U.S. patent application number 10/867183 was filed with the patent office on 2005-02-03 for gene amplification and overexpression in cancer.
This patent application is currently assigned to Tularik Inc.. Invention is credited to Mu, David.
Application Number | 20050026194 10/867183 |
Document ID | / |
Family ID | 33539227 |
Filed Date | 2005-02-03 |
United States Patent
Application |
20050026194 |
Kind Code |
A1 |
Mu, David |
February 3, 2005 |
Gene amplification and overexpression in cancer
Abstract
There are disclosed methods and compositions for the diagnosis,
prevention, and treatment of tumors and cancers in mammals, for
example, humans, utilizing a gene, which is amplified in many types
of cancer. The amplified genes, their expressed protein products
and antibodies are used diagnostically or as targets for cancer
therapy or as vaccines; they also are used to identify compounds
and reagents useful in cancer diagnosis, prevention, and
therapy.
Inventors: |
Mu, David; (Jericho,
NY) |
Correspondence
Address: |
HELLER EHRMAN WHITE & MCAULIFFE LLP
1666 K STREET,NW
SUITE 300
WASHINGTON
DC
20006
US
|
Assignee: |
Tularik Inc.
1120 Veterans Boulevard
South San Francisco
CA
94080
|
Family ID: |
33539227 |
Appl. No.: |
10/867183 |
Filed: |
June 15, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60479833 |
Jun 20, 2003 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/6.16; 435/91.2; 514/44A |
Current CPC
Class: |
C12Q 1/6886 20130101;
C12N 2310/14 20130101; C12Q 2600/136 20130101; G01N 2333/64
20130101; G01N 2500/00 20130101; C12N 15/1136 20130101; C12N
2310/111 20130101; G01N 33/57423 20130101; G01N 33/57419 20130101;
C12Q 2600/106 20130101; G01N 2800/52 20130101; C12N 2310/53
20130101; C12N 15/1138 20130101; G01N 33/57438 20130101; G01N
33/57449 20130101 |
Class at
Publication: |
435/006 ;
435/091.2; 514/044 |
International
Class: |
C12Q 001/68; C12P
019/34; A61K 048/00 |
Claims
1. A method for diagnosing a cancer in a mammal, comprising: a)
determining SALPR or Relaxin-3 gene copy number in a test sample
from a region of the mammal that is suspected to be precancerous or
cancerous, thereby generating data for a test gene copy number; and
b) comparing the test gene copy number to data for a control gene
copy number, wherein an amplification of the gene in the test
sample relative to the control, respectively, indicates the
presence of a precancerous lesion or a cancer in the mammal.
2. The method according to claim 1, wherein the cancer is a lung
cancer, a colon cancer, an ovarian cancer, or a pancreatic
cancer.
3. A method for inhibiting cancer or precancerous growth in a
mammalian tissue, comprising contacting the tissue with an
inhibitor that interacts with SALPR or Relaxin-3 protein. SALPR or
Relaxin-3 DNA or RNA and thereby inhibits SALPR or Relaxin-3
function, respectively.
4. The method according to claim 3, wherein the tissue is a lung
tissue, a colon tissue, an ovarian tissue, or a pancreatic
tissue.
5. The method according to claim 3, wherein the inhibitor is a
siRNA, miRNA, an antisense RNA, an antisense DNA, a decoy molecule,
or a decoy DNA.
6. The method according to claim 3, wherein the inhibitor contains
nucleotides, and wherein the inhibitor comprises less than about
100 bps in length.
7. The method according to claim 3, wherein the inhibitor is a
ribozyme.
8. The method according to claim 3, wherein the inhibitor is a
small molecule.
9-10. (Canceled).
11. A method for diagnosing a cancer in a mammal, comprising: a)
determining the level of SALPR or Relaxin-3 in a test sample from a
region of the mammal that is suspected to be precancerous or
cancerous, thereby generating data for a test level; and b)
comparing the test level of SALPR or Relaxin-3 to data for a
control level, wherein an elevated test level of SALPR or Relaxin-3
of the test sample relative to the control level, respectively,
indicates the presence of a precancerous lesion or a cancer in the
mammal.
12. The method according to claim 11, wherein the control level is
obtained from a database of SALPR or Relaxin-3 levels detected in a
control sample.
13. A method of blocking in vivo expression of a gene by
administering a vector encoding SALPR or Relaxin-3 siRNA.
14. The method of claim 13, wherein the siRNA interferes with SALPR
or Relaxin-3 activity.
15. The method of claim 13, wherein the siRNA causes
post-transcriptional silencing of SALPR or Relaxin-3 gene in a
mammalian cell.
16. The method of claim 15, wherein the cell is a human cell.
17. A method of screening a test molecule for SALPR or Relaxin-3
antagonist activity comprising the steps of: a) contacting the
molecule with a cancer cell; b) determining the level of SALPR or
Relaxin-3 in the cell, thereby generating data for a test level;
and c) comparing the test level to the SALPR or Relaxin-3 level of
the cancer cell prior to contacting the test molecule,
respectively, wherein a decrease in SALPR or Relaxin-3 in the test
level indicates SALPR or Relaxin-3 antagonist activity of the test
molecule.
18. The method of claim 17, wherein the level of SALPR or Relaxin-3
is determined by reverse transcription and polymerase chain
reaction (RT-PCR).
19. The method of claim 17, wherein the level of SALPR or Relaxin-3
is determined by Northern hybridization or microarray analysis.
20. The method of claim 17, wherein the cell is obtained from a
lung tissue, a colon tissue, an ovarian tissue, or a pancreatic
tissue.
21-22. (Canceled).
23. A method of determining whether a test molecule has SALPR or
Relaxin-3 antagonist activity, wherein the method comprises: a)
determining the level of SALPR or Relaxin-3 in a test sample
containing cancer cells, thereby generating data for a control
level; b) contacting the molecule with the test sample to generate
data for a test level; and c) comparing the control level to the
test level, respectively, wherein no decrease in SALPR or Relaxin-3
in the test level as compared to the control level indicates that
the test molecule has no SALPR or Relaxin-3 antagonist
activity.
24. (Canceled).
25. A method for determining the efficacy of a therapeutic
treatment regimen in a patient, comprising: a) measuring at least
one of SALPR or Relaxin-3 gene copy number, SALPR or Relaxin-3
mRNA, or SALPR or Relaxin-3 expression levels in a first sample
obtained from a patient, thereby generating an initial level; b)
administering the treatment regimen to the patient; c) measuring at
least one of SALPR or Relaxin-3 gene copy number, SALPR or
Relaxin-3 mRNA, or SALPR or Relaxin-3 expression levels in a second
sample from the patient at a time following administration of the
treatment regimen, thereby generating a test level; and d)
comparing the initial and test levels, respectively, wherein a
decrease in the gene copy number, SALPR or Relaxin-3 mRNA, or SALPR
or Relaxin-3 expression level in the test level relative to the
initial level indicates that the treatment regimen is effective in
the patient.
26. The method according to claim 25, wherein the sample is
obtained from a lung tissue, a colon tissue, an ovarian tissue, or
a pancreatic tissue.
27-31. (Canceled).
Description
[0001] This application claims priority to U.S. Ser. No.
60/479,833, filed Jun. 20, 2003, the entirety of which is hereby
incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The invention relates to oncogenes and to cancer diagnostics
and therapeutics. More specifically, the present invention relates
to amplified and/or overexpressed Somatostatin- and
Angiotensin-Like Peptide Receptor (SALPR) and Relaxin-3 genes, each
of which are involved in certain types of cancers. The invention
pertains to the amplified genes, their encoded proteins, and
antibodies, inhibitors, activators and the like and their use in
cancer diagnostics, vaccines, and anti-cancer therapy.
[0004] 2. Background of the Invention
[0005] Cancer and Gene Amplification:
[0006] Cancer is the second leading cause of death in the United
States, after heart disease (Boring, et al., CA Cancer J. Clin.,
43:7, 1993), and it develops in one in three Americans. One of
every four Americans dies of cancer. Cancer features uncontrolled
cellular growth, which results either in local invasion of normal
tissue or systemic spread of the abnormal growth. A particular type
of cancer or a particular stage of cancer development may involve
both elements.
[0007] The division or growth of cells in various tissues
functioning in a living body normally takes place in an orderly and
controlled manner. This is enabled by a delicate growth control
mechanism, which involves, among other things, contact, signaling,
and other communication between neighboring cells. Growth signals,
stimulatory or inhibitory, are routinely exchanged between cells in
a functioning tissue. Cells normally do not divide in the absence
of stimulatory signals, and will cease dividing when dominated by
inhibitory signals. However, such signaling or communication
becomes defective or completely breaks down in cancer cells. As a
result, the cells continue to divide; they invade adjacent
structures, break away from the original tumor mass, and establish
new growth in other parts of the body. The latter progression to
malignancy is referred to as "metastasis."
[0008] Cancer generally refers to malignant tumors, rather than
benign tumors. Benign tumor cells are similar to normal,
surrounding cells. These types of tumors are almost always
encapsulated in a fibrous capsule and do not have the potential to
metastasize to other parts of the body. These tumors affect local
organs but do not destroy them; they usually remain small without
producing symptoms for many years. Treatment becomes necessary only
when the tumors grow large enough to interfere with other organs.
Malignant tumors, by contrast, grow faster than benign tumors, and
they penetrate and destroy local tissues. Some malignant tumors may
spread throughout the body via blood or the lymphatic system. The
unpredictable and uncontrolled growth makes malignant cancers
dangerous, and fatal in many cases. These tumors are not
morphologically typical of the original tissue and are not
encapsulated. Malignant tumors commonly recur after surgical
removal.
[0009] Accordingly, treatment ordinarily is directed towards
malignant cancers or malignant tumors. The intervention of
malignant growth is most effective at the early stage of the cancer
development. Thus, it can be important to discover sensitive
markers for early signs of cancer formation and to identify potent
growth suppression agents associated therewith. The development of
such diagnostic and therapeutic agents involves an understanding of
the genetic control mechanisms for cell division and
differentiation, particularly in connection with tumorigenesis.
[0010] Cancer can be caused by inherited or acquired mutations in
cancer genes, which have normal cellular functions and which induce
or otherwise contribute to cancer once mutated or expressed at an
abnormal level. Certain well-studied tumors carry several different
independently mutated genes, including activated oncogenes and
inactivated tumor suppressor genes. Each of these mutations appears
to be responsible for imparting some of the traits that, in
aggregate, represent the full neoplastic phenotype (Land et al.,
Science, 222:771, 1983; Ruley, Nature, 4:602, 1983; Hunter, Cell,
64:249, 1991).
[0011] One such mutation is gene amplification. Gene amplification
involves a chromosomal region bearing specific genes undergoing a
relative increase in DNA copy number, thereby increasing the copies
of any genes that are present. In general, gene amplification often
results in increased levels of transcription and translation,
producing higher amounts of the corresponding gene mRNA and
protein. Amplification of genes can cause deleterious effects,
which contribute to cancer formation and proliferation (Lengauer et
al. Nature, 396:643-649,1999).
[0012] It is commonly appreciated by cancer researchers that whole
collections of genes are demonstrably overexpressed or
differentially expressed in a variety of different types of tumor
cells. Yet, often only a very small number of these overexpressed
genes are likely to be causally involved in the cancer phenotype.
The remaining overexpressed genes likely are secondary consequences
of more basic primary events, for example, overexpression of a
cluster of genes, involved in DNA replication. Nevertheless, gene
amplification is established as an important genetic alteration in
solid tumors (Knuutila et al., Am. J. Pathol., 152(5):1107-23,
1998; Knuutila et al., Cancer Genet. Cytogenet., 100(1):25-30,
1998).
[0013] The overexpression of certain well known genes, for example,
c-myc, has been observed at fairly high levels in the absence of
gene amplification (Yoshimoto et al., JPN J. Cancer Res.,
77(6):540-5, 1986), although these genes are frequently amplified
(Knuutila et al., Am. J. Pathol., 152(5):1107-23, 1998) and thereby
activated. Such a characteristic is considered a hallmark of
oncogenes. Overexpression in the absence of amplification may be
caused by higher transcription efficiency in those situations. In
the case of c-myc, for example, Yoshimoto et al. showed that its
transcriptional rate was greatly increased in the tested tumor cell
lines. The characteristics and interplay of overexpression and
amplification of a gene in cancer tissues, therefore, provide
significant indications of the gene's role in cancer development.
That is, increased DNA copies of certain genes in tumors, along
with and beyond their overexpression, may point to their functions
in tumor formation and progression.
[0014] It must be remembered that overexpression and amplification
are not the same phenomenon. Overexpression can be obtained from a
single, unamplified gene, and an amplified gene does not always
lead to greater expression levels of mRNA and protein. Thus, it is
not possible to predict whether one phenomenon will result in, or
is related to, the other. However, in situations where both
amplification of a gene and overexpression of the gene product
occur in cells or tissues that are in a precancerous or cancerous
state, then that gene and its product present both a diagnostic
target and a therapeutic opportunity for intervention.
Amplification, without overexpression, and overexpression, without
amplification, also can be correlated with and indicative of
cancers and pre-cancers.
[0015] Because some genes are sometimes amplified as a consequence
of their location next to a true oncogene, it also is beneficial to
determine the DNA copy number of nearby genes in a panel of tumors
so that amplified genes that are in the epicenter of the
amplification unit can be distinguished from amplified genes that
are occasionally amplified due to their proximity to another, more
relevant, amplified gene.
[0016] Thus, discovery and characterization of amplified cancer
genes, along with and in addition to their features of
overexpression or differential expression, will be a promising
avenue that leads to novel targets for diagnostic, vaccines, and
therapeutic applications.
[0017] Additionally, the completion of the working drafts of the
human genome and the paralleled advances in genomics technologies
offer new promises in the identification of effective cancer
markers and the anti-cancer agents. The high-throughput microarray
detection and screening technology, computer-empowered genetics and
genomics analysis tools, and multi-platform functional genomics and
proteomics validation systems, all assist in applications in cancer
research and findings. With the advent of modern sequencing
technologies and genomic analyses, many unknown genes and genes
with unknown or partially known functions can be revealed.
[0018] Genomic amplification and overexpression of Homo sapiens
Somatostatin- and Angiotensin-Like Peptide Receptor (SALPR) and
Relaxin-3 (H3) (RLN3) genes and their role in tumorogenesis were
not known until the instant invention. In addition to antibodies
that bind tumor cells expressing SALPR or Relaxin-3, the
possibility to treat tumors with antibodies that block the
oncogenic function of SALPR or Relaxin-3, and thereby mediate
tumor-cell killing, were not known until the present invention.
[0019] Therefore, there is a need in the art for an understanding
of SALPR and Relaxin-3 genes regulation. Understanding the
physiological role of human SALPR and Relaxin-3 genes will
facilitate early diagnosis of abnormalities associated therewith
and lead to appropriate therapies to treat such abnormalities.
These needs are satisfied for the first time by the present
invention.
SUMMARY OF THE INVENTION
[0020] The present invention relates to isolation,
characterization, overexpression and implication of genes,
including amplified genes, in cancers, methods and compositions for
use in diagnosis, vaccines, prevention and treatment of tumors and
cancers, for example, lung cancer, colon cancer, ovarian cancer,
and pancreatic cancer, in mammals, for example, humans. The
invention is based on the finding of novel attributes of SALPR and
Relaxin-3. Specifically, amplification and/or overexpression of
SALPR and/or Relaxin-3 genes in tumors, including lung tumors,
colon tumors, ovarian tumors, and pancreatic tumors, and their role
in oncogenesis was not known until the instant invention.
[0021] These novel attributes include the overexpression of the
SALPR and/or Relaxin-3 genes in certain cancers, for example, lung
cancer and/or colon cancer and/or ovarian cancer and/or pancreatic
cancer, and the frequent amplification of SALPR and/or Relaxin-3 in
cancer cells. The SALPR and/or Relaxin-3 genes and their expressed
protein products can thus be used diagnostically or as targets for
cancer therapy; and they also can be used to identify and design
compounds useful in the diagnosis, prevention, and therapy of
tumors and cancers.
[0022] Until the present invention, certain utilities of the SALPR
and Relaxin-3 genes associated with diagnostics and therapeutics in
various cancers were not known. Moreover, until the present
invention, SALPR and Relaxin-3 genes have not been fully
characterized to allow their role in tumor development to be
completely understood.
[0023] According to one aspect of the present invention, the use of
SALPR and/or Relaxin-3 in gene therapy, development of small
molecule inhibitors, small interfering RNAs (siRNAs), microRNAs
(miRNAs), and antisense nucleic acids, and development of
immunodiagnostics and immunotherapies, are provided. The present
invention includes production and the use of antibodies, for
example, monoclonal, polyclonal, single-chain and engineered
antibodies (including humanized antibodies) and fragments, which
specifically bind SALPR and/or Relaxin-3 proteins and polypeptides.
The invention also includes antagonists and inhibitors of SALPR and
Relaxin-3 proteins that can inhibit one or more of the functions or
activities of SALPR or Relaxin-3, respectively. Suitable
antagonists can include small molecules (molecular weight below
about 500 Daltons), large molecules (molecular weight above about
500 Daltons), and antibodies (including fragments and single chain
antibodies) that bind and interfere or neutralize SALPR or
Relaxin-3 proteins, polypeptides which compete with a native form
of SALPR or Relaxin-3 proteins for binding to a protein that
naturally interacts with SALPR or Relaxin-3 proteins, and nucleic
acid molecules that interfere with transcription and/or translation
of the SALPR or Relaxin-3 gene (for example, antisense nucleic acid
molecules, triple helix forming molecules, ribozymes, microRNAs,
and small interfering RNAs), respectively. The present invention
also includes useful compounds that influence or attenuate
activities of SALPR or Relaxin-3.
[0024] In addition, the present invention provides inhibitors of
SALPR and Relaxin-3 activity, such as antibodies, that block the
oncogenic function or anti-apoptotic activity of SALPR and
Relaxin-3, respectively.
[0025] Other inhibitors include antibodies that bind to a cell
over-expressing SALPR or Relaxin-3 protein, thereby resulting in
suppression or death of the cell.
[0026] The present invention further provides molecules that can
decrease the expression of SALPR or Relaxin-3 by affecting
transcription or translation. Small molecules (molecular weight
below about 500 Daltons), large molecules (molecular weight above
about 500 Daltons), and nucleic acid molecules, for example,
ribozymes, miRNAs, siRNAs and antisense molecules, including
antisense RNA, antisense DNA or decoy molecules (for example,
Morishita et al., Ann. N Y Acad. Sci., 947:294-301, 2001;
Andratschke et al., Anticancer Res., 21:(5)3541-3550, 2001), may
all be utilized to inhibit the expression or amplification.
[0027] As mentioned above, the SALPR and Relaxin-3 gene sequences
also can be employed in an RNA interference context. The phenomenon
of RNA interference is described and discussed in Bass, Nature,
411: 428-29 (2001); Elbashir et al., Nature 411: 494-98 (2001); and
Fire et al., Nature, 391: 806-11 (1998), where methods of making
interfering RNA also are discussed.
[0028] In one aspect, the present invention provides methods for
diagnosing or predicting a cancer (diagnostics or predictive uses)
for example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a mammal, which comprises, in any practical
order, obtaining a test sample from a region in the tissue that is
suspected to be precancerous or cancerous; and comparing the
average number of SALPR or Relaxin-3 gene copies measured (for
example, quantitatively and/or qualitatively) in the sample to a
control sample or a known value, thereby determining whether the
SALPR or Relaxin-3 genes are amplified in the test sample,
respectively, wherein amplification of the SALPR or Relaxin-3 gene
indicates a cancer or a precancerous condition in the tissue.
[0029] In another aspect, the present invention provides methods
for diagnosing or predicting a cancer (diagnostics or predictive
uses) for example, a lung cancer, a colon cancer, an ovarian
cancer, or a pancreatic cancer, in a mammal, which comprises, in
any practical order, obtaining a test sample from a region in the
tissue that is suspected to be precancerous or cancerous; obtaining
a control sample from a region in the tissue or other tissues that
are normal; and detecting or measuring in both the test sample and
the control sample the level of SALPR or Relaxin-3 mRNA
transcripts, wherein a level of the transcripts higher in the test
sample than that in the control sample indicates a cancer or a
precancerous condition in the tissue. In another aspect the control
sample may be obtained from a different individual or be a
normalized value based on baseline data obtained from a
population.
[0030] In another aspect, the present invention provides methods
for diagnosing or predicting a cancer (diagnostics or predictive
uses) for example, a lung cancer, a colon cancer, an ovarian
cancer, or a pancreatic cancer, in a mammal, which comprises, in
any practical order, obtaining a test sample from a region in the
tissue that is suspected to be precancerous or cancerous; and
comparing the average number of SALPR or Relaxin-3 DNA copies
detected (for example, quantitatively and/or qualitatively) in the
sample to a control sample or a known value, thereby determining
whether the SALPR or Relaxin-3 genes are amplified in the test
sample, respectively, wherein amplification of the SALPR or
Relaxin-3 gene indicates a cancer or a precancerous condition in
the tissue.
[0031] Another aspect of the present invention provides methods for
diagnosing or predicting a cancer (diagnostics or predictive uses)
for example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a mammal, which comprises, in any practical
order, obtaining a test sample from a region in the tissue that is
suspected to be precancerous or cancerous; contacting the sample
with anti-SALPR or anti-Relaxin-3 antibodies, and detecting in the
test sample, the level of SALPR or Relaxin-3 expression,
respectively, wherein an increased level of the SALPR or Relaxin-3
expression in the test sample, as compared to a control sample or a
known value indicates a precancerous or a cancerous condition in
the tissue. In another aspect, the control sample may be obtained
from a different individual or be a normalized value based on
baseline data obtained from a population. Alternatively, a given
level of SALPR or Relaxin-3, representative of the cancer-free
population, that has been previously established based on
measurements from normal, cancer-free animals, can be used as a
control. A control data point from a reference database, based on
data obtained from control samples representative of a cancer-free
population, also can be used as a control.
[0032] In another aspect, the present invention relates to methods
for comparing and compiling data wherein the data is stored in
electronic or paper format. Electronic format can be selected from
the group consisting of electronic mail, disk, compact disk (CD),
digital versatile disk (DVD), memory card, memory chip, ROM or RAM,
magnetic optical disk, tape, video, video clip, microfilm,
internet, shared network, shared server and the like; wherein data
is displayed, transmitted or analyzed via electronic transmission,
video display, telecommunication, or by using any of the above
stored formats; wherein data is compared and compiled at the site
of sampling specimens or at a location where the data is
transported following a process as described above.
[0033] In another aspect, the present invention provides methods
for preventing, controlling, reversing, or suppressing cancer
growth (and analogous uses) in a mammalian organ and tissue, for
example, in the lung, colon, ovary, or pancreas, which comprises
administering an inhibitor of SALPR or Relaxin-3 protein to the
organ or tissue, thereby inhibiting SALPR or Relaxin-3 protein
activities, respectively. Such inhibitors may be, among other
things, an antibody to SALPR or Relaxin-3 protein or polypeptide
portions thereof, an antagonist to SALPR or Relaxin-3 protein,
respectively, or other small or large molecules.
[0034] In a further aspect, the present invention provides a method
for preventing, controlling, reversing, or suppressing cancer
growth (and analogous uses) in a mammalian organ and tissue, for
example, in the lung, colon, ovary, or pancreas, which comprises
administering to the organ or tissue a nucleotide molecule that is
capable of interacting with SALPR or Relaxin-3 DNA and/or RNA and
thereby blocking or interfering the SALPR or Relaxin-3 gene
functions, respectively. Such nucleotide molecules can be an
antisense nucleotide of the SALPR or Relaxin-3 gene, a ribozyme of
SALPR or Relaxin-3 RNA, a small interfering RNA (siRNA) or it may
be a molecule capable of forming a triple helix with the SALPR or
Relaxin-3 gene, respectively.
[0035] In a further aspect, the present invention provides methods
for preventing, controlling, reversing, or suppressing cancer
growth (and analogous uses) in a mammalian organ and tissue, for
example, in the lung, colon, ovary, or pancreas, which comprises
administering to the organ or tissue a nucleotide molecule that is
capable of interacting with SALPR or Relaxin-3 DNA and/or RNA and
thereby blocking or interfering the SALPR or Relaxin-3 gene
function, respectively. Such nucleotide molecules can be an
antisense nucleotide of the SALPR or Relaxin-3 gene, a ribozyme of
SALPR or Relaxin-3 RNA; a small interfering RNA; a microRNA
(miRNA); or it may be a molecule capable of forming a triple helix
with the SALPR or Relaxin-3 gene, respectively.
[0036] In still a further aspect, the present invention provides
methods for determining the efficacy, such as potency, of a
therapeutic treatment regimen for treating a cancer (and analogous
uses), for example, a lung cancer, a colon cancer, an ovarian
cancer, or a pancreatic cancer, in a patient, for example, in a
clinical trial or other research studies, which comprises, in any
practical order, obtaining a first sample from the patient to
ultimately obtain a pre-treatment level; administering the
treatment regimen to the patient; obtaining a second sample from
the patient after a time period to ultimately obtain a test level;
and detecting in both the first and the second samples the level of
SALPR or Relaxin-3 mRNA transcripts, wherein a level of the
transcripts lower in the second sample (test level) than that in
the first sample (pre-treatment level) indicates that the treatment
regimen is effective in the patient.
[0037] In another aspect, the present invention provides methods
for determining the efficacy, such as potency, of a compound to
suppress a cancer (and analogous uses), for example, a lung cancer,
a colon cancer, an ovarian cancer, or a pancreatic cancer, in a
patient, for example, in a clinical trial or other research
studies, which comprises, in any practical order, obtaining a first
sample from the patient to ultimately obtain a pre-treatment level;
administering the treatment regimen to the patient; obtaining the
second sample from the patient after a time period to ultimately
obtain a test level; and detecting in both the first and the second
samples the level of SALPR or Relaxin-3 mRNA transcripts, wherein a
level of the transcripts lower in the second sample (test level)
than that in the first sample (pre-treatment level) indicates that
the compound is effective to suppress such a cancer or a
precancerous condition.
[0038] In another aspect, the present invention provides methods
for determining the efficacy, such as potency, of a therapeutic
treatment regimen for treating a cancer (and analogous uses), for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a patient, for example, in a clinical trial
or other research studies, which comprises, in any practical order,
obtaining a first sample from the patient to ultimately obtain a
pre-treatment level; administering the treatment regimen to the
patient; obtaining a second sample from the patient after a time
period to ultimately obtain a test level; and detecting in both the
first and the second samples the average number of SALPR or
Relaxin-3 DNA copies per cell, for example, thereby determining the
overall or average SALPR or Relaxin-3 gene amplification state in
the first and second samples, respectively, wherein a lower number
of SALPR or Relaxin-3 DNA copies per cell, or average, for example,
in the second sample (test level) than that in the first sample
(pre-treatment level) indicates that the treatment regimen is
effective.
[0039] In yet another aspect, the present invention provides
methods for determining the efficacy, such as potency, of a
therapeutic treatment regimen for treating a cancer (and analogous
uses), for example, a lung cancer, a colon cancer, an ovarian
cancer, or a pancreatic cancer, in a patient, which comprises, in
any practical order, obtaining a first sample from the patient to
ultimately obtain a pre-treatment level; administering the
treatment regimen to the patient; obtaining a second sample from
the patient after a time period to ultimately obtain a test level;
contacting the samples with anti-SALPR or anti-Relaxin-3
antibodies, and detecting the level of SALPR or Relaxin-3
expression in both the first and the second samples, respectively.
A lower level of the SALPR or Relaxin-3 expression in the second
sample (test level) than that in the first sample (pre-treatment
level) indicates that the treatment regimen is effective in the
patient.
[0040] Yet, in another aspect, the invention provides methods for
determining the efficacy, such as potency, of a therapeutic
treatment regimen for treating a cancer (and analogous uses), for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a patient, comprising, in any practical
order, the steps of: obtaining a first sample from the patient to
ultimately obtain a pre-treatment level; administering the
treatment regimen to the patient; obtaining a second sample from
the patient after a time period to ultimately obtain a test level;
contacting the samples with anti-SALPR or anti-Relaxin-3
antibodies, determining the expression level of SALPR or Relaxin-3,
in both the first and the second samples, by determining the
overall expression divided by the number of cells present in each
sample; and comparing the expression level of SALPR or Relaxin-3 in
the first and the second samples, respectively. A lower level of
the SALPR or Relaxin-3 expression in the second sample (test level)
than that in the first sample (pre-treatment level) indicates that
the treatment regimen is effective in the patient, wherein the
expression level is determined via a binding assay or other
appropriate assays, including reverse transcription and polymerase
chain reaction (RT-PCR), Northern hybridization, microarray
analysis, enzyme immuno assay (EIA), two-hybrid assays such as GAL4
DNA binding domain based assays, blot assays, sandwich assays, and
the like.
[0041] In still another aspect, the present invention provides
methods for determining the efficacy, such as potency, of a
compound to suppress a cancer (and analogous uses), for example, a
lung cancer, a colon cancer, an ovarian cancer, or a pancreatic
cancer, in a patient, for example, in a clinical trial or other
research studies, which comprises, in any practical order,
obtaining a first sample from the patient to ultimately obtain a
pre-treatment level; administering the treatment regimen to the
patient; obtaining a second sample from the patient after a time
period to ultimately obtain a test level; and detecting in both the
first and the second samples the average number of SALPR or
Relaxin-3 DNA copies per cell, for example, thereby determining the
SALPR or Relaxin-3 gene amplification state in the first and second
samples, respectively, wherein a lower number of SALPR or Relaxin-3
DNA copies per cell, or average, for example, in the second sample
(test level) than that in the first sample (pre-treatment level)
indicates that the compound is effective.
[0042] In another aspect, the present invention provides methods
for monitoring the efficacy, such as potency, of a therapeutic
treatment regimen for treating a cancer (and analogous uses), for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a patient, for example, in a clinical trial
or other research studies, which comprises, in any practical order,
obtaining a first sample from the patient to ultimately obtain a
pre-treatment level; administering the treatment regimen to the
patient; obtaining a second sample from the patient after a time
period to ultimately obtain a test level; and detecting in both the
first and the second samples the level of SALPR or Relaxin-3 mRNA
transcripts, wherein a level of the transcripts lower in the second
sample (test level) than that in the first sample (pre-treatment
level) indicates that the treatment regimen is effective in the
patient.
[0043] Yet, in another aspect, the invention provides methods for
monitoring the efficacy, such as potency, of a therapeutic
treatment regimen for treating a cancer (and analogous uses), for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a patient, for example, in a clinical trial
or sample from the patient to ultimately obtain a pre-treatment
level; administering the treatment regimen to the patient;
obtaining a second sample from the patient after a time period to
ultimately obtain a test level; determining in both the first and
the second samples the level of SALPR or Relaxin-3 mRNA
transcripts, by determining the overall level divided by the number
of cells present in each sample; and comparing the level of SALPR
or Relaxin-3 in the first and the second samples, respectively. A
lower level of the SALPR or Relaxin-3 mRNA transcripts in the
second sample (test level) than that in the first sample
(pre-treatment level) indicates that the treatment regimen is
effective in the patient, wherein the level can be determined via a
binding assay or other appropriate assays, including RT-PCR,
Northern hybridization, microarray analysis, two-hybrid assays such
as GAL4 DNA binding domain based assays, blot assays, sandwich
assays, and the like.
[0044] In another aspect, the present invention provides methods
for monitoring the efficacy, such as potency, of a compound to
suppress a cancer (and analogous uses), for example, a lung cancer,
a colon cancer, an ovarian cancer, or a pancreatic cancer, in a
patient, for example, in a clinical trial or other research
studies, which comprises, in any practical order, obtaining a first
sample from the patient to ultimately obtain a pre-treatment level;
administering the treatment regimen to the patient; obtaining the
second sample from the patient after a time period to ultimately
obtain a test level; and detecting in both the first and the second
samples the level of SALPR or Relaxin-3 mRNA transcripts, wherein a
level of the transcripts lower in the second sample (test level)
than that in the first sample (pre-treatment level) indicates that
the compound is effective to suppress such a cancer or a
precancerous condition.
[0045] In another aspect, the present invention provides methods
for monitoring the efficacy, such as potency, of a therapeutic
treatment regimen for treating a cancer (and analogous uses), for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a patient, for example, in a clinical trial
or other research studies, which comprises, in any practical order,
obtaining a first sample from the patient to ultimately obtain a
pre-treatment level; administering the treatment regimen to the
patient; obtaining a second sample from the patient after a time
period to ultimately obtain a test level; and detecting in both the
first and the second samples the average number of SALPR or
Relaxin-3 DNA copies per cell, for example, thereby determining the
overall or average SALPR or Relaxin-3 gene amplification state in
the first and second samples, respectively, wherein a lower number
of SALPR or Relaxin-3 DNA copies per cell, or average, for example,
in the second sample (test level) than that in the first sample
(pre-treatment level) indicates that the treatment regimen is
effective.
[0046] In yet another aspect, the present invention provides
methods for monitoring the efficacy, such as potency, of a
therapeutic treatment regimen for treating a cancer (and analogous
uses), for example, a lung cancer, a colon cancer, an ovarian
cancer, or a pancreatic cancer, in a patient, which comprises, in
any practical order, obtaining a first sample from the patient to
ultimately obtain a pre-treatment level; administering the
treatment regimen to the patient; obtaining a second sample from
the patient after a time period to ultimately obtain a test level;
contacting the samples with anti-SALPR or anti-Relaxin-3
antibodies, and detecting the level of SALPR or Relaxin-3
expression in both the first and the second samples, respectively.
A lower level of the SALPR or Relaxin-3 expression in the second
sample (test level) than in the first sample (pre-treatment level)
indicates that the treatment regimen is effective in the
patient.
