U.S. patent application number 10/877231 was filed with the patent office on 2005-02-03 for methods for evaluating oligonucleotide probe sequences.
Invention is credited to Delenstarr, Glenda C., Kincaid, Robert H., Shannon, Karen W., Webb, Peter G., Wolber, Paul K..
Application Number | 20050027461 10/877231 |
Document ID | / |
Family ID | 21805664 |
Filed Date | 2005-02-03 |
United States Patent
Application |
20050027461 |
Kind Code |
A1 |
Shannon, Karen W. ; et
al. |
February 3, 2005 |
Methods for evaluating oligonucleotide probe sequences
Abstract
Methods are disclosed for predicting the potential of an
oligonucleotide to hybridize to a target nucleotide sequence. A
predetermined number of unique oligonucleotides is identified. The
unique oligonucleotides are chosen to sample the entire length of a
nucleotide sequence that is hybridizable with the target nucleotide
sequence. At least one parameter that is independently predictive
of the ability of each of the oligonucleotides of the set to
hybridize to the target nucleotide sequence is determined and
evaluated for each of the above oligonucleotides. A subset of
oligonucleotides within the predetermined number of unique
oligonucleotides is identified based on the evaluation of the
parameter. Oligonucleotides in the subset are identified that are
clustered along a region of the nucleotide sequence that is
hybridizable to the target nucleotide sequence. The method may be
carried out with the aid of a computer.
Inventors: |
Shannon, Karen W.; (Los
Gatos, CA) ; Wolber, Paul K.; (Los Altos, CA)
; Delenstarr, Glenda C.; (Belmont, CA) ; Webb,
Peter G.; (Menlo Park, CA) ; Kincaid, Robert H.;
(Half Moon Bay, CA) |
Correspondence
Address: |
AGILENT TECHNOLOGIES, INC.
INTELLECTUAL PROPERTY ADMINISTRATION, LEGAL DEPT.
P.O. BOX 7599
M/S DL429
LOVELAND
CO
80537-0599
US
|
Family ID: |
21805664 |
Appl. No.: |
10/877231 |
Filed: |
June 24, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10877231 |
Jun 24, 2004 |
|
|
|
09784674 |
Feb 15, 2001 |
|
|
|
09784674 |
Feb 15, 2001 |
|
|
|
09021701 |
Feb 10, 1998 |
|
|
|
6251588 |
|
|
|
|
Current U.S.
Class: |
702/20 |
Current CPC
Class: |
G16B 40/00 20190201;
G16B 25/20 20190201; G16B 25/00 20190201 |
Class at
Publication: |
702/020 |
International
Class: |
G06F 019/00 |
Claims
What is claimed is:
1. A method for producing an array comprising: receiving one or
more target polynucleotide sequences; determining an evaluated
probe set for each of said one or more target polynucleotide
sequences; outputting data relating to the oligonucleotide
sequences of said evaulated probe set for each of said one or more
target polynucleotide sequences; and fabricating an array from said
outputted data.
2. A method for producing an array comprising: eceiving one or more
target polynucleotide sequences; determining an evaluated probe set
for each of said one or more target polynucleotide sequences;
outputting data relating to the oligonucleotide sequences of said
evaluated probe set for each of said one or more target
polynucleotide sequences to a user for examination and
modification, as desired to produce a final output data set; and
fabricating an array from said final output data set.
3. The method according to claim 2, wherein said array is useful in
diagnostic applications.
4. The method according to claim 2, wherein said method comprises
coummunicating said outputted data with another computer.
5. The method according to claim 2, wherein each of said evaulated
probe sets is made up of probes evaulated for at least one
parameter predictive of hybridization.
6. The method according to claim 2, wherein said array comprises
nucleic acids synthesized on a support.
7. A system for fabricating an array, said system comprising: an
input device for receiving one or more target polynucleotide
sequences; a means for determining an evaluated probe set for each
of said one or more target polynucleotide sequences; a
communication means for outputting data relating to the
oligonucleotide sequences of said evaluated probe set for each of
said one or more target polynucleotide sequences to a user for
examination and modification, as desired to produce a final output
data set; and means for fabricating an array from said final output
data set.
8. The system according to claim 7, wherein said communication
means communicates with another computer.
9. The system according to claim 7, wherein said means for
determining evaluated probe sets evaluates probes for at least one
parameter predictive of hybridization.
10. The system according to claim 7, wherein said array comprises
nucleic acids synthesized on a support.
11. A method for providing custom probe arrays, comprising the acts
of: receiving a user selection of one or more probe set identifiers
that each identify a plurality of potential probes; determining
verified probe sets of verified probes corresponding to the probe
set identifiers; generating a custom probe array design based, at
least in part, upon the verified probe sets; and providing to the
user one or more probe arrays based on the probe array design.
12. A method for providing custom probe arrays, comprising the acts
of: receiving a user selection of one or more probe set identifiers
that identify one or more potential probes; determining verified
probe sets of verified probes corresponding to the probe set
identifiers; generating a custom probe array design based, at least
in part, upon the verified probe sets; enabling for display to the
user a representation of one or more aspects of the custom probe
array design via one or more graphical user interfaces enabled to
receive a user selection specifying acceptance, modification, or
rejection of the custom probe array design; and providing to the
user one or more probe arrays based on the probe array design and
responsive to the user specification of acceptance or
modification.
13. The method of claim 12, wherein:one or more of the probe arrays
is constructed and arranged to diagnose a disease or medical
condition.
14. The method of claim 12, wherein:the user selection is received
over the Internet.
15. The method of claim 12, wherein:the probe set identifiers
comprise sequence information.
16. The method of claim 12, wherein:the verified probe sets are
determined based, at least in part, on any one or any combination
of frequency, length, or position of probe sequence repeats; probe
sequence length, thermodynamic properties, energetic parameters, or
uniqueness; or one or more characteristics of target molecules
specified by the user for use with the probe array.
17. The method of claim 12, wherein:the graphical user interface is
provided over a network.
18. The method of claim 5, wherein:the probe arrays include
synthesized or spotted probe arrays.
19. A system for providing custom probe arrays, comprising: an
input manager constructed and arranged to receive a user selection
of one or more probe set identifiers that identify one or more
potential probes; a gene or EST verifier constructed and arranged
to determine one or more verified probe sets of verified probes
corresponding to the probe set identifiers; a probe array generator
constructed and arranged to generate a custom probe array design
based, at least in part, upon the verified probe sets; and a user
data processor constructed and arranged to enable for display a
representation of one or more aspects of the custom probe array
design via one or more graphical user interfaces that are further
enabled to receive a user selection specifying acceptance,
modification, or rejection of the custom probe array design, and
further is constructed and arranged to provide to the user one or
more probe arrays based on a user selection specifying acceptance
or modification of the probe array design.
20. The system of claim 19, wherein:the user selection is received
over the Internet.
21. The system of claim 19, wherein:the probe set identifiers
comprise sequence information.
22. The system of claim 19, wherein:the verified probe sets are
determined based, at least in part, on any one or any combination
of frequency, length, or position of probe sequence repeats; probe
sequence length, thermodynamic properties, energetic parameters, or
uniqueness; or one or more characteristics of target molecules
specified by the user for use with the probe array.
23. The system of claim 19, wherein:the graphical user interface is
provided over a network.
24. The system of claim 19, wherein:the probe arrays include
synthesized or spotted probe arrays.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of application Ser. No.
09/784,674 filed on Feb. 15, 2001; which application is a
continuation of application Ser. No. 09/021,701 filed on Feb. 10,
1998 and now issued as U.S. Pat. No. 6,251,588; the disclosures of
which are herein incorporated by reference.
Appendix
[0002] This patent application includes an appendix (the
"Appendix"), which contains the source code for the software used
in carrying out the examples in accordance with the present
invention.
[0003] A portion of the present disclosure contains material that
is subject to copyright protection. The copyright owner has no
objection to the facsimile reproduction by anyone of the patent
document or the patent disclosure as it appears in the U.S. Patent
and Trademark Office patent files or records, but otherwise
reserves all copyright rights whatsoever.
BACKGROUND OF THE INVENTION
[0004] 1. Field of the Invention
[0005] Significant morbidity and mortality are associated with
infectious diseases and genetically inherited disorders. More rapid
and accurate diagnostic methods are required for better monitoring
and treatment of these conditions. Molecular methods using DNA
probes, nucleic acid hybridization and in vitro amplification
techniques are promising methods offering advantages to
conventional methods used for patient diagnoses.
[0006] Nucleic acid hybridization has been employed for
investigating the identity and establishing the presence of nucleic
acids. Hybridization is based on complementary base pairing. When
complementary single stranded nucleic acids are incubated together,
the complementary base sequences pair to form double-stranded
hybrid molecules. The ability of single stranded deoxyribonucleic
acid (ssDNA) or ribonucleic acid (RNA) to form a hydrogen bonded
structure with a complementary nucleic acid sequence has been
employed as an analytical tool in molecular biology research. The
availability of radioactive nucleoside triphosphates of high
specific activity and the development of methods for their
incorporation into DNA and RNA has made it possible to identify,
isolate, and characterize various nucleic acid sequences of
biological interest. Nucleic acid hybridization has great potential
in diagnosing disease states associated with unique nucleic acid
sequences. These unique nucleic acid sequences may result from
genetic or environmental change in DNA by insertions, deletions,
point mutations, or by acquiring foreign DNA or RNA by means of
infection by bacteria, molds, fungi, and viruses. The application
of nucleic acid hybridization as a diagnostic tool in clinical
medicine is limited due to the cost and effort associated with the
development of sufficiently sensitive and specific methods for
detecting potentially low concentrations of disease-related DNA or
RNA present in the complex mixture of nucleic acid sequences found
in patient samples.
[0007] One method for detecting specific nucleic acid sequences
generally involves immobilization of the target nucleic acid on a
solid support such as nitrocellulose paper, cellulose paper,
diazotized paper, or a nylon membrane. After the target nucleic
acid is fixed on the support, the support is contacted with a
suitably labeled probe nucleic acid for about two to forty-eight
hours. After the above time period, the solid support is washed
several times at a controlled temperature to remove unhybridized
probe. The support is then dried and the hybridized material is
detected by autoradiography or by spectrometric methods. When very
low concentrations must be detected, the above method is slow and
labor intensive, and nonisotopic labels that are less readily
detected than radiolabels are frequently not suitable.
[0008] A method for the enzymatic amplification of specific
segments of DNA known as the polymerase chain reaction (PCR) method
has been described. This in vitro amplification procedure is based
on repeated cycles of denaturation, oligonucleotide primer
annealing, and primer extension by thermophilic polymerase,
resulting in the exponential increase in copies of the region
flanked by the primers. The PCR primers, which anneal to opposite
strands of the DNA, are positioned so that the polymerase catalyzed
extension product of one primer can serve as a template strand for
the other, leading to the accumulation of a discrete fragment whose
length is defined by the distance between the 5' ends of the
oligonucleotide primers.
[0009] Other methods for amplifying nucleic acids have also been
developed. These methods include single primer amplification,
ligase chain reaction (LCR), transcription-mediated amplification
methods including 3SR and NASBA, and the Q-beta-replicase method.
Regardless of the amplification used, the amplified product must be
detected.
[0010] One method for detecting nucleic acids is to employ nucleic
acid probes that have sequences complementary to sequences in the
target nucleic acid. A nucleic acid probe may be, or may be capable
of being, labeled with a reporter group or may be, or may be
capable of becoming, bound to a support. Detection of signal
depends upon the nature of the label or reporter group. Usually,
the probe is comprised of natural nucleotides such as
ribonucleotides and deoxyribonucleotides and their derivatives
although unnatural nucleotide mimetics such as peptide nucleic
acids and oligomeric nucleoside phosphonates are also used.
Commonly, binding of the probes to the target is detected by means
of a label incorporated into the probe. Alternatively, the probe
may be unlabeled and the target nucleic acid labeled. Binding can
be detected by separating the bound probe or target from the free
probe or target and detecting the label. In one approach, a
sandwich is formed comprised of one probe, which may be labeled,
the target and a probe that is or can become bound to a surface.
Alternatively, binding can be detected by a change in the
signal-producing properties of the label upon binding, such as a
change in the emission efficiency of a fluorescent or
chemiluminescent label. This permits detection to be carried out
without a separation step. Finally, binding can be detected by
labeling the target, allowing the target to hybridize to a
surface-bound probe, washing away the unbound target and detecting
the labeled target that remains.
[0011] Direct detection of labeled target hybridized to
surface-bound probes is particularly advantageous if the surface
contains a mosaic of different probes that are individually
localized to discrete, known areas of the surface. Such ordered
arrays containing a large number of oligonucleotide probes have
been developed as tools for high throughput analyses of genotype
and gene expression. Oligonucleotides synthesized on a solid
support recognize uniquely complementary nucleic acids by
hybridization, and arrays can be designed to define specific target
sequences, analyze gene expression patterns or identify specific
allelic variations. One difficulty in the design of oligonucleotide
arrays is that oligonucleotides targeted to different regions of
the same gene can show large differences in hybridization
efficiency, presumably due, at least in part, to the interplay
between the secondary structures of the oligonucleotides and their
targets and the stability of the final probe/target hybridization
product. A method for predicting which oligonucleotides will show
detectable hybridization would substantially decrease the number of
iterations required for optimal array design and would be
particularly useful when the total number of oligonucleotide probes
on the array is limited. A method to predict oligonucleotide
hybridization efficiency would also streamline the empirical
approaches currently used to select potential antisense
therapeutics, which are designed to modulate gene expression in
vivo by hybridizing to specific messenger RNA (mRNA) molecules and
inhibiting their translation into proteins.
[0012] While it is well known that the structure of the target
nucleic acid affects the affinity of oligonucleotide hybridization,
current methods for predicting target structures from the primary
sequence fail to predict target regions accessible for
oligonucleotide binding. Consequently, selection of
oligonucleotides for antisense reagents or oligonucleotide probe
arrays has been largely empirical. As most of the target sequence
is sequestered by intramolecular base pairing and not accessible
for oligonucleotide binding, the process of identifying good
oligonucleotides has required large numbers of low efficiency
experiments.
[0013] The design and implementation of algorithms that effectively
predict the ability of oligonucleotides to rapidly and avidly bind
to complementary nucleotide sequences has been an important problem
in molecular biology since the invention of facile methods for
chemical DNA synthesis. The subsequent inventions of the polymerase
chain reaction (PCR), antisense inhibition of gene expression and
oligonucleotide array methods for performing massively parallel
hybridization experiments have made the need for effective
predictive algorithms even more critical.
[0014] Previous attempts to solve the nucleic acid probe design
problem include PCR primer design software applications (e.g.,
OLIGO.RTM.), neural networks, PCR primer design applications that
search for sequences that possess minimal ability to
cross-hybridize with other targets present in a sample (e.g.,
HYBsimulator.TM.), and approaches that attempt to predict the
efficiency of antisense sequence suppression of mRNA translation
from a combination of predicted nucleic acid duplex melting
temperature and predicted target strand structure. The methods that
predict effective oligonucleotide primers for performing PCR from
DNA templates work well for that application where relatively
stringent conditions are employed. This is because PCR experimental
design greatly simplifies the prediction problem: hybridization is
performed at high temperature, at relatively low ionic strength and
in the presence of a large molar excess of oligonucleotide. Under
these conditions, the oligonucleotide and target secondary
structures are relatively unimportant.
[0015] Unfortunately, these conditions do not apply to
oligonucleotide arrays, which are usually hybridized under
relatively non-denaturing conditions, or to antisense suppression
of gene expression, which takes place in vivo. Oligonucleotide
arrays can contain hundreds of thousands of different sequences and
conditions are chosen to allow the oligonucleotide with the lowest
melting temperature to hybridize efficiently. These "lowest common
denominator" conditions are usually relatively non-denaturing and
secondary structure constraints become significant. Accordingly,
the above applications require new predictive methods that are
capable of estimating the effects of oligonucleotide and target
structure on hybridization efficiency. For these reasons, current
algorithms for designing PCR primer oligonucleotides fail badly
when applied to the problems of oligonucleotide array or antisense
oligonucleotide design.
[0016] To date, the most effective approach for identifying
oligonucleotides with good hybridization efficiency has been an
empirical one. Such an approach involves the synthesis of large
numbers of oligonucleotide probes for a given target nucleotide
sequence. Arrays are formed that include the above oligonucleotide
probes. Hybridization experiments are carried out to determine
which of the oligonucleotide probes exhibit good hybridization
efficiencies. Examples of such an approach are found in D.
Lockhart, et al., Nature Biotech., infra, L. Wodicka, et al.,
Nature Biotechnology, infra., and N. Milner et al. Nature Biotech,
infra. One major drawback to this approach is the vast number of
oligonucleotides that must be synthesized in order to achieve a
satisfactory result. Typically, about 2%-5% of the test probes
synthesized yield acceptable signal levels.
[0017] The use of neural networks for oligonucleotide design has
also been investigated. Neural networks are easily taught with real
data; they therefore afford a general approach to many problems.
However, their performance is limited by the "senses" that they are
given. An analogy works best here: the human brain is an
astoundingly capable neural network, but a blind person cannot be
taught to reliably distinguish colors by smell. In addition, a
large amount of data is required to adequately teach a neural
network to perform its job well. A comprehensive database for
either oligonucleotide array design or antisense suppression of
gene expression has not been made available. For these reasons, the
performance reported to-date of neural network solutions against
the probe design problem is mediocre.
[0018] Finally, approaches that have attempted to use target
nucleic acid folding calculations to predict experimental results
inferred to depend upon hybridization efficiency (e.g. antisense
suppression of mRNA translation) have so far only demonstrated that
the predictions of current nucleic acid folding calculations
correlate poorly with observed behavior. The probable reason for
this is that the structures predicted by such programs for long
sequences are poor predictors of chemical reality; the results of
experiments that attempt to confirm the predictions of such
calculations support this assessment. Recent improvements to this
approach which use predicted RNA structure topology as a predictor
of relative RNA/RNA association kinetics have been more successful
at forecasting the results of antisense experiments. However, these
methods are not computationally efficient, and have so far only
been shown to work for targets less than 100 bases long. Such
methods are therefore not yet capable of predicting the behavior of
full-length mRNA targets, which are typically between 1,000 and
2,000 bases in length.
[0019] 2. Description of the Related Art
[0020] U.S. Pat. No. 5,512,438 (Ecker) discloses the inhibition of
RNA expression by forming a pseudo-half knot RNA at the target's
RNA secondary structure using antisense oligonucleotides.
[0021] Cook, et al., in U.S. Pat. No. 5,670,633 discuss
sugar-modified oligonucleotides that detect and modulate gene
expression.
[0022] Antisense oligonucleotide inhibition of the RAS gene is
disclosed in U.S. Pat. No. 5,582,986 (Monia, et al.).
[0023] U.S. Pat. No. 5,593,834 (Lane, et al.) discusses a method of
preparing DNA sequences with known ligand binding
characteristics.
[0024] Mitsuhashi, et al., in U.S. Pat. No. 5,556,749 discusses a
computerized method for designing optimal DNA probes and an
oligonucleotide probe design station.
[0025] U.S. Pat. No. 5,081,584 (Omichinski, et al.) discloses a
computer-assisted design of anti-peptides based on the amino acid
sequence of a target peptide.
[0026] A PCR primer design application that searches for sequences
that possess minimal ability to cross-hybridize with other targets
present in a sample is available as HYBsimulator.TM., version 2.0,
AGCT, Inc., 2102 Business Center Drive, Suite 170, Irvine, Calif.
92715 (714) 833-9983.
[0027] A PCR primer design software application is available as
OLIGO.RTM., version 5.0, National Biosciences, Inc., 3650 Annapolis
Lane North, #140, Plymouth, Minn. 55447 (800) 747-4362.
[0028] D. J. Lockhart, et al., Nature Biotech. 14:1675-1684 (1996)
describe a neural network approach to the selection of efficient
surface-bound oligonucleotide probes.
[0029] M. Mitsuhashi, et al., Nature, 367:759-761 (1994) disclose a
method for designing specific oligonucleotide probes and primers by
modeling the potential cross-hybridization of candidate probes to
non-target sequences known to be present in samples.
[0030] R. A. Stull, et al., Nuc. Acids Res., 20:3501-3508 (1992)
describe a method of predicting the efficacy of antisense
oligonucleotides, using predicted target secondary structure and
predicted oligonucleotide/target binding free energy as input
parameters.
[0031] N. Milner, et al., Nature Biotechnology, 15:537-541 (1997)
compare observed patterns of probe hybridization to those expected
from the predicted secondary structure of the nucleic acid
target.
[0032] L. Wodicka, et al., Nature Biotechnology, 15:1359-1367
(1997) describe simple rules for avoiding inefficient and
non-specific probes during design and synthesis of oligonucleotides
arrays.
[0033] J. SantaLucia Jr., et al., Biochemistry, 35:3555 (1996)
disclose parameters and methods for the calculation of
thermodynamic properties of DNA/DNA homoduplexes.
[0034] N. Sugimoto, et al., Biochemistry, 34:11211 (1995) disclose
parameters and methods for the calculation of thermodynamic
properties of DNA/RNA heteroduplexes.
[0035] J. A. Jaeger, et al., Proc. Natl. Acad. Sci. USA, 86:7706
(1989) disclose methods for estimation of the free energy of the
most stable intramolecular structure of a single-stranded
polynucleotide, by means of a dynamic programming algorithm.
[0036] S. F. Altschul, et al., Nature Genetics, 6:119-129 (1994)
disclose methods for calculating the complexity and information
content of amino acid and nucleic acid sequences.
[0037] T. A. Weber and E. Helfand, J. Chem. Phys., 71, 4760 (1979)
describe approaches for the modeling of polymer structures by
molecular dynamics simulations.
[0038] V. Patzel and G. Sczakiel, Nature Biotech., 16, 64-68 (1998)
disclose methods for estimating rate constants for association of
antisense RNA molecules with mRNA targets by examination of
predicted antisense RNA secondary structures.
[0039] Light-generated oligonucleotide arrays for rapid DNA
sequence analysis is described by A. C. Pease, et al., Proc. Nat.
Acad. Sci. USA (1994) 91:5022-5026.
[0040] Mitsuhashi discusses basic requirements for designing
optimal oligonucleotide probe sequences in J. Clinical Laboratory
Analysis (1996) 10:277-284.
[0041] Rychlik, et al., discloses a computer program for choosing
optimal oligonucleotides for filter hybridization, sequencing and
in vitro amplification of DNA in Nucleic Acids Research (1989)
17(21):8543-8551.
[0042] A strategy for designing specific antisense oligonucleotide
sequences is described by Mitsuhashi in J. Gastroenterol. (1997)
32:282-287.
[0043] Mitsuhashi discusses basic requirements for designing
optimal PCR primers in J. Clinical Laboratory Analysis (1996)
10:285-293.
[0044] Hyndman, et al., disclose software to determine optimal
oligonucleotide sequences based on hybridization simulation data in
BioTechniques (1996) 20(6): 1090-1094.
[0045] Eberhardt discloses a shell program for the design of PCR
primers using genetics computer group (GCG) software (7.1) on
VAX/VMS.TM. systems in BioTechniques (1992) 13(6):914-917.
[0046] Chen, et al., disclose a computer program for calculating
the melting temperature of degenerate oligonucleotides used in PCR
or hybridization in BioTechniques (1997) 22(6):1158-1160.
[0047] Partial thermodynamic parameters for prediction stability
and washing behavior of DNA duplexes immobilized on gel matrix is
described by Kunitsyn, et al., in J. Biomolecular Structure &
Dynamics, ISSN 0739-1102 (1996) 14(1):239-244.
SUMMARY OF THE INVENTION
[0048] One embodiment of the present invention is a method for
predicting the potential of an oligonucleotide to hybridize to a
target nucleotide sequence. A predetermined set of unique
oligonucleotide sequences is identified. The unique oligonucleotide
sequences are chosen to sample the entire length of a nucleotide
sequence that is hybridizable with the target nucleotide sequence.
At least one parameter that is predictive of the ability of each of
the oligonucleotides specified by the set of sequences to hybridize
to the target nucleotide sequence is determined and evaluated for
each of the above oligonucleotide sequences. A subset of
oligonucleotide sequences within the predetermined set of unique
oligonucleotide sequences is identified based on the examination of
the parameter values. Finally, oligonucleotide sequences in the
subset are identified that are clustered along one or more regions
of the nucleotide sequence that is hybridizable to the target
nucleotide sequence. The oligonucleotide probes corresponding to
the identified sequences find use in polynucleotide assays
particularly where the assays involve oligonucleotide arrays. For a
discussion of oligonucleotide arrays, see, e.g., U.S. Pat. No.
5,700,637 (E. Southern) and U.S. Pat. No. 5,667,667 (E. Southern),
the relevant disclosures of which are incorporated herein by
reference.
[0049] Another embodiment of the present invention is a method for
predicting the potential of an oligonucleotide to hybridize to a
complementary target nucleotide sequence. A set of overlapping
oligonucleotide sequences is identified based on a nucleotide
sequence that is complementary to the target nucleotide sequence.
At least two parameters that are independently predictive of the
ability of each of the oligonucleotides specified by the
oligonucleotide sequences to hybridize to the target nucleotide
sequence are determined and evaluated for each of the
oligonucleotide sequences. Independence is assured by requiring
that the parameters be poorly correlated with respect to one
another. A subset of oligonucleotide sequences within the set of
oligonucleotide sequences is identified based on the examination of
the parameter values. Finally, oligonucleotide sequences in the
subset are identified that are clustered along one or more regions
of the nucleotide sequence that is complementary to the target
nucleotide sequence.
[0050] Another embodiment of the present invention is a method for
predicting the potential of an oligonucleotide to hybridize to a
complementary target nucleotide sequence. A set of overlapping
oligonucleotide sequences is obtained based on a nucleotide
sequence of length L, complementary to the target nucleotide
sequence. The oligonucleotide sequences of the set of overlapping
oligonucleotide sequences are of identical length N and spaced one
nucleotide apart. The set comprises L-N+1 oligonucleotide
sequences. Parameters are determined for each of the
oligonucleotide sequences of the set of overlapping oligonucleotide
sequences. One parameter is the predicted melting temperature of
the duplex of each of the oligonucleotides specified by the
oligonucleotide sequences and the target nucleotide sequence,
corrected for salt concentration. The other parameter is the
predicted free energy of the most stable intramolecular structure
of each of the oligonucleotides specified by the oligonucleotide
sequences at the temperature of hybridization of the
oligonucleotide with the target nucleotide sequence. A subset of
oligonucleotide sequences within the set of oligonucleotide
sequences is selected based on an examination of the parameter
values by establishing cut-off values for each of the parameters.
Oligonucleotide sequences in the subset that are clustered along
one or more regions of the complementary nucleotide sequence are
ranked based on the sizes of the clusters of oligonucleotide
sequences. Finally, a subset of the clustered oligonucleotide
sequences is selected that statistically samples the clusters of
oligonucleotide sequences. The selected sampled subset is used to
specify the synthesis of oligonucleotides for experimental
evaluation.
[0051] Another aspect of the present invention is a computer based
method for predicting the potential of an oligonucleotide to
hybridize to a target nucleotide sequence. A predetermined number
of unique oligonucleotides within a nucleotide sequence that is
hybridizable with the target nucleotide sequence is identified
under computer control. The oligonucleotides are chosen to sample
the entire length of the nucleotide sequence. A value is determined
and evaluated under computer control for each of the
oligonucleotides for at least one parameter that is independently
predictive of the ability of each of the oligonucleotides to
hybridize to the target nucleotide sequence. The parameter values
are stored. A subset of oligonucleotides within the predetermined
number of unique oligonucleotides is identified by examination of
the stored parameter values under computer control. Then,
oligonucleotides in the subset that are clustered along a region of
the nucleotide sequence that is hybridizable to the target
nucleotide sequence are identified under computer control.
[0052] Another aspect of the present invention is a computer system
for conducting a method for predicting the potential of an
oligonucleotide to hybridize to a target nucleotide sequence. The
system comprises (a) input means for introducing a target
nucleotide sequence into the computer system, (b) means for
determining a number of unique oligonucleotide sequences that are
within a nucleotide sequence that is hybridizable with the target
nucleotide sequence where the oligonucleotide sequences are chosen
to sample the entire length of the nucleotide sequence, (c) memory
means for storing the oligonucleotide sequences, (d) means for
controlling the computer system to carry out for each of the
oligonucleotide sequences a determination and evaluation of a value
for at least one parameter that is independently predictive of the
ability of each of the oligonucleotide sequences to hybridize to
the target nucleotide sequence, (e) means for storing the parameter
values, (f) means for controlling the computer to carry out an
identification from the stored parameter values a subset of
oligonucleotide sequences within the number of unique
oligonucleotide sequences based on the examination of the
parameter, (g) means for storing the subset of oligonucleotides,
(h) means for controlling the computer to carry out an
identification of oligonucleotide sequences in the subset that are
clustered along a region of the nucleotide sequence that is
hybridizable to the target nucleotide sequence, (i) means for
storing the oligonucleotide sequences in the subset, and (j) means
for outputting data relating to the oligonucleotide sequences in
the subset.
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] FIG. 1 is a general flow chart depicting the method of the
present invention.
[0054] FIG. 2 is a flow chart depicting a preferred embodiment of a
method in accordance with the present invention.
[0055] FIG. 3 is a contour plot of normalized hybridization
intensity from multiple experiments, as a function of the free
energy of the most stable probe intramolecular structure
(.DELTA.G.sub.MFOLD) and the difference between the predicted
RNA/DNA heteroduplex melting temperature (T.sub.m) and the
temperature of hybridization (T.sub.hyb).
[0056] FIG. 4 shows the observed hybridization patterns for
oligonucleotides selected using a method in accordance with the
present invention and additional oligonucleotides to a portion of
the rabbit .beta.-globin gene (radiolabeled antisense RNA
target).
[0057] FIG. 5 shows the observed hybridization patterns for
oligonucleotides selected using a method in accordance with the
present invention and additional oligonucleotides to the HIV PRT
gene (fluorescein-labeled sense RNA target).
[0058] FIG. 6 shows the observed hybridization patterns for
oligonucleotides selected using a method in accordance with the
present invention and additional oligonucleotides to the G3PDH gene
(fluorescein-labeled antisense RNA target).
[0059] FIG. 7 shows the observed hybridization patterns for
oligonucleotides selected using a method in accordance with the
present invention and additional oligonucleotides to the p53 gene
(fluorescein-labeled antisense RNA target).
[0060] FIG. 8 shows the observed hybridization patterns for
oligonucleotides selected using a method in accordance with the
present invention and additional oligonucleotides to the HIV PRTs
gene (using data from the GeneChip.TM. data).
DEFINITIONS
[0061] Before proceeding further with a description of the specific
embodiments of the present invention, a number of terms will be
defined.
[0062] Nucleic Acids:
[0063] Polynucleotide--a compound or composition that is a
polymeric nucleotide or nucleic acid polymer. The polynucleotide
may be a natural compound or a synthetic compound. In the context
of an assay, the polynucleotide is often referred to as a
polynucleotide analyte. The polynucleotide can have from about 20
to 5,000,000 or more nucleotides. The larger polynucleotides are
generally found in the natural state. In an isolated state the
polynucleotide can have about 30 to 50,000 or more nucleotides,
usually about 100 to 20,000 nucleotides, more frequently 500 to
10,000 nucleotides. It is thus obvious that isolation of a
polynucleotide from the natural state often results in
fragmentation. The polynucleotides include nucleic acids, and
fragments thereof, from any source in purified or unpurified form
including DNA (dsDNA and ssDNA) and RNA, including tRNA, mRNA,
rRNA, mitochondrial DNA and RNA, chloroplast DNA and RNA, DNA/RNA
hybrids, or mixtures thereof, genes, chromosomes, plasmids, the
genomes of biological material such as microorganisms, e.g.,
bacteria, yeasts, viruses, viroids, molds, fungi, plants, animals,
humans, and the like. The polynucleotide can be only a minor
fraction of a complex mixture such as a biological sample. Also
included are genes, such as hemoglobin gene for sickle-cell anemia,
cystic fibrosis gene, oncogenes, cDNA, and the like.
[0064] The polynucleotide can be obtained from various biological
materials by procedures well known in the art. The polynucleotide,
where appropriate, may be cleaved to obtain a fragment that
contains a target nucleotide sequence, for example, by shearing or
by treatment with a restriction endonuclease or other site specific
chemical cleavage method.
[0065] For purposes of this invention, the polynucleotide, or a
cleaved fragment obtained from the polynucleotide, will usually be
at least partially denatured or single stranded or treated to
render it denatured or single stranded. Such treatments are well
known in the art and include, for instance, heat or alkali
treatment, or enzymatic digestion of one strand. For example, dsDNA
can be heated at 90-100.degree. C. for a period of about 1 to 10
minutes to produce denatured material.
[0066] Target nucleotide sequence--a sequence of nucleotides to be
identified, usually existing within a portion or all of a
polynucleotide, usually a polynucleotide analyte. The identity of
the target nucleotide sequence generally is known to an extent
sufficient to allow preparation of various sequences hybridizable
with the target nucleotide sequence and of oligonucleotides, such
as probes and primers, and other molecules necessary for conducting
methods in accordance with the present invention, an amplification
of the target polynucleotide, and so forth.
[0067] The target sequence usually contains from about 30 to 5,000
or more nucleotides, preferably 50 to 1,000 nucleotides. The target
nucleotide sequence is generally a fraction of a larger molecule or
it may be substantially the entire molecule such as a
polynucleotide as described above. The minimum number of
nucleotides in the target nucleotide sequence is selected to assure
that the presence of a target polynucleotide in a sample is a
specific indicator of the presence of polynucleotide in a sample.
The maximum number of nucleotides in the target nucleotide sequence
is normally governed by several factors: the length of the
polynucleotide from which it is derived, the tendency of such
polynucleotide to be broken by shearing or other processes during
isolation, the efficiency of any procedures required to prepare the
sample for analysis (e.g. transcription of a DNA template into RNA)
and the efficiency of detection and/or amplification of the target
nucleotide sequence, where appropriate.
