U.S. patent application number 10/042526 was filed with the patent office on 2005-02-10 for papilloma virus capsomere vaccine formulations and methods of use.
This patent application is currently assigned to Loyala University of Chicago. Invention is credited to Gissman, Lutz, Muller, Martin.
Application Number | 20050031636 10/042526 |
Document ID | / |
Family ID | 25481268 |
Filed Date | 2005-02-10 |
United States Patent
Application |
20050031636 |
Kind Code |
A1 |
Gissman, Lutz ; et
al. |
February 10, 2005 |
Papilloma virus capsomere vaccine formulations and methods of
use
Abstract
Vaccine formulations comprising viral capsomeres are disclosed
along with methods for their production. Therapeutic and
prophylactic methods of use for the vaccine formulations are also
disclosed.
Inventors: |
Gissman, Lutz; (Wiesloch,
DE) ; Muller, Martin; (Chicago, IL) |
Correspondence
Address: |
MARSHALL, GERSTEIN & BORUN LLP
6300 SEARS TOWER
233 S. WACKER DRIVE
CHICAGO
IL
60606
US
|
Assignee: |
Loyala University of
Chicago
|
Family ID: |
25481268 |
Appl. No.: |
10/042526 |
Filed: |
April 29, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10042526 |
Apr 29, 2002 |
|
|
|
09632286 |
Aug 3, 2000 |
|
|
|
09632286 |
Aug 3, 2000 |
|
|
|
08944368 |
Oct 6, 1997 |
|
|
|
6228368 |
|
|
|
|
Current U.S.
Class: |
424/186.1 ;
424/192.1 |
Current CPC
Class: |
Y10S 977/802 20130101;
C07K 14/005 20130101; A61K 2039/5258 20130101; C07K 2319/00
20130101; A61P 31/20 20180101; C12N 2710/20023 20130101; C12N 7/00
20130101; C12N 2710/20022 20130101; A61K 39/00 20130101; A61P 31/12
20180101; Y10S 977/917 20130101; A61P 35/00 20180101 |
Class at
Publication: |
424/186.1 ;
424/192.1 |
International
Class: |
A61K 039/12; A61K
039/00 |
Claims
What is claimed is:
1. A vaccine formulation comprising a human papilloma virus
capsomere, said capsomere comprising a fusion protein comprising a
human papilloma virus L1 protein adjacent amino acid residues from
a second protein.
2. A vaccine formulation comprising a human papilloma virus
capsomere, said capsomere comprising a truncated human papilloma
virus L1 protein having a deletion of one or more amino acid
residues necessary for formation of a virus-like particle.
3. The vaccine formulation of claim 2 wherein said capsomere
comprises a fusion protein comprising a truncated human papilloma
virus L1 protein adjacent amino acid residues from a second
protein.
4. The vaccine formulation of any one of claims 1, 2, or 3 wherein
the L1 protein is encoded in the genome of a human papilloma virus
selected from the group consisting of HPV6, HPV11, HPV16, HPV18,
HPV33, HPV35, and HPV45.
5. The vaccine formulation of claim 4 wherein the papilloma virus
is HVP16.
6. The vaccine formulation of any one of claims 2, 3, or 5 wherein
carboxy terminal amino acid residues are deleted from the L1
protein.
7. The vaccine formulation of claim 6 wherein 1 to 34 carboxy
terminal amino acid residues are deleted from the L1 protein.
8. The vaccine formulation of claim 7 wherein 34 carboxy terminal
amino acid residues are deleted from the L1 protein.
9. The vaccine formulation of any one of claims 2, 3, or 5 wherein
amino terminal amino acid residues are deleted from the L1
protein.
10. The vaccine formulation of any one of claims 2, 3 or 5 wherein
internal amino acid residues are deleted from the L1 protein.
11. The vaccine formulation of claim 10 wherein the amino acid
residues deleted from the L1 protein comprise a nuclear
localization signal.
12. The vaccine formulation of claims 2 or 3 wherein the amino
acids residues from the second protein are derived from an HPV
protein.
13. The vaccine formulation of claim 12 wherein the HPV protein is
an early HPV protein.
14. The vaccine formulation of claim 12 wherein the early HPV
protein is selected from the group consisting of E1, E2, E3, E4,
E5, E6, and E7.
15. A method of treating an individual infected with an HPV virus
comprising the step of administering to a patient in need thereof
an amount of the vaccine formulation of claims 1, 2, 3, 5, 7, 8,
11, 13 or 14 effective to reduce the level of HPV infection.
16. A method for preventing papilloma virus infection comprising
the step of administering to an individual susceptible thereto an
amount of the vaccine formulation of claims 1, 2, 3, 5, 7, 8, 11,
13 or 14 effective to inhibit HPV infection.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to vaccine formulations
comprising papilloma virus proteins, either as fusion proteins,
truncated proteins, or truncated fusion proteins. The invention
further embraces methods for producing capsomeres of the
formulations, as well as prophylactic and therapeutic methods for
their use.
BACKGROUND
[0002] Infections with certain high-risk strains of genital
papilloma viruses in humans (HPV)--for example, HPV 16, 18, or
45--are believed to be the main risk factor for the formation of
malignant tumors of the anogenital tract. Of the possible
malignancies, cervical carcinoma is by far the most frequent:
according to an estimate by the World Health Organization (WHO),
almost 500,000 new cases of the disease occur annually. Because of
the frequency with which this pathology occurs, the connection
between HPV infection and cervical carcinoma has been extensively
examined, leading to numerous generalizations.
[0003] For example, precursor lesions of cervical intraepithelial
neoplasia (CIN) are known to be caused by papilloma virus
infections [Crum, New Eng. J. Med. 310:880-883 (1984)]. DNA from
the genomes of certain HPV types, including for example, strains
16, 18, 33, 35, and 45, have been detected in more than 95% of
tumor biopsies from patients with this disorder, as well as in
primary cell lines cultured from the tumors. Approximately 50 to
70% of the biopsied CIN tumor cells have been found to include DNA
derived only from HPV 16.
[0004] The protein products of the HPV 16 and HPV 18 early genes E6
and E7 have been detected in cervical carcinoma cell lines as well
as in human keratinocytes transformed in vitro [Wettstein, et al.,
in PAPILLOMA VIRUSES AND HUMAN CANCER, Pfister (Ed.), CRC Press:
Boca Raton, Fla. 1990 pp 155-179] and a significant percentage of
patients with cervical carcinoma have anti-E6 or anti-E7
antibodies. The E6 and E7 proteins have been shown to participate
in induction of cellular DNA synthesis in human cells,
transformation of human keratinocytes and other cell types, and
tumor formation in transgenic mice [Arbelt, et al., J. Virol.,
68:4358-4364 (1994); Auewarakul, et al., Mol. Cell. Biol.
14:8250-8258 (1994); Barbosa, et al., J. Virol. 65:292-298 (1991);
Kaur, et al., J. Gen. Virol. 70:1261-1266 (1989); Schlegel, et al.,
EMBO J., 7:3181-3187 (1988)]. The constitutive expression of the
E6/E7 proteins appears to be necessary to maintain the transformed
condition of HPV-positive tumors.
[0005] Despite the capacity of some HPV strains to induce
neoplastic phenotypes in vivo and in vitro, still other HPV types
cause benign genital warts such as condylomata acuminata and are
only rarely associated with malignant tumors [Ikenberg. In Gross,
et al., (eds.) GENITAL PAPILLOMAVIRUS INFECTIONS, Springer Verlag:
Berlin, pp., 87-112]. Low risk strains of this type include, for
example, HPV 6 and 11.
[0006] Most often, genital papilloma viruses are transmitted
between humans during intercourse which in many instances leads to
persistent infection in the anogenital mucous membrane. While this
observation suggests that either the primary infection induces an
inadequate immune response or that the virus has developed the
ability to avoid immune surveillance, other observations suggest
that the immune system is active during primary manifestation as
well as during malignant progression of papilloma virus infections
[Altmann et al. in VIRUSES AND CANCER, Minson et al., (eds.)
Cambridge University Press, (1994) pp. 71-80].
[0007] For example, the clinical manifestation of primary infection
by rabbit and bovine papilloma virus can be prevented by
vaccination with wart extracts or viral structural proteins
[Altmann, et al., supra; Campo, Curr. Top. In Microbiol and
Immunol. 186:255-266 (1994); Yindle and Frazer, Curr. Top. In
Microbiol. and Immunol. 186; 217-253 (1994)]. Rodents previously
vaccinated with vaccinia recombinants encoding HPV 16 early
proteins E6 or E7, or with synthetic E6 or E7 peptides, are
similarly protected from tumor formation after inoculation of HPV
16 transformed autologous cells [Altman, et al., supra; Campo, et
al., supra; Yindle and Frazer, et al. supra]. Regression of warts
can be induced by the transfer of lymphocytes from regressor
animals following infection by animal papilloma viruses. Finally,
in immunosuppressed patients, such as, for example, recipients of
organ transplants or individuals infected with HIV, the incidence
of genital warts, CIN, and anogenital cancer is elevated.
