 1 hour
cells and media were collected and cells were spun down. 100 .mu.l
of the supernatant media, containing virus, was added to 35 mm
dishes with MDCK cells. After 12 hours these cells and media were
collected and assayed for CAT activity. Virus contained in this
supernatant media was used for subsequent rounds of infection of
MDCK cells in 35 mm dishes.
7.1.7. Cat Assays
[0152] CAT assays were done according to standard procedures,
adapted from Gorman et al., 1982, Mol. Cell. Biol. 2: 1044-1051.
The assays contained 10 .mu.l of .sup.14C chloramphenicol (0.5
.mu.Ci; 8.3 nM; NEN), 20 .mu.l of 40 mM acetyl CoA (Boehringer) and
50 .mu.l of cell extracts in 0.25 M Tris buffer (pH 7.5).
Incubation times were 16-18 hours.
7.2. Results
[0153] rRNA templates were prepared from HgaI digested, end filled
linearized pCATcNS using the bacteriophage T7 RNA polymerase as
described in Section 6. The rRNA templates were combined with the
viral RNA polymerase complex prepared as described in Section
6.1.1., and the resulting rRNPs were used to transfect MDCK and 293
cells lines which were superinfected with influenza A/WSN33. In
each cell line transfected with the rRNPs, high levels of
expression of CAT was obtained 6 hours post-infection. In addition,
virus stocks obtained 24 hours post-infection synthesized high
levels of CAT enzyme after subsequent passage in MDCK cells. The
CAT-RNP was packaged into virus particles.
7.2.1. Synthesis of Ivacat1 Template RNA
[0154] In order to study the transcription and replication signals
of influenza A virus RNAs in vivo, we constructed plasmid pIVACAT1
(FIG. II) which directs the synthesis of an NS RNA-like transcript.
This RNA shares the 22 5' terminal and the 26' 3' terminal
nucleotides with the NS RNA of influenza A/PR/8/34 virus and
contain--instead of the coding sequences for the NS1 and NS2
proteins--those for a full-length CAT protein. For cloning purposes
it also contains eight additional nucleotides including a BglII
site between the stop codon of the CAT gene and the stretch of U's
in the 5' noncoding region. The T7 promoter adjacent to the 5'
noncoding sequences and the HgaI site downstream of the 3' end
allow for the exact tailoring of the 5' and 3' ends. Run-off
transcription using T7 polymerase generates a 716 nt long RNA: FIG.
12, lanes 2-4 show that this RNA is of discrete length and shorter
than the 890 nt long marker NS RNA, which was synthesized by T7
transcription of pHgaNS (lane 1).
7.2.2. The IVACAT1 RNA is Transcribed In Vitro by the Influenza a
Virus RNA Polymerase
[0155] In the examples described in Section 6, it was demonstrated
that synthetic RNAs containing at the 3' end the 15 3' terminal
nucleotides of influenza virus RNA segment 8 can be transcribed in
vitro using purified influenza A virus RNA polymerase. We tested
whether unlabeled IVACAT1 RNA could be transcribed in a similar
way. FIG. 12 lane 5 shows that the in vitro transcription reaction
generated an RNA of discrete length and similar size to the product
of the T7 transcription reaction suggesting synthesis of a full
length product.
7.2.3. RNP-Transfection and CAT Activity
[0156] Since the recombinant CAT RNA could be transcribed in vitro,
a system was designed to test whether this RNA can be recognized
and replicated in vivo (FIG. 13). Recombinant RNA was mixed with
the purified polymerase to allow formation of viral RNP-like
particles. To facilitate the association, the RNA/polymerase
mixture was incubated in transcription buffer without nucleotides
for 30 minutes at 30.degree. C. prior to RNP-transfection. In some
experiments, this preincubation step was omitted. RNP-transfections
were either preceeded or followed by infection with influenza
A/WSN/33 virus, since the production of viral polymerase protein
was expected to be necessary for efficient amplification of the
gene. The cells used were either MDCK cells, which are readily
susceptible to influenza A/WSN/33 virus infection, or human 293
cells, which support infection at a slower rate.
[0157] In order to determine whether the minus sense IVACAT1 RNA
could be amplified and transcribed in vivo, an experiment was
performed in 293 cells. Cells were transfected with RNP, virus
infected one hour later and harvested at various times
post-infection. FIG. 14A shows that at early times post infection
only background levels of CAT activity were detected (lanes 5,7 and
9). However, significant levels of CAT activity appeared seven
hours after virus infection (lane 11). A similar level of CAT
activity was detected two hours later (lane 13). There were
background levels of CAT activity in the mock transfected cells at
any time point (lanes 6, 8, 10, 12 and 14), and in control cells
not infected with A/WSN/33 virus (lanes 1-4).
[0158] Preincubation of RNA and polymerase complex was not
necessary for successful RNP-transfection. As can be seen in FIG.
14B, lanes 2 and 3, preincubation might actually cause a decrease
in CAT activity, presumably due to RNA degradation during
preincubation. In another control experiment, infection by helper
virus of RNP-transfected cells was omitted (FIG. 14B, lanes 4 and
5). Since these lanes show no CAT activity we conclude that the
IVACAT1 RNA is amplified specifically by the protein machinery
supplied by the helper virus. In an additional control experiment,
naked RNA was transfected into cells which were subsequently
helper-infected or mock-infected. Again, no CAT activity was
detected in these samples (FIG. 14B, lanes 6-9). Finally,
virus-infected cells which were not transfected with recombinant
CAT-RNP also did not exhibit endogneous acetylation activity (FIG.
14B, lane 10). It thus appears that addition of the purified
polymerase to the recombinant RNA as well as infection of cells by
helper virus is important for successful expression of the CAT
enzyme.
[0159] Experiments were also performed using MDCK cells, the usual
tissue culture host cell for influenza virus (FIG. 14C). When the
reconstituted recombinant CAT-RNP complex was transfected 1 hour
before virus infection, little CAT activity was observed at 7 hours
post virus infection (FIG. 14C, lane 1). When RNP-transfection was
accomplished 2 hours after virus infection, expression of CAT was
greatly enhanced at 7 hours post-virus infection (FIG. 14C, lane
3). Therefore, MDCK cells are also viable host cells for these
experiments.
7.2.4. The CAT-RNP is Packaged into Virus Particles
[0160] Since the recombinant CAT RNA can be replicated in vivo via
helper virus functions, we examined whether virus produced in
RNP-transfected and helper virus infected cells contained the CAT
gene. MDCK cells were used in the experiment because they yield
higher titers of infectious virus than 293 cells. MDCK cells were
infected with A/WSN/33 virus, RNP-transfected 2 hours later and
allowed to incubate overnight. At 14 hours post infection, media
was harvested and cells were pelleted. Virus supernatant was then
used to infect new MDCK cell monolayers. The inoculum was removed
after 1 hour and cells were harvested at 12 hours post infection
and assayed for CAT activity. FIG. 15 reveals that the virus
preparation induces a level of CAT activity (lanes 2 and 3) which
is significantly above control (lane 1). In this case, the addition
of helper virus to the inoculum did not increase CAT activity (lane
4). Further passaging of supernatant virus on fresh MDCK cells did
not result in measurable induction of CAT activity. This is not
surprising as there is no selective pressure for retaining the CAT
gene in these viral preparations. We excluded the possibility that
we were transferring the original RNA/polymerase complex by
pretreating the inocula with RNase. This treatment destroys viral
RNPs of influenza virus (Pons et al. 1969 Virology 39: 250-259;
Scholtissek and Becht, 1971 J. Gen. Virol. 10: 11-16).
8. Rescue of Infectious Influenza Viruses Using RNA Derived from
Specific Recombinant DNA
[0161] The experiments described in the subsections below
demonstrate the rescue of infectious influenza viruses using RNA
which is derived from specific recombinant DNAs. RNAs corresponding
to the neuraminidase (NA) gene of influenza A/WSN/33 virus (WSN
virus) were transcribed in vitro from appropriate plasmid DNAs
and--following the addition of purified influenza virus polymerase
complex (as described in Section 6.1.1. supra)--were transfected
into MDBK cells as described in Section 7, supra. Superinfection
with helper virus, lacking the WSN NA gene, resulted in the release
of viruses containing the WSN NA gene. Thus, this technology allows
the engineering of infectious influenza viruses using cDNA clones
and site-specific mutagenesis of their genomes. Furthermore, this
technology may allow for the construction of infectious chimeric
influenza viruses which can be used as efficient vectors for gene
expression in tissue culture, animals or man.