[0047] Yet, in another aspect, the invention provides methods for
monitoring the efficacy, such as potency, of a therapeutic
treatment regimen for treating a cancer (and analogous uses), for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in a patient, comprising, in any practical
order, the steps of: obtaining a first sample from the patient to
ultimately obtain a pre-treatment level; administering the
treatment regimen to the patient; obtaining a second sample from
the patient after a time period to ultimately obtain a test level;
contacting the samples with anti-SALPR or anti-Relaxin-3
antibodies, determining the level of SALPR or Relaxin-3 expression
in both the first and the second samples, by determining the
overall expression divided by the number of cells present in each
sample; and comparing the expression level of SALPR or Relaxin-3 in
the first and the second samples, respectively. A lower level of
the SALPR or Relaxin-3 expression in the second sample (test level)
than that in the first sample (pre-treatment level) indicates that
the treatment regimen is effective in the patient, wherein the
expression level can be determined via a binding assay or other
appropriate assays, including RT-PCR, Northern hybridization,
microarray analysis, two-hybrid assays such as GAL4 DNA binding
domain based assays, EIA, blot assays, sandwich assays, and the
like.
[0048] In still another aspect, the present invention provides
methods for monitoring the efficacy, such as potency, of a compound
to suppress a cancer (and analogous uses), for example, a lung
cancer, a colon cancer, an ovarian cancer, or a pancreatic cancer,
in a patient, for example, in a clinical trial or other research
studies, which comprises, in any practical order, obtaining a first
sample from the patient to ultimately obtain a pre-treatment level;
administering the treatment regimen to the patient; obtaining a
second sample from the patient after a time period to ultimately
obtain a test level; and detecting in both the first and the second
samples the average number of SALPR or Relaxin-3 DNA copies per
cell, for example, thereby determining the SALPR or Relaxin-3 gene
amplification state in the first and second samples, respectively,
wherein a lower number of SALPR or Relaxin-3 DNA copies per cell,
or average, for example, in the second sample. (test level) than
that in the first sample (pre-treatment level) indicates that the
compound is effective.
[0049] One aspect of the invention provides methods for diagnosing
or predicting cancer or cancer potential and/or monitoring the
efficacy, such as potency, of a cancer therapy by using an isolated
SALPR or Relaxin-3 gene amplicon, wherein the methods further
comprise, in any practical order, obtaining a test sample from a
region in the tissue that is suspected to be precancerous or
cancerous; obtaining a control sample from a region in the tissue
or other tissues that is normal; and detecting in both the test
sample and the control sample the presence and extent of SALPR or
Relaxin-3 gene amplicons, respectively, wherein a level of
amplification higher in the test sample than that in the control
sample indicates a precancerous or cancerous condition in the
tissue. In one aspect, a control sample can be obtained from a
biological subject representative of healthy, cancer-free animals.
In another aspect, the control may be obtained from a different
individual or be a normalized value based on baseline data obtained
from a population.
[0050] Another aspect of the invention is to provide an isolated
SALPR or Relaxin-3 gene amplicon, wherein the amplicon comprises a
completely or partially amplified product of SALPR or Relaxin-3
gene, respectively, including a polynucleotide having at least
about 90% sequence identity to SALPR or Relaxin-3 gene, for
example, SEQ ID NO:1 (SALPR) or SEQ ID NO:3 (Relaxin-3), a
polynucleotide encoding the polypeptide set forth in SEQ ID NO:2
(SALPR) or SEQ ID NO:4 (Relaxin-3) or a polynucleotide that is
overexpressed in tumor cells having at least about 90% sequence
identity to the polynucleotide of SEQ ID NO:1 (SALPR) or SEQ ID
NO:3 (Relaxin-3) or the polynucleotide encoding the polypeptide set
forth in SEQ ID NO:2 (SALPR) or SEQ ID NO:4 (Relaxin-3).
[0051] In yet another aspect, the present invention provides
methods for modulating SALPR or Relaxin-3 activities by contacting
a biological subject from a region that is suspected to be
precancerous or cancerous with a modulator of the SALPR or
Relaxin-3 protein, wherein the modulator is, for example, a small
molecule.
[0052] In still another aspect, the present invention provides
methods for modulating SALPR or Relaxin-3 activities by contacting
a biological subject from a region that is suspected to be
precancerous or cancerous with a modulator of the SALPR or
Relaxin-3 protein, wherein said modulator partially or completely
inhibits transcription of SALPR or Relaxin-3 gene,
respectively.
[0053] Another aspect of the invention is to provide methods of
making a pharmaceutical composition comprising: identifying a
compound which is an inhibitor of SALPR or Relaxin-3 activity,
including the oncogenic function or anti-apoptotic activity of
SALPR or Relaxin-3; producing the compound; and optionally mixing
the compound with suitable additives or other active agents.
[0054] Still another aspect of the invention is to provide a
pharmaceutical composition obtainable by the methods described
herein, wherein the composition comprises an antibody that blocks
the oncogenic function or anti-apoptotic activity of SALPR or
Relaxin-3.
[0055] Another aspect of the invention is to provide a
pharmaceutical composition obtainable by the methods described
herein, wherein the composition comprises an antibody that binds to
a cell over-expressing SALPR or Relaxin-3 protein, thereby
resulting in death or silencing of the cell.
[0056] Yet another aspect of the invention is to provide a
pharmaceutical composition obtainable by the methods described
herein, wherein the composition comprises a SALPR- or
Relaxin-3-derived polypeptide or a fragment or a mutant thereof,
wherein the polypeptide has inhibitory activity that blocks or
inhibits the oncogenic function or anti-apoptotic activity of SALPR
or Relaxin-3, respectively.
[0057] In still a further aspect, the invention provides methods
for inducing an immune response in a mammal comprising contacting
the mammal with SALPR or Relaxin-3 polypeptide or polynucleotide,
or a fragment thereof, wherein the immune response produces
antibodies and/or T cell immune response to protect the mammal from
cancers, including a lung cancer, a colon cancer, an ovarian
cancer, or a pancreatic cancer.
[0058] Another aspect of the invention is to provide methods of
administering siRNA to a patient in need thereof, wherein the siRNA
molecule is delivered in the form of a naked oligonucleotide, sense
molecule, antisense molecule, and/or in a vector, wherein the siRNA
interacts with SALPR or Relaxin-3 gene or their transcripts,
wherein the vector is a plasmid, cosmid, bacteriophage, or a virus,
wherein the virus is for example, a retrovirus, an adenovirus, or
other suitable viral vector.
[0059] Another aspect of the invention is to provide methods of
administering miRNA to a patient in need thereof, wherein the miRNA
molecule is delivered in the form of a naked oligonucleotide, sense
molecule, antisense molecule, and/or in a vector, wherein the miRNA
interacts with SALPR or Relaxin-3 gene or their transcripts,
wherein the vector is a plasmid, cosmid, bacteriophage, or a virus,
wherein the virus is for example, a retrovirus, an adenovirus, or
other suitable viral vector.
[0060] Still in another aspect, the invention provides methods of
administering a decoy molecule to a patient in need thereof,
wherein the molecule is delivered in the form of a naked
oligonucleotide, sense molecule, antisense molecule, a decoy DNA
molecule, and/or in a vector, wherein the molecule interacts with
SALPR or Relaxin-3 gene, wherein the vector is a plasmid, cosmid,
bacteriophage, or a virus, wherein the virus is for example, a
retrovirus, an adenovirus, or other suitable viral vector.
[0061] In still a further aspect of the invention, SALPR or
Relaxin-3 decoys, antisense, triple helix forming molecules, and
ribozymes can be administered concurrently or consecutively in any
proportion; for example, two of the above can be administered
concurrently or consecutively in any proportion; or they can be
administered singly (that is, decoys, triple helix forming
molecules, antisense or ribozymes). Additionally, decoys, triple
helix forming molecules, antisense and ribozymes having different
sequences but directed against a given target (that is, SALPR or
Relaxin-3) can be administered concurrently or consecutively in any
proportion, including equimolar proportions. Thus, as is apparent
to the skilled person in view of the teachings herein, one could
choose to administer one SALPR or Relaxin-3 decoy molecule, triple
helix forming molecules, antisense and/or ribozymes, and/or two
different SALPR or Relaxin-3 decoys, triple helix forming
molecules, antisense and/or ribozymes, and/or three different SALPR
or Relaxin-3 decoys, triple helix forming molecules, antisense
and/or ribozymes in any proportion, including equimolar
proportions, for example. Of course, other permutations and
proportions can be employed by the person skilled in the art.
[0062] Still in another aspect, the invention provides methods of
administering SALPR- or Relaxin-3-siRNA and/or SALPR- or
Relaxin-3-shRNA and/or SALPR- or Relaxin-3-miRNA to a patient in
need thereof, wherein one or more of the above siRNA and/or shRNA
and/or miRNA molecules are delivered in the form of a naked
oligonucleotide, sense molecule, antisense molecule or a vector,
wherein the siRNA(s) and/or shRNA(s) and/or miRNA(s) interact(s)
with SALPR- or Relaxin-3 activity, wherein the vector is a plasmid,
cosmid, bacteriophage or a virus, wherein the virus is, for
example, a retrovirus, an adenovirus, a poxvirus, a herpes virus or
other suitable viral vector. In other words, SALPR- or
Relaxin-3-siRNAs and/or SALPR- or Relaxin-3-shRNAs and/or SALPR- or
Relaxin-3-miRNAs can be administered concurrently or consecutively
in any proportion; only two of the above can be administered
concurrently or consecutively in any proportion; or they can be
administered singly (that is, siRNAs or shRNAs or miRNAs targeting
SALPR- or Relaxin-3). Additionally, siRNAs or shRNAs or miRNAs
having different sequences but directed against a given target
(that is, SALPR or Relaxin-3) can be administered concurrently or
consecutively in any proportion, including equimolar proportions.
Thus, as is apparent to the skilled person in view of the teachings
herein, one could choose to administer one SALPR or Relaxin-3 siRNA
or shRNA or miRNA and/or two different SALPR or Relaxin-3 siRNAs or
shRNAs or miRNAs and/or three different SALPR or Relaxin-3 siRNAs
or shRNAs or miRNAs in any proportion, including equimolar
proportions, for example. Of course, other permutations and
proportions can be employed by the person skilled in the art.
Additionally, siRNAs or shRNAs or miRNAs can be employed together
with one or more of decoys, triple helix forming molecules,
antisense, ribozymes, and other functional molecules.
[0063] In another aspect, the present invention provides methods of
blocking in vivo expression of a gene by administering a vector
containing SALPR or Relaxin-3 siRNA or shRNA or miRNA, wherein the
siRNA and/or shRNA and/or miRNA interacts with SALPR or Relaxin-3
activity, respectively, wherein the siRNA and/or shRNA and/or miRNA
causes post-transcriptional silencing of SALPR or Relaxin-3 gene,
respectively, or inhibits translation of RNA into protein, in a
mammalian cell, for example, a human cell.
[0064] Yet, in another aspect, the present invention provides
methods of treating cells ex vivo by administering a vector as
described herein, wherein the vector is a plasmid, cosmid,
bacteriophage, or a virus, such as a retrovirus or an
adenovirus.
[0065] In its in vivo or ex vivo therapeutic applications, it is
appropriate to administer siRNA and/or shRNA and/or miRNA using a
viral or retroviral vector which enters the cell by transfection or
infection. In particular, as a therapeutic product according to the
invention, a vector can be a defective viral vector such as an
adenovirus or a defective retroviral vector such as a murine
retrovirus.
[0066] Another aspect of the invention provides methods of
screening or validating potency of a molecule for SALPR or
Relaxin-3 antagonist activity comprising, in any practical order,
the steps of: contacting or exposing a cancer cell with the
molecule; determining the level of SALPR or Relaxin-3 in the cell,
thereby generating data for a test level; and comparing the test
level to the level of SALPR or Relaxin-3, respectively, in the cell
prior to contacting or exposing the molecule (initial or
pre-exposed level), wherein a decrease in SALPR or Relaxin-3 in the
test level indicates SALPR or Relaxin-3 antagonist activity of the
molecule, wherein the level of SALPR or Relaxin-3 is determined by,
for example, reverse transcription and polymerase chain reaction
(RT-PCR), Northern hybridization, or microarray analysis.
[0067] In another aspect, the invention provides methods of
screening or validating potency of a molecule for SALPR or
Relaxin-3 antagonist activity comprising the steps of: contacting
or exposing the molecule with SALPR or Relaxin-3 and determining
the effect of the molecule on SALPR or Relaxin-3, respectively,
wherein the effect can be determined via a binding assay or other
appropriate assays, including RT-PCR, Northern hybridization,
microarray analysis, two-hybrid assays such as GAL4 DNA binding
domain based assays, EIA, blot assays, sandwich assays, and the
like.
[0068] In another aspect, the invention provides methods of
determining whether a molecule has SALPR or Relaxin-3 antagonist
activity or validating potency of the molecule, wherein the method
comprises, in any practical order, determining the level of SALPR
or Relaxin-3 in a test sample containing cancer cells, thereby
generating data for an initial level; contacting the molecule with
the test sample to ultimately obtain a test level; and comparing
the initial level to the test level, wherein no statistically
significant decrease in SALPR or Relaxin-3 in the test level
compared to the initial level indicates the molecule has no SALPR
or Relaxin-3 antagonist activity, respectively; and eliminating the
molecule from further evaluation or study.
[0069] In another aspect, the invention provides methods for
selecting or validating potency of molecules having SALPR or
Relaxin-3 antagonist activity, wherein the method comprises, in any
practical order, determining the level of SALPR or Relaxin-3 in a
test sample containing cancer cells, thereby generating data for an
initial level; contacting the molecule with the test sample to
ultimately obtain a test level; comparing the initial level to the
test level, wherein no statistically significant decrease in SALPR
or Relaxin-3 in the test level compared to the initial level
indicates the molecule has no SALPR or Relaxin-3 antagonist
activity, respectively; and eliminating the molecule from further
evaluation or study.
[0070] Yet, in another aspect, the invention provides methods of
screening or validating potency of a molecule for SALPR or
Relaxin-3 antagonist activity comprising, in any practical order,
the steps of: contacting a test sample containing cancer cells with
the molecule; determining the level of SALPR or Relaxin-3 mRNA
transcrips per cell, for example, by determining the overall level
divided by the number of cells present in the sample, thereby
generating data for a test level; and comparing the test level to
the expression level of SALPR or Relaxin-3 mRNA transcrips per
cell, for example, prior to contacting the molecule (initial
level), wherein a decrease in expression of SALPR or Relaxin-3 in
the test level indicates SALPR or Relaxin-3 antagonist activity of
the molecule, respectively, wherein the expression level of SALPR
or Relaxin-3 can be determined by, for example, binding assays or
other appropriate assays, including RT-PCR, Northern hybridization,
microarray analysis, two-hybrid assays such as GAL4 DNA binding
domain based assays, EIA, blot assays, sandwich assays, and the
like.
[0071] Still in another aspect, the invention provides methods of
screening or validating potency of a molecule for SALPR or
Relaxin-3 antagonist activity comprising, in any practical order,
the steps of: determining the mRNA expression level of SALPR or
Relaxin-3 in a test sample containing cancer cells, thereby
generating data for an initial or a pre-test level expression of
SALPR or Relaxin-3 mRNA; contacting the test sample with the
molecule; determining the level of SALPR or Relaxin-3 mRNA
transcrips per cell, for example, by determining the overall level
divided by the number of cells present in the sample, thereby
generating data for a test level; and comparing the test level to
the initial or pre-test level expression of SALPR or Relaxin-3 mRNA
transcrips per cell, for example, wherein a decrease in expression
of SALPR or Relaxin-3 mRNA in the test level indicates SALPR or
Relaxin-3 antagonist activity of the molecule, respectively. The
expression level of SALPR or Relaxin-3 can be determined by, for
example, binding assays or other appropriate assays, including
RT-PCR, Northern hybridization, microarray analysis, two-hybrid
assays such as GAL4 DNA binding domain based assays, blot assays,
sandwich assays, and the like.
[0072] In another aspect, the invention provides methods for
determining the level of SALPR or Relaxin-3 in a test sample for
diagnosis of a cancer, for example, a lung cancer, a colon cancer,
an ovarian cancer, or a pancreatic cancer, in a patient,
comprising, in any practical order, obtaining a control sample;
obtaining a test sample from the patient; contacting both the
control and the test samples with anti-SALPR or anti-Relaxin-3
antibodies, determining the level of SALPR or Relaxin-3 in both the
control and the test samples, by determining the overall level of
SALPR or Relaxin-3 divided by the number of cells present in each
sample; and comparing the level of SALPR or Relaxin-3,
respectively, in the control and the test samples. A higher level
of the SALPR or Relaxin-3 in the test sample obtained from the
patient than that in the control sample indicates a cancer or a
precancerous condition. The SALPR or Relaxin-3 level can be
determined via binding assays or other appropriate assays,
including RT-PCR, Northern hybridization, microarray analysis,
two-hybrid assays such as GAL4 DNA binding domain based assays,
EIA, blot assays, sandwich assays, and the like. Alternatively, a
given level of SALPR or Relaxin-3, representative of the
cancer-free population, that has been previously established based
on measurements from normal, cancer-free animals, can be used as a
control. A control data point from a reference database, based on
data obtained from control samples representative of a cancer-free
population, also can be used as a control.
[0073] In another aspect, the invention provides methods for
determining the efficacy, such as potency, of a therapeutic
treatment regimen in a patient, comprising, in any practical order,
measuring at least one of SALPR or Relaxin-3 mRNA or SALPR or
Relaxin-3 protein expression levels in a first sample obtained from
the patient, thereby generating data for a pre-treatment level;
administering the treatment regimen to the patient; measuring at
least one of SALPR or Relaxin-3 mRNA or SALPR or Relaxin-3 protein
expression levels in a second sample from the patient at a time
following administration of the treatment regimen (test level); and
comparing at least one of SALPR or Relaxin-3 mRNA or SALPR or
Relaxin-3 protein expression levels in the first and the second
samples, respectively, wherein data showing no statistically
significant decrease in the levels in the second sample relative to
the first sample indicates that the treatment regimen is not
effective in the patient.
[0074] In another aspect, the invention provides methods for
selecting test molecules having a therapeutic effect in a patient,
comprising, in any practical order, measuring at least one of SALPR
or Relaxin-3 mRNA or SALPR or Relaxin-3 protein expression levels
in a first sample obtained from the patient, thereby generating
data for a pre-treatment level; administering the test molecule to
the patient; measuring at least one of SALPR or Relaxin-3 mRNA or
SALPR or Relaxin-3 protein expression levels in a second sample
from the patient at a time following administration of the test
molecule, thereby generating a test level; comparing at least one
of SALPR or Relaxin-3 mRNA or SALPR or Relaxin-3 protein expression
levels in the first and the second samples, respectively, wherein
data showing no statistically significant decrease in the levels in
the second sample (test level) relative to the first sample
(pre-treatment level) indicates that the test molecule is not
effective in the patient; and eliminating the test molecule from
further evaluation or study.
[0075] In another aspect, the invention provides methods for
validating the potency of a therapeutic compound, wherein the
method comprises, in any practical order, measuring SALPR or
Relaxin-3 mRNA transcripts level in a first sample of cells, for
example, lung cancer, colon cancer, ovarian cancer, or pancreatic
cancer cells, wherein the cells may comprise an SALPR or Relaxin-3
amplicon, thereby generating data for a pre-treatment level;
contacting the cells with the compound; measuring SALPR or
Relaxin-3 mRNA transcripts level in a second sample from the cells
at a time following contacting the compound, thereby generating
data for a test level; and comparing the pre-treatment level to the
test level, respectively, wherein a decrease in the test level
relative to the pre-treatment level indicates that the compound is
effective.
[0076] In another aspect, the invention provides methods for
validating the potency of a therapeutic compound, wherein the
method comprises, in any practical order, measuring SALPR or
Relaxin-3 protein expression level in a first sample of cells, for
example, lung cancer, colon cancer, ovarian cancer, or pancreatic
cancer cells, wherein the cells may comprise an SALPR or Relaxin-3
amplicon, thereby generating data for a pre-treatment level;
contacting the cells with the compound; measuring SALPR or
Relaxin-3 protein expression level in a second sample from the
cells at a time following contacting the compound, thereby
generating data for a test level; and comparing the pre-treatment
level to the test level, respectively, wherein a decrease in the
test level relative to the pre-treatment level indicates that the
compound is effective.
[0077] Yet in another aspect, the invention provides methods for
validating the potency of a therapeutic compound, wherein the
method comprises culturing a cell line comprising SALPR or
Relaxin-3 amplicon in a suitable growth media; contacting the cell
line with the compound; and examining the culture for cell death or
suppression of cellular growth, wherein cellular death or
suppression of growth indicates that the compound is effective.
[0078] Samples can be obtained from the same region or a different
region of a subject. Typically, samples are taken in regions that
are similar in terms of organ or tissue type and location in order
to minimize variables.
[0079] The compounds, targets, assays, tests, inquiries and
methodologies described herein can be employed in a variety of
contexts, including diagnostic and therapeutic discovery,
diagnostic and therapeutic development, safety and efficacy
monitoring, compound and treatment regimen potency determination
and validation, treatment assessment, comparative studies,
marketing and the like. The information provided by the invention
can be communicated to regulators, physicians and other healthcare
providers, manufacturers, owners, investors, patients, and/or the
general public. This information and the like can be used in
exploratory research, pre-clinical and clinical settings, labeling,
production, advertising, and sales, for example.
[0080] Unless otherwise defined, all technical and scientific terms
used herein in their various grammatical forms have the same
meaning as commonly understood by one of ordinary skill in the art
to which this invention belongs. Although methods and materials
similar to those described herein can be used in the practice or
testing of the present invention, the preferred methods and
materials are described below. In case of conflict, the present
specification, including definitions, will control. In addition,
the materials, methods, and examples are illustrative only and are
not limiting.
[0081] Further features, objects, and advantages of the present
invention are apparent in the claims and the detailed description
that follows. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
aspects of the invention, are given by way of illustration only,
since various changes and modifications within the spirit and scope
of the invention will become apparent to those skilled in the art
from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0082] FIG. 1 depicts the epicenter mapping of human chromosome
region 5p15.1-p14 amplicon, which includes SALPR locus. The number
of DNA copies for each sample is plotted on the Y-axis, and the
X-axis corresponds to nucleotide position based on Human Genome
Project working draft sequence
(http://genome.ucsc.edu/goldenPath/aug2001Tracks.html).
[0083] FIG. 2 shows epicenter of the genomic DNA locus containing
SALPR gene in four lung tumor samples. Solid bar indicates
Relaxin-3 gene in the amplified region.
[0084] FIG. 3 depicts Cluster analysis of DNA copy numbers of
Relaxin-3, SALPR, G protein-coupled receptor 7 (LGR7), and GPCR142.
Results are displayed in the format of Eisen dendrogram: gray
shades indicate increase in DNA copy number, for example, tumors
samples 263A1 and 4159A1 exhibit amplifications of both Relaxin-3
and SALPR.
[0085] FIG. 4 shows tumor growth (Mean.+-.SEM) in athymic nude mice
following implantation with about 5 million 3T3 transfectants. A
total of 10 mice were used for each experimental (SALPR)/control
(Vector) group and palpable/measurable tumors were recorded. Tumor
growth was measured with a caliper in three perpendicular
dimensions and recorded as mm.sup.3.
[0086] FIG. 5 shows tumor growth (Mean.+-.SEM) in athymic nude mice
following implantation with about 5 million 3T3 transfectants. A
total of 6 mice for experimental (SALPR C terminal FLAG) and 5 mice
for control (Vector only) group were used. Tumor growth was
measured with a caliper in three perpendicular dimensions and
recorded as mm.sup.3.
DETAILED DESCRIPTION OF THE INVENTION
[0087] The present invention provides methods and compositions for
the diagnosis, prevention, and treatment of tumors and cancers, for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, in mammals, for example, humans. The invention
is based on the findings of novel attributes of the SALPR and
Relaxin-3 genes. The SALPR and/or Relaxin-3 genes and their
expressed protein products thus can be used diagnostically or as
targets for therapy; and, they also can be used to identify
compounds useful in the diagnosis, prevention, and therapy of
tumors and cancers (for example, a lung cancer, a colon cancer, an
ovarian cancer, or a pancreatic cancer).
[0088] The present invention also provides isolated amplified SALPR
and Relaxin-3 genes. This invention also provides that the SALPR
and Relaxin-3 genes are frequently amplified and/or overexpressed
in tumor cells, for example, human lung tumor, colon tumor, ovarian
tumor, or pancreatic tumor, and relates to methods and compositions
associated with the diagnosis, prevention, monitoring, and
treatment of cancers.
[0089] Homo sapiens Somatostatin- and Angiotensin-Like Peptide
Receptor (SALPR):
[0090] SALPR, a putative seven-transmembrane domain receptor, a
G-protein-coupled receptor (GPCR, also known as GPCR135), contains
469 amino acids and shares the highest amount of amino acid
similarity with the somatostatin (35% with seven-transmembrane
receptor SSTR5) and angiotensin (31% with angiotensin II receptor
subtype ATI) receptors. SALPR and related mRNA are expressed in
various organs in humans, including brain, particularly the
substantia nigra and pituitary regions, and at low levels in the
peripheral tissues (Matsumoto et al., Gene 248(1-2):183-189,
2000).
[0091] A full-length cDNA for SALPR has been cloned and the
sequence has been submitted to GenBank database (Accession No.
NM.sub.--016568; SEQ ID NO:1). The SALPR DNA of 1857 nucleotides
encodes a protein of 469 amino acids (GenBank Protein ID.
NP.sub.--057652.1; SEQ ID NO:2). The amino acid sequence encoded by
the DNA for SALPR shows a high degree of identity to other SALPR
family proteins. The human SALPR gene maps to chromosome
5p15.1-p14.
[0092] Several international applications and research articles
(see International Publications WO 01/48189, EP 1 126 029, WO
00/24891, JP2000279183, WO 02/31111, WO 01/85791, and WO 02/61097;
Matsumoto et al., Gene 248(1-2):183-189, 2000; O'Dowd et al., Gene
10;187(1):75-81, 1997; Kolakowski et al., FEBS Lett.
398(2-3):253-258, 1996; and Mukoyama et al., J Biol Chem
268(33):24539-24542, 1993) generally describe aspects of GPCR,
somatostatin, and angiotensin related proteins, encoding genes and
their expression products, however, amplification and
overexpression of SALPR gene and its practical uses in cancer
diagnosis and treatment have not been discussed.
[0093] Homo sapiens Relaxin-3:
[0094] Homo sapiens Relaxin-3 (H3) (RLN3) also is known as
insulin-7 (INSL7). Relaxin-3 protein is known to bind and activate
orphan leucine-rich repeat-containing G protein-coupled receptor 7
(LGR7). Human relaxin 3 (H3 relaxin) recently has been discovered
as a novel ligand for relaxin receptors (Sudo et al. J Biol Chem.
278(10):7855-62, 2003). It was not known until recently that the
relaxin-3 is an endogenous ligand of SALPR, the G-protein coupled
receptor, GPCR135 (Liu et al. J Biol Chem. 278(50):50754-64, 2003)
and a single orphan receptor, GPCR142 (Liu et al. J Biol Chem.
278(50):50765-70, 2003).
[0095] A full-length cDNA for Relaxin-3 has been cloned and the
sequence has been submitted to GenBank database (Accession No.
NM.sub.--080864; SEQ ID NO:3). The Relaxin-3 DNA of 429 nucleotides
encodes a protein of 142 amino acids (GenBank Protein ID.
NP.sub.--543140; SEQ ID NO:4). The human Relaxin-3 gene maps to
chromosome 19p13.2.
[0096] Several investigators have generally described the role of
relaxin-3 in neuropeptide signaling processes (Bathgate et al. J
Biol Chem. 277(2):1148-57, 2002) and have speculated about its
involvement in tumor progression (Ivell and Einspanier, Trends
Endocrinol Metab. 13(8):343-8, 2002), however, amplification and
overexpression of relaxin-3 gene and its practical uses in cancer
diagnosis and treatment have not been discussed.
[0097] 1. Definitions:
[0098] A "cancer" in an animal refers to the presence of cells
possessing characteristics typical of cancer-causing cells, for
example, uncontrolled proliferation, loss of specialized functions,
immortality, significant metastatic potential, significant increase
in anti-apoptotic activity, rapid growth and proliferation rate,
and certain characteristic morphology and cellular markers. In some
circumstances, cancer cells will be in the form of a tumor; such
cells may exist locally within an animal, or circulate in the blood
stream as independent cells, for example, leukemic cells.
[0099] The phrase "detecting a cancer" or "diagnosing or predicting
a cancer or a cancer potential" refers to determining the presence
or absence of cancer or a precancerous condition in an animal.
"Detecting a cancer" also can refer to obtaining indirect evidence
regarding the likelihood of the presence of precancerous or
cancerous cells in the animal or assessing the predisposition of a
patient to the development of a cancer. Detecting a cancer can be
accomplished using the methods of this invention alone, in
combination with other methods, or in light of other information
regarding the state of health of the animal.
[0100] A "tumor," as used herein, refers to all neoplastic cell
growth and proliferation, whether malignant or benign, and all
precancerous and cancerous cells and tissues.
[0101] The term "precancerous" refers to cells or tissues having
characteristics relating to changes that may lead to malignancy or
cancer. Examples include adenomatous growths in lung, colon, ovary,
or pancreas, tissues, or conditions, for example, dysplastic nevus
syndrome, a precursor to malignant melanoma of the skin. Examples
also include, abnormal neoplastic, in addition to dysplastic nevus
syndromes, polyposis syndromes, prostatic dysplasia, and other such
neoplasms, whether the precancerous lesions are clinically
identifiable or not.
[0102] A "differentially expressed gene transcript", as used
herein, refers to a gene, including an oncogene, transcript that is
found in different numbers of copies in different cell or tissue
types of an organism having a tumor or cancer, for example, a lung
cancer, a colon cancer, an ovarian cancer, or a pancreatic cancer,
compared to the numbers of copies or state of the gene transcript
found in the cells of the same tissue in a healthy organism, or in
the cells of the same tissue in the same organism. Multiple copies
of gene transcripts may be found in an organism having the tumor or
cancer, while fewer copies of the same gene transcript are found in
a healthy organism or healthy cells of the same tissue in the same
organism, or vice-versa.
[0103] A "differentially expressed gene," can be a target,
fingerprint, or pathway gene. For example, a "fingerprint gene", as
used herein, refers to a differentially expressed gene whose
expression pattern can be used as a prognostic or diagnostic marker
for the evaluation of tumors and cancers, or which can be used to
identify compounds useful for the treatment of tumors and cancers,
for example, lung cancer, colon cancer, ovarian cancer, or
pancreatic cancer. For example, the effect of a compound on the
fingerprint gene expression pattern normally displayed in
connection with tumors and cancers can be used to evaluate the
efficacy, such as potency, of the compound as a tumor and cancer
treatment, or can be used to monitor patients undergoing clinical
evaluation for the treatment of tumors and cancer.
[0104] A "fingerprint pattern", as used herein, refers to a pattern
generated when the expression pattern of a series (which can range
from two up to all the fingerprint genes that exist for a given
state) of fingerprint genes is determined. A fingerprint pattern
also may be referred to as an "expression profile". A fingerprint
pattern or expression profile can be used in the same diagnostic,
prognostic, and compound identification methods as the expression
of a single fingerprint gene.
[0105] A "target gene", as used herein, refers to a differentially
expressed gene in which modulation of the level of gene expression
or of gene product activity prevents and/or ameliorates tumor and
cancer, for example, lung cancer, colon cancer, ovarian cancer, or
pancreatic cancer, symptoms. Thus, compounds that modulate the
expression of a target gene, the target gene, or the activity of a
target gene product can be used in the diagnosis, treatment or
prevention of tumors and cancers. A particular target gene of the
present invention is the SALPR or Relaxin-3 gene.
[0106] In general, a "gene" is a region on the genome that is
capable of being transcribed to an RNA that either has a regulatory
function, a catalytic function, and/or encodes a protein. An
eukaryotic gene typically has introns and exons, which may organize
to produce different RNA splice variants that encode alternative
versions of a mature protein. The skilled artisan will appreciate
that the present invention encompasses all SALPR- and
Relaxin-3-encoding transcripts that may be found, including splice
variants, allelic variants and transcripts that occur because of
alternative promoter sites or alternative poly-adenylation sites. A
"full-length" gene or RNA therefore encompasses any naturally
occurring splice variants, allelic variants, other alternative
transcripts, splice variants generated by recombinant technologies
which bear the same function as the naturally occurring variants,
and the resulting RNA molecules. A "fragment" of a gene, including
an oncogene, can be any portion from the gene, which may or may not
represent a functional domain, for example, a catalytic domain, a
DNA binding domain, etc. A fragment may preferably include
nucleotide sequences that encode for at least 25 contiguous amino
acids, and preferably at least about 30, 40, 50, 60, 65, 70, 75 or
more contiguous amino acids or any integer thereabout or
therebetween.
[0107] "Pathway genes", as used herein, are genes that encode
proteins or polypeptides that interact with other gene products
involved in tumors and cancers. Pathway genes also can exhibit
target gene and/or fingerprint gene characteristics.
[0108] A "detectable" RNA expression level, as used herein, means a
level that is detectable by standard techniques currently known in
the art or those that become standard at some future time, and
include for example, differential display, RT (reverse
transcriptase)-coupled polymerase chain reaction (PCR), Northern
Blot, and/or RNase protection analyses. The degree of differences
in expression levels need only be large enough to be visualized or
measured via standard characterization techniques.
[0109] As used herein, the term "transformed cell" means a cell
into which (or into predecessor or an ancestor of which) a nucleic
acid molecule encoding a polypeptide of the invention has been
introduced, by means of, for example, recombinant DNA techniques or
viruses.
[0110] The nucleic acid molecules of the invention, for example,
the SALPR and Relaxin-3 genes or their subsequences, can be
inserted into a vector, as described below, which will facilitate
expression of the insert. The nucleic acid molecules and the
polypeptides they encode can be used directly as diagnostic or
therapeutic agents, or can be used (directly in the case of the
polypeptide or indirectly in the case of a nucleic acid molecule)
to generate antibodies that, in turn, are clinically useful as a
therapeutic or diagnostic agent. Accordingly, vectors containing
the nucleic acids of the invention, cells transfected with these
vectors, the polypeptides expressed, and antibodies generated
against either the entire polypeptide or an antigenic fragment
thereof, are among the aspects of the invention.
[0111] A "structural gene" is a DNA sequence that is transcribed
into messenger RNA (mRNA) which is then translated into a sequence
of amino acids characteristic of a specific polypeptide.