[0068] Oligonucleotide--a polynucleotide, usually single stranded,
usually a synthetic polynucleotide but may be a naturally occurring
polynucleotide. The oligonucleotide(s) are usually comprised of a
sequence of at least 5 nucleotides, preferably, 10 to 100
nucleotides, more preferably, 20 to 50 nucleotides, and usually 10
to 30 nucleotides, more preferably, 20 to 30 nucleotides, and
desirably about 25 nucleotides in length.
[0069] Various techniques can be employed for preparing an
oligonucleotide. Such oligonucleotides can be obtained by
biological synthesis or by chemical synthesis. For short sequences
(up to about 100 nucleotides), chemical synthesis will frequently
be more economical as compared to the biological synthesis. In
addition to economy, chemical synthesis provides a convenient way
of incorporating low molecular weight compounds and/or modified
bases during specific synthesis steps. Furthermore, chemical
synthesis is very flexible in the choice of length and region of
the target polynucleotide binding sequence. The oligonucleotide can
be synthesized by standard methods such as those used in commercial
automated nucleic acid synthesizers. Chemical synthesis of DNA on a
suitably modified glass or resin can result in DNA covalently
attached to the surface. This may offer advantages in washing and
sample handling. For longer sequences standard replication methods
employed in molecular biology can be used such as the use of M13
for single stranded DNA as described by J. Messing (1983) Methods
Enzymol, 101:20-78.
[0070] Other methods of oligonucleotide synthesis include
phosphotriester and phosphodiester methods (Narang, et al. (1979)
Meth. Enzymol 68:90) and synthesis on a support (Beaucage, et al.
(1981) Tetrahedron Letters 22:1859-1862) as well as phosphoramidite
techniques (Caruthers, M. H., et al., "Methods in Enzymology," Vol.
154, pp. 287-314 (1988)) and others described in "Synthesis and
Applications of DNA and RNA," S. A. Narang, editor, Academic Press,
New York, 1987, and the references contained therein. The chemical
synthesis via a photolithographic method of spatially addressable
arrays of oligonucleotides bound to glass surfaces is described by
A. C. Pease, et al., Proc. Nat. Acad. Sci. USA (1994)
91:5022-5026.
[0071] Oligonucleotide probe--an oligonucleotide employed to bind
to a portion of a polynucleotide such as another oligonucleotide or
a target nucleotide sequence. The design and preparation of the
oligonucleotide probes are generally dependent upon the sensitivity
and specificity required, the sequence of the target polynucleotide
and, in certain cases, the biological significance of certain
portions of the target polynucleotide sequence.
[0072] Oligonucleotide primer(s)--an oligonucleotide that is
usually employed in a chain extension on a polynucleotide template
such as in, for example, an amplification of a nucleic acid. The
oligonucleotide primer is usually a synthetic nucleotide that is
single stranded, containing a sequence at its 3'-end that is
capable of hybridizing with a defined sequence of the target
polynucleotide. Normally, an oligonucleotide primer has at least
80%, preferably 90%, more preferably 95%, most preferably 100%,
complementarity to a defined sequence or primer binding site. The
number of nucleotides in the hybridizable sequence of an
oligonucleotide primer should be such that stringency conditions
used to hybridize the oligonucleotide primer will prevent excessive
random non-specific hybridization. Usually, the number of
nucleotides in the oligonucleotide primer will be at least as great
as the defined sequence of the target polynucleotide, namely, at
least ten nucleotides, preferably at least 15 nucleotides, and
generally from about 10 to 200, preferably 20 to 50,
nucleotides.
[0073] In general, in primer extension, amplification primers
hybridize to, and are extended along (chain extended), at least the
target nucleotide sequence within the target polynucleotide and,
thus, the target sequence acts as a template. The extended primers
are chain "extension products." The target sequence usually lies
between two defined sequences but need not. In general, the primers
hybridize with the defined sequences or with at least a portion of
such target polynucleotide, usually at least a ten-nucleotide
segment at the 3'-end thereof and preferably at least 15,
frequently a 20 to 50 nucleotide segment thereof.
[0074] Nucleoside triphosphates--nucleosides having a
5'-triphosphate substituent. The nucleosides are pentose sugar
derivatives of nitrogenous bases of either purine or pyrimidine
derivation, covalently bonded to the 1'-carbon of the pentose
sugar, which is usually a deoxyribose or a ribose. The purine bases
include adenine (A), guanine (G), inosine (I), and derivatives and
analogs thereof. The pyrimidine bases include cytosine (C), thymine
(T), uracil (U), and derivatives and analogs thereof. Nucleoside
triphosphates include deoxyribonucleoside triphosphates such as the
four common deoxyribonucleoside triphosphates dATP, dCTP, dGTP and
dTTP and ribonucleoside triphosphates such as the four common
triphosphates rATP, rCTP, rGTP and rUTP.
[0075] The term "nucleoside triphosphates" also includes
derivatives and analogs thereof, which are exemplified by those
derivatives that are recognized and polymerized in a similar manner
to the underivatized nucleoside triphosphates.
[0076] Nucleotide--a base-sugar-phosphate combination that is the
monomeric unit of nucleic acid polymers, i.e., DNA and RNA. The
term "nucleotide" as used herein includes modified nucleotides as
defined below.
[0077] DNA--deoxyribonucleic acid.
[0078] RNA--ribonucleic acid.
[0079] Modified nucleotide--a unit in a nucleic acid polymer that
contains a modified base, sugar or phosphate group. The modified
nucleotide can be produced by a chemical modification of the
nucleotide either as part of the nucleic acid polymer or prior to
the incorporation of the modified nucleotide into the nucleic acid
polymer. For example, the methods mentioned above for the synthesis
of an oligonucleotide may be employed. In another approach a
modified nucleotide can be produced by incorporating a modified
nucleoside triphosphate into the polymer chain during an
amplification reaction. Examples of modified nucleotides, by way of
illustration and not limitation, include dideoxynucleotides,
derivatives or analogs that are biotinylated, amine modified,
alkylated, fluorophore-labeled, and the like and also include
phosphorothioate, phosphite, ring atom modified derivatives, and so
forth.
[0080] Nucleoside--is a base-sugar combination or a nucleotide
lacking a phosphate moiety.
[0081] Nucleotide polymerase--a catalyst, usually an enzyme, for
forming an extension of a polynucleotide along a DNA or RNA
template where the extension is complementary thereto. The
nucleotide polymerase is a template dependent polynucleotide
polymerase and utilizes nucleoside triphosphates as building blocks
for extending the 3'-end of a polynucleotide to provide a sequence
complementary with the polynucleotide template. Usually, the
catalysts are enzymes, such as DNA polymerases, for example,
prokaryotic DNA polymerase (I, II, or III), T4 DNA polymerase, T7
DNA polymerase, Klenow fragment, reverse transcriptase, Vent DNA
polymerase, Pfu DNA polymerase, Tag DNA polymerase, and the like,
or RNA polymerases, such as T3 and T7 RNA polymerases. Polymerase
enzymes may be derived from any source such as cells, bacteria such
as E. coli, plants, animals, virus, thermophilic bacteria, and so
forth.
[0082] Amplification of nucleic acids or polynucleotides--any
method that results in the formation of one or more copies of a
nucleic acid or polynucleotide molecule (exponential amplification)
or in the formation of one or more copies of only the complement of
a nucleic acid or polynucleotide molecule (linear
amplification).
[0083] Hybridization (hybridizing) and binding--in the context of
nucleotide sequences these terms are used interchangeably herein.
The ability of two nucleotide sequences to hybridize with each
other is based on the degree of complementarity of the two
nucleotide sequences, which in turn is based on the fraction of
matched complementary nucleotide pairs. The more nucleotides in a
given sequence that are complementary to another sequence, the more
stringent the conditions can be for hybridization and the more
specific will be the binding of the two sequences. Increased
stringency is achieved by elevating the temperature, increasing the
ratio of co-solvents, lowering the salt concentration, and the
like.
[0084] Hybridization efficiency--the productivity of a
hybridization reaction, measured as either the absolute or relative
yield of oligonucleotide probe/polynucleotide target duplex formed
under a given set of conditions in a given amount of time.
[0085] Homologous or substantially identical polynucleotides--In
general, two polynucleotide sequences that are identical or can
each hybridize to the same polynucleotide sequence are homologous.
The two sequences are homologous or substantially identical where
the sequences each have at least 90%, preferably 100%, of the same
or analogous base sequence where thymine (T) and uracil (U) are
considered the same. Thus, the ribonucleotides A, U, C and G are
taken as analogous to the deoxynucleotides dA, dT, dC, and dG,
respectively. Homologous sequences can both be DNA or one can be
DNA and the other RNA.
[0086] Complementary--Two sequences are complementary when the
sequence of one can bind to the sequence of the other in an
anti-parallel sense wherein the 3'-end of each sequence binds to
the 5'-end of the other sequence and each A, T(U), G, and C of one
sequence is then aligned with a T(U), A, C, and G, respectively, of
the other sequence. RNA sequences can also include complementary
G/U or U/G basepairs.
[0087] Member of a specific binding pair ("sbp member")--one of two
different molecules, having an area on the surface or in a cavity
that specifically binds to and is thereby defined as complementary
with a particular spatial and polar organization of the other
molecule. The members of the specific binding pair are referred to
as cognates or as ligand and receptor (antiligand). These may be
members of an immunological pair such as antigen-antibody, or may
be operator-repressor, nuclease-nucleotide, biotin-avidin,
hormones-hormone receptors, nucleic acid duplexes, IgG-protein A,
DNA-DNA, DNA-RNA, and the like.
[0088] Ligand--any compound for which a receptor naturally exists
or can be prepared.
[0089] Receptor ("antiligand")--any compound or composition capable
of recognizing a particular spatial and polar organization of a
molecule, e.g., epitopic or determinant site. Illustrative
receptors include naturally occurring receptors, e.g., thyroxine
binding globulin, antibodies, enzymes, Fab fragments, lectins,
nucleic acids, repressors, protection enzymes, protein A,
complement component C1q, DNA binding proteins or ligands and the
like.
[0090] Oligonucleotide Properties:
[0091] Potential of an oligonucleotide to hybridize--the
combination of duplex formation rate and duplex dissociation rate
that determines the amount of duplex nucleic acid hybrid that will
form under a given set of experimental conditions in a given amount
of time.
[0092] Parameter--a factor that provides information about the
hybridization of an oligonucleotide with a target nucleotide
sequence. Generally, the factor is one that is predictive of the
ability of an oligonucleotide to hybridize with a target nucleotide
sequence. Such factors include composition factors, thermodynamic
factors, chemosynthetic efficiencies, kinetic factors, and the
like.
[0093] Parameter predictive of the ability to hybridize--a
parameter calculated from a set of oligonucleotide sequences
wherein the parameter positively correlates with observed
hybridization efficiencies of those sequences. The parameter is,
therefore, predictive of the ability of those sequences to
hybridize. "Positive correlation" can be rigorously defined in
statistical terms. The correlation coefficient .rho..sub.x,y of two
experimentally measured discreet quantities x and y (N values in
each set) is defined as 1 x , y = Covariance ( x , y ) Variance ( x
) Variance ( y ) ,
[0094] where the Covariance (x,y) is defined by 2 Covariance ( x ,
y ) = 1 N j = 1 N ( x j - x ) ( y j - y ) .
[0095] The quantities .mu..sub.x and .mu..sub.y are the averages of
the quantities x and y, while the variances are simply the squares
of the standard deviations (defined below). The correlation
coefficient is a dimensionless (unitless) quantity between -1 and
1. A correlation coefficient of 1 or -1 indicates that x and y have
a linear relationship with a positive or negative slope,
respectively. A correlation coefficient of zero indicates no
relationship; for example, two sets of random numbers will yield a
correlation coefficient near zero. Intermediate correlation
coefficients indicate intermediate degrees of relatedness between
two sets of numbers. The correlation coefficient is a good
statistical measure of the degree to which one set of numbers
predicts a second set of numbers.
[0096] Composition factor--a numerical factor based solely on the
composition or sequence of an oligonucleotide without involving
additional parameters, such as experimentally measured
nearest-neighbor thermodynamic parameters. For instance, the
fraction (G+C), given by the formula 3 f GC = n G + n C n G + n C +
n A + n T or U ,
[0097] where n.sub.G, n.sub.C, n.sub.A and n.sub.T or U are the
numbers of G, C, A and T (or U) bases in an oligonucleotide, is an
example of a composition factor. Examples of composition factors,
by way of illustration and not limitation, are mole fraction (G+C),
percent (G+C), sequence complexity, sequence information content,
frequency of occurrence of specific oligonucleotide sequences in a
sequence database and so forth.
[0098] Thermodynamic factor--numerical factors that predict the
behavior of an oligonucleotide in some process that has reached
equilibrium. For instance, the free energy of duplex formation
between an oligonucleotide and its complement is a thermodynamic
factor. Thermodynamic factors for systems that can be subdivided
into constituent parts are often estimated by summing contributions
from the constituent parts. Such an approach is used to calculate
the thermodynamic properties of oligonucleotides.
[0099] Examples of thermodynamic factors, by way of illustration
and not limitation, are predicted duplex melting temperature,
predicted enthalpy of duplex formation, predicted entropy of duplex
formation, free energy of duplex formation, predicted melting
temperature of the most stable intramolecular structure of the
oligonucleotide or its complement, predicted enthalpy of the most
stable intramolecular structure of the oligonucleotide or its
complement, predicted entropy of the most stable intramolecular
structure of the oligonucleotide or its complement, predicted free
energy of the most stable intramolecular structure of the
oligonucleotide or its complement, predicted melting temperature of
the most stable hairpin structure of the oligonucleotide or its
complement, predicted enthalpy of the most stable hairpin structure
of the oligonucleotide or its complement, predicted entropy of the
most stable hairpin structure of the oligonucleotide or its
complement, predicted free energy of the most stable hairpin
structure of the oligonucleotide or its complement, thermodynamic
partition function for intramolecular structure of the
oligonucleotide or its complement and the like.
[0100] Chemosynthetic efficiency--oligonucleotides and nucleotide
sequences may both be made by sequential polymerization of the
constituent nucleotides. However, the individual addition steps are
not perfect; they instead proceed with some fractional efficiency
that is less than unity. This may vary as a function of position in
the sequence. Therefore, what is really produced is a family of
molecules that consists of the desired molecule plus many truncated
sequences. These "failure sequences" affect the observed efficiency
of hybridization between an oligonucleotide and its complementary
target. Examples of chemosynthetic efficiency factors, by way of
illustration and not limitation, are coupling efficiencies, overall
efficiencies of the synthesis of a target nucleotide sequence or an
oligonucleotide probe, and so forth.
[0101] Kinetic factor--numerical factors that predict the rate at
which an oligonucleotide hybridizes to its complementary sequence
or the rate at which the hybridized sequence dissociates from its
complement are called kinetic factors. Examples of kinetic factors
are steric factors calculated via molecular modeling or measured
experimentally, rate constants calculated via molecular dynamics
simulations, associative rate constants, dissociative rate
constants, enthalpies of activation, entropies of activation, free
energies of activation, and the like.
[0102] Predicted duplex melting temperature--the temperature at
which an oligonucleotide mixed with a hybridizable nucleotide
sequence is predicted to form a duplex structure (double-helix
hybrid) with 50% of the hybridizable sequence. At higher
temperatures, the amount of duplex is less than 50%; at lower
temperatures, the amount of duplex is greater than 50%. The melting
temperature T.sub.m (.degree. C.) is calculated from the enthalpy
(.DELTA.H), entropy (.DELTA.S) and C, the concentration of the most
abundant duplex component (for hybridization arrays, the soluble
hybridization target), using the equation 4 T m = H S + R ln C -
273.15 ,
[0103] where R is the gas constant, 1.987 cal/(mole-.degree. K).
For longer sequences (>100 nucleotides), T.sub.m can also be
estimated from the mole fraction (G+C), X.sub.G+C, using the
equation
T.sub.m=81.5+41.0.chi..sub.G+C.
[0104] Melting temperature corrected for salt
concentration--polynucleotid- e duplex melting temperatures are
calculated with the assumption that the concentration of sodium
ion, Na.sup.+, is 1 M. Melting temperatures T'.sub.m calculated for
duplexes formed at different salt concentrations are corrected via
the semi-empirical equation
T'.sub.m([Na.sup.+])=T.sub.m+16.6 log([Na.sup.+]).
[0105] Predicted enthalpy, entropy and free energy of duplex
formation--the enthalpy (.DELTA.H), entropy and free energy
(.DELTA.G) are thermodynamic state functions, related by the
equation
.DELTA.G=.DELTA.H-T.DELTA.S,
[0106] where T is the temperature in .degree. K. In practice, the
enthalpy and entropy are predicted via a thermodynamic model of
duplex formation (the "nearest neighbor" model which is explained
in more detail below), and used to calculate the free energy and
melting temperature.
[0107] Predicted free energy of the most stable intramolecular
structure of an oligonucleotide or its complement--single-stranded
DNA and RNA molecules that contain self-complementary sequences can
form intramolecular secondary structures. For instance, the
oligonucleotide
1 5'-ACTGGCAATCACAATTGCCAGTAA-3' (SEQ ID NO:1)
[0108] can base pair with itself, to form the structure
2 5'-ACTGGCAATCA (SEQ ID NO:1)
.vertline..vertline..vertline..vertline..vertline..vertline..vertline..ve-
rtline..vertline. C 3'-AATGACCGTTAA
[0109] where a vertical line indicates Watson-Crick base pair
formation. Many such structures are possible for a given sequence;
two are of particular interest. The first is the lowest energy
"hairpin" structure (formed by folding a sequence back on itself
with a connecting loop at least 3 nucleotides long). The second is
the lowest energy structure that can be formed by including more
complex topologies, such as "bulge loops" (unpaired duplexes
between two regions of base-paired duplex) and cloverleaf
structures, where 3 base-paired stretches meet at a
triple-junction. A good example of a complex secondary structure is
the structure of a tRNA molecule, an example of which, namely,
yeast tRNA.sup.Ala is shown below.
[0110] For either type of structure, a value of the free energy of
that structure can be calculated, relative to the unpaired strand,
by means of a thermodynamic model similar to that used to calculate
the free energy of a base-paired duplex structure. Again, the free
energy .DELTA.G is calculated from the enthalpy .DELTA.H and the
entropy .DELTA.S at a given absolute temperature T via the
equation
.DELTA.G=.DELTA.H-T.DELTA.S.
[0111] However, in this case there is the added difficulty that the
lowest energy structure must be found. For a simple hairpin
structure, this optimization can be performed via a relatively
simple search algorithm. For more complex structures (such as a
cloverleaf) a dynamic programming algorithm, such as that
implemented in the program MFOLD, must be used.
[0112] Yeast tRNA.sup.Ala--The RNA sequence includes many
non-standard ribonucleotides, such as D (5,6 dihydrouridine),
m.sup.1G (1-methylguanosine), m.sup.2G (N.sup.2-dimethylguanosine),
.psi. (pseudouridine), I (inosine), m.sup.1I (1-methylinosine) and
T (ribothymidine). Dots (-) mark (non-standard) G=U base pairs. The
structure is taken from A. L. Lehninger, et al., Principles of
Biochemistry, 2.sup.nd Ed. (Worth Publishers, New York, N.Y.,
1993).
3 3' / A C 5' C .backslash. A pG-C G-C G.multidot.U C-G G-C U U G-C
UU DG U AGGCC A C AUGCG m.sup.1G
.vertline..vertline..vertline..vertline..vertline. G (SEQ ID NO:2)
.multidot..vertline..vertline..vertline. UCCGG C G AGCGC C T.psi.
GD m.sup.2G D C-GAG U-A C-G C-G C-G U .psi. U m.sup.1I I C G
[0113] Coupling efficiencies--chemosynthetic efficiencies are
called coupling efficiencies when the synthetic scheme involves
successive attachment of different monomers to a growing oligomer;
a good example is oligonucleotide synthesis via phosphoramidite
coupling chemistry.
[0114] Algorithmic Operations:
[0115] Evaluating a parameter--determination of the numerical value
of a numerical descriptor of a property of an oligonucleotide
sequence by means of a formula, algorithm or look-up table.
[0116] Filter--a mathematical rule or formula that divides a set of
numbers into two subsets. Generally, one subset is retained for
further analysis while the other is discarded. If the division into
two subsets is achieved by testing the numbers against a simple
inequality, then the filter is referred to as a "cut-off". In the
context of the current invention, an example by way of illustration
and not limitation is the statement "The predicted self structure
free energy must be greater than or equal to -0.4 kcal/mole," which
can be used as a filter for oligonucleotide sequences; this
particular filter is also an example of a cut-off.
[0117] Filter set--A set of rules or formulae that successively
winnow a set of numbers by identifying and discarding subsets that
do not meet specific criteria. In the context of the current
invention, an example by way of illustration and not limitation is
the compound statement "the predicted self structure free energy
must be greater than or equal to -0.4 kcal/mole and the predicted
RNA/DNA heteroduplex melting temperature must lie between
60.degree. C. and 85.degree. C.," which can be used as a filter set
for oligonucleotide sequences.
[0118] Examining a parameter--comparing the numerical value of a
parameter to some cutoff-value or filter.
[0119] Statistical sampling of a cluster--extraction of a subset of
oligonucleotides from a cluster of oligonucleotides based upon some
statistical measure, such as rank by oligonucleotide starting
position in the sequence complementary to the target sequence.
[0120] First quartile, median and third quartile--If a set of
numbers is ranked by value, then the value that divides the lower
1/4 from the upper 3/4 of the set is the first quartile, the value
that divides the set in half is the median and the value that
divides the lower 3/4 from the upper 1/4 of the set is the third
quartile.
[0121] Poorly correlated--If it is not possible to perform a "good"
prediction, as defined via statistics, of one set of numbers from
another set of numbers using a simple linear model, then the two
sets of numbers are said to be poorly correlated.
[0122] Computer program--a written set of instructions that
symbolically instructs an appropriately configured computer to
execute an algorithm that will yield desired outputs from some set
of inputs. The instructions may be written in one or several
standard programming languages, such as C, C++, Visual BASIC,
FORTRAN or the like. Alternatively, the instructions may be written
by imposing a template onto a general-purpose numerical analysis
program, such as a spreadsheet.
[0123] Experimental System Components:
[0124] Small organic molecule--a compound of molecular weight less
than 1500, preferably 100 to 1000, more preferably 300 to 600 such
as biotin, fluorescein, rhodamine and other dyes, tetracycline and
other protein binding molecules, and haptens, etc. The small
organic molecule can provide a means for attachment of a nucleotide
sequence to a label or to a support.
[0125] Support or surface--a porous or non-porous water insoluble
material. The surface can have any one of a number of shapes, such
as strip, plate, disk, rod, particle, including bead, and the like.
The support can be hydrophilic or capable of being rendered
hydrophilic and includes inorganic powders such as glass, silica,
magnesium sulfate, and alumina; natural polymeric materials,
particularly cellulosic materials and materials derived from
cellulose, such as fiber containing papers, e.g., filter paper,
chromatographic paper, etc.; synthetic or modified naturally
occurring polymers, such as nitrocellulose, cellulose acetate, poly
(vinyl chloride), polyacrylamide, cross linked dextran, agarose,
polyacrylate, polyethylene, polypropylene, poly(4-methylbutene),
polystyrene, polymethacrylate, poly(ethylene terephthalate), nylon,
poly(vinyl butyrate), etc.; either used by themselves or in
conjunction with other materials; glass available as Bioglass,
ceramics, metals, and the like. Natural or synthetic assemblies
such as liposomes, phospholipid vesicles, and cells can also be
employed.
[0126] Binding of oligonucleotides to a support or surface may be
accomplished by well-known techniques, commonly available in the
literature. See, for example, A. C. Pease, et al., Proc. Nat. Acad.
Sci. USA, 91:5022-5026 (1994).
[0127] Label--a member of a signal producing system. Usually the
label is part of a target nucleotide sequence or an oligonucleotide
probe, either being conjugated thereto or otherwise bound thereto
or associated therewith. The label is capable of being detected
directly or indirectly. Labels include (i) reporter molecules that
can be detected directly by virtue of generating a signal, (ii)
specific binding pair members that may be detected indirectly by
subsequent binding to a cognate that contains a reporter molecule,
(iii) oligonucleotide primers that can provide a template for
amplification or ligation or (iv) a specific polynucleotide
sequence or recognition sequence that can act as a ligand such as
for a repressor protein, wherein in the latter two instances the
oligonucleotide primer or repressor protein will have, or be
capable of having, a reporter molecule. In general, any reporter
molecule that is detectable can be used.
[0128] The reporter molecule can be isotopic or nonisotopic,
usually non-isotopic, and can be a catalyst, such as an enzyme, a
polynucleotide coding for a catalyst, promoter, dye, fluorescent
molecule, chemiluminescent molecule, coenzyme, enzyme substrate,
radioactive group, a small organic molecule, amplifiable
polynucleotide sequence, a particle such as latex or carbon
particle, metal sol, crystallite, liposome, cell, etc., which may
or may not be further labeled with a dye, catalyst or other
detectable group, and the like. The reporter molecule can be a
fluorescent group such as fluorescein, a chemiluminescent group
such as luminol, a terbium chelator such as N-(hydroxyethyl)
ethylenediaminetriacetic acid that is capable of detection by
delayed fluorescence, and the like.
[0129] The label is a member of a signal producing system and can
generate a detectable signal either alone or together with other
members of the signal producing system. As mentioned above, a
reporter molecule can be bound directly to a nucleotide sequence or
can become bound thereto by being bound to an sbp member
complementary to an sbp member that is bound to a nucleotide
sequence. Examples of particular labels or reporter molecules and
their detection can be found in U.S. Pat. No. 5,508,178 issued Apr.
16, 1996, at column 11, line 66, to column 14, line 33, the
relevant disclosure of which is incorporated herein by reference.
When a reporter molecule is not conjugated to a nucleotide
sequence, the reporter molecule may be bound to an sbp member
complementary to an sbp member that is bound to or part of a
nucleotide sequence.
[0130] Signal Producing System--the signal producing system may
have one or more components, at least one component being the
label. The signal producing system generates a signal that relates
to the presence or amount of a target polynucleotide in a medium.
The signal producing system includes all of the reagents required
to produce a measurable signal. Other components of the signal
producing system may be included in a developer solution and can
include substrates, enhancers, activators, chemiluminescent
compounds, cofactors, inhibitors, scavengers, metal ions, specific
binding substances required for binding of signal generating
substances, and the like. Other components of the signal producing
system may be coenzymes, substances that react with enzymic
products, other enzymes and catalysts, and the like. The signal
producing system provides a signal detectable by external means, by
use of electromagnetic radiation, desirably by visual examination.
Signal-producing systems that may be employed in the present
invention are those described more fully in U.S. Pat. No.
5,508,178, the relevant disclosure of which is incorporated herein
by reference.
[0131] Ancillary Materials--Various ancillary materials will
frequently be employed in the methods and assays utilizing
oligonucleotide probes designed in accordance with the present
invention. For example, buffers and salts will normally be present
in an assay medium, as well as stabilizers for the assay medium and
the assay components. Frequently, in addition to these additives,
proteins may be included, such as albumins, organic solvents such
as formamide, quaternary ammonium salts, polycations such as
spermine, surfactants, particularly non-ionic surfactants, binding
enhancers, e.g., polyalkylene glycols, or the like.
DETAILED DESCRIPTION OF THE INVENTION
[0132] The invention is directed to methods or algorithms for
predicting oligonucleotides specific for a nucleic acid target
where the oligonucleotides exhibit a high potential for
hybridization. The algorithm uses parameters of the oligonucleotide
and the oligonucleotide/target nucleotide sequence duplex, which
can be readily predicted from the primary sequences of the target
polynucleotide and candidate oligonucleotides. In the methods of
the present invention, oligonucleotides are filtered based on one
or more of these parameters, then further filtered based on the
sizes of clusters of oligonucleotides along the input
polynucleotide sequence. The methods or algorithms of the present
invention may be carried out using either relatively simple
user-written subroutines or publicly available stand-alone software
applications (e.g., dynamic programming algorithm for calculating
self-structure free energies of oligonucleotides). The parameter
calculations may be orchestrated and the filtering algorithms may
be implemented using any of a number of commercially available
computer programs as a framework such as, e.g., Microsoft.RTM.
Excel spreadsheet, Microsoft.RTM. Access relational database and
the like. The basic steps involved in the present methods involve
parsing a sequence that is complementary to a target nucleotide
sequence into a set of overlapping oligonucleotide sequences,
evaluating one or more parameters for each of the oligonucleotide
sequences, said parameter or parameters being predictive of probe
hybridization to the target nucleotide sequence, filtering the
oligonucleotide sequences based on the values for each parameter,
filtering the oligonucleotide sequences based on the length of
contiguous sequence elements and ranking the contiguous sequence
elements based on their length. We have found that oligonucleotides
in the longest contiguous sequence elements generally show the
highest hybridization efficiencies.
[0133] The present methods are based on our recognition that
oligonucleotides showing high hybridization efficiencies tend to
form clusters. It is believed that this clustering reflects local
regions of the target nucleotide sequence that are unstructured and
accessible for oligonucleotide binding. Oligonucleotides that are
contiguous along a region of the input nucleic acid sequence are
identified. These oligonucleotides are sorted based on the length
of the contiguous sequence elements. The sorting approach used in
the present invention apparently serves as a surrogate for the
calculation of local secondary structure of the target nucleotide
sequence. This is supported by our observation that treatments
intended to eliminate long-range nucleic acid structure (e.g.,
random fragmentation) do not eliminate the differences in
hybridization yields across oligonucleotide probe arrays. This
implies that major determinants of efficient hybridization are
local regions of the target sequence. The identification of
contiguous sequence elements is a simple and efficient method for
recognizing clusters of such determinants and, thus, for
identifying oligonucleotide probes that exhibit high hybridization
efficiency for a target nucleotide sequence.
[0134] As mentioned above one embodiment of the present invention
is a method for predicting the potential of an oligonucleotide to
hybridize to a target nucleotide sequence. A predetermined number
of unique oligonucleotides is identified. The length of the
oligonucleotides may be the same or different. The oligonucleotides
are unique in that no two of the oligonucleotides are identical.
The unique oligonucleotides are chosen to sample the entire length
of a nucleotide sequence that is hybridizable with the target
nucleotide sequence. The actual number of oligonucleotides is
generally determined by the length of the nucleotide sequence and
the desired result. The number of oligonucleotides should be
sufficient to achieve a consensus behavior. In other words, the
oligonucleotide sequences should be sufficiently numerous that
several possible probes overlap or fall within a given region that
is expected to yield acceptable hybridization efficiency. Since the
location of these regions is not known before hand, the best
strategy is to equally space the probe sequences along the sequence
that is hybridizable to the target sequence. Since regions of
acceptable hybridization efficiency are generally on the order of
20 nucleotides in length, a practical strategy is to space the
starting nucleotides of the oligonucleotide sequences no more than
five basepairs apart. If computation time needed to calculate the
predictive parameters is not an issue, then the best strategy is to
space the starting nucleotides one nucleotide apart. An important
feature of the present invention is to determine oligonucleotides
that are clustered along a region of the nucleotide sequence. The
individual predictions made for individual oligonucleotide
sequences are not very good. However, we have found that the
predictions that are experimentally observed tend to form
contiguous clusters, while the spurious predictions tend to be
solitary. Thus, the number of oligonucleotides should be sufficient
to achieve the desired clustering.
[0135] Preferably, a set of overlapping sequences is chosen. To
this end, the subsequences are chosen so that there is overlap of
at least one nucleotide from one oligonucleotide to the next. More
preferably, the overlap is two or more nucleotides. Most
preferably, the oligonucleotides are spaced one nucleotide apart
and the predetermined number is L-N+1 oligonucleotides where L is
the length of the nucleotide sequence and N is the length of the
oligonucleotides. In the latter situation, the unique
oligonucleotides are of identical length N. Thus, a set of
overlapping oligonucleotides is a set of oligonucleotides that are
subsequences derived from some master sequence by subdividing that
sequence in such a way that each subsequence contains either the
start or end of at least one other subsequence in the set.
[0136] An example of the above for purposes of illustration and not
limitation is presented by the sequence ATGGACTTAGCATTCG (SEQ ID
NO:3), from which the following set of overlapping oligonucleotides
can be identified:
4 ATGGACTTAGCA (SEQ ID NO:4) TGGACTTAGCAT (SEQ ID NO:5)
GGACTTAGCATT (SEQ ID NO:6) GACTTAGCATTC (SEQ ID NO:7) ACTTAGCATTCG
(SEQ ID NO:8)
[0137] In this example the overlapping oligonucleotides are spaced
one nucleotide apart. In other words, there is overlap of all but
one nucleotide from one oligonucleotide to the next. In the example
above, the original nucleotide sequence is 16 nucleotides long
(L=16). The length of each of the overlapping oligonucleotides is
12 nucleotides long (N=12) and there are L-N+1=5
oligonucleotides.
[0138] The length of the oligonucleotides may be the same or
different and may vary depending on the length of the nucleotide
sequence. The length of the oligonucleotides is determined by a
practical compromise between the limits of current chemistries for
oligonucleotide synthesis and the need for longer oligonucleotides,
which exhibit greater binding affinity for the target sequence and
are more likely to occur only once in complicated mixtures of
polynucleotide targets. Usually, the length of the oligonucleotides
is from about 10 to 50 nucleotides, more usually, from about 25 to
35 nucleotides.
[0139] In the next step of the method at least one parameter that
is independently predictive of the ability of each of the
oligonucleotides of the set to hybridize to the target nucleotide
sequence is determined and evaluated for each of the above
oligonucleotides. Examples of such a parameter, by way of
illustration and not limitation, is a parameter selected from the
group consisting of composition factors, thermodynamic factors,
chemosynthetic efficiencies, kinetic factors and mathematical
combinations of these quantities.
[0140] The determination of a parameter may be carried out by known
methods. For example, melting temperature of the
oligonucleotide/target duplex may be determined using the nearest
neighbor method and parameters appropriate for the nucleotide acids
involved. For DNA/DNA parameters, see J. SantaLucia Jr., et al.,
(1996) Biochemistry, 35:3555. For RNA/DNA parameters, see N.