[0008] To date, no HPV vaccinations have been described which
comprise human papilloma virus late L1 protein in the form of
capsomeres which are suitable both for prophylactic and therapeutic
purposes. Since the L1 protein is not present in malignant genital
lesions, vaccination with L1 protein does not have any therapeutic
potential for these patients. Construction of chimeric proteins,
comprising amino acid residues from L1 protein and, for example E6
or E7 protein, which give rise to chimeric capsomeres, combines
prophylactic and therapeutic functions of a vaccine. A method for
high level production of chimeric capsomeres would therefore be
particularly desirable, in view of the possible advantages offered
by such a vaccine for prophylactic and therapeutic
intervention.
[0009] Thus there exists a need in the art to provide vaccine
formulations which can prevent or treat HPV infection. Methods to
produce vaccine formulations which overcome problems known in the
art to be associated with recombinant HPV protein expression and
purification would manifestly be useful to treat the population of
individuals already infected with HPV as well as useful to immunize
the population of individuals susceptible to HPV infection.
SUMMARY OF THE INVENTION
[0010] The present invention provides therapeutic and prophylactic
vaccine formulations comprising chimeric human papilloma
capsomeres. The invention also provides therapeutic methods for
treating patients infected with an HPV as well as prophylactic
methods for preventing HPV infection in a susceptible individual.
Methods for production and purification of capsomeres and proteins
of the invention are also contemplated.
[0011] In one aspect of the invention, prophylactic vaccinations
for prevention of HPV infection are considered which incorporate
the structural proteins L1 and L2 of the papilloma virus.
Development of a vaccine of this type faces significant obstacles
because papilloma viruses cannot be propagated to adequate titers
in cell cultures or other experimental systems to provide the viral
proteins in sufficient quantity for economical vaccine production.
Moreover, recombinant methodologies to express the proteins are not
always straightforward and often results in low protein yield.
Recently, virus-like particles (VLPs) similar in make up to viral
capsid structures, have been described which are formed in Sf-9
insect cells upon expression of the viral proteins L1 and L2 (or L1
on its own) using recombinant vaccinia or baculovirus. Purification
of the VLPs can be achieved very simply by means of centrifugation
in CsCl or sucrose gradients [Kimbauer, et al., Proc. Natl. Acad.
Sci. (USA), 99:12180-12814 (1992); Kirnbaurer, et al., J. Virol.
67:6929-6936 (1994); Proso, et al., J. Virol. 6714:1936-1944
(1992): Sasagawa, et al., Virology 2016:126-195 (1995); Volpers, et
al., J. Virol. 69:3258-3264 (1995); Zhou, et al., J. Gen. Virol.
74:762-769 (1993): Zhou, et al., Virology 185:251-257 (1991)]. WO
93/02184 describes a method in which papilloma virus-like particles
(VLPs) are used for diagnostic applications or as a vaccine against
infections caused by the papilloma virus. WO 94/00152 describes
recombinant production of L1 protein which mimics the
conformational neutralizing epitope on human and animal papilloma
virions.
[0012] In another aspect of the invention, therapeutic vaccinations
are provided to relieve complications of, for example, cervical
carcinoma or precursor lesions resulting from papilloma virus
infection, and thus represent an alternative to prophylactic
intervention. Vaccinations of this type may comprise early
papilloma virus proteins, principally E6 or E7, which are expressed
in the persistently infected cells. It is assumed that, following
administration of a vaccination of this type, cytotoxic T-cells
might be activated against persistently infected cells in genital
lesions. The target population for therapeutic intervention is
patients with HPV-associated pre-malignant or malignant genital
lesions. PCT patent application WO 93/20844 discloses that the
early protein E7 and antigenic fragments thereof of the papilloma
virus from HPV or BPV is therapeutically effective in the
regression, but not in the prevention, of papilloma virus tumors in
mammals. While early HPV proteins have been produced by recombinant
expression in E. coli or suitable eukaryotic cell types,
purification of the recombinant proteins has proven difficult due
to inherent low solubility and complex purification procedures
which generally require a combination of steps, including ion
exchange chromatography, gel filtration and affinity
chromatography.
[0013] According to the present invention, vaccine formulations
comprising papilloma virus capsomeres are provided which comprise
either: (i) a first protein that is an intact viral protein
expressed as a fusion protein comprised in part of amino acid
residues from a second protein; (ii) a truncated viral protein;
(iii) a truncated viral protein expressed as a fusion protein
comprised in part of amino acid residues from a second protein, or
(iv) some combination of the three types of proteins. According to
the invention, vaccine formulations are provided comprising
capsomeres of bovine papilloma virus (BPV) and human papilloma
virus. Preferred bovine virus capsomeres comprise protein from
bovine papilloma virus type I. Preferred human virus capsomeres
comprise proteins from any one of human papilloma virus strains
HPV6, HPV11, HPV16, HPV18, HPV33, HPV35, and HPV45. The most
preferred vaccine formulations comprise capsomeres comprising
proteins from HPV16.
[0014] In one aspect, capsomere vaccine formulations of the
invention comprise a first intact viral protein expressed as a
fusion protein with additional amino acid residues from a second
protein. Preferred intact viral proteins are the structural
papilloma viral proteins L1 and L2. Capsomeres comprised of intact
viral protein fusions may be produced using the L1 and L2 proteins
together or the L1 protein alone. Preferred capsomeres are made up
entirely of L1 fusion proteins, the amino acid sequence of which is
set out in SEQ ID NO: 2 and encoded by the polynucleotide sequence
of SEQ ID NO: 1. Amino acids of the second protein can be derived
from numerous sources (including amino acid residues from the first
protein) as long as the addition of the second protein amino acid
residues to the first protein permits formation of capsomeres.
Preferably, addition of the second protein amino acid residues
inhibits the ability of the intact viral protein to form virus-like
particle structures; most preferably, the second protein amino acid
residues promote capsomere formation. In one embodiment of the
invention, the second protein may be any human tumor antigen, viral
antigen, or bacterial antigen which is important in stimulating an
immune response in neoplastic or infectious disease states. In a
preferred embodiment, the second protein is also a papilloma virus
protein. It also preferred that the second protein be the
expression product of papilloma virus early gene. It is also
preferred, however, that the second protein be selected from group
of E1, E2, E3, E4, E5, E6, and E7--early gene products encoded in
the genome of papilloma virus strains HVP6, HPV11, HPV18, HPV33,
HPV35, or HPV 45. It is most preferred that the second protein be
encoded by the HPV16 E7 gene, the open reading frame of which is
set out in SEQ ID NO: 3. Capsomeres assembled from fusion protein
subunits are referred to herein as chimeric capsomeres. In one
embodiment, the vaccine formulation of the invention is comprised
of chimeric capsomeres wherein L1 protein amino acid residues make
up approximately 50 to 99% of the total fusion protein amino acid
residues. In another embodiment, L1 amino acid residues make up
approximately 60 to 90% of the total fusion protein amino acid
residues; in a particularly preferred embodiment, L1 amino acids
comprise approximately 80% of the fusion protein amino acid
residues.
[0015] In another aspect of the invention, capsomere vaccine
formulations are provided that are comprised of truncated viral
proteins having a deletion of one or more amino acid residues
necessary for formation of a virus-like particle. It is preferred
that the amino acid deletion not inhibit formation of capsomeres by
the truncated protein, and it is most preferred that the deletion
favor capsomere formation. Preferred vaccine formulations of this
type include capsomeres comprised of truncated L1 with or without
L2 viral proteins. Particularly preferred capsomeres are comprised
of truncated L1 proteins. Truncated proteins contemplated by the
invention include those having one or more amino acid residues
deleted from the carboxy terminus of the protein, or one or more
amino acid residues deleted from the amino terminus of the protein,
or one or more amino acid residues deleted from an internal region
(i.e., not from either terminus) of the protein. Preferred
capsomere vaccine formulations are comprised of proteins truncated
at the carboxy terminus. In formulations including L1 protein
derived from HPV16, it is preferred that from 1 to 34 carboxy
terminal amino acid residues are deleted. Relatively shorter
deletions are also contemplated which offer the advantage of minor
modification of the antigenic properties of the L1 proteins and the
capsomeres formed thereof. It is most preferred, however, that 34
amino acid residues be deleted from the L1 sequence, corresponding
to amino acids 472 to 505 in HPV16 set out in SEQ ID NO: 2, and
encoded by the polynucleotide sequence corresponding to nucleotides
1414 to 1516 in the human HPV16 L1 coding sequence set out in SEQ
ID NO: 1.