[0112] An "isolated DNA molecule" is a fragment of DNA that has
been separated from the chromosomal or genomic DNA of an organism.
Isolation also is defined to connote a degree of separation from
original source or surroundings. For example, a cloned DNA molecule
encoding an avidin gene is an isolated DNA molecule. Another
example of an isolated DNA molecule is a chemically-synthesized DNA
molecule, or enzymatically-produced cDNA, that is not integrated in
the genomic DNA of an organism. Isolated DNA molecules can be
subjected to procedures known in the art to remove contaminants
such that the DNA molecule is considered purified, that is, towards
a more homogeneous state.
[0113] "Complementary DNA" (cDNA), often referred to as "copy DNA",
is a single-stranded DNA molecule that is formed from an mRNA
template by the enzyme reverse transcriptase. Typically, a primer
complementary to portions of the mRNA is employed for the
initiation of reverse transcription. Those skilled in the art also
use the term "cDNA" to refer to a double-stranded DNA molecule that
comprises such a single-stranded DNA molecule and its complement
DNA strand.
[0114] The term "expression" refers to the biosynthesis of a gene
product. For example, in the case of a structural gene, expression
involves transcription of the structural gene into mRNA and the
translation of mRNA into one or more polypeptides.
[0115] The term "amplification" refers to amplification,
duplication, multiplication, or multiple expression of nucleic
acids or a gene, in vivo or in vitro, yielding about 3.0 fold or
more copies. For example, amplification of the SALPR or Relaxin-3
gene resulting in a copy number greater than or equal to 3.0 is
deemed to have been amplified. However, an increase in SALPR or
Relaxin-3 gene copy number less than 3.0 fold can still be
considered as an amplification of the gene. The 3.0 fold figure is
due to current detection limit, rather than a biological state.
[0116] The term "amplicon" refers to an amplification product
containing one or more genes, which can be isolated from a
precancerous or a cancerous cell or a tissue. SALPR or Relaxin-3
amplicon is a result of amplification, duplication, multiplication,
or multiple expression of nucleic acids or a gene, in vivo or in
vitro. "Amplicon", as defined herein, also includes a completely or
partially amplified SALPR and/or Relaxin-3 genes. For example, an
amplicon comprising a polynucleotide having at least about 90%
sequence identity to SEQ ID NO:1 (SALPR), SEQ ID NO:3 (Relaxin-3),
or a fragment thereof.
[0117] A "cloning vector" is a nucleic acid molecule, for example,
a plasmid, cosmid, or bacteriophage that has the capability of
replicating autonomously in a host cell. Cloning vectors typically
contain (i) one or a small number of restriction endonuclease
recognition sites at which foreign DNA sequences can be inserted in
a determinable fashion without loss of an essential biological
function of the vector, and (ii) a marker gene that is suitable for
use in the identification and selection of cells transformed or
transfected with the cloning vector. Marker genes include genes
that provide tetracycline resistance or ampicillin resistance, for
example.
[0118] An "expression vector" is a nucleic acid construct,
generated recombinantly or synthetically, bearing a series of
specified nucleic acid elements that enable transcription of a
particular gene in a host cell. Typically, gene expression is
placed under the control of certain regulatory elements, including
constitutive or inducible promoters, tissue-preferred regulatory
elements, and enhancers.
[0119] A "recombinant host" may be any prokaryotic or eukaryotic
cell that contains either a cloning vector or expression vector.
This term also includes those prokaryotic or eukaryotic cells that
have been genetically engineered to contain the cloned gene(s) in
the chromosome or genome of the host cell.
[0120] "Antisense RNA": In eukaryotes, RNA polymerase catalyzes the
transcription of a structural gene to produce mRNA. A DNA molecule
can be designed to contain an RNA polymerase template in which the
RNA transcript has a sequence that is complementary to that of a
preferred mRNA. The RNA transcript is termed an "antisense RNA".
Antisense RNA molecules can inhibit mRNA expression (for example,
Rylova et al., Cancer Res, 62(3):801-8, 2002; Shim et al., Int. J.
Cancer, 94(1):6-15, 2001).
[0121] "Antisense DNA" or "DNA decoy" or "decoy molecule": With
respect to a first nucleic acid molecule, a second DNA molecule or
a second chimeric nucleic acid molecule that is created with a
sequence which is a complementary sequence or homologous to the
complementary sequence of the first molecule or portions thereof,
is referred to as the "antisense DNA" or "DNA decoy" or "decoy
molecule" of the first molecule. The term "decoy molecule" also
includes a nucleic acid molecule, which may be single or double
stranded, that comprises DNA or PNA (peptide nucleic acid)
(Mischiati et al., Int. J. Mol. Med., 9(6):633-9, 2002), and that
contains a sequence of a protein binding site, preferably a binding
site for a regulatory protein and more preferably a binding site
for a transcription factor. Applications of antisense nucleic acid
molecules, including antisense DNA and decoy DNA molecules are
known in the art, for example, Morishita et al., Ann. N Y Acad.
Sci., 947:294-301, 2001; Andratschke et al., Anticancer Res,
21:(5)3541-3550, 2001. Antisense DNA or PNA molecules can inhibit,
block, or regulate function and/or expression of a SALPR or a
Relaxin-3 gene. Antisense and decoys can have different sequences,
but can be directed against a SALPR or a Relaxin-3 and can be
administered concurrently or consecutively in any proportion,
including equimolar proportions.
[0122] The term "operably linked" is used to describe the
connection between regulatory elements and a gene or its coding
region. That is, gene expression is typically placed under the
control of certain regulatory elements, including constitutive or
inducible promoters, tissue-specific regulatory elements, and
enhancers. Such a gene or coding region is said to be "operably
linked to" or "operatively linked to" or "operably associated with"
the regulatory elements, meaning that the gene or coding region is
controlled or influenced by the regulatory element.
[0123] "Sequence homology" is used to describe the sequence
relationships between two or more nucleic acids, polynucleotides,
proteins, or polypeptides, and is understood in the context of and
in conjunction with the terms including: (a) reference sequence,
(b) comparison window, (c) sequence identity, (d) percentage of
sequence identity, and (e) substantial identity or
"homologous."
[0124] (a) A "reference sequence" is a defined sequence used as a
basis for sequence comparison. A reference sequence may be a subset
of or the entirety of a specified sequence; for example, a segment
of a full-length cDNA or gene sequence, or the complete cDNA or
gene sequence. For polypeptides, the length of the reference
polypeptide sequence will generally be at least about 16 amino
acids, preferably at least about 20 amino acids, more preferably at
least about 25 amino acids, and even more preferably about 35 amino
acids, about 50 amino acids, or about 100 amino acids. For nucleic
acids, the length of the reference nucleic acid sequence will
generally be at least about 50 nucleotides, preferably at least
about 60 nucleotides, more preferably at least about 75
nucleotides, and even more preferably about 100 nucleotides or
about 300 nucleotides or any integer thereabout or
therebetween.
[0125] (b) A "comparison window" includes reference to a contiguous
and specified segment of a polynucleotide sequence, wherein the
polynucleotide sequence may be compared to a reference sequence and
wherein the portion of the polynucleotide sequence in the
comparison window may comprise additions, substitutions, or
deletions (i.e., gaps) compared to the reference sequence (which
does not comprise additions, substitutions, or deletions) for
optimal alignment of the two sequences. Generally, the comparison
window is at least 20 contiguous nucleotides in length, and
optionally can be 30, 40, 50, 100, or longer. Those of skill in the
art understand that to avoid a misleadingly high similarity to a
reference sequence due to inclusion of gaps in the polynucleotide
sequence a gap penalty is typically introduced and is subtracted
from the number of matches.
[0126] Methods of alignment of sequences for comparison are
well-known in the art. Optimal alignment of sequences for
comparison may be conducted by the local homology algorithm of
Smith and Waterman, Adv. Appl. Math., 2: 482, 1981; by the homology
alignment algorithm of Needleman and Wunsch, J. Mol. Biol., 48:
443, 1970; by the search for similarity method of Pearson and
Lipman, Proc. Natl. Acad. Sci. USA, 8: 2444, 1988; by computerized
implementations of these algorithms, including, but not limited to:
CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View,
Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin
Genetics Software Package, Genetics Computer Group (GCG), 7 Science
Dr., Madison, Wis., USA; the CLUSTAL program is well described by
Higgins and Sharp, Gene, 73: 237-244, 1988; Corpet, et al., Nucleic
Acids Research, 16:881-90, 1988; Huang, et al., Computer
Applications in the Biosciences, 8:1-6, 1992; and Pearson, et al.,
Methods in Molecular Biology, 24:7-331, 1994. The BLAST family of
programs which can be used for database similarity searches
includes: BLASTN for nucleotide query sequences against nucleotide
database sequences; BLASTX for nucleotide query sequences against
protein database sequences; BLASTP for protein query sequences
against protein database sequences; TBLASTN for protein query
sequences against nucleotide database sequences; and TBLASTX for
nucleotide query sequences against nucleotide database sequences.
See, Current Protocols in Molecular Biology, Chapter 19, Ausubel,
et al., Eds., Greene Publishing and Wiley-Interscience, New York,
1995. New versions of the above programs or new programs altogether
will undoubtedly become available in the future, and can be used
with the present invention.
[0127] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using the BLAST 2.0
suite of programs, or their successors, using default parameters.
Altschul et al., Nucleic Acids Res, 2:3389-3402, 1997. It is to be
understood that default settings of these parameters can be readily
changed as needed in the future.
[0128] As those ordinary skilled in the art will understand, BLAST
searches assume that proteins can be modeled as random sequences.
However, many real proteins comprise regions of nonrandom sequences
which may be homopolymeric tracts, short-period repeats, or regions
enriched in one or more amino acids. Such low-complexity regions
may be aligned between unrelated proteins even though other regions
of the protein are entirely dissimilar. A number of low-complexity
filter programs can be employed to reduce such low-complexity
alignments. For example, the SEG (Wooten and Federhen, Comput.
Chem., 17:149-163, 1993) and XNU (Claverie and States, Comput.
Chem., 17:191-1, 1993) low-complexity filters can be employed alone
or in combination.
[0129] (c) "Sequence identity" or "identity" in the context of two
nucleic acid or polypeptide sequences includes reference to the
residues in the two sequences which are the same when aligned for
maximum correspondence over a specified comparison window, and can
take into consideration additions, deletions and substitutions.
When percentage of sequence identity is used in reference to
proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (for example, charge or
hydrophobicity) and therefore do not deleteriously change the
functional properties of the molecule. Where sequences differ in
conservative substitutions, the percent sequence identity may be
adjusted upwards to correct for the conservative nature of the
substitution. Sequences which differ by such conservative
substitutions are said to have sequence similarity. Approaches for
making this adjustment are well-known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, for example, according to the
algorithm of Meyers and Miller, Computer Applic. Biol. Sci., 4:
11-17, 1988, for example, as implemented in the program PC/GENE
(Intelligenetics, Mountain View, Calif., USA).
[0130] (d) "Percentage of sequence identity" means the value
determined by comparing two optimally aligned sequences over a
comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions,
substitutions, or deletions (i.e., gaps) as compared to the
reference sequence (which does not comprise additions,
substitutions, or deletions) for optimal alignment of the two
sequences. The percentage is calculated by determining the number
of positions at which the identical nucleic acid base or amino acid
residue occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison and multiplying the
result by 100 to yield the percentage of sequence identity.
[0131] (e) (i) The tern "substantial identity" or "homologous" in
their various grammatical forms in the context of polynucleotides
means that a polynucleotide comprises a sequence that has a desired
identity, for example, at least 60% identity, preferably at least
70% sequence identity, more preferably at least 80%, still more
preferably at least 90% and even more preferably at least 95%,
compared to a reference sequence using one of the alignment
programs described using standard parameters. One of skill will
recognize that these values can be appropriately adjusted to
determine corresponding identity of proteins encoded by two
nucleotide sequences by taking into account codon degeneracy, amino
acid similarity, reading frame positioning and the like.
Substantial identity of amino acid sequences for these purposes
normally means sequence identity of at least 60%, more preferably
at least 70%, 80%, 90%, and even more preferably at least 95%.
[0132] Another indication that nucleotide sequences are
substantially identical if two molecules hybridize to each other
under stringent conditions. However, nucleic acids which do not
hybridize to each other under stringent conditions are still
substantially identical if the polypeptides which they encode are
substantially identical. This may occur, for example, when a copy
of a nucleic acid is created using the maximum codon degeneracy
permitted by the genetic code. One indication that two nucleic acid
sequences are substantially identical is that the polypeptide which
the first nucleic acid encodes is immunologically cross reactive
with the polypeptide encoded by the second nucleic acid, although
such cross-reactivity is not required for two polypeptides to be
deemed substantially identical.
[0133] (e) (ii) The term "substantial identity" or "homologous" in
their various grammatical forms in the context of peptides
indicates that a peptide comprises a sequence that has a desired
identity, for example, at least 60% identity, preferably at least
70% sequence identity to a reference sequence, more preferably 80%,
still more preferably 85%, even more preferably at least 90% or 95%
sequence identity to the reference sequence over a specified
comparison window. Preferably, optimal alignment is conducted using
the homology alignment algorithm of Needleman and Wunsch, J. Mol.
Biol., 48:443, 1970. An indication that two peptide sequences are
substantially identical is that one peptide is immunologically
reactive with antibodies raised against the second peptide,
although such cross-reactivity is not required for two polypeptides
to be deemed substantially identical. Thus, a peptide is
substantially identical to a second peptide, for example, where the
two peptides differ only by a conservative substitution. Peptides
which are "substantially similar" share sequences as noted above
except that residue positions which are not identical may differ by
conservative amino acid changes. Conservative substitutions
typically include, but are not limited to, substitutions within the
following groups: glycine and alanine; valine, isoleucine, and
leucine; aspartic acid and glutamic acid; asparagine and glutamine;
serine and threonine; lysine and arginine; and phenylalanine and
tyrosine, and others as known to the skilled person.
[0134] "Biological subject" as used herein refers to a target
biological object obtained, reached, or collected in vivo, ex-vivo,
or in situ, that contains or is suspected of containing nucleic
acids or polypeptides of SALPR or Relaxin-3. A biological subject
is typically of eukaryotic nature, for example, insects, protozoa,
birds, fish, reptiles, and preferably a mammal, for example, rat,
mouse, cow, dog, guinea pig, or rabbit, and more preferably a
primate, for example, chimpanzees, or humans such as a patient in
need of diagnostic review, treatment and/or monitoring of
therapy.
[0135] "Biological sample" as used herein refers to a sample
obtained from a biological subject, including sample of biological
tissue or fluid origin, obtained, reached, or collected in vivo,
ex-vivo, or in situ, that contains or is suspected of containing
nucleic acids or polypeptides of SALPR or Relaxin-3. A biological
sample also includes samples from a region of a biological subject
containing precancerous or cancer cells or tissues. Such samples
can be, but are not limited to, organs, tissues, fractions and
cells isolated from mammals including, humans such as a patient,
mice, and rats. Biological samples also may include sections of the
biological sample including tissues, for example, frozen sections
taken for histologic purposes. A biological sample is typically of
an eukaryotic origin, for example, insects, protozoa, birds, fish,
reptiles, and preferably a mammal, for example, rat, mouse, cow,
dog, guinea pig, or rabbit, and more preferably a primate, for
example, chimpanzees or humans. A biological sample, as described
herein, can be: a "control" or a "control sample" or a "test
sample".
[0136]
[0137] A "control " refers to a representative of healthy,
cancer-free biological subject or information obtained from a
different individual or a normalized value, which can be based on
baseline data obtained from a population or other acceptable
sources. A control also can refer to a given level of SALPR or
Relaxin-3, representative of the cancer-free population, that has
been previously established based on measurements from normal,
cancer-free animals. A control also can be a reference data point
in a database based on data obtained from control samples
representative of a cancer-free population. Further, a control can
be established by a specific age, sex, ethnicity or other
demographic parameters. In some situations, the control is implicit
in the particular measurement. A typical control level for a gene
is two copies per cell. An example of an implicit control is where
a detection method can only detect SALPR or Relaxin-3, or the
corresponding gene copy number, when a level higher than that
typical of a normal, cancer-free animal is present. Another example
is in the context of an immunohistochemical assay where the control
level for the assay is known. Other instances of such controls are
within the knowledge of the skilled person.
[0138] A "control sample" refers to a sample of biological material
representative of healthy, cancer-free animals or a normal
biological subject obtained from a cancer-free population. The
level of SALPR or Relaxin-3 in a control sample, or the encoding
corresponding gene copy number, is desirably typical of the general
population of normal, cancer-free animals of the same species. This
sample either can be collected from an animal for the purpose of
being used in the methods described in the present invention or it
can be any biological material representative of normal,
cancer-free animals suitable for use in the methods of this
invention. A control sample also can be obtained from normal tissue
from the animal that has cancer or is suspected of having
cancer.
[0139] A "test sample" as used herein refers to a biological
sample, including sample of biological tissue or fluid origin,
obtained, reached, or collected in vivo, ex-vivo, or in situ, that
contains or is suspected of containing nucleic acids or
polypeptides of SALPR or Relaxin-3. A test sample also includes
biological samples containing precancerous or cancer cells or
tissues. Such test samples can be, but are not limited to, organs,
tissues, fractions and cells isolated from mammals including,
humans such as a patient, mice, and rats. A test sample also may
include sections of the biological sample including tissues, for
example, frozen sections taken for histologic purposes.
[0140] "Providing a biological subject, a biological sample, or a
test sample" means to obtain a biological subject in vivo, ex-vivo,
or in situ, including tissue or cell sample for use in the methods
described in the present invention. Most often, this will be done
by removing a sample of cells from an animal, but also can be
accomplished in vivo, ex-vivo, or in situ, or by using previously
isolated cells (for example, isolated from another person, at
another time, and/or for another purpose).
[0141] "Data" includes, but is not limited to, information obtained
that relates to "biological sample", "test sample", "control
sample", and/or "control", as described above, wherein the
information is applied in generating a test level for diagnostics,
prevention, monitoring or therapeutic use. The present invention
relates to methods for comparing and compiling data wherein the
data is stored in electronic or paper formats. Electronic format
can be selected from the group consisting of electronic mail, disk,
compact disk (CD), digital versatile disk (DVD), memory card,
memory chip, ROM or RAM, magnetic optical disk, tape, video, video
clip, microfilm, internet, shared network, shared server and the
like; wherein data is displayed, transmitted or analyzed via
electronic transmission, video display, telecommunication, or by
using any of the above stored formats; wherein data is compared and
compiled at the site of sampling specimens or at a location where
the data is transported following a process as described above.
[0142] "Overexpression" of a SALPR or a Relaxin-3 gene or an
"increased," or "elevated," level of a SALPR or a Relaxin-3
ribonucleotide or protein refers to a level of SALPR or Relaxin-3
ribonucleotide or polypeptide that, in comparison with a control
level of SALPR or Relaxin-3, is detectably higher. Comparison may
be carried out by statistical analyses on numeric measurements of
the expression; or, it may be done through visual examination of
experimental results by qualified researchers.
[0143] A level of SALPR or Relaxin-3 ribonucleotide or polypeptide,
that is "expected" in a control sample refers to a level that
represents a typical, cancer-free sample, and from which an
elevated, or diagnostic, presence of SALPR or Relaxin-3 polypeptide
or polynucleotide, can be distinguished. Preferably, an "expected"
level will be controlled for such factors as the age, sex, medical
history, etc. of the mammal, as well as for the particular
biological subject being tested.
[0144] The phrase "functional effects" in the context of an assay
or assays for testing compounds that modulate SALPR or Relaxin-3
activity includes the determination of any parameter that is
indirectly or directly under the influence of SALPR or Relaxin-3,
for example, a functional, physical, or chemical effect, for
example, SALPR or Relaxin-3 activity, the ability to induce gene
amplification or overexpression in cancer cells, and to aggravate
cancer cell proliferation. "Functional effects" include in vitro,
in vivo, and ex vivo activities.
[0145] "Determining the functional effect" refers to assaying for a
compound that increases or decreases a parameter that is indirectly
or directly under the influence of SALPR or Relaxin-3, for example,
functional, physical, and chemical effects. Such functional effects
can be measured by any means known to those skilled in the art, for
example, changes in spectroscopic characteristics (for example,
fluorescence, absorbance, refractive index), hydrodynamic (for
example, shape), chromatographic, or solubility properties for the
protein, measuring inducible markers or transcriptional activation
of SALPR or Relaxin-3; measuring binding activity or binding
assays, for example, substrate binding, and measuring cellular
proliferation; measuring signal transduction; or measuring cellular
transformation; or other appropriate assay, including reverse
transcription and polymerase chain reaction (RT-PCR), Northern
hybridization, microarray analysis, enzyme immuno assay (EIA),
two-hybrid assays such as GAL4 DNA binding domain based assays,
blot assays, sandwich assays, and the like.
[0146] "Inhibitors," "activators," "modulators," and "regulators"
refer to molecules that activate, inhibit, modulate, regulate
and/or block an identified function. Any molecule having potential
to activate, inhibit, modulate, regulate and/or block an identified
function can be a "test molecule" or a "production molecule" or an
"in-process molecule", as described herein. A "test molecule"
refers to uncharacterized or partially characterized molecules,
natural or artifical, that may have the potential of anti-apoptotic
activity of SALPR or Relaxin-3 and under investigation for
potential to activate, inhibit, modulate, regulate and/or block an
identified function. A "production molecule" or an "in-process
molecule" refers to molecules that are characterized and/or
identified as having the ability to activate, inhibit, modulate,
regulate and/or block an identified function of SALPR or Relaxin-3.
A "production molecule" or an "in-process molecule" can be
validated for potency to activate, inhibit, modulate, regulate
and/or block an identified function. For example, referring to
oncogenic function or anti-apoptotic activity of SALPR or
Relaxin-3, such molecules may be identified using in vitro and in
vivo assays of SALPR or Relaxin-3, respectively. Inhibitors are
compounds that partially or totally block SALPR or Relaxin-3,
respectively, decrease, prevent, or delay their activation, or
desensitize their cellular response. This may be accomplished by
binding to SALPR or Relaxin-3 proteins directly or via other
intermediate molecules. An antagonist or an antibody that blocks
SALPR or Relaxin-3 activity, including inhibition of oncogenic
function or anti-apoptotic activity of SALPR or Relaxin-3,
respectively, is considered to be such an inhibitor.
[0147] One type of inhibitor is the soluble receptor trap. Soluble
receptors provide effective traps for their ligands, which bind the
ligands with affinities in the picomolar range, often without
creating problematic intermediates. A soluble receptor trap for
SALPR or Relaxin-3 proteins can act as an antagonist. The soluble
receptor ligand trap functions as an antagonist by sequestering
SALPR or Relaxin-3 and thus rendering unavailable to interact with
the native receptors on SALPR- or Relaxin-3-responsive cells,
respectively.
[0148] An effective antagonist of SALPR or Relaxin-3, such as a
soluble receptor trap, can comprise heterodimers of the
extracellular domains of SALPR or Relaxin-3 receptor, respectively,
thus rendering SALPR or Relaxin-3 unavailable to interact with the
native receptors on SALPR- or Relaxin-3-responsive cells,
respectively.
[0149] Soluble ligand binding domains from extracellular portion of
receptors have proven to be effective as traps for ligands
(Bargetzi, et al., Cancer Res., 53:4010-4013, 1993; Mohler, et al.,
J. Immunol., 151:1548-1561,1993; Narazaki, et al., Blood,
82:1120-1126, 1993).
[0150] The heterodimeric receptors can be engineered using fusion
regions, as described in published WO93/10151, published May 27,
1993, which describes production of beta receptor heterodimers, or
they can be prepared by crosslinking of extracellular domains by
chemical methodologies.
[0151] Technology known in the art also allows the engineering of
different heteromeric soluble receptor ligand traps, which by
virtue of their design may have additional beneficial
characteristics such as stability, Fc-receptor-mediated clearance,
or reduced effector functions (such as complement fixation).
Furthermore, the technology described will be suitable for the
engineering of any heteromeric protein in mammalian or other
suitable protein expression systems, including but not limited to
heteromeric molecules which employ receptors, ligands, and
catalytic components such as enzymes or catalytic antibodies.
[0152] Activators are compounds that bind to SALPR or Relaxin-3
protein directly or via other intermediate molecules, thereby
increasing or enhancing their activity, stimulating or accelerating
their activation, or sensitizing their cellular response. An
agonist of SALPR or Relaxin-3 is considered to be such an
activator. A modulator can be an inhibitor or activator. A
modulator may or may not bind SALPR or Relaxin-3 or their protein
directly; it affects or changes the activity or activation of SALPR
or Relaxin-3 or the cellular sensitivity to SALPR or Relaxin-3,
respectively. A modulator also may be a compound, for example, a
small molecule, that inhibits transcription of SALPR or Relaxin-3
mRNA. A regulator of SALPR or Relaxin-3 gene includes any element,
for example, nucleic acid, peptide, polypeptide, protein, peptide
nucleic acid or the like, that influences and/or controls the
transcription/expression of SALPR or Relaxin-3 gene, respectively,
or their coding region.
[0153] The group of inhibitors, activators, modulators and
regulators of this invention also includes genetically modified
versions of SALPR or Relaxin-3, for example, versions with altered
activity. Thus, unless otherwise indicated, the group is inclusive
of the naturally occurring protein as well as synthetic ligands,
antagonists, agonists, antibodies, small chemical molecules and the
like.
[0154] "Assays for inhibitors, activators, modulators, or
regulators" refer to experimental procedures including, for
example, expressing SALPR or Relaxin-3 in vitro, in cells, applying
putative inhibitor, activator, modulator, or regulator compounds,
and then determining the functional effects on SALPR or Relaxin-3
activity or transcription, as described above. Samples that contain
or are suspected of containing SALPR or Relaxin-3 are treated with
a potential activator, inhibitor, or modulator. The extent of
activation, inhibition, or change is examined by comparing the
activity measurement from the samples of interest to control
samples. A threshold level is established to assess activation or
inhibition. For example, inhibition of a SALPR or Relaxin-3
polypeptides are considered achieved when the SALPR or Relaxin-3
activity value relative to the control is 80% or lower. Similarly,
activation of a SALPR or a Relaxin-3 polypeptides are considered
achieved when the SALPR or Relaxin-3 activity value relative to the
control is two or more fold higher.
[0155] The terms "isolated," "purified," and "biologically pure"
each refer to material that is free to varying degrees from
components which normally accompany it as found in its native
state. "Isolate" denotes a degree of separation from original
source or surroundings. "Purify" denotes a degree of separation
that is higher than isolation. A "purified" or "biologically pure"
protein is sufficiently free of other materials such that any
impurities do not materially affect the biological properties of
the protein or cause other adverse consequences. That is, a nucleic
acid or peptide of this invention is purified if it is
substantially free of cellular material, viral material, or culture
medium when produced by recombinant DNA techniques, or chemical
precursors or other chemicals when chemically synthesized. Purity
and homogeneity are typically determined using analytical chemistry
techniques, for example, polyacrylamide gel electrophoresis or high
performance liquid chromatography. The term "purified" can denote
that a nucleic acid or protein gives rise to essentially one band
in an electrophoretic gel. For a protein that can be subjected to
modifications, for example, phosphorylation or glycosylation,
different modifications may give rise to different isolated
proteins, which can be separately purified. Various levels of
purity may be applied as needed according to this invention in the
different methodologies set forth herein; the customary purity
standards known in the art may be used if no standard is otherwise
specified.
[0156] An "isolated nucleic acid molecule" can refer to a nucleic
acid molecule, depending upon the circumstance, that is separated
from the 5' and 3' coding sequences of genes or gene fragments
contiguous in the naturally occurring genome of an organism. The
term "isolated nucleic acid molecule" also includes nucleic acid
molecules which are not naturally occurring, for example, nucleic
acid molecules created by recombinant DNA techniques.
[0157] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form. The term encompasses nucleic acids containing
known nucleotide analogs or modified backbone residues or linkages,
which are synthetic, naturally occurring, and non-naturally
occurring, which have similar binding properties as the reference
nucleic acid, and which are metabolized in a manner similar to the
reference nucleotides. Examples of such analogs include, without
limitation, phosphorothioates, phosphoramidates, methyl
phosphonates, chiral methyl phosphonates, 2-O-methyl
ribonucleotides, and peptide-nucleic acids (PNAs).
[0158] Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (for example, degenerate codon substitutions) and
complementary sequences, as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with suitable mixed
base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res,
19:081, 1991; Ohtsuka et al., J. Biol. Chem., 260:2600-2608, 1985;
Rossolini et al., Mol. Cell Probes, 8:91-98, 1994). The term
nucleic acid can be used interchangeably with gene, cDNA, mRNA,
oligonucleotide, and polynucleotide.
[0159] A "host cell" is a naturally occurring cell or a transformed
cell or a transfected cell that contains an expression vector and
supports the replication or expression of the expression vector.
Host cells may be cultured cells, explants, cells in vivo, and the
like. Host cells may be prokaryotic cells, for example, E. coli, or
eukaryotic cells, for example, yeast, insect, amphibian, or
mammalian cells, for example, Vero, CHO, HeLa, and others.
[0160] A "cell line" refers to cultured cells that are immortal and
can undergone passaging. Passaging refers to moving cultured cells
from one culture chamber to another so that the cultured cells can
be propagated to the subsequent generation.
[0161] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. Naturally occurring amino acids are those
encoded by the genetic code, as well as those amino acids that are
later modified, for example, hydroxyproline,
.gamma.-carboxyglutamate, and O-phosphoserine, phosphothreonine.
"Amino acid analogs" refer to compounds that have the same basic
chemical structure as a naturally occurring amino acid, i.e., a
carbon that is bound to a hydrogen, a carboxyl group, an amino
group, and an R group, for example, homoserine, norleucine,
methionine sulfoxide, methionine methyl sulfonium. Such analogs
have modified R groups (for example, norleucine) or modified
peptide backbones, but retain the same basic chemical structure as
a naturally occurring amino acid. "Amino acid mimetics" refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but that function in a
manner similar to a naturally occurring amino acid. Amino acids and
analogs are well known in the art.
[0162] Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes.
[0163] "Conservatively modified variants" apply to both amino acid
and nucleic acid sequences. With respect to particular nucleic acid
sequences, conservatively modified variants refers to those nucleic
acids which encode identical or similar amino acid sequences and
include degenerate sequences. For example, the codons GCA, GCC, GCG
and GCU all encode alanine. Thus, at every amino acid position
where an alanine is specified, any of these codons can be used
interchangeably in constructing a corresponding nucleotide
sequence. The resulting nucleic acid variants are conservatively
modified variants, since they encode the same protein (assuming
that is the only alternation in the sequence). One skilled in the
art recognizes that each codon in a nucleic acid, except for AUG
(sole codon for methionine) and UGG (tryptophan), can be modified
conservatively to yield a functionally-identical peptide or protein
molecule.
[0164] As to amino acid sequences, one skilled in the art will
recognize that substitutions, deletions, or additions to a
polypeptide or protein sequence which alter, add or delete a single
amino acid or a small number (typically less than about ten) of
amino acids is a "conservatively modified variant" where the
alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitutions are well
known in the art and include, for example, the changes of: alanine
to serine; arginine to lysine; asparigine to glutamine or
histidine; aspartate to glutamate; cysteine to serine; glutamine to
asparigine; glutamate to aspartate; glycine to proline; histidine
to asparigine or glutamine; isoleucine to leucine or valine;
leucine to valine or isoleucine; lysine to arginine, glutamine, or
glutamate; methionine to leucine or isoleucine; phenylalanine to
tyrosine, leucine or methionine; serine to threonine; threonine to
serine; tryptophan to tyrosine; tyrosine to tryptophan or
phenylalanine; valine to isoleucine or leucine. Other conservative
and semi-conservative substitutions are known in the art and can be
employed in practice of the present invention.
[0165] The terms "protein", "peptide" and "Polypeptide" each are
used herein to describe any chain of amino acids, regardless of
length or post-translational modification (for example,
glycosylation or phosphorylation). Thus, the terms can be used
interchangeably herein to refer to a polymer of amino acid
residues. The terms also apply to amino acid polymers in which one
or more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid. Thus, the term
"polypeptide" includes full-length, naturally occurring proteins as
well as recombinantly or synthetically produced polypeptides that
correspond to a full-length naturally occurring protein or to
particular domains or portions of a naturally occurring protein.
The term also encompasses mature proteins which have an added
amino-terminal methionine to facilitate expression in prokaryotic
cells.
[0166] The polypeptides of the invention can be chemically
synthesized or synthesized by recombinant DNA methods; or, they can
be purified from tissues in which they are naturally expressed,
according to standard biochemical methods of purification.
[0167] Also included in the invention are "functional
polypeptides," which possess one or more of the biological
functions or activities of a protein or polypeptide of the
invention. These functions or activities include the ability to
bind some or all of the proteins which normally bind to SALPR or
Relaxin-3 protein.
[0168] The functional polypeptides may contain a primary amino acid
sequence that has been modified from that considered to be the
standard sequence of SALPR or Relaxin-3 protein described herein.
Preferably these modifications are conservative amino acid
substitutions, as described herein.
[0169] A "label" or a "detectable moiety" is a composition that
when linked with the nucleic acid or protein molecule of interest
renders the latter detectable, via spectroscopic, photochemical,
biochemical, immunochemical, or chemical means. For example, useful
labels include radioactive isotopes, magnetic beads, metallic
beads, colloidal particles, fluorescent dyes, electron-dense
reagents, enzymes (for example, as commonly used in an ELISA),
biotin, digoxigenin, or haptens. A "labeled nucleic acid or
oligonucleotide probe" is one that is bound, either covalently,
through a linker or a chemical bond, or noncovalently, through
ionic bonds, van der Waals forces, electrostatic attractions,
hydrophobic interactions, or hydrogen bonds, to a label such that
the presence of the nucleic acid or probe may be detected by
detecting the presence of the label bound to the nucleic acid or
probe.