Sugimoto, et al., (1995) Biochemistry, 34:11211. Briefly, these
methods are based on the observation that the thermodynamics of a
nucleic acid duplex can be modeled as the sum of a term arising
from the entire duplex and a set of terms arising from overlapping
pairs of nucleotides ("nearest neighbor" model). For a discussion
of the nearest neighbor see J. SantaLucia Jr., et al., (1996)
Biochemistry, supra, and N. Sugimoto, et al., (1995) Biochemistry,
supra. For example, the enthalpy .DELTA.H of the duplex formed by
the sequence
5 ATGGACTTAGCA (SEQ ID NO:4)
[0141] and its perfect complement can be approximated by the
equation
.DELTA.H.congruent.H.sub.init+H.sub.AT+H.sub.TG+H.sub.GG+H.sub.GA+H.sub.AC-
+H.sub.CT+H.sub.TT+H.sub.TA+H.sub.AG+H.sub.GC+H.sub.CA.
[0142] In the above equation, the term H.sub.init is the initiation
enthalpy for the entire duplex, while the terms H.sub.AT, . . . ,
H.sub.CA are the so-called "nearest neighbor" enthalpies. Similar
equations can be written for the entropy, for the corresponding
quantities for RNA homoduplexes, or for DNA/RNA heteroduplexes. The
free energy can then be calculated from the enthalpy, entropy and
absolute temperature, as described previously.
[0143] Predicted free energy of the most stable intramolecular
structure of an oligonucleotide (.DELTA.G.sub.MFOLD) may be
determined using the nucleic acid folding algorithm MFOLD and
parameters appropriate for the oligonucleotide, e.g., DNA or RNA.
For MFOLD, see J. A. Jaeger, et al., (1989), supra. For DNA folding
parameters, see J. SantaLucia Jr., et al., (1996), supra. Briefly,
these methods operate in two steps. First, a map of all possible
compatible intramolecular base pairs is made. Second, the global
minimum of the free energy of the various possible base pairing
configurations is found, using the nearest neighbor model to
estimate the enthalpy and entropy, the user input temperature to
complete the calculation of free energy, and a dynamic programming
algorithm to find the global minimum. The algorithm is
computationally intensive; calculation times scale as the third
power of the sequence length.
[0144] The following Table 1 summarizes groups of parameters that
are independently predictive of the ability of each of the
oligonucleotides to hybridize to the target nucleotide sequence
together with a reference to methods for their determination.
Parameters within a given group are known or expected to be
strongly correlated to one another, while parameters in different
groups are known or expected to be poorly correlated with one
another.
6TABLE 1 Group Parameter Source or Reference I duplex enthalpy,
.DELTA.H Santa Lucia et al., 1996; Sugimoto et al., 1995 duplex
entropy, .DELTA.S Santa Lucia et al., 1996; Sugimoto et al., 1995
duplex free energy, .DELTA.G .DELTA.G = .DELTA.H - T.DELTA.S (see
text) melting temperature, T.sub.m (see text) mole fraction (or
percent) G + C self-explanatory subsequence duplex enthalpy Santa
Lucia et al., 1996; Sugimoto et al., 1995 subsequence duplex
entropy Santa Lucia et al., 1996; Sugimoto et al., 1995 subsequence
duplex free energy .DELTA.G = .DELTA.H - T.DELTA.S (see text)
subsequence duplex T.sub.m (see text) subsequence duplex mole
fraction self-explanatory (or percent) G + C II intramolecular
enthalpy, .DELTA.H.sub.MFOLD Jaeger et al., 1989; Santa Lucia et
al., 1996 intramolecular entropy, .DELTA.S.sub.MFOLD Jaeger et al.,
1989; Santa Lucia et al., 1996 intramolecular free energy,
.DELTA.G.sub.MFOLD .DELTA.G = .DELTA.H - T.DELTA.S (see text)
hairpin enthalpy, .DELTA.H.sub.hairpin Jaeger et al., 1989; Santa
Lucia et al., 1996 hairpin entropy, .DELTA.S.sub.hairpin Jaeger et
al., 1989; Santa Lucia et al., 1996 hairpin free energy,
.DELTA.G.sub.hairpin .DELTA.G = .DELTA.H - T.DELTA.S (see text)
intramolecular partition function, Z 5 Z = k structures exp ( - G
intramolecular ( k ) / RT ) III sequence complexity Altschul et
al., 1994 sequence information content Altschul et al., 1994 IV
steric factors molecular modeling or experiment molecular dynamic
simulation Weber & Hefland, 1979 enthalpy, entropy & free
energy of measured experimentally activation association &
dissociation rates Patzel & Sczakiel, 1998 V oligonucleotide
chemosynthetic measured experimentally efficiencies VI target
synthetic efficiencies measured experimentally
[0145] In a next step of the present method, a subset of
oligonucleotides within the predetermined number of unique
oligonucleotides is identified based on the above evaluation of the
parameter. A number of mathematical approaches may be followed to
sort the oligonucleotides based on a parameter. In one approach a
cut-off value is established. The cut-off value is adjustable and
can be optimized relative to one or more training data sets. This
is done by first establishing some metric for how well a cutoff
value is performing; for example, one might use the normalized
signal observed for each oligonucleotide in the training set. Once
such a metric is established, the cutoff value can be numerically
optimized to maximize the value of that metric, using optimization
algorithms well known to the art. Alternatively, the cutoff value
can be estimated using graphical methods, by graphing the value of
the metric as a function of one or more parameters, and then
establishing cutoff values that bracket the region of the graph
where the chosen metric exceeds some chosen threshold value. In
essence, the cut off values are chosen so that the rule set used
yields training data that maximizes the inclusion of
oligonucleotides that exhibit good hybridization efficiency and
minimizes the inclusion of oligonucleotides that exhibit poor
hybridization efficiency.
[0146] A preferred approach to performing such a graph-based
optimization of filter parameters is shown in FIG. 3. In FIG. 3,
hybridization data from several different genes have been used to
prepare a contour plot of relative hybridization intensity as a
function of DNA/RNA heteroduplex melting temperature and free
energy of the most stable intramolecular structure of the probe.
Contours are shown only for regions for which there are data; the
white space outside of the outermost contour indicates that there
are no experimental data for that region. The details of how the
data were obtained can be found in Example 1 below. A summary of
the sequences and number of data points employed is shown in Table
2 below. The measured hybridization intensities for each data set
were normalized prior to construction of the contour plot depicted
in FIG. 3 by dividing each observed intensity by the maximum
intensity observed for that gene. In addition, differences in
hybridization salt concentrations and hybridization temperatures
were accounted for by using the salt concentration-corrected values
of the melting temperatures and by subtracting the hybridization
temperature from each predicted melting temperature, respectively.
The filter set determined by examination of FIG. 3 is indicated by
both the dotted open box in the figure and by the inequalities
above the box.
[0147] One way in which such a contour plot may be prepared
involves the use of an appropriate software application such as
Microsoft.RTM. Excel.RTM. or the like. For example, the
cross-tabulation tool may be used in the Microsoft.RTM. Excel.RTM.
program. Data is accumulated into rectangular bins that are 0.5
kcal .DELTA.G.sub.MFOLD wide and 2.5.degree. C. T.sub.m wide. In
each bin the average values of .DELTA.G.sub.MFOLD,
T.sub.m-T.sub.hyb, and the normalized hybridization intensity are
calculated. The data is output to the software application
DeltaGraph.RTM. (Deltapoint, Inc., Monterey, Calif.) and the
contour plot is prepared using the tools and instructions
provided.
7TABLE 2 Target (GenBank Target No. Data [Na.sup.+] Accession No.)
Strand Points T.sub.hyb Correction HIV protease-reverse Sense 1,022
35.degree. C. -1.4.degree. C. transcriptase (PRT).sup.a (M15654)
HIV protease-reverse antisense 1,041 30.degree. C. -1.4.degree. C.
transcriptase (PRT).sup.a (M15654) HIV protease-reverse Sense 88
35.degree. C. -1.4.degree. C. transcriptase (PRT).sup.b (M15654)
Human G3PDH antisense 93 35.degree. C. -1.4.degree. C.
(glyceraldehyde-3- dehydrogenase).sup.b (X01677) Human p53.sup.b
(X02469) antisense 93 35.degree. C. -1.4.degree. C. Rabbit
.beta.-globin.sup.c (K03256) antisense 106 30.degree. C. 0.degree.
C. .sup.aData from Affymetrix GeneChip .TM. Array .sup.bData from
biotinylated probes bound to streptavidin-coated microtiter wells
.sup.cLiterature data: see N. Milner, K.U. Mir & E.M. Southern
(1997) Nature Biotech. 15, 537-541.
[0148] Once the cut-off value is selected, a subset of
oligonucleotides having parameter values greater than or equal to
the cut-off value is identified. This refers to the inclusion of
oligonucleotides in a subset based on whether the value of a
predictive parameter satisfies an inequality.
[0149] Examples of identifying a subset of oligonucleotides by
establishing cut-off values for predictive parameters are as
follows: for melting temperature an inequality might be 60.degree.
C..ltoreq.T.sub.m; for predicted free energy an inequality,
preferably, might be 6 G MFOLD - 0.4 kcal mole .
[0150] In a variation of the above, both a maximum and a minimum
cut-off value may be selected. A subset of oligonucleotides is
identified whose values fall within the maximum and minimum values,
i.e., values greater than or equal to the minimum cut-off value and
less than or equal to the maximum cut-off value. An example of this
approach for melting temperature might be the inequality 60.degree.
C..ltoreq.T.sub.m.ltoreq.8- 5.degree. C.
[0151] With regard to cut off values for T.sub.m the lower limit is
most important, and is preferably T.sub.m=T.sub.hyb, more
preferably, T.sub.m=T.sub.hyb+15.degree. C. The upper cutoff is
important when the sequence region under consideration is unusually
rich in G and C, and is preferably T.sub.m=T.sub.hyb+40.degree. C.
With regard to .DELTA.G.sub.MFOLD the cutoff value is usually
greater than or equal to -1.0 kcal/mole. As mentioned above, the
cutoff values preferably are determined from real data through
experimental observations.
[0152] In another approach the parameter values may be converted
into dimensionless numbers. The parameter value is converted into a
dimensionless number by determining a dimensionless score for each
parameter resulting in a distribution of scores having a mean value
of zero and a standard deviation of one. The dimensionless score is
a number that is used to rank some object (such as an
oligonucleotide) to which that score relates. A score that has no
units (i.e., a pure number) is called a dimensionless score.
[0153] In one approach the following equations are used for
converting the values of said parameters into dimensionless
numbers: 7 s i , x = x i - x { x } ,
[0154] where s.sub.i,x is the dimensionless score derived from
parameter x calculated for oligonucleotide i, x.sub.i is the value
of parameter x calculated for oligonucleotide i, <x> is the
average of parameter x calculated for all of the oligonucleotides
under consideration for a given nucleotide sequence target, and
.sigma..sub.{x} is the standard deviation of parameter x calculated
for all of the oligonucleotides under consideration for a given
nucleotide sequence target, and is given by the equation 8 { x } =
j = 1 M ( x j - x ) 2 M - 1 ,
[0155] where M is the number of oligonucleotides. The resulting
distribution of scores, {s} has a mean value of zero and a standard
deviation of one. These properties can be important for a
combination of the scores discussed below.
[0156] The use of a dimensionless number approach may further
include calculating a combination score S.sub.i by evaluating a
weighted average of the individual values of the dimensionless
scores s.sub.i,x by the equation: 9 S i = { x } q x s i , x ,
[0157] where q.sub.x is the weight assigned to the score derived
from parameter x, the individual values of q.sub.x are always
greater than zero, and the sum of the weights q.sub.x is unity.
[0158] In another variation of the above approach, the method of
calculation of the composite parameter is optimized based on the
correlation of the individual composite scores to real data, as
explained more fully below.
[0159] In one approach the calculation of the composite score
further involves determining a moving window-averaged combination
score <S.sub.i> for the ith probe by the equation: 10 S i = 1
w j = i - w - 1 2 i + w - 1 2 S j , w = anoddinteger ,
[0160] where w is the length of the window for averaging (i.e., w
nucleotides long), and then applying a cutoff filter to the value
of <S.sub.i>. This procedure results in smoothing (smoothing
procedure) by turning each score into a consensus metric for a set
of w adjacent oligonucleotide probes. The score, referred to as the
"smoothed score," is essentially continuous rather than a few
discrete values. The value of the smoothed score is strongly
influenced by clustering of scores with high or low values; window
averaging therefore provides a measurement of cluster size.
[0161] An advantage of the dimensionless score approach to the
probe prediction algorithm is that it is easy to objectively
optimize. In one approach to training the algorithm, optimization
of the weights qx above may be performed by varying the values of
the weights so that the correlation coefficient
.rho..sub.{<Si>},{Vi} between the set of window-averaged
combination scores {<S.sub.i>} and a set of calibration
experimental measurements {V.sub.i} is maximized. The correlation
coefficient .rho..sub.{<Si>},{Vi} is calculated from the
equation 11 { < S i > } , { V i } = ( 1 M ) Covariance ( S ,
V ) { < S i > } { V i } ,
[0162] where M is the number of window averaged, combination
dimensionless scores and the number of corresponding measurements,
the covariance is as defined earlier (see earlier equations) and
.sigma..sub.{<Si>} and .sigma..sub.{Vi} are the standard
deviations of {<S.sub.i>} and {V.sub.i}, as defined
previously. An example of this approach is shown in Example 2,
below.
[0163] In another approach the parameter is derived from one or
more factors by mathematical transformation of the factors. This
involves the calculation of a new predictive parameter from one or
more existing predictive parameters, by means of an equation. For
instance, the equilibrium constant K.sub.open for formation of an
oligonucleotide with no intramolecular structure from its
structured form can be calculated from the intramolecular structure
free energy .DELTA.G.sub.MFOLD, using the equation: 12 K open = exp
( G MFOLD R T ) .
[0164] In a next step of the method oligonucleotides in the subset
are then identified that are clustered along a region of the
nucleotide sequence that is hybridizable to the target nucleotide
sequence. For example, consider a set of overlapping
oligonucleotides identified by dividing a nucleotide sequence into
subsequences. A subset of the oligonucleotides is obtained as
described above. In general, this subset is obtained by applying a
rule that rejects some members of the set. For the remaining
members of the set, namely, the subset, there will be some average
number of nucleotides in the nucleotide sequence between the first
nucleotides of adjacent remaining subsequences. If, for some
sub-region of the nucleotide sequence, the average number of
nucleotides in the nucleotide sequence between the first
nucleotides of adjacent remaining subsequences is less than the
average for the entire nucleotide sequence, then the
oligonucleotides are clustered. The smaller the average number of
nucleotides between the first nucleotides of adjacent
oligonucleotides, the stronger the clustering. The strongest
clustering occurs when there are no intervening nucleotides between
adjacent starting nucleotides. In this case, the oligonucleotides
are said to be contiguous and may be referred to as contiguous
sequence elements or "contigs."
[0165] Accordingly, in this step oligonucleotides are sorted based
on length of contiguous sequence elements. Oligonucleotides in the
subset determined above are identified that are contiguous along a
region of the input nucleic acid sequence. The length of each
contig that is equal to the number of oligonucleotides in each
contig, namely, oligonucleotides from the above step whose
complement begin at positions m+1, m+2., m+k in the target
sequence, form a contig of length k. Contigs can be identified and
contig length can be calculated using, for example, a Visual
Basic.RTM. module that can be incorporated into a Microsoft.RTM.
Excel workbook.
[0166] Cluster size can be defined in several ways:
[0167] For contiguous clusters, the size is simply the number of
adjacent oligonucleotides in the cluster. Again, this may also be
referred to as contiguous sequence elements. The number may also be
referred to as "contig length". For example, consider the
nucleotide sequence discussed above, namely, ATGGACTTAGCATTCG (SEQ
ID NO:3) and the identified set of overlapping oligonucleotides
8 ATGGACTTAGCA (SEQ ID NO:4) TGGACTTAGCAT (SEQ ID NO:5)
GGACTTAGCATT (SEQ ID NO:6) GACTTAGCATTC (SEQ ID NO:7) ACTTAGCATTCG
(SEQ ID NO:8)
[0168] Suppose that, after calculation and evaluation of the
predictive parameters, four nucleotides remain:
9 ATGGACTTAGCA (SEQ ID NO:4) TGGACTTAGCAT (SEQ ID NO:5) contig
GGACTTAGCATT (SEQ ID NO:6) ACTTAGCATTCG (SEQ ID NO:8) single
oligonucleotide
[0169] A "contig" encompassing three of the oligonucleotides of the
subset is present together with a single oligonucleotide. The
contig length is 3 oligonucleotides.
[0170] Alternatively, cluster size at some position in the sequence
hybridizable or complementary to the target sequence may be defined
as the number of oligonucleotides whose center nucleotides fall
inside a region of length M centered about the position in
question, divided by M. This definition of clustering allows small
gaps in clusters. In the example used above for contiguous
clusters, if M was 10, then the cluster size would step through the
values 0/10, . . . , 0/10, 1/10, 2/10, 3/10, 3/10, 4/10, 4/10,
4/10, 4/10, 4/10, 3/10, 2/10, 1/10, 1/10, 0/10 as the center of the
window of length 10 passed through the cluster. In each fraction,
the numerator is the number of oligonucleotide sequences that have
satisfied the filter set and whose central nucleotides are within a
window 10 nucleotides long, centered about the nucleotide under
consideration. The denominator (10) is simply the window
length.
[0171] Another alternative is to define the size of a cluster at
some position in the sequence hybridizable or complementary to the
target sequence as the number of oligonucleotide sequences
overlapping that position. This definition is equivalent to the
last definition with M set equal to the oligonucleotide probe
length and omission of the division by M.
[0172] Finally, cluster size can be approximated at each position
in a nucleotide sequence by dividing the sequence into
oligonucleotides, evaluating a numerical score for each
oligonucleotide, and then averaging the scores in the neighborhood
of each position by means of a moving window average as described
above. Window averaging has the effect of reinforcing clusters of
high or low values around a particular position, while canceling
varying values about that position. The window average, therefore,
provides a score that is sensitive to both the hybridization
potential of a given oligonucleotide and the hybridization
potentials of its neighbors.
[0173] In a next step of the present method, the oligonucleotides
in the subset are ranked. Generally, this ranking is based on the
lengths of the clusters or contigs, sizes of the clusters or values
of a window averaged score. Oligonucleotides found in the longest
contigs or largest clusters, or possessing the highest window
averaged scores usually show the highest hybridization
efficiencies. Often, the highest signal intensity within the
cluster corresponds to the median oligonucleotide of the cluster.
However, the peak signal intensity within the contig can be
determined experimentally, by sampling the cluster at its first
quartile, midpoint and third quartile, measuring the hybridization
efficiencies of the sampled oligonucleotides, interpolating or
extrapolating the results, predicting the position of the optimal
probe, and then iterating the probe design process.
[0174] FIG. 1 shows a diagram of an example of the above-described
method by way of illustration and not limitation. Referring to FIG.
1 a target sequence of length L from, e.g., a database, is used to
generate a sequence that is hybridizable to the target sequence
from which candidate oligonucleotide probe sequences are generated.
One or more parameters are calculated for each of the
oligonucleotide probe sequences. The candidate oligonucleotide
probe sequences are filtered based on the values of the parameters.
Clustering of the filtered candidate probe sequences is evaluated
and the clusters are ranked by size. Then, the oligonucleotide
probes are statistically sampled and synthesized. Further
evaluation may be made by evaluating the hybridization of the
selected oligonucleotide probes in real hybridization experiments.
The above process may be reiterated to further define the
selection. In this way only a small fraction of the potential
oligonucleotide probe candidates are synthesized and tested. This
is in sharp contrast to the known method of synthesizing and
testing all or a major portion of potential oligonucleotide probes
for a given target sequence.
[0175] The methods of the present invention are preferably carried
out at least in part with the aid of a computer. For example, an
IBM.RTM. compatible personal computer (PC) may be utilized. The
computer is driven by software specific to the methods described
herein.
[0176] The preferred computer hardware capable of assisting in the
operation of the methods in accordance with the present invention
involves a system with at least the following specifications:
Pentium.RTM. processor or better with a clock speed of at least 100
MHz, at least 32 megabytes of random access memory (RAM) and at
least 80 megabytes of virtual memory, running under either the
Windows 95 or Windows NT 4.0 operating system (or successor
thereof).
[0177] As mentioned above, software that may be used to carry out
the methods may be either Microsoft Excel or Microsoft Access,
suitably extended via user-written functions and templates, and
linked when necessary to stand-alone programs that calculate
specific parameters (e.g., MFOLD for intramolecular thermodynamic
parameters). Examples of software programs used in assisting in
conducting the present methods may be written, preferably, in
Visual BASIC, FORTRAN and C++, as exemplified below in the
Examples. It should be understood that the above computer
information and the software used herein are by way of example and
not limitation. The present methods may be adapted to other
computers and software. Other languages that may be used include,
for example, PASCAL, PERL or assembly language.
[0178] FIG. 2 depicts a more specific approach to a method in
accordance with the present invention. Referring to FIG. 2, a
sequence of length L is obtained from a database such as GenBank,
UniGene or a proprietary sequence database. Probe length N is
determined by the user based on the requirements for sensitivity
and specificity and the limitations of the oligonucleotide
synthetic scheme employed. The probe length and sequence length are
used to generate L-N+1 candidate oligonucleotide probes, i.e., from
every possible starting position. An initial selection is made
based on local sequence predicted thermodynamic properties. To this
end, melting temperature T.sub.m and the self-structure free energy
.DELTA.G.sub.MFOLD, are calculated for each of the potential
oligonucleotide probe: target nucleotide sequence complexes. Next,
M probes that satisfy T.sub.m and .DELTA.G.sub.MFOLD filters are
selected. A further selection can be made based on clustering of
"good" parameters. Good parameters are parameters that satisfy all
of the filters in the filter set. Clustering is defined by any of
the methods described previously; in FIG. 2, the "contig length"
definition of clustering is used.
[0179] For each of the M oligonucleotide sequences that satisfied
all filters the question is asked whether the oligonucleotide
sequence immediately following the sequence under consideration is
also one of the sequences that satisfied all of the filters. If the
answer to this question is NO, then one stores the current value of
the contig length counter, resets the counter to zero and proceeds
to the next oligonucleotide sequence that satisfied all filters. If
the answer to the question is YES, then 1 is added to the contig
length counter and, if the counter now equals 1 (i.e., this is the
first oligonucleotide probe sequence in the contig), the starting
position of the oligonucleotide is stored. One then moves to the
next oligonucleotide that satisfied all filters, which, in this
case, is the same as the next oligonucleotide before the
application of the filter set. The process is repeated until all M
filtered oligonucleotide sequences have been examined. In this way,
a single pass through the set of M filtered oligonucleotide
sequences generates the lengths and starting positions of all
contigs.
[0180] Next, contigs are ranked based on the lengths of their
contiguous sequence elements. Longer contig lengths generally
correlate with higher hybridization efficiencies. All
oligonucleotides of the higher-ranking contigs may be considered,
or candidate oligonucleotide probes may be picked. For example,
candidate oligonucleotide probes can be picked one quarter, one
half and three quarters of the way through each contig. The latter
approach provides local curvature determination after experimental
determination of hybridization efficiencies, which allows either
interpolation or extrapolation of the positions of the next probes
to be synthesized in order to close in on the optimal probe in the
region. If the contig brackets the actual peak of hybridization
efficiency, the process will converge in 2-3 iterations. If the
contig lies to one side of the actual peak, the process will
converge in 34 iterations.
[0181] The above illustrative approach is further described with
reference to the following DNA nucleotide sequence, which is the
complement of the target RNA nucleotide sequence:
10 GTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAA (SEQ ID NO:9)
CTCATGTTCAAGA.
[0182] In the first step of the method, the nucleotide sequence is
divided into overlapping oligonucleotides that are 25 nucleotides
in length. This length is chosen because it is an effective
compromise between the need for sensitivity (enhanced by longer
oligonucleotides) and the chemosynthetic efficiency of schemes for
synthesis of surface-bound arrays of oligonucleotide probes.
[0183] Next, the estimated duplex melting temperatures (T.sub.m)
and self-structure free energies (.DELTA.G.sub.MFOLD) are
calculated for each oligonucleotide in the set of overlapping
oligonucleotides. The values are obtained from a user-written
function that calculates DNA/RNA heteroduplex thermodynamic
parameters (see N. Sugimoto, et al., Biochemistry, 34:11211 (1995))
and a modified version of the program MFOLD that estimates the free
energy of the most stable intramolecular structure of a single
stranded DNA molecule (see J. A. Jaeger, et al., (1989), supra,
respectively. The steps are illustrated below.
11 GTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGA (target
complement sequence) T.sub.m (.degree. C.) .DELTA.G.sub.MFOLD
GTCCAAAAAGGGTCAGTCTACCTCC 71.77 -1.20 SEQ ID NO:10
TCCAAAAAGGGTCAGTCTACCTCCC 71.99 -1.20 SEQ ID NO:11
CCAAAAAGGGTCAGTCTACCTCCCG 70.78 -1.20 SEQ ID NO:12
CAAAAAGGGTCAGTCTACCTCCCGC 71.23 -1.20 SEQ ID NO:13
AAAAAGGGTCAGTCTACCTCCCGCC 73.07 -1.20 SEQ ID NO:14
AAAAGGGTCAGTCTACCTCCCGCCA 75.68 -1.20 SEQ ID NO:15
AAAGGGTCAGTCTACCTCCCGCCAT 77.53 -1.20 SEQ ID NO:16
AAGGGTCAGTCTACCTCCCGCCATA 79.03 -1.20 SEQ ID NO:17
AGGGTCAGTCTACCTCCCGCCATAA 79.03 -1.20 SEQ ID NO:18
GGGTCAGTCTACCTCCCGCCATAAA 76.85 -1.20 SEQ ID NO:19
GGTCAGTCTACCTCCCGCCATAAAA 73.10 -0.80 SEQ ID NO:20
GTCAGTCTACCTCCCGCCATAAAAA 69.50 0.90 SEQ ID NO:21
TCAGTCTACCTCCCGCCATAAAAAA 65.60 0.90 SEQ ID NO:22
CAGTCTACCTCCCGCCATAAAAAAC 64.96 0.90 SEQ ID NO:23
AGTCTACCTCCCGCCATAAAAAACT 65. 1.10 SEQ ID NO:24
GTCTACCTCCCGCCATAAAAAACTC 66.36 2.40 SEQ ID NO:25
TCTACCTCCCGCCATAAAAAACTCA 64.97 2.90 SEQ ID NO:26
CTACCTCCCGCCATAAAAAACTCAT 63.96 2.70 SEQ ID NO:27
TACCTCCCGCCATAAAAAACTCATG 62.58 1.10 SEQ ID NO:28
ACCTCCCGCCATAAAAAACTCATGT 65.10 0.40 SEQ ID NO:29
CCTCCCGCCATAAAAAACTCATGTT 64.96 0.10 SEQ ID NO:30
CTCCCGCCATAAAAAACTCATGTTC 63.37 -0.10 SEQ ID NO:31
TCCCGCCATAAAAAACTCATGTTCA 62.86 -0.10 SEQ ID NO:32
CCCGCCATAAAAAACTCATGTTCAA 60.47 -0.10 SEQ ID NO:33
CCGCCATAAAAAACTCATGTTCAAG 57.98 -0.10 SEQ ID NO:34
CGCCATAAAAAACTCATGTTCAAGA 56.20 -0.10 SEQ ID NO:35
[0184] Next, the oligonucleotide sequences are filtered on the
basis of T.sub.m. A high and low cut-off value may be selected, for
example, 60.degree. C..ltoreq.T.ltoreq.85.degree. C. Thus,
oligonucleotides having T.sub.m values falling within the above
range are retained. Those outside the range are discarded, which is
indicated below by lining out of those oligonucleotides and
parameter values.
12 1
[0185] Next, the oligonucleotide sequences remaining after the
above exercise are filtered on the basis of .DELTA.G.sub.MFOLD and
are retained if the value is greater than -0.4. Those
oligonucleotides with a .DELTA.G.sub.MFOLD less than -0.4 are
discarded, which is indicated below by double lining out of those
oligonucleotides and parameter values.
13 (target comple- ment sequence)
GTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGA T.sub.m
(.degree. C.) .DELTA.G.sub.MFOLD 71.77 71.99 70.78 71.23 73.07
75.68 77.53 79.03 79.03 76.85 73.10 GTCAGTCTACCTCCCGCCATAAAAA 69.50
0.90 TCAGTCTACCTCCCGCCATAAAAAA 65.60 0.90 CAGTCTACCTCCCGCCATAAAAAAC
64.96 0.90 AGTCTACCTCCCGCCATAAAAAACT 65.48 1.10
GTCTACCTCCCGCCATAAAAAACTC 66.36 2.40 TCTACCTCCCGCCATAAAAAACTCA
64.97 2.90 CTACCTCCCGCCATAAAAAACTCAT 63.96 2.70
TACCTCCCGCCATAAAAAACTCATG 62.58 1.10 ACCTCCCGCCATAAAAAACTCATGT
65.10 0.40 CCTCCCGCCATAAAAAACTCATGTT 64.96 0.10
CTCCCGCCATAAAAAACTCATGTTC 63.37 -0.10 TCCCGCCATAAAAAACTCATGTTCA
62.86 -0.10 CCCGCCATAAAAAACTCATGTTCAA 60.47 -0.10 -0.10 -0.10
[0186] Clusters of retained oligonucleotides are identified and
ranked based on cluster size. In this example, a contiguous cluster
of 13 retained oligonucleotides is identified by the vertical black
bar on the left. Any or all of the oligonucleotides in this cluster
may be evaluated experimentally.
14 (target comple- ment sequence)
GTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGA T.sub.m
(.degree. C.) .DELTA.G.sub.MFOLD 71.77 71.99 70.78 71.23 73.07
75.68 77.53 79.03 79.03 76.85 73.10 .vertline.
GTCAGTCTACCTCCCGCCATAAAAA 69.50 0.90 .vertline.
TCAGTCTACCTCCCGCCATAAAAAA 65.60 0.90 .vertline.
CAGTCTACCTCCCGCCATAAAAAAC 64.96 0.90 .vertline.
AGTCTACCTCCCGCCATAAAAAACT 65.48 1.10 .vertline.
GTCTACCTCCCGCCATAAAAAACTC 66.36 2.40 .vertline.
TCTACCTCCCGCCATAAAAAACTCA 64.97 2.90 .vertline.
CTACCTCCCGCCATAAAAAACTCAT 63.96 2.70 .vertline.
TACCTCCCGCCATAAAAAACTCATG 62.58 1.10 .vertline.
ACCTCCCGCCATAAAAAACTCATGT 65.10 0.40 .vertline.
CCTCCCGCCATAAAAAACTCATGTT 64.96 0.10 .vertline.
CTCCCGCCATAAAAAACTCATGTTC 63.37 -0.10 .vertline.
TCCCGCCATAAAAAACTCATGTTCA 62.86 -0.10 .vertline.
CCCGCCATAAAAAACTCATGTTCAA 60.47 -0.10 -0.10 -0.10
[0187] Alternatively, in one approach the oligonucleotides at the
first quartile, the median and the third quartile of the cluster
may be selected for experimental evaluation, indicated below by
bold print.
15 (target comple- ment sequence)
GTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGA T.sub.m
(.degree. C.) .DELTA.G.sub.MFOLD 71.77 71.99 70.78 71.23 73.07
75.68 77.53 79.03 79.03 76.85 73.10 .vertline.
GTCAGTCTACCTCCCGCCATAAAAA 69.50 0.90 .vertline.
TCAGTCTACCTCCCGCCATAAAAAA 65.60 0.90 .vertline.
CAGTCTACCTCCCGCCATAAAAAAC 64.96 0.90 .vertline.
AGTCTACCTCCCGCCATAAAAAACT 65.48 1.10 .vertline.
GTCTACCTCCCGCCATAAAAAACTC 66.36 2.40 .vertline.
TCTACCTCCCGCCATAAAAAACTCA 64.97 2.90 .vertline.
CTACCTCCCGCCATAAAAAACTCAT 63.96 2.70 .vertline.
TACCTCCCGCCATAAAAAACTCATG 62.58 1.10 .vertline.
ACCTCCCGCCATAAAAAACTCATGT 65.10 0.40 .vertline.
CCTCCCGCCATAAAAAACTCATGTT 64.96 0.10 .vertline.
CTCCCGCCATAAAAAACTCATGTTC 63.37 -0.10 .vertline.
TCCCGCCATAAAAAACTCATGTTCA 62.86 -0.10 .vertline.
CCCGCCATAAAAAACTCATGTTCAA 60.47 -0.10 -0.10 -0.10
[0188] In one aspect of the present method, at least two parameters
are determined wherein the parameters are poorly correlated with
respect to one another. The reason for requiring that the different
parameters chosen are poorly correlated with one another is that an
additional parameter that is strongly correlated to the original
parameter brings no additional information to the prediction
process. The correlation to the original parameter is a strong
indication that both parameters represent the same physical
property of the system. Another way of stating this is that
correlated parameters are linearly dependent on one another, while
poorly correlated parameters are linearly independent of one
another. In practice, the absolute value of the correlation
coefficient between any two parameters should be less than 0.5,
more preferably, less than 0.25, and, most preferably, as close to
zero as possible.
[0189] In one preferred approach instead of T.sub.m, for each
oligonucleotide/target nucleotide sequence duplex, the difference
between the predicted duplex melting temperature corrected for salt
concentration and the temperature of hybridization of each of the
oligonucleotides with the target nucleotide sequence is
determined.
[0190] In one aspect the present method comprises determining two
parameters at least one of the parameters being the association
free energy between a subsequence within each of the
oligonucleotides and its complementary sequence on the target
nucleotide sequence, or some similar, strongly correlated
parameter. The object of this approach is to identify a
particularly stable subsequence of the oligonucleotide that might
be capable of acting as a nucleation site for the beginning of the
heteroduplex formation between the oligonucleotide and the target
nucleotide sequence. Such nucleation is believed to be the
rate-limiting step for process of heteroduplex formation.
[0191] The subsequence within the oligonucleotide is from about 3
to 9 nucleotides in length, usually, 5 to 7 nucleotides in length.
The subsequence is at least three nucleotides from the terminus of
the oligonucleotide. For support-bound oligonucleotides the
subsequence is at least three nucleotides from the free end of the
oligonucleotide, i.e., the end that is not attached to the support.