[0016] When a capsomere vaccine formulation is made up of proteins
bearing an internal deletion, it is preferred that the deleted
amino acid sequence comprise the nuclear localization region of the
protein. In the L1 protein of HPV 16, the nuclear localization
signal is found from about amino acid residue 499 to about amino
acid residue 505. Following expression of L1 proteins wherein the
NLS has been deleted, assembly of capsomere structures occurs in
the cytoplasm of the host cell. Consequently, purification of the
capsomeres is possible from the cytoplasm instead of from the
nucleus where intact L1 proteins assemble into capsomeres.
Capsomeres which result from assembly of truncated proteins wherein
additional amino acid sequences do not replace the deleted protein
sequences are necessarily not chimeric in nature.
[0017] In still another aspect of the invention, capsomere vaccine
formulations are provided comprising truncated viral protein
expressed as a fusion protein adjacent amino acid residues from a
second protein. Preferred truncated viral proteins of the invention
are the structural papilloma viral proteins L1 and L2. Capsomeres
comprised of truncated viral protein fusions may be produced using
L1 and L2 protein components together or L1 protein alone.
Preferred capsomeres are those comprised of L1 protein amino acid
residues. Truncated viral protein components of the fusion proteins
include those having one or more amino acid residues deleted from
the carboxy terminus of the protein, or one or more amino acid
residues deleted from the amino terminus of the protein, or one or
more amino acid residues deleted from an internal region (i.e., not
from either terminus) of the protein. Preferred capsomere vaccine
formulations are comprised of proteins truncated at the carboxy
terminus. In those formulations including L1 protein derived from
HPV16, it is preferred that from 1 to 34 carboxy terminal amino
acid residues are deleted. Relatively shorter deletions are also
contemplated that offer the advantage of minor modification of the
antigenic properties of the L1 protein component of the fusion
protein and the capsomeres formed thereof. It is most preferred,
however, that 34 amino acid residues be deleted from the L1
sequence, corresponding to amino acids 472 to 505 in HPV16 set out
in SEQ ID NO: 2, and encoded by the polynucleotide sequence
corresponding to nucleotides 1414 to 1516 in the human HPV16 L1
coding sequence set out in SEQ ID NO: 1. When the vaccine
formulation is comprised of capsomeres made up of proteins bearing
an internal deletion, it is preferred that the deleted amino acid
sequence comprise the nuclear localization region, or sequence, of
the protein.
[0018] Amino acids of the second protein can be derived from
numerous sources as long as the addition of the second protein
amino acid residues to the first protein permits formation of
capsomeres. Preferably, addition of the second protein amino acid
residues promotes or favors capsomere formation. Amino acid
residues of the second protein can be derived from numerous
sources, including amino acid residues from the first protein. In a
preferred embodiment, the second protein is also a papilloma virus
protein. It also preferred that the second protein be the
expression product of papilloma virus early gene. It is most
preferred, however, that the second protein be selected from group
of early gene products encoding by papilloma virus E1, E2, E3, E4,
E5, E6, and E7 genes. In one embodiment, the vaccine formulation of
the invention is comprised of chimeric capsomeres wherein L1
protein amino acid residues make up approximately 50 to 99% of the
total fusion protein amino acid residues. In another embodiment, L1
amino acid residues make up approximately 60 to 90% of the total
fusion protein amino acid residues; in a particularly preferred
embodiment, L1 amino acids comprise approximately 80% of the fusion
protein amino acid residues.
[0019] In a preferred embodiment of the invention, proteins of the
vaccine formulations are produced by recombinant methodologies, but
in formulations comprising intact viral protein, the proteins may
be isolated from natural sources. Intact proteins isolated from
natural sources may be modified in vitro to include additional
amino acid residues to provide a fusion protein of the invention
using covalent modification techniques well known and routinely
practiced in the art. Similarly, in formulations comprising
truncated viral proteins, the proteins may be isolated from natural
sources as intact proteins and hydrolyzed in vitro using chemical
hydrolysis or enzymatic digestion with any of a number of
site-specific or general proteases, the truncated protein
subsequently modified to include additional amino acid resides as
described above to provide a truncated fusion protein of the
invention.
[0020] In producing capsomeres, recombinant molecular biology
techniques can be utilized to produce DNA encoding either the
desired intact protein, the truncated protein, or the truncated
fusion protein. Recombinant methodologies required to produce a DNA
encoding a desired protein are well known and routinely practiced
in the art. Laboratory manuals, for example Sambrook, et al.,
(eds.), MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor
Press: Cold Spring Harbor, N.Y. (1989) and Ausebel et al., (eds.),
PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons. Inc.
(1994-1997), describe in detail techniques necessary to carry out
the required DNA manipulations. For large-scale production of
chimeric capsomeres, protein expression can be carried out using
either viral or eukaryotic vectors. Preferable vectors include any
of the well known prokaryotic expression vectors, recombinant
baculoviruses, COS cell specific vectors, vaccinia recombinants, or
yeast-specific expression constructs. When recombinant proteins are
used to provide capsomeres of the invention, the proteins may first
be isolated from the host cell of its expression and thereafter
incubated under conditions which permit self-assembly to provide
capsomeres. Alternatively, the proteins may be expressed under
conditions wherein capsomeres are formed in the host cell.
[0021] The invention also contemplates processes for producing
capsomeres of the vaccine formulations. In one method, L1 proteins
are expressed from DNA encoding six additional histidines at the
carboxy terminus of the L1 protein coding sequence. L1 proteins
expressed with additional histidines (His L1 proteins) are most
preferably expressed in E. coli and the His L1 proteins can be
purified using nickel affinity chromatography. His L1 proteins in
cell lysate are suspended in a denaturation buffer, for example, 6
M guanidine hydrochloride or a buffer of equivalent denaturing
capacity, and then subjected to nickel chromatography. Protein
eluted from the nickel chromatography step is renatured, for
example in 150 mM NaCl. 1 mM CaCl.sub.2, 0.01% Triton-X 100, 10 mM
HEPES (N-2-hydroxyethyl piperazine-N'-2 ethane sulfonic acid), pH
7.4. According to a preferred method of the invention, assembly of
capsomeres takes place after dialysis of the purified proteins,
preferably after dialysis against 150 mM NaCl, 25 mM Ca.sup.2+, 10%
DMSO (dimethyl sulfoxide), 0.1% Triton-X 100, 10 mM Tris
[tris-(hydroxymethyl) aminomethane] acetic acid with a pH value of
5.0.
[0022] Formation of capsomeres can be monitored by electron
microscopy, and, in instances wherein capsomeres are comprised of
fusion proteins, the presence of various protein components in the
assembled capsomere can be confirmed by Western blot analysis using
specific antisera.
[0023] According to the present invention, methods are provided for
therapeutic treatment of individuals infected with HPV comprising
the step of administering to a patient in need thereof an amount of
a vaccine formulation of the invention effective to reduce the
level of HPV infection. The invention also provide methods for
prophylactic treatment of individuals susceptible to HPV infection
comprising the step of administering to an individual susceptible
to HPV infection an amount of a vaccine formulation of the
invention effective to prevent HPV infection. While infected
individuals can be easily identified using standard diagnostic
techniques, susceptible individuals may be identified, for example,
as those engaged in sexual relations with an infected individual.
However, due to the high frequency of HPV infection, all sexually
active persons are susceptible to papilloma virus infection.
[0024] Administration of a vaccine formulation can include one or
more additional components such as pharmaceutically acceptable
carriers, diluents, adjuvants, and/or buffers. Vaccines may be
administered at a single time or at multiple times. Vaccine
formulation of the invention may be delivered by various routes
including, for example, oral, intravenous, intramuscular, nasal,
rectal, transdermal, vaginal, subcutaneous, and intraperitoneal
administration.
[0025] Vaccine formulations of the invention offer numerous
advantages when compared to conventional vaccine preparations. As
part of a therapeutic vaccination, capsomeres can promote
elimination of persistently infected cells in, for example,
patients with CIN or cervical carcinoma. Additionally, therapeutic
vaccinations of this type can also serve a prophylactic purpose in
protecting patients with CIN lesions from re-infection. As an
additional advantage, capsomeres can escape neutralization by
pre-existing anticapsid antibodies and thereby posses longer
circulating half-life as compared to chimeric virus-like
particles.
[0026] Vaccine formulations comprising chimeric capsomeres can
provide the additional advantage of increased antigenicity of both
protein components of the fusion protein from which the capsomere
is formed. For example, in a VLP, protein components of the
underlying capsomere may be buried in the overall structure as a
result of internalized positioning within the VLP itself.
Similarly, epitopes of the protein components may be sterically
obstructed as a result of capsomere-to-capsomere contact, and
therefore unaccessible for eliciting an immune response.