[0170] As used herein a "nucleic acid or oligonucleotide probe" is
defined as a nucleic acid capable of binding to a target nucleic
acid of complementary sequence through one or more types of
chemical bonds, usually through complementary base pairing, usually
through hydrogen bond formation. As used herein, a probe may
include natural (i.e., A, G, C, or T) or modified bases
(7-deazaguanosine, inosine, etc.). In addition, the bases in a
probe may be joined by a linkage other than a phosphodiester bond,
so long as it does not unduly interfere with hybridization. It will
be understood by one of skill in the art that probes may bind
target sequences lacking complete complementarity with the probe
sequence depending upon the stringency of the hybridization
conditions. The probes are preferably directly labeled with
isotopes, for example, chromophores, lumiphores, chromogens, or
indirectly labeled with biotin to which a streptavidin complex may
later bind. By assaying for the presence or absence of the probe,
one can detect the presence or absence of a target gene of
interest.
[0171] The phrase "selectively (or specifically) hybridizes to"
refers to the binding, duplexing, or hybridizing of a molecule only
to a particular nucleotide sequence under stringent hybridization
conditions when that sequence is present in a complex mixture (for
example, total cellular or library DNA or RNA).
[0172] The phrase "stringent hybridization conditions" refers to
conditions under which a probe will hybridize to its target
complementary sequence, typically in a complex mixture of nucleic
acids, but to no other sequences. Stringent conditions are
sequence-dependent and circumstance-dependent; for example, longer
sequences can hybridize with specificity at higher temperatures. An
extensive guide to the hybridization of nucleic acids is found in
Tijssen, Techniques in Biochemistry and Molecular
Biology-Hybridization with Nucleic Probes, "Overview of principles
of hybridization and the strategy of nucleic acid assays" (1993).
In the context of the present invention, as used herein, the term
"hybridizes under stringent conditions" is intended to describe
conditions for hybridization and washing under which nucleotide
sequences at least 60% homologous to each other typically remain
hybridized to each other. Preferably, the conditions are such that
sequences at least about 65%, more preferably at least about 70%,
and even more preferably at least about 75% or more homologous to
each other typically remain hybridized to each other.
[0173] Generally, stringent conditions are selected to be about 5
to 10.degree. C. lower than the thermal melting point (Tm) for the
specific sequence at a defined ionic strength pH. The Tm is the
temperature (under defined ionic strength, pH, and nucleic
concentration) at which 50% of the probes complementary to the
target hybridize to the target sequence at equilibrium (as the
target sequences are present in excess, at Tm, 50% of the probes
are occupied at equilibrium). Stringent conditions will be those in
which the salt concentration is less than about 1.0 M sodium ion,
typically about 0.01 to 1.0 M sodium ion concentration (or other
salts) at pH 7.0 to 8.3 and the temperature is at least about
30.degree. C. for short probes (for example, 10 to 50 nucleotides)
and at least about 60.degree. C. for long probes (for example,
greater than 50 nucleotides). Stringent conditions also may be
achieved with the addition of destabilizing agents, for example,
formamide. For selective or specific hybridization, a positive
signal is at least two times background, preferably 10 times
background hybridization.
[0174] Exemplary stringent hybridization conditions can be as
following, for example: 50% formamide, 5.times.SSC and 1% SDS,
incubating at 42.degree. C., or 5.times.SSC and 1% SDS, incubating
at 65.degree. C., with wash in 0.2.times.SSC and 0.1% SDS at about
65.degree. C. Alternative conditions include, for example,
conditions at least as stringent as hybridization at 68.degree. C.
for 20 hours, followed by washing in 2.times.SSC, 0.1% SDS, twice
for 30 minutes at about 55.degree. C. and three times for 15
minutes at about 60.degree. C. Another alternative set of
conditions is hybridization in 6.times.SSC at about 45.degree. C.,
followed by one or more washes in 0.2.times.SSC, 0.1% SDS at about
50-65.degree. C. For PCR, a temperature of about 36.degree. C. is
typical for low stringency amplification, although annealing
temperatures may vary between about 32.degree. C. and 48.degree. C.
depending on primer length. For high stringency PCR amplification,
a temperature of about 62.degree. C. is typical, although high
stringency annealing temperatures can range from about 50.degree.
C. to about 65.degree. C., depending on the primer length and
specificity. Typical cycle conditions for both high and low
stringency amplifications include a denaturation phase of
90.degree. C. to 95.degree. C. for 30 sec. to 2 min., an annealing
phase lasting 30 sec. to 2 min., and an extension phase of about
72.degree. C. for 1 to 2 min.
[0175] Nucleic acids that do not hybridize to each other under
stringent conditions are still substantially identical if the
polypeptides which they encode are substantially identical. This
occurs, for example, when a copy of a nucleic acid is created using
the maximum codon degeneracy permitted by the genetic code. In such
cases, the nucleic acids typically hybridize under moderately
stringent hybridization conditions. Exemplary "moderately stringent
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency.
[0176] The terms "about" or "approximately" in the context of
numerical values and ranges refers to values or ranges that
approximate or are close to the recited values or ranges such that
the invention can perform as intended, such as having a desired
amount of nucleic acids or polypeptides in a reaction mixture, as
is apparent to the skilled person from the teachings contained
herein. This is due, at least in part, to the varying properties of
nucleic acid compositions, age, race, gender, anatomical and
physiological variations and the inexactitude of biological
systems. Thus, these terms encompass values beyond those resulting
from systematic error.
[0177] "Antibody" refers to a polypeptide comprising a framework
region encoded by an immunoglobulin gene or fragments thereof that
specifically binds and recognizes an antigen. The recognized
immunoglobulin genes include the kappa, lambda, alpha, gamma,
delta, epsilon, and mu constant region genes, as well as the myriad
immunoglobulin variable region genes. Light chains are classified
as either kappa or lambda. Heavy chains are classified as gamma,
mu, alpha, delta, or epsilon, which in turn define the
immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
An exemplary immunoglobulin (antibody) structural unit comprises a
tetramer. Each tetramer is composed of two identical pairs of
polypeptide chains, each pair having one "light" (about 2 kDa) and
one "heavy" chain (up to about 70 kDa). Antibodies exist, for
example, as intact immunoglobulins or as a number of
well-characterized fragments produced by digestion with various
peptidases. While various antibody fragments are defined in terms
of the digestion of an intact antibody, one of skill in the art
will appreciate that such fragments may be synthesized de novo
chemically or via recombinant DNA methodologies. Thus, the term
antibody, as used herein, also includes antibody fragments produced
by the modification of whole antibodies, those synthesized de novo
using recombinant DNA methodologies (for example, single chain Fv),
humanized antibodies, and those identified using phage display
libraries (see, for example, Knappik et al., J. Mol. Biol.,
296:57-86, 2000; McCafferty et al., Nature, 348:2-4, 1990), for
example. For preparation of antibodies--recombinant, monoclonal, or
polyclonal antibodies--any technique known in the art can be used
with this invention (see, for example, Kohler & Milstein,
Nature, 256(5517):495-497, 1975; Kozbor et al., Immunology Today,
4:72, 1983; Cole et al., pp. 77-96 in Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, Inc., 1998).
[0178] Techniques for the production of single chain antibodies
(See U.S. Pat. No. 4,946,778) can be adapted to produce antibodies
to polypeptides of this invention. Transgenic mice, or other
organisms, for example, other mammals, may be used to express
humanized antibodies. Phage display technology also can be used to
identify antibodies and heteromeric Fab fragments that specifically
bind to selected antigens (see, for example, McCafferty et al.,
Nature, 348:2-4, 1990; Marks et al., Biotechnology, 10(7) :779-783,
1992).
[0179] The term antibody is used in the broadest sense including
agonist, antagonist, and blocking or neutralizing antibodies.
[0180] "Blocking antibody" is a type of antibody, as described
above, that refers to a polypeptide comprising variable and
framework regions encoded by an immunoglobulin gene or fragments,
homologues, analogs or mimetics thereof that specifically binds and
blocks biological activities of an antigen; for example, a blocking
antibody to SALPR or Relaxin-3 blocks the oncogenic function or
anti-apoptotic activity of SALPR or Relaxin-3 gene, respectively. A
blocking antibody binds to critical regions of a polypeptide and
thereby inhibits its function. Critical regions include
protein-protein interaction sites, such as active sites, functional
domains, ligand binding sites, and recognition sites. Blocking
antibodies may be induced in mammals, for example in human, by
repeated small injections of antigen, too small to produce strong
hypersensitivity reactions. See Bellanti J A, Immunology, WB
Saunders Co., p.131-368 (1971). Blocking antibodies can play an
important role in blocking the function of a marker protein and
inhibiting tumorigenic growth. See, for example, Jopling et al., J.
Biol. Chem., 277(9):6864-73 (2002); Drebin et al., Cell,
41(3):697-706 (1985); Drebin et al., Proc. Natl. Acad. Sci. USA,
83(23):9129-33 (1986).
[0181] The term "tumor-cell killing" by anti-SALPR or
anti-Relaxin-3 blocking antibodies herein is meant any inhibition
of tumor cell proliferation by means of blocking a function or
binding to block a pathway related to tumor-cell proliferation. For
example, anti-epidermal growth factor receptor monoclonal
antibodies inhibit A431 tumor cell proliferation by blocking an
autocrine pathway. See Mendelsohn et al., Trans Assoc Am
Physicians, 100:173-8 (1987); Masui et al., Cancer Res,
44(3):1002-7 (1984).
[0182] The term "SALPR- or Relaxin-3-oncogenic function-blocking
antibody" herein is meant an anti-human SALPR- or
Relaxin-3-antibody whose interaction with the SALPR or Relaxin-3
protein inhibits the oncogenic function or anti-apoptotic activity
of the protein, mediates tumor-cell killing mechanisms, or inhibits
tumor-cell proliferation. In contrast to antibodies that merely
bind to tumor cells expressing SALPR or Relaxin-3, blocking
antibodies against SALPR or Relaxin-3 mediate tumor-cell killing by
mechanisms related to the oncogenic function or anti-apoptotic
activity of SALPR or Relaxin-3. See Drebin et al., Proc. Natl.
Acad. Sci. USA, 83(23):9129-33 (1986) for inhibition of tumorigenic
growth; and Mendelsohn et al., Trans Assoc Am Physicians, 100:173-8
(1987), for an example of antibody-mediated anti-proliferative
activity.
[0183] An "anti-SALPR" antibody is an antibody or antibody fragment
that specifically binds a polypeptide encoded by a SALPR gene,
mRNA, cDNA, or a subsequence thereof. Anti-SALPR antibody also
includes a blocking antibody that inhibits oncogenic function or
anti-apoptotic activity of SALPR. These antibodies can mediate
anti-proliferative activity on tumor-cell growth.
[0184] An "anti-Relaxin-3" antibody is an antibody or antibody
fragment that specifically binds a polypeptide encoded by a
Relaxin-3 gene, mRNA, cDNA, or a subsequence thereof.
Anti-Relaxin-3 antibody also includes a blocking antibody that
inhibits oncogenic function or anti-apoptotic activity of
Relaxin-3. These antibodies can mediate anti-proliferative activity
on tumor-cell growth.
[0185] "Cancer Vaccines" are substances that are designed to
stimulate the immune system to launch an immune response against a
specific target associated with a cancer. For a general overview on
immunotherapy and vaccines for cancers, see Old L. J., Scientific
American, September, 1996.
[0186] Vaccines may be preventative or therapeutic. Typically,
preventative vaccines (for example, the flu vaccine) generally
contain parts of polypeptides that stimulate the immune system to
generate cells and/or other substances (for example, antibodies)
that fight the target of the vaccines. Preventative vaccines must
be given before exposure, concurrent with exposure, or shortly
thereafter to the target (for example, the flu virus) in order to
provide the immune system with enough time to activate and make the
immune cells and substances that can attack the target.
Preventative vaccines stimulate an immune response that can last
for years or even an individual's lifetime.
[0187] Therapeutic vaccines are used to combat existing disease.
Thus, the goal of a therapeutic cancer vaccine is not just to
prevent disease, but rather to stimulate the immune system to
attack existing cancerous cells. Because of the many types of
cancers and because it is often unpredictable who might get cancer,
among other reasons, the cancer vaccines currently being developed
are therapeutic. As discussed further below, due to the
difficulties associated with fighting an established cancer, most
vaccines are used in combination with cytokines or adjuvants that
help stimulate the immune response and/or are used in conjunction
with conventional cancer therapies.
[0188] The immune system must be able to tolerate normal cells and
to recognize and attack abnormal cells. To the immune system, a
cancer cell may be different in very small ways from a normal cell.
Therefore, the immune system often tolerates cancer cells rather
than attacking them, which allows the cancer to grow and spread.
Therefore, cancer vaccines must not only provoke an immune
response, but also stimulate the immune system strongly enough to
overcome this tolerance. The most effective anti-tumor immune
responses are achieved by stimulating T cells, which can recognize
and kill tumor cells directly. Therefore, most current cancer
vaccines try to activate T cells directly, try to enlist antigen
presenting cells (APCs) to activate T cells, or both. By way of
example, researchers are attempting to enhance T cell activation by
altering tumor cells so molecules that are normally only on APCs
are now on the tumor cell, thus enabling the molecules to give T
cells a stronger activating signal than the original tumor cells,
and by evaluating cytokines and adjuvants to determine which are
best at calling APCs to areas they are needed.
[0189] Cancer vaccines can be made from whole tumor cells or from
substances contained by the tumor (for example, antigens). For a
whole cell vaccine, tumor cells are removed from a patient(s),
grown in the laboratory, and treated to ensure that they can no
longer multiply and are incapable of infecting the patient. When
whole tumor cells are injected into a person, an immune response
against the antigens on the tumor cells is generated. There are two
types of whole cell cancer vaccines: 1) autologous whole cell
vaccines made with a patient's own whole, inactivated tumor cells;
and 2) allogenic whole cell vaccines made with another individual's
whole, inactivated tumor cells (or the tumor cells from several
individuals). Antigen vaccines are not made of whole cells, but of
one or more antigens contained by the tumor. Some antigens are
common to all cancers of a particular type, while some are unique
to an individual. A few antigens are shared between tumors of
different types of cancer.
[0190] Antigens in an antigen vaccine may be delivered in several
ways. For example, proteins or fragments thereof from the tumor
cells can be given directly as the vaccine. Nucleic acids coding
for those proteins can be given (for example, RNA or DNA vaccines).
Furthermore, viral vectors can be engineered so that when they
infect a human cell and the cell will make and display the tumor
antigen on its surface. The viral vector should be capable of
infecting only a small number of human cells in order to start an
immune response, but not enough to make a person sick. Viruses also
can be engineered to make cytokines or to display proteins on their
surface that help activate immune cells. These can be given alone
or with a vaccine to help the immune response. Finally, antibodies
themselves may be used as antigens in a vaccine (anti-idiotype
vaccines). In this way, an antibody to a tumor antigen is
administered, then the B cells make antibodies to that antibody
that also recognize the tumor cells.
[0191] Cancer vaccines frequently contain components to help boost
the immune response. Cytokines (for example, IL-2), which are
chemical messengers that recruit other immune cells to the site of
attack and help killer T cells perform their function, are
frequently employed. Similarly, adjuvants, substances derived from
a wide variety of sources, including bacteria, have been shown to
elicit immune cells to an area where they are needed. In some
cases, cytokines and adjuvants are added to the cancer vaccine
mixture, in other cases they are given separately.
[0192] Cancer vaccines are most frequently developed to target
tumor antigens normally expressed on the cell surface (for example,
membrane-bound receptors or subparts thereof). However, cancer
vaccines also may be effective against intracellular antigens that
are, in a tumor-specific manner, exposed on the cell surface. Many
tumor antigens are intracellular proteins that are degraded and
expressed on the cell surface complexed with, for example, HLA.
Frequently, it is difficult to attack these antigens with antibody
therapy because they are sparsely dispersed on the cell surface.
However, cancer vaccines are a viable alternative therapeutic
approach.
[0193] Cancer vaccines may prove most useful in preventing cancer
recurrence after surgery, radiation or chemotherapy has reduced or
eliminated the primary tumor.
[0194] The term "immunoassay" is an assay that utilizes the binding
interaction between an antibody and an antigen. Typically, an
immunoassay uses the specific binding properties of a particular
antibody to isolate, target, and/or quantify the antigen.
[0195] The phrases "specifically (or selectively) binds" to an
antibody and "specifically (or selectively) immunoreactive with,"
when referring to a protein or peptide, each refer to a binding
reaction that is determinative of the presence of the protein in a
heterogeneous population of proteins and other biologics. Thus,
under designated immunoassay conditions, the specified antibodies
bind to a particular protein at a level at least two times the
background and do not substantially bind in a significant amount to
other proteins present in the sample. Specific binding to an
antibody under such conditions may require an antibody that is
selected for its specificity for a particular protein. For example,
antibodies raised to a particular SALPR or Relaxin-3 polypeptide
can be selected to obtain only those antibodies that are
specifically immunoreactive with the SALPR or Relaxin-3
polypeptide, respectively, and not with other proteins, except for
polymorphic variants, orthologs, and alleles of the specific SALPR
or Relaxin-3 polypeptide. In addition, antibodies raised to a
particular SALPR or Relaxin-3 polypeptide ortholog can be selected
to obtain only those antibodies that are specifically
immunoreactive with the SALPR or Relaxin-3 polypeptide ortholog,
and not with other orthologous proteins, except for polymorphic
variants, mutants, and alleles of the SALPR or Relaxin-3
polypeptide ortholog. This selection may be achieved by subtracting
out antibodies that cross-react with desired SALPR or Relaxin-3
molecules, as appropriate. A variety of immunoassay formats may be
used to select antibodies specifically immunoreactive with a
particular protein. For example, solid-phase ELISA immunoassays are
routinely used to select antibodies specifically immunoreactive
with a protein. See, for example, Harlow & Lane, Antibodies, A
Laboratory Manual, 1988, for a description of immunoassay formats
and conditions that can be used to determine specific
immunoreactivity.
[0196] The phrase "selectively associates with" refers to the
ability of a nucleic acid to "selectively hybridize" with another
as defined supra, or the ability of an antibody to "selectively (or
specifically) bind" to a protein, as defined supra.
[0197] "siRNA" refers to small interfering RNAs, which also include
short hairpin RNA (shRNA) (see for example, Paddison et al., Genes
& Dev. 16:948-958, 2002; Brummelkamp et al., Science,
296(5567):550-5533, 2002), that are capable of causing interference
and can cause post-transcriptional silencing of specific genes in
cells, for example, mammalian cells (including human cells) and in
the body, for example, mammalian bodies (including humans). The
phenomenon of RNA interference is described and discussed in Bass,
Nature, 411:428-29, 2001; Elbashir et al., Nature, 411:494-98,
2001; and Fire et al., Nature, 391:806-11, 1998, wherein methods of
making interfering RNA also are discussed. The siRNAs based upon
the sequences disclosed herein (for example, GenBank Accession Nos.
NM.sub.--016568 and NM.sub.--080864 for a SALPR and Relaxin-3
sequences, respectively) are typically less than 100 base pairs
("bps") in length and constituency and preferably are about 30 bps
or shorter, and can be made by approaches known in the art,
including the use of complementary DNA strands or synthetic
approaches. The siRNAs are capable of causing interference and can
cause post-transcriptional silencing of specific genes in cells,
for example, mammalian cells (including human cells) and in the
body, for example, mammalian bodies (including humans). Exemplary
siRNAs according to the invention could have up to 30 bps, 29 bps,
25 bps, 22 bps, 21 bps, 20 bps, 15 bps, 10 bps, 5 bps or any
integer thereabout or therebetween. According to the invention,
siRNA having different sequences but directed against SALPR or
Relaxin-3 can be administered concurrently or consecutively in any
proportion, including equimolar proportions.
[0198] The term "miRNA" refers to microRNA, a class of small RNA
molecules or a small noncoding RNA molecules, that are capable of
causing interference, inhibition of RNA translation into protein,
and can cause post-transcriptional silencing of specific genes in
cells, for example, mammalian cells (including human cells) and in
the body, for example, mammalian bodies (including humans) (see,
Zeng and Cullen, RNA, 9(1):112-123, 2003; Kidner and Martienssen
Trends Genet, 19(1):13-6, 2003; Dennis C, Nature, 420(6917):732,
2002; Couzin J, Science 298(5602):2296-7, 2002). Previously, the
miRNAs were known as small temporal RNAs (stRNAs) and belonged to a
class of non-coding microRNAs, which have been shown to control
gene expression either by repressing translation or by degrading
the targeted mRNAs (see Couzin J, Science 298(5602):2296-7, 2002),
which are generally 20-28 nt in length (see Finnegan et al., Curr
Biol, 13(3):236-40, 2003; Ambros et al., RNA 9(3):277-279, 2003;
Couzin J, Science 298(5602):2296-7, 2002). Unlike other RNAs (for
example, siRNAs or shRNAs), miRNAs or stRNAs are not encoded by any
microgenes, but are generated from aberrant (probably
double-stranded) RNAs by an enzyme called Dicer, which cleaves
double-stranded RNA into smaller pieces (see Couzin J, Science
298(5602):2296-7, 2002). According to the invention, miRNA having
different sequences but directed against SALPR or Relaxin-3 can be
administered concurrently or consecutively in any proportion,
including equimolar proportions.
[0199] The term "transgene" refers to a nucleic acid sequence
encoding, for example, one of the SALPR or Relaxin-3 polypeptides,
or an antisense transcript thereto, which is partly or entirely
heterologous, i.e., foreign, to the transgenic organism or cell
into which it is introduced, or, is homologous to an endogenous
gene of the transgenic animal or cell into which it is introduced,
but which is designed to be inserted, or is inserted, into the
animal's genome in such a way as to alter the genome of the cell
into which it is inserted (for example, it is inserted at a
location which differs from that of the natural gene or its
insertion results in a knockout). A transgene can include one or
more transcriptional regulatory sequences and any other nucleic
acid, (for example, an intron), that may be necessary for optimal
expression of a selected nucleic acid.
[0200] By "transgenic" is meant any organism that includes a
nucleic acid sequence, which is inserted into a cell and becomes a
part of the genome of the animal that develops from that cell. Such
a transgene may be partly or entirely heterologous to the
transgenic animal.
[0201] Thus, for example, substitution of the naturally occurring
SALPR or Relaxin-3 gene for a gene from a second species results in
an animal that produces the protein of the second species.
Substitution of the naturally occurring gene for a gene having a
mutation results in an animal that produces the mutated protein. A
transgenic mouse, see below, expressing the human SALPR or
Relaxin-3 protein can be generated by direct replacement of the
mouse SALPR or Relaxin-3 subunit with the human gene. These
transgenic animals can be critical for drug antagonist studies on
animal models for human diseases, and for eventual treatment of
disorders or diseases associated with the respective genes.
Transgenic mice carrying these mutations will be extremely useful
in studying this disease.
[0202] A "transgenic animal" refers to any animal, preferably a
non-human mammal, that is chimeric, and is achievable with most
vertebrate species. Such species include, but are not limited to,
non-human mammals, including rodents, for example, mice and rats;
rabbits; birds or amphibians; ovines, for example, sheep and goats;
porcines, for example, pigs; and bovines, for example, cattle and
buffalo; in which one or more of the cells of the animal contains
heterologous nucleic acid introduced by way of human intervention,
for example, by transgenic techniques well known in the art. The
nucleic acid is introduced into the cell, directly or indirectly by
introduction into a precursor of the cell, by way of deliberate
genetic manipulation, for example, by microinjection or by
infection with a recombinant virus. The term genetic manipulation
does not include classical cross-breeding, or sexual fertilization,
but rather is directed to the introduction of a recombinant DNA
molecule. This molecule may be integrated within a chromosome, or
it may be extrachromosomally replicating DNA. In the typical
transgenic animals described herein, the transgene causes cells to
express a recombinant form of one of the SALPR or Relaxin-3
proteins, for example, either agonistic or antagonistic forms.
However, transgenic animals in which the recombinant SALPR or
Relaxin-3 genes are silent also are contemplated. Moreover,
"transgenic animal" also includes those recombinant animals in
which gene disruption of one or more SALPR or Relaxin-3 genes is
caused by human intervention, including both recombination and
antisense techniques. The transgene can be limited to somatic cells
or be placed into the germline.
[0203] Methods of obtaining transgenic animals are described in,
for example, Puhler, A., Ed., Genetic Engineering of Animals, VCH
Pub., 1993; Murphy and Carter, Eds., Transgenesis Techniques:
Principles and Protocols (Methods in Molecular Biology, Vol. 18),
1993; and
[0204] Pinkert, C A, Ed., Transgenic Animal Technology: A
Laboratory Handbook, Academic Press, 1994.
[0205] The term "knockout construct" refers to a nucleotide
sequence that is designed to decrease or suppress expression of a
polypeptide encoded by an endogenous gene in one or more cells of a
mammal. The nucleotide sequence used as the knockout construct is
typically comprised of (1) DNA from some portion of the endogenous
gene (one or more exon sequences, intron sequences, and/or promoter
sequences) to be suppressed and (2) a marker sequence used to
detect the presence of the knockout construct in the cell. The
knockout construct can be inserted into a cell containing the
endogenous gene to be knocked out. The knockout construct can then
integrate with one or both alleles of an endogenous gene, for
example, SALPR or Relaxin-3 gene, and such integration of the
knockout construct can prevent or interrupt transcription of the
full-length endogenous gene. Integration of the knockout construct
into the cellular chromosomal DNA is typically accomplished via
homologous recombination (i.e., regions of the knockout construct
that are homologous or complementary to endogenous DNA sequences
can hybridize to each other when the knockout construct is inserted
into the cell; these regions can then recombine so that the
knockout construct is incorporated into the corresponding position
of the endogenous DNA).
[0206] A transgenic animal carrying a "knockout" of SALPR or
Relaxin-3 gene, would be useful for the establishment of a
non-human model for diseases involving such proteins, and to
distinguish between the activities of the different SALPR or
Relaxin-3 proteins in an in vivo system. "Knockout mice" refers to
mice whose native or endogenous SALPR or Relaxin-3 allele or
alleles have been disrupted by homologous recombination or the like
and which produce no functional SALPR or Relaxin-3 of their own.
Knockout mice may be produced in accordance with techniques known
in the art, for example, Thomas, et al., Immunol, 163:978-84, 1999;
Kanakaraj, et al., J Exp Med, 187:2073-9, 1998; or Yeh et al.,
Immunity, 7:715-725, 1997.
[0207] "Aptamers": An aptamer is a peptide, a peptide-like, a
nucleic acid, or a nucleic acid-like molecule that is capable of
binding to a specific molecule (for example, SALPR or Relaxin-3) of
interest with high affinity and specificity. An aptamer also can be
a peptide or a nucleic acid molecule that mimics the three
dimensional structure of active portions of the peptides or the
nucleic acid molecules of the invention. (see, for example, James
W., Current Opinion in Pharmacology, 1:540-546 (2001); Colas et
al., Nature 380:548-550 (1996); Tuerk and Gold, Science 249:505
(1990); Ellington and Szostak, Nature 346:818 (1990)). The specific
binding molecule of the invention may be a chemical mimetic; for
example, a synthetic peptide aptamer or peptidomimetic. It is
preferably a short oligomer selected for binding affinity and
bioavailability (for example, passage across the plasma and nuclear
membranes, resistance to hydrolysis of oligomeric linkages,
adsorbance into cellular tissue, and resistance to metabolic
breakdown). The chemical mimetic may be chemically synthesized with
at least one non-natural analog of a nucleoside or amino acid (for
example, modified base or ribose, designer or non-classical amino
acid, D or L optical isomer). Modification also may take the form
of acylation, glycosylation, methylation, phosphorylation,
sulfation, or combinations thereof. Oligomeric linkages may be
phosphodiester or peptide bonds; linkages comprised of a
phosphorus, nitrogen, sulfur, oxygen, or carbon atom (for example,
phosphorothionate, disulfide, lactam, or lactone bond); or
combinations thereof. The chemical mimetic may have significant
secondary structure (for example, a ribozyme) or be constrained
(for example, a cyclic peptide).
[0208] "Peptide Aptamer": A peptide aptamer is a polypeptide or a
polypeptide-like molecule that is capable of binding to a specific
molecule (for example, SALPR and/or Relaxin-3) of interest with
high affinity and specificity. A peptide aptamer also can be a
polypeptide molecule that mimics the three dimensional structure of
active portions of the polypeptide molecules of the invention. A
peptide-aptamer can be designed to mimic the recognition function
of complementarity determining regions of immunoglobulins, for
example. The aptamer can recognize different epitopes on the
protein surface (for example, SALPR and/or Relaxin-3) with
dissociation equilibrium constants in the nanomolar range; those
inhibit the protein (for example, SALPR and/or Relaxin-3) activity.
Peptide aptamers are analogous to monoclonal antibodies, with the
advantages that they can be isolated together with their coding
genes, that their small size facilitates solution of their
structures, and that they can be designed to function inside
cells.
[0209] An peptide aptamer is typically between about 3 and about
100 amino acids or the like in length. More commonly, an aptamer is
between about 10 and about 35 amino acids or the like in length.
Peptide-aptamers may be prepared by any known method, including
synthetic, recombinant, and purification methods (James W., Current
Opinion in Pharmacology, 1:540-546 (2001); Colas et al., Nature
380:548-550 (1996)).
[0210] The instant invention also provides aptamers of SALPR and
Relaxin-3 peptides. In one aspect, the invention provides aptamers
of isolated polypeptides comprising at least one active fragment
having substantially homologous sequence of SALPR or Relaxin-3
peptides (for example, SEQ ID NO:2 or SEQ ID NO:4, respectively, or
any fragment thereof). The instant aptamers are peptide molecules
that are capable of binding to a protein or other molecule, or
mimic the three dimensional structure of the active portion of the
peptides of the invention.
[0211] "Nucleic Acid Aptamer": A nucleic acid aptamer is a nucleic
acid or a nucleic acid-like molecule that is capable of binding to
a specific molecule (for example, SALPR and/or Relaxin-3) of
interest with high affinity and specificity. A nucleic acid aptamer
also can be a nucleic acid molecule that mimics the three
dimensional structure of active portions of the nucleic acid
molecules of the invention. A nucleic acid-aptamer is typically
between about 9 and about 300 nucleotides or the like in length.
More commonly, an aptamer is between about 30 and about 100
nucleotides or the like in length. Nucleic acid-aptamers may be
prepared by any known method, including synthetic, recombinant, and
purification methods (James W., Current Opinion in Pharmacology,
1:540-546 (2001); Colas et al., Nature 380:548-550 (1996)).
[0212] According to one aspect of the invention, aptamers of the
instant invention include non-modified or chemically modified RNA,
DNA, PNA or polynucleotides. The method of selection may be by, but
is not limited to, affinity chromatography and the method of
amplification by reverse transcription (RT) or polymerase chain
reaction (PCR). Aptamers have specific binding regions which are
capable of forming complexes with an intended target molecule in an
environment wherein other substances in the same environment are
not complexed to the nucleic acid.
[0213] The instant invention also provides aptamers of SALPR and
Relaxin-3 polynucleotides. In another aspect, the invention
provides aptamers of isolated polynucleotides comprising at least
one active fragment having substantially homologous sequence of
SALPR or Relaxin-3 polynucleotides (for example, SEQ ID NO:1 or SEQ
ID NO:3, respectively, or any fragment thereof). The instant
aptamers are nucleic acid molecules that are capable of binding to
a nucleic acid or other molecule, or mimic the three dimensional
structure of the active portion of the nucleic acids of the
invention.
[0214] The invention also provides nucleic acids (for example, mRNA
molecules) that include an aptamer as well as a coding region for a
regulatory polypeptide. The aptamer is positioned in the nucleic
acid molecule such that binding of a ligand to the aptamer prevents
translation of the regulatory polypeptide.
[0215] "SALPR": The term "SALPR" can refer to SALPR nucleic acid
(DNA and RNA) or protein (or polypeptide), and can include its
polymorphic variants, alleles, mutants, and interspecies homologs
that have (i) substantial nucleotide sequence homology (for
example, at least 60% identity, preferably at least 70% sequence
identity, more preferably at least 80%, still more preferably at
least 90% and even more preferably at least 95%) with the
nucleotide sequence of the GenBank Accession No. NM.sub.--016568
(protein ID. NP.sub.--057652.1); or (ii) at least 65% sequence
homology with the amino acid sequence of the GenBank Protein ID.
NP.sub.--057652.1 (SALPR); or (iii) substantial nucleotide sequence
homology (for example, at least 60% identity, preferably at least
70% sequence identity, more preferably 80%, still more preferably
85%, even more preferably at least 90% or 95%) with the nucleotide
sequence as set forth in SEQ ID NO:1; or (iv) substantial sequence
homology with the encoded amino acid sequence (for example, SEQ ID
NO:2).
[0216] SALPR polynucleotides or polypeptides are typically from a
mammal including, but not limited to, human, rat, mouse, hamster,
cow, pig, horse, sheep, or any mammal. A "SALPR polynucleotide" and
a "SALPR polypeptide," may be either naturally occurring,
recombinant, or synthetic (for example, produced via chemical
synthesis).
[0217] SALPR DNA sequence contains 1857 base pairs (see SEQ ID
NO:1), encoding a protein of 469 amino acids (see SEQ ID NO:2).
GenBank Accession No. for Homo sapiens SALPR: NM.sub.--016568;
GenBank Protein ID. NP.sub.--057652.1.
[0218] According to an aspect of the present invention, it has been
determined that SALPR is amplified and/or overexpressed in human
cancers, including lung cancer, colon cancer, ovarian cancer, or
pancreatic cancer. Human chromosome region 5p15.1-p14 is one of the
most frequently amplified regions in human cancers including lung
cancer, colon cancer, ovarian cancer, and pancreatic cancer. More
than one gene is located in this region. In a process of
characterizing one of the 5p15.1-p14 amplicons, SALPR was found
amplified in human lung cancer, colon cancer, ovarian cancer, and
pancreatic cancer, and other tumor samples. Studies have shown that
such amplification is usually associated with aggressive histologic
types. Therefore, amplification of tumor-promoting gene(s) located
on 5p15.1-p14 can play an important role in the development and/or
progression of cancers including lung cancer, colon cancer, ovarian
cancer, and pancreatic cancer, particularly those of the invasive
histology.
[0219] Amplification of SALPR was determined via microarray
analysis (see FIG. 1). See, for example, U.S. Pat. No. 6,232,068;
Pollack et al., Nat. Genet. 23(1):41-46, (1999) and other
approaches known in the art. Amplified cell lines or tumors (for
example, lung, colon, ovarian, and pancreatic) were examined for
DNA copy number of nearby genes and DNA sequences that map to the
boundaries of the amplified regions. TaqMan epicenter data for
SALPR is shown in FIG. 1. Further analysis provided evidence that
SALPR gene is present at the epicenter.