Generally, this free end is the 5' end of the oligonucleotide. When
the oligonucleotide is attached to a support, the subsequence is at
least three nucleotides from the end of the oligonucleotide that is
bound to the surface of the support to which the oligonucleotide is
attached. Generally, the 3' end of the oligonucleotide is bound to
the support.
[0192] The predictive parameter can be, for example, either melting
temperature or duplex free energy of the subsequence with the
target nucleotide sequence. The subsequence with the maximum
(melting temperature) or minimum (free energy) value of one of the
above parameters is chosen as the representative subsequence for
that oligonucleotide probe. For example, if the oligonucleotide is
20 nucleotides in length and a subsequence of 5 nucleotides is
chosen, i.e., a 5-mer, then parameter values are calculated for all
5-mer subsequences of the oligonucleotide that do not include the 2
nucleotides at the free end of the oligonucleotide. Where 5' is the
free end of the oligonucleotide with designated nucleotide number
1, the values are calculated for all 5-mer subsequences with
starting nucleotides from position number 3 to position number 16.
Thus, in this example, parameter values for 14 different
subsequences are calculated. The subsequence with the maximum value
for the parameter is then assigned as the stability subsequence for
the oligonucleotide.
[0193] The inclusion of the above determination of a stability
subsequence results in the following algorithm for determining the
potential of an oligonucleotide to hybridize to a target nucleotide
sequence. A predetermined number of unique oligonucleotides are
identified within a nucleotide sequence that is hybridizable with
said target nucleotide sequence. The oligonucleotides are chosen to
sample the entire length of the nucleotide sequence. For each of
the oligonucleotides, parameters that are independently predictive
of the ability of each of said oligonucleotides to hybridize to
said target nucleotide sequence are determined and evaluated. Two
parameters that may be used are the thermodynamic parameters of
T.sub.m and .DELTA.G.sub.MFOLD. These parameters give rise to
associated parameter filters. In one approach evaluation of the
parameters involves establishing cut-off values as described above.
Application of these cut-off values results in the identification
of a subset of oligonucleotides for further scrutiny under the
algorithm. In accordance with this embodiment of the present
invention, there is included a stability subsequence limit in
addition to the above. Cutoff values are determined either by means
of objective optimization algorithms well known to the art or via
graphical estimation methods; both approaches have been described
previously in this document. In either case, the optimization of
cutoff values involves comparison of predictions to known
hybridization efficiency data sets. This process results in
objective optimization as it looks at prediction versus
experimental results and is otherwise referred to herein as
"training the algorithm." The experimental data used to train the
algorithm is referred to herein as "training data."
[0194] In the present approach filters are assigned to the T.sub.m
oligonucleotide probe data. The T.sub.m of each oligonucleotide
probe needs to be greater than or equal to the assigned filter
(T.sub.m probe limit) to be given a filter score of "1"; otherwise,
the filter score is "0". In addition, one can also impose a second
filter for this parameter; that is, that the T.sub.m of the
oligonucleotide probe also has to be less than a defined upper
limit. Filters are also assigned to the .DELTA.G.sub.MFOLD data.
The .DELTA.G.sub.MFOLD of each oligonucleotide probe should be
greater than or equal to the assigned filter (.DELTA.G.sub.MFOLD
limit) to be given a filter score of "1"; otherwise, the filter
score is "0". The filter scores are added. Furthermore, one can
also impose a second filter for this parameter; that is, that the
.DELTA.G.sub.MFOLD also has to be less than a defined upper limit.
In accordance with the above discussion stability subsequences are
identified. This leads to another filter. Accordingly, filters are
assigned to the stability sequence data. The stability subsequence
of each oligonucleotide probe needs to be greater than or equal to
the assigned filter limit to be given a filter score of "1";
otherwise, the filter score is "0". In addition, one can also
impose a second filter for this parameter; that is, that the
stability subsequence also has to be less than a defined upper
limit. In all cases, the filter values are determined by objective
optimization (algorithmic or graphical) of the predictions of the
present method versus training data, as described previously.
[0195] On the basis of the above filter sets a subset of
oligonucleotides within said predetermined number of unique
oligonucleotides is identified. Oligonucleotides in the subset are
identified that are clustered along a region of the nucleotide
sequence that is hybridizable to the target nucleotide sequence.
The resulting number of oligonucleotide probe regions is examined.
The above filters may then be loosened or tightened by changing the
filter limits to obtain more or fewer clusters of oligonucleotides
to match the goal, which is set by the needs of the investigator.
For instance, a particular application might require that the
investigator design 5 non-overlapping probes that efficiently
hybridize to a given target sequence.
[0196] As mentioned above, the contigs may be selected on the basis
of contig length. In another approach, the scores defined above may
be summed for cluster size determination. To this end the probe
score of the particular filter set (e.g., T.sub.m probe limit,
.DELTA.G.sub.MFOLD limit and stability sequence limit) is
calculated for each oligonucleotide probe. The probe score is the
sum of the filter scores. Thus, the probe score is 0 if no
parameters pass their respective filters. The probe score is 1, 2
or 3 if one, two or three parameters, respectively, pass their
filters for that oligonucleotide probe. This summing is continued
for each parameter that is in the current filter set of the
algorithm-used. For a given algorithm a minimum probe score limit
is set. In the current example this limit will be at least 1 and
could be 2 or 3 depending on the needs of the investigator, the
number of probe clusters required and the results of objective
optimizations of algorithm performance against training data. The
probe score is compared to this probe score limit. If the probe
score of oligonucleotide probe i is greater than or equal to the
probe score limit, then oligonucleotide probe i is assigned a score
passed value of 1. Next, a window is chosen for the evaluation of
clustering (the "cluster window"). This will be the next filter
applied. The cluster window ("w") smoothes the score passed values
by summing the values in a window w nucleotides long, centered
about position i. The resulting sum is called the cluster sum.
Usually, the cluster window is an odd integer, usually 7 or 9
nucleotides. The cluster sum values are then filtered, by comparing
to a user-set threshold, cluster filter. If cluster sum is greater
than or equal to cluster filter, this filter is passed, and the
probe is predicted to hybridize efficiently to its target.
[0197] This window summing procedure converts the score for the
passed value for each oligonucleotide into a consensus metric for a
set of w adjacent probes. A "consensus metric" is a measurement
that distills a number of values into one consensus value. In this
case, the consensus value is calculated by simply summing the
individual values. The window summing procedure therefore evaluates
a property similar to the contig length metric discussed above.
However, the summed score has the advantage of allowing for a few
probes within a cluster to have not passed their individual probe
score limits. We have found that this allows more observed
hybridization peaks to be predicted.
[0198] It may be desired in some circumstances to combine the
results of multiple algorithm versions. We refer to this operation
as "tiling". This may be explained more fully as follows. Tiling
generally involves joining together the predicted oligonucleotide
probe sets identified by multiple algorithm versions. In the
context of the present invention, tiling multiple algorithm
versions involves forming the union of multiple sets of
predictions. These predictions may arise from different embodiments
of the present invention. Alternatively, the different sets of
predictions may arise from the same embodiment, but different
filter sets. The different filter sets may additionally be
restricted to different combinations of parameter values. For
instance, one filter set might be used when the predicted duplex
melting temperature T.sub.m is greater than or equal to some value,
while another might be used when T.sub.m is below that value.
[0199] An example of the logical endpoint of tiling multiple filter
sets across different regions of the possible combinations of
predictive parameters and then forming the union of the resulting
predictions is the contour plot shown in FIG. 3, with the
associated rule that "the value of the normalized hybridization
intensity associated with a particular combination of
(T.sub.m-T.sub.hyb) and .DELTA.G.sub.MFOLD must be greater than or
equal to some threshold value." In this case, the contour at the
threshold value becomes the filter. This contour and its interior
can be thought of as the union of many small rectangular regions
("tiles"), each of which is bracketed by low and high cutoff values
for each of the parameters.
[0200] The predictions of different algorithm versions can also be
combined by forming the intersection of two or more different
predictions. The reliability of predictions within such
intersection sets is enhanced because such sets are, by definition,
insensitive to changes in the details of the predictive algorithm.
Intersection is a useful method for reducing the number of
predicted probes when a single algorithm version produces too many
candidate probes for efficient experimental evaluation.
[0201] The most specific oligonucleotide probe set (i.e., the set
least likely to include poor probes) will be the intersection set
from multiple algorithms. Clusters that have overlapping
oligonucleotide probes from multiple algorithms constitute the
intersection set of oligonucleotide probes. The oligonucleotide
probe that is in the center of an intersection cluster is chosen.
This central oligonucleotide probe may have the highest probability
of predicting a peak or, in other words, of binding well to the
target nucleotide sequence. Oligonucleotide probes on either side
of center, which are still within the intersection cluster, may
also be selected. The distance of these "side" oligonucleotide
probes from the center generally will be shorter or longer
depending upon the length of the cluster.
[0202] The most sensitive set of oligonucleotide probes (i.e., the
set most likely to include at least one good probe) is generally
the union set from multiple algorithms. Clusters that are predicted
by at least one type of algorithm constitute the union set of
oligonucleotide probes. The oligonucleotide probe in the center of
a union cluster is chosen. Oligonucleotide probes on either side of
center, which are still within the union cluster, usually are also
chosen. The distance of these side probes from the center will be
shorter or longer depending upon the length of the cluster. In
summary, the combination of using the stability subsequence
parameter, tiling multiple filter sets, and making union and
intersection cluster sets of oligonucleotide probes exhibits very
high sensitivity and specificity in predicting oligonucleotide
probes that effectively hybridize to a target nucleotide sequence
of interest.
[0203] Another aspect of the present invention is a computer based
method for predicting the potential of an oligonucleotide to
hybridize to a target nucleotide sequence. A predetermined number
of unique oligonucleotides within a nucleotide sequence that is
hybridizable with the target nucleotide sequence is identified
under computer control. The oligonucleotides are chosen to sample
the entire length of the nucleotide sequence. A value is determined
and evaluated under computer control for each of the
oligonucleotides for at least one parameter that is independently
predictive of the ability of each of the oligonucleotides to
hybridize to the target nucleotide sequence. The parameter values
are stored. Based on the examination of the stored parameter
values, a subset of oligonucleotides within the predetermined
number of unique oligonucleotides is identified under computer
control. Then, oligonucleotides in the subset that are clustered
along a region of the nucleotide sequence that is hybridizable to
the target nucleotide sequence are identified under computer
control.
[0204] A computer program is utilized to carry out the above method
steps. The computer program provides for input of a
target-hybridizable or target-complementary nucleotide sequence,
efficient algorithms for computation of oligonucleotide sequences
and their associated predictive parameters, efficient, versatile
mechanisms for filtering sets of oligonucleotide sequences based on
parameter values, mechanisms for computation of the size of
clusters of oligonucleotide sequences that pass multiple filters,
and mechanisms for outputting the final predictions of the method
of the present invention in a versatile, machine-readable or
human-readable form.
[0205] Another aspect of the present invention is a computer system
for conducting a method for predicting the potential of an
oligonucleotide to hybridize to a target nucleotide sequence. An
input means for introducing a target nucleotide sequence into the
computer system is provided. The input means may permit manual
input of the target nucleotide sequence. The input means may also
be a database or a standard format file such as GenBank. Also
included in the system is means for determining a number of unique
oligonucleotide sequences that are within a nucleotide sequence
that is hybridizable with the target nucleotide sequence. The
oligonucleotide sequences is chosen to sample the entire length of
the nucleotide sequence. Suitable means is a computer program or
software, which also provides memory means for storing the
oligonucleotide sequences. The system also includes means for
controlling the computer system to carry out a determination and
evaluation for each of the oligonucleotide sequences a value for at
least one parameter that is independently predictive of the ability
of each of the oligonucleotide sequences to hybridize to the target
nucleotide sequence. Suitable means is a computer program or
software such as, for example, Microsoft.RTM. Excel spreadsheet,
Microsoft.RTM. Access relational database or the like, which also
provides memory means for storing the parameter values. The system
further comprises means for controlling the computer to carry out
an identification of a subset of oligonucleotide sequences within
the number of unique oligonucleotide sequences based on the
automated examination of the stored parameter values. Suitable
means is a computer program or software, which also allocates
memory means for storing the subset of oligonucleotides. The system
also includes means for controlling the computer to carry out an
identification of oligonucleotide sequences in the subset that are
clustered along a region of the nucleotide sequence that is
hybridizable to the target nucleotide sequence. Suitable means is a
computer program or software, which also allocates memory means for
storing the oligonucleotide sequences in the subset. The computer
system also includes means for outputting data relating to the
oligonucleotide sequences in the subset. Such means may be machine
readable or human readable and may be software that communicates
with a printer, electronic mail, another computer program, and the
like. One particularly attractive feature of the present invention
is that the outputting means may communicate directly with software
that is part of an oligonucleotide synthesizer. In this way the
results of the method of the present invention may be used directly
to provide instruction for the synthesis of the desired
oligonucleotides.
[0206] Another advantage of the present invention is that it may be
used to predict efficient hybridization oligonucleotides for each
of multiple target sequences. Thus, very large arrays may be
constructed and tested with minimal synthesis of
oligonucleotides.
EXAMPLES
[0207] The invention is demonstrated further by the following
illustrative examples. Parts and percentages are by weight unless
otherwise indicated. Temperatures are in degrees Centigrade
(.degree. C.) unless otherwise specified. The following
preparations and examples illustrate the invention but are not
intended to limit its scope. All reagents used herein were from
Amresco, Inc., Solon, Ohio (buffers), Pharmacia Biotech,
Piscataway, N.J. (nucleoside triphosphates) or Promega, Madison,
Wis. (RNA polymerases) unless indicated otherwise.
Example 1
[0208] Synopsis: Data from labeled RNA target hybridizations to
surface-bound DNA probes directed against 4 different gene
sequences were compared to the predictions of the preferred version
of the prediction algorithm illustrated by the flow chart in FIG.
2. The RNA targets were sequences derived from the human
immunodeficiency virus protease-reverse transcriptase region (HIV
PRT; sense-strand target polynucleotide), human
glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH;
antisense-strand target polynucleotide), human tumor suppressor p53
gene (p53; antisense-strand target polynucleotide) and rabbit
.beta.-globin gene (.beta.-globin; antisense-strand target
polynucleotide). The GenBank accession numbers for the gene
sequences, number of data points collected and temperature of
hybridization have all been previously listed in Table 2.
[0209] Materials and Methods: Three different experimental systems
and two different labeling schemes were used to collect data.
[0210] The sequence and hybridization data for .beta.-globin were
taken from the literature (see Milner et al., (1997), supra; in
this experiment, .sup.32P-radiolabeled RNA target was used.
[0211] The hybridization data for HIV PRT were obtained using an
Affymetrix GeneChip.TM. HIV PRT-sense probe array (i.e. sense
strand target polynucleotide) (GeneChip.TM. HIV PRT 440s,
Affymetrix Corporation, Santa Clara, Calif.) as specified by the
manufacturer, except that the fluorescein-labeled RNA target was
not fragmented prior to hybridization and that hybridization was
performed for 24 hours. The concentration of fluorescein-labeled
RNA used was 26.3 nM; label density was approximately 18
fluoresceinated uridyl nucleotides per 1 kilobase (kb) RNA
transcript. The raw data were collected by scanning the array with
a GeneChip.TM. Scanner 50 (Affymetrix Corporation, Santa Clara,
Calif.), as specified by the manufacturer. The raw data were
reduced to a feature-averaged (".CEL") file, using the GeneChip.TM.
software supplied with the scanner. Finally, a table of
hybridization intensities for perfect-complement 20-mer probes was
constructed using the ASCII feature map file supplied with the
GeneChip.TM. software to connect probe sequences to measured
hybridization intensities. The resulting data set contained data
for every overlapping 20-mer probe to the target sequence.
[0212] The data for G3PDH and p53 were measured using 93-feature
arrays constructed using commercially available streptavidin-coated
microtiter plates (Pierce Chemical Company, Rockford, Ill.). Every
tenth possible 25-mer probe complementary to each target was
synthesized and 3'-biotinylated by a contract synthesis vendor
(Operon, Inc., Alameda, Calif.). The 3'-linked biotin was used to
anchor individual probes to microtiter wells, via the well known,
strong affinity of streptavidin for biotin. Biotinylated DNA probes
were resuspended to a concentration of 10 .mu.M in hybridization
buffer (5.times. sodium chloride-sodium phosphate-disodium
ethylenediaminetetraacetate (SSPE), 0.05% Triton X-100,
filter-sterilized; 1.times.SSPE is 150 mM sodium chloride, 10 mM
sodium phosphate, 1 mM disodium ethylenediaminetetraacetate (EDTA),
pH 7.4). Individual probes were diluted 1:10 in hybridization
buffer into specified wells (100 .mu.l total volume per well) of a
streptavidin-coated microtiter plate; probes were allowed to bind
to the covered plates overnight at 35.degree. C. The other 3 wells
of the 96-well microtiter plate were probe-less controls. The
coated plates were washed with 3.times.200 p, of wash buffer
(6.times.SSPE, 0.005% Triton X-100, filter-sterilized).
Fluorescein-labeled RNA (100 .mu.l of a 10 nM solution in
hybridization buffer) was added to each well. The plates were
covered and hybridized at 35.degree. C. for 20-24 hours. The
hybridized plates were washed with 3.times.200 .mu.l of wash
buffer. Label was then released in each well by adding 100 .mu.l of
20 .mu.g/ml RNAase I (Sigma Chemical Company, St. Louis, Mo.) in
Tris-EDTA (TE) (10 mM Tris(hydroxymethyl)aminomethane (Tris), 1 mM
EDTA, pH 8.0, sterile) and incubating at 35.degree. C. for at least
30 minutes. The fluorescence released from the surface of each well
was quantitated with a PerSeptive Biosystems Cytofluor II
microtiter plate fluorimeter (PerSeptive Biosystems, Inc.,
Framingham, Mass.) using the manufacturer's recommended excitation
and emission filter sets for fluorescein. Each plate hybridization
was performed in quadruplicate, and the data for each probe were
averaged to obtain the hybridization intensity.
[0213] Labeled RNA targets specific for G3PDH and p53 were produced
via T7 RNA polymerase transcription of DNA templates in the
presence of fluorescein-UTP (Boehringer Mannheim Corporation,
Indianapolis, Ind.), using the same method as that outlined by
Affymetrix for their GeneChip.TM. HIV PRT sense probe array. The
DNA template for G3PDH was purchased from a commercial source
(Clontech, Inc., Palo Alto, Calif.). The DNA template for p53 was
obtained by sub-cloning a PCR fragment from an ATCC-derived
reference clone (No. 57254) of human p53 into the
commercially-available PCR cloning vector pCR2.1-TOPO (Invitrogen,
Inc., Carlsbad, Calif.), then linearizing the plasmid at the end of
the polycloning site opposite the vector-derived T7 promoter.
[0214] Probe predictions were performed using a software
application (referred to as "p5") that was built atop Microsoft's
Access relational database application, using added Visual Basic
modules, the TrueDB Grid Pro 5.0 (Apex Software Corporation,
Pittsburgh, Pa.) enhancement to Visual Basic, and a version of the
FORTRAN application MFOLD, modified to run in a Windows NT 4.0
environment, as an ActiveX control. The Visual Basic source code
for the p5 software application is found in the Microfiche appendix
to this specification. The DNA target sequence complements that
were input into p5 for division into potential oligonucleotide
probe sequences are listed below:
[0215] Parent Sequence Accession No.: K03256
[0216] Locus: BUNGLOB.DNA (portion of rabbit .beta.-globin)
[0217] Length: 122
16 1 TTCTTCCACA TTCACCTTGC CCCACAGGGC SEQ ID NO: 36 AGTGACCGCA
GACTTCTCCT CACTGGACAG 61 ATGCACCATT CTGTCTGTTT TGGGGGATTG
CAAGTAAACA CAGTTGTGTC AAAAGCAAGT 121 GT
[0218] Parent Sequence Accession No.: M15654
[0219] Locus: HIV_PRTA.S (HIV PRT antisense; parses into probes
specific for sense-strand target)
[0220] Length: 1040
17 1 TGTACTGTCC ATTTATCAGG ATGGAGTTCA SEQ ID NO: 37 TAACCCATCC
AAAGGAATGG AGGTTCTTTC 61 TGATGTTTTT TGTCTGGTGT GGTAAGTCCC
CACCTCAACA GATGTTGTCT CAGCTCCTCT 121 ATTTTTGTTC TATGCTGCCC
TATTTCTAAG TCAGATCCTA CATACAAATC ATCCATGTAT 181 TGATAGATAA
CTATGTCTGG ATTTTGTTTT TTAAAAGGCT CTAAGATTTT TGTCATGCTA 241
CTTTGGAATA TTGCTGGTGA TCCTTTCCAT CCCTGTGGAA GCACATTGTA CTGATATCTA
301 ATCCCTGGTG TCTCATTGTT TATACTAGGT ATGGTAAATG CAGTATACTT
CCTGAAGTCT 361 TCATCTAAGG GAACTGAAAA ATATGCATCA CCCACATCCA
GTACTGTTAC TGATTTTTTC 421 TTTTTTAACC CTGCGGGATG TGGTATTCCT
AATTGAACTT CCCAGAAGTC TTGAGTTCTC 481 TTATTAAGTT CTCTGAAATC
TACTAATTTT CTCCATTTAG TACTGTCTTT TTTCTTTATG 541 GCAAATACTG
GAGTATTGTA TGGATTCTCA GGCCCAATTT TTGAAATTTT CCCTTCCTTT 601
TCCATTTCTG TACAAATTTC TACTAATGCT TTTATTTTTT CTTCTGTCAA TGGCCATTGT
661 TTAACTTTTG GGCCATCCAT TCCTGGCTTT AATTTTACTG GTACAGTCTC
AATAGGGCTA 721 ATGGGAAAAT TTAAAGTGCA ACCAATCTGA GTCAACAGAT
TTCTTCCAAT TATGTTGACA 781 GGTGTAGGTC CTACTAATAC TGTACCTATA
GCTTTATGTC CACAGATTTC TATGAGTATC 841 TGATCATACT GTCTTACTTT
GATAAAACCT CCAATTCCCC CTATCATTTT TGGTTTCCAT 901 CTTCCTGGCA
AACTCATTTC TTCTAATACT GTATCATCTG CTCCTGTATC TAATAGAGCT 961
TCCTTTAGTT GCCCCCCTAT CTTTATTGTG ACGAGGGGTC GTTGCCAAAG AGTGATCTGA
1021 GGGAAGTTAA AGGATACAGT
[0221] Parent Sequence Accession No.: X01677
[0222] Locus: G3PDH (Clontech G3PDH template--parses into probes
specific for antisense-strand target)
[0223] Length: 999
18 1 GAAGGTCGGA GTCAACGGAT TTGGTCGTAT SEQ ID NO: 38 TGGGCGCCTG
GTCACCAGGG CTGCTTTTAA 61 CTCTGGTAAA GTGGATATTG TTGCCATCAA
TGACCCCTTC ATTGACCTCA ACTACATGGT 121 TTACATGTTC CAATATGATT
CCACCCATGG CAAATTCCAT GGCACCGTCA AGGCTGAGAA 181 CGGGAAGCTT
GTCATCAATG GAAATCCCAT CACCATCTTC CAGGAGCGAG ATCCCTCCAA 241
AATCAAGTGG GGCGATGCTG GCGCTGAGTA CGTCGTGGAG TCCACTGGCG TCTTCACCAC
301 CATGGAGAAG GCTGGGGCTC ATTTGCAGGG GGGAGCCAAA AGGGTCATCA
TCTCTGCCCC 361 CTCTGCTGAT GCCCCCATGT TCGTCATGGG TGTGAACCAT
GAGAAGTATG ACAACAGCCT 421 CAAGATCATC AGCAATGCCT CCTGCACCAC
CAACTGCTTA GCACCCCTGG CCAAGGTCAT 481 CCATGACAAC TTTGGTATCG
TGGAAGGACT CATGACCACA GTCCATGCCA TCACTGCCAC 541 GCAGAAGACT
GTGGATGGCC CCTCCGGGAA ACTGTGGCGT GATGGCCGCG GGGCTCTCCA 601
GAACATCATC CCTGCCTCTA CTGGCGCTGC CAAGGCTGTG GGCAAGGTCA TCCCTGAGCT
661 AGACGGGAAG CTCACTGGCA TGGCCTTCCG TGTCCCCACT GCCAACGTGT
CAGTGGTGGA 721 CCTGACCTGC CGTCTAGAAA AACCTGCCAA ATATGATGAC
ATCAAGAAGG TGGTGAAGCA 781 GGCGTCGGAG GGGCCCCTCA AAGGCATCCT
GGGCTACACT GAGCACCAGG TGGTCTCCTC 841 TGACTTCAAC AGCGACACCC
ACTCCTCCAC CTTTGACGCT GGGGCTGGCA TTGCCCTCAA 901 CGACCACTTT
GTCAAGCTCA TTTCCTGGTA TGACAACGAA TTTGGCTACA GCAACAGGGT 961
GGTGGACCTC ATGGCCCACA TGCTATAGTG AGTCGTATT
[0224] Parent Sequence Accession No.: X54156
[0225] Locus: HSP53PCRa (p53 template--parses into probes specific
for antisense-strand target)
[0226] Length: 1049
19 1 GAGGTGCGTG TTTGTGCCTG TCCTGGGAGA SEQ ID NO: 39 GACCGGCGCA
CAGAGGAAGA GAATCTCCGC 61 AAGAAAGGGG AGCCTCACCA CGAGCTGCCC
CCAGGGAGCA CTAAGCGAGC ACTGCCCAAC 121 AACACCAGCT CCTCTCCCCA
GCCAAAGAAG AAACCACTGG ATGGAGAATA TTTCACCCTT 181 CAGATCCGTG
GGCGTGAGCG CTTCGAGATG TTCCGAGAGC TGAATGAGGC CTTGGAACTC 241
AAGGATGCCC AGGCTGGGAA GGAGCCAGGG GGGAGCAGGG CTCACTCCAG CCACCTGAAG
301 TCCAAAAAGG GTCAGTCTAC CTCCCGCCAT AAAAAACTCA TGTTCAAGAC
AGAAGGGCCT 361 GACTCAGACT GACATTCTCC ACTTCTTGTT CCCCACTGAC
AGCCTCCCTC CCCCATCTCT 421 CCCTCCCCTG CGATTTTGGG TTTTGGGTCT
TTGAACCCTT GCTTGCAATA GGTGTGCGTC 481 AGAAGCACCC AGGACTTCCA
TTTGCTTTGT CCCGGGGCTC CACTGAACAA GTTGGCCTGC 541 ACTGGTGTTT
TGTTGTGGGG AGGAGGATGG GGAGTAGGAC ATACCAGCTT AGATTTTAAG 601
GTTTTTACTG TGAGGGATGT TTGGGAGATG TAAGAAATGT TCTTGCAGTT AAGGGTTAGT
661 TTACAATCAG CCACATTCTA GGTAGGTAGG GGCCCACTTC ACCGTACTAA
CCAGGGAAGC 721 TGTCCCTCAT GTTGAATTTT CTCTAACTTC AAGGCCCATA
TCTGTGAAAT GCTGGCATTT 781 GCACCTACCT CACAGAGTGC ATTGTGAGGG
TTAATGAAAT AATGTACATC TGGCCTTGAA 841 ACCACCTTTT ATTACATGGG
GTCTAAAACT TGACCCCCTT GAGGGTGCCT GTTCCCTCTC 901 CCTCTCCCTG
TTGGCTGGTG GGTTGGTAGT TTCTACAGTT GGGCAGCTGG TTAGGTAGAG 961
GGAGTTGTCA AGTCTTGCTG GCCCAGCCAA ACCCTGTCTG ACAACCTCTT GGTCGACCTT
1021 AGTACCTAAA AGGAAATCTC ACCCCATCC
[0227] The sequences indicated above, which are complements of the
target sequences, were divided into overlapping oligonucleotide
sequences with one nucleotide between starting positions. The
oligonucleotide sequence lengths were 17 (rabbit .beta.-globin), 20
(HIV PRT) or 25 (G3PDH; p53). The oligonucleotide sequence lengths
were dictated by the probe lengths used in the experiments to which
the predictions were compared. The RNA target concentrations used
to calculate predicted RNA/DNA duplex melting temperatures were 100
pM (rabbit .beta.-globin), 26.3 nM (HIV PRT) and 10 nM (G3PDH;
p53). These were also dictated by experimental conditions for the
comparison data. The cut-off filter used for the predicted free
energy of the most stable probe sequence intramolecular structure,
.DELTA.G.sub.MFOLD, was 13 G MFOLD - 0.4 kcal mole .
[0228] The filter condition used for the predicted RNA/DNA duplex
melting temperature was
25.degree. C..ltoreq.T.sub.m+16.6
log([Na.sup.+])-T.sub.hyb.ltoreq.50.degr- ee. C.,
[0229] where T.sub.m is the target concentration-dependent value of
the predicted RNA/DNA duplex melting temperature before correction
for salt concentration, the term "16.6 log([Na.sup.+])" corrects
the melting temperature for salt effects, and T.sub.hyb is the
hybridization temperature. The values of the salt correction term
and T.sub.hyb have already been listed in Table 2. For convenient
use within p5, the above condition was algebraically rearranged
into the equivalent form
25.degree. C.-16.6
log([Na.sup.+])+T.sub.hyb.ltoreq.T.sub.m.ltoreq.50.degr- ee.
C.-16.6 log([Na.sup.+])+T.sub.hyb.
[0230] Clusters were ranked according to the number of contiguous
oligonucleotide sequences that passed through the filter set
("contig" length).
[0231] Results: The detailed analysis results for rabbit
.beta.-globin are presented in Table 3; a graphical summary of the
results is shown in FIG. 4. In Table 3, values of T.sub.m and
.DELTA.G.sub.MFOLD that were excluded by the filter set are shown
with a line through them, and table entries for contig length are
shown in gray when the oligonucleotide sequence in question was not
in a contig. The top 20% of the observed hybridization intensities
are shown underlined.
20TABLE 3 Oligonucleotide SEQ ID .DELTA.G.sub.MFOLD Contig
Hybridization Intensity Position Sequence NO: T.sub.m(.degree. C.)
(kcal/mole) Length (Milner et al., 1997) 1 TTCTTCCACATTCACCT 40
5.00 100 2 TCTTCCACATTCACCTT 41 5.00 130 3 CTTCCACATTCACCTTG 42
0.90 130 4 TTCCACATTCACCTTGC 43 0.50 200 5 TCCACATTCACCTTGCC 44
58.46 0.50 7 120 6 CCACATTCACCTTGCCC 45 61.10 0.50 7 180 7
CACATTCACCTTGCCCC 46 61.10 0.50 7 230 8 ACATTCACCTTGCCCCA 47 61.10
0.50 7 220 9 CATTCACCTTGCCCCAC 48 61.10 0.90 7 320 10
ATTCACCTTGCCCCACA 49 61.10 0.70 7 310 11 TTCACCTTGCCCCACAG 50 61.33
0.50 7 320 12 TCACCTTGCCCCACAGG 51 63.70 390 13 CACCTTGCCCCACAGGG
52 64.85 410 14 ACCTTGCCCCACAGGGC 53 68.01 240 15 CCTTGCCCCACAGGGCA
54 68.63 50 16 CTTGCCCCACAGGGCAG 55 64.95 20 17 TTGCCCCACAGGGCAGT
56 66.31 20 18 TGCCCCACAGGGCAGTG 57 65.79 20 19 GCCCCACAGGGCAGTGA
58 67.37 20 20 CGCCACAGGGCAGTGAC 59 63.42 40 21 CCCACAGGGCAGTGACC
60 63.42 20 22 CCACAGGGCAGTGACCG 61 59.85 20 23 CACAGGGCAGTGACCGC
62 60.14 20 24 ACAGGGCAGTGACCGCA 63 60.14 20 25 CAGGGCAGTGACCGCAG
64 59.76 30 26 AGGGCAGTGACCGCAGA 65 59.83 20 27 GGGCAGTGACCGCAGAC
66 60.22 30 28 GGCAGTGACCGCAGACT 67 59.53 30 29 GCAGTGACCGCAGACTT
68 57.06 30 30 CAGTGACCGCAGACTTC 69 40 31 AGTGACCGCAGACTTCT 70
-0.20 40 32 GTGACCGCAGACTTCTC 71 55.99 0.60 7 100 33
TGACCGCAGACTTCTCC 72 57.01 0.60 7 120 34 GACCGCAGACTTCTCCT 73 59.22
0.60 7 180 35 ACCGCAGACTTCTCCTC 74 59.28 0.60 7 210 36
CCGCAGACTTCTCCTCA 75 60.07 0.60 7 200 37 CGCAGACTTCTCCTCAC 76 56.34
0.60 7 190 38 GCAGACTTCTCCTCACT 77 57.79 0.60 7 240 39
CAGACTTCTCCTCACTG 78 0.60 240 40 AGACTTCTCCTCACTGG 79 0.00 340 41
GACTTCTCCTCACTGGA 80 55.77 340 42 ACTTCTCCTCACTGGAC 81 240 43
CTTCTCCTCACTGGACA 82 55.75 240 44 TTCTCCTCACTGGACAG 83 120 45
TCTCCTCACTGGACAGA 84 100 46 CTCCTCACTGGACAGAT 85 110 47
TCCTCACTGGACAGATG 86 80 48 CCTCACTGGACAGATGC 87 0.00 240 49
CTCACTGGACAGATGCA 88 0.20 90 50 TCACTGGACAGATGCAC 89 0.20 30 51
CACTGGACAGATGCACC 90 0.50 100 52 ACTGGACAGATGCACCA 91 80 53
CTGGACAGATGCACCAT 92 90 54 TGGACAGATGCACCATT 93 80 55
GGACAGATGCACCATTC 94 0.30 180 56 GACAGATGCACCATTCT 95 -0.10 220 57
ACAGATGCACCATTCTG 96 120 58 CAGATGCACCATTCTGT 97 120 59
AGATGCACCATTCTGTC 98 -0.10 250 60 GATGCACCATTCTGTCT 99 0.30 520 61
ATGCACCATTCTGTCTG 100 0.40 980 62 TGCACCATTCTGTCTGT 101 56.05 0.20
2 780 63 GCACCATTCTGTCTGTT 102 56.52 0.20 2 810 64
CACCATTCTGTCTGTTT 103 0.20 220 65 ACCATTCTGTCTGTTTT 104 0.20 120 66
CCATTCTGTCTGTTTTG 105 0.20 120 67 CATTCTGTCTGTTTTGG 106 0.60 160 68
ATTCTGTCTGTTTTGGG 107 1.70 310 69 TTCTGTCTGTTTTGGGG 108 1.70 250 70
TCTGTCTGTTTTGGGGG 109 1.70 2 80 71 CTGTCTGTTTTGGGGGA 110 55.91 1.40
2 30 72 TGTCTGTTTTGGGGGAT 111 0.90 50 73 GTCTGTTTTGGGGGATT 112 0.90
10 74 TCTGTTTTGGGGGATTG 113 1.10 10 75 CTGTTTTGGGGGATTGC 114 2.20
10 76 TGTTTTGGGGGATTGCA 115 1.20 10 77 GTTTTGGGGGATTGCAA 116 0.00 5
78 TTTTGGGGGATTGCAAG 117 -0.20 5 79 TTTGGGGGATTGCAAGT 118 -0.20 5
80 TTGGGGGATTGCAAGTA 119 0.00 5 81 TGGGGGATTGCAAGTAA 120 1.20 5 82
GGGGGATTGCAAGTAAA 121 1.40 5 83 GGGGATTGCAAGTAAAC 122 1.40 5 84
GGGATTGCAAGTAAACA 123 1.30 5 85 GGATTGGAAGTAAACAC 124 0.90 5 86
GATTGCAAGTAAACACA 125 0.50 5 87 ATTGCAAGTAAACACAG 126 0.50 5 88
TTGCAAGTAAACACAGT 127 0.50 5 89 TGCAAGTAAAGACAGTT 128 0.30 5 90
GCAAGTAAACACAGTTG 129 0.10 10 91 GAAGTAAACACAGTTGT 130 -0.30 5 92
AAGTAAACACAGTTGTG 131 5 93 AGTAAACACAGTTGTGT 132 5 94
GTAAACACAGTTGTGTC 133 5 95 TAAACACAGTTGTGTCA 134 5 96
AAACACAGTTGTGTCAA 135 5 97 AACACAGTTGTGTCAAA 136 5 98
ACACAGTTGTGTCAAAA 137 10 99 CACAGTTGTGTCAAAAG 138 15 100
ACAGTTGTGTCAAAAGC 139 30 101 CAGTTGTGTCAAAAGCA 140 0.20 25 102
AGTTGTGTCAAAAGCAA 141 -0.10 25 103 GTTGTGTCAAAAGCAAG 142 -0.30 20
104 TTGTGTCAAAAGCAAGT 143 -0.10 120 105 TGTGTCAAAAGCAAGTG 144 0.50
20
[0232] In FIG. 4, the hybridization intensity observed
experimentally is plotted as a function of oligonucleotide starting
position in the target-complementary sequence that was input into
p5. The identified contigs are plotted as horizontal bars, with the
contig rank (by length) shown in parentheses next to each bar. It
is clear from Table 3 and FIG. 4 that the prediction algorithm
identified contigs that overlap all of the "top 20%" hybridization
intensity peaks observed. Iterative experimental improvement of
these predictions would converge on each of the observed intensity
maxima in 3-4 iterations.