[0162] The experiments described in Sections 6 and 7 supra,
demonstrate that the 15 3' terminal nucleotides of negative strand
influenza virus RNAs are sufficient to allow transcription in vitro
using purified influenza virus polymerase proteins. In addition,
the studies using the reporter gene chloramphenicol
acetyltransferase (CAT) show that the 22 5' terminal and the 26 3'
terminal nucleotides of the viral RNAs contain all the signals
necessary for transcription, replication and packaging of influenza
virus RNAs. As an extension of these results, a plasmid, pT3NAv,
was constructed which contained the complete NA gene of influenza
A/WSN/33 virus downstream of a truncated T3 promoter (FIG. 16).
Therefore, runoff transcription of this plasmid, cut at the Ksp632I
site, yields an RNA which is identical to the true genomic NA gene
of the WSN virus (FIG. 17, lane 3). This RNA was then incubated
with purified polymerase (purified as described in Section 6.1.1)
and used in a ribonucleoprotein (RNP) transfection experiment to
allow the rescue of infectious virus using helper virus which did
not contain the WSN virus NA. The choice of WSN-HK helper virus was
based on the need for a strong selection system by which to isolate
a rescued virus. Previously, it was shown that the WSN-HK virus can
only form plaques in MDBK cells when protease is added to the
medium. This is in marked contrast to WSN virus (isogenic to WSN-HK
virus except for the neuraminidase gene), which in the absence of
protease readily replicates in MDBK cells and forms large, easily
visible plaques (Schulman et al., 1977, J. Virol. 24:170-176).
8.1. Materials and Methods
8.1.1. Viruses and Cells
[0163] Influenza A/WSN/33 virus and A/WSN-HK virus were grown in
Madin-Darby canine kidney (MDCK) cells and embryonated eggs,
respectively (Sugiura et al., 1972, J. Virol. 10:639-647; Schulman
et al., 1977, J. Virol. 24:170-176. Influenza A/PR/8/34 virus was
also grown in embryonated eggs. Madin-Darby bovine kidney (MDBK)
cells were used for the transfection experiments and for selection
of rescued virus (Sugiura et al., 1972, J. Virol. 10:639-647).
8.1.2. Construction of Plasmids
[0164] The pT3NAv, pT3NAv mut 1 and pT3NAv mut 2 plasmids were
constructed by PCR-directed mutagenesis using a cloned copy of the
WSN NA gene, which was obtained following standard procedures
(Buonagurio et al., 1986, Science 232:980-982). To construct
pT3NAv, the following primers were used:
5'-CGGAATTCTCTTCGAGCGAAAGCAGGAGTT-3' and
5'-CCAAGCTTATTAACCCTCACTAA- AAGTAGAAACAAGGAGTTT-3'. After 35 cycles
in a thermal cycler (Coy Lab products, MI), the PCR product was
digested with EcoRI and HindIII and cloned into pUC19. Plasmid
pT3NAv mut 1 was constructed in a similar fashion except that the
sequence of the primer was altered (FIG. 16). Plasmid pT3NAv mut 2
was constructed by cassette mutagenesis through the digestion of
pT3NAv with PstI and NcoI and religation in the presence of the
synthetic
oligonucleotides-5'-CATGGGTGAGTTTCGACCAAAATCTAGATTATAAAATAG-
GATACATATGCA-3' and
5'-AATGTATCCTATTTTATAATCTAGATTTTGGTCGAAACTCACC-3'. Oligonucleotides
were synthesized on an applied Biosystems DNA synthesizer. The
final clones pT3NAv, pT3NAv mut 1 and pT3NAv mut 2 were grown up
and the DNAs were partially sequenced starting from the flanking
pUC19 sequences and reaching into the coding sequences of the NA
gene. The mutations in pT3NAv mut 2 were also confirmed by
sequencing.
8.1.3. Purifacation of Influenza a Virus Polymerase and RNP
Transfection in MDBK Cells
[0165] The RNA polymerase complex was purified from influenza
A/PR/8/34 virus as described in Section 6.1.1, supra, and was then
used for RNP transfection in MDBK cells using the protocol
described in Section 7, supra, except that WSN-HK virus was used as
helper virus at an moi of 1. RNAs used for RNP transfection were
obtained by phenol extraction of purified virus or by transcription
(using T3 polymerase) of pT3NAv, pT3NAv mut 1 and pT3NAv mut 2. All
plasmids were digested with Ksp632I, end-filled by Klenow enzyme
(BRL) and then transcribed in a runoff reaction as described in
Section 7, supra.
8.2. Results
8.2.1. Rescue of Infectious Influenza Virus in MDBK Cells Using RNA
Derived from Recombinant Plasmid DNA
[0166] A plasmid, pT3NAv, was constructed to contain the complete
NA gene of influenza WSN virus downstream of a truncated T3
promoter (FIG. 16). Runoff transcription of the plasmid, cut at the
Ksp632I site, yields an RNA which is identical in length to the
true genomic NA gene of the WSN virus (FIG. 17, lane 3). This RNA
was then incubated with purified polymerase and used in a
ribonucleoprotein (RNP) transfection experiment to allow the rescue
of infectious virus using helper virus. The choice of WSN-HK virus
as helper virus was based on the need for a strong selection system
by which to isolate a rescued virus. Previously, it was shown that
the WSN-HN virus can only form plaques in MDBK cells when protease
is added to the medium (Schulman et al., 1977, J. Virol.
24:170-176). This is in marked contrast to WSN virus (isogenic to
WSN-HK helper virus except for the neuraminidase gene), which is
the absence of protease readily replicates in MDBK cells and forms
large, easily visible plaques (Sugiura et al., 1972, J. Virol.
10:639-647). MDBK cells were first infected with the WSN-HK helper
virus and RNP-transfected one hour after virus infection. Following
overnight incubation in the presence of 20 .mu.g/ml plasminogen,
supernatant from these cells was then amplified and plaqued in MDBK
cells in the absence of protease in the medium. The appearance of
plaques in MDBK cells (Schulman et al., 197, J. Virol. 10:639-647)
indicated the presence of virus which contained the WSN virus NA
gene, since supernatant from control experiments of cells infected
only with the WSN-HK virus did not produce plaques. In a typical
experiment involving the use of a 35 mm dish for the
RNP-transfection, 2.5.times.10.sup.2 plaques were observed.
[0167] In another control experiment, synthetic NA RNA was used
which was derived from plasmid pT3NAv mut 1 (FIG. 16). This RNA
differs from the wild type NA RNA derived from pT3NAv by a single
nucleotide deletion in the nontranslated region of the 5' end (FIG.
16). RNP-transfection of MDBK cells with this RNA and
superinfection with WSN-HK virus did not result in the formation of
rescued virus. This negative result is readily explained since we
have shown in Sections 6 and 7, supra, that the essential sequences
for the recognition of viral RNA by viral polymerases as well as
the packaging signals are located within the 3' and 5' terminal
sequences of the viral RNAs. However, we cannot exclude the
possibility that rescue of virus using this mutated RNA does occur,
albeit at an undetected frequency.
8.2.2. RNA Analysis of Rescued Virus
[0168] Virus obtained in the rescue experiment was plaque purified,
amplified in MDBK cells and RNA was extracted from this
preparation. The RNA was then analyzed by electrophoresis on a
polyacrylamide gel. FIG. 17 shows the RNA of the helper virus
WSN-HK (lane 1) and the synthetic NA RNA (lane 3), which was
transcribed by T3 polymerase from plasmid pT3NAv. The migration
pattern of the RNAs of the rescued virus (lane 2) is identical to
that of control WSN virus (lane 4). Also, the NA RNAs in lanes 2
and 4 migrate at the same position as the NA RNA derived from cDNA
(lane 3) and faster than the HK virus NA band in the helper WSN-HK
virus (lane 1). These experiments support the conclusion that as a
result of the RNP-transfection, infectious virus was formed
containing WSN virus NA RNA derived from cDNA.
8.2.3. Rescue of Infectious Influenza Virus Using Virion RNA
[0169] In another transfection experiment, RNA extracted from
purified WSN virus was employed. When this naked RNA is transfected
together with the polymerase proteins into helper virus infected
cells, rescue of WSN virus capable of replicating in MDBK cells is
observed. RNA isolated from an amplified plaque in this experiment
is analyzed in lane 5 of FIG. 17 and shows a pattern
indistinguishable from that of the control of WSN virus in lane
4.