[0220] SALPR was found to be amplified in 16% ({fraction (12/75)})
of lung tumors, 40% ({fraction (12/30)}) of colon tumors, 5%
({fraction (3/64)}) of ovarian tumors, and over 5% ({fraction
(1/18)}) of pancreatic tumors tested (see infra Table 1). SALPR was
found to be overexpressed in over 6% ({fraction (2/32)}) of lung
tumors, over 88% ({fraction (31/35)}) of colon tumors, 10%
({fraction (3/30)}) of ovarian tumors, and over 31% ({fraction
(5/16)}) of pancreatic tumors tested (see infra Table 1).
[0221] The folds of amplification and overexpression were measured
by TaqMan and RT-TaqMan, respectively, using SALPR-specific
fluorogenic TaqMan probes.
[0222] "Relaxin-3": The term "Relaxin-3" can refer to Relaxin-3
(H3) (RLN3) (also known as insulin7 (INSL7)) nucleic acid (DNA and
RNA) or protein (or polypeptide), and can include its polymorphic
variants, alleles, mutants, and interspecies homologs that have (i)
substantial nucleotide sequence homology (for example, at least 60%
identity, preferably at least 70% sequence identity, more
preferably at least 80%, still more preferably at least 90% and
even more preferably at least 95%) with the nucleotide sequence of
the GenBank Accession No. NM.sub.--080864; or (ii) at least 65%
sequence homology with the amino acid sequence of the GenBank
Protein ID. NP.sub.--543140; or (iii) substantial nucleotide
sequence homology (for example, at least 60% identity, preferably
at least 70% sequence identity, more preferably 80%, still more
preferably 85%, even more preferably at least 90% or 95%) with the
nucleotide sequence as set forth in SEQ ID NO:3; or (iv)
substantial sequence homology with the encoded amino acid sequence
(for example, SEQ ID NO:4).
[0223] Relaxin-3 polynucleotides or polypeptides are typically from
a mammal including, but not limited to, human, rat, mouse, hamster,
cow, pig, horse, sheep, or any mammal. A "Relaxin-3 polynucleotide"
and a "Relaxin-3 polypeptide," may be either naturally occurring,
recombinant, or synthetic (for example, produced via chemical
synthesis).
[0224] Relaxin-3 DNA sequence contains 429 base pairs (see SEQ ID
NO:3), encoding a protein of 142 amino acids (see SEQ ID NO:4).
GenBank Accession No. for Homo sapiens Relaxin-3 (H3) (RLN3):
NM.sub.--080864; GenBank Protein ID. NP.sub.--543140.
[0225] According to an aspect of the present invention, it has been
determined that Relaxin-3 is amplified and/or overexpressed in
human cancers, including lung cancer. Human chromosome region
19p13.2 is one of the most frequently amplified regions in human
cancers including lung cancer. More than one gene is located in
this region. In a process of characterizing one of the 19p13.2
amplicons, Relaxin-3 was found amplified in human lung cancer
samples. Studies have shown that such amplification is usually
associated with aggressive histologic types. Therefore,
amplification of tumor-promoting gene(s) located on 19p13.2 can
play an important role in the development and/or progression of
cancers including lung cancer, particularly those of the invasive
histology.
[0226] Amplification of Relaxin-3 and DNA copy numbers were
determined using real time quantitative PCR (QPCR) (see FIG. 2).
See, for example, U.S. Pat. No. 6,232,068; Pollack et al., Nat.
Genet. 23(1):41-46, (1999) and other approaches known in the art.
Amplified tumors (for example, lung tumors) were examined for DNA
copy number of nearby genes and DNA sequences that map to the
boundaries of the amplified regions.
[0227] Cluster analysis of DNA copy numbers of Relaxin-3, SALPR, G
protein-coupled receptor 7 (LGR7), and GPCR142 also indicate
increase in DNA copy number (See FIG. 3).
[0228] Relaxin-3 was found to be amplified in 21% ({fraction
(7/34)}) of lung tumors tested (see infra Table 2). Relaxin-3 was
found to be overexpressed in 15% ({fraction (5/34)}) of lung tumors
tested (see infra Table 2).
[0229] 2. Amplification of SALPR and Relaxin-3 Genes in Tumors:
[0230] The presence of a target gene that has undergone
amplification in tumors is evaluated by determining the copy number
of the target genes, i.e., the number of DNA sequences in a cell
encoding the target protein. Generally, a normal diploid cell has
two copies of a given autosomal gene. The copy number can be
increased, however, by gene amplification or duplication, for
example, in cancer cells, or reduced by deletion. Methods of
evaluating the copy number of a particular gene are well known in
the art, and include, inter alia, hybridization and amplification
based assays.
[0231] Any of a number of hybridization based assays can be used to
detect the copy number of the SALPR or Relaxin-3 gene in the cells
of a biological subject. One such method is Southern blot (see
Ausubel et al., or Sambrook et al., supra), where the genomic DNA
is typically fragmented, separated electrophoretically, transferred
to a membrane, and subsequently hybridized to a SALPR or Relaxin-3
specific probe. Comparison of the intensity of the hybridization
signal from the probe for the target region with a signal from a
control probe from a region of normal nonamplified, single-copied
genomic DNA in the same genome provides an estimate of the relative
SALPR or Relaxin-3 gene copy number, corresponding to the specific
probe used. An increased signal compared to control represents the
presence of amplification.
[0232] A methodology for determining the copy number of the SALPR
or Relaxin-3 gene in a sample is in situ hybridization, for
example, fluorescence in situ hybridization (FISH) (see Angerer,
1987 Meth. Enzymol., 152: 649). Generally, in situ hybridization
comprises the following major steps: (1) fixation of tissue or
biological structure to be analyzed; (2) prehybridization treatment
of the biological structure to increase accessibility of target
DNA, and to reduce nonspecific binding; (3) hybridization of the
mixture of nucleic acids to the nucleic acid in the biological
structure or tissue; (4) post-hybridization washes to remove
nucleic acid fragments not bound in the hybridization, and (5)
detection of the hybridized nucleic acid fragments. The probes used
in such applications are typically labeled, for example, with
radioisotopes or fluorescent reporters. Preferred probes are
sufficiently long, for example, from about 50, 100, or 200
nucleotides to about 1000 or more nucleotides, to enable specific
hybridization with the target nucleic acid(s) under stringent
conditions.
[0233] Another alternative methodology for determining number of
DNA copies is comparative genomic hybridization (CGH). In
comparative genomic hybridization methods, a "test" collection of
nucleic acids is labeled with a first label, while a second
collection (for example, from a normal cell or tissue) is labeled
with a second label. The ratio of hybridization of the nucleic
acids is determined by the ratio of the first and second labels
binding to each fiber in an array. Differences in the ratio of the
signals from the two labels, for example, due to gene amplification
in the test collection, is detected and the ratio provides a
measure of the SALPR or Relaxin-3 gene copy number, corresponding
to the specific probe used. A cytogenetic representation of DNA
copy-number variation can be generated by CGH, which provides
fluorescence ratios along the length of chromosomes from
differentially labeled test and reference genomic DNAs.
[0234] Hybridization protocols suitable for use with the methods of
the invention are described, for example, in Albertson (1984) EMBO
J. 3:1227-1234; Pinkel (1988) Proc. Natl. Acad. Sci. USA,
85:9138-9142; EPO Pub. No. 430:402; Methods in Molecular Biology,
Vol. 33: In Situ Hybridization Protocols, Choo, ed., Humana Press,
Totowa, N.J. (1994).
[0235] Amplification-based assays also can be used to measure the
copy number of the SALPR or Relaxin-3 gene. In such assays, the
corresponding SALPR or Relaxin-3 nucleic acid sequence act as a
template in an amplification reaction (for example, Polymerase
Chain Reaction or PCR). In a quantitative amplification, the amount
of amplification product will be proportional to the amount of
template in the original sample. Comparison to appropriate controls
provides a measure of the copy number of the SALPR or Relaxin-3
gene, corresponding to the specific probe used, according to the
principles discussed above. Methods of real-time quantitative PCR
using TaqMan probes are well known in the art. Detailed protocols
for real-time quantitative PCR are provided, for example, for RNA
in: Gibson et al., 1996, A novel method for real time quantitative
RT-PCR. Genome Res., 10:995-1001; and for DNA in: Heid et al.,
1996, Real time quantitative PCR. Genome Res., 10:986-994.
[0236] A TaqMan-based assay also can be used to quantify SALPR or
Relaxin-3 polynucleotides. TaqMan based assays use a fluorogenic
oligonucleotide probe that contains a 5' fluorescent dye and a 3'
quenching agent. The probe hybridizes to a PCR product, but cannot
itself be extended due to a blocking agent at the 3' end. When the
PCR product is amplified in subsequent cycles, the 5' nuclease
activity of the polymerase, for example, AmpliTaq, results in the
cleavage of the TaqMan probe. This cleavage separates the 5'
fluorescent dye and the 3' quenching agent, thereby resulting in an
increase in fluorescence as a function of amplification (see, for
example, http://www2.perkin-elmer.com- ).
[0237] Other suitable amplification methods include, but are not
limited to, ligase chain reaction (LCR) (see, Wu and Wallace,
Genomics, 4: 560, 1989; Landegren et al., Science, 241: 1077, 1988;
and Barringer et al., Gene, 89:117, 1990), transcription
amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA, 86:1173,
1989), self-sustained sequence replication (Guatelli et al., Proc
Nat Acad Sci, USA 87:1874, 1990), dot PCR, and linker adapter PCR,
for example.
[0238] One powerful method for determining DNA copy numbers uses
microarray-based platforms. Microarray technology may be used
because it offers high resolution. For example, the traditional CGH
generally has a 20 Mb limited mapping resolution; whereas in
microarray-based CGH, the fluorescence ratios of the differentially
labeled test and reference genomic DNAs provide a locus-by-locus
measure of DNA copy-number variation, thereby achieving increased
mapping resolution. Details of various microarray methods can be
found in the literature. See, for example, U.S. Pat. No. 6,232,068;
Pollack et al., Nat. Genet., 23(1):41-6, (1999), and others.
[0239] As demonstrated in the Examples set forth herein, the SALPR
and/or Relaxin-3 genes are frequently amplified in certain cancers,
particularly lung cancer, colon cancer, ovarian cancer, and
pancreatic cancer. As described herein, results showing cells
exhibiting a SALPR and/or Relaxin-3 DNA copy number increase also
demonstrate SALPR and/or Relaxin-3 mRNA overexpression,
respectively. The SALPR and Relaxin-3 genes have the characteristic
features of overexpression, amplification, and the correlation
between these two has been established in several tumor types.
These features are shared with other well-studied oncogenes
(Yoshimoto et al., JPN J Cancer Res, 77(6):540-5, 1986; Knuutila et
al., Am. J. Pathol., 152(5):1107-23, 1998). The SALPR and Relaxin-3
genes and their encoded polypeptides are accordingly used in the
present invention as targets for cancer diagnosis, prevention, and
treatment.
[0240] 3. Frequent Overexpression of SALPR and Relaxin-3 Genes in
Tumors:
[0241] The expression levels of the SALPR and Relaxin-3 genes in
tumors cells were examined. As demonstrated in the examples infra,
SALPR and/or Relaxin-3 gene(s) is/are overexpressed in cancers,
including lung cancer, colon cancer, ovarian cancer, and pancreatic
cancer (See Tables 1 and 2). Detection and quantification of the
SALPR or Relaxin-3 gene expression may be carried out through
direct hybridization based assays or amplification based assays.
The hybridization based techniques for measuring gene transcript
are known to those skilled in the art (Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2d Ed. vol. 1-3, Cold Spring Harbor
Press, NY, 1989). For example, one method for evaluating the
presence, absence, or quantity of the SALPR or Relaxin-3 gene is by
Northern blot. Isolated mRNAs from a given biological subject are
electrophoresed to separate the mRNA species, and transferred from
the gel to a membrane, for example, a nitrocellulose or nylon
filter. Labeled SALPR or Relaxin-3 probes are then hybridized to
the membrane to identify and quantify the respective mRNAs. The
example of amplification based assays include RT-PCR, which is well
known in the art (Ausubel et al., Current Protocols in Molecular
Biology, eds. 1995 supplement). Quantitative RT-PCR is used
preferably to allow the numerical comparison of the level of
respective SALPR or Relaxin-3 mRNAs in different samples. Other
assays, such as Northern hybridization or microarray analysis also
can be used to determine the numerical comparison of respective
mRNA levels.
[0242] 4. Cancer Diagnosis, Therapies, and Vaccines Using SALPR and
Relaxin-3:
[0243] A. Overexpression and Amplification of the SALPR and
Relaxin-3 Genes:
[0244] The SALPR and Relaxin-3 genes and their expressed gene
products can be used for diagnosis, prognosis, rational drug
design, and other therapeutic intervention of tumors and cancers
(for example, a lung cancer, a colon cancer, an ovarian cancer, or
a pancreatic cancer).
[0245] Detection and measurement of amplification and/or
overexpression of the SALPR or Relaxin-3 gene in a test sample
taken from a patient indicates that the patient may have developed
a tumor. Particularly, the presence of amplified SALPR or Relaxin-3
DNA leads to a diagnosis of cancer or precancerous condition, for
example, a lung cancer, a colon cancer, an ovarian cancer, or a
pancreatic cancer, with high probability of accuracy. The present
invention therefore provides, in one aspect, methods for
diagnosing, predicting, or characterizing a cancer or tumor or
cancer potential in a mammalian tissue by measuring the levels of
SALPR or Relaxin-3 mRNA expression in samples taken from the tissue
of suspicion, and determining whether SALPR or Relaxin-3 is
overexpressed in the tissue. The various techniques, including
hybridization-, microarray-, and amplification-based methods, for
measuring and evaluating mRNA levels are provided herein as
discussed supra. The present invention also provides, in other
aspects, methods for diagnosing or predicting a cancer or tumor or
cancer potential in a mammalian tissue by measuring the numbers of
SALPR or Relaxin-3 DNA copy in samples taken from the tissue of
suspicion, and determining whether the SALPR or Relaxin-3 genes are
amplified in the tissue. The various techniques, including
hybridization based and amplification based methods, for measuring
and evaluating DNA copy numbers are provided herein as discussed
supra. The present invention thus provides methods for detecting
amplified genes at the DNA level and increased expression at the
RNA level, wherein both the results are indicative of tumor
progression.
[0246] B. Detection of the SALPR and Relaxin-3 Protein:
[0247] According to the present invention, the detection of
increased SALPR or Relaxin-3 protein level in a test sample also
can indicate the presence of a precancerous or cancerous condition
in the tissue source of the sample. Protein detection for tumor and
cancer diagnostics and prognostics can be carried out by
immunoassays, for example, using antibodies directed against a
target gene, for example, SALPR and/or Relaxin-3. Any methods that
are known in the art for protein detection and quantitation can be
used in the methods of this invention, including, inter alia,
electrophoresis, capillary electrophoresis, high performance liquid
chromatography (HPLC), thin layer chromatography (TLC),
hyperdiffusion chromatography, immunoelectrophoresis,
radioimmunoassay (RIA), enzyme-linked immunosorbent assays
(ELISAs), immuno-flouorescent assays, Western Blot, etc. Protein
from the tissue or cell type to be analyzed may be isolated using
standard techniques, for example, as described in Harlow and Lane,
Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y. 1988).
[0248] The antibodies (or fragments thereof) useful in the present
invention can, additionally, be employed histologically, as in
immunofluorescence or immunoelectron microscopy, for in situ
detection of target gene peptides. In situ detection can be
accomplished by removing a histological specimen from a patient,
and applying thereto a labeled antibody of the present invention.
The antibody (or its fragment) is preferably applied by overlaying
the labeled antibody (or fragment) onto a biological sample.
Through the use of such a procedure, it is possible to determine
not only the presence of the target gene product, for example,
SALPR or Relaxin-3 protein, but also their distribution in the
examined tissue. Using the present invention, a skilled artisan
will readily perceive that any of a wide variety of histological
methods (for example, staining procedures) can be modified to
achieve such in situ detection.
[0249] The biological sample that is subjected to protein detection
can be brought in contact with and immobilized on a solid phase
support or carrier, for example, nitrocellulose, or other solid
support which is capable of immobilizing cells, cell particles, or
soluble proteins. The support can then be washed with suitable
buffers followed by treatment with the detectably labeled
fingerprint gene specific antibody. The solid phase support can
then be washed with the buffer a second time to remove unbound
antibody. The amount of bound label on the solid support can then
be detected by conventional means.
[0250] A target gene product-specific antibody, for example, a
SALPR or Relaxin-3 antibody can be detectably labeled, in one
aspect, by linking the same to an enzyme, for example, horseradish
peroxidase, alkaline phosphatase, or glucoamylase, and using it in
an enzyme immunoassay (EIA) (see, for example, Voller, A., 1978,
The Enzyme Linked Immunosorbent Assay (ELISA), Diagnostic Horizons,
2:1-7; Voller et al., J. Clin. Pathol., 31:507-520, 1978; Butler,
J. E., Meth. Enzymol., 73:482-523, 1981; Maggio, E. (ed.), Enzyme
Immunoassay, CRC Press, Boca Raton, Fla., 1980; and Ishikawa et al.
(eds), Enzyme Immunoassay, Kgaku Shoin, Tokyo, 1981). The enzyme
bound to the antibody reacts with an appropriate substrate,
preferably a chromogenic substrate, in such a manner as to produce
a chemical moiety that can be detected, for example, by
spectrophotometric or fluorimetric means, or by visual
inspection.
[0251] In a related aspect, therefore, the present invention
provides the use of SALPR or Relaxin-3 antibodies in cancer
diagnosis and intervention. Antibodies that specifically bind to
SALPR or Relaxin-3 protein and polypeptides can be produced by a
variety of methods. Such antibodies may include, but are not
limited to, polyclonal antibodies, monoclonal antibodies (mAbs),
humanized or chimeric antibodies, single chain antibodies, Fab
fragments, F(ab').sub.2 fragments, fragments produced by a Fab
expression library, anti-idiotypic (anti-Id) antibodies, and
epitope-binding fragments of any of the above.
[0252] Such antibodies can be used, for example, in the detection
of the target gene, SALPR or Relaxin-3, or their fingerprint or
pathway genes involved in a particular biological pathway, which
may be of physiological or pathological importance. These potential
pathways or fingerprint genes, for example, may interact with SALPR
or Relaxin-3 activity and be involved in tumorigenesis. The SALPR
or Relaxin-3 antibodies also can be used in a method for the
inhibition of SALPR or Relaxin-3 activity, respectively. Thus, such
antibodies can be used in treating tumors and cancers (for example,
lung cancer, colon cancer, ovarian cancer, or pancreatic cancer);
they also may be used in diagnostic procedures whereby patients are
tested for abnormal levels of SALPR or Relaxin-3 protein, and/or
fingerprint or pathway gene product associated with SALPR or
Relaxin-3, respectively, and for the presence of abnormal forms of
such protein.
[0253] To produce antibodies to SALPR or Relaxin-3 protein, a host
animal is immunized with the protein, or a portion thereof. Such
host animals can include, but are not limited to, rabbits, mice,
and rats. Various adjuvants can be used to increase the
immunological response, depending on the host species, including
but not limited to Freund's (complete and incomplete), RIBI Detox
(Ribi Immunochemical), QS21, liposomal formulations, mineral gels,
for example, aluminum hydroxide, surface active substances, for
example, lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin (KLH), dinitrophenol (DNP),
and potentially useful human adjuvants, for example, BCG (Bacille
Calmette-Guerin) and Corynebacterium parvum.
[0254] Monoclonal antibodies, which are homogeneous populations of
antibodies to a particular antigen, for example, SALPR or Relaxin-3
as in the present invention, can be obtained by any technique which
provides for the production of antibody molecules by continuous
cell lines in culture. These include, but are not limited to the
hybridoma technique of Kohler and Milstein, (Nature, 256:495-497,
1975; and U.S. Pat. No. 4,376,110), the human B-cell hybridoma
technique (Kosbor et al., Immunology Today, 4:72, 1983; Cole et
al., Proc. Natl. Acad. Sci. USA, 80:2026-2030, 1983), and the
BV-hybridoma technique (Cole et al., Monoclonal Antibodies And
Cancer Therapy (Alan R. Liss, Inc. 1985), pp. 77-96. Such
antibodies can be of any immunoglobulin class including IgG, IgM,
IgE, IgA, IgD and any subclass thereof. The hybridoma producing the
mAb of this invention can be cultivated in vitro or in vivo.
Production of high titers of mAbs in vivo makes this the presently
preferred method of production.
[0255] In addition, techniques developed for the production of
"chimeric antibodies" can be made by splicing the genes from a
mouse antibody molecule of appropriate antigen specificity together
with genes from a human antibody molecule of appropriate biological
activity (see, Morrison et al., Proc. Natl. Acad. Sci. USA,
81:6851-6855, 1984; Neuberger et al., Nature, 312:604-608, 1984;
Takeda et al., Nature, 314:452-454, 1985; and U.S. Pat. No.
4,816,567). A chimeric antibody is a molecule in which different
portions are derived from different animal species, for example,
those having a variable region derived from a murine mAb and a
container region derived from human immunoglobulin.
[0256] Alternatively, techniques described for the production of
single chain antibodies (for example, U.S. Pat. No. 4,946,778;
Bird, Science, 242:423-426, 1988; Huston et al., Proc. Natl. Acad.
Sci. USA, 85:5879-5883, 1988; and Ward et al., Nature, 334:544-546,
1989), and for making humanized monoclonal antibodies (U.S. Pat.
No. 5,225,539), can be used to produce anti-differentially
expressed or anti-pathway gene product antibodies.
[0257] Knappik et al. (see U.S. Pat. No. 6,300,064) describe
methods for generating antibody libraries of human-derived antibody
genes, which cover the antibodies encoded in the human genome. The
methods disclosed also enable creation of useful libraries of
(poly)peptides in general.
[0258] Antibody fragments that recognize specific epitopes can be
generated by known techniques. For example, such fragments include
but are not limited to: the F(ab').sub.2 fragments that can be
produced by pepsin digestion of the antibody molecule, and the Fab
fragments that can be generated by reducing the disulfide bridges
of the F(ab').sub.2 fragments. Alternatively, Fab expression
libraries can be constructed (Huse et al., Science, 246:1275-1281,
1989) to allow rapid and easy identification of monoclonal Fab
fragments with the desired specificity.
[0259] C. Use of SALPR and Relaxin-3 Modulators in Cancer
Diagnostics:
[0260] In addition to antibodies, the present invention provides,
in another aspect, the diagnostic and therapeutic utilities of
other molecules and compounds that interact with SALPR or Relaxin-3
protein. Specifically, such compounds can include, but are not
limited to proteins or peptides, comprising extracellular portions
of transmembrane proteins of the target, if they exist. Exemplary
peptides include soluble peptides, for example, Ig-tailed fusion
peptides. Such compounds also can be obtained through the
generation and screening of random peptide libraries (see, for
example, Lam et al., Nature, 354:82-84, 1991; Houghton et al.,
Nature, 354:84-86, 1991), made of D- and/or L-configuration amino
acids, phosphopeptides (including, but not limited to, members of
random or partially degenerate phosphopeptide libraries; see, for
example, Songyang et al., Cell, 72:767-778, 1993), and small
organic or inorganic molecules. In this aspect, the present
invention provides a number of methods and procedures to assay or
identify compounds that bind to target, i.e., SALPR or Relaxin-3
protein, or to any cellular protein that may interact with the
target, and compounds that may interfere with the interaction of
the target with other cellular proteins.
[0261] In vitro assay systems are provided that are capable of
identifying compounds that specifically bind to the target gene
product, for example, SALPR or Relaxin-3 protein. The assays
involve, for example, preparation of a reaction mixture of the
target gene product, for example, SALPR or Relaxin-3 protein and a
test compound under conditions and for a time sufficient to allow
the two components to interact and bind, thus forming a complex
that can be removed and/or detected in the reaction mixture. These
assays can be conducted in a variety of ways. For example, one
method involves anchoring the target protein or the test substance
to a solid phase, and detecting target protein--test compound
complexes anchored to the solid phase at the end of the reaction.
In one aspect of such a method, the target protein can be anchored
onto a solid surface, and the test compound, which is not anchored,
can be labeled, either directly or indirectly. In practice,
microtiter plates can be used as the solid phase. The anchored
component can be immobilized by non-covalent or covalent
attachments. Non-covalent attachment can be accomplished by simply
coating the solid surface with a solution of the protein and
drying. Alternatively, an immobilized antibody, preferably a
monoclonal antibody, specific for the protein to be immobilized can
be used to anchor the protein to the solid surface. The surfaces
can be prepared in advance and stored.
[0262] To conduct the assay, the non-immobilized component is added
to the coated surface containing the anchored component. After the
reaction is complete, unreacted components are removed, for
example, by washing, and complexes anchored on the solid surface
are detected. Where the previously immobilized component is
pre-labeled, the detection of label immobilized on the surface
indicates that complexes were formed. Where the previously
non-immobilized component is not pre-labeled, an indirect label can
be used to detect complexes anchored on the surface; for example,
using a labeled antibody specific for the immobilized component
(the antibody, in turn, can be directly labeled or indirectly
labeled with a labeled anti-Ig antibody). Alternatively, the
reaction can be conducted in a liquid phase, the reaction products
separated from unreacted components, and complexes detected, for
example, using an immobilized antibody specific for a target gene
or the test compound to anchor any complexes formed in solution,
and a labeled antibody specific for the other component of the
possible complex to detect anchored complexes.
[0263] Assays also are provided for identifying any cellular
protein that may interact with the target protein, i.e., SALPR or
Relaxin-3 protein. Any method suitable for detecting
protein-protein interactions can be used to identify novel
interactions between target protein and cellular or extracellular
proteins. Those cellular or extracellular proteins may be involved
in certain cancers, for example, lung cancer, colon cancer, ovarian
cancer, or pancreatic cancer, and represent certain tumorigenic
pathways including the target, for example, SALPR or Relaxin-3.
They may thus be denoted as pathway genes.
[0264] Methods, for example, co-immunoprecipitation and
co-purification through gradients or chromatographic columns, can
be used to identify protein-protein interactions engaged by the
target protein. The amino acid sequence of the target protein,
i.e., SALPR or Relaxin-3 protein or a portion thereof, is useful in
identifying the pathway gene products or other proteins that
interact with SALPR or Relaxin-3 protein. The amino acid sequence
of pathway gene products or other proteins can be derived from the
nucleotide sequence, or from published database records
(SWISS-PROT, PIR, EMBL); it also can be ascertained using
techniques well known to a skilled artisan, for example, the Edman
degradation technique (see, for example, Creighton, Proteins:
Structures and Molecular Principles, 1983, W. H. Freeman & Co.,
N.Y., 34-49). The nucleotide subsequences of the target gene, for
example, SALPR or Relaxin-3, can be used in a reaction mixture to
screen for pathway gene sequences. Screening can be accomplished,
for example, by standard hybridization or PCR techniques.
Techniques for the generation of oligonucleotide mixtures and the
screening are well known (see, for example, Ausubel, supra, and
Innis et al. (eds.), PCR Protocols: A Guide to Methods and
Applications, 1990, Academic Press, Inc., New York).
[0265] By way of example, the yeast two-hybrid system which is
often used in detecting protein interactions in vivo is discussed
herein. Chien et al. have reported the use of a version of the
yeast two-hybrid system (Proc. Natl. Acad. Sci. USA, 1991,
88:9578-9582); it is commercially available from Clontech (Palo
Alto, Calif.). Briefly, utilizing such a system, plasmids are
constructed that encode two hybrid proteins: the first hybrid
protein comprises the DNA-binding domain of a transcription factor,
for example, activation protein, fused to a known protein, in this
case, a protein known to be involved in a tumor or cancer, and the
second hybrid protein comprises the activation domain of the fused
transcription factor to an unknown protein that is encoded by a
cDNA which has been recombined into this plasmid as part of a cDNA
library. The plasmids are transformed into a strain of the yeast
Saccharomyces cerevisiae that contains a reporter gene, for
example, lacZ, whose expression is regulated by the transcription
factor's binding site. Either hybrid protein alone cannot activate
transcription of the reporter gene. The DNA binding hybrid protein
cannot activate transcription because it does not provide the
activation domain function, and the activation domain hybrid
protein cannot activate transcription because it lacks the domain
required for binding to its target site, i.e., it cannot localize
to the transcription activator protein's binding site. Interaction
between the DNA binding hybrid protein and the library encoded
protein reconstitutes the functional transcription factor and
results in expression of the reporter gene, which is detected by an
assay for the reporter gene product.
[0266] The two-hybrid system or similar methods can be used to
screen activation domain libraries for proteins that interact with
a known "bait" gene product. The SALPR or Relaxin-3 gene product,
involved in a number of tumors and cancers, is such a bait
according to the present invention. Total genomic or cDNA sequences
are fused to the DNA encoding an activation domain. This library
and a plasmid encoding a hybrid of the bait gene product, i.e.,
SALPR or Relaxin-3 protein or polypeptides, fused to the
DNA-binding domain are co-transformed into a yeast reporter strain,
and the resulting transformants are screened for those that express
the reporter gene. For example, the bait gene SALPR or Relaxin-3
can be cloned into a vector such that it is translationally fused
to the DNA encoding the DNA-binding domain of the GAL4 protein. The
colonies are purified and the plasmids responsible for reporter
gene expression are isolated. The inserts in the plasmids are
sequenced to identify the proteins encoded by the cDNA or genomic
DNA.
[0267] A cDNA library of a cell or tissue source that expresses
proteins predicted to interact with the bait gene product, for
example, SALPR or Relaxin-3, can be made using methods routinely
practiced in the art. According to the particular system described
herein, the library is generated by inserting the cDNA fragments
into a vector such that they are translationally fused to the
activation domain of GAL4. This library can be cotransformed along
with the bait gene-GAL4 fusion plasmid into a yeast strain which
contains a lacZ gene whose expression is controlled by a promoter
which contains a GAL4 activation sequence. A cDNA encoded protein,
fused to GAL4 activation domain, that interacts with the bait gene
product will reconstitute an active GAL4 transcription factor and
thereby drive expression of the lacZ gene. Colonies that express
lacZ can be detected by their blue color in the presence of X-gal.
Plasmids from such a blue colony can then be purified and used to
produce and isolate the SALPR- or Relaxin-3-interacting protein
using techniques routinely practiced in the art.
[0268] The assay systems involve, for example, preparation of a
reaction mixture containing the target gene product SALPR or
Relaxin-3 protein, and the binding partner under conditions and for
a time sufficient to allow the two products to interact and bind,
thus forming a complex. To test a compound for inhibitory activity,
the reaction mixture is prepared in the presence and absence of the
test compound. The test compound can be initially included in the
reaction mixture, or can be added at a time subsequent to the
addition of a target gene product and its cellular or extracellular
binding partner. Control reaction mixtures are incubated without
the test compound or with a placebo. The formation of complexes
between the target gene product SALPR or Relaxin-3 protein and the
cellular or extracellular binding partner is then detected. The
formation of a complex in the control reaction, but not in the
reaction mixture containing the test compound, indicates that the
compound interferes with the interaction of the target gene product
SALPR or Relaxin-3 protein and the interactive binding partner.
Additionally, complex formation within reaction mixtures containing
the test compound and normal target gene product can be compared to
complex formation within reaction mixtures containing the test
compound and mutant target gene product. This comparison can be
important in the situation where it is desirable to identify
compounds that disrupt interactions of mutant but not normal target
gene product.
[0269] The assays can be conducted in a heterogeneous or
homogeneous format. Heterogeneous assays involve anchoring either
the target gene product SALPR or Relaxin-3 protein or the binding
partner to a solid phase and detecting complexes anchored to the
solid phase at the end of the reaction, as described above. In
homogeneous assays, the entire reaction is carried out in a liquid
phase, as described below. In either approach, the order of
addition of reactants can be varied to obtain different information
about the compounds being tested. For example, test compounds that
interfere with the interaction between the target gene product
SALPR or Relaxin-3 protein and the binding partners, for example,
by competition, can be identified by conducting the reaction in the
presence of the test substance; i.e., by adding the test substance
to the reaction mixture prior to or simultaneously with the target
gene product SALPR or Relaxin-3 protein and interactive cellular or
extracellular binding partner. Alternatively, test compounds that
disrupt preformed complexes, for example, compounds with higher
binding constants that displace one of the components from the
complex, can be tested by adding the test compound to the reaction
mixture after complexes have been formed.
[0270] In a homogeneous assay, a preformed complex of the target
gene product and the interactive cellular or extracellular binding
partner product is prepared in which either the target gene
products or their binding partners are labeled, but the signal
generated by the label is quenched due to complex formation (see,
for example, Rubenstein, U.S. Pat. No. 4,109,496). The addition of
a test substance that competes with and displaces one of the
species from the preformed complex will result in the generation of
a signal above background. The test substances that disrupt the
interaction between the target gene product SALPR or Relaxin-3
protein and cellular or extracellular binding partners can thus be
identified.
[0271] In one aspect, the target gene product SALPR or Relaxin-3
protein can be prepared for immobilization using recombinant DNA
techniques. For example, the target SALPR or Relaxin-3 coding
region can be fused to a glutathione-S-transferase (GST) gene using
a fusion vector, for example, pGEX-5X-1, in such a manner that its
binding activity is maintained in the resulting fusion product. The
interactive cellular or extracellular binding partner product is
purified and used to raise a monoclonal antibody, using methods
routinely practiced in the art. This antibody can be labeled with
the radioactive isotope .sup.125I, for example, by methods
routinely practiced in the art.