[0233] Prediction worksheets for HIV PRT, G3PDH and p53 were
prepared in a manner similar to that for rabbit P-globin as shown
in Table 3, except that the probes were longer as indicated above
and that approximately 1,000 probes were analyzed for each of these
genes. The results of these analyses are shown in FIG. 5 (HIV PRT),
FIG. 6 (G3PDH) and FIG. 7 (p53). In FIG. 5, data are plotted for
all possible 20-mer oligonucleotide probes. In FIGS. 6 and 7, data
were available for only every 10.sup.th 25-mer probe, and the
actual data points are plotted as open diamonds.
[0234] It is clear from FIGS. 5-7 that the hybridization efficiency
prediction algorithm of the present invention performed well in the
task of identifying regions with observed high hybridization
intensity. In each case, the 4 longest contigs point to
good-to-excellent regions for experimental investigation. It should
be noted that the contigs usually bracket observed intensity peaks;
experimental iterative refinement would therefore be expected to
converge in 2-3 iterations. By this is meant that certain
oligonucleotides from the identified contigs are prepared and
subjected to evaluation in actual hybridization experiments. Based
on the results of such experiments, the observed signal is
evaluated to determine whether the oligonucleotides are hybridizing
to the left of, the right of, or on the center of a peak with
respect to the graphed data. The next iteration is carried out to
experimentally evaluate the hybridization efficiency of probes that
are inferred to lie closer to the peak of hybridization efficiency,
based on the data from the previous iteration. Iteration is
continued until the signal level is deemed acceptable by the user,
or the local hybridization efficiency maximum is reached (i.e. the
best probe in the cluster identified by the method of the current
invention has been experimentally identified). A detailed
illustration of this process is shown in Example 3.
[0235] It should be noted that clusters of predictions that overlap
the maxima of observed peaks of hybridization efficiency will often
yield user-acceptable probes on the first iteration. Thus, the
method of the present invention is much more efficient than current
methods in which every potential probe is synthesized. For
instance, in the HIV PRT example shown in FIG. 5, at least 3 good
probes would be identified after synthesis of .about.10 test probes
(i.e. statistical sampling of the 3 longest contigs). This is much
more efficient than the .about.1,000 probes represented by the data
in FIG. 5.
Example 2
[0236] Synopsis: Data from a labeled RNA target hybridization to an
Affymetrix GeneChip.TM. HIV PRT-sense probe array (GeneChip.TM. HIV
PRT 440s, Affymetrix Corporation, Santa Clara, Calif.) were
compared to the predictions of the window-averaged composite
dimensionless score version of the method of the present
invention.
[0237] Materials and Methods: Data were obtained as described for
the Affymetrix GeneChip.TM. HIV PRT-sense probe array (GeneChip.TM.
HIV PRT 440s, Affymetrix Corporation, Santa Clara, Calif.) in
Example 1. The DNA sequence (SEQ ID NO: 37) complementary to the
fluorescein-labeled RNA target was divided into overlapping 20-mer
oligonucleotide sequences spaced one nucleotide apart, using the
prototype application p5; p5 was also used to calculate the
predicted values of the RNA/DNA heteroduplex melting temperature
(T.sub.m) and the free energy of the most stable predicted probe
intramolecular structure, .DELTA.G.sub.MFOLD, as described in
Example 1. The probe sequences and parameter values were then
transferred to a Microsoft Excel spreadsheet, which was used to
complete the predictions of efficient and inefficient probes. The
weight was obtained by optimizing the performance of the algorithm
with the data of Milner et al., supra, as the training data using
the Microsoft.RTM. Excel.RTM. spreadsheet software. The composite
score was calculated using a weight of 0.62 for the dimensionless
T.sub.m score and a weight of 0.38 for the .DELTA.G.sub.MFOLD
dimensionless score. The windowed-averaging was performed using a
window width of 7 and Microsoft.RTM. Excel.RTM. spreadsheet
software. Finally, the oligonucleotide sequences having the top 10%
of the window-averaged composite dimensionless scores were
predicted to be efficient probes, while the oligonucleotide
sequences having the bottom 10% of the window-averaged composite
dimensionless scores were predicted to be inefficient probes.
[0238] Results: The calculated parameters and scores are shown in
Table 4; the algorithm predictions are also shown diagrammatically
in FIG. 8. In Table 4, window-averaged composite score values that
were in the top 10% of the distribution of values are shown in bold
type, values that were in the bottom 10% are shown in italics, and
all other values are shown with a line through them. It is clear
from both Table 4 and FIG. 8 that the window-averaged composite
dimensionless score embodiment of the current invention correctly
predicted both efficient and inefficient hybridization probes for
HIV PRT sense-strand RNA. As in Example 1, statistical sampling of
contiguous stretches of predicted "good" probes would lead to
convergence of the design process to the best probes in each region
in 2-4 design iterations.
21TABLE 4 Window- .DELTA.G.sub.MFOLD Averaged HIV PRT p5 Probe SEQ
ID RNA/DNA (kcal/mole T.sub.m .DELTA.G.sub.MFOLD Composite
Composite GeneChip .TM. Position DNA Probe Sequence NO:
T.sub.m(.degree. C.) @ 35.degree. C.) Score Score Score Score Data
1 GTACTGTCCATTTATCAGGA 145 64.16 -0.10 0.557 -0.199 0.269 1152.2 2
TACTGTCCATTTATCAGGAT 146 60.91 -0.40 0.080 -0.460 -0.125 1040.7 3
ACTGTCCATTTATCAGGATG 147 61.41 -0.90 0.152 -0.895 -0.246 291.9 4
CTGTCCATTTATCAGGATGG 148 63.46 -0.90 0.453 -0.895 -0.059 221.8 5
TGTCCATTTATCAGGATGGA 149 62.82 -0.90 0.360 -0.895 -0.117 148.3 6
GTCCATTTATCAGGATGGAG 150 63.15 -1.90 0.408 -1.764 -0.418 84.6 7
TCCATTTATCAGGATGGAGT 151 63.15 -2.10 0.408 -1.938 -0.484 128.7 8
CCATTTATCAGGATGGAGTT 152 62.03 -1.90 0.245 -1.764 -0.519 94.6 9
CATTTATCAGGATGGAGTTC 153 59.53 -0.60 -0.122 -0.634 -0.317 157.5 10
ATTTATCAGGATGGAGTTCA 154 59.53 0.80 -0.122 0.583 0.146 316.9 11
TTTATCAGGATGGAGTTCAT 155 59.53 0.40 -0.122 0.236 0.014 360.2 12
TTATCAGGATGGAGTTCATA 156 58.58 0.40 -0.262 0.236 -0.073 403.8 13
TATCAGGATGGAGTTCATAA 157 56.21 0.20 -0.609 0.062 -0.354 382.5 14
ATCAGGATGGAGTTCATAAC 158 57.34 0.20 -0.444 0.062 -0.252 324.4 15
TCAGGATGGAGTTCATAACC 159 61.25 0.20 0.129 0.062 0.104 320.5 16
CAGGATGGAGTTCATAACCC 160 63.57 0.20 0.470 0.062 0.315 238.9 17
AGGATGGAGTTCATAACCCA 161 63.57 -0.10 0.470 -0.199 0.216 202.3 18
GGATGGAGTTCATAACCCAT 162 63.34 -1.30 0.436 -1.243 -0.202 113.6 19
GATGGAGTTCATAACCCATC 163 62.24 -2.00 0.275 -1.851 -0.533 97.7 20
ATGGAGTTCATAACCCATCC 164 64.62 -3.30 0.624 -2.982 -0.746 143.3 21
TGGAGTTCATAACCCATCCC 165 68.18 -2.00 1.146 -1.851 0.007 484.6 22
GGAGTTCATAACCCATCCCA 166 69.39 -1.60 1.324 -1.504 0.249 857.6 23
GAGTTCATAACCCATCCCAA 167 64.93 -0.20 0.670 -0.286 0.307 991.4 24
AGTTCATAACCCATCCCAAA 168 61.82 0.20 0.213 0.062 0.155 907.0 25
GTTCATAACCCATCCCAAAG 169 61.82 0.20 0.213 0.062 0.155 887.9 26
TTCATAACCCATCCCAAAGG 170 61.36 0.60 0.145 0.410 0.246 1015.3 27
TCATAACCCATCCCAAAGGA 171 62.21 -0.10 0.270 -0.199 0.092 279.7 28
CATAACCCATCCCAAAGGAA 172 59.26 -0.30 -0.163 -0.373 -0.243 210.7 29
ATAACCCATCCCAAAGGAAT 173 58.19 -0.30 -0.320 -0.373 -0.340 179.9 30
TAACCCATCCCAAAGGAATG 174 58.13 -0.30 -0.328 -0.373 -0.345 91.8 31
AACCCATCCCAAAGGAATGG 175 60.78 -1.30 0.061 -1.243 -0.435 44.6 32
ACCCATCCCAAAGGAATGGA 176 63.69 -2.00 0.487 -1.851 -0.401 42.9 33
CCCATCCCAAAGGAATGGAG 177 63.40 -2.20 0.445 -2.025 -0.494 45.0 34
CCATCCCAAAGGAATGGAGG 178 62.34 -2.30 0.290 -2.112 -0.623 45.3 35
CATCCCAAAGGAATGGAGGT 179 61.72 -2.60 0.199 -2.373 -0.778 47.9 36
ATCCCAAAGGAATGGAGGTT 180 60.90 -2.20 0.079 -2.025 -0.721 49.2 37
TCCCAAAGGAATGGAGGTTC 181 62.24 -2.20 0.274 -2.025 -0.600 74.2 38
CCCAAAGGAATGGAGGTTCT 182 62.71 -2.00 0.344 -1.851 -0.490 125.5 39
CCAAAGGAATGGAGGTTCTT 183 59.47 -0.70 -0.132 -0.721 -0.356 183.3 40
CAAAGGAATGGAGGTTCTTT 184 56.10 -0.30 -0.627 -0.373 -0.530 261.4 41
AAAGGAATGGAGGTTCTTTC 185 56.11 -0.30 -0.625 -0.373 -0.529 518.3 42
AAGGAATGGAGGTTCTTTCT 186 60.05 -0.30 -0.046 -0.373 -0.170 716.5 43
AGGAATGGAGGTTCTTTCTG 187 62.09 -0.30 0.253 -0.373 0.015 1056.0 44
GGAATGGAGGTTCTTTCTGA 188 63.23 -0.30 0.420 -0.373 0.119 1084.3 45
GAATGGAGGTTCTTTCTGAT 189 60.56 0.10 0.028 -0.025 0.008 1241.1 46
AATGGAGGTTCTTTCTGATG 190 59.12 0.30 -0.183 0.149 -0.057 1278.8 47
ATGGAGGTTCTTTCTGATGT 191 64.58 0.30 0.618 0.149 0.440 1616.0 48
TGGAGGTTCTTTCTGATGTT 192 64.98 0.30 0.677 0.149 0.476 1677.5 49
GGAGGTTCTTTCTGATGTTT 193 65.49 0.30 0.751 0.149 0.522 1963.1 50
GAGGTTCTTTCTGATGTTTT 194 63.04 0.30 0.392 0.149 0.300 2126.1 51
AGGTTCTTTCTGATGTTTTT 195 61.97 0.30 0.235 0.149 0.202 2143.3 52
GGTTCTTTCTGATGTTTTTT 196 62.11 0.30 0.256 0.149 0.215 3540.6 53
GTTCTTTCTGATGTTTTTTG 197 59.21 0.30 -0.170 0.149 -0.049 1728.7 54
TTCTTTCTGATGTTTTTTGT 198 59.21 0.30 -0.170 0.149 -0.049 1364.3 55
TCTTTCTGATGTTTTTTGTC 199 60.35 0.50 -0.002 0.323 0.121 1788.4 56
CTTTCTGATGTTTTTTGTCT 200 60.96 1.20 0.086 0.931 0.407 2670.9 57
TTTCTGATGTTTTTTGTCTG 201 58.76 1.20 -0.235 0.931 0.208 3336.2 58
TTCTGATGTTTTTTGTCTGG 202 61.17 1.20 0.118 0.931 0.427 6683.6 59
TCTGATGTTTTTTGTCTGGT 203 64.20 1.20 0.562 0.931 0.702 10227.0 60
CTGATGTTTTTTGTCTGGTG 204 62.51 1.20 0.315 0.931 0.549 10965.0 61
TGATGTTTTTTGTCTGGTGT 205 63.80 1.20 0.504 0.931 0.666 11133.0 62
GATGTTTTTTGTCTGGTGTG 206 63.80 1.60 0.504 1.279 0.798 0.894 11503.0
63 ATGTTTTTTGTCTGGTGTGG 207 65.18 1.90 0.705 1.540 1.023 0.894
9492.8 64 TGTTTTTTGTCTGGTGTGGT 208 68.78 1.70 1.234 1.366 1.284
0.914 10704.0 65 GTTTTTTGTCTGGTGTGGTA 209 68.28 1.70 1.161 1.366
1.239 0.933 10741.0 66 TTTTTTGTCTGGTGTGGTAA 210 62.37 1.70 0.294
1.366 0.701 0.950 9187.5 67 TTTTTGTCTGGTGTGGTAAG 211 62.23 1.70
0.273 1.366 0.689 0.941 7871.0 68 TTTTGTCTGGTGTGGTAAGT 212 65.28
1.20 0.721 0.931 0.801 0.921 7209.1 69 TTTGTCTGGTGTGGTAAGTC 213
66.56 1.20 0.908 0.931 0.917 0.959 8052.3 70 TTGTCTGGTGTGGTAAGTCC
214 70.25 0.30 1.449 0.149 0.955 1.022 7230.6 71
TGTCTGGTGTGGTAAGTCCC 215 73.77 -0.10 1.966 -0.199 1.143 0.998
6809.5 72 GTCTGGTGTGGTAAGTCCCC 216 77.74 -0.10 2.549 -0.199 1.504
0.913 7442.8 73 TCTGGTGTGGTAAGTCCCCA 217 75.28 -0.50 2.187 -0.547
1.148 2627.7 74 CTGGTGTGGTAAGTCCCCAC 218 74.18 -2.10 2.026 -1.938
0.519 1315.0 75 TGGTGTGGTAAGTCCCCACC 219 75.80 -3.50 2.263 -3.156
0.204 4182.3 76 GGTGTGGTAAGTCCCCACCT 220 77.89 -3.80 2.571 -3.417
0.296 474.7 77 GTGTGGTAAGTCCCCACCTC 221 77.05 -2.50 2.448 -2.286
0.649 682.4 78 TGTGGTAAGTCCCCACCTCA 222 74.71 -2.50 2.105 -2.286
0.436 679.1 79 GTGGTAAGTCCCCACCTCAA 223 72.54 -2.10 1.785 -1.938
0.370 924.0 80 TGGTAAGTCCCCACCTCAAC 224 69.94 -0.90 1.404 -0.895
0.531 835.5 81 GGTAAGTCCCCACCTCAACA 225 71.14 -0.50 1.580 -0.547
0.772 1213.6 82 GTAAGTCCCCACCTCAACAG 226 68.97 0.90 1.262 0.670
1.037 1106.1 83 TAAGTCCCCACCTCAACAGA 227 67.18 0.90 0.999 0.670
0.874 0.872 1009.0 84 AAGTCCCCACCTCAACAGAT 228 67.68 0.50 1.073
0.323 0.788 0.908 1656.2 85 AGTCCCCACCTCAACAGATG 229 69.68 0.50
1.366 0.323 0.970 2178.3 86 GTCCCCACCTCAACAGATGT 230 72.56 0.20
1.789 0.062 1.132 2567.0 87 TCCCCACCTCAACAGATGTT 231 69.77 -0.10
1.379 -0.199 0.779 3000.5 88 CCCCACCTCAACAGATGTTG 232 68.19 -1.30
1.148 -1.243 0.240 2025.4 89 CCCACCTCAACAGATGTTGT 233 67.78 -2.00
1.087 -1.851 -0.030 429.2 90 CCACCTCAACAGATGTTGTC 234 65.65 -2.00
0.775 -1.851 -0.223 157.9 91 CACCTCAACAGATGTTGTCT 235 63.85 -2.00
0.511 -1.851 -0.387 135.3 92 ACCTCAACAGATGTTGTCTC 236 64.11 -2.00
0.549 -1.851 -0.363 330.8 93 CCTCAACAGATGTTGTCTCA 237 64.77 -2.00
0.646 -1.851 -0.303 900.0 94 CTCAACAGATGTTGTCTCAG 238 61.08 -2.00
0.104 -1.851 -0.639 1177.0 95 TCAACAGATGTTGTCTCAGC 239 63.40 -2.00
0.444 -1.851 -0.428 795.1 96 CAACAGATGTTGTCTCAGCT 240 63.91 -1.60
0.520 -1.504 -0.249 889.2 97 AACAGATGTTGTCTCAGCTC 241 64.19 -0.10
0.560 -0.199 0.272 1703.6 98 ACAGATGTTGTCTCAGCTCC 242 70.61 0.00
1.503 -0.112 0.889 3115.2 99 CAGATGTTGTCTCAGCTCCT 243 72.08 0.00
1.719 -0.112 1.023 0.847 4445.0 100 AGATGTTGTCTCAGCTCCTC 244 72.66
0.20 1.803 0.062 1.141 1.070 6762.8 101 GATGTTGTCTCAGCTCCTCT 245
74.49 0.90 2.071 0.670 1.539 1.227 8845.0 102 ATGTTGTCTCAGCTCCTCTA
246 72.38 0.80 1.763 0.583 1.314 1.253 9010.6 103
TGTTGTCTCAGCTCCTCTAT 247 72.38 0.80 1.763 0.583 1.314 1.260 19941.0
104 GTTGTCTCAGCTCCTCTATT 248 72.97 0.80 1.849 0.583 1.368 1.257
12577.0 105 TTGTCTCAGCTCCTCTATTT 249 69.70 0.80 1.369 0.583 1.071
1.149 7503.3 106 TGTCTCAGCTCCTCTATTTT 250 69.70 0.80 1.369 0.583
1.071 1.098 7033.8 107 GTCTCAGCTCCTCTATTTTT 251 70.26 0.80 1.451
0.583 1.121 1.024 8276.7 108 TCTCAGCTCCTCTATTTTTG 252 66.57 0.80
0.910 0.583 0.786 0.942 2899.0 109 CTCAGCTCCTCTATTTTTGT 253 68.39
0.80 1.177 0.583 0.952 0.923 2935.0 110 TCAGCTCCTCTATTTTTGTT 254
66.69 0.80 0.927 0.583 0.796 0.930 1512.8 111 CAGCTCCTCTATTTTTGTTC
255 66.69 0.80 0.927 0.583 0.796 0.872 1708.8 112
AGCTCCTCTATTTTTGTTCT 256 67.52 1.00 1.050 0.757 0.939 0.833 1977.3
113 GCTCCTCTATTTTTGTTCTA 257 66.63 1.80 0.919 1.453 1.122 2114.8
114 CTCCTCTATTTTTGTTCTAT 258 62.13 1.80 0.259 1.453 0.713 1527.3
115 TCCTCTATTTTTGTTCTATG 259 59.97 1.80 -0.058 1.453 0.516 1536.8
116 CCTCTATTTTTGTTCTATGC 260 62.84 1.80 0.363 1.453 0.777 1824.5
117 CTCTATTTTTGTTCTATGCT 261 60.87 1.50 0.074 1.192 0.499 1169.2
118 TCTATTTTTGTTCTATGCTG 262 58.71 1.50 -0.244 1.192 0.302 683.7
119 CTATTTTTGTTCTATGCTGC 263 61.60 1.50 0.181 1.192 0.565 1306.8
120 TATTTTTGTTCTATGCTGCC 264 63.53 1.50 0.464 1.192 0.741 2523.6
121 ATTTTTGTTCTATGCTGCCC 265 67.96 1.50 1.113 1.192 1.143 0.931
6682.0 122 TTTTTGTTCTATGCTGCCCT 266 69.96 1.50 1.407 1.192 1.325
1.060 9417.4 123 TTTTGTTCTATGCTGCCCTA 267 69.01 1.50 1.267 1.192
1.239 1.151 10339.0 124 TTTGTTCTATGCTGCCCTAT 268 68.62 1.50 1.210
1.192 1.203 1.254 10750.0 125 TTGTTCTATGCTGCCCTATT 269 68.62 1.50
1.210 1.192 1.203 1.282 11180.0 126 TGTTCTATGCTGCCCTATTT 270 68.62
1.50 1.210 1.192 1.203 1.271 11060.0 127 GTTCTATGCTGCCCTATTTC 271
70.37 1.80 1.468 1.453 1.462 1.221 16074.0 128 TTCTATGCTGCCCTATTTCT
272 69.00 1.80 1.266 1.453 1.337 1.144 9183.8 129
TCTATGCTGCCCTATTTCTA 273 68.05 1.80 1.127 1.453 1.251 1.082 8617.8
130 CTATGCTGCCCTATTTCTAA 274 64.38 1.70 0.589 1.366 0.884 1.040
7286.8 131 TATGCTGCCCTATTTCTAAG 275 62.71 1.50 0.344 1.192 0.666
0.978 3642.4 132 ATGCTGCCCTATTTCTAAGT 276 66.39 0.80 0.883 0.583
0.769 0.883 3799.7 133 TGCTGCCCTATTTCTAAGTC 277 67.95 0.80 1.112
0.583 0.911 3408.3 134 GCTGCCCTATTTCTAAGTCA 278 69.25 0.80 1.303
0.583 1.030 4017.4 135 CTGCCCTATTTCTAAGTCAG 279 65.26 0.80 0.718
0.583 0.667 2197.2 136 TGCCCTATTTCTAAGTCAGA 280 64.63 -0.10 0.626
-0.199 0.312 1125.0 137 GCCCTATTTCTAAGTCAGAT 281 64.73 -0.60 0.639
-0.634 0.156 1306.3 138 CCCTATTTCTAAGTCAGATC 282 61.98 -0.60 0.236
-0.634 -0.094 1019.5 139 CCTATTTCTAAGTCAGATCC 283 61.98 -0.60 0.236
-0.634 -0.094 1852.3 140 CTATTTCTAAGTCAGATCCT 284 60.05 -0.60
-0.046 -0.634 -0.270 3159.3 141 TATTTCTAAGTCAGATCCTA 285 57.43
-0.60 -0.430 -0.634 -0.508 2604.8 142 ATTTCTAAGTCAGATCCTAC 286
58.59 -0.60 -0.261 -0.634 -0.402 3986.1 143 TTTCTAAGTCAGATCCTACA
287 59.91 -0.60 -0.068 -0.634 -0.283 4500.7 144
TTCTAAGTCAGATCCTACAT 288 59.55 -0.60 -0.120 -0.634 -0.315 4754.5
145 TCTAAGTCAGATCCTACATA 289 58.62 -0.40 -0.257 -0.460 -0.334
3802.1 146 CTAAGTCAGATCCTACATAC 290 57.80 1.20 -0.377 0.931 0.120
5069.4 147 TAAGTCAGATCCTACATACA 291 57.13 1.30 -0.476 1.018 0.092
3965.2 148 AAGTCAGATCCTACATACAA 292 55.78 1.30 -0.673 1.018 -0.030
3862.3 149 AGTCAGATCCTACATACAAA 293 55.78 1.30 -0.673 1.018 -0.030
2868.9 150 GTCAGATCCTACATACAAAT 294 55.62 1.70 -0.697 1.366 0.087
3542.9 151 TCAGATCCTACATACAAATC 295 54.02 1.50 -0.932 1.192 -0.125
2477.1 152 CAGATCCTACATACAAATCA 296 54.07 1.10 -0.924 0.844 -0.252
2522.4 153 AGATCCTACATACAAATCAT 297 52.83 1.10 -1.106 0.844 -0.365
2554.6 154 GATCCTACATACAAATCATC 298 53.87 1.50 -0.953 1.192 -0.138
3580.0 155 ATCCTACATACAAATCATCC 299 56.33 1.80 -0.591 1.453 0.185
5937.7 156 TCCTACATACAAATCATCCA 300 57.54 1.80 -0.415 1.453 0.295
4606.7 157 CCTACATACAAATCATCCAT 301 56.32 1.80 -0.594 1.453 0.184
4877.2 158 CTACATACAAATCATCCATG 302 52.68 1.10 -1.128 0.844 -0.379
2608.6 159 TACATACAAATCATCCATGT 303 53.56 0.30 -0.999 0.149 -0.563
1491.7 160 ACATACAAATCATCCATGTA 304 53.56 -0.10 -0.999 -0.199
-0.695 1364.3 161 CATACAAATCATCCATGTAT 305 53.07 -0.80 -1.071
-0.808 -0.971 -0.751 1089.8 162 ATACAAATCATCCATGTATT 306 52.11
-1.10 -1.211 -1.069 -1.157 -0.818 1008.6 163 TACAAATCATCCATGTATTG
307 52.08 -0.40 -1.215 -0.460 -0.928 -0.891 624.8 164
ACAAATCATCCATGTATTGA 308 53.86 0.20 -0.955 0.062 -0.568 -0.921
535.8 165 CAAATCATCCATGTATTGAT 309 53.36 -0.50 -1.027 -0.547 -0.845
-0.860 3019.6 166 AAATCATCCATGTATTGATA 310 51.57 -0.70 -1.291
-0.721 -1.074 -0.753 214.0 167 AATCATCCATGTATTGATAG 311 53.47 -0.70
-1.012 -0.721 -0.901 212.7 168 ATCATCCATGTATTGATAGA 312 56.66 -0.50
-0.543 -0.547 -0.545 165.2 169 TCATCCATGTATTGATAGAT 313 56.66 -0.10
-0.543 -0.199 -0.412 166.0 170 CATCCATGTATTGATAGATA 314 54.80 0.30
-0.817 0.149 -0.450 151.0 171 ATCCATGTATTGATAGATAA 315 51.69 0.30
-1.273 0.149 -0.733 101.8 172 TCCATGTATTGATAGATAAC 316 52.19 0.30
-1.199 0.149 -0.687 84.0 173 CCATGTATTGATAGATAACT 317 52.89 0.30
-1.097 0.149 -0.623 -0.850 130.3 174 CATGTATTGATAGATAACTA 318 48.47
0.70 -1.746 0.496 -0.894 -0.937 67.8 175 ATGTATTGATAGATAACTAT 319
47.12 0.00 -1.944 -0.112 -1.248 -1.006 65.7 176
TGTATTGATAGATAACTATG 320 47.11 -0.20 -1.945 -0.286 -1.315 -1.048
90.0 177 GTATTGATAGATAACTATGT 321 49.90 -0.20 -1.536 -0.286 -1.061
-1.099 125.9 178 TATTGATAGATAACTATGTC 322 48.24 -0.20 -1.779 -0.286
-1.212 -1.083 132.6 179 ATTGATAGATAACTATGTCT 323 50.78 -0.20 -1.407
-0.286 -0.981 -0.998 167.4 180 TTGATAGATAACTATGTCTG 324 50.75 -0.20
-1.411 -0.286 -0.984 -0.916 219.0 181 TGATAGATAACTATGTCTGG 325
53.01 -0.20 -1.080 -0.286 -0.778 -0.866 722.6 182
GATAGATAACTATGTCTGGA 326 54.36 -0.20 -0.881 -0.286 -0.655 -0.774
825.1 183 ATAGATAACTATGTCTGGAT 327 53.04 -0.10 -1.074 -0.199 -0.742
844.4 184 TAGATAACTATGTCTGGATT 328 53.37 -0.10 -1.027 -0.199 -0.712
912.6 185 AGATAACTATGTCTGGATTT 329 54.27 0.10 -0.895 -0.025 -0.565
1301.8 186 GATAACTATGTCTGGATTTT 330 54.43 0.80 -0.870 0.583 -0.318
1367.4 187 ATAACTATGTCTGGATTTTG 331 53.08 1.50 -1.070 1.192 -0.210
1284.2 188 TAACTATGTCTGGATTTTGT 332 56.05 1.50 -0.634 1.192 0.060
1162.5 189 AACTATGTCTGGATTTTGTT 333 56.97 1.50 -0.499 1.192 0.144
1396.7 190 ACTATGTCTGGATTTTGTTT 334 59.38 1.50 -0.145 1.192 0.363
1348.3 191 CTATGTCTGGATTTTGTTTT 335 59.16 1.50 -0.177 1.192 0.343
1092.8 192 TATGTCTGGATTTTGTTTTT 336 57.45 1.50 -0.428 1.192 0.188
912.6 193 ATGTCTGGATTTTGTTTTTT 337 58.41 1.70 -0.287 1.366 0.341
994.3 194 TGTCTGGATTTTGTTTTTTA 338 57.81 2.00 -0.375 1.627 0.386
840.7 195 GTCTGGATTTTGTTTTTTAA 339 55.82 1.00 -0.667 0.757 -0.126
941.9 196 TCTGGATTTTGTTTTTTAAA 340 50.98 0.80 -1.377 0.583 -0.632
84.9 197 CTGGATTTTGTTTTTTAAAA 341 48.16 0.30 -1.790 0.149 -1.054
78.6 198 TGGATTTTGTTTTTTAAAAG 342 46.41 0.10 -2.048 -0.025 -1.279
-0.851 93.2 199 GGATTTTGTTTTTTAAAAGG 343 48.87 0.10 -1.686 -0.025
-1.055 -0.933 56.0 200 GATTTTGTTTTTTAAAAGGC 344 50.22 0.10 -1.488
-0.025 -0.932 -0.912 49.9 201 ATTTTGTTTTTTAAAAGGCT 345 50.84 0.10
-1.397 -0.025 -0.876 -0.843 55.0 202 TTTTGTTTTTTAAAAGGCTC 346 52.03
0.30 -1.223 0.149 -0.702 -0.768 64.6 203 TTTGTTTTTTAAAAGGCTCT 347
53.64 0.50 -0.987 0.323 -0.489 162.8 204 TTGTTTTTTAAAAGGCTCTA
348
52.76 0.50 -1.115 0.323 -0.569 265.8 205 TGTTTTTTAAAAGGCTCTAA 349
50.71 0.50 -1.417 0.323 -0.756 288.5 206 GTTTTTTAAAAGGCTCTAAG 350
50.86 0.50 -1.395 0.323 -0.742 548.4 207 TTTTTTAAAAGGCTCTAAGA 351
49.40 0.70 -1.609 0.496 -0.809 524.7 208 TTTTTAAAAGGCTCTAAGAT 352
49.11 1.20 -1.651 0.931 -0.670 -0.746 937.9 209
TTTTAAAAGGCTCTAAGATT 353 49.11 1.20 -1.651 0.931 -0.670 -0.790
1440.3 210 TTTAAAAGGCTCTAAGATTT 354 49.11 1.20 -1.651 0.931 -0.670
-0.820 1633.3 211 TTAAAAGGCTCTAAGATTTT 355 49.11 0.50 -1.651 0.323
-0.901 -0.735 1987.4 212 TAAAAGGCTCTAAGATTTTT 356 49.11 0.00 -1.651
-0.112 -1.067 1792.3 213 AAAAGGCTCTAAGATTTTTG 357 49.63 0.20 -1.575
0.062 -0.953 2218.9 214 AAAGGCTCTAAGATTTTTGT 358 54.13 1.20 -0.914