8.2.4. Introduction of Site-Specific Mutations into the Viral
Genome
[0170] The experiments described so far involved the rescue of
influenza WSN virus. Since the synthetic RNA used in these
experiments is identical to the authentic WSN NA gene, the unlikely
possibility of contamination by wild type WSN virus could not be
rigorously ruled out. Therefore, we introduced five silent point
mutations into the coding region of the NA gene in plasmid pT3NAv.
These mutations were introduced by cassette mutagenesis through
replacement of the short NcoI/PstI fragment present in the NA gene.
The five mutations in the cDNA included a C to T change at position
901 and a C to A change at position 925, creating a new XbaI site
and destroying the original PstI site, respectively. In addition,
the entire serine codon at position 887-889 of the cDNA clone was
replaced with an alternate serine triplet (FIG. 17).
RMP-transfection of this mutagenized RNA (pT3NAv mut 2) and helper
virus infection of MDBK cells again resulted in the rescue of a
WSN-like virus which grew in MDBK cells in the absence of added
protease. When the RNA of this virus was examined by sequence
analysis, all five point mutations present in the plasmid DNA (FIG.
16) were observed in the viral RNA (FIG. 18). Since it is extremely
unlikely that these mutations evolved in the wild type influenza
WSN virus, we conclude that successful rescue of infectious
influenza virus containing five site-specific mutations was
achieved via RNP-transfection of engineered RNA.
9. EXAMPLE
Synthetic Replication System
[0171] In the experiments described below, a cDNA clone which can
produce an influenza virus-like vRNA molecule coding for a reporter
gene was used. This resultant RNA is an NS-like vRNA which contains
the antisense of the coding region of the chloramphenicol
acetyltransferase gene (CAT) in place of the antisense coding
regions for the nonstructural proteins, NS1 and NS2 (Section 7,
supra). This recombinant RNA (IVACAT-1) was incubated with purified
influenza virus RNP proteins and used in an attempt to develop a
non-influenza virus dependent replication system. Mouse fibroblast
C127 cells were infected with mixtures of recombinant vaccinia
viruses (Smith et al., 1987, Virology, 160: 336-345) and
transfected one hour later with the IVACAT-1 RNP. Mixtures of
vectors expressing the three polymerases (PB2, PB1 and PA) and the
nucleoprotein were used. Replication and transcription of the
synthetic RNP was assayed by analyzing cells for CAT activity after
overnight incubation. FIG. 19 examines the CAT activity present in
cells initially infected--with many of the possible mixtures of the
4 recombinant vaccinia viruses. FIG. 19, lane 4 is a positive
control in which the influenza A/WSN/33 virus was used in lieu of
the recombinant vaccinia viruses. CAT activity is present in this
sample as well as in cells infected with all four vaccinia vectors
(FIG. 19, lanes 8 and 10). Cells expressing any of the subsets of
these four proteins did not produce detectable CAT protein (FIG.
19, lanes 5-7, 9, 11). In addition, transfected RNA not incubated
with the purified polymerase was also negative for CAT expression
(Section 7, supra). Thus, the presence of the PB2, PB1, PA and NP
proteins are all that is necessary and sufficient for RNP
expression and replication in this system. The levels of CAT
activity obtained in vaccinia vector-infected cells are
reproducibly higher than in cells infected with influenza as helper
virus. The most probable explanation for this is that in influenza
virus-infected cells, the CAT-RNP competes with the endogenous
viral RNP's for active polymerase whereas in the vaccinia driven
system that CAT-RNP is the only viral-like molecule present.
[0172] A number of other cell lines were then tested as hosts for
this vaccinia virus driven system. FIG. 20A shows the results using
MDBK, Hela, 293 and L cells. In each case, no CAT activity was
observed when cells were infected with vectors that express only
the 3 polymerase proteins but significant CAT activity was obtained
if the additional vaccinia-vector inducing NP expression was also
added.
[0173] Previously, a cell line (designated 3PNP-4) was constructed
which constitutively expresses low levels of the PB2, PB1 and PA
proteins and high levels of the NP protein. These cells can
complement the growth of ts mutants mapping either to the PB2 or NP
gene segments (Krystal et al., 1986, Proc. Natl. Acad. Sci. USA
83:2709-2713; Li et al., 1989, Virus Research 12:97-112). Since
replication through recombinant vaccinia virus vectors is dependent
only on these proteins, it was conceivable that this cell line may
be able to amplify and express the synthetic CAT-RNP in the absence
of any virus infection. However, when this experiment was
attempted, no detectable CAT activity was obtained. In order to
investigate the reasons why this cell line did not support
replication, mixtures of recombinant vaccinia viruses were used to
infect 3PNP-4 cells. As we expected from the results described in
Section 7, supra, the addition of the four polymerase proteins
supported the expression of CAT (FIG. 20B, lane 2). FIG. 20B, lane
3 shows that the minimum mixture of vectors needed to induce CAT
activity in 3PNP-4 cells are those expressing only the PB1 and PA
proteins. Therefore, the steady state levels of PB2 and NP proteins
in 3PNP-4 cells are sufficient but the levels of PB1 and PA are
below threshold for CAT expression in the absence of helper virus.
This correlates with the complementation phenotype exhibited by
these cells, since only the growth of PB2 and NP mutants and not
PB1 and PA mutants can be recovered at non-permissive temperature
(Desselberger et al., 1980, Gene 8:315-328).
[0174] Since the synthetic IVACAT-1 RNA is of negative polarity,
CAT can only be synthesized via transcription off the RNP molecule.
Theoretically, detectable levels of CAT can be produced either
through transcription off the transfected input RNP (equivalent to
primary transcription) or first through amplification of RNP and
subsequent transcription (necessitating RNP replication) or a
combination of both. However, previous experiments described in
Section 7, supra, using influenza virus infection to drive the
expression of the CAT protein showed that detectable expression
occurred only if the input CAT-RNP was replicated (Section 7,
supra). This was shown by the use of a second CAT-RNA, IVACAT-2,
which contains 3 mutations within the 12 bases at the 5' end of the
viral RNA (Section 7, supra). This 12 base region is conserved
among all eight gene segments in all influenza A viruses
(Desselberger, at al., 1980, Gene 8:315-328). This synthetic
IVACAT-2 RNP is competent for transcription by the influenza virus
polymerase but it is not replicated and when transfected into
influenza virus-infected cells CAT activity remained undetected
(Section 7, supra). Therefore, primary transcription off the input
RNA does not produce detectable levels of protein in influenza
virus infected cells. Accordingly, we used this mutant RNA to
examine whether the vaccinia vector-expressed influenza proteins
induces CAT activity solely through primary transcription of input
RNP or can allow for amplification through replication and
subsequent transcription. C127 cells were infected with the
recombinant vaccinia viruses and then transfected with either
IVACAT-1 and IVACAT-2 generated RNPs. FIG. 20C shows that low
levels of CAT activity can be detected in cells transfected with
IVACAT-2 RNP (lane 2). When quantitated, 0.5-1% of the
chloramphenical is converted to an acetylated form, compared
to-0.2-0.4% in mock transfected lanes. However, much greater levels
of activity are present in cells transfected with CAT-1 RNP (lane
1; routinely 15-50% conversion of chloramphenicol), indicating that
amplification is occurring in these cells. Therefore, this
recombinant vaccinia virus-driven system is sequence-specific and
the RNP's are undergoing replication.
[0175] In the experiments described, neither the NS1 nor NS2
proteins were required for RNP replication. Although their function
is not known it has been speculated that these proteins may play a
major role in replication because both proteins are synthesized in
large amounts and are present in the nucleus (Krug et al., 1989,
The Influenza Viruses, Krug, R. Ed., Plenum Press, NY, 1989, pp.
89-152; Young et al., 1983, Proc. Natl. Acad. Sci. USA
80:6105-6109; Greenspan et al., 1985, 1985, J. Virol. 54:833-843;
Lamb et al., 1984, Virology 135:139-147). Based on the data
presented, these proteins are not absolutely required for genome
replication. It may be speculated that these proteins may actually
have ancillary roles with regard to the replication of RNP, such as
interaction with host factors, regulation of the expression of
viral genes or some function involved with packaging of the RNP
into infectious virions. However, it can not be ruled out that a
function of these NS proteins may be complemented by a vaccinia
virus protein, although upon inspection, no obvious similarities
were found between either the NS1 or NS2 proteins and known
vaccinia virus proteins. The contrasting properties of these two
viruses also argues against a complimenting vaccinia virus protein,
as vaccinia is a large double-stranded DNA virus replicating
exclusively in the cytoplasm while influenza virus is a negative
sense RNA virus replicating exclusively in the nucleus. In
addition, the replication of the synthetic RNPs occurred even in
the presence of cytosine arabinoside (ara-C), an inhibitor of late
gene expression in vaccinia virus (Oda et al., 1967, J. Mol. Biol.