[0272] In a heterogeneous assay, the GST-Target gene fusion product
is anchored, for example, to glutathione-agarose beads. The
interactive cellular or extracellular binding partner is then added
in the presence or absence of the test compound in a manner that
allows interaction and binding to occur. At the end of the reaction
period, unbound material is washed away, and the labeled monoclonal
antibody can be added to the system and allowed to bind to the
complexed components. The interaction between the target gene
product SALPR or Relaxin-3 protein and the interactive cellular or
extracellular binding partner is detected by measuring the
corresponding amount of radioactivity that remains associated with
the glutathione-agarose beads. A successful inhibition of the
interaction by the test compound will result in a decrease in
measured radioactivity. Alternatively, the GST-target gene fusion
product and the interactive cellular or extracellular binding
partner can be mixed together in liquid in the absence of the solid
glutathione-agarose beads. The test compound is added either during
or after the binding partners are allowed to interact. This mixture
is then added to the glutathione-agarose beads and unbound material
is washed away. Again, the extent of inhibition of the binding
partner interaction can be detected by adding the labeled antibody
and measuring the radioactivity associated with the beads.
[0273] In other aspects of the invention, these same techniques are
employed using peptide fragments that correspond to the binding
domains of the target gene product, for example, SALPR or Relaxin-3
protein and the interactive cellular or extracellular binding
partner (where the binding partner is a product), in place of one
or both of the fill-length products. Any number of methods
routinely practiced in the art can be used to identify and isolate
the protein's binding site. These methods include, but are not
limited to, mutagenesis of one of the genes encoding one of the
products and screening for disruption of binding in a
co-immunoprecipitation assay.
[0274] Additionally, compensating mutations in the gene encoding
the second species in the complex can be selected. Sequence
analysis of the genes encoding the respective products will reveal
mutations that correspond to the region of the product involved in
interactive binding. Alternatively, one product can be anchored to
a solid surface using methods described above, and allowed to
interact with and bind to its labeled binding partner, which has
been treated with a proteolytic enzyme, for example, trypsin. After
washing, a short, labeled peptide comprising the binding domain can
remain associated with the solid material, which can be isolated
and identified by amino acid sequencing. Also, once the gene coding
for the cellular or extracellular binding partner product is
obtained, short gene segments can be engineered to express peptide
fragments of the product, which can then be tested for binding
activity and purified or synthesized.
[0275] D. Methods for Cancer Treatment Using SALPR and Relaxin-3
Modulators:
[0276] In another aspect, the present invention provides methods
for treating or controlling a cancer or tumor and the symptoms
associated therewith. Any compounds, for example, those identified
in the aforementioned assay systems, can be tested for the ability
to prevent and/or ameliorate symptoms of tumors and cancers (for
example, lung cancer, colon cancer, ovarian cancer, or pancreatic
cancer). As used herein, inhibit, control, ameliorate, prevent,
treat, and suppress collectively and interchangeably mean stopping
or slowing cancer formation, development, or growth and/or
eliminating or reducing cancer symptoms. Cell-based and animal
model-based trial systems for evaluating the ability of the tested
compounds to prevent and/or ameliorate tumors and cancer symptoms
are used according to the present invention.
[0277] For example, cell based systems can be exposed to a compound
suspected of ameliorating lung, colon, ovary, or pancreas tumor or
cancer symptoms, at a sufficient concentration and for a time
sufficient to elicit such an amelioration in the exposed
populations of cells. After exposure, the populations of cells are
examined to determine whether one or more tumor/cancer phenotypes
represented in the populations has been altered to resemble a more
normal or more wild-type, non-cancerous phenotype. Further, the
levels of SALPR or Relaxin-3 mRNA expression and DNA amplification
within these cells may be determined, according to the methods
provided herein. A decrease in the observed level of expression and
amplification would indicate the successful intervention of tumors
and cancers (for example, lung cancer, colon cancer, ovarian
cancer, or pancreatic cancer).
[0278] In addition, animal models can be used to identify compounds
for use as drugs and pharmaceuticals that are capable of treating
or suppressing symptoms of tumors and cancers. For example, animal
models can be exposed to a test compound at a sufficient
concentration and for a time sufficient to elicit such an
amelioration in the exposed animals. The response of the animals to
the exposure can be monitored by assessing the reversal of symptoms
associated with the tumor or cancer, or by evaluating the changes
in DNA copy number in cell populations and levels of mRNA
expression of the target gene, for example, SALPR or Relaxin-3. Any
treatments which reverse any symptom of tumors and cancers, and/or
which reduce overexpression and amplification of the target SALPR
or Relaxin-3 gene may be considered as candidates for therapy in
humans. Dosages of test agents can be determined by deriving
dose-response curves.
[0279] Moreover, fingerprint patterns or gene expression profiles
can be characterized for known cell states, for example, normal or
known pre-neoplastic, neoplastic, or metastatic states, within the
cell- and/or animal-based model systems. Subsequently, these known
fingerprint patterns can be compared to ascertain the ability of a
test compound to modify such fingerprint patterns, and to cause the
pattern to more closely resemble that of a normal fingerprint
pattern. For example, administration of a compound which interacts
with and affects SALPR or Relaxin-3 gene expression and
amplification or cells overexpressing or having amplification may
cause the fingerprint pattern of a precancerous or cancerous model
system to more closely resemble a control, normal system; such a
compound thus will have therapeutic utilities in treating the
cancer. In other situations, administration of a compound may cause
the fingerprint pattern of a control system to begin to mimic
tumors and cancers (for example, lung cancer, colon cancer, ovarian
cancer, or pancreatic cancer); such a compound therefore acts as a
tumorigenic agent, which in turn can serve as a target for
therapeutic interventions of the cancer and its diagnosis.
[0280] In another aspect, the present invention also provides
assays for compounds that interfere with gene and cellular protein
interactions involving the target SALPR or Relaxin-3. The target
gene product, for example, SALPR or Relaxin-3 protein, may interact
in vivo with one or more cellular or extracellular macromolecules,
for example, proteins and nucleic acid molecules. Such cellular and
extracellular macromolecules are referred to as "binding partners."
Compounds that disrupt such interactions can be used to regulate
the activity of the target gene product, for example, SALPR or
Relaxin-3 protein, especially mutant target gene product. Such
compounds can include, but are not limited to, molecules, for
example, antibodies, peptides and other chemical compounds.
[0281] E. Methods for Identifying Small Molecules That Can be Used
as SALPR and/or Relaxin-3 Modulators:
[0282] As described herein, the modulators contemplated by the
present invention can be small organic compounds. Such modulators
can be identified by assays (for example, in microtiter formats on
microtiter plates in robotic assays) used to screen large numbers
of compounds. There are many suppliers of chemical compounds,
including Sigma (St. Louis, Mo.), Aldrich (St. Louis, Mo.),
Sigma-Aldrich (St. Louis, Mo.), Fluka Chemika-Biochemica Analytika
(Buchs Switzerland) and the like.
[0283] In particular, modulators displaying a desired activity can
be identified from combinatorial libraries (i.e., collections of
diverse chemical compounds generated by either chemical synthesis
or biological synthesis by combining a number of "building
blocks"). Preparation and screening of combinatorial libraries is
well known to those of skill in the art. Such combinatorial
libraries include, but are not limited to, peptide libraries (see,
for example, U.S. Pat. No. 5,010,175, Furka, Int. J. Pept. Prot.
Res. 37:487-493 (1991) and Houghton et al., Nature 354:84-88
(1991)). Other chemistries for generating chemical diversity
libraries also can be used. Such chemistries include, but are not
limited to: peptoids (see, for example, PCT Publication No. WO
91/19735), encoded peptides (e.g., PCT Publication WO 93/20242),
random bio-oligomers (e.g., PCT Publication No. WO 92/00091),
benzodiazepines (see, for example, U.S. Pat. No. 5,288,514),
diversomers such as hydantoins, benzodiazepines and dipeptides
(Hobbs et al., Proc. Nat. Acad. Sci. USA 90:6909-6913 (1993)),
vinylogous polypeptides (Hagihara et al., J. Amer. Chem. Soc.
114:6568 (1992)), nonpeptidal peptidomimetics with glucose
scaffolding (Hirschmann et al., J. Amer. Chem. Soc. 114:9217-9218
(1992)), analogous organic syntheses of small compound libraries
(Chen et al., J. Amer. Chem. Soc. 116:2661 (1994)), oligocarbamates
(Cho et al., Science 261:1303 (1993)), and/or peptidyl phosphonates
(Campbell et al., J. Org. Chem. 59:658 (1994)), nucleic acid
libraries (see, for example, Ausubel, Berger and Sambrook, all
supra), peptide nucleic acid libraries (see, for example, U.S. Pat.
No. 5,539,083), antibody libraries (see, for example, Vaughn et
al., Nature Biotechnology, 14(3):309-314 (1996) and
PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al.,
Science, 274:1520-1522 (1996) and U.S. Pat. No. 5,593,853), small
organic molecule libraries (see, for example, benzodiazepines, Baum
C&EN, January 18, page 33 (1993); isoprenoids, U.S. Pat. No.
5,569,588; thiazolidinones and metathiazanones, U.S. Pat. No.
5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134;
morpholino compounds, U.S. Pat. No. 5,506,337; benzodiazepines,
U.S. Pat. No. 5,288,514, and the like).
[0284] Devices for the preparation of combinatorial libraries are
commercially available (see, for example, 357 MPS, 390 MPS,
Advanced Chem Tech, Louisville Ky., Symphony, Rainin, Woburn,
Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus,
Millipore, Bedford, Mass.). In addition, numerous combinatorial
libraries are commercially available (see, for example, ComGenex,
Princeton, N.J., Tripos, Inc., St. Louis, Mo., 3D Pharmaceuticals,
Exton, Pa., Martek Biosciences, Columbia, Md., etc.).
[0285] High-throughput assays also can be used to identify the
modulators. Using the high-throighput assays, it is possible to
screen thousands of potential modulators in a single day. For
example, each well of a microtiter plate can be used to run a
separate assay against a selected potential modulator, or, if
concentration or incubation time effects are to be observed, every
5-10 wells can test a single modulator. Thus, a single standard
microtiter plate can assay about 100 (for example, 96) modulators.
If 1536 well plates are used, then a single plate easily can assay
from about 100- about 1500 different compounds.
[0286] F. Methods for Monitoring Efficacy of Cancer Treatment:
[0287] In one aspect, the present invention provides methods for
monitoring the efficacy, such as potency, of a therapeutic
treatment regimen of cancer and methods for monitoring the
efficacy, such as potency, of a compound in clinical trials or
other research studies for inhibition of tumors. The monitoring can
be accomplished by detecting and measuring, in the biological
samples taken from a patient at various time points during the
course of the application of a treatment regimen for treating a
cancer or a clinical trial or other research studies, the changed
levels of expression or amplification of the target gene, for
example, SALPR or Relaxin-3 in the cell population or sample. A
level of expression and/or amplification that is lower in samples
taken at the later time of the treatment or trial or a research
study than those at the earlier time indicates that the treatment
regimen is effective to control the cancer in the patient, or the
compound is effective in inhibiting the tumor. In contrast, samples
taken at the later time of the treatment or trial or a research
study showing no statistically significant decrease in level of
expression and/or amplification than those at the earlier time
indicates that the treatment regimen is not effective to control
the cancer in the patient, or the compound is not effective in
inhibiting the tumor. Of course, the time course studies should be
so designed that sufficient time is allowed for the treatment
regimen or the compound to exert any effect it may have.
[0288] Therefore, the influence of compounds on tumors and cancers
can be monitored both in a clinical trial or other research studies
and in a basic drug screening. In a clinical trial or other
research studies, for example, tumor cells can be isolated from
lung, colon, ovary, or pancreas tumor removed by surgery, and RNA
prepared and analyzed by Northern blot analysis or TaqMan RT-PCR as
described herein, or alternatively by measuring the amount of
protein produced. The fingerprint expression profiles thus
generated can serve as putative biomarkers for lung, colon, ovary,
or pancreas tumor or cancer. Particularly, the expression of SALPR
or Relaxin-3 serves as one such biomarker. Thus, by monitoring the
level of expression of the differentially or over-expressed genes,
for example, SALPR or Relaxin-3, an effective treatment protocol
can be developed using suitable chemotherapeutic anticancer
drugs.
[0289] G. Use of Additional Modulators to SALPR or Relaxin-3
Nucleotides in Cancer Treatment:
[0290] In another further aspect of this invention, additional
compounds and methods for treatment of tumors are provided.
Symptoms of tumors and cancers can be controlled by, for example,
target gene modulation, and/or by a depletion of the precancerous
or cancerous cells. Target gene modulation can be of a negative or
positive nature, depending on whether the target resembles a gene
(for example, tumorigenic) or a tumor suppressor gene (for example,
tumor suppressive). That is, inhibition, i.e., a negative
modulation, of an oncogene-like target gene or stimulation, i.e., a
positive modulation, of a tumor suppressor-like target gene will
control or ameliorate the tumor or cancer in which the target gene
is involved. More precisely, "negative modulation" refers to a
reduction in the level and/or activity of target gene or its
product, for example, SALPR or Relaxin-3, relative to the level
and/or activity of the target gene or its product in the absence of
the modulatory treatment. "Positive modulation" refers to an
increase in the level and/or activity of target gene or its
product, for example, SALPR or Relaxin-3, relative to the level
and/or activity of target gene or its product in the absence of
modulatory treatment. Particularly because SALPR or Relaxin-3
shares many features with well known oncogenes as discussed supra,
inhibition of the SALPR or Relaxin-3, their proteins, or their
activities will control or ameliorate precancerous or cancerous
conditions, for example, lung cancer, colon cancer, ovarian cancer,
or pancreatic cancer.
[0291] The techniques to inhibit or suppress a target gene, for
example SALPR or Relaxin-3, that are involved in cancer are
provided in the present invention. Such approaches include negative
modulatory techniques. For example, compounds that exhibit negative
modulatory activity on SALPR or Relaxin-3 can be used in accordance
with the invention to prevent and/or ameliorate symptoms of tumors
and cancers (for example, lung cancer, colon cancer, ovarian
cancer, or pancreatic cancer). Such molecules can include, but are
not limited to, peptides, phosphopeptides, small molecules
(molecular weight below about 500 Daltons), large molecules
(molecular weight above about 500 Daltons), or antibodies
(including, for example, polyclonal, monoclonal, humanized,
anti-idiotypic, chimeric or single chain antibodies, and Fab,
F(ab').sub.2 and Fab expression library fragments, and
epitope-binding fragments thereof), and nucleic acid molecules that
interfere with replication, transcription, or translation of the
SALPR or Relaxin-3 gene (for example, antisense RNA, Antisense DNA,
DNA decoy or decoy molecule, siRNAs, miRNA, triple helix forming
molecules, and ribozymes, which can be administered in any
combination).
[0292] Antisense, siRNAs, miRNAs, and ribozyme molecules that
inhibit expression of a target gene, for example, SALPR or
Relaxin-3, can be used to reduce the level of the functional
activities of the target gene and its product, for example, reduce
the catalytic potency of SALPR or Relaxin-3, respectively. Triple
helix forming molecules can be used in reducing the level of target
gene activity. These molecules can be designed to reduce or inhibit
either wild type, or if appropriate, mutant target gene
activity.
[0293] For example, anti-sense RNA and DNA molecules act to
directly block the translation of mRNA by hybridizing to targeted
mRNA and preventing protein translation. With respect to antisense
DNA or DNA decoy, oligodeoxyribonucleotides derived from the
translation initiation site, for example, between the -10 and +10
regions of the target gene nucleotide sequence of interest, are
preferred.
[0294] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. A review is provided in Rossi,
Current Biology, 4:469-471 (1994). The mechanism of ribozyme action
involves sequence-specific hybridization of the ribozyme molecule
to complementary target RNA, followed by an endonucleolytic
cleavage. A composition of ribozyme molecules must include one or
more sequences complementary to the target gene mRNA, and must
include a well-known catalytic sequence responsible for mRNA
cleavage (U.S. Pat. No. 5,093,246). Engineered hammerhead motif
ribozyme molecules that may specifically and efficiently catalyze
internal cleavage of RNA sequences encoding target protein, for
example, SALPR or Relaxin-3, may be used according to this
invention in cancer intervention.
[0295] Specific ribozyme cleavage sites within any potential RNA
target are initially identified by scanning the molecule of
interest, for example, SALPR or Relaxin-3 RNA, for ribozyme
cleavage sites which include the following sequences, GUA, GUU and
GUC. Once identified, short RNA sequences of between 15 and 20
ribonucleotides corresponding to the region of the target gene, for
example, SALPR or Relaxin-3, containing the cleavage site can be
evaluated for predicted structural features, for example, secondary
structure, that can render an oligonucleotide sequence unsuitable.
The suitability of candidate sequences also can be evaluated by
testing their accessibility to hybridization with complementary
oligonucleotides, using ribonuclease protection assays.
[0296] The SALPR or Relaxin-3 gene sequences also can be employed
in an RNA interference context. The phenomenon of RNA interference
is described and discussed in Bass, Nature, 411: 428-29 (2001);
Elbashir et al., Nature, 411: 494-98 (2001); and Fire et al.,
Nature, 391: 806-11 (1998), where methods of making interfering RNA
also are discussed. The double-stranded RNA based upon the sequence
disclosed herein (for example, GenBank Accession No.
NM.sub.--016568 (SEQ ID NO:1) and NM.sub.--080864 (SEQ ID NO:3) for
SALPR and Relaxin-3, respectively) is typically less than 100 base
pairs ("bps") in length and constituency and preferably is about 30
bps or shorter, and can be made by approaches known in the art,
including the use of complementary DNA strands or synthetic
approaches. The RNAs that are capable of causing interference can
be referred to as small interfering RNAs (siRNAs), small hairpin
RNAs (shRNAs), or microRNAs (miRNAs), and can cause
post-transcriptional silencing of specific genes in cells, for
example, mammalian cells (including human cells) and in the body,
for example, mammalian bodies (including humans). Exemplary siRNAs
according to the invention could have up to 30 bps, 29 bps, 25 bps,
22 bps, 21 bps, 20 bps, 15 bps, 10 bps, 5 bps or any number
thereabout or therebetween.
[0297] Nucleic acid molecules that can associate together in a
triple-stranded conformation (triple helix) and that thereby can be
used to inhibit transcription of a target gene, should be single
helices composed of deoxynucleotides. The base composition of these
oligonucleotides must be designed to promote triple helix formation
via Hoogsteen base pairing rules, which generally require sizeable
stretches of either purines or pyrimidines on one strand of a
duplex. Nucleotide sequences can be pyrimidine-based, which will
result in TAT and CGC triplets across the three associated strands
of the resulting triple helix. The pyrimidine-rich molecules
provide bases complementary to a purine-rich region of a single
strand of the duplex in a parallel orientation to that strand. In
addition, nucleic acid molecules can be chosen that are
purine-rich, for example, those that contain a stretch of G
residues. These molecules will form a triple helix with a DNA
duplex that is rich in GC pairs, in which the majority of the
purine residues are located on a single strand of the targeted
duplex, resulting in GGC triplets across the three strands in the
triplex. Alternatively, the potential sequences that can be
targeted for triple helix formation can be increased by creating a
so-called "switchback" nucleic acid molecule. Switchback molecules
are synthesized in an alternating 5'-3', 3'-5' manner, such that
they base pair first with one strand of a duplex and then the
other, eliminating the necessity for a sizeable stretch of either
purines or pyrimidines on one strand of a duplex.
[0298] In instances wherein the antisense, ribozyme, siRNA, miRNA,
and triple helix molecules described herein are used to reduce or
inhibit mutant gene expression, it is possible that they also can
effectively reduce or inhibit the transcription (for example, using
a triple helix) and/or translation (for example, using antisense or
ribozyme molecules) of mRNA produced by the normal target gene
allele. These situations are pertinent to tumor suppressor genes
whose normal levels in the cell or tissue need to be maintained
while a mutant is being inhibited. To do this, nucleic acid
molecules which are resistant to inhibition by any antisense,
ribozyme or triple helix molecules used, and which encode and
express target gene polypeptides that exhibit normal target gene
activity, can be introduced into cells via gene therapy methods.
Alternatively, when the target gene encodes an extracellular
protein, it may be preferable to co-administer normal target gene
protein into the cell or tissue to maintain the requisite level of
cellular or tissue target gene activity. By contrast, in the case
of oncogene-like target genes, for example, SALPR or Relaxin-3, it
is the respective normal wild type SALPR or Relaxin-3 gene and
their proteins that need to be suppressed. Thus, any mutant or
variants that are defective in SALPR or Relaxin-3 function or that
interferes or completely abolishes its normal function would be
desirable for cancer treatment. Therefore, the same methodologies
described above to safeguard normal gene alleles may be used in the
present invention to safeguard the mutants of the target gene in
the application of antisense, ribozyme, and triple helix
treatment.
[0299] Antisense RNA and DNA or DNA decoy, ribozyme, and triple
helix molecules of the invention can be prepared by standard
methods known in the art for the synthesis of DNA and RNA
molecules. These include techniques for chemically synthesizing
oligodeoxyribonucleotides and oligoribonucleotides well known in
the art, for example, solid phase phosphoramidite chemical
synthesis. Alternatively, RNA molecules can be generated by in
vitro and in vivo transcription of DNA sequences encoding the
antisense RNA molecule. Such DNA sequences can be incorporated into
a wide variety of vectors which also include suitable RNA
polymerase promoters, for example, the T7 or SP6 polymerase
promoters. Alternatively, antisense cDNA constructs that synthesize
antisense RNA constitutively or inducibly, depending on the
promoter used, can be introduced stably into cell lines. Various
well-known modifications to the DNA molecules can be introduced as
a means for increasing intracellular stability and half-life.
Possible modifications include, but are not limited to, the
addition of flanking sequences of ribo- or deoxy- nucleotides to
the 5' and/or 3' ends of the molecule, or the use of
phosphorothioate or 2' O-methyl rather than phosphodiesterase
linkages within the oligodeoxyribonucleotide backbone.
[0300] In this aspect, the present invention also provides negative
modulatory techniques using antibodies. Antibodies can be generated
which are both specific for a target gene product and which reduce
target gene product activity; they can be administered when
negative modulatory techniques are appropriate for the treatment of
tumors and cancers, for example, in the case of SALPR or Relaxin-3
antibodies for lung cancer, colon cancer, ovarian cancer, or
pancreatic cancer treatment.
[0301] In instances where the target gene protein to which the
antibody is directed is intracellular, and whole antibodies are
used, internalizing antibodies are preferred. However, lipofectin
or liposomes can be used to deliver the antibody, or a fragment of
the Fab region which binds to the target gene epitope, into cells.
Where fragments of an antibody are used, the smallest inhibitory
fragment which specifically binds to the binding domain of the
protein is preferred. For example, peptides having an amino acid
sequence corresponding to the domain of the variable region of the
antibody that specifically binds to the target gene protein can be
used. Such peptides can be synthesized chemically or produced by
recombinant DNA technology using methods well known in the art (for
example, see Creighton, 1983, supra; and Sambrook et al., 1989,
supra). Alternatively, single chain neutralizing antibodies that
bind to intracellular target gene product epitopes also can be
administered. Such single chain antibodies can be administered, for
example, by expressing nucleotide sequences encoding single-chain
antibodies within the target cell population by using, for example,
techniques, for example, those described in Marasco et al., Proc.
Natl. Acad. Sci. USA, 90:7889-7893 (1993). When the target gene
protein is extracellular, or is a transmembrane protein, any of the
administration techniques known in the art which are appropriate
for peptide administration can be used to effectively administer
inhibitory target gene antibodies to their site of action. The
methods of administration and pharmaceutical preparations are
discussed below.
[0302] H. Cancer Vaccines Using SALPR and Relaxin-3:
[0303] One aspect of the invention relates to methods for inducing
an immunological response in a mammal which comprises inoculating
the mammal with SALPR and/or Relaxin-3 polypeptide, or a fragment
thereof, adequate to produce antibody and/or T cell immune response
to protect the mammal from cancers, including lung cancer, colon
cancer, ovarian cancer, or pancreatic cancer.
[0304] In another aspect, the invention relates to peptides derived
from the SALPR or Relaxin-3 amino acid sequence (see, for example,
SEQ ID NO:2 or SEQ ID NO:4, respectively) where those skilled in
the art would be aware that the peptides of the present invention,
or analogs thereof, can be synthesized by automated instruments
sold by a variety of manufacturers, can be commercially custom
ordered and prepared, or can be expressed from suitable expression
vectors as described above. The term amino acid analogs has been
previously described in the specification and for purposes of
describing peptides of the present invention, analogs can further
include branched or non-linear peptides.
[0305] The present invention therefore provides pharmaceutical
compositions comprising SALPR and/or Relaxin-3 proteins or peptides
derived therefrom for use in vaccines and in immunotherapy methods.
When used as vaccines to protect mammals against cancer, the
pharmaceutical composition can comprise as an immunogen cell lysate
from cells transfected with a recombinant expression vector or a
culture supernatant containing the expressed protein.
Alternatively, the immunogen is a partially or substantially
purified recombinant protein or a synthetic peptide.
[0306] Vaccination can be conducted by conventional methods. For
example, the immunogen can be used in a suitable diluent such as
saline or water, or complete or incomplete adjuvants. Further, the
immunogen may or may not be bound to a carrier to make the protein
immunogenic. Examples of such carrier molecules include but are not
limited to bovine serum albumin (BSA), keyhole limpet hemocyanin
(KLH), tetanus toxoid, and the like. The immunogen can be
administered by any route appropriate for antibody production such
as intravenous, intraperitoneal, intramuscular, subcutaneous, and
the like. The immunogen may be administered once or at periodic
intervals until a significant titer of anti-SALPR or anti-Relaxin-3
antibody is produced. The antibody may be detected in the serum
using an immunoassay.
[0307] In another aspect, the present invention provides
pharmaceutical compositions comprising nucleic acid sequence
capable of directing host organism synthesis of a SALPR or
Relaxin-3 protein or of a peptide derived from the SALPR or
Relaxin-3 protein sequence. Such nucleic acid sequence may be
inserted into a suitable expression vector by methods known to
those skilled in the art. Expression vectors suitable for producing
high efficiency gene transfer in vivo include, but are not limited
to, retroviral, adenoviral and vaccinia viral vectors. Operational
elements of such expression vectors are disclosed previously in the
present specification and are known to one skilled in the art. Such
expression vectors can be administered, for example, intravenously,
intramuscularly, subcutaneously, intraperitoneally or orally.
[0308] Another aspect of the invention relates to methods for
inducing an immunological response in a mammal which comprises
inoculating the mammal with naked SALPR and/or Relaxin-3 nucleic
acids, or a fragment thereof, adequate to produce an immunogenic
polypeptide, which in turn would induce antibodies and/or a T cell
immune response to protect the mammal from cancers, including lung
cancer, colon cancer, ovarian cancer, or pancreatic cancer.
[0309] Naked SALPR and/or Relaxin-3 nucleic acids, as described
herein, can be administered as a vaccine via various routes,
including, intramuscular, intravenous, intraperitoneal, intranasal
(via mucosa), intradermal, subcutaneous (see, for example, Fynan et
al. Proc Natl Acad Sci USA 90:1147811482 (1993); Molling K., J Mol
Med 75:242-246 (1997)). For example, naked DNA, when injected
intramuscularly, is taken up by cells, transcribed into mRNA, and
expressed as protein. This protein is the actual vaccine, and it is
produced by the vaccine recipient, which gives a higher chance of
natural modifications and correct folding. It is presented to the
immune system and induces both humoral and cellular immune
responses (see, for example, Tang et al. Nature 356:152154 (1992);
Molling K., J Mol Med 75:242-246 (1997)).
[0310] According to the invention, liposome encapsulated SALPR
and/or Relaxin-3 nucleic acids also can be administered. For
example, clinical trials or other research studies with liposome
encapsulated DNA in treating melanoma illustrated that the approach
is effective in gene therapy (see, for example, Nabel, J. G., et
al., "Direct gene transfer with DNA-liposome complexes in melanoma:
Expression, biological activity and lack of toxicity in humans",
Proc. Nat. Acad. Sci. U.S.A., 90:11307-11311 (1993)).
[0311] Whether the immunogen is a SALPR or a Relaxin-3 protein, a
peptide derived therefrom or a nucleic acid sequence capable of
directing host organism synthesis of SALPR or Relaxin-3 protein or
peptides derived therefrom, the immunogen may be administered for
either a prophylactic or therapeutic purposes. Such prophylactic
use may be appropriate for, for example, individuals with a genetic
predisposition to a particular cancer. When provided
prophylactically, the immunogen is provided in advance of the
cancer or any symptom due to the cancer. The prophylactic
administration of the immunogen serves to prevent or attenuate any
subsequent onset of cancer. When provided therapeutically, the
immunogen is provided at, or shortly after, the onset of cancer or
any symptom associated with the cancer.
[0312] The present invention further relates to a vaccine for
immunizing a mammal, for example, humans, against cancer comprising
SALPR or Relaxin-3 protein or an expression vector capable of
directing host organism synthesis of SALPR or Relaxin-3 protein in
a pharmaceutically acceptable carrier.
[0313] In addition to use as vaccines and in immunotherapy, the
above compositions can be used to prepare antibodies to SALPR or
Relaxin-3 protein. To prepare antibodies, a host animal is
immunized using the SALPR or Relaxin-3 protein or peptides derived
therefrom or aforementioned expression vectors capable of
expressing SALPR or Relaxin-3 protein or peptides derived
therefrom. The host serum or plasma is collected following an
appropriate time interval to provide a composition comprising
antibodies reactive with the virus particle. The gamma globulin
fraction or the IgG antibodies can be obtained, for example, by use
of saturated ammonium sulfate or DEAE Sephadex, or other techniques
known to those skilled in the art. The antibodies are substantially
free of many of the adverse side effects which may be associated
with other drugs.
[0314] The antibody compositions can be made even more compatible
with the host system by minimizing potential adverse immune system
responses. This is accomplished by removing all or a portion of the
Fc portion of a foreign species antibody or using an antibody of
the same species as the host animal, for example, the use of
antibodies from human/human hybridomas. Humanized antibodies (i.e.,
nonimmunogenic in a human) may be produced, for example, by
replacing an immunogenic portion of a non-human antibody with a
corresponding, but nonimmunogenic portion (i.e., chimeric
antibodies). Such chimeric antibodies may contain the reactive or
antigen binding portion of an antibody from one species and the Fc
portion of an antibody (nonimmunogenic) from a different species.
Examples of chimeric antibodies, include but are not limited to,
non-human mammal-human chimeras, such as rodent-human chimeras,
murine-human and rat-human chimeras (Cabilly et al., Proc. Natl.
Acad. Sci. USA, 84:3439, 1987; Nishimura et al., Cancer Res.,
47:999, 1987; Wood et al., Nature, 314:446, 1985; Shaw et al., J.
Natl. Cancer Inst., 80:15553,1988). General reviews of "humanized"
chimeric antibodies are provided by Morrison S., Science, 229:1202,
1985 and by Oi et al., BioTechniques, 4:214, 1986.
[0315] Alternatively, anti-SALPR and/or anti-Relaxin-3 antibodies
can be induced by administering anti-idiotype antibodies as
immunogen. Conveniently, a purified anti-SALPR or anti-Relaxin-3
antibody preparation prepared as described above is used to induce
anti-idiotype antibody in a host animal. The composition is
administered to the host animal in a suitable diluent. Following
administration, usually repeated administration, the host produces
anti-idiotype antibody. To eliminate an immunogenic response to the
Fc region, antibodies produced by the same species as the host
animal can be used or the Fc region of the administered antibodies
can be removed. Following induction of anti-idiotype antibody in
the host animal, serum or plasma is removed to provide an antibody
composition. The composition can be purified as described above for
anti-SALPR or anti-Relaxin-3 antibodies, or by affinity
chromatography using anti-SALPR or anti-Relaxin-3 antibodies bound
to the affinity matrix. The anti-idiotype antibodies produced are
similar in conformation to the authentic SALPR or Relaxin-3 antigen
and may be used to prepare vaccine rather than using a SALPR or a
Relaxin-3 protein.
[0316] To induce anti-SALPR or anti-Relaxin-3 antibodies in an
animal, the method of administering the SALPR or Relaxin-3 antigen
can be the same as used in the case of vaccination, for example,
intramuscularly, intraperitoneally, subcutaneously or the like in
an effective concentration in a physiologically suitable diluent
with or without adjuvant. One or more booster injections may be
desirable.
[0317] For both in vivo use of antibodies to SALPR or Relaxin-3
proteins and anti-idiotype antibodies and for diagnostic use, it
may be preferable to use monoclonal antibodies. Monoclonal
anti-SALPR or anti-Relaxin-3 antibodies, or anti-idiotype
antibodies can be produced by methods known to those skilled in the
art. (Goding, J. W. 1983. Monoclonal Antibodies: Principles and
Practice, Pladermic Press, Inc., New York, N.Y., pp. 56-97). To
produce a human-human hybridoma, a human lymphocyte donor is
selected. A donor known to have the SALPR or Relaxin-3 antigen may
serve as a suitable lymphocyte donor. Lymphocytes can be isolated
from a peripheral blood sample or spleen cells may be used if the
donor is subject to splenectomy. Epstein-Barr virus (EBV) can be
used to immortalize human lymphocytes or a human fusion partner can
be used to produce human-human hybridomas. Primary in vitro
immunization with peptides also can be used in the generation of
human monoclonal antibodies.
[0318] I. Pharmaceutical Applications of Compounds:
[0319] The identified compounds that inhibit the expression,
synthesis, and/or activity of the target gene, for example, SALPR
and/or Relaxin-3 can be administered to a patient at
therapeutically effective doses to prevent, treat, or control a
tumor or cancer. A therapeutically effective dose refers to an
amount of the compound that is sufficient to result in a measurable
reduction or elimination of cancer or its symptoms.
[0320] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, for example, for determining the LD.sub.50
(the dose lethal to 50% of the population) and the ED.sub.50 (the
dose therapeutically effective in 50% of the population). The dose
ratio between toxic and therapeutic effects is the therapeutic
index and can be expressed as the ratio, LD.sub.50/ED.sub.50.
Compounds that exhibit large therapeutic indices are preferred.
While compounds that exhibit toxic side effects can be used, care
should be taken to design a delivery system that targets such
compounds to the site of affected tissue to minimize potential
damage to normal cells and, thereby, reduce side effects.
[0321] The data obtained from the cell culture assays and animal
studies can be used to formulate a dosage range for use in humans.