Preliminary results using L1/E7 fusion proteins to produce VLPs
support this position in that no antibody response was detected
against the E7 component. This observation is consistent with
previous results which indicate that the carboxy terminal region of
L1 forms inter-pentameric arm structures that allow assembly of
capsomeres into capsids [Garcia, et al., J. Virol. 71: 2988-2995
(1997)]. Presumably in a chimeric capsomere structure, both protein
components of the fusion protein substructure are accessible to
evoke an immune response. Capsomere vaccines would therefore offer
the additional advantage of increased antigenicity against any
protein component, including, for example, neutralizing epitopes
from other virus proteins, expressed as a fusion with L1 amino acid
sequences.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The present invention is illustrated by the following
examples. Example 1 describes construction of expression vectors to
produce fusion, or chimeric, viral proteins. Example 2 relates to
generation of recombinant baculoviruses for expression of viral
proteins. Example 3 addresses purification of capsomeres. Example 4
describes an immunization protocol for production of antisera and
monoclonal antibodies. Example 5 provides a peptide ELISA to
quantitate capsomere formation. Example 6 describes an antigen
capture ELISA to quantitate capsomere formation. Example 7 provides
a hemagglutinin assay to assay for the induction of neutralizing
antibodies.
EXAMPLE 1
Construction of Chimeric L1 Genes
[0028] DNA encoding the HPV 16 L1 open reading frame was excised
from plasmid 16-114/k-L1 /L2-pSynxtVI.sup.- [Kirnbauer et al., J.
Virol. 67:6929-6936 (1994)] using BglII and the resulting fragment
subcloned into pUC19 (New England Biolabs, Beverly, Mass.)
previously linearized at the unique BamHI restriction site. Two
basic expression constructs were first generated to permit
subsequent insertion of DNA to allow fusion protein expression. One
construct encoded HPV 16 L1310 having a nine amino acid deletion;
the deleted region was known to show low level homology with all
other papilloma virus L1 proteins. The second construct, HPV 16 L1
C, encoded a protein having a 34 amino acid deletion of the carboxy
terminal L1 residues. Other constructs include an EcoRV restriction
site at the position of the deletion for facilitated insertion of
DNA encoding other protein sequences. Addition of the EcoRV site
encodes two non-L1 protein amino acids, aspartate and
isoleucine.
[0029] A. Generation of An HPV 16 L1310 Expression Construct
[0030] Two primers (SEQ ID NOs: 5 and 6) were designed to amplify
the pUC19 vector and the complete HPV 16 L1 coding sequence, except
nucleotides 916 through 942 in SEQ ID NO: 1. Primers were
synthesized to also introduce a unique EcoRV restriction site
(underlined in SEQ ID NOs: 5 and 6) at the termini of the
amplification product.
1 CCCCGATATCGCCTTTAATGTATAAATCGTCTGG SEQ ID NO: 5
CCCCGATATCTCAAATTATTTTCCTACACCTAGTG SEQ ID NO: 6
[0031] The resulting PCR product was digested with EcoRV to provide
complementary ends and the digestion product circularized by
ligation. Ligated DNA was transformed into E. coli using standard
techniques and plasmids from resulting colonies were screened for
the presence of an EcoRV restriction site. One clone designated HPV
16 L1 310 was identified as having the appropriate twenty-seven
nucleotide deletion and this construct was used to insert DNA
fragments encoding other HPV 16 proteins at the EcoRV site as
discussed below.
[0032] B. Generation of An HPV 16 L1 C Expression Constructs
[0033] Two primers (SEQ ID NOs: 7 and 8) were designed
complementary to the HPV 16 L1 open reading frame such that the
primers abutted each other to permit amplification in reverse
directions on the template DNA comprising HPV 16 L1-encoding
sequences in pUC19 described above.
2 AAAGATATCTTGTAGTAAAAATTTGCGTCCTAAAGGAAAC SEQ ID NO: 7
AAAGATATCTAATCTACCTCTACAACTGCTAAACGCAAAAAACG SEQ ID NO: 8
[0034] Each primer introduced an EcoRV restriction site at the
terminus of the amplification product. In the downstream primer
(SEQ ID NO: 8), the EcoRV site was followed by a TAA translational
stop codon positioned such that the amplification product, upon
ligation of the EcoRV ends to circularize, would include deletion
of the 34 carboxy terminal L1 amino acids. PCR was performed to
amplify the partial L1 open reading frame and the complete vector.
The amplification product was cleaved with EcoRV, circularized with
T4 DNA ligase, and transformed into E. coli DH5 .alpha. cells.
Plasmids from viable clones were analyzed for the presence of an
EcoRV site which would linearize the plasmid. One positive
construct designated pUCHPV16L1C was identified and used to insert
DNA from other HPV 16 proteins utilizing the EcoRV site.
[0035] C. Insertion of DNA Fragments Into HPV 16 L1 310 and
HPV16L1C
[0036] DNA fragments of HPV 16 E7 encoding amino acids 1-50, 1-60,
1-98, 25-75, 40-98, 50-98 in SEQ ID NO: 4 were amplified using
primers that introduced terminal 5' EcoRV restriction sites in
order to facilitate insertion of the fragment into either HPV 16 L1
310 and HPV16L1C modified sequence. In the various amplification
reactions, primer E7.1 (SEQ ID NO: 9) was used in combination with
primer E7.2 (SEQ ID NO: 10) to generate a DNA fragment encoding E7
amino acids 1-50; with primer E7.3 (SEQ ID NO: 11) generate a DNA
fragment encoding E7 amino acids 1-60; or with primer E7.4 (SEQ ID
NO: 12) generate a DNA fragment encoding E7 amino acids 1-98. In
other amplification reactions, primer pairs E7.5 (SEQ ID NO: 13)
and E7.6 (SEQ ID NO: 14) were used to amplify a DNA fragment
encoding E7 amino acids 25-75; E7.7 (SEQ ID NO: 15) and E7.4 (SEQ
ID NO: 12) were used to amplify a DNA fragment encoding E7 amino
acids 40-98; and E7.8 (SEQ ID NO: 16) and E7.4 (SEQ ID NO: 12) were
used to amplify a DNA fragment encoding E7 amino acids 50-98.
3 Primer E7.1 AAAAGATATCATGCATGGAGATACACCTACATTGC SEQ ID NO: 9
Primer E7.2 TTTTGATATCGGCTCTGTCCGGTTCTGCTTGTCC SEQ ID NO: 10 Primer
E7.3 TTTTGATATCCTTGCAACAAAAGGTTACAATATTGTAATGGGCC SEQ ID NO: 11
Primer E7.4 AAAAGATATCTGGTTTCTGAGAACAGATGGG- GCAC SEQ ID NO: 12
Primer E7.5 TTTTGATATCGATTATGAGCAATTAAA- TGACAGCTCAG SEQ ID NO: 13
Primer E7.6 TTTTGATATCGTCTACGTGTGTGCTTTGTACGCAC SEQ ID NO: 14
Primer E7.7 TTTATCGATATCGGTCCAGCTGGACAAGCAGAACCGGAC SEQ ID NO: 15
Primer E7.8 TTTTGATATCGATGCCCATTACAATATTGTAACCTTTTG SEQ ID NO:
16
[0037] Similarly, nucleotides from DNA encoding the influenza
matrix protein (SEQ ID NO: 17) was amplified using the primer pair
set out in SEQ ID NOs: 19 and 20. Both primers introduced an EcoRV
restriction site in the amplification product.
4 TTTTGATATCGATATGGAATGGCTAAAGACAAGACCAATC SEQ ID NO: 19
TTTTGATATCGTTGTTTGGATCCCCATTCCCATTG SEQ ID NO: 20
[0038] PCR products from each amplification reaction were cleaved
with EcoRV and inserted into the EcoRV site of either the HPV 16 L1
310 and HPV16L1C sequences previously linearized with the same
enzyme. In order to determine the orientation of inserts in
plasmids encoding E7 amino acids 25-75 and 50-98 and plasmid
including influenza matrix protein, ClaI digestion was employed,
taking advantage of a restriction site overlapping the newly
created EcoRV restriction site (GATATCGAT) and included in the
upstream primer. For the three expression constructs including the
initiating methionine of HPV16 E7, insert orientation was
determined utilizing a NslI restriction site within the E7 coding
region.
[0039] Once expression constructs having appropriate inserts were
identified, the protein coding region for both L1 and inserted
amino acids was excised as a unit using restriction enzymes XbaI
and SmaI and the isolated DNA ligated into plasmid pVL1393
(Invitrogen) to generate recombinant baculoviruses.
[0040] D. Elimination of EcoRV Restriction Sites in Expression
Constructs
[0041] The HPV 16 L1 AC sequence includes DNA from the EcoRV site
that results in translation of amino acids not normally found in
wild-type L1 polypeptides. Thus, a series of expression
constructions was designed in which the artificial EcoRv site was
eliminated. The L1 sequence for this series of expression
constructs was designated HPV 16L1C*.