27:395-419; Kaverin et al., 1975, Virology 65:112-119; Cooper et
al., 1979, Virology 96:368-380).
[0176] This recombinant vaccinia vector dependent scheme possesses
a number of advantages over the use of influenza virus infection to
drive the replication of synthetic RNA. For one, since the
expression of the viral proteins is completely artificial it will
allow for a precise dissection of the processes involved in
replication. Replication first involves the synthesis of positive
sense template from the negative sense genomic RNA. This positive
sense cRNA is then copied in order to amplify genomic sense RNP,
which is then used for protein expression and packaging (Krug et
al., 1989, supra). The system described herein demonstrate that
only the influenza viral PB2, PB1, PA and NP proteins are required
for the detection of expressed protein and for replication of RNP.
Another advantage of this vaccinia vector driven replication scheme
is that since the influenza polymerase proteins are expressed from
cDNA integrated into the vaccinia virus, the mutagenesis of the
polymerase proteins becomes a feasible and powerful method to
further analyze structure-function relationships of the viral
polymerase proteins.
10. EXAMPLE
Use of Bicistronic Influenza Vectors for the Expression of a
Foreign Protein by a Transfectant Influenza Virus
[0177] In the example presented herein, the coding capacity of an
influenza virus was successfully increased by the construction of a
bicistronic influenza virus RNA segment. The use of the bicistronic
approach allowed this increase in the coding capacity with no
alteration in the structure of the viral proteins.
[0178] Specifically, two influenza A viruses containing bicistronic
neuraminidase (NA) genes were constructed. The mRNA molecules
derived from the bicistronic NA genes have two different open
reading frames (ORFs), with the first encoding a foreign
polypeptide and the second encoding the NA protein. The second (NA)
polypeptide's translation is achieved via an internal ribosome
entry site (IRES) which is derived from the 5' noncoding region of
the human immunoglobulin heavy-chain binding protein (BiP)
mRNA.
10.1. Material and Methods
[0179] Viruses and cells. The influenza A virus strain X-31, which
is a reassortant of influenza A/HK/68 and A/PR/8/34 viruses, was
grown in the allantoic fluid of embryonated chicken eggs, purified
by sucrose density gradient centrifugation, and supplied by Evans
Biological Ltd, Liverpool, UK. Influenza A/WSN/33 (WSN) virus was
grown in Madin-Darby bovine kidney (MDBK) cells in reinforced
minimal essential medium (REM). WSN-HK virus, a reassortant
influenza virus which derives the NA gene from influenza A/HK/8/68
virus and the seven remaining RNA segments from WSN virus, was
grown in the allantoic fluid of 10-day-old embryonated chicken eggs
(Section 8, supra). MDBK cells were used in RNP transfection
experiments and for the selection and plaque purification of
transfectant viruses. Madin-Darby canine kidney (MDCK) cells were
infected with transfectant viruses for use in immunostaining
experiments.
[0180] Construction of plasmids. Plasmids were constructed by
standard techniques (Maniatis, T., 1982, Molecular Cloning: A Press
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.). pT3NACAT(wt) contains the CAT gene in negative
polarity flanked by the 3' and 5' noncoding regions of the WSN NA
gene, under the transcriptional control of a truncated T3 promoter.
pT3NA/BIP was constructed as follows: first, a PCR product was
obtained using the oligonucleotides 5'-GGCCACTAGTAGGTCGACGCCGGC-3'
and 5'-GCGCTGGCCATCTTGCCAGCCA-3' as primers, and a plasmid
containing the 5' noncoding region of the BiP gene as template.
This PCR product was digested with restriction enzymes Msci and
Spe1 and cloned into Msci and Xba1 digested pT3NA/EMC. The
resulting plasmid, pT3NA/BIP contains the ORF of the NA followed by
the IRES sequences of the BiP gene (nucleotide positions 372 to 592
of the GenBank data base entry HUMGRP78). pT3NA/BIP-CAT contains,
in addition, the CAT ORF following the BiP-IRES-derived sequences.
pT3NA/BIP-CAT was constructed by inserting into Msci digested
pT3NA/BIP the PCR product which was obtained by using the primers
5'-AGAAAAAAATCACTGGG-3' and 5'-TTACGCCCCGCCCTGCC-3' and template
pIVACAT1/S (Piccone, M. E. et al., 1993, Virus Res. 28:99-112). A
fragment of approximately 920 nt derived from the NA ORF was
deleted from pT3NA/BIP-CAT by digestion with PpuM1 and Spe1,
trimming and religation of the plasmid. The resulting plasmid was
called pT3delNA/BIP-CAT. To construct pT3BIP-NA, the PCR product
obtained by using the primers 5'-GCGCATCGATAGGTCGACGCCGG-3' and
5'-GGCCATCGATCCAATGGTTATTATTTTCTGGTTTGGATTCATCTTGCCAGTTGGG-3' and a
plasmid containing the 5' noncoding region of the BiP gene as
template was digested with Cla1 and inserted into Cla1 digested
pT3NAM1. pT3NAM1 contains the NA gene of WSN virus into which a
Cla1 site has been inserted at nucleotide positions 52-57 by two
silent changes. The resulting plasmid, pT3BIP-NA, has the
BIP-IRES-derived sequences in front of the NA ORF. To construct
pT3GP2/BIP-NA, a PCR product was obtained using oligonucleotides
5'-ATGACTGGATCCGCTAGCATGGCCATCATTTATCTCATTCTCCTGTT-
CACAGCAGTGAGAGGGGACCAGATAGAAGAATCGCAAAACCAGC-3' (L primer) and
5'-ATGACAGAATTCGTCGACTTATCTATTCACTACAGAAAG-3'(M primer) as primers
and a plasmid containing the DNA copy of the genome of the HIV-1
isolate BH 10 (GenBank data base entry HIVBH102) as template. The
PCR product was digested with BamH1 and EcoR1 and cloned into
BamH1/EcoR1 digested pGEX-2T (Pharmacia). This clone was used as
template for the generation of a PCR product with the primers "M"
and 5'-GCGCGAAGACGCAGCAAAAGCAGGAGTT- TAAGCTAGCATGGCCATCATTTATC-3'.
The resulting PCR product was digested with Bbs1 and Sal1, and
ligated into Bbs1/Sal1 digested pT3BIP-NA. The resulting plasmid,
pT3GP2/BIP-NA, has an ORF in front of the BIP-IRES sequences which
codes for a gp4l-derived polypeptide, containing 38 aa of the
ectodomain of gp4l, the 22 aa of the transmembrane domain and 2 aa
of the cytoplasmic tail of gp4l. This sequence is preceded by the
signal peptide (15 aa) and the first 2 aa of the HA of influenza
A/Japan/305/57. For the construction of pT3HGP2/BIP-NA, a PCR
product containing the sequences encoding the transmembrane and
cytoplasmic tail of the HA of WSN virus was obtained using the
primers 5'-CGATGGATCCGCTAGCTTGGAATCGATGG- GGGTGTATC-3' and
5'-ATCGATGAATTCGTCGACTCAGATGCATATTCTGCAC-3' and pT3/WSN-HA (Enami,
M. and Palese, P., 1991, J. Virol. 65:2711-2713) as template. This
PCR product was digested with restriction enzymes BamH1 and Sal1
and subcloned into BamH1/Sal1 digested pGEX-2T. A second PCR
product was inserted into this subclone between the BamH1 and Cla1
restriction sites. The second PCR product was obtained using
oligonucleotides "L" and
5'-ATGACTGTCGACCCATGGAAGTCAATCGATGTTATGTTAAACCAA- TTCCAC-3' as
primers and the plasmid containing the DNA copy of the HIV-1 genome
as template. From this plasmid an Nhe1-Sal1 fragment was recloned
into Nhe1/Sa1 digested pT3GP2/BIP-NA, and the resulting plasmid was
called pT3HGP2/BIP-NA. The first ORF of pT3HGP2/BIP-NA codes for a
polypeptide which has an ectodomain (39 aa, of which 31 aa are
derived from the gp4l protein ectodomain), followed by the
transmembrane and cytoplasmic domains of the HA of influenza WSN
virus (37 aa). Oligonucleotides were synthesized using an Applied
Biosystems DNA synthesizer. The presence of the appropriate
sequences in the plasmid DNAs was confirmed by sequencing with a
DNA sequencing kit (United States Biochemical Corporation).