The dosage of such compounds lies preferably within a range of
circulating concentrations that include the ED.sub.50 with little
or no toxicity. The dosage can vary within this range depending
upon the dosage form employed and the route of administration. For
any compound used in the method of the invention, the
therapeutically effective dose can be estimated initially from cell
culture assays. A dose can be formulated in animal models to
achieve a circulating plasma concentration range that includes the
IC.sub.50 (the concentration of the test compound that achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels in plasma can be measured, for example, by
high performance liquid chromatography (HPLC).
[0322] Pharmaceutical compositions for use in the present invention
can be formulated by standard techniques using one or more
physiologically acceptable carriers or excipients. The compounds
and their physiologically acceptable salts and solvates can be
formulated and administered, for example, orally, intraorally,
rectally, parenterally, epicutaneously, topically, transdermally,
subcutaneously, intramuscularly, intranasally, sublingually,
intradurally, intraocularly, intrarespiratorally, intravenously,
intraperitoneally, intrathecal, mucosally, by oral inhalation,
nasal inhalation, or rectal administration, for example.
[0323] For oral administration, the pharmaceutical compositions can
take the form of tablets or capsules prepared by conventional means
with pharmaceutically acceptable excipients, for example, binding
agents, for example, pregelatinised maize starch,
polyvinylpyrrolidone, or hydroxypropyl methylcellulose; fillers,
for example, lactose, microcrystalline cellulose, or calcium
hydrogen phosphate; lubricants, for example, magnesium stearate,
talc, or silica; disintegrants, for example, potato starch or
sodium starch glycolate; or wetting agents, for example, sodium
lauryl sulphate. The tablets can be coated by methods well known in
the art. Liquid preparations for oral administration can take the
form of solutions, syrups, or suspensions, or they can be presented
as a dry product for constitution with water or other suitable
vehicle before use. Such liquid preparations can be prepared by
conventional means with pharmaceutically acceptable additives, for
example, suspending agents, for example, sorbitol syrup, cellulose
derivatives, or hydrogenated edible fats; emulsifying agents, for
example, lecithin or acacia; non-aqueous vehicles, for example,
almond oil, oily esters, ethyl alcohol, or fractionated vegetable
oils; and preservatives, for example, methyl or
propyl-p-hydroxybenzoates or sorbic acid. The preparations also can
contain buffer salts, flavoring, coloring, and/or sweetening agents
as appropriate. Preparations for oral administration can be
suitably formulated to give controlled release of the active
compound.
[0324] For administration by inhalation, the compounds are
conveniently delivered in the form of an aerosol spray presentation
from pressurized packs or a nebulizer, with the use of a suitable
propellant, for example, dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethan- e, carbon
dioxide, or other suitable gas. In the case of a pressurized
aerosol, the dosage unit can be determined by providing a valve to
deliver a metered amount. Capsules and cartridges of, for example,
gelatin for use in an inhaler or insufflator can be formulated
containing a powder mix of the compound and a suitable powder base,
for example, lactose or starch.
[0325] The compounds can be formulated for parenteral
administration by injection, for example, by bolus injection or
continuous infusion. Formulations for injection can be presented in
unit dosage form, for example, in ampoules or in multi-dose
containers, with an added preservative. The compositions can take
such forms as suspensions, solutions, or emulsions in oily or
aqueous vehicles, and can contain formulatory agents, for example,
suspending, stabilizing, and/or dispersing agents. Alternatively,
the active ingredient can be in powder form for constitution with a
suitable vehicle, for example, sterile pyrogen-free water, before
use. The compounds also can be formulated in rectal compositions,
for example, suppositories or retention enemas, for example,
containing conventional suppository bases, for example, cocoa
butter or other glycerides.
[0326] Furthermore, the compounds also can be formulated as a depot
preparation. Such long acting formulations can be administered by
implantation (for example, subcutaneously or intramuscularly) or by
intramuscular injection. Thus, for example, the compounds can be
formulated with suitable polymeric or hydrophobic materials (for
example as an emulsion in an acceptable oil) or ion exchange
resins, or as sparingly soluble derivatives, for example, as a
sparingly soluble salt.
[0327] The compositions can, if desired, be presented in a pack or
dispenser device which can contain one or more unit dosage forms
containing the active ingredient. The pack can for example comprise
metal or plastic foil, for example, a blister pack. The pack or
dispenser device can be accompanied by instructions for
administration.
[0328] J. Administration of siRNA/shRNA/miRNA:
[0329] The invention includes methods of administering siRNA,
shRNA, and miRNA, to a patient in need thereof, wherein the siRNA,
shRNA, or miRNA molecule is delivered in the form of a naked
oligonucleotide or via an expression vector as described
herein.
[0330] The present invention provides methods of blocking the in
vivo expression of SALPR or Relaxin-3 gene by administering a naked
DNA or a vector containing siRNA, shRNA, or miRNA as set forth
herein (see, for example, Examples VIII to XII), which interacts
with the target gene and causes post-transcriptional silencing of
specific genes in cells, for example, mammalian cells (including
human cells) and in the body, for example, mammalian bodies
(including humans).
[0331] The invention also provides methods for the treatment of
cells ex vivo by administering a naked DNA or a vector according to
the invention.
[0332] In its in vivo or ex vivo therapeutic applications, it is
appropriate to administer siRNA, shRNA, or miRNAs using a viral or
retroviral vector, which enters the cell by transfection or
infection. In particular, as a therapeutic product according to the
invention, a vector can be a defective viral vector, such as an
adenovirus, or a defective retroviral vector, such as a murine
retrovirus.
[0333] The vector used to convey the gene construct according to
the invention to its target can be a retroviral vector, which will
transport the recombinant construct by a borrower capsid, and
insert the genetic material into the DNA of the host cell.
[0334] Techniques that use vectors, in particular viral vectors
(retroviruses, adenoviruses, adeno-associated viruses), to
transport genetic material to target cells can be used to introduce
genetic modifications into various somatic tissues, for example,
lung, colon, ovary, or pancreas cells.
[0335] The use of retroviral vectors to transport genetic material
necessitates, on the one hand, carrying out the genetic
construction of the recombinant retrovirus, and on the other hand
having a cell system available which provides for the function of
encapsidation of the genetic material to be transported:
[0336] i. In a first stage, genetic engineering techniques enable
the genome of a murine retrovirus, such as Moloney virus (murine
retrovirus belonging to the murine leukemia virus group (Reddy et
al., Science, 214:445-450 (1981)). The retroviral genome is cloned
into a plasmid vector, from which all the viral sequences coding
for the structural proteins (genes: Gag, Env) as well as the
sequence coding for the enzymatic activities (gene: Pol) are then
deleted. As a result, only the necessary sequences "in cis" for
replication, transcription and integration are retained (sequences
corresponding to the two LTR regions, encapsidation signal and
primer binding signal). The deleted genetic sequences may be
replaced by non-viral genes such as the gene for resistance to
neomycin (selection antibiotic for eukaryotic cells) and by the
gene to be transported by the retroviral vector, for example, SALPR
or Relaxin-3 siRNA as set forth herein.
[0337] ii. In a second stage, the plasmid construct thereby
obtained is introduced by transfection into the encapsidation
cells. These cells constitutively express the Gag, Pol and Env
viral proteins, but the RNA coding for these proteins lacks the
signals needed for its encapsidation. As a result, the RNA cannot
be encapsidated to enable viral particles to be formed. Only the
recombinant RNA emanating from the transfected retroviral
construction is equipped with the encapsidation signal and is
encapsidated. The retroviral particles produced by this system
contain all the elements needed for the infection of the target
cells (such as CD34+ cells) and for the permanent integration of
the gene of interest into these cells, for example, SALPR or
Relaxin-3 siRNA as set forth herein. The absence of the Gag, Pol
and Env genes prevents the system from continuing to propagate.
[0338] DNA viruses such as adenoviruses also can be suited to this
approach although, in this case, maintenance of the DNA in the
episomal state in the form of an autonomous replicon is the most
likely situation.
[0339] Adenoviruses possess some advantageous properties. In
particular, they have a fairly broad host range, are capable of
infecting quiescent cells and do not integrate into the genome of
the infected cell. For these reasons, adenoviruses have already
been used for the transfer of genes in vivo. To this end, various
vectors derived from adenoviruses have been prepared, incorporating
different genes (beta-gal, OTC, alpha-1At, cytokines, etc.). To
limit the risks of multiplication and the formation of infectious
particles in vivo, the adenoviruses used are generally modified so
as to render them incapable of replication in the infected cell.
Thus, the adenoviruses used generally have the E1 (E1a and/or E1b)
and possibly E3 regions deleted.
[0340] The defective recombinant adenoviruses according to the
invention may be prepared by any technique known to persons skilled
in the art (Levrero et al., Gene, 101:195 (1991), EP 185 573;
Graham, EMBO J. 3:2917 (1984)). In particular, they may be prepared
by homologous recombination between an adenovirus and a plasmid in
a suitable cell line.
[0341] According to the present invention, an exogenous DNA
sequence, for example, SALPR or Relaxin-3 siRNA as set forth
herein, is inserted into the genome of the defective recombinant
adenovirus.
[0342] Pharmaceutical compositions comprising one or more viral
vectors, such as defective recombinants as described above, may be
formulated for the purpose of topical, oral, parenteral,
intranasal, intravenous, intramuscular, subcutaneous, intraocular,
and the like, administration. Preferably, these compositions
contain vehicles which are pharmaceutically acceptable for an
administrable formulation. These can be, in particular, isotonic,
sterile saline solutions (of monosodium or disodium phosphate,
sodium, potassium, calcium or magnesium chloride, and the like, or
mixtures of such salts), or dry, in particular lyophilized,
compositions which, on addition, as appropriate, of sterilized
water or of physiological saline, enable particular injectable
solutions to be made up.
[0343] The doses of defective recombinant virus used for the
injection may be adapted in accordance with various parameters, and
in particular in accordance with the mode of administration used,
the pathology in question, the gene to be expressed or the desired
duration of treatment. Generally speaking, the recombinant
adenoviruses according to the invention may be formulated and
administered in the form of doses of between 10.sup.4 and 10.sup.4
pfu/ml, and preferably 10.sup.6 to 10.sup.10 pfu/ml. The term pfu
("plaque forming unit") corresponds to the infectious power of a
solution of virus, and is determined by infection of a suitable
cell culture and measurement, generally after 48 hours, of the
number of plaques of infected cells. The techniques of
determination of the pfu titer of a viral solution are well
documented in the literature.
[0344] The use of genetically modified viruses as a shuttle system
for transporting the modified genetic material not only permits the
genetic material to enter the recipient cell by the expedient of
using a borrower viral capsid, but also allows a large number of
cells to be treated simultaneously and over a short period of time,
which permits therapeutic treatment applied to the whole body.
[0345] The invention is further described by the following
examples, which do not limit the invention in any manner.
EXAMPLES
Example I
Amplification of the SALPR Gene in Human Cancers
[0346] DNA microarray-based comparative genomic hybridization (CGH)
was used to survey the genome for gene amplification, and it was
determined that the SALPR gene is frequently amplified in tumor
tissue and cell lines.
[0347] Genomic DNAs were isolated from lung, colon, ovarian, and
pancreatic tumor samples. DNAs were analyzed, along with (i) a
SALPR TaqMan probe representing the target and (ii) a reference
probe representing a normal non-amplified, single copy region in
the genome, with a TaqMan 7900 Sequence Detector (Applied
Biosystems) following the manufacturer's protocol.
[0348] SALPR gene was found to be amplified in primary lung, colon,
ovarian, and pancreatic tumors samples. SALPR was found amplified
in 16% ({fraction (12/75)}) of lung tumors, 40% ({fraction
(12/30)}) of colon tumors, 5% ({fraction (3/64)}) of ovarian
tumors, and over 5% ({fraction (1/18)}) of pancreatic tumors tested
(see Table 1).
[0349] Only samples with the SALPR gene copy number greater than or
equal to 3.0-fold are deemed to have been amplified because of
instrumental detection limit. However, an increase in SALPR gene
copy number less than 3.0-fold can still be considered as an
amplification of the gene, if detected.
Example II
Overexpression of the SALPR in Tumors
[0350] Reverse transcriptase (RT)-directed quantitative PCR was
performed using the TaqMan 7900 Sequence Detector (Applied
Biosystems) to determine the SALPR mRNA level in each sample. Human
.beta.-actin mRNA was used as control.
[0351] Total RNA was isolated from tumor samples using Trizol
Reagent (Invitrogen) and treated with DNAase (Ambion) to eliminate
genomic DNA. The reverse transcriptase reaction (at 48.degree. C.
for 30 minutes, for example) was coupled with quantitative PCR
measurement of cDNA copy number in a one-tube format according to
the manufacturer (Perkin Elmer/Applied Biosystems). The nucleotide
sequences of SALPR were used to design and make a suitable TaqMan
probe set (see GenBank RECORD NM.sub.--016568) for SALPR. SALPR
expression levels in the samples were normalized using human
.beta.-actin and overexpression fold was calculated by comparing
SALPR expression in tumor versus normal samples.
[0352] The RT-TaqMan showed that SALPR gene is overexpressed in
primary lung, colon, ovarian, and pancreatic tumors. More
specifically, SALPR was found to be overexpressed in over 6%
({fraction (2/32)}) of lung tumors, over 88% ({fraction (31/35)})
of colon tumors, 10% ({fraction (3/30)}) of ovarian tumors, and
over 31% ({fraction (5/16)}) of pancreatic tumors tested (see Table
1). Cancer-free normal tissues from the above-identified source
types were used as controls.
1TABLE 1 Amplification and overexpression of SALPR in primary lung,
colon, ovarian, and pancreatic tumors. SALPR Amplification* SALPR
Overexpression* Tumor Type Frequency Highest Fold Frequency Highest
Fold Lung Tumors 12/75 > 3X (16%) 5.5X 02/32 > 5X (6%) 247X
Colon Tumors 12/30 > 3X (40%) 7.6X 31/35 > 10X (88%)
>1000X Ovarian Tumors 03/64 > 3X (5%) 7.5X 03/30 > 5X
(10%) 7.2X Pancreatic 01/18 > 2.5X (5%) 2.6X 05/16 > 5X (3%)
137X Tumors *Amplification cutoff: 3.0X. *Overexpression cutoff: 5X
using .beta.-actin as reference.
Example III
Physical Map of the Amplicon Containing the SALPR Gene Locus
[0353] Cancer cell lines or primary tumors were examined for DNA
copy number of genes and markers near SALPR to map the boundaries
of the amplified regions.
[0354] DNA was purified from tumor cell lines or primary tumors.
The DNA copy number of each marker in each sample was directly
measured using PCR and a fluorescence-labeled probe. The number of
PCR cycles needed to cross a preset threshold, also known as Ct
value, in the sample tumor DNA preparations and a series of normal
human DNA preparations at various concentrations was determined for
both the target probe and a known single-copy DNA probe using a
TaqMan 7900 Sequence Detector (Applied Biosystems). The relative
abundance of target sequence to the single-copy probe in each
sample was then calculated by statistical analyses of the Ct values
of the unknown samples and the standard curve was generated from
the normal human DNA preparations at various concentrations.
[0355] To determine the DNA copy number for each of the genes,
corresponding probes to each marker were designed using
PrimerExpress 1.0 (Applied Biosystems) and synthesized by Operon
Technologies. Subsequently, the target probe (representing the
marker), a reference probe (representing a normal non-amplified,
single copy region in the genome), and tumor genomic DNA (10 ng)
were subjected to analysis by the TaqMan 7900 Sequence Detector
(Applied Biosystems) following the manufacturer's protocol. The
epicenter mapping around SALPR gene was performed using amplified
tumor and tumor cell line samples.
[0356] Human chromosome region 5p15.1-p14 was identified initially
by DNA microarray analysis of human lung tumor samples for DNA
amplification. SALPR was mapped to chromosome 5p15.1-p14 by FISH
method as described supra and found to be the only gene in this
region. FIG. 1 shows cDNA microarray analysis of eight human lung
tumor samples. The fluorescence ratios were plotted against their
physical presence on human chromosome 5p15.1-p14 based on Human
Genome Project Working Draft Sequences
(http://genome.ucsc.edu/goldenPath/hgTracks.html). It was
demonstrated that SALPR is the only gene within the amplified
region (see FIG. 1). A full-length SALPR gene was present at the
epicenter.
Example IV
Tumorigenicity of SALPR in Nude Mice
[0357] 3T3 cells were engineered to express SALPR (full length
untagged) or full length SALPR with an C-terminal Flag tag ("SALPR
C terminal FLAG") using retroviral transduction. As controls, the
parental 3T3 cell line was untrandsduced or transduced with pLPC
vector alone ("Vector").
[0358] Cells were grown in DMEM supplemented with 10% calf serum, 2
mM L-glutamine, non essential amino acids and sodium pyruvate at
37.degree. C., 5% CO.sub.2, 95% humidity. Cultures were detached
from culture plates using trypsin/EDTA in one tube. Cells were
counted by hemocytometer, washed 1.times. with PBS (without
Ca.sup.2+ or Mg.sup.2+) and resuspended in PBS to a final
concentration of 25.times.10.sup.6 cells/mL. 5.times.10.sup.6 cells
or 0.2 mL were injected subcutaneously per athymic nude mouse.
[0359] Tumor growth (Mean.+-.SEM) in athymic nude mice following
implantation of about 5 million 3T3 transfectants is shown in FIGS.
4-5. A total of 10 mice were used for each experimental/control
group and palpable/measurable tumors were recorded. The mice were
checked daily and when a palpable tumor was evident. Tumor volumes
were measured with a caliper in three perpendicular dimensions and
recorded as mm.sup.3. Results indicate that 10/10 nude mice
injected with 3T3 cells containing full length SALPR with no
C-terminal flag tag (full length untagged) produced significantly
larger tumors (over 1000 mm.sup.3) (see FIG. 4), compared to those
(5/5 or 6/6 nude mice) implanted with 3T3 parental cells (about 400
mm.sup.3), or "SALPR C terminal FLAG" (about 800 mm.sup.3) (see
FIG. 5).
Example V
Amplification of the Relaxin-3 Gene in Human Cancers
[0360] DNA microarray-based comparative genomic hybridization (CGH)
was used to survey the genome for gene amplification, and it was
determined that the Relaxin-3 gene is frequently amplified in tumor
tissues.
[0361] Genomic DNAs were isolated from lung tumor samples. DNAs
were analyzed, along with (i) a Relaxin-3 TaqMan probe representing
the target and (ii) a reference probe representing a normal
non-amplified, single copy region in the genome, with a TaqMan 7900
Sequence Detector (Applied Biosystems) following the manufacturer's
protocol.
[0362] Relaxin-3 gene was found to be amplified in primary lung
tumors samples. Relaxin-3 was found amplified in 21% ({fraction
(7/34)}) of lung tumors tested (see Table 2). Relaxin-3 is
amplified gene in lung cancer and occasionally co-amplified with
its receptor, SALPR.
[0363] Only samples with the Relaxin-3 gene copy number greater
than or equal to 3.0-fold are deemed to have been amplified because
of instrumental detection limit. However, an increase in Relaxin-3
gene copy number less than 3.0-fold can still be considered as an
amplification of the gene, if detected.
Example VI
Overexpression of the Relaxin-3 in Tumors
[0364] Reverse transcriptase (RT)-directed quantitative PCR was
performed using the TaqMan 7900 Sequence Detector (Applied
Biosystems) to determine the Relaxin-3 mRNA level in each sample.
Human .beta.-actin mRNA was used as control.
[0365] Total RNA was isolated from tumor samples using Trizol
Reagent (Invitrogen) and treated with DNAase (Ambion) to eliminate
genomic DNA. The reverse transcriptase reaction (at 48.degree. C.
for 30 minutes, for example) was coupled with quantitative PCR
measurement of cDNA copy number in a one-tube format according to
the manufacturer (Perkin Elmer/Applied Biosystems). The nucleotide
sequences of Relaxin-3 were used to design and make a suitable
TaqMan probe set (see GenBank RECORD NM.sub.--080864) for
Relaxin-3. Relaxin-3 expression levels in the samples were
normalized using human .beta.-actin and overexpression fold was
calculated by comparing Relaxin-3 expression in tumor versus normal
samples.
[0366] The RT-TaqMan showed that Relaxin-3 gene is overexpressed in
primary lung tumors. More specifically, Relaxin-3 was found to be
overexpressed in 15% ({fraction (5/34)}) of lung tumors tested (see
infra Table 2). Cancer-free normal tissues from the
above-identified source types were used as controls.
2TABLE 2 Amplification and overexpression of Relaxin-3 in primary
lung tumors. Relaxin-3 Amplification* Relaxin-3 Overexpression*
Tumor Type Frequency Frequency Lung Tumors 7/34 > 3X (21%) 5/34
> 5X (15%) *Amplification cutoff: 3.0X. *Overexpression cutoff:
5X using .beta.-actin as reference.
Example VII
Relaxin-3 Epicenter of the Genomic DNA Locus Containing SALPR
[0367] DNA copy number was determined using real time quantitative
PCR (QPCR) in four lung tumor samples (450A1, 102A1, 4159A1,
5885C1). Relaxin-3 gene (solid black bar) is contained in the
minimal commonly amplified region of approximately 400 kb in size,
implicating that relaxin-3 is targeted by DNA copy number increase
for this region (See FIG. 2).
[0368] Cluster analysis of DNA copy numbers of Relaxin-3, SALPR, G
protein-coupled receptor 7 (LGR7), and GPCR142 were carried out.
Results are displayed in the format of Eisen dendrogram (See FIG.
3). LGR7 and GPCR142 are two other receptors are known to have
affinity for relaxin-3. Relaxin-3 and SALPR are put next to each
other as being more closely related in terms of DNA copy number
increase in this panel of tumors. Results indicate increase in DNA
copy number, for example, tumors samples 263A1 and 4159A1 exhibit
amplifications of both Relaxin-3 and SALPR (See FIG. 3, gray
shades).
Example VIII
Small Interfering RNA (siRNA)
[0369] Sense and antisense siRNAs duplexes are made based upon
targeted region of a SALPR or a Relaxin-3 DNA sequences, disclosed
herein (see, for example, SEQ ID NO:1 (SALPR), SEQ ID NO:3
(Relaxin-3), or a fragment thereof), are typically less than 100
base pairs ("bps") in length and constituency and preferably are
about 30 bps or shorter, and are made by approaches known in the
art, including the use of complementary DNA strands or synthetic
approaches. SiRNA derivatives employing polynucleic acid
modification techniques, such as peptide nucleic acids, also can be
employed according to the invention. The siRNAs are capable of
causing interference and can cause post-transcriptional silencing
of specific genes in cells, for example, mammalian cells (including
human cells) and in the body, for example, mammalian bodies
(including humans). Exemplary siRNAs according to the invention
have up to 30 bps, 29 bps, 25 bps, 22 bps, 21 bps, 20 bps, 15 bps,
10 bps, 5 bps or any integer thereabout or therebetween.
[0370] A targeted region is selected from the DNA sequence (for
example, SEQ ID NO:1, SEQ ID NO:3, or a fragment thereof). Various
strategies are followed in selecting target regions and designing
siRNA oligos, for example, 5' or 3' UTRs and regions nearby the
start codon should be avoided, as these may be richer in regulatory
protein binding sites. Designed sequences preferably include
AA-(N27 or less nucleotides)-TT and with about 30% to 70%
G/C-content. If no suitable sequences are found, the fragment size
is extended to sequences AA(N29 nucleotides). The sequence of the
sense siRNA corresponds to, for example, (N27 nucleotides)-TT or
N29 nucleotides, respectively. In the latter case, the 3' end of
the sense siRNA is converted to TT. The rationale for this sequence
conversion is to generate a symmetric duplex with respect to the
sequence composition of the sense and antisense 3' overhangs. It is
believed that symmetric 3' overhangs help to ensure that the small
interfering ribonucleoprotein particles (siRNPs) are formed with
approximately equal ratios of sense and antisense target
RNA-cleaving siRNPs (Elbashir et al. Genes & Dev. 15:188-200,
2001).
Example IX
SALPR siRNA
[0371] Sense or antisense siRNAs are designed based upon targeted
regions of a DNA sequence, as disclosed herein (see, for example,
SEQ ID NO:1, GenBank Accession No. NM.sub.--016568), and include
fragments having up to 30 bps, 29 bps, 25 bps, 22 bps, 21 bps, 20
bps, 15 bps, 10 bps, 5 bps or any integer thereabout or
therebetween. For example, 29 bps siRNA include:
[0372] Targeted region (base position numbers 376-404, SEQ ID NO:5)
5'-GCAGCCACGATAGCCACCATGAATAAGGC-3', the corresponding sense siRNA
(SEQ ID NO:6) 5'-GCAGCCACGAUAGCCACCAUGAAUAAGGC-3', and the
antisense siRNA (SEQ ID NO:7)
5'-GCCUUAUUCAUGGUGGCUAUCGUGGCUGC-3';
[0373] Targeted region (base position numbers 379-407, SEQ ID NO:8)
5'-GCCACGATAGCCACCATGAATAAGGCAGC-3', the corresponding sense siRNA
(SEQ ID NO:9) 5'-GCCACGAUAGCCACCAUGAAUAAGGCAGC-3', and the
antisense siRNA (SEQ ID NO:10)
5'-GCUGCCUUAUUCAUGGUGGCUAUCGUGGC-3';
[0374] Targeted region (base position numbers 486-514, SEQ ID
NO:11) 5'-GCTGCAGCTTCCGGACTTGTGGTGGGAGC-3', the corresponding sense
siRNA (SEQ ID NO:12) 5'-GCUGCAGCUUCCGGACUUGUGGUGGGAGC-3', and the
antisense siRNA (SEQ ID NO:13)
5'-GCUCCCACCACAAGUCCGGAAGCUGCAGC-3';
[0375] Targeted region (base position numbers 492-520, SEQ ID
NO:14) 5'-GCTTCCGGACTTGTGGTGGGAGCTGGGGC-3', the corresponding sense
siRNA (SEQ ID NO:15) 5'-GCUUCCGGACUUGUGGUGGGAGCUGGGGC-3', and the
antisense siRNA (SEQ ID NO:16)
5'-GCCCCAGCUCCCACCACAAGUCCGGAAGC-3';
[0376] Targeted region (base position numbers 644-672, SEQ ID
NO:17) 5'-GGTTGGCGGGCAACCTGCTGGTTCTCTAC-3', the corresponding sense
siRNA (SEQ ID NO:18) 5'-GGUUGGCGGGCAACCUGCUGGUUCUCUAC-3', and the
antisense siRNA (SEQ ID NO:19)
5'-GUAGAGAACCAGCAGGUUGCCCGCCAACC-3';
[0377] Targeted region (base position numbers 645-673, SEQ ID
NO:20) 5'-GTTGGCGGGCAACCTGCTGGTTCTCTACC-3', the corresponding sense
siRNA (SEQ ID NO:21) 5'-GUUGGCGGGCAACCUGCUGGUUCUCUACC-3', and the
antisense siRNA (SEQ ID NO:22) 5'-GGUAGAGAACCAGCAGGUUGCCCGCCAAC-3';
and continuing in this progression to the end of SALPR sequence,
for example,
[0378] Targeted region (base position numbers 1732-1760, SEQ ID
NO:23) 5'-GGGCGCTACGACCTGCTGCCCAGCAGCTC-3', the corresponding sense
siRNA (SEQ ID NO:24) 5'-GGGCGCUACGACCUGCUGCCCAGCAGCUC-3', and the
antisense siRNA (SEQ ID NO:25)
5'-GAGCUGCUGGGCAGCAGGUCGUAGCGAAA-3;
[0379] Targeted region (base position numbers 1736-1764, SEQ ID
NO:26) 5'-GCTACGACCTGCTGCCCAGCAGCTCTGCC-3', the corresponding sense
siRNA (SEQ ID NO:27) 5'-GCUACGACCUGCUGCCCAGCAGCUCUGCC-3', and the
antisense siRNA (SEQ ID NO:28) 5'-GGCAGAGCUGCUGGGCAGCAGGUCGUAGC-3;
and so on as set forth herein.
[0380] A set of siRNAs/shRNAs are designed based on SALPR-coding
sequence (see, for example, SEQ ID NO:1, GenBank Accession No.
NM.sub.--016568; coding-region base positions: 361-1770).
Example X
A PCR-based Strategy for Cloning SALPR siRNA/shRNA Sequences
[0381] SALPR oligos can be designed based on a set criteria, for
example, 29 bps `sense` sequences (for example, a target region
starting base position number 376 of the SALPR sequence:
5'-GCAGCCACGATAGCCACCATGAATAAG- GC-3', SEQ ID NO:5) containing a
`C` at the 3' end are selected from the SALPR sequence. A
termination sequence (for example, AAAAAA, SEQ ID NO:29), the
corresponding antisense SALPR sequence (for example,
5'-GCCTTATTCATGGTGGCTATCGTGGCTGC-3', SEQ ID NO:30), a loop (for
example, CAAGCTTC, SEQ ID NO:31), and a reverse primer (for
example, U6 reverse primer, GGTGTTTCGTCCTTTCCACAA, SEQ ID NO:32)
are subsequently added to the 29 bps sense strands to construct PCR
primers (see for example, Paddison et al., Genes & Dev.
16:948-958, 2002). Of course, other sense and anti-sense sequences
can be selected from a target molecule to develop siRNAs for that
molecule.
[0382] Several steps are followed in generating hairpin primers.
First, a 29 nt "sense" sequence containing a "C" at the 3' end is
selected. Second, the actual hairpin is constructed in a 5'-3'
orientation with respect to the intended transcript. Third, a few
stem pairings are changed to G-U by altering the sense strand
sequence. G-U base pairing seems to be beneficial for stability of
short hairpins in bacteria and does not interfere with silencing.
Finally, the hairpin construct is converted to its "reverse
complement" and combined with 21 nt human U6 promoter. See below,
an example of the model structures drawn:
[0383] A model shRNA structure based on SEQ ID NO:5 is (SEQ ID
NO:33):
3 5'->3' Anti-sense strand -------.vertline. GAA
GCAGCCACGAUAGCCACCAUGAAUAAGGC G CGUCGGUGCUAUCGGUGGUACUUAUUCCG C
UU{circumflex over ( )} GUU 3'<-5' Sense strand
[0384] The linear form of the model (SEQ ID NO:34):
4 Anti-sense Loop Sense Termination
GCAGCCACGAUAGCCACCAUGAAUAAGGCGAAGCUUGGCCUUAU-
UCAUGGUGGCUAUCGUGGCUGCUUUUUU
[0385] Some base pairing are changed to G-U by altering sense
sequence. The final hairpin is converted to its reverse
complement.
[0386] Hairpin portion of the primer (about 72 nt) (SEQ ID
NO:35):
5
AAAAAAGCAGCCACGAUAGCCACCAUGAAUAAGGCCAAGCUUCGCCUUAUUCAUGGUGGCUAUCG-
UGGCUGC +
[0387] U6 promoter (reverse primer sequence): GGUGUUUCGUCCUUUCCACAA
(SEQ ID NO:36)
[0388] Thus, the final hairpin sequence (SEQ ID NO:37) is:
6 AAAAAAGCAGCCACGAUAGCCACCAUGAAUAAGGCCAAGCUUCGCCUUAU
UCAUGGUGGCUAUCGUGGCUGCGGUGUUUCGUCCUUUCCACAA
[0389] Model shRNA structures also can be developed based on a
different set of criteria (see for example, Brummelkamp et al.,
Science, 296(5567):550-5533, 2002). Thus, SALPR oligos, siRNA/shRNA
also can be designed based sense or anti-sense sequences and the
model structure.
[0390] PCR and Cloning: A pGEM1 plasmid (Promega) containing the
human U6 locus (G. Hannon, CSHL) is used as the template for the
PCR reaction. This vector contains about 500 bp of upstream U6
promoter sequence. Since an SP6 sequence flanks the upstream
portion of the U6 promoter, an SP6 oligo is used as the universal
primer in U6-hairpin PCR reactions. The PCR product is about 600 bp
in length. T-A and directional topoisomerase-mediated cloning kits
(Invitrogen, Inc. Catalog No. K2040-10, K2400-20) are used
according to the manufacturer's instruction.
[0391] To obtain stable siRNAs/shRNAs, some nucleotide bases are
modified, therefore, the designed oligo sequences may not match the
actual coding sequences.
[0392] Examples of oligos designed and the targeted base position
numbers of the 29 nt sense sequence of the SALPR-coding region
(see, for example, SEQ ID NO:1, GenBank Accession No.
NM.sub.--016568; coding-region base positions: 361-1770) are shown
below:
[0393] SEQ ID NO:38: Primer containing a target region (starting
base position number 376 of the SALPR sequence):
[0394]
AAAAAAGCAGCCACGAUAGCCACCAUGAAUAAGGCCAAGCUUCGCCUUAUUCAUGGUGGCUAUCGUG-
GCUGCGGUGUUUCGUCCUUUCCACAA-3', and
[0395] the targeted SALPR-coding region is (coding region base
position numbers 376-404, SEQ ID NO:5)
5'-GCAGCCACGATAGCCACCATGAATAAGGC-3';
[0396] SEQ ID NO:39: Primer containing a target region (starting
base position number 379 of the SALPR sequence):
[0397]
AAAAAAGCCACGAUAGCCACCAUGAAUAAGGCAGCCAAGCUUCCGGUGCUAUCGGUGGUACUUAUUC-
CGUCGGGUGUUUCGUCCUUUCCACAA-3', and
[0398] the targeted SALPR-coding region is (coding region base
position numbers 379-407, SEQ ID NO:8)
5'-GCCACGATAGCCACCATGAATAAGGCAGC-3';
[0399] SEQ ID NO:40: Primer containing a target region (starting
base position number 1732 of the SALPR sequence):
[0400]
AAAAAAGGGCGCUACGACCUGCUGCCCAGCAGCUCCAAGCUUCGAGCUGCUGGGCAGCAGGUCGUAG-
CGCCCGGUGUUUCGUCCUUUCCACAA-3', and
[0401] the targeted SALPR-coding region is (coding region base
position numbers 1732-1760, SEQ ID NO: 23)
5'-GGGCGCTACGACCTGCTGCCCAGCAGCTC-3'; and
[0402] SEQ ID NO:41: Primer containing a target region (starting
base position number 1736 of the SALPR sequence):
[0403]
AAAAAAGCUACGACCUGCUGCCCAGCAGCUCUGCCCAAGCUUCGGCAGAGCUGCUGGGCAGCAGGUC-
GUAGCGGUGUUUCGUCCUUUCCACAA-3', and
[0404] the targeted SALPR-coding region is (coding region base
position numbers 1736-1764, SEQ ID NO:26)
5'-GCTACGACCTGCTGCCCAGCAGCTCTGCC-3'.