[0042] To generate an expression construct containing the HPV
16L1C* sequence, two PCR reactions were performed to amplify two
overlapping fragments from the pUC-HPV16 L1C encoding E7 amino
acids 1-50. The resulting DNA fragments overlapped at the position
of the L1/E7 boundary but did not contain the two EcoRV restriction
sites. Fragment 1 was generated using primers P1 (SEQ ID NO: 21)
and P2 (SEQ ID NO: 22) and fragment 2 using primers P3 (SEQ ID NO:
23) and P4 (SEQ ID NO: 24).
5 Primer P1 GTTATGACATACATACATTCTATG SEQ ID NO: 21 Primer P2
CCATGCATTCCTGCTTGTAGTAAAAATTTGCGTCC SEQ ID NO: 22 Primer P3
CTACAAGCAGGAATGCATGGAGATACACC SEQ ID NO: 23 Primer P4
CATCTGAAGCTTAGTAATGGGCTCTGTCCGGTTCTG SEQ ID NO: 24
[0043] Following the first two amplification reactions, the two
purified products were used as templates in another PCR reaction
using primers P1 and P4 only. The resulting amplification product
was digested with enzymes EcoNI and HindIII inserted into the HPV
16L1C expression construct described above following digestion with
the same enzymes. The resulting expression construct differed from
the original HPV16L1C construct with DNA encoding L1 and E7 amino
acids 1-50 by loss of the two internal EcoRV restriction sites. The
first EcoRV site was replaced by DNA encoding native L1 alanine and
glycine amino acids in this position and the second was replaced by
a translational stop signal. In addition, the expression constrict,
designated HPV 16 L1C* E7 1-52, contained the first 52 amino acids
of HPV 16 E7 as a result of using primer P4 which also encodes E7
amino acids residues histidine at position 51 and tyrosine at
position 52. HPV 16 L1C* E7 1-52 was then used to generate
additional HPV 16 L1C expression constructs further including DNA
encoding E7 amino acids 1-55 using primer P1 (SEQ ID NO: 21) in
combination with primer P5 (SEQ ID NO: 25), E7 amino acids 1-60
with primer pair P1 and P6 (SEQ ID NO: 26), and E7 amino acids 1-65
with primer pair P1 and P7 (SEQ ID NO: 27). The additional animo
acid-encoding DNA sequences in the amplification products arose
from design of the primers to include additional nucleotides for
the desired amino acids.
6 Primer P5 CATCTGAAGCTTAACAATATTGTAATGGGCTCTGTCCG SEQ ID NO: 25
Primer P6 CATCTGAAGCTTACTTGCAACAAAAGGTTACAATATTGTAATGGGCTCT- GTCCG
SEQ ID NO: 26 Primer P7 CATCTGAAGCTTAAAGCGTAGAGTCACA-
CTTGCAACAAAAGGTTACAATATTGTAATGGGCTCTGTCCG SEQ ID NO: 27
[0044] Similarly, HPV 16 L1C* E7 1-70 was generated using template
DNA encoding HPV 16 L1C* E7 1-66 and the primer pair P1 and P8 (SEQ
ID NO: 28).
7 Primer P8 CATCTGAAGCTTATTGTACGCACAACCGAAGCGTAGAGTCACACTTG SEQ ID
NO: 28
[0045] Following each PCR reaction, the amplification products were
digested with EcoNI and HindIII and inserted into HPV16L1C
previously digested with the same enzymes. Sequences of each
constructs were determined using an Applied Biosystems Prism 377
sequencing instrument with fluorescent chain terminating
dideoxynucleotides [Prober et al., Science 238:336-341 (1987)].
EXAMPLE 2
Generation of Recombinant Baculoviruses
[0046] Spodoptera frugiperda (Sf9) cells were grown in suspension
or monolayer cultures at 27.degree. in TNMFH medium (Sigma)
supplemented with 10% fetal calf serum and 2 mM glutamine. For HPV
16 L1-based recombinant baculovirus construction, Sf9 cells were
transfected with 10 .mu.g of transfer plasmid together with 2 .mu.g
of linearized Baculo-Gold DNA (PharMingen, San Diego, Calif.).
Recombinant viruses were purified by according to manufacturer's
suggested protocol.
[0047] To test for expression of HPV 16 L1 protein, 10.sup.5 Sf9
cells were infected with baculovirus recombinant at a multiplicity
of infection (m.o.i) of 5 to 10. After incubation for three to four
days at 28.degree. C., media was removed and cells were washed with
PBS. The cells were lysed in SDS sample buffer and analyzed by
SDS-PAGE and Western blotting using anti-HPV16 L1 and anti-HPV16 E7
antibodies.
[0048] In order to determine which of the chimeric L1 protein
expression constructs would preferentially produce capsomeres,
extracts from transfected cells were subjected to gradient
centrifugation. Fractions obtained from the gradient were analyzed
for L1 protein content by Western blotting and for VLP formation by
electron microscopy. The results are shown in Table 1.
[0049] The intact HPV L1 protein, as well as the expression
products HPV 16 L1310 and HPV 16 L1C, each were shown to produce
capsomeres and virus-like particles in equal proportions. When E7
coding sequences were inserted into the HPV 16 L1310 vector, only
fusion proteins including E7 amino acids 1 to 50 produced gave rise
to detectable capsomere formation.
[0050] When E7 encoding DNA was inserted into the HPV 16 L1C
vector, all fusion proteins were found to produce capsomeres;
chimeric proteins including E7 amino acid residues 40-98 produced
the highest level of exclusively capsomere structures. Chimeric
proteins including E7 amino acids 1-98 and 25-75 both produced
predominantly capsomeres, even thorough virus-like particle
formation was also observed. The chimeric protein including E7
amino acids 1-60 resulted in nearly equal levels of capsomere and
virus-like particle production.
[0051] When E7 sequences were inserted into the HPV 16 L1*C vector,
all fusion proteins were shown to produce capsomeres. Insertion of
DNA encoding E7 residues 1-52, 1-55, and 1-60 produced the highest
level of capsomeres, but equal levels of virus-like particle
production were observed. While insertion of DNA encoding E7 DNA
for residues 1-65, 1-70, 25-75, 40-98, and 1-98 resulted in
comparatively lower levels or undetectable levels of capsid,
capsomeres were produced in high quantities.
8TABLE 1 Capsomeree and Capsid Forming Capacity of Chimeric HPV L1
Proteins L1 Expression Capsomere Capsid Construct Insert Yield
Yield HVP 16 L1 None +++++ +++++ HPV 16 L1.sub..DELTA.310 None +++
++ HPV 16 L1.sub..DELTA.C None ++++ ++++ HPV 16 L1.sub..DELTA.310
E7 1-98 - - HPV 16 L1.sub..DELTA.310 E7 1-50 ++ - HPV 16
L1.sub..DELTA.310 E7 25-75 - - HPV 16 L1.sub..DELTA.310 E7 50-98 -
- HPV 16 L1.sub..DELTA.C E7 1-98 +++ + HPV 16 L1.sub..DELTA.C E7
25-75 +++ + HPV 16 L1.sub..DELTA.C E7 50-98 + + HPV 16
L1.sub..DELTA.C E7 1-60 +++++ +++++ HPV 16 L1.sub..DELTA.C E7 40-98
++++ - HPV 16 L1.sub..DELTA.C Influenza +++ + HPV 16
L1.sub..DELTA.*C E7 1-52 +++++ +++++ HPV 16 L1.sub..DELTA.*C E7
1-55 +++++ +++++ HPV 16 L1.sub..DELTA.*C E7 1-60 +++ ++++ HPV 16
L1.sub..DELTA.*C E7 1-65 ++ - HPV 16 L1.sub..DELTA.*C E7 1-70 ++
-
EXAMPLE 3
Purification of Capsomeres
[0052] Trichopulsia ni (TN) High Five cells were grown to a density
of approximately 2.times.10.sup.6 cells/ml in Ex-Cell 405
serum-free medium (JRH Biosciences). Approximately 2.times.10.sup.8
cells were pelleted by centrifugation at 1000.times.g for 15
minutes, resuspended in 20 ml of medium, and infected with
recombinant baculoviruses at m.o.i of 2 to 5 for 1 hour at room
temperature. After addition of 200 ml medium, cells were plated and
incubated for 3 to 4 days at 27.degree. C. Following incubation,
cells were harvested, pelleted, and resuspended in 10 ml of
extraction buffer.