0.931 -0.213 2371.4 215 AAGGCTCTAAGATTTTTGTC 359 57.38 1.20 -0.439
0.931 0.082 3308.9 216 AGGCTCTAAGATTTTTGTCA 360 60.78 0.80 0.061
0.583 0.260 4070.5 217 GGCTCTAAGATTTTTGTCAT 361 60.56 0.80 0.028
0.583 0.239 5394.5 218 GCTCTAAGATTTTTGTCATG 362 57.81 0.80 -0.376
0.583 -0.011 2025.5 219 CTCTAAGATTTTTGTCATGC 363 57.81 0.80 -0.376
0.583 -0.011 1741.9 220 TCTAAGATTTTTGTCATGCT 364 57.81 0.80 -0.376
0.583 -0.011 1707.6 221 CTAAGATTTTTGTCATGCTA 365 55.87 0.80 -0.660
0.583 -0.187 1783.0 222 TAAGATTTTTGTCATGCTAC 366 54.43 0.80 -0.872
0.583 -0.319 3131.4 223 AAGATTTTTGTCATGCTACT 367 56.99 0.60 -0.495
0.410 -0.151 4892.5 224 AGATTTTTGTCATGCTACTT 368 59.39 0.60 -0.144
0.410 0.067 5856.4 225 GATTTTTGTCATGCTACTTT 369 59.54 0.60 -0.122
0.410 0.080 6439.0 226 ATTTTTGTCATGCTACTTTG 370 58.09 0.60 -0.334
0.410 -0.051 5820.3 227 TTTTTGTCATGCTACTTTGG 371 60.78 0.60 0.060
0.410 0.193 5189.6 228 TTTTGTCATGCTACTTTGGA 372 61.79 0.60 0.209
0.410 0.285 4721.7 229 TTTGTCATGCTACTTTGGAA 373 59.35 0.60 -0.149
0.410 0.063 4221.0 230 TTGTCATGCTACTTTGGAAT 374 59.00 0.60 -0.200
0.410 0.032 4279.0 231 TGTCATGCTACTTTGGAATA 375 58.10 0.60 -0.333
0.410 -0.051 4102.0 232 GTCATGCTACTTTGGAATAT 376 58.16 0.90 -0.324
0.670 0.054 5069.8 233 TCATGCTACTTTGGAATATT 377 55.52 0.90 -0.711
0.670 -0.186 2407.9 234 CATGCTACTTTGGAATATTG 378 54.23 1.30 -0.900
1.018 -0.171 2443.0 235 ATGCTACTTTGGAATATTGC 379 56.90 1.40 -0.508
1.105 0.105 2324.3 236 TGCTACTTTGGAATATTGCT 380 58.82 0.90 -0.227
0.670 0.114 1894.1 237 GCTACTTTGGAATATTGCTG 381 58.82 1.30 -0.227
1.018 0.246 2363.8 238 CTACTTTGGAATATTGCTGG 382 57.35 1.70 -0.443
1.366 0.244 1363.0 239 TACTTTGGAATATTGCTGGT 383 58.39 1.70 -0.290
1.366 0.339 1217.5 240 ACTTTGGAATATTGCTGGTG 384 58.88 1.70 -0.217
1.366 0.384 1621.8 241 CTTTGGAATATTGCTGGTGA 385 59.64 1.70 -0.106
1.366 0.453 1438.2 242 TTTGGAATATTGCTGGTGAT 386 57.72 1.80 -0.388
1.453 0.311 1608.0 243 TTGGAATATTGCTGGTGATC 387 58.73 1.80 -0.241
1.453 0.403 2334.6 244 TGGAATATTGCTGGTGATCC 388 62.18 0.50 0.266
0.323 0.288 3776.7 245 GGAATATTGCTGGTGATCCT 389 64.19 -0.20 0.561
-0.286 0.239 5648.7 246 GAATATTGCTGGTGATCCTT 390 61.99 -0.20 0.238
-0.286 0.039 5358.8 247 AATATTGCTGGTGATCCTTT 391 61.03 -0.20 0.097
-0.286 -0.049 5517.2 248 ATATTGCTGGTGATCCTTTC 392 64.63 -0.20 0.625
-0.286 0.279 6246.4 249 TATTGCTGGTGATCCTTTCC 393 68.48 -0.20 1.190
-0.286 0.629 9975.1 250 ATTGCTGGTGATCCTTTCCA 394 70.22 -0.20 1.446
-0.286 0.788 11990.0 251 TTGCTGGTGATCCTTTCCAT 395 70.22 -0.60 1.446
-0.634 0.655 11543.0 252 TGCTGGTGATCCTTTCCATC 396 71.48 -0.60 1.631
-0.634 0.770 0.862 14125.0 253 GCTGGTGATCCTTTCCATCC 397 75.32 -0.60
2.193 -0.634 1.119 0.936 23489.0 254 CTGGTGATCCTTTCCATCCC 398 74.58
-0.60 2.085 -0.634 1.052 1.022 15975.0 255 TGGTGATCCTTTCCATCCCT 399
74.58 -0.70 2.085 -0.721 1.019 1.082 16053.0 256
GGTGATCCTTTCCATCCCTG 400 74.58 -0.30 2.085 -0.373 1.151 1.136
19205.0 257 GTGATCCTTTCCATCCCTGT 401 75.40 0.20 2.206 0.062 1.391
1.080 17872.0 258 TGATCCTTTCCATCCCTGTG 402 71.89 0.20 1.691 0.062
1.072 0.955 12871.0 259 GATCCTTTCCATCCCTGTGG 403 74.58 -0.30 2.085
-0.373 1.151 8792.7 260 ATCCTTTCCATCCCTGTGGA 404 74.58 -1.60 2.085
-1.504 0.721 5609.6 261 TCCTTTCCATCCCTGTGGAA 405 72.27 -2.60 1.746
-2.373 0.181 3018.0 262 CCTTTCCATCCCTGTGGAAG 406 71.00 -2.80 1.559
-2.547 -0.001 1802.6 263 CTTTCCATCCCTGTGGAAGC 407 71.60 -2.80 1.648
-2.547 0.054 1074.0 264 TTTCCATCCCTGTGGAAGCA 408 70.81 -2.80 1.532
-2.547 -0.018 1132.5 265 TTCCATCCCTGTGGAAGCAC 409 71.02 -2.60 1.562
-2.373 0.067 1454.5 266 TCCATCCCTGTGGAAGCACA 410 71.74 -1.70 1.669
-1.591 0.430 1676.8 267 CCATCCCTGTGGAAGCACAT 411 70.20 -2.20 1.443
-2.025 0.125 2268.9 268 CATCCCTGTGGAAGCACATT 412 67.07 -2.20 0.983
-2.025 -0.160 1682.6 269 ATCCCTGTGGAAGCACATTG 413 65.82 -2.20 0.801
-2.025 -0.273 1753.9 270 TCCCTGTGGAAGCACATTGT 414 68.98 -2.20 1.263
-2.025 0.014 1281.8 271 CCCTGTGGAAGCACATTGTA 415 66.92 -2.20 0.962
-2.025 -0.173 1227.8 272 CCTGTGGAAGCACATTGTAC 416 63.84 -2.20 0.509
-2.025 -0.454 700.3 273 CTGTGGAAGCACATTGTACT 417 62.01 -2.20 0.241
-2.025 -0.620 618.7 274 TGTGGAAGCACATTGTACTG 418 59.99 -2.00 -0.056
-1.851 -0.738 771.5 275 GTGGAAGCACATTGTACTGA 419 61.39 -0.50 0.149
-0.547 -0.115 1180.6 276 TGGAAGCACATTGTACTGAT 420 58.35 0.50 -0.296
0.323 -0.061 1160.5 277 GGAAGCACATTGTACTGATA 421 57.86 0.50 -0.368
0.323 -0.106 1314.7 278 GAAGCACATTGTACTGATAT 422 55.32 0.50 -0.740
0.323 -0.336 1102.5 279 AAGCACATTGTACTGATATC 423 55.30 0.50 -0.744
0.323 -0.339 1222.1 280 AGCACATTGTACTGATATCT 424 59.26 0.50 -0.162
0.323 0.022 1893.2 281 GCACATTGTACTGATATCTA 425 58.48 0.50 -0.277
0.323 -0.049 2097.7 282 CACATTGTACTGATATCTAA 426 52.51 0.50 -1.152
0.323 -0.592 1237.8 283 ACATTGTACTGATATCTAAT 427 51.20 0.50 -1.345
0.323 -0.711 959.5 284 CATTGTACTGATATCTAATC 428 51.89 0.10 -1.244
-0.025 -0.781 1149.1 285 ATTGTACTGATATCTAATCC 429 54.53 -0.30
-0.856 -0.373 -0.672 2351.3 286 TTGTACTGATATCTAATCCC 430 58.41
-0.30 -0.287 -0.373 -0.320 4191.6 287 TGTACTGATATCTAATCCCT 431
59.99 -0.30 -0.055 -0.373 -0.176 5565.8 288 GTACTGATATCTAATCCCTG
432 59.99 -0.30 -0.055 -0.373 -0.176 9980.2 289
TACTGATATCTAATCCCTGG 433 59.52 -0.30 -0.124 -0.373 -0.218 6318.9
290 ACTGATATCTAATCCCTGGT 434 63.07 -0.30 0.397 -0.373 0.104 7749.5
291 CTGATATCTAATCCCTGGTG 435 62.43 -0.30 0.303 -0.373 0.046 8165.3
292 TGATATCTAATCCCTGGTGT 436 63.60 -0.30 0.474 -0.373 0.152 9107.6
293 GATATCTAATCCCTGGTGTC 437 65.19 0.10 0.707 -0.025 0.429 13914.0
294 ATATCTAATCCCTGGTGTCT 438 65.82 1.50 0.800 1.192 0.949 15093.0
295 TATCTAATCCCTGGTGTCTC 439 67.41 1.50 1.033 1.192 1.093 18647.0
296 ATCTAATCCCTGGTGTCTCA 440 69.20 1.30 1.296 1.018 1.190 0.904
21810.0 297 TCTAATCCCTGGTGTCTCAT 441 69.20 0.80 1.296 0.583 1.025
0.996 20102.0 298 CTAATCCCTGGTGTCTCATT 442 67.98 0.80 1.117 0.583
0.914 1.052 20967.0 299 TAATCCCTGGTGTCTCATTG 443 65.90 0.80 0.811
0.583 0.725 1.092 18200.0 300 AATCCCTGGTGTCTCATTGT 444 69.78 0.80
1.380 0.583 1.077 1.088 19845.0 301 ATCCCTGGTGTCTCATTGTT 445 72.61
0.80 1.797 0.583 1.336 1.057 19231.0 302 TCCCTGGTGTCTCATTGTTT 446
73.04 0.80 1.860 0.583 1.375 0.981 17629.0 303 CCCTGGTGTCTCATTGTTTA
447 70.72 0.80 1.519 0.583 1.164 0.918 17009.0 304
CCTGGTGTCTCATTGTTTAT 448 66.82 0.80 0.946 0.583 0.808 11580.0 305
CTGGTGTCTCATTGTTTATA 449 62.17 0.80 0.264 0.583 0.386 8374.6 306
TGGTGTCTCATTGTTTATAC 450 60.65 0.90 0.042 0.670 0.281 6153.3 307
GGTGTCTCATTGTTTATACT 451 62.88 0.20 0.369 0.062 0.252 7134.0 308
GTGTCTCATTGTTTATACTA 452 59.43 0.20 -0.138 0.062 -0.062 4435.2 309
TGTCTCATTGTTTATACTAG 453 56.35 0.20 -0.589 0.062 -0.342 2035.5 310
GTCTCATTGTTTATACTAGG 454 59.21 0.20 -0.170 0.062 -0.082 2466.6 311
TCTCATTGTTTATACTAGGT 455 59.21 0.20 -0.170 0.062 -0.082 1080.9 312
CTCATTGTTTATACTAGGTA 456 57.15 0.20 -0.472 0.062 -0.269 956.0 313
TCATTGTTTATACTAGGTAT 457 55.08 0.20 -0.776 0.062 -0.458 529.4 314
CATTGTTTATACTAGGTATG 458 53.70 0.20 -0.978 0.062 -0.583 471.4 315
ATTGTTTATACTAGGTATGG 459 55.01 0.20 -0.785 0.062 -0.463 510.4 316
TTGTTTATACTAGGTATGGT 460 58.17 0.20 -0.322 0.062 -0.176 531.0 317
TGTTTATACTAGGTATGGTA 461 57.21 0.20 -0.463 0.062 -0.264 613.3 318
GTTTATACTAGGTATGGTAA 462 55.23 0.00 -0.753 -0.112 -0.510 685.1 319
TTTATACTAGGTATGGTAAA 463 50.42 0.00 -1.459 -0.112 -0.947 300.0 320
TTATACTAGGTATGGTAAAT 464 50.12 0.00 -1.504 -0.112 -0.975 316.1 321
TATACTAGGTATGGTAAATG 465 49.79 0.00 -1.551 -0.112 -1.004 387.5 322
ATACTAGGTATGGTAAATGC 466 54.30 0.00 -0.889 -0.112 -0.594 685.7 323
TACTAGGTATGGTAAATGCA 467 55.59 0.20 -0.700 0.062 -0.411 759.6 324
ACTAGGTATGGTAAATGCAG 468 56.32 0.80 -0.593 0.583 -0.146 1050.2 325
CTAGGTATGGTAAATGCAGT 469 58.78 1.10 -0.232 0.844 0.177 1020.4 326
TAGGTATGGTAAATGCAGTA 470 56.24 1.10 -0.605 0.844 -0.054 742.6 327
AGGTATGGTAAATGCAGTAT 471 56.81 1.10 -0.521 0.844 -0.002 889.6 328
GGTATGGTAAATGCAGTATA 472 56.07 1.10 -0.631 0.844 -0.070 858.8 329
GTATGGTAAATGCAGTATAC 473 54.02 1.10 -0.931 0.844 -0.256 379.0 330
TATGGTAAATGCAGTATACT 474 53.06 0.40 -1.071 0.236 -0.575 166.7 331
ATGGTAAATGCAGTATACTT 475 53.94 0.40 -0.943 0.236 -0.495 215.3 332
TGGTAAATGCAGTATACTTC 476 55.21 0.40 -0.757 0.236 -0.380 103.2 333
GGTAAATGCAGTATACTTCC 477 59.15 0.40 -0.178 0.236 -0.021 246.3 334
GTAAATGCAGTATACTTCCT 478 58.53 0.80 -0.269 0.583 0.055 163.4 335
TAAATGCAGTATACTTCCTG 479 55.54 0.10 -0.708 -0.025 -0.448 294.1 336
AAATGCAGTATACTTCCTGA 480 57.36 -0.30 -0.441 -0.373 -0.415 531.4 337
AATGCAGTATACTTCCTGAA 481 57.36 -0.30 -0.441 -0.373 -0.415 1995.5
338 ATGCAGTATACTTCCTGAAG 482 59.50 -0.30 -0.128 -0.373 -0.221 510.1
339 TGCAGTATACTTCCTGAAGT 483 62.63 -0.90 0.332 -0.895 -0.134 555.4
340 GCAGTATACTTCCTGAAGTC 484 64.24 -1.10 0.568 -1.069 -0.054 1214.0
341 CAGTATACTTCCTGAAGTCT 485 61.94 -1.10 0.230 -1.069 -0.263 825.7
342 AGTATACTTCCTGAAGTCTT 486 61.00 -1.10 0.094 -1.069 -0.348 1582.6
343 GTATACTTCCTGAAGTCTTC 487 62.28 -1.10 0.281 -1.069 -0.232 2391.8
344 TATACTTCCTGAAGTCTTCA 488 60.34 -1.10 -0.004 -1.069 -0.409
2276.3 345 ATACTTCCTGAAGTCTTCAT 489 60.91 -1.20 0.080 -1.156 -0.389
2702.8 346 TACTTCCTGAAGTCTTCATC 490 62.40 -1.20 0.299 -1.156 -0.254
3781.7 347 ACTTCCTGAAGTCTTCATCT 491 65.05 -1.20 0.686 -1.156 -0.014
5343.4 348 CTTCCTGAAGTCTTCATCTA 492 63.86 -1.20 0.512 -1.156 -0.122
6309.0 349 TTCCTGAAGTCTTCATCTAA 493 59.70 -1.20 -0.098 -1.156
-0.500 6372.4 350 TCCTGAAGTCTTCATCTAAG 494 59.55 -1.20 -0.120
-1.156 -0.513 3835.3 351 CCTGAAGTCTTCATCTAAGG 495 60.76 -1.20 0.057
-1.156 -0.404 8925.5 352 CTGAAGTCTTCATCTAAGGG 496 59.48 -1.20
-0.130 -1.156 -0.520 1211.8 353 TGAAGTCTTCATCTAAGGGA 497 58.84
-1.00 -0.224 -0.982 -0.512 609.4 354 GAAGTCTTCATCTAAGGGAA 498 56.91
-0.10 -0.507 -0.199 -0.390 629.1 355 AAGTCTTCATCTAAGGGAAC 499 56.13
-0.10 -0.622 -0.199 -0.461 749.3 356 AGTCTTCATCTAAGGGAACT 500 60.12
-0.10 -0.036 -0.199 -0.098 805.6 357 GTCTTCATCTAAGGGAACTG 501 59.84
-0.10 -0.077 -0.199 -0.124 817.0 358 TCTTCATCTAAGGGAACTGA 502 58.11
-0.10 -0.331 -0.199 -0.281 327.1 359 CTTCATCTAAGGGAACTGAA 503 54.95
-0.60 -0.794 -0.634 -0.733 320.0 360 TTCATCTAAGGGAACTGAAA 504 51.39
-0.60 -1.316 -0.634 -1.057 -0.822 84.1 361 TCATCTAAGGGAACTGAAAA 505
49.50 0.10 -1.595 -0.025 -0.998 -1.002 67.7 362
CATCTAAGGGAACTGAAAAA 506 46.98 0.10 -1.963 -0.025 -1.227 -1.171
62.2 363 ATCTAAGGGAACTGAAAAAT 507 45.78 0.10 -2.140 -0.025 -1.336
-1.298 78.9 364 TCTAAGGGAACTGAAAAATA 508 45.27 0.10 -2.214 -0.025
-1.382 -1.328 43.2 365 CTAAGGGAACTGAAAAATAT 509 44.36 0.10 -2.349
-0.025 -1.466 -1.322 50.4 366 TAAGGGAACTGAAAAATATG 510 42.71 0.10
-2.591 -0.025 -1.616 -1.242 43.7 367 AAGGGAACTGAAAAATATGC 511 46.54
0.10 -2.028 -0.025 -1.267 -1.163 45.6 368 AGGGAACTGAAAAATATGCA 512
49.21 0.30 -1.637 0.149 -0.958 -1.119 49.8 369 GGGAACTGAAAAATATGCAT
513 49.11 1.20 -1.651 0.931 -0.670 -1.082 53.2 370
GGAACTGAAAAATATGCATC 514 47.87 1.20 -1.834 0.931 -0.783 -0.958 56.6
371 GAACTGAAAAATATGCATCA 515 46.82 0.60 -1.987 0.410 -1.076 -0.844
45.3 372 AACTGAAAAATATGCATCAC 516 46.12 0.40 -2.090 0.236 -1.206
-0.773 56.3 373 ACTGAAAAATATGCATCACC 517 51.18 0.40 -1.347 0.236
-0.746 61.7 374 CTGAAAAATATGCATCACCC 518 54.20 0.40 -0.905 0.236
-0.471 224.5 375 TGAAAAATATGCATCACCCA 519 53.65 0.60 -0.985 0.410
-0.455 413.0 376 GAAAAATATGCATCACCCAC 520 54.14 1.30 -0.913 1.018
-0.179 1584.0 377 AAAAATATGCATCACCCACA 521 54.14 1.30 -0.913 1.018
-0.179 1846.7 378 AAAATATGCATCACCCACAT 522 55.78 1.10 -0.673 0.844
-0.096 2445.8 379 AAATATGCATCACCCACATC 523 58.72 0.90 -0.241 0.670
0.105 3709.4 380 AATATGCATCACCCACATCC 524 64.13 0.90 0.552 0.670
0.597 4548.4 381 ATATGCATCACCCACATCCA 525 67.27 0.90 1.013 0.670
0.883 5254.1 382 TATGCATCACCCACATCCAG 526 67.53 0.90 1.051 0.670
0.906 0.864 5527.2 383 ATGCATCACCCACATCCAGT 527 71.21 0.90 1.590
0.670 1.241 0.991 6916.9 384 TGCATCACCCACATCCAGTA 528 70.68 0.70
1.513 0.496 1.127 1.030 5861.4 385 GCATCACCCACATCCAGTAC 529 71.39
0.70 1.617 0.496 1.191 1.043 8078.4 386 CATCACCCACATCCAGTACT 530
69.16 0.70 1.290 0.496 0.988 1.013 4148.8 387 ATCACCCACATCCAGTACTG
531 67.91 0.70 1.107 0.496 0.875 0.913 3317.1 388
TCACCCACATCCAGTACTGT 532 71.15 0.10 1.582 -0.025 0.971 2486.4 389
CACCCACATCCAGTACTGTT 533 69.94 -0.40 1.404 -0.460 0.696 2746.4 390
ACCCACATCCAGTACTGTTA 534 68.25 -0.40 1.157 -0.460 0.543 2133.0 391
CCCACATCCAGTACTGTTAC 535 68.25 -0.40 1.157 -0.460 0.543 2197.0 392
CCACATCCAGTACTGTTACT 536 66.50 -0.40 0.900 -0.460 0.383 1824.0 393
CACATCCAGTACTGTTACTG 537 62.61 -1.90 0.329 -1.764 -0.467 1675.2 394
ACATCCAGTACTGTTACTGA 538 62.71 -2.30 0.344 -2.112 -0.590 1219.8 395
CATCCAGTACTGTTACTGAT 539 62.12 -2.30 0.258 -2.112 -0.643 1414.0 396
ATCCAGTACTGTTACTGATT 540 61.21 -2.30 0.124 -2.112 -0.726 1710.7 397
TCCAGTACTGTTACTGATTT 541 61.58 -2.30 0.178 -2.112 -0.692 2280.7 398
CCAGTACTGTTACTGATTTT 542 60.48 -2.30 0.017 -2.112 -0.792 2847.7 399
CAGTACTGTTACTGATTTTT 543 56.84 -1.90 -0.518 -1.764 -0.992 2830.2
400 AGTACTGTTACTGATTTTTT 544 55.82 -0.30 -0.666 -0.373 -0.555
4336.3 401 GTACTGTTACTGATTTTTTC 545 57.04 0.40 -0.488 0.236 -0.213
6581.1 402 TACTGTTACTGATTTTTTCT 546 55.95 -0.10 -0.649 -0.199
-0.478 5406.6 403 ACTGTTACTGATTTTTTCTT 547 56.89 -0.10 -0.510
-0.199 -0.392 6083.1 404 CTGTTACTGATTTTTTCTTT 548 56.67 -0.10
-0.542 -0.199 -0.412 6585.7 405 TGTTACTGATTTTTTCTTTT 549 54.96
-0.10 -0.793 -0.199 -0.567 3923.2 406 GTTACTGATTTTTTCTTTTT 550
55.36 -0.10 -0.734 -0.199 -0.531 4093.5 407 TTACTGATTTTTTCTTTTTT
551 52.62 -0.10 -1.136 -0.199 -0.780 1381.5 408
TACTGATTTTTTCTTTTTTA 552 51.70 -0.10 -1.272 -0.199 -0.864 -0.784
1194.3 409 ACTGATTTTTTCTTTTTTAA 553 50.45 -0.10 -1.454 -0.199
-0.977 -0.746 2371.3 410 CTGATTTTTTCTTTTTTAAC 554 50.45 -0.10
-1.454 -0.199 -0.977 395.9
411 TGATTTTTTCTTTTTTAACC 555 52.50 -0.10 -1.155 -0.199 -0.792 230.7
412 GATTTTTTCTTTTTTAACCC 556 56.43 0.30 -0.578 0.149 -0.302 314.9
413 ATTTTTTCTTTTTTAACCCT 557 57.05 0.80 -0.487 0.583 -0.080 276.1
414 TTTTTTCTTTTTTAACCCTG 558 56.99 0.80 -0.495 0.583 -0.085 273.3
415 TTTTTCTTTTTTAACCCTGC 559 60.68 0.80 0.045 0.583 0.250 628.4 416
TTTTCTTTTTTAACCCTGCG 560 60.85 0.80 0.071 0.583 0.265 4661.4 417
TTTCTTTTTTAACCCTGCGG 561 62.93 0.70 0.377 0.496 0.422 411.2 418
TTCTTTTTTAACCCTGCGGG 562 65.01 -0.60 0.681 -0.634 0.181 289.5 419
TCTTTTTTAACCCTGCGGGA 563 65.91 -1.00 0.813 -0.982 0.131 244.8 420
CTTTTTTAACCCTGCGGGAT 564 64.52 -1.00 0.610 -0.982 0.005 250.7 421
TTTTTTAACCCTGCGGGATG 565 62.66 -1.00 0.337 -0.982 -0.164 207.8 422
TTTTTAACCCTGCGGGATGT 566 65.23 -1.00 0.713 -0.982 0.069 255.8 423
TTTTAACCCTGCGGGATGTG 567 64.80 -1.00 0.651 -0.982 0.030 356.8 424
TTTAACCCTGCGGGATGTGG 568 66.83 -1.00 0.949 -0.982 0.215 497.8 425
TTAACCCTGCGGGATGTGGT 569 69.50 -1.00 1.339 -0.982 0.457 754.3 426
TAACCCTGCGGGATGTGGTA 570 68.63 -1.00 1.212 -0.982 0.378 902.4 427
AACCCTGCGGGATGTGGTAT 571 69.14 -1.00 1.286 -0.982 0.424 1186.6 428
ACCCTGCGGGATGTGGTATT 572 71.66 -1.00 1.657 -0.982 0.654 1514.9 429
CCCTGCGGGATGTGGTATTC 573 72.66 -0.60 1.804 -0.634 0.878 2407.6 430
CCTGCGGGATGTGGTATTCC 574 72.66 -0.60 1.804 -0.634 0.878 3019.4 431
CTGCGGGATGTGGTATTCCT 575 71.02 -1.30 1.563 -1.243 0.497 3275.3 432
TGCGGGATGTGGTATTCCTA 576 68.54 -1.30 1.199 -1.243 0.271 2830.8 433
GCGGGATGTGGTATTCCTAA 577 66.48 -1.30 0.896 -1.243 0.083 2620.5 434
CGGGATGTGGTATTCCTAAT 578 62.46 -1.30 0.307 -1.243 -0.282 1827.8 435
GGGATGTGGTATTCCTAATT 579 62.37 -1.30 0.294 -1.243 -0.290 1957.4 436
GGATGTGGTATTCCTAATTG 580 59.71 -0.90 -0.097 -0.895 -0.400 1686.2
437 GATGTGGTATTCCTAATTGA 581 58.45 -0.20 -0.281 -0.286 -0.283
1395.0 438 ATGTGGTATTCCTAATTGAA 582 55.24 -0.20 -0.752 -0.286
-0.575 1245.7 439 TGTGGTATTCCTAATTGAAC 583 55.76 -0.30 -0.675
-0.373 -0.561 1314.0 440 GTGGTATTCCTAATTGAACT 584 57.73 -0.30
-0.387 -0.373 -0.382 1818.7 441 TGGTATTCCTAATTGAACTT 585 55.15
-0.30 -0.765 -0.373 -0.616 880.3 442 GGTATTCCTAATTGAACTTC 586 56.47
-0.30 -0.572 -0.373 -0.496 1419.0 443 GTATTCCTAATTGAACTTCC 587
57.76 -0.30 -0.383 -0.373 -0.379 1567.9 444 TATTCCTAATTGAACTTCCC
588 58.57 -0.30 -0.264 -0.373 -0.306 1959.4 445
ATTCCTAATTGAACTTCCCA 589 60.26 -0.30 -0.016 -0.373 -0.152 2971.8
446 TTCCTAATTGAACTTCCCAG 590 60.45 -0.10 0.013 -0.199 -0.068 1898.5
447 TCCTAATTGAACTTCCCAGA 591 61.36 0.70 0.146 0.496 0.279 1392.3
448 CCTAATTGAACTTCCCAGAA 592 58.27 0.70 -0.308 0.496 -0.002 1143.2
449 CTAATTGAACTTCCCAGAAG 593 54.92 -0.70 -0.800 -0.721 -0.770 427.7
450 TAATTGAACTTCCCAGAAGT 594 55.84 -1.90 -0.664 -1.764 -1.082 148.5
451 AATTGAACTTCCCAGAAGTC 595 57.61 -2.10 -0.404 -1.938 -0.987 259.1
452 ATTGAACTTCCCAGAAGTCT 596 61.42 -2.10 0.154 -1.938 -0.641 -0.751
241.9 453 TTGAACTTCCCAGAAGTCTT 597 61.76 -2.10 0.205 -1.938 -0.609
-0.730 808.1 454 TGAACTTCCCAGAAGTCTTG 598 61.34 -2.10 0.143 -1.938
-0.648 351.6 455 GAACTTCCCAGAAGTCTTGA 599 62.71 -2.10 0.344 -1.938
-0.523 499.7 456 AACTTCCCAGAAGTCTTGAG 600 61.63 -2.10 0.186 -1.938
-0.621 407.4 457 ACTTCCCAGAAGTCTTGAGT 601 66.97 -1.90 0.969 -1.764
-0.069 492.1 458 CTTCCCAGAAGTCTTGAGTT 602 66.75 -1.00 0.937 -0.982
0.208 736.1 459 TTCCCAGAAGTCTTGAGTTC 603 66.31 -0.20 0.872 -0.286
0.432 815.2 460 TCCCAGAAGTCTTGAGTTCT 604 67.98 -1.20 1.116 -1.156
0.253 888.8 461 CCCAGAAGTCTTGAGTTCTC 605 67.98 -1.40 1.116 -1.330
0.187 2021.6 462 CCAGAAGTCTTGAGTTCTCT 606 66.10 -1.40 0.842 -1.330
0.017 1988.5 463 CAGAAGTCTTGAGTTCTCTT 607 62.41 -1.40 0.300 -1.330
-0.319 2008.8 464 AGAAGTCTTGAGTTCTCTTA 608 60.43 -1.20 0.009 -1.156
-0.434 2631.8 465 GAAGTCTTGAGTTCTCTTAT 609 60.20 -0.50 -0.025
-0.547 -0.223 3052.8 466 AAGTCTTGAGTTCTCTTATT 610 59.12 0.30 0.183
0.149 -0.057 3509.3 467 AGTCTTGAGTTCTCTTATTA 611 60.75 0.30 0.056
0.149 0.091 3221.6 468 GTCTTGAGTTCTCTTATTAA 612 58.29 0.30 -0.305
0.149 -0.132 3677.1 469 TCTTGAGTTCTCTTATTAAG 613 55.25 0.30 -0.751
0.149 -0.409 1176.6 470 CTTGAGTTCTCTTATTAAGT 614 57.04 0.10 -0.488
-0.025 -0.312 1168.1 471 TTGAGTTCTCTTATTAAGTT 615 55.29 0.10 -0.745
-0.025 -0.471 666.3 472 TGAGTTCTCTTATTAAGTTC 616 56.35 0.10 -0.589
-0.025 -0.375 674.0 473 GAGTTCTCTTATTAAGTTCT 617 58.57 0.10 -0.263
-0.025 -0.173 1471.4 474 AGTTCTCTTATTAAGTTCTC 618 58.61 0.10 -0.257
-0.025 -0.169 1493.5 475 GTTCTCTTATTAAGTTCTCT 619 60.59 0.10 0.032
-0.025 0.011 2191.5 476 TTCTCTTATTAAGTTCTCTG 620 57.16 0.10 -0.471
-0.025 -0.301 1410.3 477 TCTCTTATTAAGTTCTCTGA 621 58.23 0.10 -0.314
-0.025 -0.204 1262.8 478 CTCTTATTAAGTTCTCTGAA 622 54.79 0.10 -0.817
-0.025 -0.516 1072.9 479 TCTTATTAAGTTCTCTGAAA 623 50.95 0.10 -1.382
-0.025 -0.866 540.9 480 CTTATTAAGTTCTCTGAAAT 624 49.77 0.50 -1.554
0.323 -0.841 539.2 481 TTATTAAGTTCTCTGAAATC 625 48.99 0.50 -1.668
0.323 -0.912 -0.768 709.0 482 TATTAAGTTCTCTGAAATCT 626 50.64 0.50
-1.427 0.323 -0.762 -0.775 978.1 483 ATTAAGTTCTCTGAAATCTA 627 50.64
0.50 -1.427 0.323 -0.762 -0.732 1217.7 484 TTAAGTTCTCTGAAATCTAC 628
51.15 0.50 -1.352 0.323 -0.716 1748.1 485 TAAGTTCTCTGAAATCTACT 629
52.79 0.50 -1.112 0.323 -0.567 2511.5 486 AAGTTCTCTGAAATCTACTA 630
52.79 0.50 -1.112 0.323 -0.567 2997.2 487 AGTTCTCTGAAATCTACTAA 631
52.79 0.50 -1.112 0.323 -0.567 2887.6 488 GTTCTCTGAAATCTACTAAT 632
52.65 0.50 -1.133 0.323 -0.580 4421.3 489 TTCTCTGAAATCTACTAATT 633
50.14 0.70 -1.500 0.496 -0.741 -0.832 1937.7 490
TCTCTGAAATCTACTAATTT 634 50.14 0.20 -1.500 0.062 -0.906 -0.962
1773.3 491 CTCTGAAATCTACTAATTTT 635 49.31 -0.30 -1.622 -0.373
-1.147 -1.102 1491.1 492 TCTGAAATCTACTAATTTTC 636 48.55 -0.60
-1.734 -0.634 -1.316 -1.171 376.6 493 CTGAAATCTACTAATTTTCT 637
49.31 -1.30 -1.622 -1.243 -1.478 -1.178 371.9 494
TGAAATCTACTAATTTTCTC 638 48.55 -1.30 -1.734 -1.243 -1.547 -1.092
415.2 495 GAAATCTACTAATTTTCTCC 639 52.45 -0.90 -1.161 -0.895 -1.060
-0.938 1097.9 496 AAATCTACTAATTTTCTCCA 640 52.47 -0.10 -1.158
-0.199 -0.794 -0.778 1429.1 497 AATCTACTAATTTTCTCCAT 641 54.25 0.90
-0.897 0.670 -0.301 1812.5 498 ATCTACTAATTTTCTCCATT 642 56.46 1.00
-0.572 0.757 -0.067 1943.4 499 TCTACTAATTTTCTCCATTT 643 56.80 0.50
-0.523 0.323 -0.202 1506.1 500 CTACTAATTTTCTCCATTTA 644 54.93 0.50
-0.797 0.323 -0.372 1694.7 501 TACTAATTTTCTCCATTTAG 645 53.14 0.30
-1.060 0.149 -0.600 946.7 502 ACTAATTTTCTCCATTTAGT 646 56.69 -0.70
-0.539 -0.721 -0.608 1114.3 503 CTAATTTTCTCCATTTAGTA 647 55.57 0.00
-0.704 -0.112 -0.479 963.9 504 TAATTTTCTCCATTTAGTAC 648 54.12 0.50
-0.917 0.323 -0.446 1347.9 505 AATTTTCTCCATTTAGTACT 649 56.69 0.70
-0.539 0.496 -0.145 2067.7 506 ATTTTCTCCATTTAGTACTG 650 58.66 0.80
-0.250 0.583 0.067 2724.2 507 TTTTCTCCATTTAGTACTGT 651 61.92 0.60
0.228 0.410 0.297 3367.9 508 TTTCTCCATTTAGTACTGTC 652 63.10 0.60