Example XI
Relaxin-3 siRNA
[0405] Sense or antisense siRNAs are designed based upon targeted
regions of a DNA sequence, as disclosed herein (see, for example,
SEQ ID NO:3, GenBank Accession No. NM.sub.--080864), and include
fragments having up to 30 bps, 29 bps, 25 bps, 22 bps, 21 bps, 20
bps, 15 bps, 10 bps, 5 bps or any integer thereabout or
therebetween. For example, 29 bps siRNA include:
[0406] Targeted region (base position numbers 4-32, SEQ ID NO:42)
5'-GCCAGGTACATGCTGCTGCTGCTCCTGGC-3', the corresponding sense siRNA
(SEQ ID NO:43) 5'-GCCAGGUACAUGCUGCUGCUGCUCCUGGC-3', and the
antisense siRNA (SEQ ID NO:44)
5'-GCCAGGAGCAGCAGCAGCAUGUACCUGGC-3';
[0407] Targeted region (base position numbers 77-105, SEQ ID NO:45)
5'-GGGCAGCGCCTTACGGGGTCAGGCTTTGC-3', the corresponding sense siRNA
(SEQ ID NO:46) 5'-GGGCAGCGCCUUACGGGGUCAGGCUUUGC-3', and the
antisense siRNA (SEQ ID NO:47)
5'-GCAAAGCCUGACCCCGUAAGGCGCUGCCC-3';
[0408] Targeted region (base position numbers 122-150, SEQ ID
NO:48) 5'-GAGCAGTCATCTTCACCTGCGGGGGCTCC-3', the corresponding sense
siRNA (SEQ ID NO:49) 5'-GAGCAGUCAUCUUCACCUGCGGGGGCUCC-3', and the
antisense siRNA (SEQ ID NO:50) 5'-GGAGCCCCCGCAGGUGAAGAUGACUGCUC-3';
and continuing in this progression to the end of Relaxin-3
coding-sequence, for example,
[0409] Targeted region (base position numbers 398-426, SEQ ID
NO:51) 5'-GTAGCAAAAGTGAAATCAGTAGCCTTTGC-3', the corresponding sense
siRNA (SEQ ID NO:52) 5'-GUAGCAAAAGUGAAAUCAGUAGCCUUUGC-3', and the
antisense siRNA (SEQ ID NO:53) 5'-CGAAAGGCUACUGAUUUCACUUUUGCUAC-3;
and so on as set forth herein.
[0410] A set of siRNAs/shRNAs are designed based on Relaxin-3
coding-sequence (see, for example, SEQ ID NO:3, GenBank Accession
No. NM.sub.--080864).
Example XII
A PCR-based Strategy for Cloning Relaxin-3 siRNA/shRNA
Sequences
[0411] Relaxin-3 oligos can be designed based on a set criteria,
for example, 29 bps `sense` sequences (for example, a target region
starting base position number 4 of the Relaxin-3 sequence:
5'-GCCAGGTACATGCTGCTGCT- GCTCCTGGC-3', SEQ ID NO:42) containing a
`C` at the 3' end are selected from the Relaxin-3 sequence. A
termination sequence (for example, AAAAAA, SEQ ID NO:29), the
corresponding antisense Relaxin-3 sequence (for example,
5'-GCCAGGAGCAGCAGCAGCATGTACCTGGC-3', SEQ ID NO:54), a loop (for
example, CAAGCTTC, SEQ ID NO:31), and a reverse primer (for
example, U6 reverse primer, GGTGTTTCGTCCTTTCCACAA, SEQ ID NO:32)
are subsequently added to the 29 bps sense strands to construct PCR
primers (see for example, Paddison et al., Genes & Dev.
16:948-958, 2002). Of course, other sense and anti-sense sequences
can be selected from a target molecule to develop siRNAs for that
molecule.
[0412] Several steps are followed in generating hairpin primers.
First, a 29 nt "sense" sequence containing a "C" at the 3' end is
selected. Second, the actual hairpin is constructed in a 5'-3'
orientation with respect to the intended transcript. Third, a few
stem pairings are changed to G-U by altering the sense strand
sequence. G-U base pairing seems to be beneficial for stability of
short hairpins in bacteria and does not interfere with silencing.
Finally, the hairpin construct is converted to its "reverse
complement" and combined with 21 nt human U6 promoter. See below,
an example of the model structures drawn:
[0413] A model shRNA structure based on SEQ ID NO:42 is (SEQ ID
NO:55):
7 5'->3' Anti-sense strand -------.vertline. GAA
GCCAGGAGCAGCAGCAGCAUGUACCUGGC G CGGUCCUCGUCGUCGUCGUACAUGGACCG C
UU{circumflex over ( )} GUU 3'<-5' Sense strand
[0414] The linear form of the model (SEQ ID NO:56):
8 Anti-sense Loop Sense Termination
GCCAGGAGCAGCAGCAGCAUGUACCUGGCGAAGCUUGGCCAGGU-
ACAUGCUGCUGCUGCUCCUGGCUUUUUU
[0415] Some base pairing are changed to G-U by altering sense
sequence. The final hairpin is converted to its reverse
complement.
[0416] Hairpin portion of the primer (about 72 nt) (SEQ ID
NO:57):
9
AAAAAACGGUCCUCGUCGUCGUCGUACAUGGACCGCAAGCUUCGCCAGGAGCAGCAGCAGCAUGU-
ACCUGGC +
[0417] U6 promoter (reverse primer sequence): GGUGUUUCGUCCUUUCCACAA
(SEQ ID NO:36) Thus, the final hairpin sequence (SEQ ID NO:58)
is:
10 AAAAAACGGUCCUCGUCGUCGUCGUACAUGGACCGCAAGCUUCGCCAGGA
GCAGCAGCAGCAUGUACCUGGCGGUGUUUCGUCCUUUCCACAA
[0418] Model shRNA structures also can be developed based on a
different set of criteria (see for example, Brummelkamp et al.,
Science, 296(5567):550-5533, 2002). Thus, Relaxin-3 oligos,
siRNA/shRNA also can be designed based sense or anti-sense
sequences and the model structure.
[0419] PCR and Cloning: A pGEM1 plasmid (Promega) containing the
human U6 locus (G. Hannon, CSHL) is used as the template for the
PCR reaction. This vector contains about 500 bp of upstream U6
promoter sequence. Since an SP6 sequence flanks the upstream
portion of the U6 promoter, an SP6 oligo is used as the universal
primer in U6-hairpin PCR reactions. The PCR product is about 600 bp
in length. T-A and directional topoisomerase-mediated cloning kits
(Invitrogen, Inc. Catalog No. K2040-10, K2400-20) are used
according to the manufacturer's instruction.
[0420] To obtain stable siRNAs/shRNAs, some nucleotide bases are
modified, therefore, the designed oligo sequences may not match the
actual coding sequences.
[0421] Examples of oligos designed and the targeted base position
numbers of the 29 nt sense sequence of the Relaxin-3-coding region
(see, for example, SEQ ID NO:3, GenBank Accession No.
NM.sub.--080864) are shown below:
[0422] SEQ ID NO:59: Primer containing a target region (starting
base position number 4 of the Relaxin-3 sequence):
[0423]
AAAAAAGCCAGGUACAUGCUGCUGCUGCUCCUGGCCAAGCUUCGCCAGGAGCAGCAGCAGCAUGUAC-
CUGGCGGUGUUUCGUCCUUUCCACAA-3', and
[0424] the targeted Relaxin-3-coding region is (coding region base
position numbers 4-32, SEQ ID NO:42)
5'-GCCAGGTACATGCTGCTGCTGCTCCTGGC-3';
[0425] SEQ ID NO:60: Primer containing a target region (starting
base position number 77 of the Relaxin-3 sequence):
[0426]
AAAAAAGGGCAGCGCCUUACGGGGUCAGGCUUUGCCAAGCUUCGCAAAGCCUGACCCCGUAAGGCGC-
UGCCCGGUGUUUCGUCCUUUCCACAA-3', and
[0427] the targeted Relaxin-3-coding region is (coding region base
position numbers 77-105, SEQ ID NO:45)
5'-GGGCAGCGCCTTACGGGGTCAGGCTTTGC-3- ';
[0428] SEQ ID NO:61: Primer containing a target region (starting
base position number 122 of the Relaxin-3 sequence):
[0429]
AAAAAGAGCAGUCAUCUUCACCUGCGGGGGCUCCCAAGCUUCGGAGCCCCCGCAGGUGAAGAUGACU-
GCUCGGUGUUUCGUCCUUUCCACAA-3', and
[0430] the targeted Relaxin-3-coding region is (coding region base
position numbers 122-150, SEQ ID NO: 48)
5'-GAGCAGTCATCTTCACCTGCGGGGGCTCC- -3'; and
[0431] SEQ ID NO:62: Primer containing a target region (starting
base position number 398 of the Relaxin-3 sequence):
[0432]
AAAAAAGUAGCAAAAGUGAAAUCAGUAGCCUUUGCCAAGCUUCCGAAAGGCUACUGAUUUCACUUUU-
GCUACGGUGUUUCGUCCUUUCCACAA-3', and
[0433] the targeted Relaxin-3-coding region is (coding region base
position numbers 398-426, SEQ ID NO:51)
5'-GTAGCAAAAGTGAAATCAGTAGCCTTTGC-- 3'.
[0434] It is to be understood that the description, specific
examples and data, while indicating exemplary embodiments, are
given by way of illustration and are not intended to limit the
present invention. Various changes and modifications within the
present invention will become apparent to the skilled artisan from
the discussion, disclosure and data contained herein, and thus are
considered part of the invention.
[0435] SEQ ID NO:1. Homo sapiens G-protein coupled receptor
(GPCR135); somatostatin- and angiotensin-like peptide receptor
(SALPR) sequence (1857 bp). The GenBank Accession No. for Homo
sapiens SALPR is NM.sub.--016568 (coding region base positions:
361-1770).
11 1 GATTTGGGGA GTTATGCGCC AGTGCCCCAG TGACCGCGGG ACACGGAGAG
GGGAAGTCTG 61 CGTTGTACAT AAGGACCTAG GGACTCCGAG CTTGGCCTGA
GAACCCTTGG ACGCCGAGTG 121 CTTGCCTTAC GGGCTGCACT CCTCAACTCT
GCTCCAAAGC AGCCGCTGAG CTCAACTCCT 181 GCGTCCAGGG CGTTCGCTGC
GCGCCAGGAC GCGCTTAGTA CCCAGTTCCT GGGCTCTCTC 241 TTCAGTAGCT
GCTTTGAAAG CTCCCACGCA CGTCCCGCAG GCTAGCCTGG CAACAAAACT 301
GGGGTAAACC GTGTTATCTT AGGTCTTGTC CCCCAGAACA TGACCTAGAG GTACCTGCGC
361 ATGCAGATGG CCGATGCAGC CACGATAGCC ACCATGAATA AGGCAGCAGG
CGGGGACAAG 421 CTAGCAGAAC TCTTCAGTCT GGTCCCGGAC CTTCTGGAGG
CGGCCAACAC GAGTGGTAAC 481 GCGTCGCTGC AGCTTCCGGA CTTGTGGTGG
GAGCTGGGGC TGGAGTTGCC GGACGGCGCG 541 CCGCCAGGAC ATCCCCCGGG
CAGCGGCGGG GCAGAGAGCG CGGACACAGA GGCCCGGGTG 601 CGGATTCTCA
TCAGCGTGGT GTACTGGGTG GTGTGCGCCC TGGGGTTGGC GGGCAACCTG 661
CTGGTTCTCT ACCTGATGAA GAGCATGCAG GGCTGGCGCA AGTCCTCTAT CAACCTCTTC
721 GTCACCAACC TGGCGCTGAC GGACTTTCAG TTTGTGCTCA CCCTGCCCTT
CTGGGCGGTG 781 GAGAACGCTC TTGACTTCAA ATGGCCCTTC GGCAAGGCCA
TGTGTAAGAT CGTGTCCATG 841 GTGACGTCCA TGAACATGTA CGCCAGCGTG
TTCTTCCTCA CTGCCATGAG TGTGACGCGC 901 TACCATTCGG TGGCCTCGGC
TCTGAAGAGC CACCGGACCC GAGGACACGG CCGGGGCGAC 961 TGCTGCGGCC
GGAGCCTGGG GGACAGCTGC TGCTTCTCGG CCAAGGCGCT GTGTGTGTGG 1021
ATCTGGGCTT TGGCCGCGCT GGCCTCGCTG CCCAGTGCCA TTTTCTCCAC CACGGTCAAG
1081 GTGATGGGCG AGGAGCTGTG CCTGGTGCGT TTCCCGGACA AGTTGCTGGG
CCGCGACAGG 1141 CAGTTCTGGC TGGGCCTCTA CCACTCGCAG AAGGTGCTGT
TGGGCTTCGT GCTGCCGCTG 1201 GGCATCATTA TCTTGTGCTA CCTGCTGCTG
GTGCGCTTCA TCGCCGACCG CCGCGCGGCG 1261 GGGACCAAAG GAGGGGCCGC
GGTAGCCGGA GGACGCCCGA CCGGAGCCAG CGCCCGGAGA 1321 CTGTCGAAGG
TCACCAAATC AGTGACCATC GTTGTCCTGT CCTTCTTCCT GTGTTGGCTG 1381
CCCAACCAGG CGCTCACCAC CTGGAGCATC CTCATCAAGT TCAACGCGGT GCCCTTCAGC
1441 CAGGAGTATT TCCTGTGCCA GGTATACGCG TTCCCTGTGA GCGTGTGCCT
AGCGCACTCC 1501 AACAGCTGCC TCAACCCCGT CCTCTACTGC CTCGTGCGCC
GCGAGTTCCG CAAGGCGCTC 1561 AAGAGCCTGC TGTGGCGCAT CGCGTCTCCT
TCGATCACCA GCATGCGCCC CTTCACCGCC 1621 ACTACCAAGC CGGAGCACGA
GGATCAGGGG CTGCAGGCCC CGGCGCCGCC CCACGCGGCC 1681 GCGGAGCCGG
ACCTGCTCTA CTACCCACCT GGCGTCGTGG TCTACAGCGG GGGGCGCTAC 1741
GACCTGCTGC CCAGCAGCTC TGCCTACTGA CGCAGGCCTC AGGCCCAGGG CGCGCCGTCG
1801 GGGCAAGGTG GCCTTCCCCG GGCGGTAAAG AGGTGAAAGG ATGAAGGAGG
GCTGGGG
[0436] SEQ ID NO:2. Human Somatostatin- and Angiotensin-Like
Peptide Receptor (SALPR) Polypeptide Sequence (469 amino acids).
The GenBank Protein ID. number is NP.sub.--057652.1.
12 1 MQMADAATIA TMNKAAGGDK LAELFSLVPD LLEAANTSGN ASLQLPDLWW
ELGLELPDGA 61 PPGHPPGSGG AESADTEARV RILISVVYWV VCALGLAGNL
LVLYLMKSMQ GWRKSSINLF 121 VTNLALTDFQ FVLTLPFWAV ENALDFKWPF
GKAMCKIVSM VTSMNMYASV FFLTANSVTR 181 YHSVASALKS HRTRGHGRGD
CCGRSLGDSC CFSAKALCVW IWALAALASL PSAIFSTTVK 241 VMGEELCLVR
FPDKLLGRDR QFWLGLYHSQ KVLLGFVLPL GIIILCYLLL VRFIADRRAA 301
GTKGGAAVAG GRPTGASARR LSKVTKSVTI VVLSFFLCWL PNQALTTWSI LIKFNAVPFS
361 QEYFLCQVYA FPVSVCLAHS NSCLNPVLYC LVRREFRKAL KSLLWRIASP
SITSMRPFTA 421 TTKPEHEDQG LQAPAPPHAA AEPDLLYYPP GVVVYSGGRY
DLLPSSSAY
[0437] SEQ ID NO:3. Homo sapiens Relaxin-3 (H3) coding sequence
(429 bps). The GenBank Accession No. for Homo sapiens Relaxin-3
(H3) is NM.sub.--080864.
13 1 ATGGCCAGGT ACATGCTGCT GCTGCTCCTG GCGGTATGGG TGCTGACCGG
GGAGCTGTGG 61 CCGGGAGCTG AGGCCCGGGC AGCGCCTTAC GGGGTCAGGC
TTTGCGGCCG AGAATTCATC 121 CGAGCAGTCA TCTTCACCTG CGGGGGCTCC
CGGTGGAGAC GATCAGACAT CCTGGCCCAC 181 GAGGCTATGG GAGATACCTT
CCCGGATGCA GATGCTGATG AAGACAGTCT GGCAGGCGAG 241 CTGGATGAGG
CCATGGGGTC CAGCGAGTGG CTGGCCCTGA CCAAGTCACC CCAGGCCTTT 301
TACAGGGGGC GACCCAGCTG GCAAGGAACC CCTGGGGTTC TTCGGGGCAG CCGAGATGTC
361 CTGGCTGGCC TTTCCAGCAG CTGCTGCAAG TGGGGGTGTA GCAAAAGTGA
AATCAGTAGC 421 CTTTGCTAG
[0438] SEQ ID NO:4. Human Relaxin-3 preproprotein; insulin-like 7
(INSL7) Polypeptide Sequence (142 amino acids). The GenBank Protein
ID. number is NP.sub.--543140.1.
14 1 MARYMLLLLL AVWVLTGELW PGAEARAAPY GVRLCGREFI PAVIFTCGGS
RWRRSDILAH 61 EANGDTFPDA DADEDSLAGE LDEAMGSSEW LALTKSPQAF
YRGRPSWQGT PGVLRGSRDV 121 LAGLSSSCCK WGCSKSEISS LC
[0439]
Sequence CWU 1
1
63 1 1857 DNA Homo sapiens 1 gatttgggga gttatgcgcc agtgccccag
tgaccgcggg acacggagag gggaagtctg 60 cgttgtacat aaggacctag
ggactccgag cttggcctga gaacccttgg acgccgagtg 120 cttgccttac
gggctgcact cctcaactct gctccaaagc agccgctgag ctcaactcct 180
gcgtccaggg cgttcgctgc gcgccaggac gcgcttagta cccagttcct gggctctctc
240 ttcagtagct gctttgaaag ctcccacgca cgtcccgcag gctagcctgg
caacaaaact 300 ggggtaaacc gtgttatctt aggtcttgtc ccccagaaca
tgacctagag gtacctgcgc 360 atgcagatgg ccgatgcagc cacgatagcc
accatgaata aggcagcagg cggggacaag 420 ctagcagaac tcttcagtct
ggtcccggac cttctggagg cggccaacac gagtggtaac 480 gcgtcgctgc
agcttccgga cttgtggtgg gagctggggc tggagttgcc ggacggcgcg 540
ccgccaggac atcccccggg cagcggcggg gcagagagcg cggacacaga ggcccgggtg
600 cggattctca tcagcgtggt gtactgggtg gtgtgcgccc tggggttggc
gggcaacctg 660 ctggttctct acctgatgaa gagcatgcag ggctggcgca
agtcctctat caacctcttc 720 gtcaccaacc tggcgctgac ggactttcag
tttgtgctca ccctgccctt ctgggcggtg 780 gagaacgctc ttgacttcaa
atggcccttc ggcaaggcca tgtgtaagat cgtgtccatg 840 gtgacgtcca
tgaacatgta cgccagcgtg ttcttcctca ctgccatgag tgtgacgcgc 900
taccattcgg tggcctcggc tctgaagagc caccggaccc gaggacacgg ccggggcgac
960 tgctgcggcc ggagcctggg ggacagctgc tgcttctcgg ccaaggcgct
gtgtgtgtgg 1020 atctgggctt tggccgcgct ggcctcgctg cccagtgcca
ttttctccac cacggtcaag 1080 gtgatgggcg aggagctgtg cctggtgcgt
ttcccggaca agttgctggg ccgcgacagg 1140 cagttctggc tgggcctcta
ccactcgcag aaggtgctgt tgggcttcgt gctgccgctg 1200 ggcatcatta
tcttgtgcta cctgctgctg gtgcgcttca tcgccgaccg ccgcgcggcg 1260
gggaccaaag gaggggccgc ggtagccgga ggacgcccga ccggagccag cgcccggaga
1320 ctgtcgaagg tcaccaaatc agtgaccatc gttgtcctgt ccttcttcct
gtgttggctg 1380 cccaaccagg cgctcaccac ctggagcatc ctcatcaagt
tcaacgcggt gcccttcagc 1440 caggagtatt tcctgtgcca ggtatacgcg
ttccctgtga gcgtgtgcct agcgcactcc 1500 aacagctgcc tcaaccccgt
cctctactgc ctcgtgcgcc gcgagttccg caaggcgctc 1560 aagagcctgc
tgtggcgcat cgcgtctcct tcgatcacca gcatgcgccc cttcaccgcc 1620
actaccaagc cggagcacga ggatcagggg ctgcaggccc cggcgccgcc ccacgcggcc
1680 gcggagccgg acctgctcta ctacccacct ggcgtcgtgg tctacagcgg
ggggcgctac 1740 gacctgctgc ccagcagctc tgcctactga cgcaggcctc
aggcccaggg cgcgccgtcg 1800 gggcaaggtg gccttccccg ggcggtaaag
aggtgaaagg atgaaggagg gctgggg 1857 2 469 PRT Homo sapiens 2 Met Gln
Met Ala Asp Ala Ala Thr Ile Ala Thr Met Asn Lys Ala Ala 1 5 10 15
Gly Gly Asp Lys Leu Ala Glu Leu Phe Ser Leu Val Pro Asp Leu Leu 20
25 30 Glu Ala Ala Asn Thr Ser Gly Asn Ala Ser Leu Gln Leu Pro Asp
Leu 35 40 45 Trp Trp Glu Leu Gly Leu Glu Leu Pro Asp Gly Ala Pro
Pro Gly His 50 55 60 Pro Pro Gly Ser Gly Gly Ala Glu Ser Ala Asp
Thr Glu Ala Arg Val 65 70 75 80 Arg Ile Leu Ile Ser Val Val Tyr Trp
Val Val Cys Ala Leu Gly Leu 85 90 95 Ala Gly Asn Leu Leu Val Leu
Tyr Leu Met Lys Ser Met Gln Gly Trp 100 105 110 Arg Lys Ser Ser Ile
Asn Leu Phe Val Thr Asn Leu Ala Leu Thr Asp 115 120 125 Phe Gln Phe
Val Leu Thr Leu Pro Phe Trp Ala Val Glu Asn Ala Leu 130 135 140 Asp
Phe Lys Trp Pro Phe Gly Lys Ala Met Cys Lys Ile Val Ser Met 145 150
155 160 Val Thr Ser Met Asn Met Tyr Ala Ser Val Phe Phe Leu Thr Ala
Met 165 170 175 Ser Val Thr Arg Tyr His Ser Val Ala Ser Ala Leu Lys
Ser His Arg 180 185 190 Thr Arg Gly His Gly Arg Gly Asp Cys Cys Gly
Arg Ser Leu Gly Asp 195 200 205 Ser Cys Cys Phe Ser Ala Lys Ala Leu
Cys Val Trp Ile Trp Ala Leu 210 215 220 Ala Ala Leu Ala Ser Leu Pro
Ser Ala Ile Phe Ser Thr Thr Val Lys 225 230 235 240 Val Met Gly Glu
Glu Leu Cys Leu Val Arg Phe Pro Asp Lys Leu Leu 245 250 255 Gly Arg
Asp Arg Gln Phe Trp Leu Gly Leu Tyr His Ser Gln Lys Val 260 265 270
Leu Leu Gly Phe Val Leu Pro Leu Gly Ile Ile Ile Leu Cys Tyr Leu 275
280 285 Leu Leu Val Arg Phe Ile Ala Asp Arg Arg Ala Ala Gly Thr Lys
Gly 290 295 300 Gly Ala Ala Val Ala Gly Gly Arg Pro Thr Gly Ala Ser
Ala Arg Arg 305 310 315 320 Leu Ser Lys Val Thr Lys Ser Val Thr Ile
Val Val Leu Ser Phe Phe 325 330 335 Leu Cys Trp Leu Pro Asn Gln Ala
Leu Thr Thr Trp Ser Ile Leu Ile 340 345 350 Lys Phe Asn Ala Val Pro
Phe Ser Gln Glu Tyr Phe Leu Cys Gln Val 355 360 365 Tyr Ala Phe Pro
Val Ser Val Cys Leu Ala His Ser Asn Ser Cys Leu 370 375 380 Asn Pro
Val Leu Tyr Cys Leu Val Arg Arg Glu Phe Arg Lys Ala Leu 385 390 395
400 Lys Ser Leu Leu Trp Arg Ile Ala Ser Pro Ser Ile Thr Ser Met Arg
405 410 415 Pro Phe Thr Ala Thr Thr Lys Pro Glu His Glu Asp Gln Gly
Leu Gln 420 425 430 Ala Pro Ala Pro Pro His Ala Ala Ala Glu Pro Asp
Leu Leu Tyr Tyr 435 440 445 Pro Pro Gly Val Val Val Tyr Ser Gly Gly
Arg Tyr Asp Leu Leu Pro 450 455 460 Ser Ser Ser Ala Tyr 465 3 429
DNA Homo sapiens 3 atggccaggt acatgctgct gctgctcctg gcggtatggg
tgctgaccgg ggagctgtgg 60 ccgggagctg aggcccgggc agcgccttac
ggggtcaggc tttgcggccg agaattcatc 120 cgagcagtca tcttcacctg
cgggggctcc cggtggagac gatcagacat cctggcccac 180 gaggctatgg
gagatacctt cccggatgca gatgctgatg aagacagtct ggcaggcgag 240
ctggatgagg ccatggggtc cagcgagtgg ctggccctga ccaagtcacc ccaggccttt
300 tacagggggc gacccagctg gcaaggaacc cctggggttc ttcggggcag
ccgagatgtc 360 ctggctggcc tttccagcag ctgctgcaag tgggggtgta
gcaaaagtga aatcagtagc 420 ctttgctag 429 4 142 PRT Homo sapiens 4
Met Ala Arg Tyr Met Leu Leu Leu Leu Leu Ala Val Trp Val Leu Thr 1 5
10 15 Gly Glu Leu Trp Pro Gly Ala Glu Ala Arg Ala Ala Pro Tyr Gly
Val 20 25 30 Arg Leu Cys Gly Arg Glu Phe Ile Arg Ala Val Ile Phe
Thr Cys Gly 35 40 45 Gly Ser Arg Trp Arg Arg Ser Asp Ile Leu Ala
His Glu Ala Met Gly 50 55 60 Asp Thr Phe Pro Asp Ala Asp Ala Asp
Glu Asp Ser Leu Ala Gly Glu 65 70 75 80 Leu Asp Glu Ala Met Gly Ser
Ser Glu Trp Leu Ala Leu Thr Lys Ser 85 90 95 Pro Gln Ala Phe Tyr
Arg Gly Arg Pro Ser Trp Gln Gly Thr Pro Gly 100 105 110 Val Leu Arg
Gly Ser Arg Asp Val Leu Ala Gly Leu Ser Ser Ser Cys 115 120 125 Cys
Lys Trp Gly Cys Ser Lys Ser Glu Ile Ser Ser Leu Cys 130 135 140 5
29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 5 gcagccacga tagccaccat gaataaggc 29 6 29
RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 6 gcagccacga uagccaccau gaauaaggc 29 7 29
RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 7 gccuuauuca ugguggcuau cguggcugc 29 8 29
DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 8 gccacgatag ccaccatgaa taaggcagc 29 9 29
RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 9 gccacgauag ccaccaugaa uaaggcagc 29 10
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 10 gcugccuuau ucaugguggc uaucguggc 29 11
29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 11 gctgcagctt ccggacttgt ggtgggagc 29 12
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 12 gcugcagcuu ccggacuugu ggugggagc 29 13
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 13 gcucccacca caaguccgga agcugcagc 29 14
29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 14 gcttccggac ttgtggtggg agctggggc 29 15
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 15 gcuuccggac uugugguggg agcuggggc 29 16
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 16 gccccagcuc ccaccacaag uccggaagc 29 17
29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 17 ggttggcggg caacctgctg gttctctac 29 18
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 18 gguuggcggg caaccugcug guucucuac 29 19
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 19 guagagaacc agcagguugc ccgccaacc 29 20
29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 20 gttggcgggc aacctgctgg ttctctacc 29 21
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 21 guuggcgggc aaccugcugg uucucuacc 29 22
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 22 gguagagaac cagcagguug cccgccaac 29 23
29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 23 gggcgctacg acctgctgcc cagcagctc 29 24
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 24 gggcgcuacg accugcugcc cagcagcuc 29 25
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 25 gagcugcugg gcagcagguc guagcgaaa 29 26
29 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 26 gctacgacct gctgcccagc agctctgcc 29 27
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 27 gcuacgaccu gcugcccagc agcucugcc 29 28
29 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 28 ggcagagcug cugggcagca ggucguagc 29 29
6 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 29 aaaaaa 6 30 29 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Oligonucleotide 30
gccttattca tggtggctat cgtggctgc 29 31 8 DNA Artificial Sequence
Description of Artificial Sequence Synthetic Oligonucleotide 31
caagcttc 8 32 21 DNA Artificial Sequence Description of Artificial
Sequence Synthetic Oligonucleotide 32 ggtgtttcgt cctttccaca a 21 33
68 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 33 gcagccacga uagccaccau gaauaaggcg
aagcuuggcc uuauucaugg uggcuaucgu 60 ggcugcuu 68 34 72 RNA
Artificial Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 34 gcagccacga uagccaccau gaauaaggcg aagcuuggcc
uuauucaugg uggcuaucgu 60 ggcugcuuuu uu 72 35 72 RNA Artificial
Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 35 aaaaaagcag ccacgauagc caccaugaau aaggccaagc
uucgccuuau ucaugguggc 60 uaucguggcu gc 72 36 21 RNA Artificial
Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 36 gguguuucgu ccuuuccaca a 21 37 93 RNA Artificial
Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 37 aaaaaagcag ccacgauagc caccaugaau aaggccaagc
uucgccuuau ucaugguggc 60 uaucguggcu gcgguguuuc guccuuucca caa 93 38
93 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 38 aaaaaagcag ccacgauagc caccaugaau
aaggccaagc uucgccuuau ucaugguggc 60 uaucguggcu gcgguguuuc
guccuuucca caa 93 39 93 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Oligonucleotide 39 aaaaaagcca
cgauagccac caugaauaag gcagccaagc uuccggugcu aucgguggua 60
cuuauuccgu cggguguuuc guccuuucca caa 93 40 93 RNA Artificial
Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 40 aaaaaagggc gcuacgaccu gcugcccagc agcuccaagc
uucgagcugc ugggcagcag 60 gucguagcgc ccgguguuuc guccuuucca caa 93 41
93 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 41 aaaaaagcua cgaccugcug cccagcagcu
cugcccaagc uucggcagag cugcugggca 60 gcaggucgua gcgguguuuc
guccuuucca caa 93 42 29 DNA Artificial Sequence Description of
Artificial Sequence Synthetic Oligonucleotide 42 gccaggtaca
tgctgctgct gctcctggc 29 43 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 43 gccagguaca
ugcugcugcu gcuccuggc 29 44 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 44 gccaggagca
gcagcagcau guaccuggc 29 45 29 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 45 gggcagcgcc
ttacggggtc aggctttgc 29 46 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 46 gggcagcgcc
uuacgggguc aggcuuugc 29 47 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 47 gcaaagccug
accccguaag gcgcugccc 29 48 29 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 48 gagcagtcat
cttcacctgc gggggctcc 29 49 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 49 gagcagucau
cuucaccugc gggggcucc 29 50 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 50 ggagcccccg
caggugaaga ugacugcuc 29 51 29 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 51 gtagcaaaag
tgaaatcagt agcctttgc 29 52 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 52 guagcaaaag
ugaaaucagu agccuuugc 29 53 29 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 53 cgaaaggcua
cugauuucac uuuugcuac 29 54 29 DNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 54 gccaggagca
gcagcagcat gtacctggc 29 55 68 RNA Artificial Sequence Description
of Artificial Sequence Synthetic Oligonucleotide 55 gccaggagca
gcagcagcau guaccuggcg aagcuuggcc agguacaugc ugcugcugcu 60 ccuggcuu
68 56 72 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 56 gccaggagca gcagcagcau guaccuggcg
aagcuuggcc agguacaugc ugcugcugcu 60 ccuggcuuuu uu 72 57 72 RNA
Artificial Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 57 aaaaaacggu ccucgucguc gucguacaug gaccgcaagc
uucgccagga gcagcagcag 60 cauguaccug gc 72 58 93 RNA Artificial
Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 58 aaaaaacggu ccucgucguc gucguacaug gaccgcaagc
uucgccagga gcagcagcag 60 cauguaccug gcgguguuuc guccuuucca caa 93 59
93 RNA Artificial Sequence Description of Artificial Sequence
Synthetic
Oligonucleotide 59 aaaaaagcca gguacaugcu gcugcugcuc cuggccaagc
uucgccagga gcagcagcag 60 cauguaccug gcgguguuuc guccuuucca caa 93 60
93 RNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 60 aaaaaagggc agcgccuuac ggggucaggc
uuugccaagc uucgcaaagc cugaccccgu 60 aaggcgcugc ccgguguuuc
guccuuucca caa 93 61 93 RNA Artificial Sequence Description of
Artificial Sequence Synthetic Oligonucleotide 61 aaaaaagagc
agucaucuuc accugcgggg gcucccaagc uucggagccc ccgcagguga 60
agaugacugc ucgguguuuc guccuuucca caa 93 62 93 RNA Artificial
Sequence Description of Artificial Sequence Synthetic
Oligonucleotide 62 aaaaaaguag caaaagugaa aucaguagcc uuugccaagc
uuccgaaagg cuacugauuu 60 cacuuuugcu acgguguuuc guccuuucca caa 93 63
31 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Oligonucleotide 63 aannnnnnnn nnnnnnnnnn nnnnnnnnnt t
31
* * * * *
References