[0053] The following steps were performed at 4.degree. C. Cells
were sonicated for 45 seconds at 60 watts and the resulting cell
lysate was centrifuged at 10,000 rpm in a Sorval SS34 rotor. The
supernatant was removed and retained while the resulting pellet was
resuspended in 6 ml of extraction buffer, sonicated for an
additional 3 seconds at 60 watts, and centrifuged again. The two
supernatants were combined, layered onto a two-step gradient
containing 14 ml of 40% sucrose on top of 8 ml of CsCl solution
(4.6 g CsCl per 8 ml in extraction buffer), and centrifuged in a
Sorval AH629 swinging bucket rotor for 2 hours at 27,000 rpm at
10.degree. C. The interface region between the CsCl and the sucrose
along with the CsCl complete layer were collected into 13.4 ml
Quickseal tubes (Beckman) and extraction buffer added to adjust the
volume 13.4 ml. Samples were centrifuged overnight at 50,000 rpm at
20.degree. C. in a Beckman 70 TI rotor. Gradients were fractionated
(1 ml per fraction) by puncturing tubes on top and bottom with a
21-gauge needle. Fractions were collected from each tube and 2.5
.mu.l of each fraction were analyzed by a 10% SDS-polyacrylamide
gel and Western blotting using an anti-HPV16 L1 antibody.
[0054] Virus-like particles and capsomeres were separated from the
fractions identified above by sedimentation on 10 to 50% sucrose
gradients. Peak fractions from CsCl gradients were pooled and
dialyzed for 2 hours against 5 mM HEPES (pH 7.5). Half of the
dialysate was used to produce capsomeres by disassembly of intact
VLPs overnight by adding EDTA (final concentration 50 mM), EGTA (50
mM), DTT (30 mM), NaCl (100 mM), and Tris/HCl, pH 8.0, (10 mM). As
control, NaCl and Tris/HCl only were added to the other half.
[0055] For analysis of capsomeres produced from disassembled VLPs,
EDTA, EGTA, and DTT (final concentration 5 mM each) were added to
the sucrose cushions which were centrifuged at 250,000.times.g for
2 to 4 hours at 4.degree. C. Fractions were collected by puncturing
tubes from the bottom. A 1:10 dilution of each fraction was then
analyzed by antigen capture ELISA.
EXAMPLE 4
Immunization Protocol for Production of Polyclonal Antisera and
Monoclonal Antibodies
[0056] Balb/c mice are immunized subcutaneously three times, every
four weeks with approximately 60 .mu.g of HPV chimeric capsomeres
mixed 1:1 with complete or incomplete Freund's Adjuvants in a total
volume of 100 .mu.l. Six weeks after the third immunization, mice
are sacrificed and blood is collected by cardiac puncture.
EXAMPLE 5
Peptide ELISA to Quantitate Capsomere Formation
[0057] Microtiter plates (Dynatech) are coated overnight with 50
.mu.l of peptide E701 [Muller et al., 1982] at a concentration of
10 .mu.g/ml in PBS. Wells are blocked for 2 hour at 37.degree. C.
with 100 .mu.l of buffer containing 5% BSA and 0.05% Tween 20 in
PBS and washed three times with PBS containing 0.05% Tween 20.
After the third wash, 50 .mu.l of sera diluted 1:5000 in BSA/Tween
20/PBS is added to each well and incubation carried out for 1 hour.
Plates are washed again as before and 50 .mu.l of goat-anti-mouse
peroxidase conjugate is added at a 1:5000 dilution. After 1 hour,
plates are washed and stained using ABTS substrate (0.2 mg/ml,
2.2'-Azino-bis(3-ethylbenzhiazoline-.beta.-sulfonic acid in 0.1 M
Na-Acetate-Phosphate buffer (pH 4.2) with 4 .mu.l 30%
H.sub.2O.sub.2 per 10 ml). Extinction is measured after 1 hour at
490 nm in a Dynatech automated plate reader.
EXAMPLE 6
Antigen Capture ELISA to Quantitate Capsomere Formation
[0058] To allow relative quantification of virus-like particles and
capsomeres in fractions of CsCl gradients, an antigen capture ELISA
was utilized. Microtiter plates were coated overnight with 50
.mu.l/well of a 1:500 dilution (final concentration of 2 .mu.g per
ml, in PBS) with a protein A purified mouse monoclonal antibody
immunospecific for HPV 16 L1 (antibodies 25/C, MM07 and Ritti 1
were obtained from mice immunized with HPV 16 VLPs). Plates were
blocked with 5% milk/PBS for 1 hour and 50 .mu.l of fractions of
CsCl gradients were added for 1 hour at 37.degree. C. using a 1:300
dilution (in 5% milk/PBS). After three washings with PBS/0.05%
Tween 20, 50 ,.mu.l of a polyclonal rabbit antiserum (1:3000
dilution in milk/PBS), raised against HPV 16 VLPs was added and
plates were incubated at 37.degree. for 1 hour. Plates were washed
again and further incubated with 50 .mu.l of a goat-anti-rabbit
peroxidase conjugate (Sigma) diluted 1:5000 in PBS containing 5%
milk for 1 hour. After final washing, plates were stained with ABTS
substrate for 30 minutes and extinction measured at 490 nm in a
Dynatech automated plate reader. As a negative control, the assay
also included wells coated only with PBS.
[0059] To test monoclonal antibodies for capsomere specificity,
VLPs with EDTA/DTT to disassemble particles. Treated particle
preparations were assayed in the antigen-capture ELISA and readings
compared to untreated controls. For disassembly, 40 .mu.l of VLPs
was incubated overnight at 4.degree. C. in 500 .mu.l of disruption
buffer containing 30 mM DTT. 50 mM EGTA, 60 mM EDTA, 100 mM NaCl,
and 100 mM Tris/HCl, pH 8.0. Aliquots of treated and untreated
particles were used in the above capture ELISA in a 1:20-1:40
dilution.
EXAMPLE 7
Hemagglutinin Inhibition Assay
[0060] In order to determine the extent to which chimeric capsomere
vaccines evoke production of neutralizing antibodies, a
hemagglutination inhibition assay is carried out as briefly
described below. This assay is based on previous observations that
virus-like particles are capable of hemagglutinizing red blood
cells.
[0061] Mice are immunized with any of a chimeric capsomere vaccine
and sera is collected as described above in Example 4. As positive
controls, HPV16 L1 virus like particles (VLPs) and bovine PV1 (BPV)
L1 VLPs are assayed in parallel with a chimeric capsomere
preparation. To establish a positive baseline, the HPV 16 or BPV1
VLPs are first incubated with or without sera collected from
immunized mice after which red blood cells are added. The extent to
which preincubation with mouse cera inhibits red blood cell
hemagglutinization is an indication of the neutralizing capacity of
the mouse sera. The experiments are then repeated using chimeric
capsomeres in order to determine the neutralizing effect of the
mouse sera on the vaccine. A brief protocol for the
hemagglutination inhibition assay is described below.
[0062] One hundred microliters of heparin (1000 usp units/ml) are
added to 1 ml fresh mouse blood. Red blood cells are washed three
times with PBS followed by centrifugation and resuspension in a
volume of 10 ml. Next, erythrocytes are resuspended in 0.5 ml PBS
and stored at 4.degree. C. for up to three days. For the
hemagglutinin assay, 70 .mu.l of the suspension is used per well on
a 96-well plate.
[0063] Chimeric capsomere aliquots from CsCl gradients are dialyzed
for one hour against 10 mM Hepes (pH 7.5) and 100 .mu.l of two-fold
serial dilutions in PBS are added to mouse erythrocytes in
round-bottom 96-well microtiter plates which are further incubated
for 3-16 hours at 4.degree. C. For hemagglutination inhibition,
capsomeres are incubated with dilutions of antibodies in PBS for 60
minutes at room temperature and then added to the erythrocytes. The
level of erythrocyte hemagglutination, and therefore the presence
of neutralizing antibodies, is determined by standard methods.
[0064] In preliminary results, mouse sera generated against
chimeric capsomeres comprising HPV16L1C protein in association with
E7 amino acid residues 1-98 was observed to inhibit
hemagglutination by HPV16 VLPs, but not by BPV VLPs. The mouse sera
was therefore positive for neutralizing antibodies against the
human VLPs and this differential neutralization was most likely the
result of antibody specificity for epitopes against which the
antibodies were raised.
[0065] Numerous modifications and variations in the invention as
set forth in the above illustrative examples are expected to occur
to those skilled in the art. Consequently only such limitations as
appear in the appended claims should be placed on the invention.