0.401 0.410 0.404 5235.8 509 TTCTCCATTTAGTACTGTCT 653 64.84 0.60
0.656 0.410 0.562 6423.5 510 TCTCCATTTAGTACTGTCTT 654 64.84 0.60
0.656 0.410 0.562 7758.9 511 CTCCATTTAGTACTGTCTTT 655 63.63 0.60
0.479 0.410 0.453 8001.5 512 TCCATTTAGTACTGTCTTTT 656 61.92 0.60
0.228 0.410 0.297 5512.4 513 CCATTTAGTACTGTCTTTTT 657 60.78 0.60
0.061 0.410 0.194 5300.0 514 CATTTAGTACTGTCTTTTTT 658 57.04 0.80
-0.489 0.583 -0.081 3902.1 515 ATTTAGTACTGTCTTTTTTC 659 57.08 0.80
-0.482 0.583 -0.077 4641.8 516 TTTAGTACTGTCTTTTTTCT 660 59.26 0.80
-0.162 0.583 0.121 4888.4 517 TTAGTACTGTCTTTTTTCTT 661 59.26 0.80
-0.162 0.583 0.121 5477.3 518 TAGTACTGTCTTTTTTCTTT 662 59.26 0.80
-0.162 0.583 0.121 5064.9 519 AGTACTGTCTTTTTTCTTTA 663 59.26 1.00
-0.162 0.757 0.187 5580.3 520 GTACTGTCTTTTTTCTTTAT 664 59.04 2.70
-0.195 2.236 0.729 5478.3 521 TACTGTCTTTTTTCTTTATG 665 55.71 2.90
-0.683 2.410 0.492 2275.5 522 ACTGTCTTTTTTCTTTATGG 666 59.07 1.70
-0.190 1.366 0.402 1730.8 523 CTGTCTTTTTTCTTTATGGC 667 62.92 1.70
0.374 1.366 0.751 2405.5 524 TGTCTTTTTTCTTTATGGCA 668 62.14 1.70
0.260 1.366 0.680 1942.0 525 GTCTTTTTTCTTTATGGCAA 669 60.05 1.50
-0.047 1.192 0.424 2085.6 526 TCTTTTTTCTTTATGGCAAA 670 54.99 0.60
-0.788 0.410 -0.333 493.2 527 CTTTTTTCTTTATGGCAAAT 671 53.75 0.10
-0.971 -0.025 -0.612 532.7 528 TTTTTTCTTTATGGCAAATA 672 51.30 0.10
-1.331 -0.025 -0.835 280.0 529 TTTTTCTTTATGGCAAATAC 673 51.49 0.10
-1.302 -0.025 -0.817 440.8 530 TTTTCTTTATGGCAAATACT 674 53.08 0.10
-1.069 -0.025 -0.672 463.1 531 TTTCTTTATGGCAAATACTG 675 52.74 0.10
-1.119 -0.025 -0.704 579.0 532 TTCTTTATGGCAAATACTGG 676 54.90 0.10
-0.802 -0.025 -0.507 673.7 533 TCTTTATGGCAAATACTGGA 677 55.85 0.10
-0.663 -0.025 -0.421 837.0 534 CTTTATGGCAAATACTGGAG 678 54.78 0.10
-0.820 -0.025 -0.518 1061.9 535 TTTATGGCAAATACTGGAGT 679 55.74 0.30
-0.679 0.149 -0.365 855.0 536 TTATGGCAAATACTGGAGTA 680 54.87 0.60
-0.806 0.410 -0.344 775.0 537 TATGGCAAATACTGGAGTAT 681 54.56 0.00
-0.852 -0.112 -0.571 773.6 535 ATGGCAAATACTGGAGTATT 682 55.42 -1.00
-0.726 -0.982 -0.823 702.5 539 TGGCAAATACTGGAGTATTG 683 55.37 -1.20
-0.733 -1.156 -0.893 -0.775 387.5 540 GGCAAATACTGGAGTATTGT 684
58.33 -1.20 -0.298 -1.156 -0.624 -0.924 435.3 541
GCAAATACTGGAGTATTGTA 685 55.24 -1.20 -0.753 -1.156 -0.906 -0.974
93.7 542 CAAATACTGGAGTATTGTAT 686 51.30 -1.20 -1.331 -1.156 -1.264
-0.913 50.0 543 AAATACTGGAGTATTGTATG 687 49.96 -1.20 -1.527 -1.156
-1.386 -0.809 50.4 544 AATACTGGAGTATTGTATGG 688 54.30 -1.00 -0.890
-0.982 -0.925 64.7 545 ATACTGGAGTATTGTATGGA 689 57.60 -0.30 -0.406
-0.373 -0.394 76.0 546 TACTGGAGTATTGTATGGAT 690 57.60 0.40 -0.406
0.236 -0.162 86.0 547 ACTGGAGTATTGTATGGATT 691 58.53 1.30 -0.269
1.018 0.220 123.4 545 CTGGAGTATTGTATGGATTC 692 59.39 2.00 -0.144
1.627 0.529 121.5 549 TGGAGTATTGTATGGATTCT 693 59.39 1.80 -0.144
1.453 0.463 641.3 550 GGAGTATTGTATGGATTCTC 694 60.95 0.60 0.086
0.410 0.209 161.5 551 GAGTATTGTATGGATTCTCA 695 59.52 0.60 -0.124
0.410 0.079 129.9 552 AGTATTGTATGGATTCTCAG 696 58.31 1.10 -0.302
0.844 0.134 88.7 553 GTATTGTATGGATTCTCAGG 697 60.87 1.10 0.074
0.844 0.367 112.5 554 TATTGTATGGATTCTCAGGC 698 61.97 1.10 0.236
0.844 0.467 134.6 555 ATTGTATGGATTCTCAGGCC 699 66.52 1.10 0.902
0.844 0.880 191.6 556 TTGTATGGATTCTCAGGCCC 700 70.34 0.70 1.463
0.496 1.096 254.5 557 TGTATGGATTCTCAGGCCCA 701 71.11 0.20 1.577
0.062 1.001 332.2 558 GTATGGATTCTCAGGCCCAA 702 68.95 0.00 1.259
-0.112 0.738 415.6 559 TATGGATTCTCAGGCCCAAT 703 65.78 0.00 0.795
-0.112 0.450 285.0 560 ATGGATTCTCAGGCCCAATT 704 66.68 0.00 0.925
-0.112 0.531 464.0 561 TGGATTCTCAGGCCCAATTT 705 67.04 0.20 0.979
0.062 0.630 492.5 562 GGATTCTCAGGCCCAATTTT 706 67.51 1.10 1.048
0.844 0.970 639.7 563 GATTCTCAGGCCCAATTTTT 707 65.34 1.30 0.729
1.018 0.839 512.4 564 ATTCTCAGGCCCAATTTTTG 708 63.94 0.60 0.524
0.410 0.481 393.4 565 TTCTCAGGCCCAATTTTTGA 709 65.24 0.20 0.716
0.062 0.467 334.3 566 TCTCAGGCCCAATTTTTGAA 710 62.85 0.20 0.364
0.062 0.249 308.2 567 CTCAGGCCCAATTTTTGAAA 711 59.62 0.20 -0.109
0.062 -0.044 199.2 568 TCAGGCCCAATTTTTGAAAT 712 57.85 0.20 -0.369
0.062 -0.205 164.3 569 CAGGCCCAATTTTTGAAATT 713 56.95 -0.50 -0.501
-0.547 -0.518 125.6 570 AGGCCCAATTTTTGAAATTT 714 56.09 -1.00 -0.627
-0.982 -0.762 102.6 571 GGCCCAATTTTTGAAATTTT 715 56.23 -1.00 -0.606
-0.982 -0.749 91.6 572 GCCCAATTTTTGAAATTTTC 716 55.07 -1.00 -0.777
-0.982 -0.855 -0.806 76.2 573 CCCAATTTTTGAAATTTTCC 717 54.96 -1.00
-0.792 -0.982 -0.864 -0.881 78.8 574 CCAATTTTTGAAATTTTCCC 718 54.96
-1.00 -0.792 -0.982 -0.864 -0.841 84.8 575 CAATTTTTGAAATTTTCCCT 719
53.17 -1.00 -1.055 -0.982 -1.027 -0.755 162.0 576
AATTTTTGAAATTTTCCCTT 720 52.25 -0.80 -1.190 -0.808 -1.045 539.5 577
ATTTTTGAAATTTTCCCTTC 721 55.17 0.10 -0.762 -0.025 -0.482 1787.3 578
TTTTTGAAATTTTCCCTTCC 722 58.88 0.10 -0.219 -0.025 -0.145 6354.2 579
TTTTGAAATTTTCCCTTCCT 723 60.39 0.10 0.004 -0.025 -0.007 9513.6 580
TTTGAAATTTTCCCTTCCTT 724 60.39 0.10 0.004 -0.025 -0.007 10660.0 581
TTGAAATTTTCCCTTCCTTT 725 60.39 0.10 0.004 -0.025 -0.007 11202.0 582
TGAAATTTTCCCTTCCTTTT 726 60.39 0.10 0.004 -0.025 -0.007 11543.0 583
GAAATTTTCCCTTCCTTTTC 727 61.81 0.40 0.212 0.236 0.221 14774.0 584
AAATTTTCCCTTCCTTTTCC 728 64.17 1.20 0.557 0.931 0.699 0.952 18197.0
585 AATTTTCCCTTCCTTTTCCA 729 67.39 1.70 1.030 1.366 1.158 1.307
21410.0 586 ATTTTCCCTTCCTTTTCCAT 730 69.58 4.00 1.351 3.366 2.117
1.679 22869.0 587 TTTTCCCTTCCTTTTCCATT 731 69.96 5.00 1.408 4.236
2.482 2.039 21818.0 588 TTTCCCTTCCTTTTCCATTT 732 69.96 5.00 1.408
4.236 2.482 2.113 21341.0 589 TTCCCTTCCTTTTCCATTTC 733 71.19 5.00
1.588 4.236 2.594 2.085 22063.0 590 TCCCTTCCTTTTCCATTTCT 734 72.77
5.00 1.820 4.236 2.738 1.863 22152.0 591 CCCTTCCTTTTCCATTTCTG 735
71.01 0.90 1.561 0.670 1.223 1.571 20764.0 592 CCTTCCTTTTCCATTTCTGT
736 70.68 0.20 1.513 0.062 0.961 1.289 12579.0 593
CTTCCTTTTCCATTTCTGTA 737 66.30 0.20 0.870 0.062 0.563 0.945 9036.3
594 TTCCTTTTCCATTTCTGTAC 738 64.87 0.20 0.660 0.062 0.433 8251.8
595 TCCTTTTCCATTTCTGTACA 739 65.74 0.20 0.788 0.062 0.512 20788.0
596 CCTTTTCCATTTCTGTACAA 740 62.11 0.20 0.256 0.062 0.182 7073.9
597 CTTTTCCATTTCTGTACAAA 741 56.39 0.20 -0.583 0.062 -0.338 2932.4
598 TTTTCCATTTCTGTACAAAT 742 54.49 0.20 -0.862 0.062 -0.511 1897.3
599 TTTCCATTTCTGTACAAATT 743 54.49 -0.30 -0.862 -0.373 -0.676
2158.1 600 TTCCATTTCTGTACAAATTT 744 54.49 -0.30 -0.862 -0.373
-0.676 2215.9 601 TCCATTTCTGTACAAATTTC 745 55.43 -0.30 -0.724
-0.373 -0.591 2168.6 602 CCATTTCTGTACAAATTTCT 746 56.07 -0.30
-0.631 -0.373 -0.533 2025.8 603 CATTTCTGTACAAATTTCTA 747 51.65
-0.30 -1.278 -0.373 -0.934 1277.2 604 ATTTCTGTACAAATTTCTAC 748
50.83 -0.10 -1.398 -0.199 -0.943 -0.736 1944.8 605
TTTCTGTACAAATTTCTACT 749 52.78 0.40 -1.112 0.236 -0.600 -0.790
2504.3 606 TTCTGTACAAATTTCTACTA 750 51.90 0.40 -1.242 0.236 -0.681
-0.876 2941.5 607 TCTGTACAAATTTCTACTAA 751 49.84 0.40 -1.544 0.236
-0.868 -0.846 2694.8 608 CTGTACAAATTTCTACTAAT 752 48.73 0.40 -1.707
0.236 -0.969 -0.827 2610.7 609 TGTACAAATTTCTACTAATG 753 46.88 0.40
-1.979 0.236 -1.137 -0.845 1678.1 610 GTACAAATTTCTACTAATGC 754
50.66 0.60 -1.424 0.410 -0.727 -0.854 5877.3 611
TACAAATTTCTACTAATGCT 755 49.82 0.60 -1.547 0.410 -0.803 -0.849
4461.0 612 ACAAATTTCTACTAATGCTT 756 50.65 0.60 -1.425 0.410 -0.728
-0.816 5943.2 613 CAAATTTCTACTAATGCTTT 757 50.46 0.60 -1.453 0.410
-0.745 -0.753 6492.9 614 AAATTTCTACTAATGCTTTT 758 49.47 0.60 -1.599
0.410 -0.836 -0.745 6875.0 615 AATTTCTACTAATGCTTTTA 759 50.61 0.60
-1.431 0.410 -0.731 7950.3 616 ATTTCTACTAATGCTTTTAT 760
52.40 0.20 -1.169 0.062 -0.701 8314.8 617 TTTCTACTAATGCTTTTATT 761
52.72 0.20 -1.122 0.062 -0.672 6885.8 618 TTCTACTAATGCTTTTATTT 762
52.72 0.20 -1.122 0.062 -0.672 6443.2 619 TCTACTAATGCTTTTATTTT 763
52.72 0.20 -1.122 0.062 -0.672 -0.731 6331.0 620
CTACTAATGCTTTTATTTTT 764 51.81 0.20 -1.255 0.062 -0.755 5952.5 621
TACTAATGCTTTTATTTTTT 765 50.18 0.20 -1.494 0.062 -0.903 2662.8 622
ACTAATGCTTTTATTTTTTC 766 51.96 0.20 -1.233 0.062 -0.741 3034.0 623
CTAATGCTTTTATTTTTTCT 767 53.41 0.20 -1.021 0.062 -0.609 2198.5 624
TAATGCTTTTATTTTTTCTT 768 51.76 0.40 -1.263 0.236 -0.694 1670.1 625
AATGCTTTTATTTTTTCTTC 769 53.61 1.10 -0.992 0.844 -0.294 3039.4 626
ATGCTTTTATTTTTTCTTCT 770 57.66 2.10 -0.397 1.714 0.405 3873.8 627
TGCTTTTATTTTTTCTTCTG 771 57.60 2.80 -0.406 2.323 0.631 3609.7 628
GCTTTTATTTTTTCTTCTGT 772 60.96 3.10 0.087 2.583 1.036 4891.4 629
CTTTTATTTTTTCTTCTGTC 773 57.96 3.10 -0.353 2.583 0.763 3071.6 630
TTTTATTTTTTCTTCTGTCA 774 57.22 3.10 -0.461 2.583 0.696 2667.2 631
TTTATTTTTTCTTCTGTCAA 775 54.81 1.70 -0.816 1.366 0.013 2293.1 632
TTATTTTTTCTTCTGTCAAT 776 54.46 1.20 -0.866 0.931 -0.183 2123.0 633
TATTTTTTCTTCTGTCAATG 777 54.08 1.20 -0.922 0.931 -0.218 1914.7 634
ATTTTTTCTTCTGTCAATGG 778 57.36 1.20 -0.442 0.931 0.080 2174.1 635
TTTTTTCTTCTGTCAATGGC 779 61.67 1.20 0.192 0.931 0.473 3659.7 636
TTTTTCTTCTGTCAATGGCC 780 65.26 1.20 0.717 0.931 0.799 5217.7 637
TTTTCTTCTGTCAATGGCCA 781 66.11 1.20 0.843 0.931 0.877 4559.7 638
TTTCTTCTGTCAATGGCCAT 782 65.73 1.00 0.787 0.757 0.776 4347.7 639
TTCTTCTGTCAATGGCCATT 783 65.73 1.00 0.787 0.757 0.776 5267.4 640
TCTTCTGTCAATGGCCATTG 784 65.26 -0.60 0.718 -0.634 0.204 3922.8 641
CTTCTGTCAATGGCCATTGT 785 66.97 -1.30 0.968 -1.243 0.128 3608.6 642
TTCTGTCAATGGCCATTGTT 786 65.36 -1.30 0.733 -1.243 -0.018 1881.6 643
TCTGTCAATGGCCATTGTTT 787 65.36 -1.30 0.733 -1.243 -0.018 1658.0 644
CTGTCAATGGCCATTGTTTA 788 63.32 -1.30 0.433 -1.243 -0.204 1369.8 645
TGTCAATGGCCATTGTTTAA 789 59.38 -1.30 -0.144 -1.243 -0.562 605.8 646
GTCAATGGCCATTGTTTAAC 790 59.99 -1.30 -0.055 -1.243 -0.506 933.2 647
TCAATGGCCATTGTTTAACT 791 58.93 -1.30 -0.211 -1.243 -0.603 441.8 648
CAATGGCCATTGTTTAACTT 792 57.97 -0.90 -0.352 -0.895 -0.558 545.6 649
AATGGCCATTGTTTAACTTT 793 57.07 0.90 -0.483 0.670 -0.045 781.4 650
ATGGCCATTGTTTAACTTTT 794 59.31 0.90 -0.156 0.670 0.158 1027.3 651
TGGCCATTGTTTAACTTTTG 795 59.24 0.90 -0.165 0.670 0.152 1102.5 652
GGCCATTGTTTAACTTTTGG 796 61.84 0.30 0.216 0.149 0.190 935.7 653
GCCATTGTTTAACTTTTGGG 797 61.84 -0.10 0.216 -0.199 0.058 403.7 654
CCATTGTTTAACTTTTGGGC 798 61.84 0.30 0.216 0.149 0.190 269.3 655
CATTGTTTAACTTTTGGGCC 799 61.84 0.90 0.216 0.670 0.389 296.8 656
ATTGTTTAACTTTTGGGCCA 800 61.84 0.90 0.216 0.670 0.389 449.4 657
TTGTTTAACTTTTGGGCCAT 801 61.84 0.90 0.216 0.670 0.389 448.1 658
TGTTTAACTTTTGGGCCATC 802 62.91 0.90 0.373 0.670 0.486 584.9 659
GTTTAACTTTTGGGCCATCC 803 66.73 0.40 0.934 0.236 0.669 1032.4 660
TTTAACTTTTGGGCCATCCA 804 64.79 -0.70 0.649 -0.721 0.128 737.8 661
TTAACTTTTGGGCCATCCAT 805 64.44 -1.20 0.598 -1.156 -0.069 950.2 662
TAACTTTTGGGCCATCCATT 806 64.44 -1.20 0.598 -1.156 -0.069 1308.0 663
AACTTTTGGGCCATCCATTC 807 66.42 -1.20 0.888 -1.156 0.111 2360.1 664
ACTTTTGGGCCATCCATTCC 808 72.21 -1.20 1.738 -1.156 0.638 4946.0 665
CTTTTGGGCCATCCATTCCT 809 73.53 -1.20 1.930 -1.156 0.758 6789.2 666
TTTTGGGCCATCCATTCCTG 810 71.49 -1.20 1.632 -1.156 0.573 8150.6 667
TTTGGGCCATCCATTCCTGG 811 73.62 -1.20 1.945 -1.156 0.766 7589.0 668
TTGGGCCATCCATTCCTGGC 812 77.43 -2.80 2.504 -2.547 0.584 13914.0 669
TGGGCCATCCATTCCTGGCT 813 78.94 -3.50 2.725 -3.156 0.490 17513.0 670
GGGCCATCCATTCCTGGCTT 814 79.51 -3.50 2.809 -3.156 0.542 19883.0 671
GGCCATCCATTCCTGGCTTT 815 77.37 -3.50 2.494 -3.156 0.347 20103.0 672
GCCATCCATTCCTGGCTTTA 816 74.28 -3.10 2.040 -2.808 0.198 18622.0 673
CCATCCATTCCTGGCTTTAA 817 67.92 -1.30 1.109 -1.243 0.215 16915.0 674
CATCCATTCCTGGCTTTAAT 818 64.36 -1.30 0.585 -1.243 -0.109 13910.0
675 ATCCATTCCTGGCTTTAATT 819 63.53 -1.30 0.464 -1.243 -0.185
12524.0 676 TCCATTCCTGGCTTTAATTT 820 63.88 -1.30 0.516 -1.243
-0.152 11890.0 677 CCATTCCTGGCTTTAATTTT 821 62.81 -0.90 0.359
-0.895 -0.118 12839.0 678 CATTCCTGGCTTTAATTTTA 822 58.55 0.90
-0.266 0.670 0.090 9726.8 679 ATTCCTGGCTTTAATTTTAC 823 57.84 1.50
-0.371 1.192 0.223 8499.7 680 TTCCTGGCTTTAATTTTACT 824 59.78 1.90
-0.086 1.540 0.532 6800.4 681 TCCTGGCTTTAATTTTACTG 825 59.37 1.90
-0.146 1.540 0.494 5445.6 682 CCTGGCTTTAATTTTACTGG 826 60.53 1.90
0.024 1.540 0.600 2901.6 683 CTGGCTTTAATTTTACTGGT 827 59.77 1.90
-0.087 1.540 0.531 1174.2 684 TGGCTTTAATTTTACTGGTA 828 57.25 1.90
-0.458 1.540 0.301 521.3 685 GGCTTTAATTTTACTGGTAC 829 57.86 1.90
-0.368 1.540 0.357 611.1 686 GCTTTAATTTTACTGGTACA 830 56.55 1.80
-0.560 1.453 0.205 287.6 687 CTTTAATTTTACTGGTACAG 831 52.66 0.40
-1.130 0.236 -0.611 109.5 688 TTTAATTTTACTGGTACAGT 832 53.62 -0.80
-0.989 -0.808 -0.920 59.5 689 TTAATTTTACTGGTACAGTC 833 54.59 -1.00
-0.847 -0.982 -0.898 62.1 690 TAATTTTACTGGTACAGTCT 834 56.28 -1.00
-0.599 -0.982 -0.745 59.4 691 AATTTTACTGGTACAGTCTC 835 58.27 -1.00
-0.308 -0.982 -0.564 68.0 692 ATTTTACTGGTACAGTCTCA 836 61.78 -1.00
0.207 -0.982 -0.245 72.9 693 TTTTACTGGTACAGTCTCAA 837 59.61 -1.00
-0.111 -0.982 -0.442 62.2 694 TTTACTGGTACAGTCTCAAT 838 59.25 -1.00
-0.164 -0.982 -0.475 64.5 695 TTACTGGTACAGTCTCAATA 839 58.30 -1.00
-0.303 -0.982 -0.561 53.5 696 TACTGGTACAGTCTCAATAG 840 58.15 -1.00
-0.326 -0.982 -0.575 57.8 697 ACTGGTACAGTCTCAATAGG 841 61.44 -0.80
0.157 -0.808 -0.210 341.0 698 CTGGTACAGTCTCAATAGGG 842 63.55 0.10
0.467 -0.025 0.280 54.8 699 TGGTACAGTCTCAATAGGGC 843 65.89 1.10
0.810 0.844 0.823 47.1 700 GGTACAGTCTCAATAGGGCT 844 68.08 0.90
1.131 0.670 0.956 59.7 701 GTACAGTCTCAATAGGGCTA 845 64.73 0.70
0.640 0.496 0.586 47.0 702 TACAGTCTCAATAGGGCTAA 846 59.35 0.70
-0.149 0.496 0.096 49.3 703 ACAGTCTCAATAGGGCTAAT 847 59.91 0.70
-0.067 0.496 0.147 55.0 704 CAGTCTCAATAGGGCTAATG 848 59.29 0.70
-0.158 0.496 0.091 49.0 705 AGTCTCAATAGGGCTAATGG 849 60.62 0.90
0.037 0.670 0.278 45.7 706 GTCTCAATAGGGCTAATGGG 850 63.00 1.10
0.386 0.844 0.560 115.6 707 TCTCAATAGGGCTAATGGGA 851 61.22 0.40
0.125 0.236 0.167 50.6 708 CTCAATAGGGCTAATGGGAA 852 57.97 1.40
-0.352 1.105 0.202 48.0 709 TCAATAGGGCTAATGGGAAA 853 54.39 1.40
-0.877 1.105 -0.124 50.5 710 CAATAGGGCTAATGGGAAAA 854 51.64 1.80
-1.281 1.453 -0.242 44.1 711 AATAGGGCTAATGGGAAAAT 855 50.45 1.90
-1.454 1.540 -0.316 43.1 712 ATAGGGCTAATGGGAAAATT 856 52.34 1.00
-1.178 0.757 -0.442 45.2 713 TAGGGCTAATGGGAAAATTT 857 52.63 0.50
-1.135 0.323 -0.581 47.4 714 AGGGCTAATGGGAAAATTTA 858 52.63 0.50
-1.135 0.323 -0.581 50.0 715 GGGCTAATGGGAAAATTTAA 859 50.89 0.50
-1.390 0.323 -0.739 -0.867 47.8 716 GGCTAATGGGAAAATTTAAA 860 47.14
0.50 -1.940 0.323 -1.080 -1.022 50.2 717 GCTAATGGGAAAATTTAAAG 861
45.00 0.50 -2.254 0.323 -1.275 -1.096 43.0 718 CTAATGGGAAAATTTAAAGT
862 43.95 0.50 -2.408 0.323 -1.371 -1.088 57.0 719
TAATGGGAAAATTTAAAGTG 863 42.27 0.50 -2.655 0.323 -1.524 -1.072 58.7
720 AATGGGAAAATTTAAAGTGC 864 46.18 0.70 -2.081 0.496 -1.102 -1.011
183.6 721 ATGGGAAAATTTAAAGTGCA 865 48.90 1.70 -1.682 1.366 -0.524
-0.924 303.4 722 TGGGAAAATTTAAAGTGCAA 866 47.39 1.80 -1.903 1.453
-0.628 -0.837 135.7 723 GGGAAAATTTAAAGTGCAAC 867 47.84 1.60 -1.838
1.279 -0.653 -0.766 241.7 724 GGAAAATTTAAAGTGCAACC 868 49.12 1.20
-1.649 0.931 -0.669 -0.737 132.5 725 GAAAATTTAAAGTGCAACCA 869 48.09
1.20 -1.801 0.931 -0.763 -0.758 128.8 726 AAAATTTAAAGTGCAACCAA 870
45.57 1.10 -2.171 0.844 -1.025 141.0 727 AAATTTAAAGTGCAACCAAT 871
46.97 1.10 -1.965 0.844 -0.897 282.0 728 AATTTAAAGTGCAACCAATC 872
49.46 1.10 -1.599 0.844 -0.671 948.6 729 ATTTAAAGTGCAACCAATCT 873
52.84 1.10 -1.104 0.844 -0.363 1815.1 730 TTTAAAGTGCAACCAATCTG 874
52.81 1.10 -1.109 0.844 -0.366 3188.2 731 TTAAAGTGCAACCAATCTGA 875
53.71 1.00 -0.976 0.757 -0.317 3566.1 732 TAAAGTGCAACCAATCTGAG 876
53.56 1.00 -0.999 0.757 -0.331 2925.1 733 AAAGTGCAACCAATCTGAGT 877
56.81 1.00 -0.522 0.757 -0.036 3233.2 734 AAGTGCAACCAATCTGAGTC 878
59.99 1.00 -0.055 0.757 0.254 3615.6 735 AGTGCAACCAATCTGAGTCA 879
63.25 1.00 0.422 0.757 0.550 3994.8 736 GTGCAACCAATCTGAGTCAA 880
61.00 1.00 0.093 0.757 0.345 4033.0 737 TGCAACCAATCTGAGTCAAC 881
58.62 1.00 -0.257 0.757 0.128 3380.2 738 GCAACCAATCTGAGTCAACA 882
59.87 1.00 -0.073 0.757 0.242 4288.7 739 CAACCAATCTGAGTCAACAG 883
56.22 -0.30 -0.608 -0.373 -0.519 744.1 740 AACCAATCTGAGTCAACAGA 884
56.24 -1.60 -0.605 -1.504 -0.946 -0.757 392.2 741
ACCAATCTGAGTCAACAGAT 885 58.10 -2.30 -0.332 -2.112 -1.009 -1.030
158.1 742 CCAATCTGAGTCAACAGATT 886 57.90 -3.30 -0.362 -2.982 -1.357
-1.219 70.8 743 CAATCTGAGTCAACAGATTT 887 54.41 -3.80 -0.874 -3.417
-1.840 -1.262 190.0 744 AATCTGAGTCAACAGATTTC 888 54.37 -3.60 -0.880
-3.243 -1.778 -1.168 87.7 745 ATCTGAGTCAACAGATTTCT 889 58.37 -2.60
-0.293 -2.373 -1.084 -1.017 152.7 746 TCTGAGTCAACAGATTTCTT 890
58.73 -1.90 -0.241 -1.764 -0.820 -0.797 270.5 747
CTGAGTCAACAGATTTCTTC 891 58.73 -0.30 -0.241 -0.373 -0.291 498.7 748
TGAGTCAACAGATTTCTTCC 892 60.70 0.20 0.049 0.062 0.054 891.0 749
GAGTCAACAGATTTCTTCCA 893 62.06 0.20 0.248 0.062 0.177 1509.8 750
AGTCAACAGATTTCTTCCAA 894 58.66 0.20 -0.250 0.062 -0.132 1009.3 751
GTCAACAGATTTCTTCCAAT 895 58.47 0.20 -0.279 0.062 -0.149 1198.0 752
TCAACAGATTTCTTCCAATT 896 55.86 0.20 -0.661 0.062 -0.387 680.5 753
CAACAGATTTCTTCCAATTA 897 54.08 0.20 -0.922 0.062 -0.548 762.5 754
AACAGATTTCTTCCAATTAT 898 52.82 0.20 -1.107 0.062 -0.663 689.8 755
ACAGATTTCTTCCAATTATG 899 54.58 0.20 -0.849 0.062 -0.503 715.1 756
CAGATTTCTTCCAATTATGT 900 56.99 0.20 -0.496 0.062 -0.284 833.8 757
AGATTTCTTCCAATTATGTT 901 56.02 0.20 -0.638 0.062 -0.372 1067.7 758
GATTTCTTCCAATTATGTTG 902 55.80 0.30 -0.670 0.149 -0.359 1225.9 759
ATTTCTTCCAATTATGTTGA 903 55.80 -0.10 -0.670 -0.199 -0.491 1028.7
760 TTTCTTCCAATTATGTTGAC 904 56.34 -0.10 -0.591 -0.199 -0.442
1419.0 761 TTCTTCCAATTATGTTGACA 905 57.29 -0.10 -0.452 -0.199
-0.356 1437.4 762 TCTTCCAATTATGTTGACAG 906 57.14 -0.10 -0.474
-0.199 -0.369 1518.3 763 CTTCCAATTATGTTGACAGG 907 58.36 -0.10
-0.295 -0.199 -0.259 1560.3 764 TTCCAATTATGTTGACAGGT 908 59.43
-0.10 -0.138 -0.199 -0.161 1100.0 765 TCCAATTATGTTGACAGGTG 909
59.02 -0.10 -0.198 -0.199 -0.198 1096.4 766 CCAATTATGTTGACAGGTGT
910 60.68 -0.10 0.046 -0.199 -0.047 1103.4 767 CAATTATGTTGACAGGTGTA
911 56.24 0.30 -0.605 0.149 -0.319 738.1 768 AATTATGTTGACAGGTGTAG
912 55.09 1.10 -0.774 0.844 -0.159 596.7 769 ATTATGTTGACAGGTGTAGG
913 59.83 1.10 -0.079 0.844 0.272 548.1 770 TTATGTTGACAGGTGTAGGT
914 63.16 1.10 0.409 0.844 0.575 701.1 771 TATGTTGACAGGTGTAGGTC 915
64.38 -0.20 0.588 -0.286 0.256 724.7 772 ATGTTGACAGGTGTAGGTCC 916
69.08 -0.60 1.278 -0.634 0.551 1129.8 773 TGTTGACAGGTGTAGGTCCT 917
71.21 -0.60 1.591 -0.634 0.745 1214.0 774 GTTGACAGGTGTAGGTCCTA 918
70.75 -0.60 1.523 -0.634 0.703 1425.4 775 TTGACAGGTGTAGGTCCTAC 919
67.83 -0.60 1.095 -0.634 0.438 838.8 776 TGACAGGTGTAGGTCCTACT 920
69.52 -0.90 1.343 -0.895 0.493 1173.1 777 GACAGGTGTAGGTCCTACTA 921
69.06 -0.90 1.275 -0.895 0.450 1367.0 778 ACAGGTGTAGGTCCTACTAA 922
65.30 -0.90 0.723 -0.895 0.108 872.0 779 CAGGTGTAGGTCCTACTAAT 923
64.69 -0.90 0.634 -0.895 0.053 897.6 780 AGGTGTAGGTCCTACTAATA 924
62.84 -0.90 0.362 -0.895 -0.115 962.2 781 GGTGTAGGTCCTACTAATAC 925
63.19 -0.90 0.414 -0.895 -0.083 1382.6 782 GTGTAGGTCCTACTAATACT 926
62.53 -0.90 0.317 -0.895 -0.143 1132.9 783 TGTAGGTCCTACTAATACTG 927
59.27 -0.90 -0.160 -0.895 -0.439 1180.7 784 GTAGGTCCTACTAATACTGT
928 62.53 -0.50 0.317 -0.547 -0.011 1932.9 785 TAGGTCCTACTAATACTGTA
929 58.77 0.70 -0.234 0.496 0.043 1634.4 786 AGGTCCTACTAATACTGTAC
930 59.91 0.50 -0.067 0.323 0.081 2488.1 787 GGTCCTACTAATACTGTACC
931 63.54 0.50 0.466 0.323 0.411 3560.9 788 GTCCTACTAATACTGTACCT
932 62.91 0.50 0.373 0.323 0.354 3850.1 789 TCCTACTAATACTGTACCTA
933 59.31 0.50 -0.155 0.323 0.026 1879.0 790 CCTACTAATACTGTACCTAT
934 57.99 0.50 -0.348 0.323 -0.093 1920.4 791 CTACTAATACTGTACCTATA
935 53.68 0.50 -0.981 0.323 -0.486 1131.2 792 TACTAATACTGTACCTATAG
936 51.92 0.70 -1.240 0.496 -0.580 756.5 793 ACTAATACTGTACCTATAGC
937 56.45 1.20 -0.574 0.931 -0.002 1881.3 794 CTAATACTGTACCTATAGCT
938 57.85 1.20 -0.369 0.931 0.125 2033.6 795 TAATACTGTACCTATAGCTT
939 56.25 1.20 -0.604 0.931 -0.021 1853.9 796 AATACTGTACCTATAGCTTT
940 57.14 1.20 -0.473 0.931 0.060 2462.6 797 ATACTGTACCTATAGCTTTA
941 58.55 1.20 -0.266 0.931 0.189 2436.8 798 TACTGTACCTATAGCTTTAT
942 58.55 1.20 -0.266 0.931 0.189 1865.2 799 ACTGTACCTATAGCTTTATG
943 59.06 1.20 -0.192 0.931 0.235 1682.1 800 CTGTACCTATAGCTTTATGT
944 61.64 1.30 0.187 1.018 0.503 1551.3 801 TGTACCTATAGCTTTATGTC
945 61.08 1.10 0.105 0.844 0.386 1600.1 802 GTACCTATAGCTTTATGTCC
946 65.16 1.10 0.703 0.844 0.757 4094.6 803 TACCTATAGCTTTATGTCCA
947 63.16 1.10 0.409 0.844 0.575 2794.2 804 ACCTATAGCTTTATGTCCAC
948 64.30 1.30 0.577 1.018 0.745 4754.9 805 CCTATAGCTTTATGTCCACA
949 64.94 1.30 0.671 1.018 0.803 4185.4 806 CTATAGCTTTATGTCCACAG