[0181] Ribonucleoprotein (RNP) transfections. Influenza virus RNA
polymerase was isolated from influenza X-31 virus as previously
described (Section 7, supra). RNP transfections were performed in
influenza virus-infected MDBK cells according to Enami and Palese
(Enami, M. and Palese, P., 1991, J. Virol. 65:2711-2713). Briefly,
plasmids used in transfections were digested with Ksp6321 or Bbs1
restriction enzymes. 500 ng of linearized plasmid was transcribed
with T3 RNA polymerase (Stratagene) in the presence of purified
influenza virus polymerase. The resultant RNP complexes were
DEAE-transfected into WSN or WSN-HK infected MDBK cells.
[0182] CAT assays. After RNP-transfection of 10.sup.6 WSN-infected
MDBK cells in a 35-mm-diameter dish, cells were further incubated
at 37.degree. C. for 16 h in the presence of 1.5 ml of REM medium
and after that period cells were harvested by using a rubber
policeman.
[0183] Following low speed centrifugation, cell pellets were
resuspended in 100 .mu.l of 0.25 M Tris-HCl buffer (pH 75) and
determinations of CAT activity in these samples were performed as
previously described (Li, X. and Palese, 1992, J. Virol.,
66:4331-4338).
[0184] Selection of Influenza virus transfectants. RNP
transfections were performed in the same way as described before
for CAT expression, except that MDBK cells were infected with
WSN-HK helper virus (Enami, M. and Palese, P., 1991, J. Virol.
65:2711-2713). Medium from transfected cells was harvested 18 h
after transfection and used for infection of a subconfluent
monolayer of MDBK cells in an 80-cm.sup.2 flask. Infected cells
were incubated 4 days at 37.degree. C. in REM and transfectant
viruses released to the medium were plaque purified three times in
MDBK cells covered with agar overlay media.
[0185] Virus purification. WSN virus and transfectant viruses were
grown in MDBK cells after infection at an MOI of 0.01. Media from
infected cells was harvested 2 days after infection and clarified
by two 30 minute centrifugations at 3,000 rpm and 10,000 rpm,
respectively. Viruses were purified from supernatants by pelleting
in a Beckman SW27 rotor at 25,000 rpm (90 min) through a 10 ml 30%
sucrose cushion in NTE buffer (NaCl 100 mM, Tris-HCl 10 mM, EDTA 1
mM, pH 8,0). Virus pellets were resuspended in NTE and the protein
concentration in purified virus samples was determined by the
Bio-Rad protein assay (Bio-Rad). In order to test the purity of the
samples, 100 ng of protein were subjected to SDS-PAGE in a 10%
polyacrylamide gel according to Laemmli (Laemmli, U.K., 1970,
Nature 227:680-685) and protein bands were visualized by silver
staining (Merril, C. R. et al., 1981, Science 211:1437-1438). In
all cases, the viral proteins in the nt of protein. Samples
represented more than 90% of the total amount of protein.
[0186] RNA extraction, electrophoresis and sequencing. RNAs were
extracted from purified viruses as previously described (Luo, G. et
al., 1992, J. Virol. 66:4679-4685). Approximately 100 ng of virion
RNAs were electrophoresed on a 2.8% polyacrylamide gel containing
7.7 M urea at 150 V for 110 min. The RNA segments were visualized
by silver staining (Section 8, supra). The NA-RNA segment of
transfectant viruses was sequenced as follows: first, 100 ng of
viron RNAs were used for a reverse transcription reaction using.
the primer 5'-GCGCGAATTCTCTTCGAGCAAAAGCAGG-- 3' (EKFLU, annealing
to the last 12 nt at the 3' end of the influenza A virus RNAs), and
SuperScript reverse transcriptase (GibcoBRL). The obtained cDNAs
were PCR-amplified using the primers EKFLU and
5'-AGAGATGAATTGCCGGTT-3' (corresponding to nt positions 243-226 of
the NA gene). PCR products were cloned into pUC19 (New England
Biolabs), and sequenced with a DNA sequencing kit (United States
Biochemical Corporation).
[0187] Immunostaining of Infected cells. Confluent MDCK monolayers
in a 96-well plate were infected with transfectant or wild-type
influenza viruses at an MOI.gtoreq.2. Nine hours postinfection,
cells were washed with PBS and fixed with 25 .mu.l of 1 t
paraformaldehyde in PBS. Then, cells were incubated with 100 .mu.l
of PBS containing 0.1% BSA for 1 hour, washed with PBS three times,
and incubated 1 h with 50 .mu.l of PBS, 0.1% BSA containing 2
.mu.g/ml of the human monoclonal antibody 2F5. This antibody
recognizes the amino acid sequence Glu-Leu-Asp-Lys-Trp-Ala (ELDKWA)
which is present in the ectodomain of gp4l of HIV-1 (Muster, T. et
al., 1993, J. Virol. 67:6642-6647). After three PBS washings,
2F5-treated cells were incubated with 50 .mu.l of PBS, 0.1% BSA,
containing a 1:100 dilution of a peroxidase-conjugated goat
antibody directed against human immunoglobulins (Boehringer
Mannheim). Finally, cells were PBS-washed three times, and stained
with a peroxidase substrate (AEC chromogen, Dako Corporation).
[0188] Western Immunoblot analysis. Confluent monolayers of MDBK
cells in 35-mm dishes were infected with transfectant or wild-type
influenza viruses at an MOI.gtoreq.2. Eight hours postinfection,
infected cells were lysed in 100 .mu.l of 50 mM Tris-HC.sup.1
buffer pH 8.0 containing 150 mM NaCl, 1% NP-40 and 1 mM Pefabloc
(Boehringer Mannheim). 5 .mu.l of these cell extracts or 2 .mu.g of
purified viruses were subjected to SDS-PAGE on a 5-20%
polyacrylamide gradient gel, according to Fairbanks et al.
(Fairbanks, G. et al., 1991, Biochemistry 10:2606-2617). Proteins
were subsequently transferred to a nitrocellulose membrane, and the
monoclonal antibody 2F5 was used to detect the gp41-derived
polypeptides. The Western blot was developed with an alkaline
phosphatase-coupled goat antibody against human immunoglobulins
(Boehringer Mannheim).
10.2. Results
[0189] In this report, it is shown that the IRES element derived
from the 51 noncoding region of the human immunoglobulin
heavy-chain binding protein (BiP) mRNA (Macejak, D. G. and Sarnow,
P., 1991, Nature 353:90-94) is able to promote translation of a
downstream ORF in influenza virus-infected cells. Specifically,
transfectant influenza viruses were constructed containing
bicistronic NA segments which express a foreign polypeptide on the
surface of infected cells in addition to the NA protein. The
foreign polypeptide is translated in infected cells from the
bicistronic mRNA via cap-dependent initiation of translation. The
NA is translated via internal binding of the ribosome to the
bicistronic mRNA, which contains the BIP-IRES element. Furthermore,
it is shown that the foreign polypeptide is incorporated into the
virus particle.
10.2.1. A Synthetic Influenza Virus-Like Gene is Expressed under
the Translational Control of the BIP-IRES Element in Influenza
Virus-Infected Cells
[0190] pT3delNA/BIP-CAT (FIG. 21A) was constructed in order to
study an influenza virus gene whose second ORF is preceded by the
BIP-IRES element. This plasmid contains the CAT ORF in negative
polarity downstream of the BIP-IRES sequence. Since the BIP-IRES
derived sequences do not contain an initiation codon, a short ORF
(110 aa) derived from the NA gene (delNA) was inserted upstream of
the IRES. The delNA ORF was used instead of the full-length NA in
order to reduce the size of the synthetic gene, since the
RNP-transaction efficiency decreases with the length of the
transfected gene. Recognition of the delNA/BIP-CAT gene by the
influenza virus transcription machinery was achieved by flanking
the gene with the 3' and 5'. noncoding regions of the influenza
virus NA gene. pT3delNA/BIP-CAT was linearized with Ksp6321 to
allow runoff transcripbon in vitro using T3 RNA polymerase. The
resulting delNA/BIP-CAT RNA was incubated with purified influenza
virus polymerases to form RNP complexes which were transfected into
WSN infected MDBK cells.