Sequence CWU 1
1
28 1 1518 DNA Human Papilloma Virus CDS (1)..(1518) 1 atg tct ctt
tgg ctg cct agt gag gcc act gtc tac ttg cct cct gtc 48 Met Ser Leu
Trp Leu Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val 1 5 10 15 cca
gta tct aag gtt gta agc acg gat gaa tat gtt gca cgc aca aac 96 Pro
Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn 20 25
30 ata tat tat cat gca gga aca tcc aga cta ctt gca gtt gga cat ccc
144 Ile Tyr Tyr His Ala Gly Thr Ser Arg Leu Leu Ala Val Gly His Pro
35 40 45 tat ttt cct att aaa aaa cct aac aat aac aaa ata tta gtt
cct aaa 192 Tyr Phe Pro Ile Lys Lys Pro Asn Asn Asn Lys Ile Leu Val
Pro Lys 50 55 60 gta tca gga tta caa tac agg gta ttt aga ata cat
tta cct gac ccc 240 Val Ser Gly Leu Gln Tyr Arg Val Phe Arg Ile His
Leu Pro Asp Pro 65 70 75 80 aat aag ttt ggt ttt cct gac acc tca ttt
tat aat cca gat aca cag 288 Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe
Tyr Asn Pro Asp Thr Gln 85 90 95 cgg ctg gtt tgg gcc tgt gta ggt
gtt gag gta ggt cgt ggt cag cca 336 Arg Leu Val Trp Ala Cys Val Gly
Val Glu Val Gly Arg Gly Gln Pro 100 105 110 tta ggt gtg ggc att agt
ggc cat cct tta tta aat aaa ttg gat gac 384 Leu Gly Val Gly Ile Ser
Gly His Pro Leu Leu Asn Lys Leu Asp Asp 115 120 125 aca gaa aat gct
agt gct tat gca gca aat gca ggt gtg gat aat aga 432 Thr Glu Asn Ala
Ser Ala Tyr Ala Ala Asn Ala Gly Val Asp Asn Arg 130 135 140 gaa tgt
ata tct atg gat tac aaa caa aca caa ttg tgt tta att ggt 480 Glu Cys
Ile Ser Met Asp Tyr Lys Gln Thr Gln Leu Cys Leu Ile Gly 145 150 155
160 tgc aaa cca cct ata ggg gaa cac tgg ggc aaa gga tcc cca tgt acc
528 Cys Lys Pro Pro Ile Gly Glu His Trp Gly Lys Gly Ser Pro Cys Thr
165 170 175 aat gtt gca gta aat cca ggt gat tgt cca cca tta gag tta
ata aac 576 Asn Val Ala Val Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu
Ile Asn 180 185 190 aca gtt att cag gat ggt gat atg gtt gat act ggc
ttt ggt gct atg 624 Thr Val Ile Gln Asp Gly Asp Met Val Asp Thr Gly
Phe Gly Ala Met 195 200 205 gac ttt act aca tta cag gct aac aaa agt
gaa gtt cca ctg gat att 672 Asp Phe Thr Thr Leu Gln Ala Asn Lys Ser
Glu Val Pro Leu Asp Ile 210 215 220 tgt aca tct att tgc aaa tat cca
gat tat att aaa atg gtg tca gaa 720 Cys Thr Ser Ile Cys Lys Tyr Pro
Asp Tyr Ile Lys Met Val Ser Glu 225 230 235 240 cca tat ggc gac agc
tta ttt ttt tat tta cga agg gaa caa atg ttt 768 Pro Tyr Gly Asp Ser
Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe 245 250 255 gtt aga cat
tta ttt aat agg gct ggt gct gtt ggt gaa aat gta cca 816 Val Arg His
Leu Phe Asn Arg Ala Gly Ala Val Gly Glu Asn Val Pro 260 265 270 gac
gat tta tac att aaa ggc tct ggg tct act gca aat tta gcc agt 864 Asp
Asp Leu Tyr Ile Lys Gly Ser Gly Ser Thr Ala Asn Leu Ala Ser 275 280
285 tca aat tat ttt cct aca cct agt ggt tct atg gtt acc tct gat gcc
912 Ser Asn Tyr Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala
290 295 300 caa ata ttc aat aaa cct tat tgg tta caa cga gca cag ggc
cac aat 960 Gln Ile Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala Gln Gly
His Asn 305 310 315 320 aat ggc att tgt tgg ggt aac caa cta ttt gtt
act gtt gtt gat act 1008 Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe
Val Thr Val Val Asp Thr 325 330 335 aca cgc agt aca aat atg tca tta
tgt gct gcc ata tct act tca gaa 1056 Thr Arg Ser Thr Asn Met Ser
Leu Cys Ala Ala Ile Ser Thr Ser Glu 340 345 350 act aca tat aaa aat
act aac ttt aag gag tac cta cga cat ggg gag 1104 Thr Thr Tyr Lys
Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu 355 360 365 gaa tat
gat tta cag ttt att ttt caa ctg tgc aaa ata acc tta act 1152 Glu
Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr 370 375
380 gca gac gtt atg aca tac ata cat tct atg aat tcc act att ttg gag
1200 Ala Asp Val Met Thr Tyr Ile His Ser Met Asn Ser Thr Ile Leu
Glu 385 390 395 400 gac tgg aat ttt ggt cta caa cct ccc cca gga ggc
aca cta gaa gat 1248 Asp Trp Asn Phe Gly Leu Gln Pro Pro Pro Gly
Gly Thr Leu Glu Asp 405 410 415 act tat agg ttt gta acc tcc cag gca
att gct tgt caa aaa cat aca 1296 Thr Tyr Arg Phe Val Thr Ser Gln
Ala Ile Ala Cys Gln Lys His Thr 420 425 430 cct cca gca cct aaa gaa
gat ccc ctt aaa aaa tac act ttt tgg gaa 1344 Pro Pro Ala Pro Lys
Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu 435 440 445 gta aat tta
aag gaa aag ttt tct gca gac cta gat cag ttt cct tta 1392 Val Asn
Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu 450 455 460
gga cgc aaa ttt tta cta caa gca gga ttg aag gcc aaa cca aaa ttt
1440 Gly Arg Lys Phe Leu Leu Gln Ala Gly Leu Lys Ala Lys Pro Lys
Phe 465 470 475 480 aca tta gga aaa cga aaa gct aca ccc acc acc tca
tct acc tct aca 1488 Thr Leu Gly Lys Arg Lys Ala Thr Pro Thr Thr
Ser Ser Thr Ser Thr 485 490 495 act gct aaa cgc aaa aaa cgt aag ctg
taa 1518 Thr Ala Lys Arg Lys Lys Arg Lys Leu 500 505 2 505 PRT
Human Papilloma Virus 2 Met Ser Leu Trp Leu Pro Ser Glu Ala Thr Val
Tyr Leu Pro Pro Val 1 5 10 15 Pro Val Ser Lys Val Val Ser Thr Asp
Glu Tyr Val Ala Arg Thr Asn 20 25 30 Ile Tyr Tyr His Ala Gly Thr
Ser Arg Leu Leu Ala Val Gly His Pro 35 40 45 Tyr Phe Pro Ile Lys
Lys Pro Asn Asn Asn Lys Ile Leu Val Pro Lys 50 55 60 Val Ser Gly
Leu Gln Tyr Arg Val Phe Arg Ile His Leu Pro Asp Pro 65 70 75 80 Asn
Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gln 85 90
95 Arg Leu Val Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro
100 105 110 Leu Gly Val Gly Ile Ser Gly His Pro Leu Leu Asn Lys Leu
Asp Asp 115 120 125 Thr Glu Asn Ala Ser Ala Tyr Ala Ala Asn Ala Gly
Val Asp Asn Arg 130 135 140 Glu Cys Ile Ser Met Asp Tyr Lys Gln Thr
Gln Leu Cys Leu Ile Gly 145 150 155 160 Cys Lys Pro Pro Ile Gly Glu
His Trp Gly Lys Gly Ser Pro Cys Thr 165 170 175 Asn Val Ala Val Asn
Pro Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn 180 185 190 Thr Val Ile
Gln Asp Gly Asp Met Val Asp Thr Gly Phe Gly Ala Met 195 200 205 Asp
Phe Thr Thr Leu Gln Ala Asn Lys Ser Glu Val Pro Leu Asp Ile 210 215
220 Cys Thr Ser Ile Cys Lys Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu
225 230 235 240 Pro Tyr Gly Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu
Gln Met Phe 245 250 255 Val Arg His Leu Phe Asn Arg Ala Gly Ala Val