950 61.34 1.10 0.143 0.844 0.409 3284.3 807 TATAGCTTTATGTCCACAGA
951 60.70 1.10 0.048 0.844 0.351 2819.7 808 ATAGCTTTATGTCCACAGAT
952 61.27 0.60 0.132 0.410 0.238 3545.1 809 TAGCTTTATGTCCACAGATT
953 61.63 0.60 0.186 0.410 0.271 4232.6 810 AGCTTTATGTCCACAGATTT
954 62.57 0.60 0.324 0.410 0.356 5252.8 811 GCTTTATGTCCACAGATTTC
955 63.85 0.60 0.511 0.410 0.472 6823.9 812 CTTTATGTCCACAGATTTCT
956 61.56 0.60 0.176 0.410 0.265 4829.8 813 TTTATGTCCACAGATTTCTA
957 58.97 0.60 -0.205 0.410 0.029 4333.7 814 TTATGTCCACAGATTTCTAT
958 58.62 0.60 -0.257 0.410 -0.004 3801.0 815 TATGTCCACAGATTTCTATG
959 58.20 0.60 -0.318 0.410 -0.041 3528.2 816 ATGTCCACAGATTTCTATGA
960 60.12 0.60 -0.036 0.410 0.134 2080.0 817 TGTCCACAGATTTCTATGAG
961 60.34 0.60 -0.004 0.410 0.153 913.8 818 GTCCACAGATTTCTATGAGT
962 63.68 0.60 0.486 0.410 0.457 1228.3 819 TCCACAGATTTCTATGAGTA
963 59.83 0.80 -0.078 0.583 0.173 238.1 820 CCACAGATTTCTATGAGTAT
964 58.43 1.10 -0.285 0.844 0.144 219.4 821 CACAGATTTCTATGAGTATC
965 55.78 0.90 -0.673 0.670 -0.162 138.6 822 ACAGATTTCTATGAGTATCT
966 56.48 -0.10 -0.571 -0.199 -0.430 112.7 823 CAGATTTCTATGAGTATCTG
967 55.85 -1.30 -0.663 -1.243 -0.883 133.8 824 AGATTTCTATGAGTATCTGA
968 55.87 -0.10 -0.659 -0.199 -0.485 296.8 825 GATTTCTATGAGTATCTGAT
969 55.69 0.60 -0.686
0.410 -0.270 279.7 826 ATTTCTATGAGTATCTGATC 970 55.67 0.80 -0.689
0.583 -0.206 484.4 827 TTTCTATGAGTATCTGATCA 971 57.06 0.20 -0.485
0.062 -0.277 502.0 828 TTCTATGAGTATCTGATCAT 972 56.70 -0.50 -0.538
-0.547 -0.541 637.3 829 TCTATGAGTATCTGATCATA 973 55.75 -1.10 -0.678
-1.069 -0.826 489.0 830 CTATGAGTATCTGATCATAC 974 54.95 -1.30 -0.794
-1.243 -0.965 808.7 831 TATGAGTATCTGATCATACT 975 54.95 -1.10 -0.794
-1.069 -0.899 -0.783 903.2 832 ATGAGTATCTGATCATACTG 976 55.49 -1.20
-0.715 -1.156 -0.883 1709.3 833 TGAGTATCTGATCATACTGT 977 58.64
-1.20 -0.254 -1.156 -0.597 2103.9 834 GAGTATCTGATCATACTGTC 978
60.20 -1.20 -0.025 -1.156 -0.455 3973.4 835 AGTATCTGATCATACTGTCT
979 60.88 -1.00 0.076 -0.982 -0.326 6462.3 836 GTATCTGATCATACTGTCTT
980 61.03 -0.30 0.097 -0.373 -0.081 9749.0 837 TATCTGATCATACTGTCTTA
981 57.16 0.90 -0.470 0.670 -0.037 7817.2 838 ATCTGATCATACTGTCTTAC
982 58.34 0.90 -0.298 0.670 0.070 9683.1 839 TCTGATCATACTGTCTTACT
983 60.42 0.90 0.008 0.670 0.259 8089.0 840 CTGATCATACTGTCTTACTT
984 59.32 0.90 -0.154 0.670 0.159 8696.8 841 TGATCATACTGTCTTACTTT
985 57.63 0.90 -0.401 0.670 0.006 6880.5 842 GATCATACTGTCTTACTTTG
986 57.63 0.90 -0.401 0.670 0.006 7033.7 843 ATCATACTGTCTTACTTTGA
987 57.63 0.90 -0.401 0.670 0.006 5406.5 844 TCATACTGTCTTACTTTGAT
988 57.63 0.70 -0.401 0.496 -0.060 4239.4 845 CATACTGTCTTACTTTGATA
989 55.68 0.70 -0.688 0.496 -0.238 3727.4 846 ATACTGTCTTACTTTGATAA
990 52.44 0.70 -1.163 0.496 -0.533 2665.5 847 TACTGTCTTACTTTGATAAA
991 50.65 0.70 -1.426 0.496 -0.696 1817.8 848 ACTGTCTTACTTTGATAAAA
992 49.49 -0.30 -1.595 -0.373 -1.131 -0.809 1335.9 849
CTGTCTTACTTTGATAAAAC 993 49.49 -0.50 -1.595 -0.547 -1.197 -0.916
1526.2 850 TGTCTTACTTTGATAAAACC 994 51.45 -0.50 -1.309 -0.547
-1.019 -0.949 822.7 851 GTCTTACTTTGATAAAACCT 995 53.32 -0.50 -1.034
-0.547 -0.849 -0.966 1227.4 852 TCTTACTTTGATAAAACCTC 996 51.75
-0.50 -1.264 -0.547 -0.991 -0.946 503.0 853 CTTACTTTGATAAAACCTCC
997 54.28 -0.50 -0.894 -0.547 -0.762 -0.910 1174.3 854
TTACTTTGATAAAACCTCCA 998 53.70 -0.50 -0.978 -0.547 -0.814 -0.901
885.5 855 TACTTTGATAAAACCTCCAA 999 51.79 -0.50 -1.259 -0.547 -0.988
-0.916 650.6 856 ACTTTGATAAAACCTCCAAT 1000 52.29 -0.50 -1.185
-0.547 -0.943 -0.826 615.4 857 CTTTGATAAAACCTCCAATT 1001 52.11
-0.50 -1.212 -0.547 -0.959 563.4 858 TTTGATAAAACCTCCAATTC 1002
51.46 -0.30 -1.307 -0.373 -0.952 420.9 859 TTGATAAAACCTCCAATTCC
1003 54.68 0.60 -0.834 0.410 -0.362 536.6 860 TGATAAAACCTCCAATTCCC
1004 57.79 0.60 -0.378 0.410 -0.079 1417.8 861 GATAAAACCTCCAATTCCCC
1005 61.15 1.00 0.114 0.757 0.359 4351.2 862 ATAAAACCTCCAATTCCCCC
1006 63.24 1.90 0.421 1.540 0.846 7738.7 863 TAAAACCTCCAATTCCCCCT
1007 64.88 1.90 0.663 1.540 0.996 11136.0 864 AAAACCTCCAATTCCCCCTA
1008 64.88 1.90 0.663 1.540 0.996 1.074 14811.0 865
AAACCTCCAATTCCCCCTAT 1009 66.73 1.90 0.933 1.540 1.164 1.261
15751.0 866 AACCTCCAATTCCCCCTATC 1010 70.07 1.80 1.424 1.453 1.435
1.330 19661.0 867 ACCTCCAATTCCCCCTATCA 1011 73.21 1.80 1.883 1.453
1.720 1.335 20301.0 868 CCTCCAATTCCCCCTATCAT 1012 72.64 1.80 1.801
1.453 1.669 1.327 19376.0 869 CTCCAATTCCCCCTATCATT 1013 69.66 1.60
1.364 1.279 1.332 1.254 17642.0 870 TCCAATTCCCCCTATCATTT 1014 68.21
1.10 1.150 0.844 1.034 1.093 13751.0 871 CCAATTCCCCCTATCATTTT 1015
67.12 1.10 0.991 0.844 0.935 0.931 12669.0 872 CAATTCCCCCTATCATTTTT
1016 64.02 1.10 0.536 0.844 0.653 9255.9 873 AATTCCCCCTATCATTTTTG
1017 62.80 0.40 0.357 0.236 0.311 8929.1 874 ATTCCCCCTATCATTTTTGG
1018 67.28 0.00 1.014 -0.112 0.586 6148.2 875 TTCCCCCTATCATTTTTGGT
1019 70.46 0.00 1.480 -0.112 0.875 5468.0 876 TCCCCCTATCATTTTTGGTT
1020 70.46 0.00 1.480 -0.112 0.875 5803.7 877 CCCCCTATCATTTTTGGTTT
1021 69.27 0.00 1.307 -0.112 0.768 5192.0 878 CCCCTATCATTTTTGGTTTC
1022 67.18 0.00 1.000 -0.112 0.577 3557.4 879 CCCTATCATTTTTGGTTTCC
1023 67.18 0.00 1.000 -0.112 0.577 5274.3 880 CCTATCATTTTTGGTTTCCA
1024 64.63 0.00 0.625 -0.112 0.345 3787.9 881 CTATCATTTTTGGTTTCCAT
1025 60.77 -0.50 0.059 -0.547 -0.171 2726.8 882
TATCATTTTTGGTTTCCATC 1026 60.20 -0.50 -0.025 -0.547 -0.223 3249.9
883 ATCATTTTTGGTTTCCATCT 1027 62.83 -0.50 0.361 -0.547 0.016 5548.9
884 TCATTTTTGGTTTCCATCTT 1028 63.21 -0.50 0.416 -0.547 0.050 5290.0
885 CATTTTTGGTTTCCATCTTC 1029 63.21 -0.50 0.416 -0.547 0.050 7451.0
886 ATTTTTGGTTTCCATCTTCC 1030 65.88 -0.50 0.809 -0.547 0.293
11578.0 887 TTTTTGGTTTCCATCTTCCT 1031 67.93 -0.50 1.109 -0.547
0.480 13722.0 888 TTTTGGTTTCCATCTTCCTG 1032 67.42 -0.50 1.035
-0.547 0.434 15064.0 889 TTTGGTTTCCATCTTCCTGG 1033 69.71 -0.90
1.370 -0.895 0.509 10869.0 890 TTGGTTTCCATCTTCCTGGC 1034 73.74
-1.30 1.962 -1.243 0.744 16035.0 891 TGGTTTCCATCTTCCTGGCA 1035
74.48 -1.30 2.071 -1.243 0.812 16304.0 892 GGTTTCCATCTTCCTGGCAA
1036 72.21 -1.30 1.737 -1.243 0.605 14885.0 893
GTTTCCATCTTCCTGGCAAA 1037 67.37 -1.30 1.027 -1.243 0.165 11910.0
894 TTTCCATCTTCCTGGCAAAC 1038 64.82 -1.30 0.653 -1.243 -0.067
11929.0 895 TTCCATCTTCCTGGCAAACT 1039 66.34 -1.30 0.877 -1.243
0.071 11517.0 896 TCCATCTTCCTGGCAAACTC 1040 67.47 -1.30 1.042
-1.243 0.174 11822.0 897 CCATCTTCCTGGCAAACTCA 1041 67.12 -0.90
0.991 -0.895 0.274 11710.0 898 CATCTTCCTGGCAAACTCAT 1042 63.55 0.90
0.466 0.670 0.544 7635.3 899 ATCTTCCTGGCAAACTCATT 1043 62.71 1.00
0.343 0.757 0.501 8378.2 900 TCTTCCTGGCAAACTCATTT 1044 63.06 0.90
0.395 0.670 0.500 6321.4 901 CTTCCTGGCAAACTCATTTC 1045 63.06 0.70
0.395 0.496 0.434 7659.0 902 TTCCTGGCAAACTCATTTCT 1046 63.06 0.70
0.395 0.496 0.434 11621.0 903 TCCTGGCAAACTCATTTCTT 1047 63.06 0.70
0.395 0.496 0.434 3389.0 904 CCTGGCAAACTCATTTCTTC 1048 63.06 0.70
0.395 0.496 0.434 3870.6 905 CTGGCAAACTCATTTCTTCT 1049 61.24 0.70
0.127 0.496 0.268 1992.7 906 TGGCAAACTCATTTCTTCTA 1050 58.74 0.70
-0.239 0.496 0.040 698.3 907 GGCAAACTCATTTCTTCTAA 1051 56.86 0.70
-0.514 0.496 -0.130 718.3 908 GCAAACTCATTTCTTCTAAT 1052 54.36 0.70
-0.882 0.496 -0.358 372.3 909 CAAACTCATTTCTTCTAATA 1053 49.93 0.60
-1.530 0.410 -0.793 180.6 910 AAACTCATTTCTTCTAATAC 1054 49.11 0.60
-1.651 0.410 -0.868 430.0 911 AACTCATTTCTTCTAATACT 1055 52.79 0.60
-1.111 0.410 -0.533 904.3 912 ACTCATTTCTTCTAATACTG 1056 54.63 0.60
-0.842 0.410 -0.366 1663.5 913 CTCATTTCTTCTAATACTGT 1057 57.14 0.60
-0.474 0.410 -0.138 2694.2 914 TCATTTCTTCTAATACTGTA 1058 54.51 0.60
-0.859 0.410 -0.377 3222.9 915 CATTTCTTCTAATACTGTAT 1059 53.21 0.60
-1.049 0.410 -0.495 3142.8 916 ATTTCTTCTAATACTGTATC 1060 53.13 0.80
-1.061 0.583 -0.436 5867.0 917 TTTCTTCTAATACTGTATCA 1061 54.51 1.20
-0.859 0.931 -0.179 6641.4 918 TCTTCTAATACTGTATCAT 1062 54.17 1.30
-0.908 1.018 -0.176 7151.9 919 TCTTCTAATACTGTATCATC 1063 55.17 1.30
-0.762 1.018 -0.086 8134.9 920 CTTCTAATACTGTATCATCT 1064 55.86 1.30
-0.661 1.018 -0.023 8551.4 921 TTCTAATACTGTATCATCTG 1065 53.80 1.30
-0.964 1.018 -0.211 5741.7 922 TCTAATACTGTATCATCTGC 1066 57.65 1.30
-0.398 1.018 0.140 8575.9 923 CTAATACTGTATCATCTGCT 1067 58.28 1.30
-0.307 1.018 0.197 8980.3 924 TAATACTGTATCATCTGCTC 1068 57.65 1.30
-0.398 1.018 0.140 10762.0 925 AATACTGTATCATCTGCTCC 1069 62.19 1.30
0.268 1.018 0.553 17037.0 926 ATACTGTATCATCTGCTCCT 1070 66.43 1.30
0.889 1.018 0.938 20970.0 927 TACTGTATCATCTGCTCCTG 1071 66.32 1.30
0.874 1.018 0.929 23084.0 928 ACTGTATCATCTGCTCCTGT 1072 70.36 0.60
1.466 0.410 1.065 0.875 24474.0 929 CTGTATCATCTGCTCCTGTA 1073 69.13
0.60 1.286 0.410 0.953 0.910 22217.0 930 TGTATCATCTGCTCCTGTAT 1074
67.04 0.60 0.979 0.410 0.763 0.890 19829.0 931 GTATCATCTGCTCCTGTATC
1075 68.85 0.60 1.244 0.410 0.927 0.842 23548.0 932
TATCATCTGCTCCTGTATCT 1076 67.44 0.60 1.037 0.410 0.799 21759.0 933
ATCATCTGCTCCTGTATCTA 1077 67.44 0.60 1.037 0.410 0.799 22711.0 934
TCATCTGCTCCTGTATCTAA 1078 65.13 0.60 0.699 0.410 0.589 18134.0 935
CATCTGCTCCTGTATCTAAT 1079 63.60 1.00 0.475 0.757 0.582 17772.0 936
ATCTGCTCCTGTATCTAATA 1080 61.77 1.60 0.207 1.279 0.614 17134.0 937
TCTGCTCCTGTATCTAATAG 1081 62.01 1.60 0.241 1.279 0.635 10969.0 938
CTGCTCCTGTATCTAATAGA 1082 61.90 0.50 0.225 0.323 0.262 9556.3 939
TGCTCCTGTATCTAATAGAG 1083 60.12 0.30 -0.036 0.149 0.034 3739.9 940
GCTCCTGTATCTAATAGAGC 1084 64.50 -1.00 0.607 -0.982 0.003 4088.3 941
CTCCTGTATCTAATAGAGCT 1085 62.21 0.30 0.271 0.149 0.224 2263.0 942
TCCTGTATCTAATAGAGCTT 1086 60.56 0.30 0.028 0.149 0.074 1018.0 943
CCTGTATCTAATAGAGCTTC 1087 60.56 0.30 0.028 0.149 0.074 1319.1 944
CTGTATCTAATAGAGCTTCC 1088 60.56 0.30 0.028 0.149 0.074 2347.8 945
TGTATCTAATAGAGCTTCCT 1089 60.56 0.30 0.028 0.149 0.074 1871.6 946
GTATCTAATAGAGCTTCCTT 1090 61.00 0.30 0.092 0.149 0.114 3469.1 947
TATCTAATAGAGCTTCCTTT 1091 58.20 0.30 -0.318 0.149 -0.141 1114.6 948
ATCTAATAGAGCTTCCTTTA 1092 58.20 0.30 -0.318 0.149 -0.141 1358.4 949
TCTAATAGAGCTTCCTTTAG 1093 58.39 0.30 -0.289 0.149 -0.123 665.4 950
CTAATAGAGCTTCCTTTAGT 1094 60.12 0.00 -0.036 -0.112 -0.065 807.4 951
TAATAGAGCTTCCTTTAGTT 1095 58.46 0.30 -0.280 0.149 -0.117 608.7 952
AATAGAGCTTCCTTTAGTTG 1096 58.97 0.30 -0.205 0.149 -0.070 623.8 953
ATAGAGCTTCCTTTAGTTGC 1097 65.53 0.30 0.758 0.149 0.526 674.5 954
TAGAGCTTCCTTTAGTTGCC 1098 69.50 0.30 1.340 0.149 0.887 0.841 814.3
955 AGAGCTTCCTTTAGTTGCCC 1099 73.89 0.30 1.983 0.149 1.286 1.157
1183.8 956 GAGCTTCCTTTAGTTGCCCC 1100 77.20 0.30 2.470 0.149 1.588
1.454 2219.4 957 AGCTTCCTTTAGTTGCCCCC 1101 79.38 0.30 2.789 0.149
1.785 1.650 4642.2 958 GCTTCCTTTAGTTGCCCCCC 1102 82.41 0.40 3.234
0.236 2.095 1.765 8804.8 959 CTTCCTTTAGTTGCCCCCCT 1103 80.06 0.80
2.889 0.583 2.013 1.823 11331.0 960 TTCCTTTAGTTGCCCCCCTA 1104 77.67
1.10 2.539 0.844 1.895 1.818 12976.0 961 TCCTTTAGTTGCCCCCCTAT 1105
77.27 0.60 2.480 0.410 1.693 1.765 12369.0 962 CCTTTAGTTGCCCCCCTATC
1106 77.27 0.60 2.480 0.410 1.693 1.669 15090.0 963
CTTTAGTTGCCCCCCTATCT 1107 75.74 0.60 2.255 0.410 1.554 1.581
16130.0 964 TTTAGTTGCCCCCCTATCTT 1108 74.23 0.60 2.033 0.410 1.416
1.545 15304.0 965 TTAGTTGCCCCCCTATCTTT 1109 74.23 0.60 2.033 0.410
1.416 1.539 14829.0 966 TAGTTGCCCCCCTATCTTTA 1110 73.31 0.80 1.899
0.583 1.399 1.490 15309.0 967 AGTTGCCCCCCTATCTTTAT 1111 73.83 1.40
1.976 1.105 1.645 1.498 15205.0 968 GTTGCCCCCCTATCTTTATT 1112 73.91
1.40 1.986 1.105 1.652 1.524 14192.0 969 TTGCCCCCCTATCTTTATTG 1113
70.59 1.40 1.500 1.105 1.350 1.515 8699.5 970 TGCCCCCCTATCTTTATTGT
1114 73.39 1.40 1.911 1.105 1.605 1.461 7786.6 971
GCCCCCCTATCTTTATTGTG 1115 73.39 1.40 1.911 1.105 1.605 1.328 6709.1
972 CCCCCCTATCTTTATTGTGA 1116 70.61 1.40 1.502 1.105 1.351 1.165
6198.4 973 CCCCCTATCTTTATTGTGAC 1117 67.66 1.20 1.070 0.931 1.017
0.999 4910.2 974 CCCCTATCTTTATTGTGACG 1118 64.37 1.20 0.587 0.931
0.718 850.0 975 CCCTATCTTTATTGTGACGA 1119 62.05 1.20 0.248 0.931
0.507 404.9 976 CCTATCTTTATTGTGACGAG 1120 58.56 1.20 -0.265 0.931
0.190 166.6 977 CTATCTTTATTGTGACGAGG 1121 57.28 1.20 -0.452 0.931
0.073 126.9 978 TATCTTTATTGTGACGAGGG 1122 57.91 1.20 -0.361 0.931
0.130 92.6 979 ATCTTTATTGTGACGAGGGG 1123 61.03 1.20 0.097 0.931
0.414 97.9 980 TCTTTATTGTGACGAGGGGT 1124 64.18 0.90 0.559 0.670
0.601 122.3 981 CTTTATTGTGACGAGGGGTC 1125 64.18 -0.80 0.559 -0.808
0.039 267.0 982 TTTATTGTGACGAGGGGTCG 1126 62.63 -1.20 0.332 -1.156
-0.233 396.0 983 TTATTGTGACGAGGGGTCGT 1127 65.37 -2.30 0.734 -2.112
-0.348 446.0 984 TATTGTGACGAGGGGTCGTT 1128 65.37 -2.80 0.734 -2.547
-0.513 661.9 985 ATTGTGACGAGGGGTCGTTG 1129 65.82 -2.80 0.800 -2.547
-0.472 864.5 986 TTGTGACGAGGGGTCGTTGC 1130 70.01 -2.80 1.414 -2.547
-0.091 1465.7 957 TGTGACGAGGGGTCGTTGCC 1131 73.21 -2.80 1.884
-2.547 0.200 2836.9 988 GTGACGAGGGGTCGTTGCCA 1132 74.44 -2.80 2.065
-2.547 0.312 3589.7 989 TGACGAGGGGTCGTTGCCAA 1133 69.05 -2.80 1.274
-2.547 -0.178 2100.4 990 GACGAGGGGTCGTTGCCAAA 1134 67.10 -2.80
0.988 -2.547 -0.355 1948.7 991 ACGAGGGGTCGTTGCCAAAG 1135 66.13
-2.60 0.845 -2.373 -0.378 1384.3 992 CGAGGGGTCGTTGCCAAAGA 1136
66.81 -1.40 0.945 -1.330 0.081 1192.0 993 GAGGGGTCGTTGCCAAAGAG 1137
66.84 0.20 0.950 0.062 0.612 1221.0 994 AGGGGTCGTTGCCAAAGAGT 1138
68.70 0.20 1.223 0.062 0.782 953.2 995 GGGGTCGTTGCCAAAGAGTG 1139
68.32 0.20 1.167 0.062 0.747 988.6 996 GGGTCGTTGCCAAAGAGTGA 1140
67.11 0.20 0.989 0.062 0.636 937.8 997 GGTCGTTGCCAAAGAGTGAT 1141
64.59 0.50 0.620 0.323 0.507 852.1 998 GTCGTTGCCAAAGAGTGATC 1142
63.51 0.00 0.461 -0.112 0.243 1189.4 999 TCGTTGCCAAAGAGTGATCT 1143
62.35 -1.00 0.291 -0.982 -0.192 1501.7 1000 CGTTGCCAAAGAGTGATCTG
1144 60.92 -1.20 0.081 -1.156 -0.389 1360.9 1001
GTTGCCAAAGAGTGATCTGA 1145 61.71 -1.20 0.198 -1.156 -0.317 1112.9
1002 TTGCCAAAGAGTGATCTGAG 1146 58.90 -1.20 -0.215 -1.156 -0.572
468.3 1003 TGCCAAAGAGTGATCTGAGG 1147 61.08 -1.20 0.104 -1.156
-0.375 400.1 1004 GCCAAAGAGTGATCTGAGGG 1148 63.68 -1.50 0.485
-1.417 -0.237 401.6 1005 CCAAAGAGTGATCTGAGGGA 1149 60.94 -1.20
0.084 -1.156 -0.387 199.9 1006 CAAAGAGTGATCTGAGGGAA 1150 55.32
-1.20 -0.741 -1.156 -0.899 202.1 1007 AAAGAGTGATCTGAGGGAAG 1151
54.21 -1.20 -0.903 -1.156 -0.999 258.7 1008 AAGAGTGATCTGAGGGAAGT
1152 59.12 -1.20 -0.183 -1.156 -0.552 274.7 1009
AGAGTGATCTGAGGGAAGTT 1153 61.60 -1.00 0.181 -0.982 -0.261 297.2
1010 GAGTGATCTGAGGGAAGTTA 1154 60.78 -0.30 0.061 -0.373 -0.104
250.6 1011 AGTGATCTGAGGGAAGTTAA 1155 57.35 0.60 -0.443 0.410 -0.119
231.3 1012 GTGATCTGAGGGAAGTTAAA 1156 55.25 0.60 -0.751 0.410 -0.310
214.5 1013 TGATCTGAGGGAAGTTAAAG 1157 52.55 0.60 -1.147 0.410 -0.556
102.3 1014 GATCTGAGGGAAGTTAAAGG 1158 55.09 0.60 -0.774 0.410 -0.324
102.3 1015 ATCTGAGGGAAGTTAAAGGA 1159 55.09 0.60 -0.774 0.410 -0.324
49.4 1016 TCTGAGGGAAGTTAAAGGAT 1160 55.09 0.60 -0.774 0.410 -0.324
104.3 1017 CTGAGGGAAGTTAAAGGATA 1161 53.32 1.00 -1.034 0.757 -0.353
46.3 1018 TGAGGGAAGTTAAAGGATAC 1162 51.95 1.30 -1.235 1.018 -0.378
50.9 1019 GAGGGAAGTTAAAGGATACA 1163 53.26 0.90 -1.043 0.670 -0.392
58.2 1020 AGGGAAGTTAAAGGATACAG 1164 52.14 0.90 -1.207 0.670 -0.494
50.5 1021 GGGAAGTTAAAGGATACAGT 1165 54.81 0.90 -0.815 0.670 -0.251
53.1
Example 3
[0239] Synopsis: The method of the present invention is
particularly useful as a guide to the iterative refinement of
probes. One of the specific predictions made for rabbit
.beta.-globin in Example 1 is used to provide an example of such a
refinement.
[0240] Materials and Methods: The contig spanning positions 5-11 of
a portion of the rabbit .beta.-globin gene (Example 1, Table 3) was
analyzed, using the experimentally measured data to simulate the
results of successive experimental measurements. The iterative
refinement was performed using a rule-based algorithm, outlined
below. This algorithm is used by way of example only; other
algorithms for efficiently finding local maxima are well known to
the art and could be employed to perform this task.
[0241] Given experimental data for probes from the 1.sup.st
quartile, median and 3.sup.rd quartile of a contig, as well as a
user-set signal threshold for further consideration of a probe,
[0242] 1) If all 3 measurements are below the user-specified signal
threshold, discard the prediction.
[0243] 2) If at least one of the measurements is above the
user-specified threshold, determine which point yields the maximum
signal.
[0244] a) If the maximum point is the 1.sup.st quartile probe, then
make three new measurements for probes with the same spacing as
that used in the preceding iteration, but displaced so that the
third probe is identical to the original 1.sup.st quartile probe.
In other words, repeat the search with the same pattern and
spacing, but displace the pattern in the direction of increasing
signal found in the first experiment.
[0245] b) If the maximum point is the 3.sup.rd quartile probe, then
make three new measurements for probes with the same spacing as
that used in the preceding iteration, but displaced so that the
first probe is identical to the original 3.sup.rd quartile probe.
In other words, repeat the search with the same pattern and
spacing, but displace the pattern in the direction of increasing
signal found in the first experiment.
[0246] c) If the maximum point is the median probe, then repeat the
experiment, keeping the median point the same, but shrinking the
spacing between probes by a factor of 2.
[0247] 3) Continue iteration until a maximum is found, or the user
judges the signal level observed to be acceptable. Use the
experimental value measured for the probe duplicated in successive
iterations to tie together the successive data sets, via a simple
normalization procedure, described below. Where appropriate,
consider all of the data (i.e. all of the iterations) when deciding
how to proceed, or whether the peak hybridization intensity has
been found.
[0248] Results: Iterative refinement of the contig spanning
positions 5-11 in Table 3 proceeds as follows:
[0249] Iteration 1: Probes are synthesized at positions 6, 8 and
10, yielding the experimental hybridization intensities 180, 220
and 310, respectively.
[0250] Iteration 2: Following rule 2b), probes are synthesized at
positions 10, 12 and 14. Note that the redundant measurement at
position 10 serves as a bridge between experiments, and allows
comparison of the two sets by normalizing the intensities by
multiplying the second iteration measurements by the ratio of the
intensity observed for the probe at position 10 in the first
iteration to the value observed in the second iteration. In the
simplest case, the ratio is 1; in any case, the second iteration
yields the normalized values 310, 390, 240 for probe positions 10,
12 and 14, respectively.
[0251] Iteration 3: By rule 2c), measurements are performed for
probes at positions 11, 12 and 13; after normalization, these yield
the normalized hybridization intensities 320, 390 and 410,
respectively. Combination of these results with the results from
iteration 2, probe position 14, yields the conclusion that the best
probe for this intensity peak is the probe that starts at sequence
position 13.
[0252] The overall result is that iterative improvement converges
in three iterations, and requires the synthesis of seven test
probes, one of which is the local optimal probe. In addition, the
first and second iterations yield probes that exhibit 75% and 95%
of the local maximum hybridization intensities, respectively. In
many applications, either of these probes would be considered
acceptable.
[0253] The above examples 1 and 2 demonstrate that two different
implementations of the method of the present invention are capable
of efficiently predicting regions of high hybridization efficiency
in a variety of polynucleotide targets. Many of the predictions
yield acceptable probe sequences on the first design iteration, and
all would yield optimized probe sets after 24 rounds of iterative
refinement, as demonstrated in Example 3. The performance
demonstrated in these examples greatly exceeds the performance of
current methods. Finally, the examples demonstrate that the
predictions can be performed by a software application that has
been implemented and installed on a Pentium.RTM.-based computer
workstation.
[0254] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0255] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to those of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
Sequence CWU 1
1
* * * * *