[0191] Cells were collected 16 hours posttransfection and extracts
were assayed for CAT enzyme (FIG. 22). For comparison, an RNP
transfection was performed using NACAT(wt) RNA, which contains the
CAT gene flanked by the noncoding sequences of the NA gene of WSN.
As shown in FIG. 22, the delNA/BIP-CAT RNA was transcribed in
influenza virus-infected cells and the resulting mRNA was
translated into the CAT protein. It is thus likely that CAT
expression from the delNA/BIP-CAT mRNA started by internal binding
of the ribosomes to the BIP-IRES sequences and that initiation of
translation began at the ATG of the CAT ORF. This could be due to
1) different transfection efficiencies of the RNAS, delNA/BIP-CAT
RNA being longer than NACAT(wt) RNA, or 2) a lower translation
efficiency of the CAT ORF in the context of the delNA/BIP-CAT
construct.
10.2.2. Rescue of a Transfectant Influenza Virus in which the
BIP-IRES Element was Inserted Upstream of the NA ORF
[0192] CAT expression from delNA/BIP-CAT RNA in influenza
virus-infected cells suggested that the BIP-IRES could be used for
the construction of transfectant influenza viruses containing a
bicistronic gene. Such a gene could direct from the same mRNA the
synthesis of both a foreign protein and an essential virus protein.
Thus, the rescue of a transfectant virus whose NA-specific ORF was
preceded by the BIP-IRES element was attempted. Plasmid pT3BIP-NA
was engineered (FIG. 21B) to direct the synthesis of an RNA which
contains the NA ORF of WSN virus downstream of a BIP-IRES element,
both in negative polarity, and flanked by the 3' and 5' noncoding
regions of the NA RNA segment of WSN virus. As in delNA/BIP-CAT
RNA, a short ORF (42 aa) derived also from the NA gene was
introduced upstream of the IRES sequences. Thus, initiation of
translation of the NA protein by ribosomal scanning of the 5' end
of the BIP-NA derived mRNA is unlikely. RNP-transfection of BIP-NA
into WSN-HK infected MDBK cells resulted in the rescue of
infectious virus.
[0193] In order to confirm the presence of the transfected gene in
the rescued BIP-NA virus, viral RNA was extracted from purified
virions and analyzed by polyacrylamide gel electrophoresis (FIG.
23). The RNA preparation of the transfectant virus did not show an
RNA band at the position of the wild type NA gene, and contained a
new RNA segment whose length was identical to that of the in vitro
synthesized pT3BIP-NA RNA. Confirmation of the presence of the
transfected gene in the BIP-NA virus was obtained by
PCR-amplification and sequencing of the 3' end of the NA gene, as
described in Materials and Methods, in Section 10.1., above.
The-sequence was found to be identical to that of the corresponding
plasmid.
10.2.3. Rescue of Transfectant Influenza Viruses Whose Bicistronic
NA Genes Contain a Foreign ORF
[0194] Since in was now possible to rescue the transfectant BIP-NA
virus, the next step was to attempt to insert a foreign ORF
upstream of the BIP-IRES element. pT3GP2/BIP-NA and pT3HGP2/BIP-NA
were constructed (FIG. 21C). The GP2/BP-NA RNA contains two ORFS:
The first ORF, GP2, codes for a polypeptide containing 38 aa of the
ectodomain of the gp4l protein of HIV-l, the complete transmembrane
domain and the first two amino acids of the cytoplasmic tail of
gp4l.
[0195] In order to target the GP2 polypeptide to the endoplasmic
reticulum (ER), the leader peptide-coding sequence of the HA
protein of influenza A/Japan/305/57 virus was fused in frame to the
GP2 ORF. The second ORF of the GP2/BIP-NA RNA codes for the WSN NA
protein. This second ORF is under the translational control of the
BIP-IRES element. The HGP2/BIP-NA RNA is identical to the
GP2/BIP-NA RNA except that 7 aa of the ectodomain and the
transmembrane and cytoplasmic domains of the encoded GP2
polypeptide were substituted by 6 aa of the ectodomain and the
transmembrane and cytoplasmic domains of the HA protein of the
influenza WSN virus.
[0196] RNP-transfection of GP2/BIP-NA and HGP2/BIP-NA RNAs into
WSN-HK infected MDBK cells resulted in the rescue of these RNAs
into transfectant viruses. The presence of the transfected gene in
GP2/BIP-NA and HGP2/BIP-NA transfectant viruses was confirmed by
polyacrylamide gel electrophoresis of viral RNAs isolated from
purified virions (FIG. 24), and by PCR-amplification and sequencing
of the 3' end of the NA RNA segments of the transfectants.
GP2/BIP-NA and HGP2/BIP-NA transfectant viruses grew to half a log
and one and a half log lower titers, respectively, than wild-type
transfectant virus.
10.2.4. GP2 and HGP2 Expression in Transfectant Virus-Infected
Cells
[0197] Since the NA is required for viral infectivity in MDBK
cells, transfectant viruses GP2/BIP-NA and HGP2/BIP-NA were able to
express the NA protein in infected cells from their bicistronic NA
genes. In order to study the expression of the GP2 and HGP2
polypeptides in transfectant virus-infected cells, infected MDCK
cells were immunostained using the human monoclonal antibody 2F5.
This antibody is specific for the amino acid sequence ELDKWA of
gp4l, which is present in the polypeptides GP2 and HGP2. The
results are shown in FIG. 25. Wild-type WSN virus-infected cells
did not stain with the gp4l-specific antibody 2F5. In contrast,
both GP2/BIP-NA and HGP2/BIP-NA virus-infected cells showed
positive staining with the 2F5 antibody. These results indicate
that the first cistron (GP2 or HGP2) of the NA RNA segment of these
two transfectant viruses is expressed in infected cells.
[0198] The pattern of immunostaining was different for GP2/BIP-NA
and HGP2/BIP-NA virus-infected cells. Most of the staining in
HGP2/BIP-NA infected cells was localized on the cellular surface,
specifically at the junction between cells. In contrast,
cytoplasmic structures, possibly corresponding to the ER or the
Golgi, are strongly stained in GP2/BIP-NA infected cells. This
finding might indicate that the GP2 protein is transported to the
membrane at a slower rate than HGP2 protein. Alternatively, the GP2
protein may be retained in the ER or the Golgi. Although a
conventional reagent was not utilized for cell permeabilization in
these experiments, it is assumed that cell fixation with 1%
paraformaldehyde permeabilizes the cells to some extent, allowing
cytoplasmic staining.
10.2.5. HGP2 Polypeptide is Incorporated into Virus Particles
[0199] The presence of polypeptides GP2 and HGP2 in GP2/BIP-NA and
HGP2/BIP-NA virus-infected MDBK cells and in purified virions was
analyzed by Western immunoblotting, using the 2F5 antibody. As
shown in FIG. 26A, a low molecular weight polypeptide was detected
in GP2/BIP-NA and HGP2/BIP-NA virus-infected cells (FIG. 26A, lanes
2 and 3) and not in wild-type WSN virus-infected cells (FIG. 26A,
lane 1). The presence of an additional protein band in HGP2/BIP-NA
infected cells (FIG. 26A, lane 3) might be attributed to different
levels of glycosylation of the HGP2 protein. A putative
glycosylation site, Asn-X-Thr, is present in both the GP2 and the
HGP2 polypeptides. When the infected cell extracts were incubated
with PNGase (NEB) prior to electrophoresis only one band was
detected. In addition, a gp4l-derived polypeptide was also
detectable in purified HGP2/BIP-NA (and not in in GP2/BIP-NA or
WSN) virions (FIG. 26B). These results indicate that both
polypeptides GP2 and HGP2 are expressed in cells infected with the
corresponding transfectant viruses. However, only the HGP2
polypeptide, which contains the transmembrane and the cytoplasmic
tail of the WSN HA protein, is incorporated into virus
particles.
[0200] In conclusion, it is demonstrated here that transfectant
influenza viruses containing bicistronic NA genes have been
constructed. These bicistronic genes are maintained in the virus
population after passaging since the gene is required for the
expression of the essential viral NA protein. In addition, this
transfectant virus directs the synthesis of a foreign
polypeptide.