Gly Glu Asn Val Pro 260 265 270 Asp Asp Leu Tyr Ile Lys Gly Ser Gly
Ser Thr Ala Asn Leu Ala Ser 275 280 285 Ser Asn Tyr Phe Pro Thr Pro
Ser Gly Ser Met Val Thr Ser Asp Ala 290 295 300 Gln Ile Phe Asn Lys
Pro Tyr Trp Leu Gln Arg Ala Gln Gly His Asn 305 310 315 320 Asn Gly
Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr 325 330 335
Thr Arg Ser Thr Asn Met Ser Leu Cys Ala Ala Ile Ser Thr Ser Glu 340
345 350 Thr Thr Tyr Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly
Glu 355 360 365 Glu Tyr Asp Leu Gln Phe Ile Phe Gln Leu Cys Lys Ile
Thr Leu Thr 370 375 380 Ala Asp Val Met Thr Tyr Ile His Ser Met Asn
Ser Thr Ile Leu Glu 385 390 395 400 Asp Trp Asn Phe Gly Leu Gln Pro
Pro Pro Gly Gly Thr Leu Glu Asp 405 410 415 Thr Tyr Arg Phe Val Thr
Ser Gln Ala Ile Ala Cys Gln Lys His Thr 420 425 430 Pro Pro Ala Pro
Lys Glu Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu 435 440 445 Val Asn
Leu Lys Glu Lys Phe Ser Ala Asp Leu Asp Gln Phe Pro Leu 450 455 460
Gly Arg Lys Phe Leu Leu Gln Ala Gly Leu Lys Ala Lys Pro Lys Phe 465
470 475 480 Thr Leu Gly Lys Arg Lys Ala Thr Pro Thr Thr Ser Ser Thr
Ser Thr 485 490 495 Thr Ala Lys Arg Lys Lys Arg Lys Leu 500 505 3
297 DNA Human Papilloma Virus CDS (1)..(297) 3 atg cat gga gat aca
cct aca ttg cat gaa tat atg tta gat ttg caa 48 Met His Gly Asp Thr
Pro Thr Leu His Glu Tyr Met Leu Asp Leu Gln 1 5 10 15 cca gag aca
act gat ctc tac tgt tat gag caa tta aat gac agc tca 96 Pro Glu Thr
Thr Asp Leu Tyr Cys Tyr Glu Gln Leu Asn Asp Ser Ser 20 25 30 gag
gag gag gat gaa ata gat ggt cca gct gga caa gca gaa ccg gac 144 Glu
Glu Glu Asp Glu Ile Asp Gly Pro Ala Gly Gln Ala Glu Pro Asp 35 40
45 aga gcc cat tac aat att gta acc ttt tgt tgc aag tgt gac tct acg
192 Arg Ala His Tyr Asn Ile Val Thr Phe Cys Cys Lys Cys Asp Ser Thr
50 55 60 ctt cgg ttg tgc gta caa agc aca cac gta gac att cgt act
ttg gaa 240 Leu Arg Leu Cys Val Gln Ser Thr His Val Asp Ile Arg Thr
Leu Glu 65 70 75 80 gac ctg tta atg ggc aca cta gga att gtg tgc ccc
atc tgt tct cag 288 Asp Leu Leu Met Gly Thr Leu Gly Ile Val Cys Pro
Ile Cys Ser Gln 85 90 95 aaa cca taa 297 Lys Pro 4 98 PRT Human
Papilloma Virus 4 Met His Gly Asp Thr Pro Thr Leu His Glu Tyr Met
Leu Asp Leu Gln 1 5 10 15 Pro Glu Thr Thr Asp Leu Tyr Cys Tyr Glu
Gln Leu Asn Asp Ser Ser 20 25 30 Glu Glu Glu Asp Glu Ile Asp Gly
Pro Ala Gly Gln Ala Glu Pro Asp 35 40 45 Arg Ala His Tyr Asn Ile
Val Thr Phe Cys Cys Lys Cys Asp Ser Thr 50 55 60 Leu Arg Leu Cys
Val Gln Ser Thr His Val Asp Ile Arg Thr Leu Glu 65 70 75 80 Asp Leu
Leu Met Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln 85 90 95
Lys Pro 5 34 DNA Artificial sequence Synthetic primer 5 ccccgatatc
gcctttaatg tataaatcgt ctgg 34 6 35 DNA Artificial sequence
Synthetic primer 6 ccccgatatc tcaaattatt ttcctacacc tagtg 35 7 40
DNA Artificial sequence Synthetic primer 7 aaagatatct tgtagtaaaa
atttgcgtcc taaaggaaac 40 8 44 DNA Artificial sequence Synthetic
primer 8 aaagatatct aatctacctc tacaactgct aaacgcaaaa aacg 44 9 35
DNA Artificial sequence Synthetic primer 9 aaaagatatc atgcatggag
atacacctac attgc 35 10 34 DNA Artificial sequence Synthetic primer
10 ttttgatatc ggctctgtcc ggttctgctt gtcc 34 11 44 DNA Artificial
sequence Synthetic primer 11 ttttgatatc cttgcaacaa aaggttacaa
tattgtaatg ggcc 44 12 35 DNA Artificial sequence Synthetic primer
12 aaaagatatc tggtttctga gaacagatgg ggcac 35 13 38 DNA Artificial
sequence Synthetic primer 13 ttttgatatc gattatgagc aattaaatga
cagctcag 38 14 35 DNA Artificial sequence Synthetic primer 14
ttttgatatc gtctacgtgt gtgctttgta cgcac 35 15 39 DNA Artificial
sequence Synthetic primer 15 tttatcgata tcggtccagc tggacaagca
gaaccggac 39 16 39 DNA Artificial sequence Synthetic primer 16
ttttgatatc gatgcccatt acaatattgt aaccttttg 39 17 294 DNA Human
Papilloma Virus CDS (1)..(294) 17 atg agt ctt cta acc gag gtc gaa
acg ctt acc aga aac gga tgg gag 48 Met Ser Leu Leu Thr Glu Val Glu
Thr Leu Thr Arg Asn Gly Trp Glu 1 5 10 15 tgc aaa tgc agc gat tca
agt gat cct ctc att atc gca gcg agt atc 96 Cys Lys Cys Ser Asp Ser
Ser Asp Pro Leu Ile Ile Ala Ala Ser Ile 20 25 30 att ggg atc ttg
cac ttg ata ttg tgg att ttt tat cgt ctt ttc ttc 144 Ile Gly Ile Leu
His Leu Ile Leu Trp Ile Phe Tyr Arg Leu Phe Phe 35 40 45 aaa tgc
att tat cgt cgc ctt aaa tac ggt ttg aaa aga ggg cct tct 192 Lys Cys
Ile Tyr Arg Arg Leu Lys Tyr Gly Leu Lys Arg Gly Pro Ser 50 55 60
acg gaa gga gcg cct gag tct atg agg gaa gaa tat cgg cag gaa cag 240
Thr Glu Gly Ala Pro Glu Ser Met Arg Glu Glu Tyr Arg Gln Glu Gln 65
70 75 80 cag agt gct gtg gat gtt gac gat gtt cat ttt gtc aac ata
gag ctg 288 Gln Ser Ala Val Asp Val Asp Asp Val His Phe Val Asn Ile
Glu Leu 85 90 95 gag taa 294 Glu 18 97 PRT Human Papilloma Virus 18
Met Ser Leu Leu Thr Glu Val Glu Thr Leu Thr Arg Asn Gly Trp Glu 1 5
10 15 Cys Lys Cys Ser Asp Ser Ser Asp Pro Leu Ile Ile Ala Ala Ser
Ile 20 25 30 Ile Gly Ile Leu His Leu Ile Leu Trp Ile Phe Tyr Arg
Leu Phe Phe 35 40 45 Lys Cys Ile Tyr Arg Arg Leu Lys Tyr Gly Leu
Lys Arg Gly Pro Ser 50 55 60 Thr Glu Gly Ala Pro Glu Ser Met Arg
Glu Glu Tyr Arg Gln Glu Gln 65 70 75 80 Gln Ser Ala Val Asp Val Asp
Asp Val His Phe Val Asn Ile Glu Leu 85 90 95 Glu 19 40 DNA
Artificial sequence Synthetic primer 19 ttttgatatc gatatggaat
ggctaaagac aagaccaatc 40 20 35 DNA Artificial sequence Synthetic
primer 20 ttttgatatc gttgtttgga tccccattcc cattg 35 21 24 DNA
Artificial sequence Synthetic primer 21 gttatgacat acatacattc tatg
24 22 35 DNA Artificial sequence Synthetic primer 22 ccatgcattc
ctgcttgtag taaaaatttg cgtcc 35 23 29 DNA Artificial sequence
Synthetic primer 23 ctacaagcag gaatgcatgg agatacacc 29 24 36 DNA
Artificial sequence Synthetic primer 24 catctgaagc ttagtaatgg
gctctgtccg gttctg 36 25 38 DNA Artificial sequence Synthetic primer
25 catctgaagc ttatcaatat tgtaatgggc tctgtccg 38 26 54 DNA
Artificial sequence Synthetic primer 26 catctgaagc ttacttgcaa
caaaaggtta caatattgta atgggctctg tccg 54 27 69 DNA Artificial
sequence Synthetic primer 27 catctgaagc ttaaagcgta gagtcacact
tgcaacaaaa ggttacaata ttgtaatggg 60 ctctgtccg 69 28 47 DNA
Artificial sequence Synthetic primer 28 catctgaagc ttattgtacg
cacaaccgaa gcgtagagtc acacttg 47
* * * * *