[0201] For the construction of a bicistronic influenza virus gene a
mammalian IRES sequence was utilized. IRES sequences were first
discovered in the nontranslated regions of picornaviral mRNAs
(Jang, S. K. et al., 1989, J. Virol. 63:1651-1660; Jang, S. K. et
al., 1988, J. Virol. 62:2636-2643; Pelletier, J. and Sonenberg,
1988, Nature 334:320-325) derived from EMCV, poliovirus,
rhinovirus, or foot-and-mouth disease virus. Although, the EMCV
IRES has been used for the construction of bicistronic genes in
chimeric retroviruses and polioviruses (Adam, M. A. et al., 1991,
J. Virol. 65:4985-4990; Alexander, L. et al., 1994, Proc. Natl.
Acad. Sci. USA 91:1406-1410; Molla, A. et al., 1992, Nature
356:255-257) expression of a reporter gene engineered downstream of
an EMCV IRES in a synthetic influenza virus gene was undetectable.
Nonviral IRES elements were therefore considered. In this example,
the generation of functional bicistronic genes using the IRES
element derived from the human BiP mRNA is described.
[0202] Other strategies to express foreign polypeptides involve the
use of a fusion protein containing a protease signal, but these
approaches result in the expression of altered proteins due to the
presence of the specific protease signal in the polyproteins.
[0203] The BIP-IRES element, which allows the expression of a
second independently translated cistron, was attractive for two
reasons. First, it only has about 220 nucleotides and is thus
shorter than the functionally equivalent picornaviral sequences.
This is a desired characteristic since we have previously found
packaging limitations with respect to the length of the influenza
virus RNAS. Secondly, the BIP-IRES element shares no sequence or
structural homology with the picornaviral elements, which is
desirable since the latter appears to have only low activity in
influenza virus-infected cells. The hepatitis C virus IRES element
(Tsukiyama-Kohara, K. et al., 1992, J. Virol. 66:1476-1483) would
be another attractive candidate for the construction of bicistronic
influenza virus genes for the same reasons.
[0204] It was first attempted to determine if the BIP-IRES element
was active in influenza virus-infected cells after RNP transfection
using the CAT reporter-system. Experiments demonstrated that the
BIP-IRES element (in T3 delNA/BIP-CAT RNA) can initiate translation
of the CAT gene in influenza virus-infected cells (FIG. 22).
Similar CAT constructs which contained the EMCV IRES or the
rhinovirus 14 IRES instead of the BiP-derived sequence, did not
express CAT protein in influenza virus-infected cells (see
above).
[0205] Next, the investigation was extended by constructing an
influenza virus (BIP-NA) whose NA protein was translated from an
internal ORF preceded by the BIP-IRES element. The fact that this
virus was viable indicates that the NA expression achieved using
the IRES element was sufficient for the generation of an infectious
influenza virus.
[0206] Finally, two transfectant influenza viruses, GP2/BIP-NA and
HGP2/BIP-NA, were generated whose NA mRNAs directed translation of
a foreign cistron (GP2 or HGP2, containing sequences derived from
gp4l of HIV-1) by a conventional cap-dependent scanning mechanism,
and of a second cistron (NA) by internal initiation from the
BIP-IRES. The results are in agreement with the reported IRES
activity of the nontranslated region of the BiP mRNA (Macejak, D.
G. and Sarnow, 1991, Nature 353:90-94).
[0207] Although the proteins were not quantified, it is assumed
that the levels of expression of the GP2 and HGP2 proteins in
infected cells are similar to those of the NA in wild-type
virus-infected cells, since the foreign recombinant ORFs are in the
same background as the ORF of the wild-type NA. It is likely that
the levels of expression of the foreign protein could be increased
by using other influenza virus genes, such as the HA gene, which on
a molar level appears to express 5-10 times more protein than the
NA gene. Although the expression of the NA protein in transfectant
virus-infected cells was not quantified, one might expect lower
levels than in wild type virus-infected cells, since the
transfectant viruses are attenuated in tissue culture. Also,
RNP-transfection experiments using the construct delNA/BiP-CAT
showed lower CAT expression levels than the control involving the
wild-type construct NACAT(wt) (FIG. 22).
[0208] Surface expression of a foreign protein may be desirable for
the induction of a humoral immune response against the protein
(Both, G. W. et al., 1992, Immunol. and Cell Biol. 70:73-78).
Surface expression of both gp41-derived polypeptides was attempted
by fusing inframe the coding sequence for the leader peptide of the
HA of influenza A/Japan/305/57 with the coding sequence of the
foreign protein. Surface expression was detected by immunostaining
of infected cells using the antibody 2F5, which is specific for a
linear epitope in the ectodomain of gp41. In addition, HGP2
polypeptide was successfully packaged into virus particles by
including the transmembrane and cytoplasmic domains of the
influenza virus HA. (It should be noted, however, that initial
experiments following infection of mice with HGP2/BIP-NA virus did
not show a vigorous immune response directed against the gp41
derived sequences.) In contrast to the finding with HGP2, the GP2
polypeptide, which contains the transmembrane domain derived from
the HIV-1 gp4l, was not packaged into virus particles. Recently,
Naim and Roth (Naim, H. Y. and Roth, M. G., 1993, J. Virol.
67:4831-4841), reported that an HA-specific transmembrane domain is
required for incorporation of the HA into influenza virions. The
results discussed here are in agreement with this finding and they
also demonstrate that the transmembrane and cytoplasmic domains of
the HA-protein contain all the signals required for incorporation
of a protein into influenza virus envelopes.
[0209] In summary, the use of the BIP-IRES element for the
construction of bicistronic influenza virus vectors may represent a
new methodology for expressing foreign genes which should have
practical applications in molecular and medical virology.
11. Deposit of Microorganisms
[0210] An E. coli cell line containing the plasmid pIVACAT is being
deposited with the Agricultural Research Culture Collection (NRRL),
Peoria, Ill.; and has the following accession number
6 Strain Plasmid Accession Number E. coli (DH5a) pIVACAT NRRL
[0211] The present invention-is not to be limited in scope by the
specific embodiments described which are intended as single
illustrations of individual aspects of the invention, and any
constructs, viruses or enzymes which are functionally equivalent
are within the scope of this invention. Indeed, various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description and accompanying drawings. Such
modifications are intended to fall within the scope of the appended
claims.
Sequence CWU 1
1
63 1 21 DNA Artificial Sequence Primer for rescue of the mutant NA
gene into virus particles 1 tacgaggaaa tgttcctgtt a 21 2 19 PRT
Influenza virus 2 Gln Leu Val Trp Met Ala Cys Asn Ser Ala Ala Phe
Glu Asp Leu Arg 1 5 10 15 Val Leu Ser 3 16 PRT Influenza virus
epitope within the NP protein 3 Thr Tyr Gln Arg Thr Arg Gln Leu Val
Arg Leu Thr Gly Met Asp Pro 1 5 10 15 4 95 DNA Artificial Sequence
Primer for construction of plasmid pV-wt 4 gaagcttaat acgactcact
ataagtagaa acaagggtgt tttttcatat catttaaact 60 tcaccctgct
tttgctgaat tcattcttct gcagg 95 5 95 DNA Artificial Sequence Primer
for construction of plasmid pM-wt 5 gaagcttaat acgactcact
ataagcaaaa gcagggtgaa gtttaaatga tatgaaaaaa 60 cacccttgtt
tctactgaat tcattcttct gcagg 95 6 68 DNA Artificial Sequence Primer
for construction of plasmid pV-d5' 6 agcttaatac gactcactat
aagatctatt aaacttcacc ctgcttttgc tgaattcatt 60 cttctgca 68 7 60 DNA
Artificial Sequence Primer for construction of plasmid pV-d5' 7
gaagaatgaa ttcagcaaaa gcagggtgaa gtttaataga tcttatagtg agtcgtatta
60 8 42 DNA Artificial Sequence Primer for construction of plasmid
pHgaNS 8 ccgaattctt aatacgactc actataagta gaaacaaggg tg 42 9 30 DNA
Artificial Sequence Primer for construction of plasmid pHgaNS 9
cctctagacg ctcgagagca aaagcaggtg 30 10 15 RNA Artificial Sequence
Primer for construction of plasmid pHgaNS 10 cacccugcuu uugcu 15 11
15 RNA Artificial Sequence Primer for generating point mutations in
promoter sequence 11 cacccugcuu uuacu 15 12 15 RNA Artificial
Sequence Primer for generating point mutations in promoter sequence
12 cacccugcuu cugcu 15 13 15 RNA Artificial Sequence Primer for
generating point mutations in promoter sequence 13 cacccuguuu cugcu
15 14 16 RNA Artificial Sequence Primer for generating point
mutations in promoter sequence 14 cacccuugcu uuugcu 16 15 15 RNA
Artificial Sequence Primer for generating point mutations in
promoter sequence 15 cacccuguuu uuacu 15 16 15 RNA Artificial
Sequence Primer for generating point mutations in promoter sequence
16 cacccuguuu uugcu 15 17 16 RNA Artificial Sequence Primer for
generating point mutations in promoter sequence 17 cacccuugcu
uuuacu 16 18 16 RNA Artificial Sequence Primer for generating point
mutations in promoter sequence 18 cacccuuguu uuuacu 16 19 16 RNA
Artificial Sequence Primer for generating point mutations in
promoter sequence 19 cacccuuguu ucuacu 16 20 96 DNA Artificial
Sequence Primer 20 ctagacgccc tgcagcaaaa gcagggtgac aaagacataa
tggagaaaaa aatcactggg 60 tataccaccg ttgatatatc ccaatcgcat cgtaaa 96
21 96 DNA Artificial Sequence Primer for generating flanking
sequences of NS RNA to fuse with the coding sequence of the CAT
gene 21 gttctttacg atgcgattgg gatatatcaa cggtggtata cccagtgatt
tttttctcca 60 ttatgtcttt gtcaccctgc ttttgctgca gggcgt 96 22 34 DNA
Artificial Sequence Primer for generating flanking sequences of NS
RNA to fuse with the coding sequence of the CAT gene 22 actgcgatga
gtggcagggc ggggcgtaat agat 34 23 38 DNA Artificial Sequence Primer
for construction of plasmid pIVACAT1 23 ctagatctat tacgccccgc
cctgccactc atcgcagt 38 24 34 DNA Artificial Sequence Primer 24
actgcgatga gtggcagggc ggggcgtaat agat 34 25 38 DNA Artificial
Sequence Primer for generating flanking sequences of NS RNA to fuse
with the coding sequence of the CAT gene 25 ctagatctat tacgccccgc
cctgccactc atcgcagt 38 26 97 DNA Artificial Sequence Primer for
construction of plasmid pIVACAT1 26 ctagacgccc tgcagcaaaa
gcagggtgac aaagacataa tggagaaaaa aaatcactgg 60 gtataccacc
gttgatatat cccaatcgca tcgtaaa 97 27 96 DNA Artificial Sequence
Primer for construction of plasmid pIVACAT1 27 gttctttacg
atgcgattgg gatatatcaa cggtggtata cccagtgatt tttttctcca 60
ttatgtcttt gtcaccctgc ttttgctgca gggcgt 96 28 30 DNA Artificial
Sequence Primer for construction of pT3NAv 28 cggaattctc ttcgagcgaa
agcaggagtt 30 29 51 DNA Artificial Sequence Primer for construction
of pT3NAv mut 2 29 catgggtgag tttcgaccaa aatctagatt ataaaatagg
atacatatgc a 51 30 51 DNA Artificial Sequence Primer 30 catgggtgag
tttcgaccaa aatctagatt ataaaatagg atacatatgc a 51 31 43 DNA
Artificial Sequence Primer for construction of pT3NAv mut 2 31
aatgtatcct attttataat ctagattttg gtcgaaactc acc 43 32 24 DNA
Artificial Sequence Primer for construction of pT3NA/BIP 32
ggccactagt aggtcgacgc cggc 24 33 22 DNA Artificial Sequence Primer
for construction of pT3NA/BIP 33 gcgctggcca tcttgccagc ca 22 34 17
DNA Artificial Sequence Primer for construction of pT3NA/BIP-CAT 34
agaaaaaaat cactggg 17 35 17 DNA Artificial Sequence Primer for
construction of pT3NA/BIP-CAT 35 ttacgccccg ccctgcc 17 36 23 DNA
Artificial Sequence Primer for construction of pT3BIP-NA 36
gcgcatcgat aggtcgacgc cgg 23 37 55 DNA Artificial Sequence Primer
for construction of pT3BIP-NA 37 ggccatcgat ccaatggtta ttattttctg
gtttggattc atcttgccag ttggg 55 38 91 DNA Artificial Sequence Primer
for construction of pT3GP2/BIP-NA (L-primer) 38 atgactggat
ccgctagcat ggccatcatt tatctcattc tcctgttcac agcagtgaga 60
ggggaccaga tagaagaatc gcaaaaccag c 91 39 39 DNA Artificial Sequence
Primer for construction of pT3GP2/BIP-NA (M-primer) 39 atgacagaat
tcgtcgactt atctattcac tacagaaag 39 40 53 DNA Artificial Sequence
Primer for construction of pT3GP2/BIP-NA 40 gcgcgaagac gcagcaaaag
caggagttta agctagcatg gccatcattt atc 53 41 38 DNA Artificial
Sequence Primer for construction of pT3HGP2/BIP-NA 41 cgatggatcc
gctagcttgg aatcgatggg ggtgtatc 38 42 37 DNA Artificial Sequence
Primer for construction of pT3HGP2/BIP-NA 42 atcgatgaat tcgtcgactc
agatgcatat tctgcac 37 43 51 DNA Artificial Sequence Primer for
construction of pT3HGP2/BIP-NA 43 atgactgtcg acccatggaa gtcaatcgat
gttatgttaa accaattcca c 51 44 28 DNA Influenza A virus 44
gcgcgaattc tcttcgagca aaagcagg 28 45 18 DNA Influenza virus
Position 243-226 of the NA gene 45 agagatgaat tgccggtt 18 46 6 PRT
Human Immunodeficiency Virus-1 (HIV-1) 46 Glu Leu Asp Lys Trp Ala 1
5 47 12 RNA Artificial Sequence Primer 47 ccugcuuuyg cu 12 48 22
RNA Artificial Sequence Primer 48 aguagaaaca aggguguuuu uu 22 49 52
RNA Influenza A virus 49 aguagaaaca aggguguuuu uucauaucau
uuaacuucac ccugcuuuug cu 52 50 53 RNA Influenza A virus 50
agcaaaagca gggugaaguu uaaaugauau gaaaaaacac ccuuguuucu acu 53 51 30
RNA Influenza A virus 51 agaucuauua aacuucaccc ugcuuuugcu 30 52 43
RNA Artificial Sequence Primer for generate mutagenesis sequence
within viral gene segments 52 aguagaaaca aggguguuuu uucagaucua
uuacgccccg ccc 43 53 15 RNA Artificial Sequence Primer for
construction of WSN NA gene in pT3NAv plasmid 53 aguagaaaca aggag
15 54 14 RNA Artificial Sequence Primer for construction of WSN NA
gene in pT3NAv plasmid 54 aguagaaaca agag 14 55 12 RNA Artificial
Sequence Primer for construction of WSN NA gene in pT3NAv plasmid
55 ccugcuuucg cu 12 56 53 DNA Artificial Sequence Primer 56
ccatgggtga gtttcgacca aaatctagat tataaaatag gatacatatg cag 53 57 15
DNA Artificial Sequence Primer 57 cctgcagaag aatga 15 58 55 RNA
Artificial Sequence Primer for generate mutagenesis sequence within
viral gene segments 58 gugguauacc cagugauuuu uuucuccauu augucuuugu
cacccugcuu uugcu 55 59 53 RNA Artificial Sequence Primer for
construction of WSN NA gene in pT3NAv plasmid 59 cugcagaugu
auccuauuuu auaaucuagg uuuuggucga aggacaccca ugg 53 60 12 RNA
Artificial Sequence Primer for construction of WSN NA gene in
pT3NAv plasmid 60 ccugcuuucg cu 12 61 53 RNA Artificial Sequence
Primer for construction of WSN NA gene in pT3NAv plasmid 61
cugcauaugu auccuauuuu auaaucuaga uuuuggucga aacucaccca ugg 53 62 96
DNA Artificial Sequence Primer 62 ctagacgccc tgcagcaaaa gcagggtgac
aaagacataa tggagaaaaa aatcactggg 60 tataccaccg ttgatatatc
ccaatcgcat cgtaaa 96 63 42 DNA Artificial Sequence Primer for
construction of pT3NAv 63 ccaagcttat taaccctcac taaaagtaga
aacaaggagt tt 42
* * * * *